Science.gov

Sample records for cells gamma radiation

  1. Gamma radiation effects on Sporothrix schenckii yeast cells.

    PubMed

    Lacerda, Camila Maria de Souza; Martins, Estefnia Mara do Nascimento; de Resende, Maria Aparecida; de Andrade, Antero Silva Ribeiro

    2011-06-01

    Sporotrichosis is a subcutaneous mycosis caused by Sporothrix schenckii. Zoonotic transmission to man can occur after scratches or bites of animals, mainly cats. In this study, the gamma radiation effects on yeast of S. schenckii were analyzed with a view of developing a radioattenuated vaccine for veterinary use. The cultures were irradiated at doses ranging from 1.0 to 9.0 kGy. The reproductive capacity was measured by the ability of cells to form colonies. No colonies could be recovered above 8.0 kGy, using inocula up to 10(7) cells. Nevertheless, yeast cells irradiated with 7.0 kGy already were unable to produce infection in immunosuppressed mice. Evaluation by the FungaLight Kit (Invitrogen) indicated that yeast cells remained viable up to 9.0 kGy. At 7.0 kGy, protein synthesis, estimated by the incorporation of [L-(35)S] methionine, continues at levels slightly lower than the controls, but a significant decrease was observed at 9.0 kGy. The DNA of 7.0 kGy irradiated cells, analyzed by electrophoresis in agarose gel, was degraded. Cytoplasmic vacuolation was the main change verified in these cells by transmission electron microscopy. The dose of 7.0 kGy was considered satisfactory for yeast attenuation since irradiated cells were unable to produce infection but retained viability, metabolic activity, and morphology. PMID:21327789

  2. Influence on cell proliferation of background radiation or exposure to very low, chronic gamma radiation. [Paramecium tetraurelia; Synechococcus lividus

    SciTech Connect

    Planel, H.; Soleilhavoup, J.P.; Tixador, R.; Richoilley, G.; Conter, A.; Croute, F.; Caratero, C.; Gaubin, Y.

    1987-05-01

    Investigations carried out on the protozoan Paramecium tetraurelia and the cyanobacteria Synechococcus lividus, which were shielded against background radiation or exposed to very low doses of gamma radiation, demonstrated that radiation can stimulate the proliferation of these two single-cell organisms. Radiation hormesis depends on internal factors (age of starting cells) and external factors (lighting conditions). The stimulatory effect occurred only in a limited range of doses and disappeared for dose rates higher than 50 mGy/y.

  3. Interactions between endothelial cells and T cells modulate responses to mixed neutron/gamma radiation.

    PubMed

    Cary, Lynnette H; Noutai, Daniel; Salber, Rudolph E; Williams, Margaret S; Ngudiankama, Barbara F; Whitnall, Mark H

    2014-06-01

    Detonation of an improvised nuclear device near a population center would cause significant casualties from the acute radiation syndrome (ARS) due to exposure to mixed neutron/gamma fields (MF). The pathophysiology of ARS involves inflammation, microvascular damage and alterations in immune function. Interactions between endothelial cells (EC) and hematopoietic cells are important not only for regulating immune cell traffic and function, but also for providing the microenvironment that controls survival, differentiation and migration of hematopoietic stem and progenitor cells in blood-forming tissues. Endothelial cells/leukocyte interactions also influence tumor progression and the results of anticancer therapies. In this study, we hypothesized that irradiation of endothelial cells would modulate their effects on hematopoietic cells and vice versa. Human umbilical vein endothelial cells (HUVEC) and immortalized T lymphocytes (Jurkat cells) were cultured individually and in co-culture after exposure to mixed fields. Effects of nonirradiated cells were compared to effects of irradiated cells and alterations in signaling pathways were determined. Mitogen-activated protein kinases (MAPKs) p38 and p44/42 (ERK1/2) in HUVEC exhibited higher levels of phosphorylated protein after exposure to mixed field radiation. IL-6, IL-8, G-CSF, platelet derived growth factor (PDGF) and angiopoietin 2 (ANG2) protein expression were upregulated in HUVEC by exposure to mixed field radiation. PCR arrays using HUVEC mRNA revealed alterations in gene expression after exposure to mixed fields and/or co-culture with Jurkat cells. The presence of HUVEC also influenced the function of Jurkat cells. Nonirradiated Jurkat cells showed an increase in proliferation when co-cultured with nonirradiated HUVEC, and a decrease in proliferation when co-cultured with irradiated HUVEC. Additionally, nonirradiated Jurkat cells incubated in media from irradiated HUVEC exhibited upregulation of activated caspase 3. Irradiation of Jurkat cells caused a G2/M arrest and increased adherence to HUVEC. When co-cultured with HUVEC, irradiated Jurkat cells exhibited G0/G1 arrest and increased apoptosis. The data indicate that gene expression and cell function of endothelial cells and hematopoietic cells are influenced by radiation and by interactions between the two cell types. These phenomena may affect the success of therapies for ARS and cancer. PMID:24828109

  4. A paracrine signal mediates the cell transformation response to low dose gamma radiation in JB6 cells

    SciTech Connect

    Weber, Thomas J.; Siegel, Robert W.; Markillie, Lye Meng; Chrisler, William B.; Lei, Xingye C.; Colburn, Nancy H.

    2005-05-01

    Radiation at low doses (? 50 cGy) can enhance or reduce tumor incidence in the mouse skin multistage model of carcinogenesis, depending on the timing of radiation exposure relative to chemical initiator. Here we have used JB6 mouse epidermal cells, an in vitro model of late stage tumor promotion, to evaluate the effects of low dose gamma radiation on cell transformation response. JB6 cells were isolated from the DNA-dependent Protein Kinase (DNA-PK) deficient Balb/c mouse that exhibits an unusually sensitive mammary tumor response to ionizing radiation. Exposure of JB6 cells to low dose (2-20 cGy) gamma radiation increased cell transformation response in a dose- and cell density-dependent fashion. JB6 cells were transfected with a membrane targeted enhanced yellow fluorescent protein (EYFP-membrane) and used as bystander cells in a co-culture model. Co-culture of 10 cGy irradiated JB6 cells with na?ve EYFP-membrane cells resulted in a significant increase in EYFP-expressing colonies, relative to co-cultures of sham exposed P+ cells/na?ve EYFP-membrane cells. In contrast, low dose gamma radiation (20 cGy) reduced tumor promoter (epidermal growth factor; 12-O-tetradecanoyl phorbol-13-acetate)-induced transformation response and cell survival in a clonogenic assay to a comparable extent (40%). Our results demonstrate different selective pressures depending on whether low dose radiation modulated the cell transformation response of irradiated or bystander cells, or whether irradiation occurred in conjunction with tumor promoter treatment. The co-culture system developed here is a promising model to define positive and negative selective pressures induced by low dose radiation in a DNA damage repair deficient context that are relevant to carcinogenesis responses.

  5. Effect of gamma radiation on sodium channels in different conformations in neuroblastoma cells

    SciTech Connect

    Freschi, J.E.; Moran

    1986-01-01

    The dose-response relationship between gamma radiation and batrachotoxin-stimulated sodium influx in neuroblastoma cells in tissue culture was studied. Also tested was the hypothesis that changes in sodium-channel conformation may alter the radiosensitivity of the channel. It was found that gamma radiation inhibited toxin-stimulated /sup 22/Na uptake at doses beyond a threshold of 200-300 Gy. No effects were seen following doses below 100 Gy. This inhibition of sodium permeability was seen when the cells were irradiated with sodium channels in the closed or inactivated, nonconducting states. However, when the channels were in the toxin-opened, conducting state, gamma radiation had no effect at doses up to 2000 Gy. Results support earlier electrophysiological studies that showed that high doses of ionizing radiation are required to produce a measureable decrease in sodium permeability. In addition, the data suggest that by changing the sodium-channel conformation, batrachotoxin appears to alter radiosensitive chemical bonds in the gating or ion-conducting portion of the channel.

  6. Sensitivity of Roberts syndrome cells to gamma radiation, mitomycin C, and protein synthesis inhibitors.

    PubMed

    Van den Berg, D J; Francke, U

    1993-07-01

    Roberts syndrome (RS) is a rare autosomal recessive disorder characterized by pre- and postnatal growth retardation, limb reduction abnormalities, and craniofacial anomalies. Mitotic chromosomes from RS individuals display repulsion of heterochromatin regions or centromere splitting, leading to a railroad-track appearance of mitotic chromosomes. Abnormalities in metaphase duration, anaphase progression, nuclear morphology, and increased frequency of micronucleation have been reported in RS cells. Cells from RS heterozygotes are normal in these respects, and in vitro complementation of the defects in somatic cell hybrids has been reported. Therefore, in preparation for the isolation of cDNAs that complement the RS defect, we investigated various drug treatments to identify an agent that specifically involves the growth of RS cells. Based on the cytogenetic and cell biologic findings, we chose agents that increase micronucleation or inhibit protein synthesis. We found that RS cells are hypersensitive to gamma radiation, mitomycin C, G418 and hygromycin B, but not to colcemid or streptonigrin when compared to normal cells. DNA content and cell viability analysis confirmed that the sensitivity to gamma irradiation was primarily due to increased cell death. PMID:8211379

  7. Gamma radiation increases endonuclease-dependent L1 retrotransposition in a cultured cell assay

    PubMed Central

    Farkash, Evan A.; Kao, Gary D.; Horman, Shane R.; Prak, Eline T. Luning

    2006-01-01

    Long Interspersed Elements (LINE-1s, L1s) are the most active mobile elements in the human genome and account for a significant fraction of its mass. The propagation of L1 in the human genome requires disruption and repair of DNA at the site of integration. As Barbara McClintock first hypothesized, genotoxic stress may contribute to the mobilization of transposable elements, and conversely, element mobility may contribute to genotoxic stress. We tested the ability of genotoxic agents to increase L1 retrotransposition in a cultured cell assay. We observed that cells exposed to gamma radiation exhibited increased levels of L1 retrotransposition. The L1 retrotransposition frequency was proportional to the number of phosphorylated H2AX foci, an indicator of genotoxic stress. To explore the role of the L1 endonuclease in this context, endonuclease-deficient tagged L1 constructs were produced and tested for their activity in irradiated cells. The activity of the endonuclease-deficient L1 was very low in irradiated cells, suggesting that most L1 insertions in irradiated cells still use the L1 endonuclease. Consistent with this interpretation, DNA sequences that flank L1 insertions in irradiated cells harbored target site duplications. These results suggest that increased L1 retrotransposition in irradiated cells is endonuclease dependent. The mobilization of L1 in irradiated cells potentially contributes to genomic instability and could be a driving force for secondary mutations in patients undergoing radiation therapy. PMID:16507671

  8. Evaluation of genotoxicity of the acute gamma radiation on earthworm Eisenia fetida using single cell gel electrophoresis technique (Comet assay).

    PubMed

    Sowmithra, K; Shetty, N J; Jha, S K; Chaubey, R C

    2015-12-01

    Earthworms (Eisenia fetida) most suitable biological indicators of radioactive pollution. Radiation-induced lesions in DNA can be considered to be molecular markers for early effects of ionizing radiation. Gamma radiation produces a wide spectrum of DNA. Some of these lesions, i.e., DNA strand breaks and alkali labile sites can be detected by the single-cell gel electrophoresis (SCGE) or comet assay by measuring the migration of DNA from immobilized nuclear DNA. E. fetida were exposed to different doses of gamma radiation, i.e., 1, 5, 10, 20, 30, 40 and 50Gy, and comet assay was performed for all the doses along with control at 1, 3 and 5h post irradiation to evaluate the genotoxicity of gamma radiation in this organism. The DNA damage was measured as percentage of comet tail DNA. A significant increase in DNA damage was observed in samples exposed to 5Gy and above, and the increase in DNA damage was dose dependent i.e., DNA damage was increased with increased doses of radiation. The highest DNA damage was noticed at 1h post irradiation and gradually decreased with time, i.e., at 3 and 5h post irradiation. The present study reveals that gamma radiation induces DNA damage in E. fetida and the comet assay is a sensitive and rapid method for its detection to detect genotoxicity of gamma radiation. PMID:26653984

  9. Mutant quantity and quality in mammalian cells (AL) exposed to cesium-137 gamma radiation: effect of caffeine

    NASA Technical Reports Server (NTRS)

    McGuinness, S. M.; Shibuya, M. L.; Ueno, A. M.; Vannais, D. B.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian AL human-hamster hybrid cells exposed to 137Cs gamma radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1- mutants by 137Cs gamma radiation. Molecular analysis of 235 S1- mutants using a series of DNA probes mapped to the human chromosome 11 in the AL hybrid cells revealed that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, 137Cs gamma rays alone or 137Cs gamma rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These "complex" mutations were rare for 137Cs gamma irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by 137Cs gamma irradiation.

  10. Mutant quantity and quality in mammalian cells (A{sub L}) exposed to cesium-137 gamma radiation: Effect of caffeine

    SciTech Connect

    McGuinness, S.M.; Shibuya, M.L.; Ueno, A.M.

    1995-06-01

    We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian A{sub L} human-hamster hybrid cells exposed to {sup 137}Cs {gamma} radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1{sup {minus}} mutants by {sup 137}Cs {gamma} radiation. Molecular analysis of 235 S1{sup {minus}} mutants using a series of DNA probes mapped to the human chromosome 11 in the A{sub L} hybrid cells revealed that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, {sup 137}Cs {gamma} rays alone or {sup 137}Cs {gamma} rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These {open_quotes}complex{close_quotes} mutations were rare for {sup 137}Cs {gamma} irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by {sup 137}Cs {gamma} irradiation. 62 refs., 3 figs., 3 tabs.

  11. Diffuse gamma radiation

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Simpson, G. A.; Thompson, D. J.

    1977-01-01

    An examination of the intensity, energy spectrum, and spatial distribution of the diffuse gamma-radiation observed by SAS-2 satellite away from the galactic plane in the energy range above 35 MeV has shown that it consists of two components. One component is generally correlated with galactic latitudes, the atomic hydrogen column density was deduced from 21 cm measurements, and the continuum radio emission, believed to be synchrotron emission. It has an energy spectrum similar to that in the plane and joins smoothly to the intense radiation from the plane. It is therefore presumed to be of galactic origin. The other component is apparently isotropic, at least on a coarse scale, and has a steep energy spectrum. No evidence is found for a cosmic ray halo surrounding the galaxy in the shape of a sphere or oblate spheroid with galactic dimensions. Constraints for a halo model with significantly larger dimensions are set on the basis of an upper limit to the gamma-ray anisotropy.

  12. Lung tumorigenic response of strain A mice exposed to hypoxic cell sensitizers alone and in combination with gamma-radiation

    SciTech Connect

    Mian, T.A.; Theiss, J.C.; Grdina, D.J.

    1983-01-01

    The influence of metronidazole, misonidazole, and desmethylmisonidazole on the induction of lung adenomas in the strain A mouse was examined. Two dose levels of the hypoxic cell sensitizers, 0.2 and 0.6 mg/g, were used either alone or in combination with 900 rads of gamma-radiation in a fractionated dose schedule of twice a week for 3 weeks. In the groups of mice which received hypoxic cell sensitizers only, the prevalence and the mean number of lung tumors per mouse were somewhat increased (p less than 0.10) in the group receiving the higher dose (0.6 mg/g) of misonidazole but was not significantly different from results for the control animals in the other two sensitizer groups. The combination of hypoxic cell sensitizer and radiation did not show any significant enhancement of lung tumor response when compared with the group which received radiation only. The dose of radiation used in this study significantly enhanced lung tumor formation in mice when compared with that in the control group. Thus, under the experimental exposure conditions used in this investigation, which were somewhat similar to the exposure conditions occurring in clinical treatment, each of the hypoxic cell sensitizers tested failed to sensitize significantly the mice to the carcinogenic effects of gamma-radiation.

  13. Gamma radiation field intensity meter

    DOEpatents

    Thacker, L.H.

    1994-08-16

    A gamma radiation intensity meter measures dose rate of a radiation field. The gamma radiation intensity meter includes a tritium battery emitting beta rays generating a current which is essentially constant. Dose rate is correlated to an amount of movement of an electroscope element charged by the tritium battery. Ionizing radiation decreases the voltage at the element and causes movement. A bleed resistor is coupled between the electroscope support element or electrode and the ionization chamber wall electrode. 4 figs.

  14. Gamma radiation field intensity meter

    DOEpatents

    Thacker, Louis H. (Knoxville, TN)

    1995-01-01

    A gamma radiation intensity meter measures dose rate of a radiation field. The gamma radiation intensity meter includes a tritium battery emitting beta rays generating a current which is essentially constant. Dose rate is correlated to an amount of movement of an electroscope element charged by the tritium battery. Ionizing radiation decreases the voltage at the element and causes movement. A bleed resistor is coupled between the electroscope support element or electrode and the ionization chamber wall electrode.

  15. Gamma radiation field intensity meter

    DOEpatents

    Thacker, Louis H. (Knoxville, TN)

    1994-01-01

    A gamma radiation intensity meter measures dose rate of a radiation field. The gamma radiation intensity meter includes a tritium battery emitting beta rays generating a current which is essentially constant. Dose rate is correlated to an amount of movement of an electroscope element charged by the tritium battery. Ionizing radiation decreases the voltage at the element and causes movement. A bleed resistor is coupled between the electroscope support element or electrode and the ionization chamber wall electrode.

  16. Gamma radiation field intensity meter

    DOEpatents

    Thacker, L.H.

    1995-10-17

    A gamma radiation intensity meter measures dose rate of a radiation field. The gamma radiation intensity meter includes a tritium battery emitting beta rays generating a current which is essentially constant. Dose rate is correlated to an amount of movement of an electroscope element charged by the tritium battery. Ionizing radiation decreases the voltage at the element and causes movement. A bleed resistor is coupled between the electroscope support element or electrode and the ionization chamber wall electrode. 4 figs.

  17. Gamma radiation induced cell cycle perturbations and DNA damage in Catla Catla as measured by flow cytometry.

    PubMed

    Anbumani, S; Mohankumar, Mary N

    2015-03-01

    Gamma radiation induced cell cycle perturbations and DNA damage in Catla catla were analyzed in erythrocytes at different time points using flow cytometry (FCM). Protracted exposure to radiation induced damage between days 12 and 45. Disturbances in cell cycle machinery, i.e., proportional increase and decrease in Gap0 or quiescent/Gap1 (G0/G1), Synthesis (S) and Gap2/Mitotic (G2/M) phases were observed at both acute and protracted treatments. Both acute and protracted exposures induced apoptosis with a notable significance between days 3 and 6 at protracted and on day 45 at acute doses. Fish exposed protractedly avail some DNA repair mechanisms than acutely exposed. This is the first study to analyze radiation induced DNA damage under laboratory conditions and suggests that flow cytometry can also be an alternate tool to screen genotoxicity induced by ionizing radiation in fish. PMID:25483367

  18. Analysis of white blood cell counts in mice after gamma- or proton-radiation exposure.

    PubMed

    Maks, Casey J; Wan, X Steven; Ware, Jeffrey H; Romero-Weaver, Ana L; Sanzari, Jenine K; Wilson, Jolaine M; Rightnar, Steve; Wroe, Andrew J; Koss, Peter; Gridley, Daila S; Slater, James M; Kennedy, Ann R

    2011-08-01

    In the coming decades human space exploration is expected to move beyond low-Earth orbit. This transition involves increasing mission time and therefore an increased risk of radiation exposure from solar particle event (SPE) radiation. Acute radiation effects after exposure to SPE radiation are of prime importance due to potential mission-threatening consequences. The major objective of this study was to characterize the dose-response relationship for proton and ? radiation delivered at doses up to 2 Gy at high (0.5 Gy/min) and low (0.5 Gy/h) dose rates using white blood cell (WBC) counts as a biological end point. The results demonstrate a dose-dependent decrease in WBC counts in mice exposed to high- and low-dose-rate proton and ? radiation, suggesting that astronauts exposed to SPE-like radiation may experience a significant decrease in circulating leukocytes. PMID:21476859

  19. Galactic plane gamma-radiation

    NASA Technical Reports Server (NTRS)

    Hartman, R. C.; Kniffen, D. A.; Thompson, D. J.; Fichtel, C. E.; Ogelman, H. B.; Tumer, T.; Ozel, M. E.

    1979-01-01

    Analysis of the SAS 2 data together with the COS B results shows that the distribution of galactic gamma-radiation has several similarities to that of other large-scale tracers of galactic structure. The radiation is primarily confined to a thin disc which exhibits offsets from b = 0 degrees similar to warping at radio frequencies. The principal distinction of the gamma-radiation is a stronger contrast in intensity between the region from 310 to 45 degrees in longitude and the regions away from the center that can be attributed to a variation in cosmic-ray density as a function of position in Galaxy. The diffuse galactic gamma-ray energy spectrum shows no significant variation in direction, and the spectrum seen along the plane is the same as that for the galactic component of the gamma-radiation at high altitudes. The uniformity of the galactic gamma-ray spectrum, the smooth decrease in intensity as a function of altitude, and the absence of any galactic gamma-ray sources at high altitudes indicate a diffuse origin for bulk of the galactic gamma-radiation rather than a collection of localized sources.

  20. Increase of RhoB in {gamma}-radiation-induced apoptosis is regulated by c-Jun N-terminal kinase in Jurkat T cells

    SciTech Connect

    Kim, Chun-Ho; Won, Misun; Choi, Chung-Hae; Ahn, Jiwon; Kim, Bo-Kyung; Song, Kyung-Bin; Kang, Chang-Mo; Chung, Kyung-Sook

    2010-01-08

    The Ras-related small GTP-binding protein RhoB is known to be a pro-apoptotic protein and immediate-early inducible by genotoxic stresses. In addition, JNK activation is known to function in {gamma}-radiation-induced apoptosis. However, it is unclear how JNK activation and {gamma}-radiation-dependent RhoB induction are related. Here we verified the relationship between JNK activation and RhoB induction. RhoB induction by {gamma}-radiation occurred at the transcriptional level and transcriptional activation of RhoB was concomitant with an increase in RhoB protein. {gamma}-Radiation-induced RhoB expression was markedly attenuated by pretreatment with a JNK-specific inhibitor, SP600125, but not by a p38 MAPK inhibitor, SB203580. Inhibition of JNK caused a decrease in early apoptotic cell death that correlated with RhoB expression. However, PI3K inhibition had no significant effects, indicating that the AKT survival pathway was not involved. The siRNA knockdown of JNK resulted in a decrease in RhoB expression and the siRNA knockdown of RhoB restored cell growth even in the {gamma}-irradiated cells. These results suggest that RhoB regulation involves the JNK pathway and contributes to the early apoptotic response of Jurkat T cells to {gamma}-radiation.

  1. DNA-binding protein activated by gamma radiation in human cells

    SciTech Connect

    Singh, S.P.; Lavin, M.F. )

    1990-10-01

    DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

  2. DNA sequence analysis of gamma radiation-induced deletions and insertions at the APRT locus of hamster cells

    SciTech Connect

    Miles, C.; Sargent, G.; Phear, G.; Meuth, M. )

    1990-01-01

    Gamma radiation-induced gene rearrangements at the Chinese hamster ovary cell locus coding for the purine salvage enzyme adenine phosphoribosyl transferase (APRT) consist of both simple deletions and more complex alterations that are presumably the result of multiple strand breaks. To characterize these mutations at the DNA sequence level, fragments altered by deletion and insertion mutations were obtained by cloning in lambda phage vectors or by using the polymerase chain reaction. The radiation-induced deletions characterized here eliminate 3-4 kb and have at least one breakpoint in an AT-rich region or near short direct or inverted repeats. Insertions involve small fragments (102 and 456 bp) of repetitive DNA that appear to be related to B2 (short interspersed repetitive) and long interspersed repeat families. The novel fragments bear little resemblance to each other or to sequences at the integration sites, and their introduction is accompanied by a small target site deletion.

  3. Gamma radiation from radio pulsars

    NASA Technical Reports Server (NTRS)

    Ruderman, Malvin

    1990-01-01

    The probable magnetospheric location and source of the gamma ray emission from some young radiopulsars is discussed. The suggested evolution of this emission as a function of pulsar period gives a diminished gamma-ray luminosity for a more rapidly spinning pre-Crab pulsar. A greatly enhanced one, similar to that of unidentified Cos B sources, is predicted for a slightly slower post-Vela pulsar, followed by a relatively rapid quenching of the gamma-ray luminosity at still longer periods. Possible anomalous exo-magnetospheric pulsed MeV and TeV-PeV radiation from the Crab pulsar is considered.

  4. Treatment by gamma or electron radiation decreases cell wall and gossypol content of cottonseed meal

    NASA Astrophysics Data System (ADS)

    Nayefi, M.; Salari, S.; Sari, M.; Behgar, M.

    2014-06-01

    The current study evaluated the effect of gamma and beam treatment (up to 40 kGy) on chemical composition and gossypol content of cottonseed meal. Irradiation decreased the crude fiber content. Gamma and electron treatment decreased total and free gossypol content.

  5. Abdominal {gamma}-Radiation Induces an Accumulation of Function-Impaired Regulatory T Cells in the Small Intestine

    SciTech Connect

    Billiard, Fabienne; Buard, Valerie; Benderitter, Marc; Linard, Christine

    2011-07-01

    Purpose: To assess the frequency and the functional characteristics of one major component of immune tolerance, the CD4{sup +}FoxP3{sup +} regulatory T cells (Tregs) in a mouse model of abdominal irradiation. Methods and Materials: Mice were exposed to a single abdominal dose of {gamma}-radiation (10 Gy). We evaluated small intestine Treg infiltration by Foxp3 immunostaining and the functional suppressive activity of Tregs isolated from mesenteric lymph nodes. Results: Foxp3 immunostaining showed that radiation induced a long-term infiltration of the intestine by Tregs (levels 5.5 times greater than in controls). Co-culture of Tregs from mesenteric lymph nodes with CD4{sup +} effector cells showed that the Tregs had lost their suppressive function. This loss was associated with a significant decrease in the levels of Foxp3, TGF-{beta}, and CTLA-4 mRNA, all required for optimal Treg function. At Day 90 after irradiation, Tregs regained their suppressive activity as forkhead box P3 (Foxp3), transforming growth factor beta (TGF-{beta}), and cytotoxic T-lymphocyte antigen 4 (CTLA-4) expression returned to normal. Analysis of the secretory function of mesenteric lymph node Tregs, activated in vitro with anti-CD3/anti-CD28 Abs, showed that this dysfunction was independent of a defect in interleukin-10 secretion. Conclusion: Radiation caused a long-term accumulation of function-impaired Foxp3{sup +}CD4{sup +} Tregs in the intestine. Our study provides new insights into how radiation affects the immune tolerance in peripheral tissues.

  6. Combination of PTEN and {gamma}-Ionizing Radiation Enhances Cell Death and G{sub 2}/M Arrest Through Regulation of AKT Activity and p21 Induction in Non-Small-Cell Lung Cancer Cells

    SciTech Connect

    Park, Jong Kuk; Jung, Hae-Yun; Park, Seon Ho; Kang, Seung Yi; Yi, Mi-Rang; Um, Hong Duck; Hong, Sung Hee

    2008-04-01

    Purpose: To identify the role of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) during {gamma}-ionizing radiation ({gamma}-IR) treatment for non-small-cell lung cancer cells. Methods and Materials: Wild-type PTEN or mutant forms of PTEN plasmids were transfected to construct stable transfectants of the NCI-H1299 non-small-cell lung cancer cell line. Combined effects of PTEN expression and IR treatment were tested using immunoblot, clonogenic, and cell-counting assays. Related signaling pathways were studied with immunoblot and kinase assays. Results: At steady state, stable transfectants showed almost the same proliferation rate but had different AKT phosphorylation patterns. When treated with {gamma}-IR, wild-type PTEN transfectants showed higher levels of cell death compared with mock vector or mutant transfectants, and showed increased G{sub 2}/M cell-cycle arrest accompanied by p21 induction and CDK1 inactivation. NCI-H1299 cells were treated with phosphosinositide-3 kinase (PI3K)/AKT pathway inhibitor (LY29002), resulting in reduced AKT phosphorylation levels. Treatment of NCI-H1299 cells with LY29002 and {gamma}-IR resulted in increased cell-cycle arrest and p21 induction. Endogenous wild-type PTEN-containing NCI-H460 cells were treated with PTEN-specific siRNA and then irradiated with {gamma}-IR: however reduced PTEN levels did not induce cell-cycle arrest or p21 expression. Conclusions: Taken together, these findings indicate that PTEN may modulate cell death or the cell cycle via AKT inactivation by PTEN and {gamma}-IR treatment. We also propose that a PTEN-PI3K/AKT-p21-CDK1 pathway could regulate cell death and the cell cycle by {gamma}-IR treatment.

  7. Gamma radiation-induced single strand breaks in DNA and their repair in spheroplasts and nuclei of light-grown and dark-grown Euglena cells.

    PubMed

    Netrawali, M S; Nair, K A

    1983-01-01

    Exposure of light-grown and dark-grown Euglena cells to gamma radiation causes single strand breaks in nuclear DNA as assessed by sedimentation analysis in alkaline sucrose density gradients. The number of radiation-induced single strand breaks in nuclear DNA of light-grown cells is found to be less than that in dark-grown cells. Post-irradiation incubation of both types of cells in 0 . 1 M phosphate buffer, pH 7 . 0 at 25 degrees C for 1 hour results in restitution of the strand breaks in DNA. Light-grown cells (cells with chloroplasts) are able to rejoin all the single strand breaks in DNA produced by gamma irradiation at D50 and D5 doses. On the other hand, dark-grown cells (cells devoid of chloroplasts) are unable to rejoin all the strand breaks caused by irradiation at either of the doses. The rate of DNA repair in dark-grown cells is also much slower than that in light-grown cells. Radiation-induced single strand breaks in DNA and their repair in nuclei from both types of cells is found to be similar to that observed in the spheroplasts. It is suggested that some factor(s) elaborated by chloroplasts may contribute towards the efficiency of nuclear DNA repair in Euglena cells. PMID:6403482

  8. Effects of low-dose radiation on gene expression in Syrian hamster embryo cells: Comparison of JANUS neutrons and gamma rays

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, C.M.

    1992-07-01

    Past work by or group and others has shown the modulation of specific genes following exposure of cells to ionizing radiation. Many classes of genes have been found to be modulated in response to ionizing radiation, including those encoding cytoskeletal elements, cell growth arresting proteins, cytokines, and cellular oncogenes. The functions of this specific modulation of gene expression are currently being investigated by several groups: it has been suggested that gene modulation in response to radiation plays a role in the cellular repair of DNA damage, cell survival, or cellular transformation. Several groups have examined induction of nuclear proto-oncogenes following exposure to DNA-damaging agents. In all experiments, we examined modulation of gene expression by ionizing radiations in Syrian hamster embryo (SHE) fibroblasts, which are normal diploid cells that can be neoplastically transformed by low doses of ionizing radiations. Cells plated in 100-mm Petri plates containing 10 ml of medium were irradiated with {sup 60}C {gamma}-rays or fission-spectrum neutrons (0.85 MeV) from the JANUS reactor. All irradiations were performed at 37{degrees}C on cycling cells; equitoxic doses of neutrons and {gamma}-rays were selected on the basis of survival data.

  9. Effects of low-dose radiation on gene expression in Syrian hamster embryo cells: Comparison of JANUS neutrons and gamma rays

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, C.M.

    1992-01-01

    Past work by or group and others has shown the modulation of specific genes following exposure of cells to ionizing radiation. Many classes of genes have been found to be modulated in response to ionizing radiation, including those encoding cytoskeletal elements, cell growth arresting proteins, cytokines, and cellular oncogenes. The functions of this specific modulation of gene expression are currently being investigated by several groups: it has been suggested that gene modulation in response to radiation plays a role in the cellular repair of DNA damage, cell survival, or cellular transformation. Several groups have examined induction of nuclear proto-oncogenes following exposure to DNA-damaging agents. In all experiments, we examined modulation of gene expression by ionizing radiations in Syrian hamster embryo (SHE) fibroblasts, which are normal diploid cells that can be neoplastically transformed by low doses of ionizing radiations. Cells plated in 100-mm Petri plates containing 10 ml of medium were irradiated with {sup 60}C {gamma}-rays or fission-spectrum neutrons (0.85 MeV) from the JANUS reactor. All irradiations were performed at 37{degrees}C on cycling cells; equitoxic doses of neutrons and {gamma}-rays were selected on the basis of survival data.

  10. Gamma radiation characteristics of plutonium dioxide fuel

    NASA Technical Reports Server (NTRS)

    Gingo, P. J.

    1969-01-01

    Investigation of plutonium dioxide as an isotopic fuel for Radioisotope Thermoelectric Generators yielded the isotopic composition of production-grade plutonium dioxide fuel, sources of gamma radiation produced by plutonium isotopes, and the gamma flux at the surface.

  11. Virtual Gamma Ray Radiation Sources through Neutron Radiative Capture

    SciTech Connect

    Scott Wilde, Raymond Keegan

    2008-07-01

    The countrate response of a gamma spectrometry system from a neutron radiation source behind a plane of moderating material doped with a nuclide of a large radiative neutron capture cross-section exhibits a countrate response analogous to a gamma radiation source at the same position from the detector. Using a planar, surface area of the neutron moderating material exposed to the neutron radiation produces a larger area under the prompt gamma ray peak in the detector than a smaller area of dimensions relative to the active volume of the gamma detection system.

  12. Protective Role of Hsp27 Protein Against Gamma Radiation-Induced Apoptosis and Radiosensitization Effects of Hsp27 Gene Silencing in Different Human Tumor Cells

    SciTech Connect

    Aloy, Marie-Therese Hadchity, Elie; Bionda, Clara; Diaz-Latoud, Chantal; Claude, Line; Rousson, Robert; Arrigo, Andre-Patrick; Rodriguez-Lafrasse, Claire

    2008-02-01

    Purpose: The ability of heat shock protein 27 (Hsp27) to protect cells from stressful stimuli and its increased levels in tumors resistant to anticancer therapeutics suggest that it may represent a target for sensitization to radiotherapy. In this study, we investigate the protective role of Hsp27 against radiation-induced apoptosis and the effect of its attenuation in highly expressing radioresistant cancer cell lines. Methods and Materials: We examined clonogenic death and the kinetics of apoptotic events in different tumor cell lines overexpressing or underexpressing Hsp27 protein irradiated with photons. The radiosensitive Jurkat cell line, which does not express Hsp27 constitutively or in response to {gamma}-rays, was stably transfected with Hsp27 complementary DNA. Attenuation of Hsp27 expression was accomplished by antisense or RNAi (interfering RNA) strategies in SQ20B head-and-neck squamous carcinoma, PC3 prostate cancer, and U87 glioblastoma radioresistant cells. Results: We measured concentration-dependent protection against the cytotoxic effects of radiation in Jurkat-Hsp27 cells, which led to a 50% decrease in apoptotic cells at 48 hours in the highest expressing cells. Underlying mechanisms leading to radiation resistance involved a significant increase in glutathione levels associated with detoxification of reactive oxygen species, a delay in mitochondrial collapse, and caspase activation. Conversely, attenuation of Hsp27 in SQ20B cells, characterized by their resistance to apoptosis, sensitizes cells to irradiation. This was emphasized by increased apoptosis, decreased glutathione basal level, and clonogenic cell death. Sensitization to irradiation was confirmed in PC3 and U87 radioresistant cells. Conclusion: Hsp27 gene therapy offers a potential adjuvant to radiation-based therapy of resistant tumors.

  13. Apparatus and method for detecting gamma radiation

    DOEpatents

    Sigg, Raymond A. (Martinez, GA)

    1994-01-01

    A high efficiency radiation detector for measuring X-ray and gamma radiation from small-volume, low-activity liquid samples with an overall uncertainty better than 0.7% (one sigma SD). The radiation detector includes a hyperpure germanium well detector, a collimator, and a reference source. The well detector monitors gamma radiation emitted by the reference source and a radioactive isotope or isotopes in a sample source. The radiation from the reference source is collimated to avoid attenuation of reference source gamma radiation by the sample. Signals from the well detector are processed and stored, and the stored data is analyzed to determine the radioactive isotope(s) content of the sample. Minor self-attenuation corrections are calculated from chemical composition data.

  14. Apparatus and method for detecting gamma radiation

    DOEpatents

    Sigg, R.A.

    1994-12-13

    A high efficiency radiation detector is disclosed for measuring X-ray and gamma radiation from small-volume, low-activity liquid samples with an overall uncertainty better than 0.7% (one sigma SD). The radiation detector includes a hyperpure germanium well detector, a collimator, and a reference source. The well detector monitors gamma radiation emitted by the reference source and a radioactive isotope or isotopes in a sample source. The radiation from the reference source is collimated to avoid attenuation of reference source gamma radiation by the sample. Signals from the well detector are processed and stored, and the stored data is analyzed to determine the radioactive isotope(s) content of the sample. Minor self-attenuation corrections are calculated from chemical composition data. 4 figures.

  15. Dibasic calcium phosphate dihydrate, USP material compatibility with gamma radiation

    NASA Astrophysics Data System (ADS)

    Betancourt Quiles, Maritza

    Gamma radiation is a commonly used method to reduce the microbial bioburden in compatible materials when it is applied at appropriate dose levels. Gamma irradiation kills bacteria and mold by breaking down the organisms DNA and inhibiting cell division. The purpose of this study is to determine the radiation dosage to be used to treat Dibasic Calcium Phosphate Dihydrate, USP (DCPD) and to evaluate its physicochemical effects if any, on this material. This material will be submitted to various doses of gamma radiation that were selected based on literature review and existing regulations that demonstrate that this method is effective to reduce or eliminate microbial bioburden in natural source and synthetic materials. Analytical testing was conducted to the DCPD exposed material in order to demonstrate that gamma radiation does not alter the physicochemical properties and material still acceptable for use in the manufacture of pharmaceutical products. The results obtained through this study were satisfactory and demonstrated that the gamma irradiation dosages from 5 to 30 kGy can be applied to DCPD without altering its physicochemical properties. These are supported by the Assay test data evaluation of lots tested before and after gamma irradiation implementation that show no significant statistical difference between irradiated and non irradiated assay results. The results of this study represent an achievement for the industry since they provide as an alternative the use of Gamma irradiation technology to control the microbial growth in DCPD.

  16. Determination of environmental gamma radiation in Bitlis

    NASA Astrophysics Data System (ADS)

    Sahin Bal, Sultan; Karatepe, Sule

    2015-07-01

    In this study; the environmental gamma radiation at the various points (16 points) in the districts of and in Bitlis, where it was located in the Turkey Eastern Anatolia region, were measured. The environmental gamma radiation measurement was made from two levels (the ground and one meter above the surface) by using portable gamma survey meter which consisted of 2?2? scintillation detector (NaI(Tl)). The obtained data were discussed in considering the geological structure of the region and the other factors.

  17. Relative Biological Effectiveness (RBE) of 131I Radiation Relative to 60Co Gamma Rays

    PubMed Central

    Neshasteh-Riz, Ali; Mahmoud Pashazadeh, Ali; Mahdavi, Seyed Rabie

    2013-01-01

    Objective: To assess relative biological effectiveness (RBE) of 131I radiation relative to 60Co gamma rays in glioblastoma spheroid cells. Materials and Methods: : In this experimental study, glioblastoma spheroid cells were exposed to 131I radiation and 60Co gamma rays. Radiation induced DNA damage was evaluated by alkaline comet assay. Samples of spheroid cells were treated by radiation from 131I for four different periods of time to find the dose-response equation. Spheroid cells were also exposed by 200 cGy of 60Co gamma rays as reference radiation to induce DNA damage as endpoint. Results: Resulted RBE of 131I radiation relative to 60Co gamma rays in 100 µm giloblastoma spheroid cells was equal to 1.16. Conclusion: The finding of this study suggests that 131I photons and electrons can be more effective than 60Co gamma rays to produce DNA damage in glioblastoma spheroid cells. PMID:24027663

  18. 30 CFR 57.5047 - Gamma radiation surveys.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Gamma radiation surveys. 57.5047 Section 57..., Radiation, Physical Agents, and Diesel Particulate Matter Radiation-Underground Only 57.5047 Gamma radiation surveys. (a) Gamma radiation surveys shall be conducted annually in all underground mines...

  19. 30 CFR 57.5047 - Gamma radiation surveys.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Gamma radiation surveys. 57.5047 Section 57..., Radiation, Physical Agents, and Diesel Particulate Matter Radiation-Underground Only 57.5047 Gamma radiation surveys. (a) Gamma radiation surveys shall be conducted annually in all underground mines...

  20. Gamma rays and supernova explosions. [high temperature radiation measurement

    NASA Technical Reports Server (NTRS)

    Arnett, W. D.

    1977-01-01

    Thermal radiation associated with the explosion of supernovae is investigated. High temperature is required to produce copious gamma radiation of this sort. It appears that type 11 supernovae do not release much of their energy as gamma ray continuum radiation.

  1. Centromere detection in vinblastine- and radiation-induced micronuclei of cytokinesis-blocked mouse cells by using in situ hybridization with a mouse gamma (major) satellite DNA probe

    SciTech Connect

    Salassidis, K.; Huber, R.; Zitzelsberger, H.; Bauchinger, M. )

    1992-01-01

    Non-isotopic in situ hybridization using a mouse gamma (major) satellite probe DNA was applied to detect centromeres in micronuclei, which were induced in vitro mouse liver cells by ionizing radiation and by vinblastine sulfate. In a cytokinesis-blocked micronucleus assay a dose-dependent induction of micronuclei was found for both agents. After vinblastine exposure the observed micronuclei showed centromere-positive hybridization signals in an order of magnitude of 70-91%, but after radiation exposure the magnitude was only 10-20%. Since the in situ hybridization technique detects centromeric DNA directly, it can be used in a cytokinesis-blocked micronucleus assay for a rapid and reliable discrimination between aneuploidy-inducing and clastogenic agents.

  2. Low Dose Radiation Response Curves, Networks and Pathways in Human Lymphoblastoid Cells Exposed from 1 to 10 cGy of Acute Gamma Radiation

    SciTech Connect

    Wyrobek, A. J.; Manohar, C. F.; Nelson, D. O.; Furtado, M. R.; Bhattacharya, M. S.; Marchetti, F.; Coleman, M.A.

    2011-04-18

    We investigated the low dose dependency of the transcriptional response of human cells to characterize the shape and biological functions associated with the dose response curve and to identify common and conserved functions of low dose expressed genes across cells and tissues. Human lymphoblastoid (HL) cells from two unrelated individuals were exposed to graded doses of radiation spanning the range of 1-10 cGy were analyzed by transcriptome profiling, qPCR and bioinformatics, in comparison to sham irradiated samples. A set of {approx}80 genes showed consistent responses in both cell lines; these genes were associated with homeostasis mechanisms (e.g., membrane signaling, molecule transport), subcellular locations (e.g., Golgi, and endoplasmic reticulum), and involved diverse signal transduction pathways. The majority of radiation-modulated genes had plateau-like responses across 1-10 cGy, some with suggestive evidence that transcription was modulated at doses below 1 cGy. MYC, FOS and TP53 were the major network nodes of the low-dose response in HL cells. Comparison our low dose expression findings in HL cells with those of prior studies in mouse brain after whole body exposure, in human keratinocyte cultures, and in endothelial cells cultures, indicates that certain components of the low dose radiation response are broadly conserved across cell types and tissues, independent of proliferation status.

  3. Effects of gamma radiation on wastewater microbiota.

    PubMed

    Verde, Sandra Cabo; Silva, Telma; Matos, Paula

    2016-03-01

    Wastewater treatment by gamma radiation is a promising technology, with the capacity to reduce the impact of chemical and biological pollution of effluents in the environment. The aim of this study was to find out the effect of gamma radiation on the inactivation response of wastewater microorganisms. Wastewater samples were irradiated at a Co-60 facility, at different dose rates and at sublethal doses. The D10-values of total coliforms and mesophilic microbiota were determined for each sample and dose rate. Radio-resistant microorganisms in wastewater samples were isolated and their growth and inactivation kinetics in different composition substrates were determined, to find out the capacity of these bacteria to biodegrade the organic content of the wastewater. The results obtained suggest that irradiation substrate and dose rate influence the response of microorganisms to gamma radiation and could be also important factors for bioremediation. PMID:26370692

  4. Gamma radiation background measurements from Spacelab 2

    NASA Technical Reports Server (NTRS)

    Paciesas, William S.; Gregory, John C.; Fishman, Gerald J.

    1989-01-01

    A Nuclear Radiation Monitor incorporating a NaI(Tl) scintillation detector was flown as part of the verification flight instrumentation on the Spacelab 2 mission, July 29 to August 6, 1985. Gamma-ray spectra were measured with better than 20 s resolution throughout most of the mission in the energy range 0.1 to 30 MeV. Knowledge of the decay characteristics and the geomagnetic dependence of the counting rates enable measurement of the various components of the Spacelab gamma-ray background: prompt secondary radiation, earth albedo, and delayed induced radioactivity. The status of the data analysis and present relevant examples of typical background behavior are covered.

  5. Gamma radiation background measurements from Spacelab 2

    NASA Technical Reports Server (NTRS)

    Paciesas, William S.; Gregory, John C.; Fishman, Gerald J.

    1988-01-01

    A Nuclear Radiation Monitor incorporating a NaI(Tl) scintillation detector was flown as part of the verification flight instrumentation on the Spacelab 2 mission, July 29 to August 6, 1985. Gamma-ray spectra were measured with better than 20 s resolution throughout most of the mission in the energy range 0.1 to 30 MeV. Knowledge of the decay characteristics and the geomagnetic dependence of the counting rates enable measurement of the various components of the Spacelab gamma-ray background: prompt secondary radiation, Earth albedo, and delayed induced radioactivity. The status of the data analysis and present relevant examples of typical background behavior are covered.

  6. Gamma-radiation-induced cell death in the fetal rat brain possesses molecular characteristics of apoptosis and is associated with specific messenger RNA elevations.

    PubMed

    Borovitskaya, A E; Evtushenko, V I; Sabol, S L

    1996-01-01

    Low-dose ionizing irradiation of 16-18-day pregnant rats rapidly kills stem cells in the fetal forebrain. We have examined gamma-irradiated 17-day fetal rat brain tissue for molecular characteristics of apoptosis and changes in levels of mRNAs relevant to apoptosis. In many forebrain cells radiation elicits within 5 h nuclear condensation and fragmentation consistent with apoptosis. An electrophoretic DNA ladder indicative of internucleosomal chromatin cleavage was prominent within 3 h after irradiation. Pretreatment of pregnant rats with cycloheximide, or pretreatment of dissociated fetal brain cells in culture with actinomycin D, abolished the radiation-induced internucleosomal DNA fragmentation, demonstrating requirements for protein and RNA synthesis. Irradiation dramatically increased the level of the p53 transcription factor and the abundances of mRNAs coding for the cell-cycle inhibitor p21/Waf-1/Cip-1 and the AP-1-associated transcription factors Fos and JunB. Irradiation moderately increased the level of mRNA for the positive apoptosis regulator Bax. In contrast, irradiation reduced by 50-70% the abundances of most other mRNAs tested, including those for housekeeping proteins, p53, Jun, Myc, interleukin-1-beta-converting enzyme, and the negative apoptosis regulators Bcl-2 and Bcl-xL. These results indicate that radiation-elicited apoptosis of fetal brain cells is associated with activation of the p53 system, probable increases in AP-1 Fos/JunB heterodimers, and an increased ratio of Bax to Bcl-2 + Bcl-xL. PMID:8717336

  7. Gamma Radiation Effects on Peanut Skin Antioxidants

    PubMed Central

    de Camargo, Adriano Costa; de Souza Vieira, Thais Maria Ferreira; Regitano-DArce, Marisa Aparecida Bismara; Calori-Domingues, Maria Antonia; Canniatti-Brazaca, Solange Guidolin

    2012-01-01

    Peanut skin, which is removed in the peanut blanching process, is rich in bioactive compounds with antioxidant properties. The aims of this study were to measure bioactive compounds in peanut skins and evaluate the effect of gamma radiation on their antioxidant activity. Peanut skin samples were treated with 0.0, 5.0, 7.5, or 10.0 kGy gamma rays. Total phenolics, condensed tannins, total flavonoids, and antioxidant activity were evaluated. Extracts obtained from the peanut skins were added to refined-bleached-deodorized (RBD) soybean oil. The oxidative stability of the oil samples was determined using the Oil Stability Index method and compared to a control and synthetic antioxidants (100 mg/kg BHT and 200 mg/kg TBHQ). Gamma radiation changed total phenolic content, total condensed tannins, total flavonoid content, and the antioxidant activity. All extracts, gamma irradiated or not, presented increasing induction period (h), measured by the Oil Stability Index method, when compared with the control. Antioxidant activity of the peanut skins was higher than BHT. The present study confirmed that gamma radiation did not affect the peanut skin extracts antioxidative properties when added to soybean oil. PMID:22489142

  8. Gamma radiation effects on peanut skin antioxidants.

    PubMed

    de Camargo, Adriano Costa; de Souza Vieira, Thais Maria Ferreira; Regitano-D'Arce, Marisa Aparecida Bismara; Calori-Domingues, Maria Antonia; Canniatti-Brazaca, Solange Guidolin

    2012-01-01

    Peanut skin, which is removed in the peanut blanching process, is rich in bioactive compounds with antioxidant properties. The aims of this study were to measure bioactive compounds in peanut skins and evaluate the effect of gamma radiation on their antioxidant activity. Peanut skin samples were treated with 0.0, 5.0, 7.5, or 10.0 kGy gamma rays. Total phenolics, condensed tannins, total flavonoids, and antioxidant activity were evaluated. Extracts obtained from the peanut skins were added to refined-bleached-deodorized (RBD) soybean oil. The oxidative stability of the oil samples was determined using the Oil Stability Index method and compared to a control and synthetic antioxidants (100 mg/kg BHT and 200 mg/kg TBHQ). Gamma radiation changed total phenolic content, total condensed tannins, total flavonoid content, and the antioxidant activity. All extracts, gamma irradiated or not, presented increasing induction period (h), measured by the Oil Stability Index method, when compared with the control. Antioxidant activity of the peanut skins was higher than BHT. The present study confirmed that gamma radiation did not affect the peanut skin extracts' antioxidative properties when added to soybean oil. PMID:22489142

  9. Inspection of cargo containers using gamma radiation

    NASA Astrophysics Data System (ADS)

    Hussein, Esam M. A.; Gokhale, Prasad; Arendtsz, Nina V.; Lawrence, Andre H.

    1997-02-01

    This paper investigate, with the aid of Monte Carlo simulations and laboratory experiments, a technique for the detection of narcotics in large cargo containers using gamma-radiation. The transmission and back-scattering of photons, at different energies, is used to provide information useful for identifying the presence of bulk quantities of commonly encountered narcotics.

  10. Effect of Brazilian propolis (AF-08) on genotoxicity, cytotoxicity and clonogenic death of Chinese hamster ovary (CHO-K1) cells irradiated with (60)Co gamma-radiation.

    PubMed

    Santos, Geyza Spigoti; Tsutsumi, Shigetoshi; Vieira, Daniel Perez; Bartolini, Paolo; Okazaki, Kayo

    2014-03-01

    The present study was conducted in order to evaluate the effect of Brazilian propolis (AF-08; 5, 10, 15, 30, 50, 100, and 200?g/mL) in protecting CHO-K1 cells against genotoxic and cytotoxic damage and clonogenic death induced by (60)Co gamma-radiation (1.0, 2.0, 4.0, and 6.0Gy). For this purpose, three interlinked endpoints were analyzed: induction of DNA damage by use of the micronucleus (MN) test (genotoxic damage), cell viability by means of the MTS assay, and differential staining (cytotoxic damage) and clonogenic death via the colony-formation test (cytotoxic damage). The MN test revealed that propolis alone (5-100?g/mL) was not genotoxic up to 100?g/mL and that 30?g/mL of propolis reduced the radiation-induced DNA damage (?56% reduction, p<0.05), exhibiting a radio-protective effect on irradiated CHO-K1 cells. On the other hand, analysis of cytotoxicity showed that a concentration of 50?g/mL presented a significant proliferative effect (p<0.001) when associated with radiation, decreasing the percentage of necrotic cells (p<0.01). No mediated cytotoxic effect was found, but the concentration of 200?g/mL was toxic when analyzed at 24 and 48h via the differential staining technique, but not at 72h after irradiation, analyzed with the MTS assay. Differential staining also showed that necrosis was the main death modality in irradiated cells and that apoptosis was induced only at the toxic concentration of propolis (200?g/mL). Concerning the clonogenic capacity, a concentration of 50?g/mL also exhibited a significant stimulating effect on cell proliferation (p<0.001), in agreement with the data from differential staining. Taken together, these data suggest that the use of propolis AF-08 for the prevention of the adverse effects of ionizing radiation is promising. Nevertheless, additional investigations are necessary for a better understanding of potential applications of propolis to improve human health. PMID:24525380

  11. Sterilization of teeth by gamma radiation.

    PubMed

    White, J M; Goodis, H E; Marshall, S J; Marshall, G W

    1994-09-01

    Clinical simulations and restorative materials research and development conducted in vitro require the use of large numbers of extracted teeth. The simultaneous need for infection control procedures and minimal alterations of structure and properties of the tissue prompted this study of gamma irradiation as a method to eliminate microbes associated with extracted teeth and their storage solutions. Evaluations of potential change in structure of dentin were conducted in terms of permeability, Fourier transform infrared spectroscopy (FTIR), and optical properties. The dose required for sterilization by gamma irradiation was established by means of a tooth model inoculated with Bacillus subtilis (10(8) organisms/mL). Sterilization occurred at a dose above 173 krad with use of a Cesium (Cs137) radiation source. Gamma irradiation did not affect permeability of crown segments of dentin. A comparative evaluation of the effects of four sterilization methods on dentin disks was based on FTIR and ultraviolet-visible-near infrared (UV/VIS/NIR) spectra before and after sterilization by (1) gamma irradiation; (2) ethylene oxide; (3) dry heat; and (4) autoclaving. No detectable changes were found with gamma irradiation, but all other methods introduced some detectable change in the spectra. This suggests that common methods of sterilization alter the structure of the dentin, but gamma irradiation shows promise as a method which both is effective and introduces no detectable changes as measured by FTIR, UV/VIS/NIR, or permeability. PMID:7929992

  12. Field Deployable Gamma Radiation Detectors for DHS Use

    SciTech Connect

    Sanjoy Mukhopadhyay

    2007-08-31

    Recently, the U.S. Department of Homeland Security (DHS) has integrated all nuclear detection research, development, testing, evaluation, acquisition, and operational support into a single office: the Domestic Nuclear Detection Office (DNDO). The DNDO has specific requirements set for all commercial and government off-the-shelf radiation detection equipment and data acquisition systems. This article would investigate several recent developments in field deployable gamma radiation detectors that are attempting to meet the DNDO specifications. Commercially available, transportable, handheld radio isotope identification devices (RIID) are inadequate for DHSs requirements in terms of sensitivity, resolution, response time and reach back capability. The leading commercial vendor manufacturing handheld gamma spectrometer in the United States is Thermo Electron Corporation. Thermo Electrons identiFINDER, which primarily uses sodium iodide crystals (3.18-cm x 2.54-cm cylinders) as gamma detector, has a Full-Width-at-Half-Maximum energy resolution of 7 percent at 662 keV. Thermo Electron has just recently come up with a reach-back capability patented as RadReachBack that enables emergency personnel to obtain real-time technical analysis of radiation samples they find in the field. The current project has the goal to build a prototype handheld gamma spectrometer, equipped with a digital camera and an embedded cell phone to be used as an RIID with higher sensitivity (comparable to that of a 7.62-cm x 7.62-cm sodium iodide crystal at low gamma energy ranging from 30 keV to 3,000 keV), better resolution (< 3.0 percent at 662 keV), faster response time (able to detect the presence of gamma-emitting radio isotopes within 5 seconds of approach), which will make it useful as a field deployable tool. The handheld equipment continuously monitors the ambient gamma radiation and, if it comes across any radiation anomalies with higher than normal gamma gross counts, it sets an alarm condition. When a substantial alarm level is reached, the system auto triggers saving of relevant spectral data and software-triggers the digital camera to take a snapshot. The spectral data including in situ analysis and the imagery data will be packaged in a suitable format and sent to a command post using an imbedded cell phone.

  13. 30 CFR 57.5047 - Gamma radiation surveys.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... milliroentgens per hour in the working place, gamma radiation dosimeters shall be provided for all persons... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Gamma radiation surveys. 57.5047 Section 57..., Radiation, Physical Agents, and Diesel Particulate Matter Radiation-Underground Only § 57.5047...

  14. Composition and apparatus for detecting gamma radiation

    DOEpatents

    Hofstetter, Kenneth J. (Aiken, SC)

    1994-01-01

    A gamma radiation detector and a radioluminiscent composition for use therein. The detector includes a radioluminscent composition that emits light in a characteristic wavelength region when exposed to gamma radiation, and means for detecting said radiation. The composition contains a scintillant such as anglesite (PbSO.sub.4) or cerussite (PbCO.sub.3) incorporated into an inert, porous glass matrix via a sol-gel process. Particles of radiation-sensitive scintillant are added to, a sol solution. The mixture is polymerized to form a gel, then dried under conditions that preserve the structural integrity and radiation sensitivity of the scintillant. The final product is a composition containing the uniformly-dispersed scintillant in an inert, optically transparent and highly porous matrix. The composition is chemically inert and substantially impervious to environmental conditions including changes in temperature, air pressure, and so forth. It can be fabricated in cylinders, blocks with holes therethrough for flow of fluid, sheets, surface coatings, pellets or other convenient shapes.

  15. Composition and apparatus for detecting gamma radiation

    DOEpatents

    Hofstetter, K.J.

    1994-08-09

    A gamma radiation detector and a radioluminescent composition for use therein. The detector includes a radioluminescent composition that emits light in a characteristic wavelength region when exposed to gamma radiation, and means for detecting said radiation. The composition contains a scintillant such as anglesite (PbSO[sub 4]) or cerussite (PbCO[sub 3]) incorporated into an inert, porous glass matrix via a sol-gel process. Particles of radiation-sensitive scintillant are added to, a sol solution. The mixture is polymerized to form a gel, then dried under conditions that preserve the structural integrity and radiation sensitivity of the scintillant. The final product is a composition containing the uniformly-dispersed scintillant in an inert, optically transparent and highly porous matrix. The composition is chemically inert and substantially impervious to environmental conditions including changes in temperature, air pressure, and so forth. It can be fabricated in cylinders, blocks with holes therethrough for flow of fluid, sheets, surface coatings, pellets or other convenient shapes. 3 figs.

  16. Diverse delayed effects in human lymphoblastoid cells surviving exposure to high-LET (56)Fe particles or low-LET (137)Cs gamma radiation

    NASA Technical Reports Server (NTRS)

    Evans, H. H.; Horng, M. F.; Ricanati, M.; Diaz-Insua, M.; Jordan, R.; Schwartz, J. L.

    2001-01-01

    To obtain information on the origin of radiation-induced genomic instability, we characterized a total of 166 clones that survived exposure to (56)Fe particles or (137)Cs gamma radiation, isolated approximately 36 generations after exposure, along with their respective control clones. Cytogenetic aberrations, growth alterations, responses to a second irradiation, and mutant frequencies at the Na(+)/K(+) ATPase and thymidine kinase loci were determined. A greater percentage of clones that survived exposure to (56)Fe particles exhibited instability (defined as clones showing one or more outlying characteristics) than in the case of those that survived gamma irradiation. The phenotypes of the unstable clones that survived exposure to (56)Fe particles were also qualitatively different from those of the clones that survived gamma irradiation. A greater percentage (20%) of the unstable clones that survived gamma irradiation than those that survived exposure to (56)Fe particles (4%) showed an altered response to the second irradiation, while an increase in the percentage of clones that had an outlying frequency of ouabain-resistant and thymidine kinase mutants was more evident in the clones exposed to (56)Fe particles than in those exposed to gamma rays. Growth alterations and increases in dicentric chromosomes were found only in clones with more than one alteration. These results underscore the complex nature of genomic instability and the likelihood that radiation-induced genomic instability arises from different original events.

  17. Afterglow Radiation from Gamma Ray Bursts

    SciTech Connect

    Desmond, Hugh; /Leuven U. /SLAC

    2006-08-28

    Gamma-ray bursts (GRB) are huge fluxes of gamma rays that appear randomly in the sky about once a day. It is now commonly accepted that GRBs are caused by a stellar object shooting off a powerful plasma jet along its rotation axis. After the initial outburst of gamma rays, a lower intensity radiation remains, called the afterglow. Using the data from a hydrodynamical numerical simulation that models the dynamics of the jet, we calculated the expected light curve of the afterglow radiation that would be observed on earth. We calculated the light curve and spectrum and compared them to the light curves and spectra predicted by two analytical models of the expansion of the jet (which are based on the Blandford and McKee solution of a relativistic isotropic expansion; see Sari's model [1] and Granot's model [2]). We found that the light curve did not decay as fast as predicted by Sari; the predictions by Granot were largely corroborated. Some results, however, did not match Granot's predictions, and more research is needed to explain these discrepancies.

  18. SSPM Scintillator Readout for Gamma Radiation Detection

    SciTech Connect

    Baker, S A; Wendelberger, B; Young, J A; Green, J A; Guise, R E; Franks, L

    2011-09-01

    Silicon-based photodetectors offer several benefits relative to photomultiplier tubebased scintillator systems. Solid-state photomultipliers (SSPM) can realize the gain of a photomultiplier tube (PMT) with the quantum efficiency of silicon. The advantages of the solid-state approach must be balanced with adverse trade-offs, for example from increased dark current, to optimize radiation detection sensitivity. We are designing a custom SSPM that will be optimized for green emission of thallium-doped cesium iodide (CsI(Tl)). A typical field gamma radiation detector incorporates thallium doped sodium iodide (NaI(Tl)) and a radiation converter with a PMT. A PMTs sensitivity peaks in the blue wavelengths and is well matched to NaI(Tl). This paper presents results of photomultiplier sensitivity relative to conventional SSPMs and discusses model design improvements. Prototype fabrications are in progress.

  19. Satellite observation of atmospheric nuclear gamma radiation

    NASA Technical Reports Server (NTRS)

    Letaw, John R.; Share, G. H.; Kinzer, R. L.; Silberberg, R.; Chupp, E. L.

    1989-01-01

    Satellite observations of the spectrum of gamma radiation from the earth's atmosphere in the energy interval from 300 keV to 8.5 MeV were obtained with a gamma-ray spectrometer during 1980-1983. A total of 20 atmospheric line features are superimposed on a continuum background which is modeled using a power law with an index of -1.16. The line energies and intensities are consistent with production by secondary neutrons interacting with atmospheric N-14 and O-16. The intensity and spectrum of photons at energies below the 511-keV line, in excess of a power law continuum, are explained by Compton scattering of the annihilation line photons in traversing an average of 21 g/sq cm of atmosphere.

  20. 30 CFR 57.5047 - Gamma radiation surveys.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Gamma radiation surveys. 57.5047 Section 57... radiation surveys. (a) Gamma radiation surveys shall be conducted annually in all underground mines where radioactive ores are mined. (b) Surveys shall be in accordance with American National Standards...

  1. 30 CFR 57.5047 - Gamma radiation surveys.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Gamma radiation surveys. 57.5047 Section 57... radiation surveys. (a) Gamma radiation surveys shall be conducted annually in all underground mines where radioactive ores are mined. (b) Surveys shall be in accordance with American National Standards...

  2. Radiation Sterilization and Food Irradiation Using Gamma Radiation

    NASA Astrophysics Data System (ADS)

    O'Hara, Kevin

    2003-03-01

    Since the introduction of MDS Nordion's first irradiator in the early 1960's, a variety of gamma-processing systems has been developed. Each design is suited to a particular set of requirements - from high-throughput operations of diverse product lots to full automation or batch processing, all using gamma radiation. Gamma irradiator designs include the Centurion irradiator for temperature-sensitive food products like hamburgers and poultry; the Brevion, a compact batch irradiator providing flexibility, timeliness and simplicity on a whole new scale; a JS-10000 irradiator that operates in either automatic or batch mode to enable multipurpose product scheduling and optimum throughput; and, an irradiator that processes full pallets and is ideal for processing high-density products requiring excellent dose uniformity. These innovative irradiator designs help facilities to be more efficient, maximize operating time, improve product turnaround and minimize inventory levels. MDS Nordion's development of improved Point Kernel and Monte Carlo techniques is discussed, including their application in radiation source optimization, production irradiator design and process control. Absorbed-dose calculations also provide insight into the critical areas for dose mapping and routine monitoring, allowing for the optimum placement of dosimeters. Calculations may also be used to determine the absorbed-dose distribution within product, especially in areas of complex geometry such as material interfaces. The use of easily accessible, accurate and validated dose-calculation programs can be used to optimize the irradiation process. Key Words: dosimetry, irradiator design, dose calculation, modelling, modeling, process control, radiation source optimization.

  3. Ultrarelativistic electrons and solar flare gamma-radiation

    NASA Technical Reports Server (NTRS)

    Semukhin, P. E.; Kovaltsov, G. A.

    1985-01-01

    Ten solar flares with gamma radiation in excess of 10 MeV were observed. Almost all took place within a heliolatitude greater than 60 deg, close to the solar limb, an indication of the essential anisotropy of high-energy gamma radiation. This high-energy solar flare gamma radiation can be explained by the specific features of the bremsstrahlung of ultrarelativistic electrons trapped within the magnetic arc of the solar atmosphere, even if the acceleration of the electrons is anisotropic.

  4. Cell Radiation Experiment System

    NASA Technical Reports Server (NTRS)

    Morrison, Dennis R.

    2010-01-01

    The cell radiation experiment system (CRES) is a perfused-cell culture apparatus, within which cells from humans or other animals can (1) be maintained in homeostasis while (2) being exposed to ionizing radiation during controlled intervals and (3) being monitored to determine the effects of radiation and the repair of radiation damage. The CRES can be used, for example, to determine effects of drug, radiation, and combined drug and radiation treatments on both normal and tumor cells. The CRES can also be used to analyze the effects of radiosensitive or radioprotectant drugs on cells subjected to radiation. The knowledge gained by use of the CRES is expected to contribute to the development of better cancer treatments and of better protection for astronauts, medical-equipment operators, and nuclear-power-plant workers, and others exposed frequently to ionizing radiation.

  5. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sndor, Nikolett; Schilling, Boglrka; Kis, Enik?; Lumniczky, Katalin; Sfrny, Gza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co ?-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  6. Annihilation radiation in cosmic gamma-ray bursts

    NASA Technical Reports Server (NTRS)

    Aptekar, R. L.; Golenetskii, S. V.; Guryan, Y. A.; Ilyinskii, V. N.; Mazets, E. P.

    1985-01-01

    The pair annihilation radiation in gamma-ray bursts is seen as broad lines with extended hard wings. This radiation is suggested to escape in a collimated beam from magnetic polar regions of neutron stars.

  7. Repair effects of exogenous SOD on Bacillus subtilis against gamma radiation exposure.

    PubMed

    Chen, Xiaoming; Zhang, E; Fang, Liu; Zhang, Jianguo; Zhu, Jie; He, Wei; Luo, Xuegang

    2013-12-01

    Superoxide dismutase (SOD) is an enzyme that removes free radicals from cells in many organisms. In order to further characterize these repair effects and their mechanism when subjected to radiation, Bacillus subtilis cells were exposed to gamma radiation and the cell survival rate, intracellular SOD activity, and DNA double-strand breakage were investigated. Vegetative cells of B. subtilis were irradiated by (60)Co gamma radiation at varying doses and subsequently exposed to varying levels of exogenous SOD. Standard plate-count, xanthine oxidase, and pulsed-field gel electrophoresis (PFGE) methods were employed to investigate the repair effects. The results showed that the exogenous SOD could significantly improve cell survival rate and intracellular SOD activity after gamma radiation. The cell survival rate was elevated 30-87 times above levels observed in control samples. Adding exogenous SOD into gamma irradiated cells may dramatically increase intracellular SOD activity (p < 0.01), while percentage of DNA release (PR) values may decrease significantly when cells are treated with SOD. The repair effects were observed to vary with the gamma radiation dose and SOD concentration. These findings suggest that exogenous SOD may have the ability to repair vegetative B. subtilis cell damage after irradiated by gamma radiation. DNA strand scission may also be prevented by addition of SOD. This research contributes to better understanding of protection from the effects of free radicals and their mechanisms, an ongoing process in many organisms that involves the cellular response to gamma radiation, which occurs naturally in soil and water, as well as in unusual cases of high-dosage exposure. PMID:24096311

  8. Gamma radiation shielding analysis of lead-flyash concretes.

    PubMed

    Singh, Kanwaldeep; Singh, Sukhpal; Dhaliwal, A S; Singh, Gurmel

    2014-11-01

    Six samples of lead-flyash concrete were prepared with lead as an admixture and by varying flyash content - 0%, 20%, 30%, 40%, 50% and 60% (by weight) by replacing cement and keeping constant w/c ratio. Different gamma radiation interaction parameters used for radiation shielding design were computed theoretically and measured experimentally at 662keV, 1173keV and 1332keV gamma radiation energy using narrow transmission geometry. The obtained results were compared with ordinary-flyash concretes. The radiation exposure rate of gamma radiation sources used was determined with and without lead-flyash concretes. PMID:25464195

  9. Gamma radiation effects on nestling Tree Swallows

    SciTech Connect

    Zach, R.; Mayoh, K.R.

    1984-10-01

    The sensitivity of Tree Swallows (Tachycineta bicolor) to the stress of ionizing radiation was investigated with growth analysis. Freshly hatched nestlings were temporarily removed from nests, taken to the laboratory and acutely exposed to 0.9, 2.7, or 4.5 Gy gamma radiation. Some of the unirradiated control nestlings were also taken to the laboratory whereas others were left in the nests. Growth of all the nestlings was measured daily and analyzed by fitting growth models. There was no detectable radiation-induced mortality up to fledgling, approx. = 20 d after irradiation. Radiation exposure did not affect the basic growth pattern; the logistic growth model was most suitable for body mass and foot length, and the von Bertalanffy model for primary-feather length, irrespective of treatment. Parameter values from these models indicated pronounced growth depression in the 2.7-Gy and 4.5-Gy groups, particularly for body mass. Radiation also affected the timing of development. The growth depression of the 2.7-Gy group was similar to that caused by hatching asynchrony in unirradiated nestlings. The 4.5-Cy nestlings grew as well as unexposed nestlings that died from natural causes. Chronic irradiation at approx. = 1.0 Cy/d caused more severe growth effects than acute exposure to 4.5 Gy and may have caused permanent stunting. Growth analysis is a potent tool for assessing man-made environmental stresses. Observed body-mass statistics and model parameters seem to be most sensitive to environmental stresses, but coefficients of variation are not necessarily correlated with sensitivity. 34 references, 2 figures, 4 tables.

  10. Satellite observation of atmospheric nuclear gamma radiation.

    PubMed

    Letaw, J R; Share, G H; Kinzer, R L; Silberberg, R; Chupp, E L; Forrest, D J; Rieger, E

    1989-02-01

    We present a satellite observation of the spectrum of gamma radiation from the Earth's atmosphere in the energy interval from 300 keV to 8.5 MeV. The data were accumulated by the gamma ray spectrometer on the Solar Maximum Mission over 3 1/2 years, from 1980 to 1983. The excellent statistical accuracy of the data allows 20 atmospheric line features to be identified. The features are superimposed on a continuum background which is modeled using a power law with index -1.16. Many of these features contain a blend of more than one nuclear line. All of these lines (with the exception of the 511-keV annihilation line) are Doppler broadened. Line energies and intensities are consistent with production by secondary neutrons interacting with atmospheric 14N and 16O. Although we find no evidence for other production mechanisms, we cannot rule out significant contributions from direct excitation or spallation by primary cosmic ray protons. The relative intensities of the observed line features are in fair agreement with theoretical models; however, existing models are limited by the availability of neutron cross sections, especially at high energies. The intensity and spectrum of photons at energies below the 511-keV line, in excess of a power law continuum, can be explained by Compton scattering of the annihilation line photons in traversing an average of approximately 21 g cm-2 of atmosphere. PMID:11537397

  11. Orchid flowers tolerance to gamma-radiation

    NASA Astrophysics Data System (ADS)

    Kikuchi, Olivia Kimiko

    2000-03-01

    Cut flowers are fresh goods that may be treated with fumigants such as methyl bromide to meet the needs of the quarantine requirements of importing countries. Irradiation is a non-chemical alternative to substitute the methyl bromide treatment of fresh products. In this research, different cut orchids were irradiated to examine their tolerance to gamma-rays. A 200 Gy dose did inhibit the Dendrobium palenopsis buds from opening, but did not cause visible damage to opened flowers. Doses of 800 and 1000 Gy were damaging because they provoked the flowers to drop from the stem. Cattleya irradiated with 750 Gy did not show any damage, and were therefore eligible for the radiation treatment. Cymbidium tolerated up to 300 Gy and above this dose dropped prematurely. On the other hand, Oncydium did not tolerate doses above 150 Gy.

  12. Carbohydrate based materials for gamma radiation shielding

    NASA Astrophysics Data System (ADS)

    Tabbakh, F.; Babaee, V.; Naghsh-Nezhad, Z.

    2015-05-01

    Due to the limitation in using lead as a shielding material for its toxic properties and limitation in abundance, price or non-flexibility of other commonly used materials, finding new shielding materials and compounds is strongly required. In this conceptual study carbohydrate based compounds were considered as new shielding materials. The simulation of radiation attenuation is performed using MCNP and Geant4 with a good agreement in the results. It is found that, the thickness of 2 mm of the proposed compound may reduce up to 5% and 50% of 1 MeV and 35 keV gamma-rays respectively in comparison with 15% and 100% for the same thickness of lead.

  13. Solar cell radiation handbook

    NASA Technical Reports Server (NTRS)

    Carter, J. R., Jr.; Tada, H. Y.

    1973-01-01

    A method is presented for predicting the degradation of a solar array in a space radiation environment. Solar cell technology which emphasizes the cell parameters that degrade in a radiation environment, is discussed along with the experimental techniques used in the evaluation of radiation effects. Other topics discussed include: theoretical aspects of radiation damage, methods for developing relative damage coefficients, nature of the space radiation environment, method of calculating equivalent fluence from electron and proton energy spectrums and relative damage coefficients, and comparison of flight data with estimated degradation.

  14. Intrinsic radiation resistance in human chondrosarcoma cells

    SciTech Connect

    Moussavi-Harami, Farid; Mollano, Anthony; Martin, James A.; Ayoob, Andrew; Domann, Frederick E.; Gitelis, Steven; Buckwalter, Joseph A. . E-mail: joseph-buckwalter@uiowa.edu

    2006-07-28

    Human chondrosarcomas rarely respond to radiation treatment, limiting the options for eradication of these tumors. The basis of radiation resistance in chondrosarcomas remains obscure. In normal cells radiation induces DNA damage that leads to growth arrest or death. However, cells that lack cell cycle control mechanisms needed for these responses show intrinsic radiation resistance. In previous work, we identified immortalized human chondrosarcoma cell lines that lacked p16{sup ink4a}, one of the major tumor suppressor proteins that regulate the cell cycle. We hypothesized that the absence of p16{sup ink4a} contributes to the intrinsic radiation resistance of chondrosarcomas and that restoring p16{sup ink4a} expression would increase their radiation sensitivity. To test this we determined the effects of ectopic p16{sup ink4a} expression on chondrosarcoma cell resistance to low-dose {gamma}-irradiation (1-5 Gy). p16{sup ink4a} expression significantly increased radiation sensitivity in clonogenic assays. Apoptosis did not increase significantly with radiation and was unaffected by p16{sup ink4a} transduction of chondrosarcoma cells, indicating that mitotic catastrophe, rather than programmed cell death, was the predominant radiation effect. These results support the hypothesis that p16{sup ink4a} plays a role in the radiation resistance of chondrosarcoma cell lines and suggests that restoring p16 expression will improve the radiation sensitivity of human chondrosarcomas.

  15. [Effect of continuous gamma-radiation at low doses on clonogenic hemopoietic (CFU-S) and stromal (CFU-F) bone marrow cells ].

    PubMed

    Domaratskaia, E I; Starostin, V I; Tsetlin, V V; Butorina, N N; Bueverova, E I; Bragina, E V; Khrushchov, N G

    2002-01-01

    We studied the effects of low doses of continuous gamma-irradiation (Co60, 10 days, mean daily dose power 1.5-2.0 mGy, total dose 15 mGy) on hemopoietic and stromal progenitor cells of murine bone marrow. The content of hemopoietic clonogenic cells representing a "younger" (CFU-S-11) and more "mature" (CFU-S-7) categories in the compartment of stem cells was determined in the bone marrow. The state of bone marrow stroma was estimated by the method of in vitro cloning according to the number of progenitor cells that form colonies of fibroblasts (CFU-F) and by the method of ectopic transplantation according to the capacity of stroma of organizing and building new hemopoietic territories. Continuous gamma-irradiation at low doses, that were by one order of magnitude lower than those inducing hermesis, exerted a stimulating effect on both hemopoietic (CFU-S) and stromal (CFU-F) progenitor cells. The number of CFU-S in the compartment of stem cells of the bone marrow markedly increased and they formed larger hemopoietic territories but these cells appeared to create a qualitatively different microenvironment, which stimulated the proliferation of CFU-S. PMID:12180004

  16. Pulsar and diffuse contributions to the observed galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Harding, A. K.; Stecker, F. W.

    1980-01-01

    With the acquisition of satellite data on the energy spectrum of galactic gamma-radiation, it is clear that such radiation has a multicomponent nature. A calculation of the pulsar gamma ray emission spectrum is used together with a statistical analysis of recent data on 328 known pulsars to make a new determination of the pulsar contribution to galactic gamma ray emission. The contributions from diffuse interstellar cosmic ray induced production mechanisms to the total emission are then reexamined. It is concluded that pulsars may account for a significant fraction of galactic gamma ray emission.

  17. Petroleum and diesel sulfur degradation under gamma radiation

    NASA Astrophysics Data System (ADS)

    Andrade, Luana dos Santos; Calvo, Wilson Aparecido Parejo; Sato, Ivone Mulako; Duarte, Celina Lopes

    2015-10-01

    Hydrodesulfurization (HDS) is currently the most common method used by refineries to remove sulfur compounds from petroleum fractions. However, it is not highly effective for removing thiophene compounds such as benzothiophene. Additionally, this process generates high costs for the oil industry. In the present work, ionizing radiation was used in order to study the effect on the degradation of petroleum and diesel sulfur compounds. Crude oil and diesel fuel samples were studied, without any pretreatment, and irradiated using a cobalt-60 gamma cell in a batch system at absorbed doses of 30 kGy and 50 kGy. The sulfur compounds were extracted and then analyzed by gas chromatography associated with mass spectrometry (GCMS). A high efficiency of ionizing radiation was observed regarding the degradation of sulfur compounds such as benzothiophene and benzenethiol and the formation of fragments, for example 1.2-dimethylbenzene and toluene.

  18. Inhaled /sup 147/Pm and/or total-body gamma radiation: Early mortality and morbidity in rats

    SciTech Connect

    Filipy, R.E.; Lauhala, K.E.; McGee, D.R.; Cannon, W.C.; Buschbom, R.L.; Decker, J.R.; Kuffel, E.G.; Park, J.F.; Ragan, H.A.; Yaniv, S.S.; Scott, B.R.

    1989-05-01

    Rats were given doses of /sup 60/Co gamma radiation and/or lung burdens of /sup 147/Pm (in fused aluminosilicate particles) within lethal ranges in an experiment to determine and compare morbidity and mortality responses for the radiation insults within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Acute mortality and morbidity from inhaled promethium were caused primarily by radiation pneumonitis and pulmonary fibrosis that occurred more than 53 days after exposure. Acute mortality and morbidity from total-body gamma irradiation occurred within 30 days of exposure and resulted from the bone-marrow radiation syndrome. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell levels and by reduced body weight gain in animals that survived the acute gamma radiation syndrome. Inhaled promethium caused a loss of body weight and diminished pulmonary function, but its only effect on blood cell levels was lymphocytopenia. Combined gamma irradiation and promethium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Promethium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the later effect of promethium lung burdens. 70 refs., 68 figs., 21 tabs.

  19. A Device for Search of Gamma-Radiation Intensive Sources at the Radiation Accident Condition

    SciTech Connect

    Batiy, Valeriy; Klyuchnykov, A; Kochnev, N; Rudko, Vladimir; shcherbin, vladimir; Yegorov, V; Schmieman, Eric A.

    2005-08-08

    The procedure designed for measuring angular distributions of gamma radiation and for search of gamma radiation intensive sources is described. It is based on application of the original multidetector device ShD-1, for measuring an angular distribution in a complete solid angle (4 pi). The calibration results and data on the angular distributions of intensity of gamma radiation at the roof of Chornobyl NPP ''Shelter'' are presented.

  20. On gamma and neutrino radiation from Cyg X-3

    NASA Technical Reports Server (NTRS)

    Berezinsky, V. S.

    1985-01-01

    The production of high energy gamma and neutrino radiation is studied for Cyg X-3. A heating model is proposed to explain the presence of only one gamma-pulse during 4.8 h period of the source. The acceleration mechanisms are discussed. High energy neutrino flux from Cyg X-3 is calculated.

  1. Inactivation of rabies diagnostic reagents by gamma radiation

    SciTech Connect

    Gamble, W.C.; Chappell, W.A.; George, E.H.

    1980-11-01

    Treatment of CVS-11 rabies adsorbing suspensions and street rabies infected mouse brains with gamma radiation resulted in inactivated reagents that are safer to distribute and use. These irradiated reagents were as sensitive and reactive as the nonirradiated control reagents.

  2. Solar cell radiation handbook

    NASA Technical Reports Server (NTRS)

    Tada, H. Y.; Carter, J. R., Jr.

    1977-01-01

    Solar cell theory cells are manufactured, and how they are modeled mathematically is reviewed. The interaction of energetic charged particle radiation with solar cells is discussed in detail and the concept of 1 MeV equivalent electron fluence is introduced. The space radiation environment is described and methods of calculating equivalent fluences for the space environment are developed. A computer program was written to perform the equivalent fluence calculations and a FORTRAN listing of the program is included. Finally, an extensive body of data detailing the degradation of solar cell electrical parameters as a function of 1 MeV electron fluence is presented.

  3. [Cytotoxicity of PVC tubes sterilized in ethylene oxide after gamma radiation exposure].

    PubMed

    de Souza, Rafael Queiroz; Graziano, Kazuko Uchikawa; Ikeda, Tamiko Ichikawa; Gonalves, Cludia Regina; Cruz, Aurea Silveira

    2013-04-01

    Do materials sterilized using gamma rays become toxic when re-sterilized in ethylene oxide? This question guided the objective of this study, which was to investigate the potential cytotoxic effect of PVC sterilized by gamma radiation and re-sterilized with EO by the agar diffusion method in cell cultures. Nine PVC tubes were subjected to gamma radiation sterilization and were re-sterilized in EO. The tubes were divided into a total of 81 units of analysis that were tested so as to represent the internal and external surfaces and mass of each tube. It was concluded that the PVC materials sterilized in gamma radiation and re-sterilized in EO are not cytotoxic. PMID:23743920

  4. Solar cell radiation handbook

    SciTech Connect

    Tada, H.Y.; Carter, J.R. Jr.; Anspaugh, B.E.

    1982-11-01

    The handbook to predict the degradation of solar cell electrical performance in any given space radiation environment is presented. Solar cell theory, cell manufacturing and how they are modeled mathematically are described. The interaction of energetic charged particles radiation with solar cells is discussed and the concept of 1 MeV equivalent electron fluence is introduced. The space radiation environment is described and methods of calculating equivalent fluences for the space environment are developed. A computer program was written to perform the equivalent fluence calculations and a FORTRAN listing of the program is included. Data detailing the degradation of solar cell electrical parameters as a function of 1 MeV electron fluence are presented.

  5. Solar cell radiation handbook

    NASA Technical Reports Server (NTRS)

    Tada, H. Y.; Carter, J. R., Jr.; Anspaugh, B. E.; Downing, R. G.

    1982-01-01

    The handbook to predict the degradation of solar cell electrical performance in any given space radiation environment is presented. Solar cell theory, cell manufacturing and how they are modeled mathematically are described. The interaction of energetic charged particles radiation with solar cells is discussed and the concept of 1 MeV equivalent electron fluence is introduced. The space radiation environment is described and methods of calculating equivalent fluences for the space environment are developed. A computer program was written to perform the equivalent fluence calculations and a FORTRAN listing of the program is included. Data detailing the degradation of solar cell electrical parameters as a function of 1 MeV electron fluence are presented.

  6. An integrated view of gamma radiation effects on marine fauna: from molecules to ecosystems.

    PubMed

    Won, Eun-Ji; Dahms, Hans-U; Kumar, K Suresh; Shin, Kyung-Hoon; Lee, Jae-Seong

    2015-11-01

    Accidental release of nuclides into the ocean is causing health risks to marine organisms and humans. All life forms are susceptible to gamma radiation with a high variation, depending on various physical factors such as dose, mode, and time of exposure and various biological factors such as species, vitality, age, and gender. Differences in sensitivity of gamma radiation are also associated with different efficiencies of mechanisms related to protection and repair systems. Gamma radiation may also affect various other integration levels: from gene, protein, cells and organs, population, and communities, disturbing the energy flow of food webs that will ultimately affect the structure and functioning of ecosystems. Depending on exposure levels, gamma radiation induces damages on growth and reproduction in various organisms such as zooplankton, benthos, and fish in aquatic ecosystems. In this paper, harmful effects of gamma-irradiated aquatic organisms are described and the potential of marine copepods in assessing the risk of gamma radiation is discussed with respect to physiological adverse effects that even affect the ecosystem level. PMID:25382502

  7. Development of a novel gamma probe for detecting radiation direction

    NASA Astrophysics Data System (ADS)

    Pani, R.; Pellegrini, R.; Cinti, M. N.; Longo, M.; Donnarumma, R.; D'Alessio, A.; Borrazzo, C.; Pergola, A.; Ridolfi, S.; De Vincentis, G.

    2016-01-01

    Spatial localization of radioactive sources is currently a main issue interesting different fields, including nuclear industry, homeland security as well as medical imaging. It is currently achieved using different systems, but the development of technologies for detecting and characterizing radiation is becoming important especially in medical imaging. In this latter field, radiation detection probes have long been used to guide surgery, thanks to their ability to localize and quantify radiopharmaceutical uptake even deep in tissue. Radiolabelled colloid is injected into, or near to, the tumor and the surgeon uses a hand-held radiation detector, the gamma probe, to identify lymph nodes with radiopharmaceutical uptkake. The present work refers to a novel scintigraphic goniometric probe to identify gamma radiation and its direction. The probe incorporates several scintillation crystals joined together in a particular configuration to provide data related to the position of a gamma source. The main technical characteristics of the gamma locator prototype, i.e. sensitivity, spatial resolution and detection efficiency, are investigated. Moreover, the development of a specific procedure applied to the images permits to retrieve the source position with high precision with respect to the currently used gamma probes. The presented device shows a high sensitivity and efficiency to identify gamma radiation taking a short time (from 30 to 60 s). Even though it was designed for applications in radio-guided surgery, it could be used for other purposes, as for example homeland security.

  8. RADIATION SENSITIVITY & PROCESSING OF DNA DAMAGE FOLLOWING LOW DOSES OF GAMMA-RAY ALPHA PARTICLES & HZE IRRADIATION OF NORMAL DSB REPAIR DEFICIENT CELLS

    SciTech Connect

    O'Neil, Peter

    2009-05-15

    Non-homologous end joining (NHEJ) predominates in the repair of DNA double strand breaks (DSB) over homologous recombination (HR). NHEJ occurs throughout the cell cycle whereas HR occurs in late S/G2 due to the requirement of a sister chromatid (Rothkamm et al, Mol Cell Biol 23 5706-15 [2003]). To date evidence obtained with DSB repair deficient cells using pulsed-field gel electrophoresis has revealed the major pathway throughout all phases of the cell cycle for processing high dose induced DSBs is NHEJ (Wang et al, Oncogene 20 2212-24 (2001); Pluth et al, Cancer Res. 61 2649-55 [2001]). These findings however were obtained at high doses when on average >> 20-30 DSBs are formed per cell. The contribution of the repair pathways (NHEJ and HR) induced in response to DNA damage during the various phases of the cell cycle may depend upon the dose (the level of initial DSBs) especially since low levels of DSBs are induced at low dose. To date, low dose studies using NHEJ and HR deficient mutants have not been carried out to address this important question with radiations of different quality. The work presented here leads us to suggest that HR plays a relatively minor role in the repair of radiation-induced prompt DSBs. SSBs lead to the induction of DSBs which are associated specifically with S-phase cells consistent with the idea that they are formed at stalled replication forks in which HR plays a major role in repair. That DNA-PKcs is in some way involved in the repair of the precursors to replication-induced DSB remains an open question. Persistent non-DSB oxidative damage also leads to an increase in RAD51 positive DSBs. Both simple and complex non-DSB DNA damage may therefore contribute to indirect DSBs induced by ionising radiation at replication forks.

  9. Radiosensitivity and Induction of Apoptosis by High LET Carbon Ion Beam and Low LET Gamma Radiation: A Comparative Study.

    PubMed

    Ghorai, Atanu; Bhattacharyya, Nitai P; Sarma, Asitikantha; Ghosh, Utpal

    2014-01-01

    Cancer treatment with high LET heavy ion beam, especially, carbon ion beam ((12)C), is becoming very popular over conventional radiotherapy like low LET gamma or X-ray. Combination of Poly(ADP-ribose) polymerase (PARP) inhibitor with xenotoxic drugs or conventional radiation (gamma or X-ray) is the newer approach for cancer therapy. The aim of our study was to compare the radiosensitivity and induction of apoptosis by high LET (12)C and low LET gamma radiation in HeLa and PARP-1 knocked down cells. We did comet assay to detect DNA breaks, clonogenic survival assay, and cell cycle analysis to measure recovery after DNA damage. We measured apoptotic parameters like nuclear fragmentation and caspase-3 activation. DNA damage, cell killing, and induction of apoptosis were significantly higher for (12)C than gamma radiation in HeLa. Cell killing and apoptosis were further elevated upon knocking down of PARP-1. Both (12)C and gamma induced G2/M arrest although the (12)C had greater effect. Unlike the gamma, (12)C irradiation affects DNA replication as detected by S-phase delay in cell cycle analysis. So, we conclude that high LET (12)C has greater potential over low LET gamma radiation in killing cells and radiosensitization upon PARP-1 inhibition was several folds greater for (12)C than gamma. PMID:25018892

  10. Radiosensitivity and Induction of Apoptosis by High LET Carbon Ion Beam and Low LET Gamma Radiation: A Comparative Study

    PubMed Central

    Ghorai, Atanu; Bhattacharyya, Nitai P.; Sarma, Asitikantha; Ghosh, Utpal

    2014-01-01

    Cancer treatment with high LET heavy ion beam, especially, carbon ion beam (12C), is becoming very popular over conventional radiotherapy like low LET gamma or X-ray. Combination of Poly(ADP-ribose) polymerase (PARP) inhibitor with xenotoxic drugs or conventional radiation (gamma or X-ray) is the newer approach for cancer therapy. The aim of our study was to compare the radiosensitivity and induction of apoptosis by high LET 12C and low LET gamma radiation in HeLa and PARP-1 knocked down cells. We did comet assay to detect DNA breaks, clonogenic survival assay, and cell cycle analysis to measure recovery after DNA damage. We measured apoptotic parameters like nuclear fragmentation and caspase-3 activation. DNA damage, cell killing, and induction of apoptosis were significantly higher for 12C than gamma radiation in HeLa. Cell killing and apoptosis were further elevated upon knocking down of PARP-1. Both 12C and gamma induced G2/M arrest although the 12C had greater effect. Unlike the gamma, 12C irradiation affects DNA replication as detected by S-phase delay in cell cycle analysis. So, we conclude that high LET 12C has greater potential over low LET gamma radiation in killing cells and radiosensitization upon PARP-1 inhibition was several folds greater for 12C than gamma. PMID:25018892

  11. Observations of Galactic gamma-radiation with the SMM spectrometer

    NASA Technical Reports Server (NTRS)

    Share, G. H.; Kinzer, R. L.; Messina, D. C.; Purcell, W. R.; Chupp, E. L.

    1986-01-01

    Preliminary results from the SMM gamma-ray spectrometer are reported which indicate the detection of a constant source of 0.511-MeV annihilation radiation from the Galaxy. Year-to-year variability appears to be less than 30 percent. The radiation probably comes from a diffuse source and is not associated with the reported compact object at the Galactic center.

  12. A localized excess of diffuse gamma radiation

    NASA Technical Reports Server (NTRS)

    Chen, A.; Dwyer, J.; Kaaret, P.

    1995-01-01

    Using archival Energetic Gamma Ray Experiment Telescope (EGRET) gamma-ray data and atomic hydrogen (H I) column densities derived from 21 cm radio observations, we have found a large irregular region in the northern Galactic hemisphere extending from (l approximately 90 deg, b approximately 52 deg) to (l approximately 45 deg, b approximately 77 deg) with a significant enhancement in the gamma-ray emissivity compared to the surrounding sky. The region contains no previously identified gamma-ray point sources. The emission may arise from a localized enhancement in cosmic-ray density or from the presence of matter other than H I. If the emission is due to unseen matter, a column density enhancement equivalent to approximately 2 x 10(exp 20) H-atoms/sq cm is required.

  13. Natural gamma radiation from long-lived actinide isotopes

    SciTech Connect

    Dupree, S.A.; Sanger, H.M.

    1987-06-01

    The purpose of this report is to describe a method, developed at Sandia National Laboratories, for calculating volumetric, unshielded, gamma radiation source spectra with arbitrary energy group structures from essentially arbitrary mixtures of actinide isotopes. The computer code and data base are combined as INRAD. These spectra can be used to describe the source for gamma radiation transport codes. Coupled with this source routine is a special version of the one-dimensional, discrete ordinates, radiation transport code XSDRN that uses the spectrum generating routine to define sources in an appropriate energy group structure. 15 refs., 34 figs., 10 tabs.

  14. Designing Equipment for Use in Gamma Radiation Environments

    SciTech Connect

    Vandergriff, K.U.

    1990-01-01

    High levels of gamma radiation are known to cause degradation in a variety of materials and components. When designing systems to operate in a high radiation environment, special precautions and procedures should be followed. This report (1) outlines steps that should be followed in designing equipment and (2) explains the general effects of radiation on various engineering materials and components. Much information exists in the literature on radiation effects upon materials. However, very little information is available to give the designer a step-by-step process for designing systems that will be subject to high levels of gamma radiation, such as those found in a nuclear fuel reprocessing facility. In this report, many radiation effect references are relied upon to aid in the design of components and systems.

  15. A study of the diffuse galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Kniffen, D. A.

    1982-01-01

    Assuming cosmic rays pervade the Galaxy, they necessarily produced high energy gamma-rays as they interact with the instellar matter and photons. The cosmic ray nucleon interactions five rise to gamma rays primarily through the decay of pi mesons, giving a unique spectrum with a maximum at approximately 68 MeV. Cosmic ray electrons produce gamma rays through bremsstrahlung, but with a markedly different energy spectral shape, one which decreases monotonically with energy. Cosmic ray electrons also interact with the interstellar starlight, optical and infrared photons, and the blackbody radiation through the Compton process. A model of galactic gamma ray production is discussed, and the predicted spatial distribution and energy spectra are presented. Considering the uncertainty in the point source contributions, the agreement between the theoretical predictions and the gamma ray data seems quite reasonable.

  16. Measurement and Calculation of Gamma Radiation from HWZPR Reactor

    SciTech Connect

    Jalali, Majid

    2006-07-01

    HWZPR is a research reactor with natural uranium fuel, D{sub 2}O moderator and graphite reflector with maximum power of 100 W. It is a suitable means for theoretical research and heavy water reactor experiments. Neutrons from the core participate in different nuclear reactions by interactions with fuel, moderator, graphite and the concrete around the reactor. The results of these interactions are the production of prompt gammas in the environment. Useful information is gained by the reactor gamma spectrum measurement from point of view of relative quantity and energy distribution of direct and scattered radiations. Reactor gamma ray spectrum has been gathered in different places around the reactor by HPGe detector. In analysis of these spectra, {sup 1}H(n,{gamma}){sup 2}H, {sup 16}O(n,n'{gamma}){sup 16}O, {sup 2}H(n,{gamma}){sup 3}H and {sup 238}U(n,{gamma}){sup 239}U reactions occurring in reactor moderator and fuel, are important. The measured spectrum has been primarily estimated by the MCNP code. There is agreement between the code and the experiments in some points. The scattered gamma rays from {sup 27}Al (n,{gamma}){sup 28}Al reaction in the reactor tank, are the most among the gammas scattered in the reactor environment. Also the dose calculations by MCNP code show that 72% of gamma dose belongs to the energy range 3-11 MeV from reactor gamma spectrum and the danger of exposure from the reactor high-energy photons is serious. (author)

  17. SM22{alpha}-induced activation of p16{sup INK4a}/retinoblastoma pathway promotes cellular senescence caused by a subclinical dose of {gamma}-radiation and doxorubicin in HepG2 cells

    SciTech Connect

    Kim, Tae Rim; Lee, Hee Min; Lee, So Yong; Kim, Eun Jin; Kim, Kug Chan; Paik, Sang Gi; Cho, Eun Wie; Kim, In Gyu

    2010-09-10

    Research highlights: {yields} SM22{alpha} overexpression in HepG2 cells leads cells to a growth arrest state, and the treatment of a subclinical dose of {gamma}-radiation or doxorubicin promotes cellular senescence. {yields} SM22{alpha} overexpression elevates p16{sup INK4a} followed by pRB activation, but there are no effects on p53/p21{sup WAF1/Cip1} pathway. {yields} SM22{alpha}-induced MT-1G activates p16{sup INK4a}/pRB pathway, which promotes cellular senescence by damaging agents. -- Abstract: Smooth muscle protein 22-alpha (SM22{alpha}) is known as a transformation- and shape change-sensitive actin cross-linking protein found in smooth muscle tissue and fibroblasts; however, its functional role remains uncertain. We reported previously that SM22{alpha} overexpression confers resistance against anti-cancer drugs or radiation via induction of metallothionein (MT) isozymes in HepG2 cells. In this study, we demonstrate that SM22{alpha} overexpression leads cells to a growth arrest state and promotes cellular senescence caused by treatment with a subclinical dose of {gamma}-radiation (0.05 and 0.1 Gy) or doxorubicin (0.01 and 0.05 {mu}g/ml), compared to control cells. Senescence growth arrest is known to be controlled by p53 phosphorylation/p21{sup WAF1/Cip1} induction or p16{sup INK4a}/retinoblastoma protein (pRB) activation. SM22{alpha} overexpression in HepG2 cells elevated p16{sup INK4a} followed by pRB activation, but did not activate the p53/p21{sup WAF1/Cip1} pathway. Moreover, MT-1G, which is induced by SM22{alpha} overexpression, was involved in the activation of the p16{sup INK4a}/pRB pathway, which led to a growth arrest state and promoted cellular senescence caused by damaging agents. Our findings provide the first demonstration that SM22{alpha} modulates cellular senescence caused by damaging agents via regulation of the p16{sup INK4a}/pRB pathway in HepG2 cells and that these effects of SM22{alpha} are partially mediated by MT-1G.

  18. Reusable shielding material for neutron- and gamma-radiation

    NASA Astrophysics Data System (ADS)

    Calzada, Elbio; Grnauer, Florian; Schillinger, Burkhard; Trck, Harald

    2011-09-01

    At neutron research facilities all around the world radiation shieldings are applied to reduce the background of neutron and gamma radiation as far as possible in order to perform high quality measurements and to fulfill the radiation protection requirements. The current approach with cement-based compounds has a number of shortcomings: "Heavy concrete" contains a high amount of elements, which are not desired to obtain a high attenuation of neutron and/or gamma radiation (e.g. calcium, carbon, oxygen, silicon and aluminum). A shielding material with a high density of desired nuclei such as iron, hydrogen and boron was developed for the redesign of the neutron radiography facility ANTARES at beam tube 4 (located at a cold neutron source) of FRM-II. The composition of the material was optimized by help of the Monte Carlo code MCNP5. With this shielding material a considerable higher attenuation of background radiation can be obtained compared to usual heavy concretes.

  19. Effect of gamma radiation on honey quality control

    NASA Astrophysics Data System (ADS)

    Bera, A.; Almeida-Muradian, L. B.; Sabato, S. F.

    2009-07-01

    Honey is one of the most complex substances produced by bees, mainly from the nectar of flowers. Gamma radiation is a technique that can be used to decrease the number of microbiological problems associated with food and increase the shelf life of certain products. The objective of this study was to verify the effect of gamma radiation with source of cobalto-60 (10 kGy) on some parameters used in honey quality control. Seven samples of pure honey were obtained from local markets in Sao Paulo, Brazil, in 2007. The methods used are in accordance with Brazilian Regulations. The physicochemical parameters analyzed were: moisture, HMF, free acidity, pH, sugars and ash. The results showed that gamma radiation, in the dose mentioned above, did not cause significant physicochemical alterations.

  20. Nano-Sensitization under gamma rays and fast ion radiation

    NASA Astrophysics Data System (ADS)

    Porcel, E.; Li, S.; Usami, N.; Remita, H.; Furusawa, Y.; Kobayashi, K.; Le Sech, C.; Lacombe, S.

    2012-07-01

    The use of heavy compounds to enhance radiation induced damage is a promising approach to improve the therapeutic index of radiotherapy. In order to quantify and control the effects of these radiosensitizers, it is of fundamental interest to describe the elementary processes which take place at the molecular level. Using DNA as a probe, we present a comparison of the damage induced in the presence of platinum compounds exposed to different types of ionizing radiation. We present the results obtained with gamma rays (Linear Energy Transfer (LET) = 0.2 keV.?m-1), fast helium ions He2+ (LET = 2.3 keV.?m-1) and fast carbon ions C6+ (LET = 13 keV.?m-1 and LET = 110 keV.?m-1). The efficiency of two different sensitizers was measured: platinum based molecules (the chloroterpyridine platinum - PtTC) and platinum nanoparticles (PtNP). These experiments show that the two sensitizers are efficiently amplifying molecular damage under photon or ion irradiation. Experiments with a radical scavenger confirmed that these damages are mediated by free radicals for more than 90%. More interestingly, the induction of complex damage, the most lethal for the cells, is amplified by a factor of 1.5 on average if platinum (PtTC and PtNP) is present. As already known, the induction of complex damages increases also with the radiation LET. So, finally, the most significant enhancement of complex damage is observed when ion radiation is combined with platinum induced sensitization.

  1. Gamma-delta t-cell lymphomas.

    PubMed

    Foppoli, Marco; Ferreri, Andrs J M

    2015-03-01

    Gamma-delta T-cell lymphomas are aggressive and rare diseases originating from gamma-delta lymphocytes. These cells, which naturally play a role in the innate, non-specific immune response, develop from thymic precursor in the bone marrow, lack the major histocompatibility complex restrictions and can be divided into two subpopulations: Vdelta1, mostly represented in the intestine, and Vdelta2, prevalently located in the skin, tonsils and lymph nodes. Chronic immunosuppression such as in solid organ transplanted subjects and prolonged antigenic exposure are probably the strongest risk factors for the triggering of lymphomagenesis. Two entities are recognised by the 2008 WHO Classification: hepatosplenic gamma-delta T-cell lymphoma (HSGDTL) and primary cutaneous gamma-delta T-cell lymphoma (PCGDTL). The former is more common among young males, presenting with B symptoms, splenomegaly and thrombocytopenia, usually with the absence of nodal involvement. Natural behaviour of HSGDTL is characterised by low response rates, poor treatment tolerability, common early progression of disease and disappointing survival figures. PCGDTL accounts for <1% of all primary cutaneous lymphomas, occurring in adults with relevant comorbidities. Cutaneous lesions may vary, but its clinical behaviour is usually aggressive and long-term survival is anecdotal. Available literature on gamma-delta T-cell lymphomas is fractioned, mostly consisting of case reports or small cumulative series. Therefore, clinical suspicion and diagnosis are usually delayed, and therapeutic management remains to be established. This review critically analyses available evidence on diagnosis, staging and behaviour of gamma-delta T-cell lymphomas, provides recommendations for therapeutic management in routine practice and discusses relevant unmet clinical needs for future studies. PMID:25154298

  2. Annual effective dose from environmental gamma radiation in Bushehr city

    PubMed Central

    2014-01-01

    Background Present study was an attempt to measure outdoor and indoor gamma dose rates in Bushehr city to determine corresponding annual effective dose and, to assess effect of active nuclear power plant located in Bushehr city on background radiation level of this city. Methods All measurements were performed by G.M (Geiger Muller) detector (X5C plus) calibrated in Iran Atomic Energy Agency. In order to avoid effects of ground on outdoor and indoor measurements, G.M detector was placed one meter higher than ground level. Also, during the outdoor measurements, G.M detector was used at least six meters away from the walls of any building nearby to avoid unwanted effects of the materials used in the buildings on measurements. Results Average gamma dose rates of outdoor and indoor measurements were determined as 51.8??8.8nSv/h and 60.2??7.2nSv/h, respectively. Annual effective dose due to background gamma radiation was calculated as 0.36mSv which was lower than average global level. Conclusions The average annual effective dose from background gamma radiation in Bushehr city was less than global level. Comparison of the results of present study, as follow up, with previous attempt performed in 2004 to determine effective dose of environmental gamma radiation in Bushehr province revealed that, during eight years, nuclear power plant located in this city has not significantly increased level of annual effective dose of Bushehr city. PMID:24393421

  3. Effect of gamma radiation on dentin bond strength and morphology.

    PubMed

    Sperandio, M; Souza, J B; Oliveira, D T

    2001-01-01

    Sterilization by gamma radiation is a method often used for bone and extracted teeth banking. The bond strength of human dentin submitted to gamma rays has not been reported. Therefore, the aim of this study was to assess the effect of gamma radiation on dentin shear bond strength and morphology. The roots were removed from extracted human bicuspids and their crowns divided into two groups: an untreated control and crowns submitted to gamma radiation sterilization. The crowns were mounted in epoxy resin and the buccal enamel removed exposing the subjacent dentin. SBMPPlus adhesive system was applied to a 3-mm diameter area after 15 s of 35% phosphoric acid etching. The samples were mounted in composite resin cylinders and stored in distilled water at 37 degrees C for 24 h until the shear test. Dental fragments from both groups were prepared for SEM analysis. There was no statistically significant difference between the results of the shear test for the two groups according to the Tukey test (p > 0.05). Scanning electron micrographs also did not show alterations. These results indicate that gamma radiation neither affected the shear bond strength of SBMPPlus nor altered the dentin surface morphology. PMID:11696920

  4. Haemopoietic cell renewal in radiation fields

    NASA Astrophysics Data System (ADS)

    Fliedner, T. M.; Nothdurft, W.; Tibken, B.; Hofer, E.; Weiss, M.; Kindler, H.

    1994-10-01

    Space flight activities are inevitably associated with a chronic exposure of astronauts to a complex mixture of ionising radiation. Although no acute radiation consequences are to be expected as a rule, the possibility of Solar Particle Events (SPE) associated with relatively high doses of radiation (1 or more Gray) cannot be excluded. It is the responsibility of physicians in charge of the health of astronauts to evaluate before, during and after space flight activities the functional status of haemopoietic cell renewal. Chronic low level exposure of dogs indicate that daily gamma-exposure doses below about 2 cGy are tolerated for several years as far as blood cell concentrations are concerned. However, the stem cell pool may be severely affected. The maintenance of sufficient blood cell counts is possible only through increased cell production to compensate for the radiation inflicted excess cell loss. This behaviour of haemopoietic cell renewal during chronic low level exposure can be simulated by bioengineering models of granulocytopoiesis. It is possible to define a ``turbulence region'' for cell loss rates, below which an prolonged adaptation to increased radiation fields can be expected to be tolerated. On the basis of these experimental results, it is recommended to develop new biological indicators to monitor haemopoietic cell renewal at the level of the stem cell pool using blood stem cells in addition to the determination of cytokine concentrations in the serum (and other novel approaches). To prepare for unexpected haemopoietic effects during prolonged space missions, research should be increased to modify the radiation sensitivity of haemopoietic stem cells (for instance by the application of certain regulatory molecules). In addition, a ``blood stem cell bank'' might be established for the autologous storage of stem cells and for use in space activities keeping them in a radiation protected container.

  5. Measurements of background gamma radiation on Spacelab 2

    NASA Technical Reports Server (NTRS)

    Fishman, G. J.; Paciesas, W. S.; Gregory, J. C.

    1987-01-01

    A nuclear radiation monitor (NRM) which was flown as part of the verification instrumentation on the Spacelab 2 mission (July 29 - August 6, 1985) recorded spectra every 20 seconds and counting rates in coarse energy bands on finer time scales. The gamma radiation environment on Spacelab is characterized by cosmic-ray and trapped proton secondary radiation in the Spacelab/Shuttle, earth albedo radiation, and delayed induced radioactivity in the detector and surrounding materials. It is found that passages through South Atlantic Anomaly protons produce a well-defined background enhancement.

  6. Radiation burst from a single {gamma}-photon field

    SciTech Connect

    Shakhmuratov, R. N.; Vagizov, F.; Kocharovskaya, O.

    2011-10-15

    The radiation burst from a single {gamma}-photon field interacting with a dense resonant absorber is studied theoretically and experimentally. This effect was discovered for the fist time by P. Helisto et al.[Phys. Rev. Lett. 66, 2037 (1991)] and it was named the ''gamma echo''. The echo is generated by a 180 Degree-Sign phase shift of the incident radiation field, attained by an abrupt change of the position of the absorber with respect to the radiation source during the coherence time of the photon wave packet. Three distinguishing cases of the gamma echo are considered; i.e., the photon is in exact resonance with the absorber, close to resonance (on the slope of the absorption line), and far from resonance (on the far wings of the resonance line). In resonance the amplitude of the radiation burst is two times larger than the amplitude of the input radiation field just before its phase shift. This burst was explained by Helisto et al. as a result of constructive interference of the coherently scattered field with the phase-shifted input field, both having almost the same amplitude. We found that out of resonance the scattered radiation field acquires an additional component with almost the same amplitude as the amplitude of the incident radiation field. The phase of the additional field depends on the optical thickness of the absorber and resonant detuning. Far from resonance this field interferes destructively with the phase-shifted incident radiation field and radiation quenching is observed. Close to resonance the three fields interfere constructively and the amplitude of the radiation burst is three times larger than the amplitude of the input radiation field.

  7. Curcumin Regulates Low-Linear Energy Transfer {gamma}-Radiation-Induced NF{kappa}B-Dependent Telomerase Activity in Human Neuroblastoma Cells

    SciTech Connect

    Aravindan, Natarajan; Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh; Herman, Terence S.; Natarajan, Mohan

    2011-03-15

    Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NF{kappa}B regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NF{kappa}B-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NF{kappa}B-dependent regulation was investigated either by luciferase reporter assays using pNF{kappa}B-, pGL3-354-, pGL3-347-, or pUSE-I{kappa}B{alpha}-Luc, p50/p65, or RelA siRNA-transfected cells. NF{kappa}B activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NF{kappa}B. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NF{kappa}B becomes functionally activated after IR and mediates TA upregulation by binding to the {kappa}B-binding region in the promoter region of the TERT gene. Consistently, elimination of the NF{kappa}B-recognition site on the telomerase promoter or inhibition of NF{kappa}B by the I{kappa}B{alpha} mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NF{kappa}B overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results strongly suggest that curcumin inhibits IR-induced TA in an NF{kappa}B dependent manner in human neuroblastoma cells.

  8. Primary stress responses in Arabidopsis thaliana exposed to gamma radiation.

    PubMed

    Vanhoudt, Nathalie; Horemans, Nele; Wannijn, Jean; Nauts, Robin; Van Hees, May; Vandenhove, Hildegarde

    2014-03-01

    As the environment is inevitably exposed to ionizing radiation from natural and anthropogenic sources, it is important to evaluate gamma radiation induced stress responses in plants. The objective of this research is therefore to investigate radiation effects in Arabidopsis thaliana on individual and subcellular level by exposing 2-weeks-old seedlings for 7 days to total doses of 3.9 Gy, 6.7 Gy, 14.8 Gy and 58.8 Gy and evaluating growth, photosynthesis, chlorophyll a, chlorophyll b and carotenoid concentrations and antioxidative enzyme capacities. While the capacity of photosystem II (PSII measured as Fv/Fm) remained intact, plants started optimizing their photosynthetic process at the lower radiation doses by increasing the PSII efficiency (φPSII) and the maximal electron transport rate (ETRmax) and by decreasing the non-photochemical quenching (NPQ). At the highest radiation dose, photosynthetic parameters resembled those of control conditions. On subcellular level, roots showed increased superoxide dismutase (SOD) and ascorbate peroxidase (APX) capacities under gamma irradiation but catalase (CAT), syringaldazine peroxidase (SPX) and guaiacol peroxidase (GPX) activities, on the other hand, decreased. In the leaves no alterations were observed in SOD, CAT and SPX capacities, but GPX was highly affected. Based on these results it seems that roots are more sensitive for oxidative stress under gamma radiation exposure than leaves. PMID:24333636

  9. Gamma Radiation from PSR B1055-52

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Bailes, M.; Bertsch, D. L.; Cordes, J.; DAmico, N. D.; Esposito, J. A.; Finley, J.; Hartman, R. C.; Hermsen, W.; Kanbach, G.; Kaspi, V. M.; Kniffen, D. A.; Kuiper, L.; Lin, Y. C.; Lyne, A.; Manchester, R.; Matz, S. M.; Mayer-Hasselwander, H. A.; Michelson, P. F.; Nolan, P. L.

    1998-01-01

    The telescopes on the Compton Gamma Ray Observatory (CCRO) have observed PSR B1055-52 a number of times between 1991 and 1998. From these data, a more detailed picture of the gamma radiation from this source has been developed, showing several characteristics which distinguish this pulsar: the light curve is complex; there is no detectable unpulsed emission; the energy spectrum is flat, with no evidence of a sharp high-energy cutoff up to greater than 4 GeV. Comparisons of the gamma-ray data with observations at longer wavelengths show that no two of the known gamma-ray pulsars have quite the same characteristics; this diversity makes interpretation in terms of theoretical models difficult.

  10. Gamma Radiation from PSR B1055-52

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Bailes, M.; Bertsch, D. L.; Cordes, J.; DAmico, N.; Esposito, J. A.; Finley, J.; Hartman, R. C.; Hermsen, W.; Kanbach, G.; Kaspi, V. M.; Kniffen, D. A.; Kuiper, L.; Lin, Y. C.; Lyne, A.; Manchester, R.; Matz, S. M.; Mayer-Hasselwander, H. A.; Michelson, P. F.; Nolan, P. L.

    1999-01-01

    The telescopes on the Compton Gamma Ray Observatory (CGRO) have observed PSR B1055-52 a number of times between 1991 and 1998. From these data, a more detailed picture of the gamma radiation from this source has been developed, showing several characteristics which distinguish this pulsar: the light curve is complex; there is no detectable unpulsed emission; the energy spectrum is flat, with no evidence of a sharp high-energy cutoff up to greater than 4 GeV. Comparisons of the gamma-ray data with observations at longer wavelengths show that no two of the known gamma-ray pulsars have quite the same characteristics; this diversity makes interpretation in terms of theoretical models difficult.

  11. GAMMA RADIATION TREATMENT OF WATERS FROM LIGNITE MINES

    EPA Science Inventory

    Discussed in this report are results of laboratory investigations carried out with the application of gamma radiation for the purification of waters drained from surface lignite mines. These waters are polluted to a considerable extent with suspended matter of various sizes, a la...

  12. Carbon Nanotubes Synthesis Through Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Tirado, Pablo; Garcia, Rafael; Montes, Jorge; Melendrez, Rodrigo; Barboza, Marcelino; Contreras, Oscar

    2015-03-01

    Carbon nanotubes show a great potential of applications since there discovery by Iijima in 1991[1] due to their numerous physical-chemical properties such as their high weight to strength relationship, which make them ideal to use in high resistance compound materials, and in many other applications[2] In this work, a novel method for the synthesis of carbon nanotubes is presented, starting from an ultra-thin sheet of graphite synthesized by the chemical vapor decomposition technique (CVD), using ultra high purity methane and hydrogen at 1200C in a horizontal quartz reactor. For the synthesis of carbon nanotubes, the graphite sheets were exposed to different doses of radiation, with the objective of breaking the graphite bonds and form carbon nanotubes; a Gammacell equipment model 220 Excel was used for the purpose, which counts with a radiation source of cobalt 60, and a current radiation rate of 0.9 Gy/seconds. The time of exposure to radiation was varied in each sample, according to the desired dose of radiation in each case, afterwards the samples were characterized using the Raman spectroscopy and TEM microscopy techniques with the objective of observing the kind of nanotubes formed, their morphology and their number of defects. Results will be shown during the poster session.

  13. Bioburden assessment and gamma radiation inactivation patterns in parchment documents

    NASA Astrophysics Data System (ADS)

    Nunes, Ins; Mesquita, Nuno; Cabo Verde, Sandra; Carolino, Maria Manuela; Portugal, Antnio; Botelho, Maria Lusa

    2013-07-01

    Parchment documents are part of our cultural heritage and, as historical artifacts that they are, should be preserved. The aim of this study was to validate an appropriate methodology to characterize the bioburden of parchment documents, and to assess the growth and gamma radiation inactivation patterns of the microbiota present in that material. Another goal was to estimate the minimum gamma radiation dose (Dmin) to be applied for the decontamination of parchment as an alternative treatment to the current toxic chemical and non-chemical decontamination methods. Two bioburden assessment methodologies were evaluated: the Swab Method (SM) and the Destructive Method (DM). The recovery efficiency of each method was estimated by artificial contamination, using a Cladosporium cladosporioides spore suspension. The parchment samples' microbiota was typified using morphological methods and the fungal isolates were identified by ITS-DNA sequencing. The inactivation pattern was assessed using the DM after exposure to different gamma radiation doses, and using C. cladosporioides as reference. Based on the applied methodology, parchment samples presented bioburden values lower than 5103 CFU/cm2 for total microbiota, and lower than 10 CFU/cm2 for fungal propagules. The results suggest no evident inactivation trend for the natural parchment microbiota, especially regarding the fungal community. A minimum gamma radiation dose (Dmin) of 5 kGy is proposed for the decontamination treatment of parchment. Determining the minimal decontamination dose in parchment is essential for a correct application of gamma radiation as an alternative decontamination treatment for this type of documents avoiding the toxicity and the degradation promoted by the traditional chemical and non-chemical treatments.

  14. Radiation effect on silicon transistors in mixed neutrons-gamma environment

    NASA Astrophysics Data System (ADS)

    Assaf, J.; Shweikani, R.; Ghazi, N.

    2014-10-01

    The effects of gamma and neutron irradiations on two different types of transistors, Junction Field Effect Transistor (JFET) and Bipolar Junction Transistor (BJT), were investigated. Irradiation was performed using a Syrian research reactor (RR) (Miniature Neutron Source Reactor (MNSR)) and a gamma source (Co-60 cell). For RR irradiation, MCNP code was used to calculate the absorbed dose received by the transistors. The experimental results showed an overall decrease in the gain factors of the transistors after irradiation, and the JFETs were more resistant to the effects of radiation than BJTs. The effect of RR irradiation was also greater than that of gamma source for the same dose, which could be because neutrons could cause more damage than gamma irradiation.

  15. Impact of gamma-radiation on antigenic properties of cow's milk beta-lactoglobulin.

    PubMed

    Kaddouri, H; Mimoun, S; El-Mecherfi, K E; Chekroun, A; Kheroua, O; Saidi, D

    2008-06-01

    This study evaluated the effects of gamma-radiation on the antigenic properties of beta-lactoglobulin in cow's milk. Liquid and lyophilized samples of cow's milk and whey were irradiated with gamma-cells (60Co) at dose levels of 3, 5, and 10 kGy, at room temperature in the presence of air. Effects of treatment on proteins were monitored by Lowry's method, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and enzyme-linked immunosorbent assay. Radiation did not affect the molecular-weight distributions of proteins, but it did reduce their solubility. Furthermore, results showed that irradiation at 10 kGy increased the recognition of milk and whey powders by anti-beta-lactoglobulin (beta-Lg) rabbit immunoglobulin G, with the other samples remaining antigenically stable. These results indicate that gamma-rays do not reduce cow's milk beta-lactoglobulin antigenicity. PMID:18592759

  16. Rheology of Indian Honey: Effect of Temperature and Gamma Radiation

    PubMed Central

    Panicker, Lata; Gautam, Satyendra

    2014-01-01

    Honey brands commonly available in Indian market were characterized for their rheological and thermal properties. Viscosity of all the honey samples belonging to different commercial brands was found to decrease with increase in temperature (5–40°C) and their sensitivity towards temperature varied significantly as explained by calculating activation energy based on Arrhenius model and ranged from 54.0 to 89.0 kJ/mol. However, shear rate was not found to alter the viscosity of honey indicating their Newtonian character and the shear stress varied linearly with shear rate for all honey samples. Honey is known to contain pathogenic microbial spores and in our earlier study gamma radiation was found to be effective in achieving microbial decontamination of honey. The effect of gamma radiation (5–15 kGy) on rheological properties of honey was assessed, and it was found to remain unchanged upon radiation treatment. The glass transition temperatures (Tg) of these honey analyzed by differential scanning calorimetry varied from −44.1 to −54.1°C and remained unchanged upon gamma radiation treatment. The results provide information about some key physical properties of commercial Indian honey. Radiation treatment which is useful for ensuring microbial safety of honey does not alter these properties. PMID:26904655

  17. Gamma radiation from pulsar magnetospheric gaps

    NASA Technical Reports Server (NTRS)

    Chiang, James; Romani, Roger W.

    1992-01-01

    We investigate the production of gamma rays in two pulsar emission models: the 'polar cap' model and the 'outer cap' model. For the former, we have performed detailed simulations of energetic electrons flowing in the vacuum dipole open field line region. In the outer gap case, we generate light curves for various magnetosphere geometries. Using data from radio and optical observations, we construct models for specific viewing angles appropriate to the Crab and Vela pulsars. Phase-resolved spectra are also computed in the polar cap case and provide signatures for testing the models. The calculations have been extended to include millisecond pulsars, and we have been able to predict fluxes and spectra for populations of recycled pulsars, which are compared to COS B data for globular cluster populations.

  18. 77 FR 62267 - Proposed Extension of Existing Information Collection; Gamma Radiation Surveys

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-12

    ... underground mines where radioactive ores are mined. 30 CFR 57.5047(c) requires that gamma radiation dosimeters... Safety and Health Administration Proposed Extension of Existing Information Collection; Gamma Radiation...: I. Background Gamma radiation occurs where radioactive materials are present. It has been...

  19. A study of the diffuse galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Kniffen, D. A.

    1984-01-01

    The observed diffuse galactic gamma radiation is compared to that predicted from galactic cosmic ray interactions with galactic matter and photons, assuming that on a broad scale the galactic cosmic rays in the plane are correlated with matter density. Recent considerations of the galactic diffuse matter distribution, particularly the molecular hydrogen, the galactic photon density, and a revised cosmic ray galactic scale height, are included. The predictions are compared to the observational gamma ray longitude distributions, the latitude distribution, and energy spectrum, including the COS-B satellite results, and the COS-B background estimate. Considering the uncertainties, the agreement between the theoretical predictions and the gamma ray data seems generally reasonable, suggesting that the general concepts are likely to be correct. Both the results determined here alone and in conjunction with other work calculating source functions assuming only cosmic ray matter contributions indicate no necessity for a significant point source contribution to the diffuse gamma radiation in the energy range being considered (E(gamma)10 MeV). Previously announced in STAR as N84-18151

  20. A study of the diffuse galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Kniffen, D. A.

    1984-01-01

    The observed diffuse galactic gamma radiation is compared to that predicted from galactic cosmic ray interactions with galactic matter and photons, assuming that on a broad scale the galactic cosmic rays in the plane are correlated with matter density. Recent considerations of the galactic diffuse matter distribution, particularly the molecular hydrogen, the galactic photon density, and a revised cosmic ray galactic scale height, are included. The predictions are compared to the observational gamma ray longitude distributions, the latitude distribution, and energy spectrum, including the COS-B satellite results, and the COS-B background estimate. Considering the uncertainties, the agreement between the theoretical predictions and the gamma ray data seems generally reasonable, suggesting that the general concepts are likely to be correct. Both the results determined here alone and in conjunction with other work calculating source functions assuming only cosmic ray matter contributions indicate no necessity for a significant point source contribution to the diffuse gamma radiation in the energy range being considered (E(gamma)10 MeV).

  1. Effects of gamma radiation on spermatogenesis and fertility of male Amblyomma americanum (Acari: Ixodidae)

    SciTech Connect

    Oliver, J.H. Jr.; Stanley, M.A.

    1987-04-01

    Amblyomma americanum males were treated with 0.5, 1, 2, 3, 4, 8, and 16 krad of gamma radiation. Testes of ticks treated with 2, 3, 4, 8, and 16 krad were smaller than those of ticks irradiated at lower levels and controls. No recognizable alteration in timing of spermatogenesis was noted among the different radiation groups, but severe breakdown and depletion of germinal cells was noted at 4, 8, and 16 krad. Percent hatch of larvae from crosses of irradiated males and untreated females decreased with increasing radiation level. No hatch was observed from eggs of females mated to males treated at 2 krad or higher.

  2. Characterization of commercial proton exchange membrane materials after exposure to beta and gamma radiation

    SciTech Connect

    Thomson, S.N.; Carson, R.; Muirhead, C.; Li, H.; Castillo, I.; Boniface, H.; Suppiah, S.; Ratnayake, A.; Robinson, J.

    2015-03-15

    Proton Exchange Membrane (PEM) type electrolysis cells have a potential use for tritium removal and heavy water upgrading. AECL is currently exposing various commercial PEM materials to both gamma (Cobalt-60 source) and beta (tritiated water) radiation to study the effects of radiation on these materials. This paper summarizes the testing methods and results that have been collected to date. The PEM materials that are or have been exposed to radiation are: Nafion 112, 212, 117 and 1110. Membrane characterization pre- and post- exposure consists of non-destructive inspection (FTIR, SEM/XPS), mechanical (tensile strength, percentage elongation, and modulus), electrical (resistance), or chemical (ion-exchange capacity - IEC). It has appeared that the best characterization techniques to compare exposed versus unexposed membranes were IEC, ultimate tensile strength and percent elongation. These testing techniques are easy and cheap to perform. The non-destructive tests, such as SEM and FTIR did not provide particularly useful information on radiation-induced degradation. Where changes in material properties were measured after radiation exposure, they would be expected to result in poorer cell performance. However, for modest γ-radiation exposure, all membranes showed a slight decrease in cell voltage (better performance). In contrast, the one β-radiation exposed membrane did show the expected increase in cell voltage. The counterintuitive trend for γ-radiation exposed membranes is not yet understood. Based on these preliminary results, it appears that γ- and β-radiation exposures have different effects.

  3. Gamma radiation survey of the LDEF spacecraft

    NASA Technical Reports Server (NTRS)

    Phillips, G. W.; King, S. E.; August, R. A.; Ritter, J. C.; Cutchin, J. H.; Haskins, P. S.; Mckisson, J. E.; Ely, D. W.; Weisenberger, A. G.; Piercey, R. B.

    1991-01-01

    The retrieval of the Long Duration Exposure Facility (LDEF) spacecraft after nearly 6 years in orbit offered a unique opportunity to study the long term buildup of induced radioactivity in the variety of materials on board. The first complete gamma ray survey was conducted of a large spacecraft on LDEF shortly after its return to Earth. A surprising observation was the large Be-7 activity which was seen primarily on the leading edge of the satellite, implying that it was picked up by LDEF in orbit. This is the first known evidence for accretion of a radioactive isotope onto an orbiting spacecraft. Other isotopes seen during the survey, the strongest being Na-22 and Mn-54, are all attributed to activation of spacecraft components in orbit. Be-7 is a spallation product of cosmic rays on nitrogen and oxygen in the upper atmosphere. However, the observed density is much greater than expected due to cosmic ray production in situ. This implies transport of Be-7 from much lower altitudes up to the LDEF orbit.

  4. Gamma radiation survey of the LDEF spacecraft

    NASA Technical Reports Server (NTRS)

    Phillips, G. W.; King, S. E.; August, R. A.; Ritter, J. C.; Cutchin, J. H.; Haskins, P. S.; Mckisson, J. E.; Ely, D. W.; Weisenberger, A. G.; Piercey, R. B.

    1992-01-01

    The retrieval of the Long Duration Exposure Facility spacecraft in January 1990 after nearly six years in orbit offered a unique opportunity to study the long term buildup of induced radioactivity in the variety of materials on board. We conducted the first complete gamma-ray survey of a large spacecraft on LDEF shortly after its return to earth. A surprising observation was the Be-7 activity which was seen primarily on the leading edge of the satellite, implying that it was picked up by LDEF in orbit. This is the first known evidence for accretion of a radioactive isotope onto an orbiting spacecraft. Other isotopes observed during the survey, the strongest being Na-22, are all attributed to activation of spacecraft components. Be-7 is a spallation product of cosmic rays on nitrogen and oxygen in the upper atmosphere. However, the observed density is much greater than expected due to cosmic-ray production in situ. This implies transport of Be-7 from much lower altitudes up to the LDEF orbit.

  5. Characterization of an Escherichia coli mutant (radB101) sensitive to. gamma. and uv radiation, and methyl methanesulfonate

    SciTech Connect

    Sargentini, N.J.; Smith, K.C.

    1983-03-01

    After N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis of Escherichia coli K-12 (xthA14), an X-ray-sensitive mutant was isolated. This sensitivity is due to a mutation, radB101, which is located at 56.5 min on the E.coli K-12 linkage map. The radB101 mutation sensitized wild-type cells to ..gamma.. and uv radiation, and to methyl methanesulfonate. When known DNA repair-deficient mutants were ranked for their ..gamma..-radiation sensitivity relative to their uv-radiation sensitivity, their order was (starting with the most selectively ..gamma..-radiation-sensitive strain): recB21, radB101, wild type, polA1, recF143, lexA101, recA56, uvrD3, and uvrA6. The radB mutant was normal for ..gamma..- and uv-radiation mutagenesis, it showed only a slight enhancement of ..gamma..- and uv-radiation-induced DNA degradation, and it was approx. 60% deficient in recombination ability. The radB gene is suggested to play a role in the recA gene-dependent (Type III) repair of DNA single-strand breaks after ..gamma.. irradiation and in postreplication repair after uv irradiation for the following reasons: the radB strain was normal for the host-cell reactivation of ..gamma..- and uv-irradiated bacteriophage lambda; the radB mutation did not sensitize a recA strain, but did sensitize a polA strain to ..gamma.. and uv radiation; the radB mutation sensitized a uvrB strain to uv radiation.

  6. Effects of ionizing radiations on bacterial endotoxins: Comparison between gamma radiations and accelerated electrons

    NASA Astrophysics Data System (ADS)

    Guyomard, S.; Goury, V.; Darbord, J. C.

    Determinations of the effect of radiation sterilization processing on purified endotoxins, in aqueous solution or on dried support, are reported. These observations allow us to accept gamma radiations for sterilization of parenteral devices with an estimated probability of existence of non apyrogenic items, based upon a similar definition of the usual Sterility Assurance Level SAL = 10 -6).

  7. Thermal stability of grafted fibers. [Gamma radiation

    SciTech Connect

    Sundardi, F.; Kadariah; Marlianti, I.

    1983-10-01

    Presented the experimental results on the study of thermal stability of grafted fibers, i.e., polypropylene-, polyester-, and rayon-grafted fibers. These fibers were obtained by radiation grafting processes using hydrophylic monomers such as 1-vinyl 2-pyrolidone, acrylic acid, N-methylol acrylamide, and acrylonitrile. The thermal stability of the fibers was studied using a Shimadzu Thermal Analyzer DT-30. The thermal stability of the fibers, which can be indicated by the value of the activation energy for thermal degradation, was not improved by radiation grafting. The degree of improvement depends on the thermal stability of the monomers used for grafting. The thermal stability of a polypropylene fiber, either a grafted or an ungrafted one, was found to be inferior compared to the polyester of a rayon fiber, which may be due to the lack of C=O and C=C bonds in the polypropylene molecules. The thermal stability of a fiber grafted with acrylonitrile monomer was found to be better than that of an ungrafted one. However, no improvement was detected in the fibers grafted with 1-vinyl 2-pyrrolidone monomer, which may be due to the lower thermal stability of poly(1-vinyl-2-pyrrolidone), compared to the polypropylene or polyester fibers. 17 figures, 3 tables.

  8. Analytical modeling for gamma radiation damage on silicon photodiodes

    NASA Astrophysics Data System (ADS)

    Jafari, H.; Feghhi, S. A. H.

    2016-04-01

    Radiation-induced damage in PIN silicon photodiode induces degradation of the photodiode parameters. In this work, by presenting an analytical model, the effect of gamma dose on the dark current in a PIN photodiode array was investigated. Geant4 was used to obtain the damage constant as a result of primary incident particle fluence and NIEL distribution calculations. Experimental measurements as well as numerical simulation of the semiconductor with ATLAS were carried out to verify and parameterize the analytical model calculations. A reasonable agreement has been found between analytical results and experimental data for BPX65 silicon photodiodes irradiated by a Co-60 gamma source at total doses up to 500 krad under different reverse voltages. Moreover, the results showed that the dark current of each photodiode array pixel has considerably increased by gamma dose irradiation.

  9. Characterization of gamma radiation inducible thioredoxin h from Spirogyra varians.

    PubMed

    Yoon, Minchul; Yang, Ho-Yeon; Lee, Seung-Sik; Kim, Dong-Ho; Kim, Gwang-Hoon; Choi, Jong-il

    2013-08-15

    In this study, thioredoxin h (Trxh) was isolated and characterized from the fresh water green alga Spirogyra varians, which was one amongst the pool of proteins induced upon gamma radiation treatment. cDNA clones encoding S. varians thioredoxin h were isolated from a pre-constructed S. varians cDNA library. Trxh had a molecular mass of 13.5kDa and contained the canonical WCGPC active site. Recombinant Trxh showed the disulfide reduction activity, and exhibited insulin reduction activity. Also, Trxh had higher 5,5'-dithiobis(2-nitrobenzoic acid) reduction activity with Arabidopsis thioredoxin reductase (TR) than with Escherichia coli TR. Specific expression of the Trxh gene was further analyzed at mRNA and protein levels and was found to increase by gamma irradiation upto the absorbed dose of 3kGy, suggesting that Trxh may have potential functions in protection of biomolecules from gamma irradiation. PMID:23830452

  10. Optical Sensors for Monitoring Gamma and Neutron Radiation

    NASA Technical Reports Server (NTRS)

    Boyd, Clark D.

    2011-01-01

    For safety and efficiency, nuclear reactors must be carefully monitored to provide feedback that enables the fission rate to be held at a constant target level via adjustments in the position of neutron-absorbing rods and moderating coolant flow rates. For automated reactor control, the monitoring system should provide calibrated analog or digital output. The sensors must survive and produce reliable output with minimal drift for at least one to two years, for replacement only during refueling. Small sensor size is preferred to enable more sensors to be placed in the core for more detailed characterization of the local fission rate and fuel consumption, since local deviations from the norm tend to amplify themselves. Currently, reactors are monitored by local power range meters (LPRMs) based on the neutron flux or gamma thermometers based on the gamma flux. LPRMs tend to be bulky, while gamma thermometers are subject to unwanted drift. Both electronic reactor sensors are plagued by electrical noise induced by ionizing radiation near the reactor core. A fiber optic sensor system was developed that is capable of tracking thermal neutron fluence and gamma flux in order to monitor nuclear reactor fission rates. The system provides near-real-time feedback from small- profile probes that are not sensitive to electromagnetic noise. The key novel feature is the practical design of fiber optic radiation sensors. The use of an actinoid element to monitor neutron flux in fiber optic EFPI (extrinsic Fabry-Perot interferometric) sensors is a new use of material. The materials and structure used in the sensor construction can be adjusted to result in a sensor that is sensitive to just thermal, gamma, or neutron stimulus, or any combination of the three. The tested design showed low sensitivity to thermal and gamma stimuli and high sensitivity to neutrons, with a fast response time.

  11. Self-occluding quad NaI directional gamma radiation detector for standoff radiation detection

    NASA Astrophysics Data System (ADS)

    Portnoy, David; Mattson, John

    2011-09-01

    Currently there is a significant amount of interest in standoff radiation detection. One of the biggest challenges is to separate small radiation signals from large varying background radiation. Many systems have been developed to address this problem that rely on coded-aperture and/or Compton imaging. These imaging systems tend to be large, heavy, complex, and therefore expensive. In this paper we report on the development of a self-occluding directional gamma radiation sensor that is relatively small (<40 kg), inexpensive, and simple in design. Laboratory and field measurements suggest that these sensors will work as well as the gamma imaging systems for many radiation detection applications at a fraction of the cost, weight, and complexity. An azimuth can be resolved with a standard deviation of 7 in 10 seconds for a source yielding 45 CPS at the detector in a 300 CPS background radiation field. This paper describes the self-occluding quad NaI directional gamma radiation detector, the impact of gamma energy and distance on angular precision and accuracy, and potential applications.

  12. Titanium-Water Thermosyphon Gamma Radiation Exposure and Results

    NASA Technical Reports Server (NTRS)

    Sanzi, James, L.A; Jaworske, Donald, A.; Goodenow, Debra, A.

    2012-01-01

    Titanium-water thermosyphons are being considered for use in heat rejection systems for fission power systems. Their proximity to the nuclear reactor will result in some gamma irradiation. Noncondensable gas formation from radiation-induced breakdown of water over time may render portions of the thermosyphon condenser inoperable. A series of developmental thermosyphons were operated at nominal operating temperature under accelerated gamma irradiation, with exposures on the same order of magnitude as that expected in 8 years of heat rejection system operation. Temperature data were obtained during exposure at three locations on each thermosyphon: evaporator, condenser, and condenser end cap. Some noncondensable gas was evident; however, thermosyphon performance was not affected because the noncondensable gas was compressed into the fill tube region at the top of the thermosyphon, away from the heat rejecting fin. The trend appeared to be an increasing amount of noncondensable gas formation with increasing gamma irradiation dose. Hydrogen is thought to be the most likely candidate for the noncondensable gas and hydrogen is known to diffuse through grain boundaries. Post-exposure evaluation of one thermosyphon in a vacuum chamber and at temperature revealed that the noncondensable gas diffused out of the thermosyphon over a relatively short period of time. Further research shows a number of experimental and theoretical examples of radiolysis occurring through gamma radiation alone in pure water.

  13. Titanium-Water Thermosyphon Gamma Radiation Effects and Results

    NASA Technical Reports Server (NTRS)

    Sanzi, James L.; Jaworske, Donald A.; Goodenow, Debra A.

    2012-01-01

    Titanium-water thermosyphons are being considered for use in heat rejection systems for fission power systems. Their proximity to the nuclear reactor will result in some exposure to gamma irradiation. Non-condensable gas formation from radiation may breakdown water over time and render a portion of the thermosyphon condenser inoperable. A series of developmental thermosyphons were operated at nominal operating temperature with accelerated gamma irradiation exposures on the same order of magnitude that is expected in eight years of heat rejection system operation. Temperature data were obtained during exposure at three locations on each thermosyphon; evaporator, condenser, and condenser end cap. Some non-condensable gas was evident, however thermosyphon performance was not affected because the non-condensable gas was compressed into the fill tube region at the top of the thermosyphon, away from the heat rejecting fin. The trend appeared to be an increasing amount of non-condensable gas formation with increasing gamma irradiation dose. Hydrogen is thought to be the most likely candidate for the non-condensable gas and hydrogen is known to diffuse through grain boundaries. Post-exposure evaluation of selected thermosyphons at temperature and in a vacuum chamber revealed that the non-condensable gas likely diffused out of the thermosyphons over a relatively short period of time. Further research shows a number of experimental and theoretical examples of radiolysis occurring through gamma radiation alone in pure water.

  14. The Gamma-ray galactic diffuse radiation and Cerenkov telescopes

    SciTech Connect

    Chardonnet, P.; Salati, P.; Silk, J.; Grenier, I.; Smoot, G.

    1995-12-01

    By using the PYTHIA version of the Lund Monte Carlo program, we study the photon yield of proton-proton collisions in the energy range between 10 GeV and 1 TeV. The resulting photon spectrum turns out to scale roughly with incident energy. Then, by folding the energy spectrum of cosmic-ray protons with the distribution of HI and CO, the Galactic diffuse emission of {gamma}-rays above 100 GeV is mapped. Prospects for observing that diffuse radiation with atmospheric Cerenkov telescopes are discussed. Present instruments are able to detect the {gamma}-ray glow of the Galactic center. The latter will be mapped by the next generation of telescopes if their energy threshold is decreased. However, a detailed survey of the Galactic ridge will be a real challenge, even in the long term. The MILAGRO project seems more appropriate. Finally, we investigate the {gamma}-ray emission from weakly interacting massive particles clustering at the Galactic center. It has been speculated that those species are a major component of the halo dark matter. We show that their {gamma}-ray signal is swamped in the Galactic diffuse radiation and cannot be observed at TeV energies. {copyright} {ital 1995 The American Astronomical Society.}

  15. Gamma radiation from the Crab and Vela pulsars

    NASA Technical Reports Server (NTRS)

    Kanbach, Gottfried

    1990-01-01

    The young pulsars in Crab and Vela were observed as very efficient emitters of high energy gamma radiation. While their radiation in the radio, optical, and x ray range was always known to differ considerably, the gamma ray emission on a superficial level appears quite similar: lightcurves with two narrow peaks, separated by 141 deg (Crab) and 153 deg (Vela) and photon energies in excess of 1 GeV with spectra that can be described by a power-law for Crab and a broken power-law for Vela. The detailed observations of these sources with the COS-B instrument, extending over nearly seven years, have revealed significant differences in the characteristics of the pulsars in the gamma-ray domain. Secular changes in the temporal (Crab) and spectral (Vela) properties above 50 MeV were found. These tantalizing signatures of the pulsar emission processes must now be explored in more detail and over a larger spectral range with the GRO (Gamma Ray Observatory) instruments in order to gain a deeper understanding of the physics of young neutron stars.

  16. Airborne gamma radiation soil moisture measurements over short flight lines

    NASA Technical Reports Server (NTRS)

    Peck, Eugene L.; Carrol, Thomas R.; Lipinski, Daniel M.

    1990-01-01

    Results are presented on airborne gamma radiation measurements of soil moisture condition, carried out along short flight lines as part of the First International Satellite Land Surface Climatology Project Field Experiment (FIFE). Data were collected over an area in Kansas during the summers of 1987 and 1989. The airborne surveys, together with ground measurements, provide the most comprehensive set of airborne and ground truth data available in the U.S. for calibrating and evaluating airborne gamma flight lines. Analysis showed that, using standard National Weather Service weights for the K, Tl, and Gc radiation windows, the airborne soil moisture estimates for the FIFE lines had a root mean square error of no greater than 3.0 percent soil moisture. The soil moisture estimates for sections having acquisition time of at least 15 sec were found to be reliable.

  17. Modification of microcrystalline cellulose by gamma radiation-induced grafting

    NASA Astrophysics Data System (ADS)

    Madrid, Jordan F.; Abad, Lucille V.

    2015-10-01

    Modified microcrystalline cellulose (MCC) was prepared through gamma radiation-induced graft polymerization of glycidyl methacrylate (GMA). Simultaneous grafting was employed wherein MCC with GMA in methanol was irradiated with gamma radiation in nitrogen atmosphere. The effects of different experimental factors such as monomer concentration, type of solvent and absorbed dose on the degree of grafting, Dg, were studied. The amount of grafted GMA, expressed as Dg, was determined gravimetrically. Information from grafted samples subjected to Fourier transformed infrared spectroscopy (FTIR) in attenuated total reflectance (ATR) mode showed peaks corresponding to GMA which indicates successful grafting. The X-ray diffraction (XRD) analysis revealed that the crystalline region of MCC was not adversely affected after grafting with GMA. The thermogravimetric analysis (TGA) data showed that the decomposition of grafted MCC occurred at higher temperature compared to the base MCC polymer.

  18. Characterization of muon and gamma radiations at the PTOLEMY site

    NASA Astrophysics Data System (ADS)

    Betts, Susannah; Gentile, Charles; Tully, Chris; Zapata, Sandra; Chris Tully Collaboration

    2013-10-01

    PTOLEMY is an experimental project at Princeton Plasma Physics Laboratory designed to determine the present day number density of relic neutrinos through measurement of electrons produced from neutrino capture on tritium. The weak interaction cross section for relic neutrino interactions necessitates high sensitivity measurements that could be influenced by high energy particles, like muons and gamma ray photons, which induce nuclear transitions and secondary electrons. Muons produced from the collision of cosmic rays with atmospheric nuclei are a significant source of background radiation at and below Earth's surface. The muon flux is measured by the coincidence of minimum ionization radiation loss in two plastic scintillator paddles. The spectrum of gamma ray photons is measured using sodium iodide based scintillators. These measurements will provide a characterization of the background and rates at the PTOLEMY site.

  19. A hemispherical high-pressure xenon gamma radiation spectrometer

    NASA Astrophysics Data System (ADS)

    Kessick, Royal; Tepper, Gary

    2002-09-01

    A prototype hemispherical high-pressure xenon gamma radiation spectrometer was designed, constructed and tested. The detector consists of a pair of concentric hemispherical electrodes contained inside a thin-walled stainless steel pressure dome. Detector performance parameters such as energy resolution, linearity and vibration sensitivity were determined and compared to previous cylindrical and planar designs. Without a Frisch grid, the hemispherical detector provides a total room temperature energy resolution of 6% @ 662 keV and is relatively insensitive to acoustic interference.

  20. Effects of gamma-Radiation on Select Lipids and Antioxidants

    NASA Technical Reports Server (NTRS)

    Gandolph, Jacob; Mauer, Lisa; Perchonok, Michele

    2006-01-01

    Radiation encountered on an extended duration space mission (estimates of 3 Sieverts for a mission to Mars) poses a threat not only to human health, but also to the quality, nutritional value, and palatability of the food system. Free radicals generated by radiation interaction with foods may initiate many unwanted reactions including: 1) autoxidation in lipids that alters flavor, odor, and concentrations of essential fatty acids, and 2) depletion of antioxidants food products and dietary supplements. Studies have shown that antioxidants may provide long term health protection from oxidative stress caused by radiation exposure; therefore, consumption of antioxidants will be important. Stability of essential fatty acids is also important for astronauts long-term health status. The objectives of this study were to characterize the effects of low dose gamma-radiation on lipids and antioxidants by monitoring oxidation and reducing power, respectively, in model systems. Select oils and antioxidants were exposed to levels of gamma-radiation ranging from 0 to 1000 Gy (1 Gy = 1 Sv) using a Gammacell 220 and stored at ambient or elevated temperatures (65 C) for up to 3 months prior to analysis. A Fricke dosimeter was used to verify differences between the radiation doses administered. Primary and secondary products of lipid oxidation in soybean and peanut oils were monitored using conjugated diene and 2-thiobarbituric acid (TBARs) assays. Changes in fatty acid composition and formation and vitamin E levels were also measured. The reducing power of antioxidant compounds, including vitamins C and E and beta-carotene, was determined using the ferric reducing antioxidant power (FRAP) assay. Significant differences (alpha =0.05) were present between all radiation doses tested using the Fricke dosimeter. Increasing radiation doses above 3 Sv resulted in significantly (alpha =0.05) elevated levels of oxidation and free fatty acids in soybean and peanut oils. Decreases in concentrations of essential fatty acids upon increasing radiation doses were also observed. Increasing radiation doses caused significant (alpha =0.05) decreases in reducing power and hence the effectiveness of vitamins C and E as well as beta-carotene. This work establishes a need for quantifying the effects of space relevant radiation doses in the development of a food system for an extended duration mission and for identifying threshold radiation levels that will impact the useful shelf-life of the variety of foods that will be sent. Eventual rancidity of lipids and the loss of antioxidant bioprotective effects are major concerns for the acceptability and nutritional profile of a food system.

  1. Effects of proton and gamma radiation on lymphocyte populations and acute response to antigen

    NASA Technical Reports Server (NTRS)

    Kajioka, E. H.; Gheorghe, C.; Andres, M. L.; Abell, G. A.; Folz-Holbeck, J.; Slater, J. M.; Nelson, G. A.; Gridley, D. S.

    1999-01-01

    BACKGROUND: The clinical use of proton radiation in the management of cancer, as well as benign disorders, is rapidly increasing. The major goal of this study was to compare the effects of proton and gamma (60Co) radiation on cell-mediated and humoral immunological parameters. MATERIALS AND METHODS: C57BL/6 mice were exposed to a single dose of 3 Gray (Gy) protons or gamma-rays and intraperitoneally injected 1 day later with sheep red blood cells (sRBC). On 4, 10, 15, and 29 days after exposure, subsets from each group were euthanised; nonirradiated controls (with and without sRBC injection) were included. Body and relative spleen weights, leukocyte counts, spontaneous blastogenesis, lymphocyte populations, and anti-sRBC titers were evaluated. RESULTS: The data showed significant depression (p < 0.05) in nearly all assays on days 4 and 10 after irradiation. B lymphocytes (CD19+) were the most radiosensitive, although reconstitution back to normal levels was observed by day 15. T cell (CD3+) and T helper cell (CD4+) recovery was evident by day 29, whereas the T cytotoxic cell (CD8+) count remained significantly below normal. Natural killer cells (NK1.1+) were relatively radioresistant. Anti-sRBC antibody production was slow and low titers were obtained after irradiation. No significant differences were noted between the two types of radiation. CONCLUSIONS: Taken together, the data show that whole-body irradiation with protons or gamma-rays, at the dose employed, results in marked, but transient, immunosuppression. However, at the time points of testing and with the assays used, little or no differences were found between the two forms of radiation.

  2. Coherent Synchrotron Radiation of Gamma-Ray Bursts

    NASA Astrophysics Data System (ADS)

    Gainullin, K. G.; Zlobin, A. M.

    By now there is no doubt that the gamma-ray bursts (GRB) have a cosmological origin. This allows to regard GRB as the most powerful known energy sources, ? 1054 erg (with a total number of gamma quanta N? 1060). A plausible mechanism of coherent synchrotron radiation (CSR) of relativistic electrons driven by a local magnetic field is studied in this paper. We consider relativistic electrons arising in the Compton scattering of a GRB in directions close to that of the ray from the source to a ground-based observer. The synchrotron pulses from Compton electrons located at different points on the line between the GRB source and the observer arrive at the observation point simultaneously. This simultaneity ensures the coherence of the detected radiation. Both molecular clouds in the host galaxy of the GRB and our own Galaxy, as well as the Earth atmosphere are assumed to be scatterers of the GRB radiation. Signals of each scatterer reach the Earth surface, and can be detected at radio wavelengths. We estimate the characteristics of this radiation. The comparison of GRB data with the corresponding information on CSR pulses offers a way to determine some global characteristics of the medium between the Earth and the GRB source.

  3. Coherent Synchrotron Radiation of Gamma-Ray Bursts

    NASA Astrophysics Data System (ADS)

    Gainullin, K. G.; Zlobin, A. M.

    2005-06-01

    By now there is no doubt that the gamma-ray bursts (GRB) have a cosmological origin. This allows to regard GRB as the most powerful known energy sources, ? 1054 erg (with a total number of gamma quanta N_? 1060). A plausible mechanism of coherent synchrotron radiation (CSR) of relativistic electrons driven by a local magnetic field is studied in this paper. We consider relativistic electrons arising in the Compton scattering of a GRB in directions close to that of the ray from the source to a ground-based observer. The synchrotron pulses from Compton electrons located at different points on the line between the GRB source and the observer arrive at the observation point simultaneously. This simultaneity ensures the coherence of the detected radiation. Both molecular clouds in the host galaxy of the GRB and our own Galaxy, as well as the Earth atmosphere are assumed to be scatterers of the GRB radiation. Signals of each scatterer reach the Earth surface, and can be detected at radio wavelengths. We estimate the characteristics of this radiation. The comparison of GRB data with the corresponding information on CSR pulses offers a way to determine some global characteristics of the medium between the Earth and the GRB source.

  4. On the omnipresent background gamma radiation of the continuous spectrum

    NASA Astrophysics Data System (ADS)

    Banjanac, R.; Maleti?, D.; Jokovi?, D.; Veselinovi?, N.; Dragi?, A.; Udovi?i?, V.; Ani?in, I.

    2014-05-01

    The background spectrum of a germanium detector, shielded from the radiations arriving from the lower and open for the radiations arriving from the upper hemisphere, is studied by means of absorption measurements, both in a ground level and in an underground laboratory. The low-energy continuous portion of this background spectrum that peaks at around 100 keV, which is its most intense component, is found to be of very similar shape at the two locations. It is established that it is mostly due to the radiations of the real continuous spectrum, which is quite similar to the instrumental one. The intensity of this radiation is in our cases estimated to about 8000 photons/(m2s2?srad) in the ground level laboratory, and to about 5000 photons/(m2s2?srad) in the underground laboratory, at the depth of 25 m.w.e. Simulations by GEANT4 and CORSIKA demonstrate that this radiation is predominantly of terrestrial origin, due to environmental gamma radiations scattered off the materials that surround the detector (the "skyshine radiation"), and to a far less extent to cosmic rays of degraded energy.

  5. Gamma-ray pulsars: Radiation processes in the outer magnetosphere

    NASA Technical Reports Server (NTRS)

    Romani, Roger W.

    1996-01-01

    We describe an emission model for gamma ray pulsars based on curvature radiation-reaction limited charges in the outer magnetosphere. We show how pair production on thermal surface flux can limit the acceleration zones. Estimates for the efficiency of GeV photon production eta gamma and the gamma-ray beaming fraction are derived, including their dependence on pulsar parameters. In general eta gamma increases with pulsar age, but is decreased for low magnetic fields and for small magnetic inclinations. We argue that this produces GeV pulse profiles, curvature spectra and detection statistics consistent with the observations. We also describe the optical through X-ray pulsar synchrotron spectrum and the spectral variations with pulsar phase. A test computation for Vela-like parameters reproduces phase-resolved GeV spectra consistent with those observed by EGRET. Finally we comment on very high energy pulsed emission and particle production and note extensions needed to allow a more complete pulsar model.

  6. Gamma radiation induced changes in nuclear waste glass containing Eu

    NASA Astrophysics Data System (ADS)

    Mohapatra, M.; Kadam, R. M.; Mishra, R. K.; Kaushik, C. P.; Tomar, B. S.; Godbole, S. V.

    2011-10-01

    Gamma radiation induced changes were investigated in sodium-barium borosilicate glasses containing Eu. The glass composition was similar to that of nuclear waste glasses used for vitrifying Trombay research reactor nuclear waste at Bhabha Atomic Research Centre, India. Photoluminescence (PL) and electron paramagnetic resonance (EPR) techniques were used to study the speciation of the rare earth (RE) ion in the matrix before and after gamma irradiation. Judd-Ofelt ( J- O) analyses of the emission spectra were done before and after irradiation. The spin counting technique was employed to quantify the number of defect centres formed in the glass at the highest gamma dose studied. PL data suggested the stabilisation of the trivalent RE ion in the borosilicate glass matrix both before and after irradiation. It was also observed that, the RE ion distributes itself in two different environments in the irradiated glass. From the EPR data it was observed that, boron oxygen hole centre based radicals are the predominant defect centres produced in the glass after irradiation along with small amount of E’ centres. From the spin counting studies the concentration of defect centres in the glass was calculated to be 350 ppm at 900 kGy. This indicated the fact that bulk of the glass remained unaffected after gamma irradiation up to 900 kGy.

  7. Current Trends in Gamma Radiation Detection for Radiological Emergency Response

    SciTech Connect

    Mukhopadhyay, S., Guss, P., Maurer, R.

    2011-09-01

    Passive and active detection of gamma rays from shielded radioactive materials, including special nuclear materials, is an important task for any radiological emergency response organization. This article reports on the current trends and status of gamma radiation detection objectives and measurement techniques as applied to nonproliferation and radiological emergencies. In recent years, since the establishment of the Domestic Nuclear Detection Office by the Department of Homeland Security, a tremendous amount of progress has been made in detection materials (scintillators, semiconductors), imaging techniques (Compton imaging, use of active masking and hybrid imaging), data acquisition systems with digital signal processing, field programmable gate arrays and embedded isotopic analysis software (viz. gamma detector response and analysis software [GADRAS]1), fast template matching, and data fusion (merging radiological data with geo-referenced maps, digital imagery to provide better situational awareness). In this stride to progress, a significant amount of interdisciplinary research and development has taken place–techniques and spin-offs from medical science (such as x-ray radiography and tomography), materials engineering (systematic planned studies on scintillators to optimize several qualities of a good scintillator, nanoparticle applications, quantum dots, and photonic crystals, just to name a few). No trend analysis of radiation detection systems would be complete without mentioning the unprecedented strategic position taken by the National Nuclear Security Administration (NNSA) to deter, detect, and interdict illicit trafficking in nuclear and other radioactive materials across international borders and through the global maritime transportation–the so-called second line of defense.

  8. Current trends in gamma radiation detection for radiological emergency response

    NASA Astrophysics Data System (ADS)

    Mukhopadhyay, Sanjoy; Guss, Paul; Maurer, Richard

    2011-09-01

    Passive and active detection of gamma rays from shielded radioactive materials, including special nuclear materials, is an important task for any radiological emergency response organization. This article reports on the current trends and status of gamma radiation detection objectives and measurement techniques as applied to nonproliferation and radiological emergencies. In recent years, since the establishment of the Domestic Nuclear Detection Office by the Department of Homeland Security, a tremendous amount of progress has been made in detection materials (scintillators, semiconductors), imaging techniques (Compton imaging, use of active masking and hybrid imaging), data acquisition systems with digital signal processing, field programmable gate arrays and embedded isotopic analysis software (viz. gamma detector response and analysis software [GADRAS]1), fast template matching, and data fusion (merging radiological data with geo-referenced maps, digital imagery to provide better situational awareness). In this stride to progress, a significant amount of inter-disciplinary research and development has taken place-techniques and spin-offs from medical science (such as x-ray radiography and tomography), materials engineering (systematic planned studies on scintillators to optimize several qualities of a good scintillator, nanoparticle applications, quantum dots, and photonic crystals, just to name a few). No trend analysis of radiation detection systems would be complete without mentioning the unprecedented strategic position taken by the National Nuclear Security Administration (NNSA) to deter, detect, and interdict illicit trafficking in nuclear and other radioactive materials across international borders and through the global maritime transportation-the so-called second line of defense.

  9. Biological wound dressings sterilized with gamma radiation: Mexican clinical experience

    NASA Astrophysics Data System (ADS)

    Martnez-Pardo, M. E.; Ley-Chvez, E.; Reyes-Fras, M. L.; Rodrguez-Ferreyra, P.; Vzquez-Maya, L.; Salazar, M. A.

    2007-11-01

    Biological wound dressings sterilized with gamma radiation, such as amnion and pig skin, are a reality in Mexico. These tissues are currently processed in the tissue bank and sterilized in the Gamma Industrial Irradiation Plant; both facilities belong to the Instituto Nacional de Investigaciones Nucleares (ININ) (National Institute of Nuclear Research). With the strong support of the International Atomic Energy Agency, the bank was established at the ININ and the Mexican Ministry of Health issued its sanitary license on July 7, 1999. The Quality Management System of the bank was certified by ISO 9001:2000 on August 1, 2003; the scope of the system is "Research, Development and Processing of Biological Tissues Sterilized with Gamma Radiation". At present, more than 150 patients from 16 hospitals have been successfully treated with these tissues. This paper presents a brief description of the tissue processing, as well as the present Mexican clinical experience with children and adult patients who underwent medical treatment with radiosterilized amnion and pig skin, used as biological wound dressings on burns and ocular surface disorders.

  10. The origin of the diffuse background gamma-radiation

    NASA Technical Reports Server (NTRS)

    Stecker, F. W.; Puget, J. L.

    1974-01-01

    Recent observations have now provided evidence for diffuse background gamma radiation extending to energies beyond 100 MeV. There is some evidence of isotropy and implied cosmological origin. Significant features in the spectrum of this background radiation have been observed which provide evidence for its origin in nuclear processes in the early stages of the big-band cosmology and tie in these processes with galaxy fromation theory. A crucial test of the theory may lie in future observations of the background radiation in the 100 MeV to 100 GeV energy range which may be made with large orbiting spark-chamber satellite detectors. A discussion of the theoretical interpretations of present data, their connection with baryon symmetric cosmology and galaxy formation theory, and the need for future observations are given.

  11. The origin of the diffuse background gamma radiation

    NASA Technical Reports Server (NTRS)

    Stecker, F. W.; Puget, J. L.

    1974-01-01

    Recent observations provided evidence for diffuse background gamma radiation extending to energies beyond 100 MeV, and evidence of isotropy and implied cosmological origin. Significant features in the spectrum of this background radiation were observed which provide evidence for its origin in nuclear processes in the early stages of big-bang cosmology, and connect these processes with the galaxy formation theory. A test of the theory is in future observations of the background radiation in the 100 MeK to 100 GeV energy range which are made with large orbiting spark-chamber satellite detectors. The theoretical interpretations of present data, their connection with baryon-symmetric cosmology and galaxy formation theory, and the need for future observations are discussed.

  12. IFN-{gamma}+ CD8+ T Lymphocytes: Possible Link Between Immune and Radiation Responses in Tumor-Relevant Hypoxia

    SciTech Connect

    De Ridder, Mark Jiang Heng; Esch, Gretel van; Law, Kalun; Monsaert, Christinne; Berge, Dirk L. van den; Verellen, Dirk; Verovski, Valeri N.; Storme, Guy A.

    2008-07-01

    Activated T lymphocytes are known to kill tumor cells by triggering cytolytic mechanisms; however, their ability to enhance radiation responses remains unclear. This study examined the radiosensitizing potential of mouse CD8+ T cells, obtained by T-cell-tailored expansion and immunomagnetic purification. Activated CD8+ T cells displayed an interferon (IFN)-{gamma}+ phenotype and enhanced by 1.8-fold the radiosensitivity of EMT-6 tumor cells in 1% oxygen, which modeled tumor-relevant hypoxia. Radiosensitization was counteracted by neutralizing IFN-{gamma} or by blocking the inducible isoform of nitric oxide synthase, thus delineating the immune-tumor cell interaction through the IFN-{gamma} secretion pathway. Reverse transcriptase-polymerase chain reaction, enzyme-linked immunosorbent assay, and fluorescence-activated cell sorter data in agreement detected downregulation of the IFN-{gamma} gene by hypoxia, which caused IFN-{gamma} deficiency next to radioresistance. Therefore, immune and radiation responses are likely to be allied in the hypoxic tumor microenvironment, and CD8+ T cells may bridge immunostimulatory and radiosensitizing strategies.

  13. EFFECTS OF GAMMA RADIATION ON ELECTROCHEMICAL PROPERTIES OF IONIC LIQUIDS

    SciTech Connect

    Visser, A; Nicholas Bridges, N; Thad Adams, T; John Mickalonis, J; Mark02 Williamson, M

    2009-04-21

    The electrochemical properties of ionic liquids (ILs) make them attractive for possible replacement of inorganic salts in high temperature molten salt electrochemical processing of nuclear fuel. To be a feasible replacement solvent, ILs need to be stable in moderate and high doses of radiation without adverse chemical and physical effects. Here, we exposed seven different ILs to a 1.2 MGy dose of gamma radiation to investigate their physical and chemical properties as they related to radiological stability. The azolium-based ILs experienced the greatest change in appearance, but these ILs were chemically more stable to gamma radiation than some of the other classes of ILs tested, due to the presence of aromatic electrons in the azolium ring. All the ILs exhibited a decrease in their conductivity and electrochemical window (at least 1.1 V), both of which could affect the utility of ILs in electrochemical processing. The concentration of the irradiation decomposition products was less than 3 mole %, with no impurities detectable using NMR techniques.

  14. Geraniin down regulates gamma radiation-induced apoptosis by suppressing DNA damage.

    PubMed

    Bing, So Jin; Ha, Danbee; Kim, Min Ju; Park, Eunjin; Ahn, Ginnae; Kim, Dae Seung; Ko, Ryeo Kyeong; Park, Jae Woo; Lee, Nam Ho; Jee, Youngheun

    2013-07-01

    Gamma ray irradiation triggers DNA damage and apoptosis of proliferating stem cells and peripheral immune cells, resulting in the destruction of intestinal crypts and lymphoid system. Geraniin is a natural compound extracts from an aquatic plant Nymphaea tetragona and possesses good antioxidant property. In this study, we demonstrate that geraniin rescues radiosensitive splenocytes and jejunal crypt cells from radiation-induced DNA damage and apoptosis. Isolated splenocytes from C57BL/6 mice treated with geraniin were protected against radiation injury of 2 Gy irradiation through the enhancement of the proliferation and attenuation of DNA damage. Also, geraniin inhibited apoptosis in radiosensitive splenocytes by reducing the expression level and immunoreactivity of proapoptotic p53 and Bax and increasing those of anti-apoptotic Bcl-2. In mice exposed to radiation, geraniin treatment protected splenocytes and intestinal crypt cells from radiation-induced cell death. Our results suggest that geraniin presents radioprotective effects by regulating DNA damage on splenocytes, exerting immunostimulatory capacities and inhibiting apoptosis of radiosensitive immune cells and jejunal crypt cells. Therefore, geraniin can be a radioprotective agent against γ-irradiation exposure. PMID:23541438

  15. SAS 2 observations of the earth albedo gamma radiation above 35 MeV

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Simpson, G. A.; Ozel, M. E.

    1981-01-01

    The earth albedo gamma radiation above 35 MeV in the equatorial region is investigated using observations from the second Small Astronomy Satellite. The zenith angle distribution of the gamma radiation has a peak toward the horizon which is about an order of magnitude more intense than the radiation coming from the nadir, and nearly two orders of magnitude more intense than the gamma radiation from most parts of the sky. The gamma radiation originating from the western horizon is a factor of four more intense than the radiation from the eastern horizon and a factor of three more intense than that from the northern and southern directions. This reflects the geomagnetic effects on the incident cosmic rays whose interactions produce the albedo gamma rays. The variation of the upcoming gamma ray intensity with vertical cutoff rigidity is consistent with the empirical relationship found by Gur'yan et al. (1979).

  16. Radiative cooling for solar cells

    NASA Astrophysics Data System (ADS)

    Zhu, Linxiao; Raman, Aaswath; Wang, Ken X.; Anoma, Marc A.; Fan, Shanhui

    2015-03-01

    Standard solar cells heat up under sunlight, and the resulting increased temperature of the solar cell has adverse consequences on both its efficiency and its reliability. We introduce a general approach to radiatively lower the operating temperature of a solar cell through sky access, while maintaining its sunlight absorption. We present first an ideal scheme for the radiative cooling of solar cells. For an example case of a bare crystalline silicon solar cell, we show that the ideal scheme can passively lower the operating temperature by 18.3 K. We then show a microphotonic design based on realistic material properties, that approaches the performance of the ideal scheme. We also show that the radiative cooling effect is substantial, even in the presence of significant non-radiative heat change, and parasitic solar absorption in the cooling layer, provided that we design the cooling layer to be sufficiently thin.

  17. Natural Radiation from Soil using Gamma-Ray Spectrometry

    SciTech Connect

    Silveira, M. A. G.; Moreira, R. H.; Paula, A. L. C. de; Medina, N. H.

    2009-06-03

    We have studied the distribution of natural radioactivity in the soil of Interlagos, in Sao Paulo city and Billings Reservoir, in Sao Bernardo do Campo, Sao Paulo, Brazil. The main contribution of the effective radiation dose is due to the elements of the {sup 238}Th decay series, with smaller contributions from {sup 40}K and the elements of the series of {sup 238}U. The results indicate the dose in all of the studied areas is around the average international dose due to external exposure to gamma rays (0.48 mSv/yr) proceeding from natural terrestrial elements.

  18. Ceramic Matrix Composites Performances Under High Gamma Radiation Doses

    NASA Astrophysics Data System (ADS)

    Cemmi, A.; Baccaro, S.; Fiore, S.; Gislon, P.; Serra, E.; Fassina, S.; Ferrari, E.; Ghisolfi, E.

    2014-06-01

    Ceramic matrix composites reinforced by continuous ceramic fibers (CMCs) represent a class of advanced materials developed for applications in automotive, aerospace, nuclear fusion reactors and in other specific systems for harsh environments. In the present work, the silicon carbide/silicon carbide (SiCf/SiC) composites, manufactured by Chemical Vapour Infiltration process at FN S.p.A. plant, have been evaluated in term of gamma radiation hardness at three different absorbed doses (up to around 3MGy). Samples behavior has been investigated before and after irradiation by means of mechanical tests (flexural strength) and by surface and structural analyses (X-ray diffraction, SEM, FTIR-ATR, EPR).

  19. Mechanisms for Production of the Diffuse Gamma-ray Continuum Radiation

    NASA Technical Reports Server (NTRS)

    Stecker, F. W.

    1973-01-01

    The production of cosmic gamma radiation from Compton interactions with low energy photons, bremsstrahlung interactions, cosmic ray induced neutral pion production, and matter-antimatter annihilation is discussed.

  20. Gamma radiation effects on commercial Mexican bread making wheat flour

    NASA Astrophysics Data System (ADS)

    Agndez-Arvizu, Z.; Fernndez-Ramrez, M. V.; Arce-Corrales, M. E.; Cruz-Zaragoza, E.; Melndrez, R.; Chernov, V.; Barboza-Flores, M.

    2006-04-01

    Gamma irradiation is considered to be an alternative method for food preservation to prevent food spoilage, insect infestation and capable of reducing the microbial load. In the present investigation, commercial Mexican bread making wheat flour was irradiated at 1.0 kGy using a 60C Gammabeam 651 PT irradiator facility. No changes were detected in moisture, protein and ashes in gamma irradiated samples as compared to those of non-irradiated samples. Slight radiation effects were observed in the alveogram values and farinograph properties; the falling number decreased 11%, the absorption as well as the mixing tolerance were practically unchanged by irradiation. An increase of 15% in the stability value and a 29% in the dough development time were observed. Also the deformation energy decreased 7% with no change at all in the tenacity/extensibility factor. Total aerobic, yeast and mold counts were reduced 96%, 25% and 75%; respectively by the irradiation process. The obtained results confirm that gamma irradiation is effective in reducing the microbial load in bread making wheat flour without a significant change in the physicochemical and baking properties.

  1. An experimental search for gamma radiation associated with thunderstorm activity

    SciTech Connect

    Fryberger, D.

    1992-11-01

    This experiment is a repeat of an earlier experiment, but with more sensitive apparatus and in a location with a higher incidence of thunderstorm activity. The earlier experiment was undertaken by Ashby and Whitehead to investigate the theory that ball lightning might be associated with the annihilation of small amounts of antimatter, and it yielded some very interesting but inconclusive results. In the course of about 12 months of data taking, four high rate bursts of gamma radiation were detected. These events lasted a few seconds and had many thousands of counts (16500, 5000, 3700, and [gt] 7700. Unfortunately, the association of these gamma ray bursts with thunderstorms or ball lightning was not clearly established, although one of the bursts did occur during a local thunderstorm in rough coincidence with a lightning bolt striking a flagpole about 100 yards from the gamma ray detection crystals. A pulse height spectrum taken for this burst (no spectrum was taken for the other three) exhibited a significant peak, well above background, the energy of which appeared to be compatible with the 511 keV positron annihilation line. While the peak could not be unambiguously attributed to positron annihilation, this certainly appeared to be the most likely source.

  2. An experimental search for gamma radiation associated with thunderstorm activity

    SciTech Connect

    Fryberger, D.

    1992-11-01

    This experiment is a repeat of an earlier experiment, but with more sensitive apparatus and in a location with a higher incidence of thunderstorm activity. The earlier experiment was undertaken by Ashby and Whitehead to investigate the theory that ball lightning might be associated with the annihilation of small amounts of antimatter, and it yielded some very interesting but inconclusive results. In the course of about 12 months of data taking, four high rate bursts of gamma radiation were detected. These events lasted a few seconds and had many thousands of counts (16500, 5000, 3700, and {gt} 7700. Unfortunately, the association of these gamma ray bursts with thunderstorms or ball lightning was not clearly established, although one of the bursts did occur during a local thunderstorm in rough coincidence with a lightning bolt striking a flagpole about 100 yards from the gamma ray detection crystals. A pulse height spectrum taken for this burst (no spectrum was taken for the other three) exhibited a significant peak, well above background, the energy of which appeared to be compatible with the 511 keV positron annihilation line. While the peak could not be unambiguously attributed to positron annihilation, this certainly appeared to be the most likely source.

  3. Galactic gamma radiation from cosmic rays concentrated in spiral arms

    NASA Technical Reports Server (NTRS)

    Kniffen, D. A.; Fichtel, C. E.; Thompson, D. J.; Cheung, C. Y.; Bignami, G. F.

    1975-01-01

    Extending the model proposed by Bignami et al. (1975), and by Fichtel et al. (1975a) for the production of the galactic high energy gamma ray distribution observed by SAS-2 to lower energies indicates the radiation is dominated by the bremsstrahlung emission of cosmic ray electrons traversing the interstellar gas. Although secondary electrons contribute only about 15% to the 10-30 MeV gamma ray emission in the solar vicinity, their contribution in the model is proportional to the third power of N, where N(r, gal. long., gal. lat.) is the total interstellar gas density, as compared to the square of N for the case of the primary components, and hence their relative importance increases in high density regions. Gamma-ray observations at these energies when compared to those at high energies (above 100 MeV) may provide a means for mapping the ratio of cosmic ray electrons to nucleons throughout the galaxy without the necessity of invoking models for the galactic magnetic field.

  4. Radiation effects on bacterial cells

    NASA Technical Reports Server (NTRS)

    Powers, E. L.

    1968-01-01

    Study reveals the physicochemical and biochemical mechanisms which alter or modify the effects of high-energy radiation on living cells. An in-depth discussion is presented emphasizing the importance of optimizing bacterial treatment with glycerol.

  5. An investigation of gamma background radiation in Hamadan province, Iran.

    PubMed

    Rostampour, Nima; Almasi, Tinoosh; Rostampour, Masoumeh; Mohammadi, Mohammad; Ghazikhanlou Sani, Karim; Khosravi, Hamid R; Pooya, S Mehdi Hosseini; Golzar, Bahman; Jabari Vesal, Naghi

    2012-12-01

    The general population, everywhere in the world is exposed to a small dose of ionising radiation from natural sources. Stochastic effects such as cancer and genetic disorders are caused when living creatures are exposed to low doses. In Iran, it is measured in some cities, especially in high-background areas such as Ramsar, but so far there is no measurement in the Hamadan province. Hamadan is located in the west of Iran. Measurements were performed using a RDS-110 survey meter, CaSO(4):Dy thermoluminecense dosimetries (TLDs) and a Harshaw 4000 TLD reader. To estimate the dose rate  outdoors, four stations along the main directions (north, south, west and east) and one in the town centre were selected. Mean annual X and gamma equivalent dose in Hamadan province are 1.12±0.22  and 1.66±0.07 mSv, which related to RDS-110 survey meter and TLDs measurements, respectively. The TLDs and RDS-110 results are representative of the external photon radiation doses for the selected monitoring locations and for those locations for the hours during which the measurements were taken, respectively. Maximum and minimum of external photon radiation doses are related to Hamadan and Kaboudar-Ahang towns, respectively. According to the results of the study, it seems that the annual X and gamma equivalent dose in Hamadan province exceeded the global mean external exposure amounts by the UNSCEAR, and further studies are needed to measure internal exposures to determine the total environmental radiation level in  Hamadan province. PMID:22570508

  6. Inhaled /sup 239/PuO/sub 2/ and/or total-body gamma radiation: Early mortality and morbidity in rats and dogs

    SciTech Connect

    Filipy, R.E.; Decker, J.R.; Lai, Y.L.; Lauhala, K.E.; Buschbom, R.L.; Hiastala, M.P.; McGee, D.R.; Park, J.F.; Kuffel, E.G.; Ragan, H.A.; Cannon, W.C.; Yaniv, S.S.; Scott, B.R.

    1988-08-01

    Rats and beagle dogs were given doses of /sup 60/Co gamma radiation and/or body burdens of /sup 239/PuO/sub 2/ within lethal ranges in an experiment to determine and compare morbidity and mortality responses of both species within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell concentrations and by long-term loss of body weight and diminished pulmonary function in animals of both species that survived the acute gamma radiation syndrome. Inhaled plutonium caused a loss of body weight and diminished pulmonary function in both species, but its only effect on blood cell concentrations was lymphocytopenia in dogs. Combined gamma irradiation and plutonium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Plutonium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the long-term effect of plutonium lung burdens in both species. Rats were less sensitive to both kinds of radiation, whether administered alone or in combination. 71 refs., 105 figs., 48 tabs.

  7. Human hematopoietic cell express two forms of the cytokine receptor common gamma-chain (gamma c).

    PubMed

    Shi, Y F; Hill, M; Novak, A; Chen, Z Q; Wang, R X; Liew, C C; Mills, G B

    1997-12-01

    Recent studies have revealed that the gamma-chain of the IL-2 receptor is shared by the receptors for IL-4, IL-7, IL-9, IL-13, and IL-15, and it is therefore also referred to as the common gamma-chain (gamma c). Mutations of gamma c result in X-linked severe combined immunodeficiency syndrome in humans, indicating that gamma c is essential for normal development and function of the immune system. We demonstrate that human hematopoietic cells express two gamma c transcripts differing in their carboxyl terminal coding region. One transcript is the previously reported sequence (gamma c-long), whereas the newly identified sequence exhibits a deletion of 72 nucleotides close to the 3'-end of the open reading frame (gamma c-short). This alteration predicts a loss of 24 amino acids including a conserved tyrosine residue which is shared by several members of the cytokine receptor family. The presence of these two distinct forms of gamma c transcripts was demonstrated by sequencing of reversely transcribed and polymerase chain reaction (RT-PCR) amplified mRNA, restriction digestion of the RT-PCR products, RNAse protection, and Northern blotting from human cell lines and human peripheral blood lymphocytes. Furthermore, the two variants were present in peripheral blood lymphocytes from both female and male donors, which rules out allelic variants since gamma c is a single copy gene located on the X chromosome. A truncation mutant at a site near the observed changes in gamma c-short has been reported by others to alter biochemical events activated by cytokines. This combined with the loss of a potential SH2 "docking" site in gamma c-short suggests that gamma c-long and gamma c-short may link to different signaling pathways and may play an important role in determining the cellular response to IL-2, IL-4, IL-7, IL-9, IL-13, IL-15. PMID:9444398

  8. Enhancement of natural background gamma-radiation dose around uranium microparticles in the human body.

    PubMed

    Pattison, John E; Hugtenburg, Richard P; Green, Stuart

    2010-04-01

    Ongoing controversy surrounds the adverse health effects of the use of depleted uranium (DU) munitions. The biological effects of gamma-radiation arise from the direct or indirect interaction between secondary electrons and the DNA of living cells. The probability of the absorption of X-rays and gamma-rays with energies below about 200 keV by particles of high atomic number is proportional to the third to fourth power of the atomic number. In such a case, the more heavily ionizing low-energy recoil electrons are preferentially produced; these cause dose enhancement in the immediate vicinity of the particles. It has been claimed that upon exposure to naturally occurring background gamma-radiation, particles of DU in the human body would produce dose enhancement by a factor of 500-1000, thereby contributing a significant radiation dose in addition to the dose received from the inherent radioactivity of the DU. In this study, we used the Monte Carlo code EGSnrc to accurately estimate the likely maximum dose enhancement arising from the presence of micrometre-sized uranium particles in the body. We found that although the dose enhancement is significant, of the order of 1-10, it is considerably smaller than that suggested previously. PMID:19776147

  9. Radiative Penguin Decays of B Mesons: Measurements of B to K* gamma, B to K2* gamma, and Search for B0 to phi gamma

    SciTech Connect

    Bauer, J.

    2005-01-03

    Electromagnetic radiative penguin decays of the B meson were studied with the BaBar detector at SLAC's PEP-II asymmetric-energy B Factory. Branching fractions and isospin asymmetry of the decay B {yields} K*{gamma}, branching fractions of B {yields} K*{sub 2}(1430){gamma}, and a search for B{sup 0} {yields} {phi}{gamma} are presented. The decay rates may be enhanced by contributions from non-standard model processes.

  10. Effect of Gamma radiation on microbial population of natural casings

    NASA Astrophysics Data System (ADS)

    Trigo, M. J.; Fraqueza, M. J.

    1998-06-01

    The high microbial load of fresh and dry natural casings increases the risk of meat product contamination with pathogenic microorganisms, agents of foodborn diseases. The aim of this work is to evaluate the killing effect of gamma radiation of the resident microbial population of pork and beef casings, to improve their hygiene and safety. Portions of fresh pork (small intestines and colon) and dry beef casings were irradiated in a Cobalt 60 source with with absorbed doses of 1,2,5 and 10 kGy. The D 10 values of total aerobic microorganisms in the pork casings were 1.65 kGy for colon and 1.54 kGy for small intestine. The D 10 value found in beef dry casings (small intestine) was 10.17 kGy. Radurization with 5 kGy was able to reduce, at least, 6 logs the coliform bacteria in pork casings. The killing effect over faecal Streptococci was 4 logs for pork fresh casings and 2 logs for beef dry casings. Gamma radiation with 5 kGy proved to be a convenient method to reduce substantially the microbial population of pork fresh casings. Otherwise, the microbial population of beef dry casings still resisted to 10 kGy.

  11. Removal of trihalomethane from chlorinated seawater using gamma radiation.

    PubMed

    Rajamohan, R; Natesan, Usha; Venugopalan, V P; Rajesh, Puspalata; Rangarajan, S

    2015-12-01

    Chlorine addition as a biocide in seawater results in the formation of chlorination by-products such as trihalomethanes (THMs). Removal of THMs is of importance as they are potential mutagenic and carcinogenic agents. In this context, a study was conducted that used ionizing radiation to remove THMs from chlorinated (1, 3, and 5mg/L) seawater by applying various dosages (0.4-5.0kGy) of gamma radiation. Bromoform (BF) showed a faster rate of degradation as compared to other halocarbons such as bromodichloromethane (BDCM) and dibromochloromethane (DBCM). In chlorine-dosed seawater, total irradiation dose of 0.4 to 5kGy caused percentage reduction in the range of 6.9 to 76.7%, 2.3 to 99.6%, and 45.7 to 98.3% for BDCM, DBCM, and BF, respectively. During the irradiation process, pH of the chlorinated seawater decreased with increase in the absorbed dose; however, no change in total organic carbon (TOC) was observed. The results show that gamma dose of 2.5kGy was adequate for maximum degradation of THM; but for complete mineralization, higher dose would be required. PMID:26199004

  12. Radiomodifying and anticlastogenic effect of Zingerone on Swiss albino mice exposed to whole body gamma radiation.

    PubMed

    Rao, B Nageshwar; Rao, B S Satish; Aithal, B Kiran; Kumar, M R Sunil

    2009-01-01

    The radioprotective effect and antigenotoxic potential of phenolic alkanone, Zingerone (ZO) were investigated in Swiss albino mice exposed to gamma radiation. To study the optimum dose for radiation protection, mice were administered with ZO (10-100mg/kgb.wt.), once daily for five consecutive days. One hour after the last administration of ZO on the fifth day, animals were whole body exposed to 10 Gy gamma radiations. The radioprotective potential was assessed using animal survival at an optimal ZO dose of 20mg/kgb.wt., administered prior to 7-11 Gy. Further, the radioprotective potential of ZO was also analyzed by haemopoietic stem cell survival (CFU) assay, mouse bone marrow micronucleus test and histological observations of intestinal and bone marrow damage. Effect of ZO pretreatment on radiation-induced changes in glutathione (GSH), glutathione-S-transferase (GST), superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation (LPx) levels was also analyzed. ZO treatment resulted increase in the LD(50/30) by 1.8 Gy (dose reduction factor = 1.2). The number of spleen colonies after whole body irradiation of mice (4.5 or 7.5 Gy) was increased when ZO was administered 1h prior to irradiation. The histological observations indicated a decline in the villus height and crypt number with an increase in goblet and dead cell population in the irradiated group, which was normalized by pretreatment with ZO. A significant (p < 0.001) reduction in micronucleated polychromatic, normochromatic erythrocytes, increased PCE/NCE ratio, increase in the GSH, GST, SOD, CAT and decreased LPx levels were observed in ZO pretreated group when compared to the irradiated animals. Our findings demonstrate the potential of ZO in mitigating radiation-induced mortality and cytogenetic damage, which may be attributed to inhibition radiation-induced decline in the endogenous antioxidant levels and scavenging of radiation-induced free radicals. PMID:19463966

  13. Aberrant megakaryocytopoiesis preceding radiation-induced leukemia in the dog. [Gamma radiation

    SciTech Connect

    Tolle, D.V.; Seed, T.M.; Cullen, S.M.; Poole, C.M.; Fritz, T.E.

    1982-01-01

    Six of nine decedent beagles exposed continuously to 2.5 R/22 hour day of whole-body /sup 60/Co ..gamma..-radiation died with myeloproliferative diseases: three cases of myelogenous leukemia and one each of monocytic leukemia, erythroleukemia, and erythremic myelosis. The three dogs that died with myelogenous leukemia had micromegakaryocytes and megakaryoblasts in the peripheral blood during the preleukemic phase when myeloblasts were not observed in the peripheral blood or in increased numbers in the bone marrow. In this study we have examined the megakaryocytes during the preleukemic period by a combination of light, transmission, and scanning electron microscopy. Morphologic abnormalities seen by light microscopy included mononucleated and binucleated forms, many with cytoplasmic blebs. The small mononuclear forms in the bone marrow tended to form clusters. Ultrastructural features included a paucity of both specific ..cap alpha.. granules and dense granules. The micromegakaryocytes showed dysgenesis of the demarcation membrane system. This membrane system appeared disorganized with a few dilated round, oval, or rarely, elongated vesicles and showed no evidence of platelet formation. The cells also had a paucity of endoplasmic reticulum, few mitochrondria, and sparse glycogen accumulations. The scarcity of cytoplasmic organelles gave a pale immature appearance to the cytoplasm. By scanning electron microscopy, the sponge-like surface of large mature megakaryocytes from unirradiated marrow contrasted with the characteristically smooth, topographically featureless surfaces of the micromegakaryocytes from preleukemic dogs.

  14. Aberrant megakaryocytopoiesis preceding radiation-induced leukemia in the dog. [Gamma radiation

    SciTech Connect

    Tolle, D.V.; Seed, T.M.; Cullen, S.M.; Poole, C.M.; Fritz, T.E.

    1982-01-01

    Six of nine decedent beagles exposed continuously to 2.5 R*/22 hour day of whole-body 60Co gamma-radiation died with myeloproliferative diseases: three cases of myelogenous leukemia and one each of monocytic leukemia, erythroleukemia, and erythremic myelosis. The three dogs that died with myelogenous leukemia had micromegakaryocytes and megakaryoblasts in the peripheral blood during the preleukemic phase when myeloblasts were not observed in the peripheral blood or in increased numbers in the bone marrow. In this study we have examined the megakaryocytes during the preleukemic period by a combination of light, transmission, and scanning electron microscopy. Morphologic abnormalities seen by light microscopy included mononucleated and binucleated forms, many with cytoplasmic blebs. The small mononuclear forms in the bone marrow tended to form clusters. Ultrastructural features included a paucity of both specific alpha granules and dense granules. The micromegakaryocytes showed dysgenesis of the demarcation membrane system. This membrane system appeared disorganized with a few dilated round, oval, or rarely, elongated vesicles and showed no evidence of platelet formation. The cells also had a paucity of endoplasmic reticulum, few mitochrondria, and sparse glycogen accumulations. The scarcity of cytoplasmic organelles gave a pale immature appearance to the cytoplasm. By scanning electron microscopy, the sponge-like surface of large mature megakaryocytes from unirradiated marrow contrasted with the characteristically smooth, topographically featureless surfaces of the micromegakaryocytes from preleukemic dogs.

  15. Mechanisms of radiation-induced neoplastic cell transformation

    SciTech Connect

    Yang, T.C.H.; Tobias, C.A.

    1984-04-01

    Studies with cultured mammalian cells demonstrated clearly that radiation can transform cells directly and can enhance the cell transformation by oncogenic DNA viruses. In general, high-LET heavy-ion radiation can be more effective than X and gamma rays in inducing neoplastic cell transformation. Various experimental results indicate that radiation-induced DNA damage, most likely double-strand breaks, is important for both the initiation of cell transformation and for the enhancement of viral transformation. Some of the transformation and enhancement lesions can be repaired properly in the cell, and the amount of irrepairable lesions produced by a given dose depends on the quality of radiation. An inhibition of repair processes with chemical agents can increase the transformation frequency of cells exposed to radiation and/or oncogenic viruses, suggesting that repair mechanisms may play an important role in the radiation transformation. The progression of radiation-transformed cells appears to be a long and complicated process that can be modulated by some nonmutagenic chemical agents, e.g., DMSO. Normal cells can inhibit the expression of transforming properties of tumorigenic cells through an as yet unknown mechanism. The progression and expression of transformation may involve some epigenetic changes in the irradiated cells. 38 references, 15 figures, 1 table.

  16. DNA damage induced by gamma-radiation in combination with ethylene oxide or propylene oxide in human fibroblasts.

    PubMed

    Chovanec, M; Cedervall, B; Kolman, A

    2001-09-28

    To estimate the effects of interaction of gamma-rays and an epoxide, cell survival and induction of DNA double-strand breaks (DSBs) following combined exposure to ionizing radiation and ethylene oxide (EtO) or propylene oxide (PO) were studied in human fibroblasts. Two treatment protocols were applied: (a) the cells were pre-exposed to different doses of gamma-rays and then treated with epoxide, and (b) the cells were pretreated with epoxide and then exposed to different doses of gamma-rays. Here we show that order of the treatment did not play a role in cell survival and that the effect of combined exposure on cell killing was additive for both epoxides. As to DNA DSBs induction, however, a difference dependent upon the order of the treatment was observed. While EtO or PO treatment followed by gamma-rays exposure led to an increased number of DSBs at higher gamma-ray doses (2-3 Gy), no significant increase of DSBs was detected after the opposite order of the treatment (gamma-ray exposure followed by EtO or PO treatment). PMID:11566293

  17. Oxidative stress and gamma radiation-induced cancellous bone loss with musculoskeletal disuse

    PubMed Central

    Kondo, Hisataka; Yumoto, Kenji; Alwood, Joshua S.; Mojarrab, Rose; Wang, Angela; Almeida, Eduardo A. C.; Searby, Nancy D.; Limoli, Charles L.

    2010-01-01

    Exposure of astronauts in space to radiation during weightlessness may contribute to subsequent bone loss. Gamma irradiation of postpubertal mice rapidly increases the number of bone-resorbing osteoclasts and causes bone loss in cancellous tissue; similar changes occur in skeletal diseases associated with oxidative stress. Therefore, we hypothesized that increased oxidative stress mediates radiation-induced bone loss and that musculoskeletal disuse changes the sensitivity of cancellous tissue to radiation exposure. Musculoskeletal disuse by hindlimb unloading (1 or 2 wk) or total body gamma irradiation (1 or 2 Gy of 137Cs) of 4-mo-old, male C57BL/6 mice each decreased cancellous bone volume fraction in the proximal tibiae and lumbar vertebrae. The extent of radiation-induced acute cancellous bone loss in tibiae and lumbar vertebrae was similar in normally loaded and hindlimb-unloaded mice. Similarly, osteoclast surface in the tibiae increased 46% as a result of irradiation, 47% as a result of hindlimb unloading, and 64% as a result of irradiation + hindlimb unloading compared with normally loaded mice. Irradiation, but not hindlimb unloading, reduced viability and increased apoptosis of marrow cells and caused oxidative damage to lipids within mineralized tissue. Irradiation also stimulated generation of reactive oxygen species in marrow cells. Furthermore, injection of ?-lipoic acid, an antioxidant, mitigated the acute bone loss caused by irradiation. Together, these results showed that disuse and gamma irradiation, alone or in combination, caused a similar degree of acute cancellous bone loss and shared a common cellular mechanism of increased bone resorption. Furthermore, irradiation, but not disuse, may increase the number of osteoclasts and the extent of acute bone loss via increased reactive oxygen species production and ensuing oxidative damage, implying different molecular mechanisms. The finding that ?-lipoic acid protected cancellous tissue from the detrimental effects of irradiation has potential relevance to astronauts and radiotherapy patients. PMID:19875718

  18. Gamma radiation consequences on desert locust Schistocerca gregaria (Forsk.) digestive system.

    PubMed

    Dushimirimana, S; Muratori, F; Damiens, D; Hance, T

    2010-01-01

    Schistocera gregaria (Forsk.) (Orthoptera, Acrididae) remains a major insect pest in Africa, more particularly in the Sahelian zone. Present control methods are only partially efficient. In a previous study, we tested the potentiality of a sterile insect technique (SIT). Males of S. gregaria appeared to be much radiosensitive as already a dose of 3 Gy limited their survival. Gamma-radiations are known to damages the epithelial tissue of midgut, which affects the alimentation in insects. In this work, we show how digestive system of S. gregaria males is affected when submitted to a dose of 4 gamma rays. Nutrition is affected as males stop feeding soon after irradiation and progressively lose weight. Histological analyses on the midgut showed important epithelium damages. The regenerative cells by which the epithelial cells are replaced were damaged on the first days following irradiation. Consequently, regenerative cells are unable to divide and replace the normal loss of midgut cell. After nine days, the entire midgut epithelium was destroyed and only longitudinal muscles layer remained intact. This indicates that low radiation doses should be used if SIT will be applied. PMID:21539264

  19. Combined Treatment With Peroxisome Proliferator-Activated Receptor (PPAR) Gamma Ligands and Gamma Radiation Induces Apoptosis by PPAR?-Independent Up-Regulation of Reactive Oxygen Species-Induced Deoxyribonucleic Acid Damage Signals in Non-Small Cell Lung Cancer Cells

    SciTech Connect

    Han, Eun Jong; Im, Chang-Nim; Park, Seon Hwa; Moon, Eun-Yi; Hong, Sung Hee

    2013-04-01

    Purpose: To investigate possible radiosensitizing activities of the well-known peroxisome proliferator-activated receptor (PPAR)? ligand ciglitazone and novel PPAR? ligands CAY10415 and CAY10506 in non-small cell lung cancer (NSCLC) cells. Methods and Materials: Radiosensitivity was assessed using a clonogenic cell survival assay. To investigate the mechanism underlying PPAR? ligand-induced radiosensitization, the subdiploid cellular DNA fraction was analyzed by flow cytometry. Activation of the caspase pathway by combined PPAR? ligands and ?-radiation treatment was detected by immunoblot analysis. Reactive oxygen species (ROS) were measured using 2,7-dichlorodihydrofluorescein diacetate and flow cytometry. Results: The 3 PPAR? ligands induced cell death and ROS generation in a PPAR?-independent manner, enhanced ?-radiationinduced apoptosis and caspase-3mediated poly (ADP-ribose) polymerase (PARP) cleavage in vitro. The combined PPAR? ligand/?-radiation treatment triggered caspase-8 activation, and this initiator caspase played an important role in the combination-induced apoptosis. Peroxisome proliferator-activated receptor-? ligands may enhance the ?-radiation-induced DNA damage response, possibly by increasing ?-H2AX expression. Moreover, the combination treatment significantly increased ROS generation, and the ROS scavenger N-acetylcysteine inhibited the combined treatment-induced ROS generation and apoptotic cell death. Conclusions: Taken together, these results indicated that the combined treatment of PPAR? ligands and ?-radiation synergistically induced DNA damage and apoptosis, which was regulated by ROS.

  20. Search for Charmonium States Decaying to J/\\psi\\gamma \\gamma $ Using Initial-State Radiation Events

    SciTech Connect

    Aubert, B.; Barate, R.; Bona, M.; Boutigny, D.; Couderc, F.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Tisserand, V.; Zghiche, A.; Grauges, E.; Palano, A.; Chen, J.C.; Qi, N.D.; Rong, G.; Wang, P.; Zhu, Y.S.; Eigen, G.; Ofte, I.; Stugu, B.; Abrams, G.S.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U., EKP /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /Milan U. /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Naples U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Pennsylvania U. /Perugia U. /INFN, Perugia /Pisa U. /INFN, Pisa /Prairie View A-M /Princeton U. /Rome U. /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Stony Brook /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison /Yale U.

    2006-11-30

    We study the processes e{sup +}e{sup -} {yields} (J/{psi}{gamma}{gamma}){gamma} and e{sup +}e{sup -} {yields} (J/{psi}{pi}{sup -}{pi}{sup +}){gamma} where the hard photon radiated from an initial e{sup +}e{sup -} collision with center-of-mass (CM) energy near 10.58 GeV is detected. In the final state J/{psi}{gamma}{gamma} we consider J/{psi}{pi}{sup 0}, J/{psi}{eta}, {chi}{sub c1}{gamma}, and {chi}c{sub 2}{gamma} candidates. The invariant mass of the hadronic final state defines the effective e{sup +}e{sup -} CM energy in each event, so these data can be compared with direct e{sup +}e{sup -} measurements. We report 90% CL upper limits for the integrated cross section times branching fractions of the J/{psi}{gamma}{gamma} channels in the Y (4260) mass region.

  1. Combination of {gamma}-radiation antagonizes the cytotoxic effects of vincristine and vinblastine on both mitotic arrest and apoptosis

    SciTech Connect

    Sui, Meihua; Fan Weimin . E-mail: fanw@musc.edu

    2005-03-15

    Purpose: Combination therapy with different modalities is a common practice in the treatment of cancer. The promising clinical profile of vincristine and vinblastine has promoted considerable interest in combining these vinca alkaloids with radiation therapy to treat a variety of solid tumors. However, the therapeutic efficacy and the interaction between the vinca alkaloids with radiation is not entirely clear. In this study, we assessed the potential interactions in the combination of vincristine or vinblastine with {gamma}-radiation against human tumor cells in vitro. Methods and materials: Vincristine or vinblastine and {gamma}-radiation were administrated at three different sequences designed as preradiated, coradiated, and postradiated combinations in human breast cancer cells and human epidermoid carcinoma cells. The cytotoxic interactions and mutual influences between these two modalities were analyzed by a series of assays including cytotoxic, morphologic, and biochemical examinations. Results: Our results showed that the combination of these two modalities did not produce any synergistic or additive effects. Instead, the clonogenic assays showed the survival rates of these combinations were increased up to 2.17-fold and 2.7-fold, respectively, of those treated with vincristine or vinblastine alone (p < 0.01). DNA fragmentation, T{alpha}T-mediated dUTP nick end labeling (TUNEL) assay, and flow cytometric assays also showed that the combination of {gamma}-radiation significantly interfered with the ability of these vinca alkaloids to induce apoptosis. Further analyses indicated that addition of {gamma}-radiation resulted in cell cycle arrest at the G{sub 2} phase, which subsequently prevented the mitotic arrest induced by vincristine or vinblastine. In addition, biochemical examinations revealed that {gamma}-radiation regulated p34{sup cdc2}/cyclin B1 and survivin, and inhibited I{kappa}B{alpha} degradation and bcl-2 phosphorylation. Conclusions: These results suggest that {gamma}-radiation might specifically block the cell cycle at the G{sub 2} phase, which in turn interferes with the cytotoxic effects of vincristine or vinblastine on mitotic arrest and apoptosis. Thereby, it eventually results in an antagonistic interaction between these two modalities. This finding may be implicated in the clinical application of combination therapy of vinca alkaloids and radiation.

  2. Networked gamma radiation detection system for tactical deployment

    NASA Astrophysics Data System (ADS)

    Mukhopadhyay, Sanjoy; Maurer, Richard; Wolff, Ronald; Smith, Ethan; Guss, Paul; Mitchell, Stephen

    2015-08-01

    A networked gamma radiation detection system with directional sensitivity and energy spectral data acquisition capability is being developed by the National Security Technologies, LLC, Remote Sensing Laboratory to support the close and intense tactical engagement of law enforcement who carry out counterterrorism missions. In the proposed design, three clusters of 2″ × 4″ × 16″ sodium iodide crystals (4 each) with digiBASE-E (for list mode data collection) would be placed on the passenger side of a minivan. To enhance localization and facilitate rapid identification of isotopes, advanced smart real-time localization and radioisotope identification algorithms like WAVRAD (wavelet-assisted variance reduction for anomaly detection) and NSCRAD (nuisance-rejection spectral comparison ratio anomaly detection) will be incorporated. We will test a collection of algorithms and analysis that centers on the problem of radiation detection with a distributed sensor network. We will study the basic characteristics of a radiation sensor network and focus on the trade-offs between false positive alarm rates, true positive alarm rates, and time to detect multiple radiation sources in a large area. Empirical and simulation analyses of critical system parameters, such as number of sensors, sensor placement, and sensor response functions, will be examined. This networked system will provide an integrated radiation detection architecture and framework with (i) a large nationally recognized search database equivalent that would help generate a common operational picture in a major radiological crisis; (ii) a robust reach back connectivity for search data to be evaluated by home teams; and, finally, (iii) a possibility of integrating search data from multi-agency responders.

  3. Relative biological effectiveness of tritiated water to gamma radiation for germ line mutations

    SciTech Connect

    Byrne, B.J.; Lee, W.R.

    1989-03-01

    The relative biological effectiveness was determined using sex-linked recessive lethals induced in Drosophila spermatozoa as the biological effect. The sex-linked recessive lethal test, a measure of mutations induced in germ cells and transmitted through successive generations, yields a linear dose-response curve in the range used in these experiments. A dose-response curve was determined from three exposures to tritiated water and three exposures to /sup 60/Co gamma radiation. The ratio of the slopes of these two response curves is 2.7 +/- 0.3, yielding a relative biological effectiveness that suggests the tritium beta particle is 2.7 times more effective per unit of energy absorbed in inducing gene mutations transmitted to successive generations than /sup 60/Co gamma radiation. The increase in relative biological effectiveness with higher linear energy transfer for tritium beta radiation strongly suggests that single-strand breaks are repaired by a nearly error-free repair mechanism. Ion tracks with a high density of ions (high linear energy transfer) are more efficient than tracks with a low ion density (low linear energy transfer) in inducing transmissible mutations, suggesting interaction among products of ionization. Since most transmitted mutations induced by ionizing radiation result from strand breakage, interaction probably occurs at this level with double-strand breaks being repaired by an error-prone mechanism yielding transmissible mutations.

  4. The Impact of Gamma Radiation on Sediment Microbial Processes

    PubMed Central

    Brown, Ashley R.; Boothman, Christopher; Pimblott, Simon M.

    2015-01-01

    Microbial communities have the potential to control the biogeochemical fate of some radionuclides in contaminated land scenarios or in the vicinity of a geological repository for radioactive waste. However, there have been few studies of ionizing radiation effects on microbial communities in sediment systems. Here, acetate and lactate amended sediment microcosms irradiated with gamma radiation at 0.5 or 30 Gy h−1 for 8 weeks all displayed NO3− and Fe(III) reduction, although the rate of Fe(III) reduction was decreased in 30-Gy h−1 treatments. These systems were dominated by fermentation processes. Pyrosequencing indicated that the 30-Gy h−1 treatment resulted in a community dominated by two Clostridial species. In systems containing no added electron donor, irradiation at either dose rate did not restrict NO3−, Fe(III), or SO42− reduction. Rather, Fe(III) reduction was stimulated in the 0.5-Gy h−1-treated systems. In irradiated systems, there was a relative increase in the proportion of bacteria capable of Fe(III) reduction, with Geothrix fermentans and Geobacter sp. identified in the 0.5-Gy h−1 and 30-Gy h−1 treatments, respectively. These results indicate that biogeochemical processes will likely not be restricted by dose rates in such environments, and electron accepting processes may even be stimulated by radiation. PMID:25841009

  5. Gamma radiation influence on technological characteristics of wheat flour

    NASA Astrophysics Data System (ADS)

    Teixeira, Christian A. H. M.; Inamura, Patricia Y.; Uehara, Vanessa B.; Mastro, Nelida L. d.

    2012-08-01

    This study aimed at determining the influence of gamma radiation on technological characteristics of wheat (Triticum sativum) flour and physical properties of pan breads made with this flour. The bread formulation included wheat flour, water, milk, salt, sugar, yeast and butter. The α-amylase activity of wheat flour irradiated with 1, 3 and 9 kGy in a Gammacell 220 (AECL), one day, five days and one month after irradiation was evaluated. Deformation force, height and weight of breads prepared with the irradiated flour were also determined. The enzymatic activity increased—reduction of falling number time—as radiation dose increased, their values being 397 s (0 kGy), 388 s (1 kGy), 343 s (3 kGy) and 293 s (9 kGy) respectively, remaining almost constant over the period of one month. Pan breads prepared with irradiated wheat flour showed increased weight. Texture analysis showed that bread made of irradiated flour presented an increase in maximum deformation force. The results indicate that wheat flour ionizing radiation processing may confer increased enzymatic activity on bread making and depending on the irradiation dose, an increase in weight, height and deformation force parameters of pan breads made of it.

  6. Neutron and gamma radiation shielding material, structure, and process of making structure

    DOEpatents

    Hondorp, Hugh L. (Princeton Junction, NJ)

    1984-01-01

    The present invention is directed to a novel neutron and gamma radiation elding material consisting of 95 to 97 percent by weight SiO.sub.2 and 5 to 3 percent by weight sodium silicate. In addition, the method of using this composition to provide a continuous neutron and gamma radiation shielding structure is disclosed.

  7. Population doses from environmental gamma radiation in Iraq

    SciTech Connect

    Marouf, B.A.; Mohamad, A.S.; Taha, J.S.; al-Haddad, I.K. )

    1992-05-01

    The exposure rates due to external gamma radiation were measured in 11 Iraqi governerates. Measurements were performed with an Environmental Monitoring System (RSS-111) in open air 1 m above the ground. The average absorbed dose rate in each governerate was as follows (number x 10(-2) microGy h-1): Babylon (6.0), Kerbala (5.3), Al-Najaf (5.4), Al-Kadysia (6.5), Wasit (6.5), Diala (6.5), Al-Anbar (6.5), Al-Muthana (6.6), Maisan (6.8), Thee-Kar (6.6), and Al-Basrah (6.5). The collective doses to the population living in these governerates were 499, 187, 239, 269, 262, 458, 384, 153, 250, 450, and 419 person-Sv, respectively.

  8. [Interferon gamma as a regulator of immune cell function].

    PubMed

    Szuster-Ciesielska, A; Kandefer-Szerszeń, M

    1999-01-01

    The article reviews the literature with regard to identification of lymphocyte subsets that respond to specific inducers and produce IFN-gamma, the structure of IFN-gamma gene, the IFN signal transduction pathway that initiates biochemical changes at cellular level and influences the function of immunocompetent cells: mononuclear phagocytes, T and B lymphocytes. The interaction of IFN-gamma with other cytokines in regulation of immune response is also discussed. PMID:10352545

  9. Survival of mouse testicular stem cells after. gamma. or neutron irradiation

    SciTech Connect

    Lu, C.C.; Meistrich, M.L.; Thames, H.D. Jr.

    1980-03-01

    The survival of mouse testicular stem cells after ..gamma.. or neutron irradiation was measured by counts of repopulated tubular cross sections and by the numbers of differentiated spermatogenic cells produced. The numbers of such cells were determined either by sperm head counts of the X-isozyme of lactate dehydrogenase enzyme levels. Qualitatively similar results were obtained with all three assays. The results have confirmed that, with C3H mice, stem-cell survival is higher when the ..gamma..-radiation dose is fractionated by a 24-h interval. Single-dose ..gamma..-radiaton survival curves for the stem cell had large shoulders and also showed the presence of a radioresistant subpopulation which predominated after doses greater than 600 rad. Part of the shoulder must have resulted from repair of sublethal damage since neutron irradiation produced survival curves with smaller shoulders. The relative biological effectiveness for stem-cell killing for these neutrons (mean energy, 22 MeV) varied from about 2.9 at 10 rad of ..gamma.. radiation to 2.2 at 600 rad.

  10. Cytoskeletal and functional changes in bioreactor assembled thyroid tissue organoids exposed to gamma radiation

    NASA Technical Reports Server (NTRS)

    Green, Lora M.; Patel, Zarana; Murray, Deborah K.; Rightnar, Steven; Burell, Cheryl G.; Gridley, Daila S.; Nelson, Gregory A.

    2002-01-01

    Fischer rat thyroid cells were grown under low-shear stress in a bioreactor to a stage of organization composed of integrated follicles resembling small thyroid glands prior to exposure to 3 Gray-gamma radiation. Bioreactor tissues and controls (both irradiated and non-irradiated) were harvested at 24, 48, 96 and 144 hours post-exposure. Tissue samples were fixed and fluorescently labeled for actin and microtubules. Tissues were assessed for changes in cytoskeletal components induced by radiation and quantified by laser scanning cytometry. ELISA's were used to quantify transforming growth factor-beta and thyroxin released from cells to the culture supernatant. Tissue architecture was disrupted by exposure to radiation with the structural organization of actin and loss of follicular content the most obviously affected. With time post-irradiation the actin appeared disordered and the levels of fluorescence associated with filamentous-actin and microtubules cycled in the tissue analogs, but not in the flask-grown cultures. Active transforming growth factor-beta was higher in supernatants from the irradiated bioreactor tissue. Thyroxin release paralleled cell survival in the bioreactors and control cultures. Thus, the engineered tissue responses to radiation differed from those of conventional tissue culture making it a potentially better mimic of the in vivo situation.

  11. Consequences of Lethal-Whole-Body Gamma Radiation and Possible Ameliorative Role of Melatonin

    PubMed Central

    Mihandoost, Ehsan; Shirazi, Alireza; Mahdavi, Seied Rabie; Aliasgharzadeh, Akbar

    2014-01-01

    Gamma radiation induces the generation of free radicals, leading to serious cellular damages in biological systems. Radioprotectors act as prophylactic agents that are administered to shield normal cells and tissues from the deleterious effects of radiation. Melatonin synergistically acts as an immune-stimulator and antioxidant. We investigated the possible radioprotective role of melatonin (100 mg/kg i.p.) against lethal-whole-body radiation- (10 Gy) induced sickness, body weight loss, and mortality in rats. Results of the present study suggest that exposure to lethal-whole-body radiation incurred mortality, body weight loss, and apoptosis and it also depleted the immunity and the antioxidant status of the rats. Our results show that melatonin pretreatment provides protection against radiation induced mortality, oxidative stress, and immune-suppression. The melatonin pretreated irradiated rats showed less change in body weight as compared to radiation only group. On the other hand, melatonin appeared to have another radioprotective role, suggesting that melatonin may reduce apoptosis through a caspase-3-mediated pathway by blocking caspase-3 activity. PMID:25431791

  12. Cell Phone RF Radiation

    NASA Astrophysics Data System (ADS)

    Abdul-Razzaq, Wathiq

    2015-04-01

    In a recent article in Physics Today, Meredith and Redish emphasized the need to make introductory physics courses beneficial for life sciences majors.1 In this study, a lab activity is proposed to measure the intensity of electromagnetic waves emitted by cell phones and connect these measurements to various standards, biological topics, and personal health.

  13. Cell Phone RF Radiation

    ERIC Educational Resources Information Center

    Abdul-Razzaq, Wathiq

    2015-01-01

    In a recent article in "Physics Today," Meredith and Redish emphasized the need to make introductory physics courses beneficial for life sciences majors. In this study, a lab activity is proposed to measure the intensity of electromagnetic waves emitted by cell phones and connect these measurements to various standards, biological…

  14. Cell Phone RF Radiation

    ERIC Educational Resources Information Center

    Abdul-Razzaq, Wathiq

    2015-01-01

    In a recent article in "Physics Today," Meredith and Redish emphasized the need to make introductory physics courses beneficial for life sciences majors. In this study, a lab activity is proposed to measure the intensity of electromagnetic waves emitted by cell phones and connect these measurements to various standards, biological

  15. JITTER RADIATION MODEL OF THE CRAB GAMMA-RAY FLARES

    SciTech Connect

    Teraki, Yuto; Takahara, Fumio

    2013-02-15

    The gamma-ray flares of the Crab nebula detected by the Fermi and AGILE satellites challenge our understanding of the physics of pulsars and their nebulae. The central problem is that the peak energy of the flares exceeds the maximum energy E {sub c} determined by synchrotron radiation loss. However, when turbulent magnetic fields exist with scales {lambda}{sub B} smaller than 2{pi}mc {sup 2}/eB, jitter radiation can emit photons with energies higher than E {sub c}. The scale required for the Crab flares is about two orders of magnitude less than the wavelength of the striped wind. We discuss a model in which the flares are triggered by plunging the high-density blobs into the termination shock. The observed hard spectral shape may be explained by the jitter mechanism. We make three observational predictions: first, the polarization degree will become lower in flares; second, no counterpart will be seen in TeV-PeV range; and third, the flare spectrum will not be harder than {nu}F {sub {nu}}{proportional_to}{nu}{sup 1}.

  16. Mediate gamma radiation effects on some packaged food items

    NASA Astrophysics Data System (ADS)

    Inamura, Patricia Y.; Uehara, Vanessa B.; Teixeira, Christian A. H. M.; del Mastro, Nelida L.

    2012-08-01

    For most of prepackaged foods a 10 kGy radiation dose is considered the maximum dose needed; however, the commercially available and practically accepted packaging materials must be suitable for such application. This work describes the application of ionizing radiation on several packaged food items, using 5 dehydrated food items, 5 ready-to-eat meals and 5 ready-to-eat food items irradiated in a 60Co gamma source with a 3 kGy dose. The quality evaluation of the irradiated samples was performed 2 and 8 months after irradiation. Microbiological analysis (bacteria, fungus and yeast load) was performed. The sensory characteristics were established for appearance, aroma, texture and flavor attributes were also established. From these data, the acceptability of all irradiated items was obtained. All ready-to-eat food items assayed like manioc flour, some pâtés and blocks of raw brown sugar and most of ready-to-eat meals like sausages and chicken with legumes were considered acceptable for microbial and sensory characteristics. On the other hand, the dehydrated food items chosen for this study, such as dehydrated bacon potatoes or pea soups were not accepted by the sensory analysis. A careful dose choice and special irradiation conditions must be used in order to achieve sensory acceptability needed for the commercialization of specific irradiated food items.

  17. Effect of gamma radiation and oregano essential oil on murein and ATP concentration of Listeria monocytogenes.

    PubMed

    Caillet, Stphane; Lacroix, Monique

    2006-12-01

    The effects of gamma radiation and of oregano essential oil alone or in combination with radiation on murein composition of Listeria monocytogenes and on the intracellular and extracellular concentration of ATP were evaluated. The bacterial strain was treated with two radiation doses, 1.2 kGy to induce cell damage and 3.5 kGy to cause cell death. Oregano essential oil was used at 0.020 and 0.025% (wt/vol), which is the MIC. All treatments had a significant effect (P < or = 0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment influenced differently the relative percentage and number of muropeptides. There was a significant correlation (P < or = 0.05) between the reduction of intracellular ATP and increase in extracellular ATP, following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when essential oil was combined with irradiation, but irradiation of L. monocytogenes alone induced a significant decrease (P < or = 0.05) of the internal ATP without affecting the external ATP. Transmission electron microscopic observation revealed that oregano oil and irradiation have an effect on cell wall structure. PMID:17186665

  18. Cell death is induced by ciglitazone, a peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonist, independently of PPAR{gamma} in human glioma cells

    SciTech Connect

    Lee, Myoung Woo; Kim, Dae Seong; Kim, Hye Ryung; Kim, Hye Jin; Yang, Jin Mo; Ryu, Somi; Noh, Yoo Hun; Lee, Soo Hyun; Son, Meong Hi; Jung, Hye Lim; Yoo, Keon Hee; Koo, Hong Hoe; Sung, Ki Woong

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Greater than 30 {mu}M ciglitazone induces cell death in glioma cells. Black-Right-Pointing-Pointer Cell death by ciglitazone is independent of PPAR{gamma} in glioma cells. Black-Right-Pointing-Pointer CGZ induces cell death by the loss of MMP via decreased Akt. -- Abstract: Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) regulates multiple signaling pathways, and its agonists induce apoptosis in various cancer cells. However, their role in cell death is unclear. In this study, the relationship between ciglitazone (CGZ) and PPAR{gamma} in CGZ-induced cell death was examined. At concentrations of greater than 30 {mu}M, CGZ, a synthetic PPAR{gamma} agonist, activated caspase-3 and induced apoptosis in T98G cells. Treatment of T98G cells with less than 30 {mu}M CGZ effectively induced cell death after pretreatment with 30 {mu}M of the PPAR{gamma} antagonist GW9662, although GW9662 alone did not induce cell death. This cell death was also observed when cells were co-treated with CGZ and GW9662, but was not observed when cells were treated with CGZ prior to GW9662. In cells in which PPAR{gamma} was down-regulated cells by siRNA, lower concentrations of CGZ (<30 {mu}M) were sufficient to induce cell death, although higher concentrations of CGZ ( Greater-Than-Or-Slanted-Equal-To 30 {mu}M) were required to induce cell death in control T98G cells, indicating that CGZ effectively induces cell death in T98G cells independently of PPAR{gamma}. Treatment with GW9662 followed by CGZ resulted in a down-regulation of Akt activity and the loss of mitochondrial membrane potential (MMP), which was accompanied by a decrease in Bcl-2 expression and an increase in Bid cleavage. These data suggest that CGZ is capable of inducing apoptotic cell death independently of PPAR{gamma} in glioma cells, by down-regulating Akt activity and inducing MMP collapse.

  19. Progenitors Mobilized by Gamma-Tocotrienol as an Effective Radiation Countermeasure

    PubMed Central

    Singh, Vijay K.; Wise, Stephen Y.; Fatanmi, Oluseyi O.; Scott, Jessica; Romaine, Patricia L. P.; Newman, Victoria L.; Verma, Amit; Elliott, Thomas B.; Seed, Thomas M.

    2014-01-01

    The purpose of this study was to elucidate the role of gamma-tocotrienol (GT3)-mobilized progenitors in mitigating damage to mice exposed to a supralethal dose of cobalt-60 gamma-radiation. CD2F1 mice were transfused 24 h post-irradiation with whole blood or isolated peripheral blood mononuclear cells (PBMC) from donors that had received GT3 72 h prior to blood collection and recipient mice were monitored for 30 days. To understand the role of GT3-induced granulocyte colony-stimulating factor (G-CSF) in mobilizing progenitors, donor mice were administered a neutralizing antibody specific to G-CSF or its isotype before blood collection. Bacterial translocation from gut to heart, spleen and liver of irradiated recipient mice was evaluated by bacterial culture on enriched and selective agar media. Endotoxin in serum samples also was measured. We also analyzed the colony-forming units in the spleens of irradiated mice. Our results demonstrate that whole blood or PBMC from GT3-administered mice mitigated radiation injury when administered 24 h post-irradiation. Furthermore, administration of a G-CSF antibody to GT3-injected mice abrogated the efficacy of blood or PBMC obtained from such donors. Additionally, GT3-mobilized PBMC inhibited the translocation of intestinal bacteria to the heart, spleen, and liver, and increased colony forming unit-spleen (CFU-S) numbers in irradiated mice. Our data suggests that GT3 induces G-CSF, which mobilizes progenitors and these progenitors mitigate radiation injury in recipient mice. This approach using mobilized progenitor cells from GT3-injected donors could be a potential treatment for humans exposed to high doses of radiation. PMID:25423021

  20. The effect of gamma radiation on the ultrastructure of sweet potatoes (Ipomoea batatas)

    SciTech Connect

    Brown, A.

    1986-12-01

    Radiation is being used to increase the storage life of fresh foods. Various doses of gamma radiation were administered to Jewel cultivar sweet potatoes and the effects were monitored by direct observation and by scanning and transmission electron microscopy. Potatoes were divided into two groups: those irradiated immediately after harvest (doses = 0 kGy - 0.4 KGy) and those irradiated one week after harvest (doses = 0 kGy - 0.4 kGy). Potatoes were examined and viewed each month for 7 months. Gross observations included weight, color and texture of the sweet potatoes. Those potatoes irradiated immediately after harvest spoiled faster than those irradiated one week after harvest. Scanning electron microscopy demonstrated several cellular modifications accompanying spoilage. Cell collapse was greatest at the higher radiation doses during the periods of 1 to 5 months post-irradiation. The shape and size of starch granules varied with storage time and radiation levels. The mitochondria, cell walls and plasma membranes appeared normal as seen by transmission electron microscopy until 6 months post-irradiation for potatoes irradiated both immediately after harvest and one week after harvest. Thereafter, degradative changes were observed.

  1. Gamma radiation from blazar PKS 0537-441

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Bertsch, D. L.; Fichtel, C. E.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kniffen, D. A.; Kwok, P. W.; Lin, Y. C.; Mattox, J. R.

    1993-01-01

    The Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (CGRO) observed high-energy gamma rays from PKS 0537-441 during observations in 1991 July-August. Upper limits from later EGRET observations suggest time variability.

  2. Rapid and transient activation of gamma/delta T cells to interferon gamma production, NK cell-like killing and antigen processing during acute virus infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gamma/delta T cells are the majority peripheral blood T cells in young cattle. The role of gamma/delta T cells in innate responses against infection with foot-and-mouth disease virus (FMDV) was analyzed on 5 consecutive days following infection. Before infection, bovine gamma/delta T cells expressed...

  3. Gamma-ray radiation response at 1550 nm of fluorine-doped radiation hard single-mode optical fiber.

    PubMed

    Kim, Youngwoong; Ju, Seongmin; Jeong, Seongmook; Lee, Seung Ho; Han, Won-Taek

    2016-02-22

    We have investigated gamma-ray radiation response at 1550 nm of fluorine-doped radiation hard single-mode optical fiber. Radiation-induced attenuation (RIA) of the optical fiber was measured under intermittent gamma-ray irradiations with dose rate of ~10 kGy/h. No radiation hardening effect on the RIA by the gamma-ray pre-dose was found when the exposed fiber was bleached for long periods of time (27~47 days) at room-temperature. Photo-bleaching scheme upon 980 nm LD pumping has proven to be an effective deterrent to the RIA, particularly by suppressing the incipient RIA due to room-temperature unstable self-trapped hole defects (STHs). Large temperature dependence of the RIA of the optical fiber together with the photo-bleaching effect are worthy of note for reinforcing its radiation hard characteristics. PMID:26907044

  4. Gamma irradiation induced apoptotic changes in the chromatin structure of human erythroleukemia K562 cells.

    PubMed

    Banfalvi, Gaspar; Klaisz, Mariann; Ujvarosi, Kinga; Trencsenyi, Gyorgy; Rozsa, David; Nagy, Gabor

    2007-12-01

    Exponentially growing human erythroleukemia K562 cells were synchronized by centrifugal elutriation prior to and after Co60 gamma-irradiation (4 Gy). Forward scatter flow cytometry used for size analysis revealed the increase of an early apoptotic cell population ranging from lower (0.05 C-value) to higher DNA content (approximately 1 C) as the cells progressed through the S phase. The increase in cellular DNA content expressed in C-values correlated with apoptotic chromatin changes manifested as many small apoptotic bodies in early S phase and larger but less numerous disintegrated apoptotic bodies in late S phase. Most significant changes after exposure to gamma-irradiation took place in early S phase resulting in an increase of nuclear size by more than 50%. Cell fractions containing irradiated cells showed enhanced growth arrest at 2.4 C-value, which was accompanied by apoptosis. Apoptotic cell cycle arrest near to the G1/G0 checkpoint and apoptotic changes indicate that the radiation resistance of K562 cells is related to the bypass of the early stage of the p53 apoptotic pathway. Apoptotic changes in chromatin structure induced by gamma-irradiation indicate that these injury-specific changes can be identified and distinguished from chromatin changes induced by UV radiation or heavy metals. PMID:17924194

  5. Effect of gamma radiation on the growth, survival, hematology and histological parameters of rainbow trout (Oncorhynchus mykiss) larvae.

    PubMed

    Oujifard, Amin; Amiri, Roghayeh; Shahhosseini, Gholamreza; Davoodi, Reza; Moghaddam, Jamshid Amiri

    2015-08-01

    Effects of low (1, 2.5 and 5Gy) and high doses (10, 20 and 40Gy) of gamma radiation were examined on the growth, survival, blood parameters and morphological changes of the intestines of rainbow trout (Oncorhynchus mykiss) larvae (10320mg) after 12 weeks of exposure. Negative effects of gamma radiation on growth and survival were observed as radiation level and time increased. Changes were well documented at 10 and 20Gy. All the fish were dead at the dose of 40Gy. In all the treatments, levels of red blood cells (RBC), hematocrit (HCT) and hemoglobin (HB) were significantly (P<0.05) declined as the irradiation levels increased, whereas the amount of mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) did not change. No significant differences (P>0.05) were found in the levels of white blood cells (WBC), lymphocytes and monocytes. Destruction of the intestinal epithelium cells was indicated as the irradiation levels increased to 1Gy and above. The highest levels of growth, survival, specific growth rate (SGR), condition factor (CF) and protein efficiency rate (PER) were obtained in the control treatment. The results showed that gamma rays can be a potential means for damaging rainbow trout cells. PMID:26141584

  6. Radiation Metabolomics: Identification of Minimally Invasive Urine Biomarkers for Gamma-Radiation Exposure in Mice

    PubMed Central

    Tyburski, John B.; Patterson, Andrew D.; Krausz, Kristopher W.; Slavk, Josef; Fornace, Albert J.; Gonzalez, Frank J.; Idle, Jeffrey R.

    2008-01-01

    Gamma-radiation exposure has both short- and long-term adverse health effects. The threat of modern terrorism places human populations at risk for radiological exposures, yet current medical countermeasures to radiation exposure are limited. Here we describe metabolomics for ?-radiation biodosimetry in a mouse model. Mice were ?-irradiated at doses of 0, 3 and 8 Gy (2.57 Gy/min), and urine samples collected over the first 24 h after exposure were analyzed by ultra-performance liquid chromatographytime-of-flight mass spectrometry (UPLCTOFMS). Multivariate data were analyzed by orthogonal partial least squares (OPLS). Both 3- and 8-Gy exposures yielded distinct urine metabolomic phenotypes. The top 22 ions for 3 and 8 Gy were analyzed further, including tandem mass spectrometric comparison with authentic standards, revealing that N-hexanoylglycine and ?-thymidine are urinary biomarkers of exposure to 3 and 8 Gy, 3-hydroxy-2-methylbenzoic acid 3-O-sulfate is elevated in urine of mice exposed to 3 but not 8 Gy, and taurine is elevated after 8 but not 3 Gy. Gene Expression Dynamics Inspector (GEDI) self-organizing maps showed clear doseresponse relationships for subsets of the urine metabolome. This approach is useful for identifying mice exposed to ? radiation and for developing metabolomic strategies for noninvasive radiation biodosimetry in humans. PMID:18582157

  7. Natural gamma-radiation in the Aeolian volcanic arc.

    PubMed

    Chiozzi, P; Pasquale, V; Verdoya, M; Minato, S

    2001-11-01

    Pulse-height distributions of gamma-rays, obtained with a field NaI(Tl) scintillation spectrometer in numerous sites of the Lipari and Vulcano islands (Aeolian volcanic arc, Italy), were measured to determine the U, Th and K concentrations of the bedrock and the relative values of the air absorbed dose rate. U is spatially related to both Th and K and the Th/U ratio is on average 3.1-3.5. The magmatic evolution is reflected by the concentration of the three radioelements, as they are more abundant within the more felsic units of the volcanic series. The higher values of U (15.7-20.0 ppm) coincide with higher Th (48.3-65.9 ppm) and K (4.9-6.1%) concentrations associated with rhyolitic rocks of the third cycle (< 50 ky). The air absorbed dose rate varies from 20 to 470 nGy h(-1). The highest values (> 350 nGy h(-1)) are observed on outcrops of rhyolitic obsidian lava flows. The cosmic-ray contribution is also evaluated to estimate the total background radiation dose rate. PMID:11573810

  8. Gamma radiation effect on gas production in anion exchange resins

    NASA Astrophysics Data System (ADS)

    Traboulsi, A.; Labed, V.; Dauvois, V.; Dupuy, N.; Rebufa, C.

    2013-10-01

    Radiation-induced decomposition of Amberlite IRA400 anion exchange resin in hydroxide form by gamma radiolysis has been studied at various doses in different atmospheres (anaerobic, anaerobic with liquid water, and aerobic). The effect of these parameters on the degradation of ion exchange resins is rarely investigated in the literature. We focused on the radiolysis gases produced by resin degradation. When the resin was irradiated under anaerobic conditions with liquid water, the liquid phase over the resin was also analyzed to identify any possible water-soluble products released by degradation of the resin. The main products released are trimethylamine (TMA), molecular hydrogen (H2g) and carbon dioxide (CO2g). TMA and H2g are produced in all the irradiation atmospheres. However, TMA was in gaseous form under anaerobic and aerobic conditions and in aqueous form in presence of liquid water. In the latter conditions, TMAaq was associated with aqueous dimethylamine (DMAaq), monomethylamine (MMAaq) and ammonia (NH). CO2g is formed in the presence of oxygen due to oxidation of organic compounds present in the system, in particular the degradation products such as TMAg.

  9. Corrosion of copper-based materials in gamma radiation

    SciTech Connect

    Yunker, W.H.

    1986-06-01

    The corrosion behaviors of pure copper (CDA 101), 7% aluminum-copper bronze (CDA 613) and 30% nickel-copper (CDA 715) are being studied in a gamma radiation field of 1 x 10{sup 5} R/h. These studies are in support of the Nevada Nuclear Waste Storage Investigations (NNWSI) Project, by Lawrence Livermore National Laboratory (LLNL), of copper-based materials for possible use in container systems for the permanent geologic burial of nuclear waste. Weight loss, tear drop (stressed), and crevice specimens of the three materials were exposed to water vapor-air atmospheres at 95{sup 0}C and 150{sup 0}C and to liquid water at 95{sup 0}C for periods of one, three, and six months. Longer exposures are in progress. Measurements include: changes in the chemical composition of the gas and water, specimen weight changes, oxide film weights, evidence of microcracking and crevice corrosion, and chemical composition of the oxide films by Auger electron spectroscopy and x-ray diffraction. Interim results show considerable pit and under-film corrosion of alloys CDA 613 and CDA 715. Uniform corrosion rates range from 0.012 mil/yr (0.30 {mu}m/yr) to 0.22 mil/yr (5.6 {mu}m/yr), based on specimen weight losses during six- and seven-month exposures. The time dependencies will be determined as more data become available.

  10. APPLICATION OF JITTER RADIATION: GAMMA-RAY BURST PROMPT POLARIZATION

    SciTech Connect

    Mao, Jirong; Wang, Jiancheng

    2013-10-10

    A high degree of polarization of gamma-ray burst (GRB) prompt emission has been confirmed in recent years. In this paper, we apply jitter radiation to study the polarization feature of GRB prompt emission. In our framework, relativistic electrons are accelerated by turbulent acceleration. Random and small-scale magnetic fields are generated by turbulence. We further determine that the polarization property of GRB prompt emission is governed by the configuration of the random and small-scale magnetic fields. A two-dimensional compressed slab, which contains a stochastic magnetic field, is applied in our model. If the jitter condition is satisfied, the electron deflection angle in the magnetic field is very small and the electron trajectory can be treated as a straight line. A high degree of polarization can be achieved when the angle between the line of sight and the slab plane is small. Moreover, micro-emitters with mini-jet structures are considered to be within a bulk GRB jet. The jet 'off-axis' effect is intensely sensitive to the observed polarization degree. We discuss the depolarization effect on GRB prompt emission and afterglow. We also speculate that the rapid variability of GRB prompt polarization may be correlated with the stochastic variability of the turbulent dynamo or the magnetic reconnection of plasmas.

  11. Hydrogel membranes of PVAl/ clay by gamma radiation

    NASA Astrophysics Data System (ADS)

    de Oliveira, M. J. A.; Parra, D. F.; Amato, V. S.; Lugão, A. B.

    2013-03-01

    In the last decades several studies concerning the new methods for drug delivery system have been investigated. A new field known as "smart therapy" involves devices and drug delivery systems to detect, identify and treat the site affected by the disease, not interfering with the biological system. Cutaneous Leishmaniasis is an endemic disease that is characterized by the development of single or multiple localized lesions on exposed areas of skin and one coetaneous treatment could be a potential solution. The aim of this study was to obtain polymeric hydrogel matrices of poly(vinylalcohol)(PVAl) and chitosan with inorganic nanoparticles, which can release a drug according to the need of the treatment of injury caused by leishmania on the skin. The hydrogels matrices were obtained with PVAl/ chitosan and PVAl/ chitosan 0.5; 1.0 and 1.5% laponite RD clay, crosslinked by ionizing gamma radiation with dose of 25 kGy. The techniques used for characterization were swelling, gel fraction, Fourier transform infrared spectroscopy (FTIR) and thermogravimetry (TGA). After synthesis, the samples were immersed in distilled water and weighed in periods of time until 60 h for the swelling determination. The obtained results have indicated that the swelling of the membranes increases with clay concentration, in consequence of ionic groups present in the clay.

  12. Effects of Dietary Iron and Gamma Radiation on the Rat Retina

    NASA Technical Reports Server (NTRS)

    Morgan, Jennifer; Marshall, Grace; Theriot, Corey A.; Chacon, Natalia; Zwart, Sara; Zanello, Susana B.

    2012-01-01

    A health risk of concern for NASA relates to radiation exposure and its synergistic effects with other space environmental factors, includi ng nutritional status of the crew. Astronauts consume almost three times the recommended daily allowance of iron due to the use of fortifie d foods aboard the International Space Station, with iron intake occa sionally exceeding six times the recommended values. Recently, NASA has become concerned with visual changes associated with spaceflight, a nd research is being conducted to elucidate the etiology of eye structure alterations in the spaceflight environment. Terrestrially, iron o verload is also associated with certain optic neuropathies. In additi on, due to its role in Fenton reactions, iron can potentiate oxidative stress, which is a recognized cause of cataract formation. As part o f a study investigating the combined effects of radiation exposure an d iron overload on multiple physiological systems, we focused on defining the effects of both treatments on eye biology. In this study, 12- week-old Sprague-Dawley rats were assigned to one of four experimental groups: normal iron/no radiation (Control/Sham), high iron/no radiat ion (Fe/Sham), normal iron/gamma radiation (3 Gy cumulative dose, fra ctionated at 0.375 Gy/d every other day for 16 d) (Control/Rad), and high iron/gamma radiation (Fe/Rad). Oxidative stress-induced DNA damag e, measured as concentration of the marker 8-hydroxy-2'-deoxyguanosine (8OHdG) in eye retinal tissue by enzyme-immunoanalysis did not show significant changes among treatments. However, there was an overall i ncrease in 8OHdG immunostaining density in retina sections due to radiation exposure (P = 0.05). Increased dietary iron and radiation expos ure had an interactive effect (P = 0.02) on 8OHdG immunostaining of t he retinal ganglion cell layer with iron diet increasing the signal in the group not exposed to radiation (P = 0.05). qPCR gene expression profiling of relevant target genes indicated upregulation of ferritin light chain (P = 0.09) as a result of dietary iron but no change in e xpression of the gene for ferritin heavy chain. Immunolocalization of light chain and heavy chain of the iron storage protein ferritin showed the expected distribution in the choroid, photoreceptor layer, inn er nuclear layer and in the inner plexiform layer that corresponded t o the synaptic terminals of bipolar cells. Evidence of stress and damage in the retina was also suggested by a decrease in expression of th e survival marker Bcl2 (P = 0.01) and the protective proteins clusterin (P = 0.04) and heat shock factor 1 (Hsf1, P < 0.001), as a result o f increased dietary iron. The effect of increased iron on expression of the antioxidant enzyme heme oxygenase 1 (Hmox1) had a significant interaction with the effect of radiation (P < 0.001). In summary, the results of this study indicate that both gamma radiation exposure and a moderate increase in dietary iron can contribute to deleterious cha nges in retinal health and physiology.

  13. Effect of gamma radiation on Aspergillus flavus and Aspergillus ochraceus ultrastructure and mycotoxin production

    NASA Astrophysics Data System (ADS)

    Ribeiro, J.; Cavaglieri, L.; Vital, H.; Cristofolini, A.; Merkis, C.; Astoreca, A.; Orlando, J.; Carú, M.; Dalcero, A.; Rosa, C. A. R.

    2011-05-01

    The aim of this work was to study the effect of gamma radiation (2 kGy) on Aspergillus flavus and Aspergillus ochraceus ultrastructure. Moreover, the influence on aflatoxin B 1 and ochratoxin A production was also observed. Irradiated A. flavus strain showed a dull orangish colony while control strain showed the typical green color. Minor differences were observed on stipes, metulae and conidia size between control and irradiated A. flavus and A. ochraceus strains. Irradiated fungi showed ultrastructural changes on cell wall, plasmalema and cytoplasm levels. The levels of mycotoxins produced by irradiated strains were two times greater than those produced by control strains. Successive transferences of irradiated strains on malt extract agar allowed the fungus to recuperate morphological characteristics. Although minor changes in the fungal morphology were observed, ultrastructural changes at cell wall level and the increase of mycotoxin production ability were observed. Inappropriate storage of irradiated food and feed would allow the development of potentially more toxicogenic fungal propagules.

  14. Some neutron and gamma radiation characteristics of plutonium cermet fuel for isotopic power sources

    NASA Technical Reports Server (NTRS)

    Neff, R. A.; Anderson, M. E.; Campbell, A. R.; Haas, F. X.

    1972-01-01

    Gamma and neutron measurements on various types of plutonium sources are presented in order to show the effects of O-17, O-18 F-19, Pu-236, age of the fuel, and size of the source on the gamma and neutron spectra. Analysis of the radiation measurements shows that fluorine is the main contributor to the neutron yields from present plutonium-molybdenum cermet fuel, while both fluorine and Pu-236 daughters contribute significantly to the gamma ray intensities.

  15. Development of an alpha/beta/gamma detector for radiation monitoring

    SciTech Connect

    Yamamoto, Seiichi; Hatazawa, Jun

    2011-11-15

    For radiation monitoring at the site of nuclear power plant accidents such as Fukushima Daiichi, radiation detectors not only for gamma photons but also for alpha and beta particles are needed because some nuclear fission products emit beta particles and gamma photons and some nuclear fuels contain plutonium that emits alpha particles. We developed a radiation detector that can simultaneously monitor alpha and beta particles and gamma photons for radiation monitoring. The detector consists of three-layered scintillators optically coupled to each other and coupled to a photomultiplier tube. The first layer, which is made of a thin plastic scintillator (decay time: 2.4 ns), detects alpha particles. The second layer, which is made of a thin Gd{sub 2}SiO{sub 5} (GSO) scintillator with 1.5 mol.% Ce (decay time: 35 ns), detects beta particles. The third layer made of a thin GSO scintillator with 0.4 mol.% Ce (decay time: 70 ns) detects gamma photons. By using pulse shape discrimination, the count rates of these layers can be separated. With individual irradiation of alpha and beta particles and gamma photons, the count rate of the first layer represented the alpha particles, the second layer represented the beta particles, and the third layer represented the gamma photons. Even with simultaneous irradiation of the alpha and beta particles and the gamma photons, these three types of radiation can be individually monitored using correction for the gamma detection efficiency of the second and third layers. Our developed alpha, beta, and gamma detector is simple and will be useful for radiation monitoring, especially at nuclear power plant accident sites or other applications where the simultaneous measurements of alpha and beta particles and gamma photons are required.

  16. Detection system for high-resolution gamma radiation spectroscopy with neutron time-of-flight filtering

    DOEpatents

    Dioszegi, Istvan; Salwen, Cynthia; Vanier, Peter

    2014-12-30

    A .gamma.-radiation detection system that includes at least one semiconductor detector such as HPGe-Detector, a position-sensitive .alpha.-Detector, a TOF Controller, and a Digitizer/Integrator. The Digitizer/Integrator starts to process the energy signals of a .gamma.-radiation sent from the HPGe-Detector instantly when the HPGe-Detector detects the .gamma.-radiation. Subsequently, it is determined whether a coincidence exists between the .alpha.-particles and .gamma.-radiation signal, based on a determination of the time-of-flight of neutrons obtained from the .alpha.-Detector and the HPGe-Detector. If it is determined that the time-of-flight falls within a predetermined coincidence window, the Digitizer/Integrator is allowed to continue and complete the energy signal processing. If, however, there is no coincidence, the Digitizer/Integrator is instructed to be clear and reset its operation instantly.

  17. A gamma-ray testing technique for spacecraft. [considering cosmic radiation effects

    NASA Technical Reports Server (NTRS)

    Gribov, B. S.; Repin, N. N.; Sakovich, V. A.; Sakharov, V. M.

    1977-01-01

    The simulated cosmic radiation effect on a spacecraft structure is evaluated by gamma ray testing in relation to structural thickness. A drawing of the test set-up is provided and measurement errors are discussed.

  18. Effect of Gamma Radiation on Zinc Tolerance Efficiency of Aspergillus terreus Thorn.

    PubMed

    Das, Dipanwita; Chakraborty, A; Santra, S C

    2016-03-01

    The present study emphasizes the potential of gamma radiation in enhancing zinc tolerance of Aspergillus terreus. Gamma-exposed A. terreus could tolerate 1.13 times more Zn, reflecting higher growth (in terms of CFU) under Zn stress and enhanced Zn removal efficacies than their unirradiated counterparts. Radiation-induced upregulation of antioxidative system (SOD, CAT, GSH and MT) of A. terreus is responsible for radiation-induced enhancement of Zn tolerance. FTIR spectra reveals the involvement of functional groups in Zn biosorption; SEM study divulges the structural changes due to metal and gamma exposure and SEM-EDX depicts the Zn uptake by A. terreus (both in gamma-exposed and unexposed conditions). This work sheds light toward utilizing low doses of ionizing radiation for making more metal-tolerant fungi and the possible mechanisms adopted by A. terreus for being more metallo-resistant. PMID:26612034

  19. Influence of gamma radiation on microbiological parameters of the ethanolic fermentation of sugar-cane must

    NASA Astrophysics Data System (ADS)

    Alcarde, A. R.; Walder, J. M. M.; Horii, J.

    2003-04-01

    The influence of gamma radiation on reducing the population of some bacteria Bacillus and Lactobacillus that usually contaminate the sugar-cane must and its effects on acidity of the medium and viability of the yeast during fermentation were evaluated. The treatment with gamma radiation reduced the bacterial load of the sugar-cane must. Consequently, the volatile acidity produced during the fermentation of the must decreased and the viability of the yeast afterwards added increased.

  20. Airborne time-series measurement of soil moisture using terrestrial gamma radiation

    NASA Technical Reports Server (NTRS)

    Carroll, Thomas R.; Lipinski, Daniel M.; Peck, Eugene L.

    1988-01-01

    Terrestrial gamma radiation data and independent ground-based core soil moisture data are analyzed. They reveal the possibility of using natural terrestrial gamma radiation collected from a low-flying aircraft to make reliable real-time soil moisture measurements for the upper 20 cm of soil. The airborne data were compared to the crude ground-based soil moisture data set collected at the core sites.

  1. Pulsar and diffuse contributions to observed galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Harding, A. K.; Stecker, F. W.

    1981-01-01

    The first calculation of a gamma-ray production spectrum from pulsars in the Galaxy, along with a statistical analysis of data on 328 known radio pulsars, are presented. The implications of this point source contribution to the general interpretation of the observed galactic gamma-ray spectrum are indicated. The contributions from diffuse interstellar cosmic-ray induced production mechanisms are then re-examined, concluding that pulsars may be contributing significantly to the galactic gamma-ray emission.

  2. Occurrence in vivo of sister chromatid exchanges at the same locus in successive cell divisions caused by nonrepairable lesions induced by gamma rays

    SciTech Connect

    Morales-Ramirez, P.; Vallarino-Kelly, T.; Rodriguez-Reyes, R.

    1988-01-01

    The capacity of lesions induced by gamma radiation to produce sister chromatid exchanges (SCE) in successive divisions in mouse bone marrow cells in vivo was evaluated using a protocol for the three-way differentiation of sister chromatids. Evidence was obtained that exposure to gamma radiation induces DNA lesions that result in the formation of SCE at the same locus in two successive cell divisions. The relevance of this observation with respect to DNA repair and mutagenesis is discussed.

  3. Cellular and adenovirus dl312 DNA metabolism in cycling or mitotic human cultures exposed to supralethal gamma radiation

    PubMed Central

    1989-01-01

    Cellular repair of DNA damage due to lethal gamma irradiation was studied to reveal differences between strains and cell cycle stages that are otherwise difficult to detect. Cycling and metaphase-blocked cultures of normal fibroblasts and carcinoma cells were compared for repair of gamma sites (gamma radiation-induced nicks, breaks, and alkalilabile sites in DNA) at supralethal exposures ranging from 7 to 150 krad 137Cs radiation and at postirradiation incubations of 20-180 min. Fibroblasts from normal human skin or lung repaired gamma sites efficiently when cycling but did not repair them when blocked at mitosis. Bladder (253J) or lung (A549) carcinoma cells, unlike normal fibroblasts, repaired gamma sites efficiently even when blocked at mitosis. HeLa cells degraded their DNA soon after exposure at all doses tested, regardless of mitotic arrest. Whether the above differences in DNA repair between cell cycle stages and between strains result from differences in chromatin structure (cis effects) or from differences in the nuclear enzymatic environment (trans effects) could be resolved by placing an inert, extrachromosomal DNA molecule in the cell nucleus. Specifically, cis effects should be confined to the host chromosomes and would not be detected in the inert probe whereas trans effects should be detected in host chromosomes and inert probe DNA alike. Indeed, we found a suitable DNA molecule in the adenovirus deletion mutant dl312, which does not proliferate in the absence of E1A complementation. Gamma sites in 32P-labeled adenovirus dl312 DNA were repaired efficiently in all hosts, regardless of mitotic arrest. Failure of mitosis-arrested fibroblasts to repair gamma sites was therefore due to a cis effect of chromatin organization rather than to a trans effect such as repair enzyme insufficiency. In sharp contrast, chromosomes of mitotic carcinoma cells remained accessible to repair enzymes and nucleases alike. By means of these new tools, we should get a better understanding of higher-order chromatin management in normal and cancer cells. PMID:2808517

  4. Shelf life extension of fresh turmeric ( Curcuma longa L.) using gamma radiation

    NASA Astrophysics Data System (ADS)

    Dhanya, R.; Mishra, B. B.; Khaleel, K. M.; Cheruth, Abdul Jaleel

    2009-09-01

    Gamma radiation processing was found to extend shelf life of fresh turmeric. A 5 kGy radiation dose and 10 °C storage temperature was found to keep peeled turmeric samples microbe free and acceptable until 60 days of storage. The control sample without radiation treatment spoiled within a week of storage. The changes in color, texture and moisture content of fresh turmeric due to radiation treatment were found to be statistically insignificant.

  5. Gamma scattering in condensed matter with high intensity Moessbauer radiation

    SciTech Connect

    Not Available

    1990-01-01

    We give a progress report for the work which has been carried out in the last three years with DOE support. A facility for high-intensity Moessbauer scattering is now fully operational at the University of Missouri Research Reactor (MURR) as well as a facility at Purdue, using special isotopes produced at MURR. High precision, fundamental Moessbauer effect studies have been carried out using scattering to filter the unwanted radiation. These have led to a new Fourier transform method for describing Moessbauer effect (ME) lineshape and a direct method of fitting ME data to the convolution integral. These methods allow complete correction for source resonance self absorption (SRSA) and the accurate representation of interference effects that add an asymmetric component to the ME lines. We have begun applying these techniques to attenuated ME sources whose central peak has been attenuated by stationary resonant absorbers, to more precisely determine interference parameters and line-shape behavior in the resonance asymptotic region. This analysis is important to both the fundamental ME studies and to scattering studies for which a deconvolution is essential for extracting the correct recoilless fractions and interference parameters. A number of scattering studies have been successfully carried out including a study of the thermal diffuse scattering in Si, which led to an analysis of the resolution function for gamma-ray scattering. Also studied was the anharmonic motion in Na and the satellite reflection Debye-Waller factor in TaS{sub 2}, which indicate phason rather than phonon behavior. We have begun quasielastic diffusion studies in viscous liquids and current results are summarized. These advances, coupled to our improvements in MIcrofoil Conversion Electron spectroscopy lay the foundation for the proposed research outlined in this request for a three-year renewal of DOE support.

  6. Latexin sensitizes leukemogenic cells to gamma-irradiation-induced cell-cycle arrest and cell death through Rps3 pathway.

    PubMed

    You, Y; Wen, R; Pathak, R; Li, A; Li, W; St Clair, D; Hauer-Jensen, M; Zhou, D; Liang, Y

    2014-01-01

    Leukemia is a leading cause of cancer death. Recently, the latexin (Lxn) gene was identified as a potential tumor suppressor in several types of solid tumors and lymphoma, and Lxn expression was found to be absent or downregulated in leukemic cells. Whether Lxn functions as a tumor suppressor in leukemia and what molecular and cellular mechanisms are involved are unknown. In this study, the myeloid leukemogenic FDC-P1 cell line was used as a model system and Lxn was ectopically expressed in these cells. Using the protein pull-down assay and mass spectrometry, ribosomal protein subunit 3 (Rps3) was identified as a novel Lxn binding protein. Ectopic expression of Lxn inhibited FDC-P1 growth in vitro. More surprisingly, Lxn enhanced gamma irradiation-induced DNA damages and induced cell-cycle arrest and massive necrosis, leading to depletion of FDC-P1 cells. Mechanistically, Lxn inhibited the nuclear translocation of Rps3 upon radiation, resulting in abnormal mitotic spindle formation and chromosome instability. Rps3 knockdown increased the radiation sensitivity of FDC-P1, confirming that the mechanism of action of Lxn is mediated by Rps3 pathway. Moreover, Lxn enhanced the cytotoxicity of chemotherapeutic agent, VP-16, on FDC-P1 cells. Our study suggests that Lxn itself not only suppresses leukemic cell growth but also potentiates the cytotoxic effect of radio- and chemotherapy on cancer cells. Lxn could be a novel molecular target that improves the efficacy of anti-cancer therapy. PMID:25341047

  7. Latexin sensitizes leukemogenic cells to gamma-irradiation-induced cell-cycle arrest and cell death through Rps3 pathway

    PubMed Central

    You, Y; Wen, R; Pathak, R; Li, A; Li, W; St Clair, D; Hauer-Jensen, M; Zhou, D; Liang, Y

    2014-01-01

    Leukemia is a leading cause of cancer death. Recently, the latexin (Lxn) gene was identified as a potential tumor suppressor in several types of solid tumors and lymphoma, and Lxn expression was found to be absent or downregulated in leukemic cells. Whether Lxn functions as a tumor suppressor in leukemia and what molecular and cellular mechanisms are involved are unknown. In this study, the myeloid leukemogenic FDC-P1 cell line was used as a model system and Lxn was ectopically expressed in these cells. Using the protein pull-down assay and mass spectrometry, ribosomal protein subunit 3 (Rps3) was identified as a novel Lxn binding protein. Ectopic expression of Lxn inhibited FDC-P1 growth in vitro. More surprisingly, Lxn enhanced gamma irradiation-induced DNA damages and induced cell-cycle arrest and massive necrosis, leading to depletion of FDC-P1 cells. Mechanistically, Lxn inhibited the nuclear translocation of Rps3 upon radiation, resulting in abnormal mitotic spindle formation and chromosome instability. Rps3 knockdown increased the radiation sensitivity of FDC-P1, confirming that the mechanism of action of Lxn is mediated by Rps3 pathway. Moreover, Lxn enhanced the cytotoxicity of chemotherapeutic agent, VP-16, on FDC-P1 cells. Our study suggests that Lxn itself not only suppresses leukemic cell growth but also potentiates the cytotoxic effect of radio- and chemotherapy on cancer cells. Lxn could be a novel molecular target that improves the efficacy of anti-cancer therapy. PMID:25341047

  8. Effects of gamma radiation on raspberries: safety and quality issues.

    PubMed

    Verde, S Cabo; Trigo, M J; Sousa, M B; Ferreira, A; Ramos, A C; Nunes, I; Junqueira, C; Melo, R; Santos, P M P; Botelho, M L

    2013-01-01

    There is an ever-increasing global demand from consumers for high-quality foods with major emphasis placed on quality and safety attributes. One of the main demands that consumers display is for minimally processed, high-nutrition/low-energy natural foods with no or minimal chemical preservatives. The nutritional value of raspberry fruit is widely recognized. In particular, red raspberries are known to demonstrate a strong antioxidant capacity that might prove beneficial to human health by preventing free radical-induced oxidative stress. However, food products that are consumed raw, are increasingly being recognized as important vehicles for transmission of human pathogens. Food irradiation is one of the few technologies that address both food quality and safety by virtue of its ability to control spoilage and foodborne pathogenic microorganisms without significantly affecting sensory or other organoleptic attributes of the food. Food irradiation is well established as a physical, nonthermal treatment (cold pasteurization) that processes foods at or nearly at ambient temperature in the final packaging, reducing the possibility of cross contamination until the food is actually used by the consumer. The aim of this study was to evaluate effects of gamma radiation on raspberries in order to assess consequences of irradiation. Freshly packed raspberries (Rubus idaeus L.) were irradiated in a (60)Co source at several doses (0.5, 1, or 1.5 kGy). Bioburden, total phenolic content, antioxidant activity, physicochemical properties such as texture, color, pH, soluble solids content, and acidity, and sensorial parameters were assessed before and after irradiation and during storage time up to 14 d at 4C. Characterization of raspberries microbiota showed an average bioburden value of 10(4) colony-forming units (CFU)/g and a diverse microbial population predominantly composed of two morphological types (gram-negative, oxidase-negative rods, 35%, and filamentous fungi, 41%). The inactivation studies on the raspberries mesophilic population indicated a one log reduction of microbial load (95% inactivation efficiency for 1.5 kGy), in the surviving population mainly constituted by filamentous fungi (79-98%). The total phenolic content of raspberries indicated an increase with radiation doses and a decrease with storage time. The same trend was found for raspberries' antioxidant capacity with storage time. Regarding raspberries physicochemical properties, irradiation induced a significant decrease in firmness compared with nonirradiated fruit. However, nonirradiated and irradiated fruit presented similar physicochemical and sensory properties during storage time. Further studies are needed to elucidate the benefits of irradiation as a raspberries treatment process. PMID:23514071

  9. Nature of gamma rays background radiation in new and old buildings of Qatar University

    SciTech Connect

    Al-Houty, L.; Abou-Leila, H.; El-Kameesy, S. )

    1987-01-01

    Measurements and analysis of gamma-background radiation spectrum in four different places of Qatar University campus were performed at the energy range 10 keV-3 MeV using hyper pure Ge-detector. The dependence of the detector absolute photopeak efficiency on gamma-ray energies was determined and correction of the data for that was also done. The absorbed dose for each gamma line was calculated and an estimation of the total absorbed dose for the detected gamma lines in the four different places was obtained. Comparison with other results was also performed.

  10. EGRET Observations of High-Energy Gamma Radiation from PSR B1706-44

    NASA Astrophysics Data System (ADS)

    Thompson, D. J.; Bailes, M.; Bertsch, D. L.; Esposito, J. A.; Fichtel, C. E.; Harding, A. K.; Hartman, R. C.; Hunter, S. D.; Manchester, R. N.; Mattox, J. R.; von Montigny, C.; Mukherjee, R.; Ramanamurthy, P. V.; Sreekumar, P.; Fierro, J. M.; Lin, Y. C.; Michelson, P. F.; Nolan, P. L.; Kanbach, G.; Mayer-Hasselwander, H. A.; Merck, M.; Kniffen, D. A.; Schneid, E. J.; Kaspi, V. M.; Johnston, S.; Daugherty, J.; Ruderman, M.

    1996-07-01

    The Energetic Gamma-Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory has observed PSR B1706-44 a number of times between 1991 and 1995. From these data, a more detailed picture of the gamma radiation from this source has been developed, showing several characteristics that distinguish this pulsar from others: the light curve is complex, with evidence of three pulses; there is no detectable unpulsed emission; and the energy spectrum changes slope at 1 GeV. No two of the known gamma-ray pulsars have quite the same characteristics; this diversity makes interpretation in terms of theoretical models difficult.

  11. GaAs Solar Cell Radiation Handbook

    NASA Technical Reports Server (NTRS)

    Anspaugh, B. E.

    1996-01-01

    History of GaAs solar cell development is provided. Photovoltaic equations are described along with instrumentation techniques for measuring solar cells. Radiation effects in solar cells, electrical performance, and spacecraft flight data for solar cells are discussed. The space radiation environment and solar array degradation calculations are addressed.

  12. X-ray and gamma-ray astronomy. [origins of extraterrestrial radiation sources

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Accomplishments in the fields of X-ray and gamma ray astronomy are discussed. Data obtained from IMP and OGO satellites are analyzed to determine the sources of interplanetary radiation bursts. The energy spectrum of cosmic gamma ray bursts as observed by IMP-6 is described. The application of cooling blackbody techniques as a method for examining cosmic gamma ray bursts is reported. The experimental results and theoretical interpretation of high energy diffuse gamma rays are investigated. The structure of the SAS-2 satellite is depicted and the accomplishments are examined. Other sources of gamma radiation to include galactic fermi, Cygnus X-1, supernovae, and the planet Jupiter are proposed. Data obtained from the Pioneer 10 space probe are presented in graph form.

  13. RBE (relative biological effectiveness) of tritium beta radiation to gamma radiation and x-rays analyzed by both molecular and genetic methods

    SciTech Connect

    Lee, W.R.

    1988-01-01

    The relative biological effectiveness (RBE) of tritium beta radiation to /sup 60/Co gamma radiation was determined using sex-linked recessive lethals (SLRL) induced in Drosophila melanogaster spermatozoa as the biological effect. The SLRL test, a measure of mutations induced in germ cells transmitted through successive generations, yields a linear dose-response curve in the range used in these experiments. From these ratios of the slopes of the /sup 3/H beta and the /sup 60/ Co gamma radiation linear dose response curves, an RBE of 2.7 is observed. When sources of error are considered, this observation suggests that the tritium beta particle is 2.7 /plus minus/ 0.3 times more effective per unit of energy absorbed in inducing gene mutations transmitted to successive generation than /sup 60/Co gamma radiation. Ion tracks with a high density of ions (high LET) are more efficient than tracks with a low ion density (low LET) in inducing transmissible mutations, suggesting interaction among products of ionization. Molecular analysis of x-ray induced mutations shows that most mutations are deletions ranging from a few base pairs as determined from sequence data to multi locus deletions as determined from complementation tests and Southern blots. 14 refs., 1 fig.

  14. Paracoccidioides brasiliensis-stimulated human gamma/delta T cells support antibody production by B cells.

    PubMed Central

    Munk, M E; Fazioli, R A; Calich, V L; Kaufmann, S H

    1995-01-01

    Paracoccidioidomycosis patients show hyperactive humoral immune responses. Consequently, we investigated whether cytokines in supernatants from Paracoccidioides brasiliensis-stimulated gamma/delta T cells support B-cell activation. We detected proliferation of B cells and increased immunoglobulin M (IgM) and IgG production. Thus, gamma/delta T cells may participate in polyclonal B-cell activation during paracoccidioidomycosis. PMID:7890430

  15. Attosecond Gamma-Ray Pulses via Nonlinear Compton Scattering in the Radiation-Dominated Regime

    NASA Astrophysics Data System (ADS)

    Li, Jian-Xing; Hatsagortsyan, Karen Z.; Galow, Benjamin J.; Keitel, Christoph H.

    2015-11-01

    The feasibility of the generation of bright ultrashort gamma-ray pulses is demonstrated in the interaction of a relativistic electron bunch with a counterpropagating tightly focused superstrong laser beam in the radiation-dominated regime. The Compton scattering spectra of gamma radiation are investigated using a semiclassical description for the electron dynamics in the laser field and a quantum electrodynamical description for the photon emission. We demonstrate the feasibility of ultrashort gamma-ray bursts of hundreds of attoseconds and of dozens of megaelectronvolt photon energies in the near-backwards direction of the initial electron motion. The tightly focused laser field structure and the radiation reaction are shown to be responsible for such short gamma-ray bursts, which are independent of the durations of the electron bunch and of the laser pulse. The results are measurable with the laser technology available in the near future.

  16. Isodose mapping of terrestrial gamma radiation dose rate of Selangor state, Kuala Lumpur and Putrajaya, Malaysia.

    PubMed

    Sanusi, M S M; Ramli, A T; Gabdo, H T; Garba, N N; Heryanshah, A; Wagiran, H; Said, M N

    2014-09-01

    A terrestrial gamma radiation survey for the state of Selangor, Kuala Lumpur and Putrajaya was conducted to obtain baseline data for environmental radiological health practices. Based on soil type, geological background and information from airborne survey maps, 95 survey points statistically representing the study area were determined. The measured doses varied according to geological background and soil types. They ranged from 17 nGy h(-1) to 500 nGy h(-1). The mean terrestrial gamma dose rate in air above the ground was 182 81 nGy h(-1). This is two times higher than the average dose rate of terrestrial gamma radiation in Malaysia which is 92 nGy h(-1) (UNSCEAR 2000). An isodose map was produced to represent exposure rate from natural sources of terrestrial gamma radiation. PMID:24787672

  17. Attosecond Gamma-Ray Pulses via Nonlinear Compton Scattering in the Radiation-Dominated Regime.

    PubMed

    Li, Jian-Xing; Hatsagortsyan, Karen Z; Galow, Benjamin J; Keitel, Christoph H

    2015-11-13

    The feasibility of the generation of bright ultrashort gamma-ray pulses is demonstrated in the interaction of a relativistic electron bunch with a counterpropagating tightly focused superstrong laser beam in the radiation-dominated regime. The Compton scattering spectra of gamma radiation are investigated using a semiclassical description for the electron dynamics in the laser field and a quantum electrodynamical description for the photon emission. We demonstrate the feasibility of ultrashort gamma-ray bursts of hundreds of attoseconds and of dozens of megaelectronvolt photon energies in the near-backwards direction of the initial electron motion. The tightly focused laser field structure and the radiation reaction are shown to be responsible for such short gamma-ray bursts, which are independent of the durations of the electron bunch and of the laser pulse. The results are measurable with the laser technology available in the near future. PMID:26613446

  18. Indoor and outdoor in situ high-resolution gamma radiation measurements in urban areas of Cyprus.

    PubMed

    Svoukis, E; Tsertos, H

    2007-01-01

    In situ, high-resolution, gamma-ray spectrometry of a total number of 70 outdoor and 20 indoor representative measurements were performed in preselected, common locations of the main urban areas of Cyprus. Specific activities and gamma absorbed dose rates in air due to the naturally occurring radionuclides of (232)Th and (238)U series, and (40)K are determined and discussed. Effective dose rate to the Cyprus population due to terrestrial gamma radiation is derived directly from this work. The results obtained outdoors match very well with those derived previously by high-resolution gamma spectrometry of soil samples, which were collected from the main island bedrock surface. This implies that the construction and building materials in urban areas do not affect the external gamma dose rate; thus they are mostly of local origin. Finally, the indoor/outdoor gamma dose ratio was found to be 1.4 +/- 0.5. PMID:17065195

  19. Protection effects of condensed bromoacenaphthylene on radiation deterioration of ethylene-propylene-diene rubber. [Gamma radiation

    SciTech Connect

    Morita, Y.; Hagiwara, M.; Kasai, N.

    1982-09-01

    As a continuation of a series of the studies on the flame and ..gamma..-radiation resistant modification of ethylene-propylene-diene rubber (EPDM), condensed bromoacenaphthylene (con-BACN) as a newly developed flame retardant was synthesized and its effects on the radiation resistance of EPDM were investigated. The radiation resistance evaluated by measuring tensile properties of irradiated sheets of 2 mm thick was found improved greatly by adding con-BACN together with ordinary rubber ingredients but decreased by decabromodiphenylether (DBDPE) that has bromins in aromatic rings as con-BACN. When EPDM sheets of 1 mm thick were irradiated in oxygen at a dose rate of 1 X 10/sup 5/ rad/h, the weight swelling ratio increased with increasing dose, indicating that oxidative main chain scission is predominant under the irradiation conditions. On the other hand, crosslinking was shown to be predominant in nitrogen. From the results of the swelling experiments with different additives, it was concluded that DBDPE accelerates both the main chain scission in oxygen and the crosslinking in nitrogen. In contrast to this, con-BACN reduced the chain scission in oxygen. This observation was accounted by the assumption that the influence of the oxidative chain scission is partly compensated by the concurrent crosslinking which takes place through additions of con-BACN to substrate polymers even in the presence of oxygen.

  20. Study of a number of biochemical indices of the blood and tissue of dogs after prolonged gamma-radiation

    NASA Technical Reports Server (NTRS)

    Alers, I.; Alersova, E.; Praslichka, T.; Mishurova, E.; Sedlakova, A.; Malatova, Z.; Akhunov, A. A.; Markelov, B. A.

    1974-01-01

    The glucose content in blood and the lipid content in serum and tissues of dogs exposed to chronic radiation for 3 and 5 years were studied. In tissues of these animals, the concentration of soluble DNA and DNA contained in DNP was studied in the spleen, lymph node (deep cervical node) and bone marrow of thigh bones. Results indicate that chronic gamma irradiation significantly changes concentrations of glucose in the blood, and that of several lipids in serum and tissues. A reduction in the concentration of DNP in tested organs reflects changes in the relative number of cells with various nuclear cytoplasmic ratios; most pronounced changes in biochemical indices occur in dogs exposed to chronic gamma radiation in doses of 125 rad per year.

  1. Comptonization of diffuse ambient radiation by a relativistic jet: The source of gamma rays from blazars?

    NASA Technical Reports Server (NTRS)

    Sikora, Marek; Begelman, Mitchell C.; Rees, Martin J.

    1994-01-01

    Recent Energy Gamma Ray Experiment Telescope (EGRET) observations of blazars have revealed strong, variable gamma-ray fluxes with no signatures of gamma-ray absorption by pair production. This radiation probably originates from the inner parts of relativistic jets which are aimed nearly toward us. On sub-parsec scales, the jet will be pervaded by radiation from the broad-line region, as well as by photons from the central continuum source (some of which will be scattered by thermal plasma). In a frame moving with the relativistic outflow, the energy of this ambient radiation would be enhanced. This radiation would be Comptonized by both cold and relativistic electrons in the jet, yielding (in the observer's frame) a collimated beam of X-rays and gamma rays. On the assumption that this process dominates self-Comptonization of synchrotron radiation, we develop a self-consistent model for variable gamma-ray emission, involving a single population of relativistic electrons accelerated by a disturbance in the jet. The spectral break between the X-ray and gamma-ray band, observed in 3C 279 and deduced for other blazars, results from inefficient radiative cooling of lower energy electrons. The existence of such a break strongly favors a model involving Comptonization of an external radiation field over a synchrotron self-Compton model. We derive constraints on such model parameters as the location and speed of the source, its dimensions and internal physical parameters, the maximum photon energies produced in the source, and the density and distribution of ambient radiation. Finally, we discuss how observations might discriminate between our model and alternative ones invoking Comptonization of ambient radiation.

  2. Novel Fc gamma receptor I family gene products in human mononuclear cells.

    PubMed Central

    Porges, A J; Redecha, P B; Doebele, R; Pan, L C; Salmon, J E; Kimberly, R P

    1992-01-01

    Unlike the human Fc gamma RII and Fc gamma RIII families, which exhibit considerable diversity at both the nucleic acid and protein levels, the human Fc gamma RI family has only a single recognized product expressed as a 70-kD cell surface receptor with high affinity for monomeric IgG (hFc gamma RIa1). Using both polymerase chain reaction-based amplification and Northern hybridization, we document multiple interferon-gamma-inducible hFc gamma RI RNA transcripts in human mononuclear cells and neutrophils. The sequences of two of these Fc gamma RI related transcripts indicate that they are alternatively spliced products of a second Fc gamma RI family gene, termed Fc gamma RIB. The cDNA derived from the larger of these transcripts, termed hFc gamma RIb1, encodes a surface molecule that is not recognized by Fc gamma RI specific monoclonal antibodies when transfected into COS-7 cells. Unlike the interferon-gamma-inducible hFc gamma RIA gene product, hFc gamma RIb1 does not bind monomeric IgG with high affinity. However, both hFc gamma RIa1 and hFc gamma RIb1 do bind aggregated human IgG. Previously unrecognized diversity within the hFc gamma RI family includes an interferon-gamma-inducible, putative low affinity Fc gamma receptor that may play an important role in the mechanism by which Fc gamma receptors participate in the humoral immune response. Images PMID:1430234

  3. Coherent. gamma. radiation production by interaction between a relativistic electron beam and two interfering laser fields

    SciTech Connect

    Bertolotti, M.; Sibilia, C.

    1982-12-01

    A method is proposed for obtaining coherent ..gamma.. radiation through the interaction between a relativistic electron beam and two interfering laser fields. The periodic structure associated with the interference fringes gives rise to coherent effects of the radiation emitted by stimulated inverse Compton scattering, if suitable conditions are fulfilled.

  4. Reliability studies on Si PIN photodiodes under Co-60 gamma radiation

    SciTech Connect

    Prabhakara Rao, Y. P.; Praveen, K. C.; Gnana Prakash, A. P.; Rani, Y. Rejeena

    2013-02-05

    Silicon PIN photodiodes were fabricated with 250 nm SiO{sub 2} antireflective coating (ARC). The changes in the electrical characteristics, capacitance-voltage characteristics and spectral response after gamma irradiation are systematically studied to estimate the radiation tolerance up to 10 Mrad. The different characteristics studied in this investigation demonstrate that Si PIN photodiodes are suitable for high radiation environment.

  5. Mold and aflatoxin reduction by gamma radiation of packed hot peppers and their evolution during storage.

    PubMed

    Iqbal, Qumer; Amjad, Muhammad; Asi, Muhammad Rafique; Ario, Agustin

    2012-08-01

    The effect of gamma radiation on moisture content, total mold counts, Aspergillus counts, and aflatoxins of three hot pepper hybrids (Sky Red, Maha, and Wonder King) was investigated. Whole dried peppers packed in polyethylene bags were gamma irradiated at 0 (control), 2, 4, and 6 kGy and stored at 25C for 90 days. Gamma radiation proved to be effective in reducing total mold and Aspergillus counts in a dose-dependent relationship. Total mold counts in irradiated peppers immediately after treatments were significantly lowered compared with those in nonirradiated samples, achieving 90 and 99% reduction at 2- and 4-kGy doses, respectively. Aspergillus counts were significantly reduced, by 93 and 97%, immediately after irradiation at doses of 2 and 4 kGy, respectively. A radiation dose of 6 kGy completely eliminated the population of total molds and Aspergillus fungi. The evolution of total molds in control and irradiated samples indicated no further fungal proliferation during 3 months of storage at 25C. Aflatoxin levels were slightly affected by radiation doses of 2 and 4 kGy and showed a nonsignificant reduction of 6% at the highest radiation dose of 6 kGy. The distinct effectiveness of gamma radiation in molds and aflatoxins can be explained by the target theory of food irradiation, which states that the likelihood of a microorganism or a molecule being inactivated by gamma rays increases as its size increases. PMID:22856582

  6. Recent results on celestial gamma radiation from SMM

    NASA Technical Reports Server (NTRS)

    Share, Gerald H.

    1991-01-01

    Observations made by the Gamma Ray Spectrometer on board the SMM are described. Recent results reported include observations and analyses of gamma-ray lines from Co-56 produced in supernovae, observations of the temporal variation of the 511 keV line observed during Galactic center transits, and measurements of the diffuse Galactic spectrum from 0.3 to 8.5 MeV. The work in progress includes measurements of the distribution of Galactic Al-26, observations to place limits on Galactic Ti-44 and Fe-60 and on Be-7 produced in novae, and searches for a characteristic gamma-ray emission from pair plasmas, a 2.223 MeV line emission, limits on deexcitation lines from interstellar C and O, and gamma-ray bursts.

  7. Reflectivity of linear and nonlinear gamma radiated apodized chirped Bragg grating under ocean

    NASA Astrophysics Data System (ADS)

    Hamdalla, Taymour A.

    2012-09-01

    In this paper, the effect Co60 gamma radiation is investigated on the effective refractive index of apodized chirped Bragg grating. Nine apodization profiles are considered. Comparison between the reflectivity of the gamma radiated and non radiated fiber Bragg grating has been carried out. The electric field of signals propagating through the apodized chirped fiber Bragg grating (ACFBG) is first calculated from which, new values for the refractive index are determined. The nonlinear effects appear on the ACFBG reflectivity. The effect of nonlinearity and undersea temperature and pressure on the grating is also studied.

  8. Reflectivity of linear and nonlinear gamma radiated apodized chirped Bragg grating under ocean

    SciTech Connect

    Hamdalla, Taymour A.

    2012-09-06

    In this paper, the effect Co{sup 60} gamma radiation is investigated on the effective refractive index of apodized chirped Bragg grating. Nine apodization profiles are considered. Comparison between the reflectivity of the gamma radiated and non radiated fiber Bragg grating has been carried out. The electric field of signals propagating through the apodized chirped fiber Bragg grating (ACFBG) is first calculated from which, new values for the refractive index are determined. The nonlinear effects appear on the ACFBG reflectivity. The effect of nonlinearity and undersea temperature and pressure on the grating is also studied.

  9. Roles of ionizing radiation in cell transformation

    SciTech Connect

    Tobias, C.A.; Albright, N.W.; Yang, T.C.

    1983-07-01

    Earlier the authors described a repair misrepair model (RMR-I) which is applicable for radiations of low LET, e.g., x rays and gamma rays. RMR-II was described later. Here is introduced a mathematical modification of the RMR model, RMR-III, which is intended to describe lethal effects caused by heavily ionizing tracks. 31 references, 4 figures.

  10. SMM detection of interstellar Al-26 gamma radiation

    NASA Technical Reports Server (NTRS)

    Share, G. H.; Kinzer, R. L.; Chupp, E. L.; Forrest, D. J.; Rieger, E.

    1985-01-01

    The gamma ray spectrometer on the Solar Maximum Mission Satellite has detected the interstellar Al-26 line when the Galactic center traversed its aperture. The center of the emission is consistent with the location of the Galactic center, but the spatial distribution is presently not well defined. The total flux in the direction of the Galactic center is 4.3 + or - 0.4) x .0001 gamma/sq cm-s-rad for an assumed population I distribution.

  11. Evaluation of the Combined Effects of Gamma Radiation and High Dietary Iron on Peripheral Leukocyte Distribution and Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian E.; Morgan, Jennifer L. L.; Quiriarte, Heather A.; Sams, Clarence F.; Smith, Scott M.; Zwart, Sara R.

    2011-01-01

    NASA is concerned with the health risks to astronauts, particularly those risks related to radiation exposure. Both radiation and increased iron stores can independently increase oxidative damage, resulting in protein, lipid and DNA oxidation. Oxidative stress increases the risk of many health problems including cancer, cataracts, and heart disease. This study, a subset of a larger interdisciplinary investigation of the combined effect of iron overload on sensitivity to radiation injury, monitored immune parameters in the peripheral blood of rats subjected to gamma radiation, high dietary iron or both. Specific immune measures consisted of (A) peripheral leukocyte distribution; (B) plasma cytokine levels; (C) cytokine production profiles following whole blood stimulation of either T cells or monocytes.

  12. Comparison of the effects of gamma radiation on hydrated and air dried rye grass seeds

    SciTech Connect

    Worthington, M.

    1988-01-01

    This is a comparative study of the effects of gamma radiation on the growth of hydrated and air dried seeds during the first weeks of primary growth. Four groups of seeds were used in the study: 1) hydrated sweet corn, 2) air dried sweet corn, 3) hydrated rye grass, and 4) air dried rye grass. Each group was then further subdivided and exposed to various levels of gamma radiation using a Cobalt-60 irradiator, except for the control samples of the four groups which received no radiation above background level. All seeds samples were then planted, allowed to grow for approximately 12 days, and harvested. Growth of both shoot and root of each seed was recorded for data analysis according to specific groups. Analyses of data from this study shows that the mean growth of air dried seeds when exposed to gamma radiation prior to planting.

  13. Different patterns of allelic imbalance in sporadic tumors and tumors associated with long-term exposure to gamma-radiation.

    PubMed

    Litviakov, Nikolai V; Freidin, Maxim B; Sazonov, Aleksey E; Khalyuzova, Maria V; Buldakov, Mikhail A; Karbyshev, Mikhail S; Albakh, ?lena N; Isubakova, Daria S; Gagarin, ?leksey A; Nekrasov, Gennadiy B; Mironova, Elena B; Izosimov, ?ndrey S; Takhauov, Ravil M; Karpov, ?ndrei B

    2015-12-01

    The study aimed to reveal cancer related mutations in DNA repair and cell cycle genes associated with chronic occupational exposure to gamma-radiation in personnel of the Siberian Group of Chemical Enterprises (SGCE). Mutations were analyzed by comparing genotypes of malignant tumors and matched normal tissues of 255 cancer patients including 98 exposed to external gamma-radiation (mean dose 128.1150.5mSv). Also a genetic association analysis was carried out in a sample of 149 cancer patients and 908 healthy controls occupationally exposed to gamma-radiation (153.2204.6mSv and 150.5211.2mSv, respectively). Eight SNPs of genes of DNA excision repair were genotyped (rs13181, rs1052133, rs1042522, rs2305427, rs4244285, rs1045642, rs1805419 and rs1801133). The mutation profiles in heterozygous loci for selected SNP were different between sporadic tumors and tumors in patients exposed to radiation. In sporadic tumors, heterozygous genotype Arg/Pro of the rs1042522 SNP mutated into Arg/0 in 15 cases (9.6%) and 0/Pro in 14 cases (8.9%). The genotype Lys/Gln of the rs13181 SNP mutated into Lys/0 and 0/Gln in 9 and 4 cases, respectively. In tumors of patients exposed to low-level radiation, the rs1042522 Arg/0 mutated genotype was found in 12 cases (12.1%), while in 2 cases (2%) 0/Pro mutation was observed. Finally, the rs13181 0/Gln mutated genotype was observed in 15 cases (16,5%) . Thus, our study showed the difference in patterns of allelic imbalance in tumors appeared under low-level radiation exposure and spontaneous tumors for selected SNPs. This suggests different mechanisms of inactivation of heterozygous genotypes in sporadic and radiation-induced tumors. PMID:26653978

  14. AGM1+ spleen cells contain gamma interferon (IFN-gamma) gene transcripts in the early, sex-dependent production of IFN-gamma after picornavirus infection.

    PubMed Central

    McFarland, H I; Bigley, N J

    1990-01-01

    Encephalomyocarditis D variant (EMCV-D)-infected spleen cell cultures prepared from diabetes-resistant ICR Swiss female mice produce more gamma interferon (IFN-gamma) activity over a 24-h period than do spleen cell cultures from diabetes-susceptible male mice of this strain. Pretreatment of mice with anti-asialo GM1 eliminates early in vitro IFN-gamma production from 4 to 16 h postinfection (p.i.) and reduces IFN-gamma production from 16 to 24 h p.i. In this study, depletion of spleen cells with anti-Thy-1 by panning greatly reduced IFN-gamma activity in EMCV-D-infected spleen cell cultures throughout a 24-h period. Populations of asialo GM1 (AGM1), L3T4, and Lyt-2-positive cells were isolated from cells harvested at 9 h p.i. from EMCV-D-infected spleen cell cultures by a modified panning technique on polystyrene microscope slides. By in situ hybridization with a [35S]dATP-labeled IFN-gamma cDNA probe, only the AGM1-bearing cells were found to contain detectable IFN-gamma gene transcripts. An AGM1+, Thy-1+ natural killer-like cell is the probable producer of the early, sex-dependent IFN-gamma activity in this system. Images PMID:1974653

  15. Galactic plane gamma radiation. [SAS-2 and COS-b observations

    NASA Technical Reports Server (NTRS)

    Hartman, R. C.; Kniffen, D. A.; Thompson, D. J.; Fichtel, C. E.; Ogelman, H. B.; Tuner, T.; Ozel, M. E.

    1978-01-01

    Analysis of the complete data from SAS-2 accentuates the fact that the distribution of galactic gamma radiation has several similarities to that of other large-scale tracers of galactic structure. The gamma radiation shows no statistically significant variation with direction, and the spectrum seen along the plane is the same as that derived for the galactic component of the gamma radiation at high latitude. This uniformity of the energy spectrum, the smooth decrease in intensity as a function of galactic latitude, and the absence of any galactic gamma ray sources at high latitudes argue in favor of a diffuse origin for most of the galactic gamma radiation, rather than a collection of localized sources. All the localized sources identified in the SAS 2 data are associated with known compact objects on the basis of observed periodicities, except gamma195+5 Excluding those SAS 2 sources observed by COS-B and two other excesses (CG 312-1 and CG333+0) visible in the SAS 2 data associated with tangential directions of spiral arms, thera are eight remaining new sources in the COS-B catalog.

  16. Changes in the biological properties of an ordinary chernozem exposed to gamma radiation

    NASA Astrophysics Data System (ADS)

    Denisova, T. V.; Kazeev, K. Sh.; Kolesnikov, S. I.; Val'Kov, V. F.

    2007-09-01

    The dynamics of changes in the number of microorganisms and biochemical properties of an ordinary chernozem were studied in model experiments 3, 30, and 90 days after the soil was subjected to gamma radiation at doses of 0.12-2.0 Mrad. The microscopic fungi are the most radiosensitive soil microorganisms. In 90 days of incubation after the gamma radiation, the number of microorganisms remained lower than that in the control variant by 31-96% in accordance with the dose. The enzyme activity of the ordinary chernozem, as compared to that of the microorganisms, was more resistant to the gamma radiation. The integral index of the soil biological state (ISBSI) decreased by 20-63% upon the radiation depending on the dose applied. After 90 days, the ISBSI value was close to the control variant (doses of 0.1-0.5 Mrad), whereas, in the variants with high doses of radiation (1.0 and 2.0 Mrad), its values were 46 and 59% lower, respectively, than in the control. The rate of restoring of the biological properties was related to the dose of radiation: the less the dose, the quicker the rate of restoration of the biological properties of the ordinary chernozem. However, at the high levels of gamma radiation, some biological properties were not restored even after 90 days.

  17. What is the radiative process of the prompt phase of Gamma Ray Bursts?

    SciTech Connect

    Ghisellini, G.

    2010-07-15

    Despite the dramatic improvement of our knowledge of the phenomenology of Gamma Ray Bursts, we still do not know several fundamental aspects of their physics. One of the puzzles concerns the nature of the radiative process originating the prompt phase radiation. Although the synchrotron process qualifies itself as a natural candidate, it faces severe problems, and many efforts have been done looking for alternatives. These, however, suffer from other problems, and there is no general consensus yet on a specific radiation mechanism.

  18. Effect of gamma radiation and oregano essential oil on murein and ATP concentration of Staphylococcus aureus.

    PubMed

    Caillet, Stphane; Ursachi, Laura; Shareck, Franois; Lacroix, Monique

    2009-01-01

    The study was carried out to evaluate the effects of gamma-irradiation alone or in combination with oregano essential oil on murein composition of Staphylococcus aureus and on the intracellular and extracellular concentration of ATP. The bacterial strain was treated with 3 irradiation doses: 1.2 kGy to induce cell damage, 2.9 kGy to obtain a viable but nonculturable state, and 3.5 kGy to cause cell death. Oregano essential oil was used at 0.010% and 0.013% (w/v), which is the minimum inhibitory concentration (MIC). All treatments had a significant effect (P < or = 0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment influenced differently the relative percentage and number of muropeptides. There was a significant (P < or = 0.05) correlation between the reduction of intracellular ATP and increase in extracellular ATP following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when essential oil was combined with irradiation. Also, irradiation alone of S. aureus induced a significant decrease (P < or = 0.05) of the internal ATP and a significant increase (P < or = 0.05) of the external ATP. However, no significant difference (P > 0.05) was observed in ATP concentrations between different radiation doses. Transmission electron microscopic observation revealed that oregano oil and irradiation have an effect on cell wall structure. PMID:20492121

  19. Intestinal endocrine cells in radiation enteritis

    SciTech Connect

    Pietroletti, R.; Blaauwgeers, J.L.; Taat, C.W.; Simi, M.; Brummelkamp, W.H.; Becker, A.E. )

    1989-08-01

    In this study, the intestinal endocrine cells were investigated in 13 surgical specimens affected by radiation enteritis. Endocrine cells were studied by means of Grimelius' silver staining and immunostaining for chromogranin, a general marker of endocrine cells. Positively stained cells were quantified by counting their number per unit length of muscularis mucosa. Results in radiation enteritis were compared with matched control specimens by using Student's t test. Chromogranin immunostaining showed a statistically significant increase of endocrine cells in radiation enteritis specimens compared with controls both in small and large intestine (ileum, 67.5 +/- 23.5 cells per unit length of muscularis mucosa in radiation enteritis versus 17.0 +/- 6.1 in controls; colon, 40.9 +/- 13.7 cells per unit length of muscularis mucosa in radiation enteritis versus 9.5 +/- 4.1 in controls--p less than 0.005 in both instances). Increase of endocrine cells was demonstrated also by Grimelius' staining; however, without reaching statistical significance. It is not clear whether or not the increase of endocrine cells in radiation enteritis reported in this study is caused by a hyperplastic response or by a sparing phenomenon. We should consider that increased endocrine cells, when abnormally secreting their products, may be involved in some of the clinical features of radiation enteropathy. In addition, as intestinal endocrine cells produce trophic substances to the intestine, their increase could be responsible for the raised risk of developing carcinoma of the intestine in long standing radiation enteritis.

  20. Evaluation of the sensitivity of the gas-discharge gamma-counters to the concomitant neutron radiation

    NASA Astrophysics Data System (ADS)

    Pikalov, G. L.; Kiseev, S. V.

    2015-11-01

    In the fields of gamma-neutron radiation the accuracy measurement of gamma- ray doses depends on their sensitivity to concomitant neutron radiation. In this connection, verification results of gamma-dosimetry on the installation with isotope cobalt or cesium sources are not always adequate to measurement results in real gamma-neutron fields. The data prove, that the sensitivity coefficients of gas-discharge gamma-dosimeters at PRIZ-M reactor is 1.23 larger as compared to Co60 source, due to the effect of the concomitant neutrons on their indications. The error due to the neutrons effect can be significantly reduced or eliminated completely, if gamma-dosimeters calibrated in the field of gamma-neutron radiation, adequate spectral and dose characteristics to radiation fields in which they are used.

  1. Up-regulation of Bcl-2 expression in cultured human lymphocytes after exposure to low doses of gamma radiation

    PubMed Central

    Azimian, Hosein; Bahreyni-Toossi, Mohammad Taghi; Rezaei, Abdul Rahim; Rafatpanah, Houshang; Hamzehloei, Tayebeh; Fardid, Reza

    2015-01-01

    Lymphocytes have demonstrated complex molecular responses to induced stress by ionizing radiation. Many of these reactions are mediated through modifications in gene expressions, including the genes involved in apoptosis. The primary aim of this study was to assess the effects of low doses of ionizing radiation on the apoptotic genes, expression levels. The secondary goal was to estimate the time-effect on the modified gene expression caused by low doses of ionizing radiation. Mononuclear cells in culture were exposed to various dose values ranged from 20 to 100 mGy by gamma rays from a Cobalt-60 source. Samples were taken for gene expression analysis at hours 4, 24, 48, 72, and 168 following to exposure. Expression level of two apoptotic genes; BAX (pro-apoptotic) and Bcl-2 (anti-apoptotic) were examined by relative quantitative real-time polymerase chain reaction (PCR), at different time intervals. Radio-sensitivity of peripheral blood mononucleated cells (PBMCs) was measured by the Bcl-2/BAX ratio (as a predictive marker for radio-sensitivity). The non-parametric two independent samples MannWhitney U-test were performed to compare means of gene expression. The results of this study revealed that low doses of gamma radiation can induce early down-regulation of the BAX gene of freshly isolated human PBMCs; however, these changes were restored to near normal levels after 168 hours. In most cases, expression of the Bcl-2 anti-apoptotic gene was up-regulated. Four hours following to exposure to low doses of gamma radiation, apoptotic gene expression is modified, this is manifested as adaptive response. Modification of these gene expressions seems to be a principle pathway in the early radioresistance response. In our study, we found that these changes were temporary and faded completely within a week. PMID:26150686

  2. High-energy gamma radiation from Geminga observed by EGRET

    NASA Technical Reports Server (NTRS)

    Mayer-Hasselwander, H. A.; Bertsch, D. L.; Brazier, K. T. S.; Chiang, J.; Fichtel, C. E.; Fierro, J. M.; Hartman, R. C.; Hunter, S. D.; Kanbach, G.; Kwok, P. W.

    1994-01-01

    The Energetic Gamma Ray Experiment Telescope (EGRET) on the Compton Gamma Ray Observatory (CGRO) has carried out extensive studies of the gamma-ray source Geminga. Following the detection of pulsed X-rays (Halpern and Holt 1992) from Geminga, Bertsch et al. (1992) reported the same 237 ms periodicity to be visible in the EGRET data. A full analysis of the Geminga source shows that the energy spectrum is compatible with a power law with a spectral index of -1.50 +/- 0.08 between 30 MeV and 2 GeV. A falloff relative to the power law is observed for energies above 2 GeV. Phase-resolved spectra also show power laws with high-energy cutoffs, but with significant variation of the spectral index with phase. No unpulsed emission is observed. No evidence for time variation was found within the EGRET observations.

  3. Gamma Delta (??) T Cells and Their Involvement in Behet's Disease

    PubMed Central

    Hasan, Md. Samiul; Bergmeier, Lesley Ann; Petrushkin, Harry; Fortune, Farida

    2015-01-01

    Behet's disease (BD) is a multisystem inflammatory disorder characterized by orogenital ulcerations, ocular manifestations, arthritis, and vasculitis. The disease follows a relapsing-remitting course and its pathogenesis is unknown. Genetic predisposition and immune-dysregulation involving gamma delta (??) T cells are reported to have a role. ?? T cells are atypical T cells, which represent a small proportion of total lymphocytes. They have features of both innate and adaptive immunity and express characteristics of conventional T cells, natural killer cells, and myeloid antigen presenting cells. These unconventional T cells are found in the inflammatory BD lesions and have been suggested to be responsible for inducing and/or maintaining the proinflammatory environment characteristic of the disease. Over the last 20 years there has been much interest in the role of ?? T cells in BD. We review the literature and discuss the roles that ?? T cells may play in BD pathogenesis. PMID:26539557

  4. Morphological changes in rat's brain choroid plexus after exposure to low doses of high energy oxygen ions, fast neutrons, and gamma radiation.

    PubMed

    Burneva, V; Gitsov, L; Mladenova, V; Fedorenko, B; Kabitsyna, R; Budnnaia, N

    1995-01-01

    Ultrastructural and morphometrical changes in choroid plexus cells of the rat's brain in the delay period after irradiation with low doses of oxygen ions [= 300 MeV/nucleon], and fast neutrons [1.5 MeV], and gamma rays (Co60) were described. The applied irradiations provoked similar ultrastructural changes in choroid plexus cells; however, the obtained morphometrical data showed differing effects of these radiations, due to, probably, different mechanisms of their effect on the cells. PMID:7550170

  5. Effect of proton and gamma irradiation on human lung carcinoma cells: Gene expression, cell cycle, cell death, epithelial-mesenchymal transition and cancer-stem cell trait as biological end points.

    PubMed

    Narang, Himanshi; Kumar, Amit; Bhat, Nagesh; Pandey, Badri N; Ghosh, Anu

    2015-10-01

    Proton beam therapy is a cutting edge modality over conventional gamma radiotherapy because of its physical dose deposition advantage. However, not much is known about its biological effects vis-a-vis gamma irradiation. Here we investigated the effect of proton- and gamma- irradiation on cell cycle, death, epithelial-mesenchymal transition (EMT) and "stemness" in human non-small cell lung carcinoma cells (A549). Proton beam (3MeV) was two times more cytotoxic than gamma radiation and induced higher and longer cell cycle arrest. At equivalent doses, numbers of genes responsive to proton irradiation were ten times higher than those responsive to gamma irradiation. At equitoxic doses, the proton-irradiated cells had reduced cell adhesion and migration ability as compared to the gamma-irradiated cells. It was also more effective in reducing population of Cancer Stem Cell (CSC) like cells as revealed by aldehyde dehydrogenase activity and surface phenotyping by CD44(+), a CSC marker. These results can have significant implications for proton therapy in the context of suppression of molecular and cellular processes that are fundamental to tumor expansion. PMID:26278043

  6. Gamma radiation induced degradation in PE-PP block copolymer

    SciTech Connect

    Ravi, H. R.; Sreepad, H. R.; Ahmed, Khaleel; Govindaiah, T. N.

    2012-06-05

    In the present investigation, effect of gamma irradiation on the PP-PE block copolymer has been studied. The polymer has been subjected to gamma irradiation from 100 to 500 Mrad dosages. Characterization of the polymer using XRD and FTIR was done both before irradiation and after irradiation in each step. Effect of irradiation on the electrical properties of the material has also been studied. FTIR study shows that the sample loses C - C stretching mode of vibration but gains C=C stretching mode of vibration after irradiation. Present investigation clearly indicates that though the electrical conductivity increases in the material, it undergoes degradation and shows brittleness due to irradiation.

  7. Lower Bound on the Cosmic TeV Gamma-Ray Background Radiation

    NASA Astrophysics Data System (ADS)

    Inoue, Yoshiyuki; Tanaka, Yasuyuki T.

    2016-02-01

    The Fermi gamma-ray space telescope has revolutionized our understanding of the cosmic gamma-ray background radiation in the GeV band. However, investigation on the cosmic TeV gamma-ray background radiation still remains sparse. Here, we report the lower bound on the cosmic TeV gamma-ray background spectrum placed by the cumulative flux of individual detected extragalactic TeV sources including blazars, radio galaxies, and starburst galaxies. The current limit on the cosmic TeV gamma-ray background above 0.1 TeV is obtained as 2.8 10?8(E/100 GeV)?0.55 exp(?E/2100GeV)[GeV cm?2 s?1 sr?1] < E2dN/dE < 1.1 10?7(E/100 GeV)?0.49 [GeV cm?2 s?1 sr?1], where the upper bound is set by requirement that the cascade flux from the cosmic TeV gamma-ray background radiation can not exceed the measured cosmic GeV gamma-ray background spectrum. Two nearby blazars, Mrk 421 and Mrk 501, explain ?70% of the cumulative background flux at 0.84 TeV, while extreme blazars start to dominate at higher energies. We also provide the cumulative background flux from each population, i.e., blazars, radio galaxies, and starburst galaxies which will be the minimum requirement for their contribution to the cosmic TeV gamma-ray background radiation.

  8. Gamma radiation exposure of accompanying persons due to Lu-177 patients

    NASA Astrophysics Data System (ADS)

    Kovan, Bilal; Demir, Bayram; Tuncman, Duygu; Capali, Veli; Turkmen, Cuneyt

    2015-07-01

    Neuroendocrine tumours (NET) are cancers usually observed and arisen in the stomach, intestine, pancreas and breathing system. Recently, radionuclide therapy applications with Lu-177 peptide compound are rapidly growing; especially effective clinical results are obtained in the treatment of well-differentiated and metastatic NET. In this treatment, Lu-177-DOTA, a beta emitter radioisotope in the radiopharmaceutical form, is given to the patient by intravenous way. Lu-177 has also gamma rays apart from beta rays. Gamma rays have 175 keV average energy and these gamma rays should be under the control in terms of radiation protection. In this study, we measured the exposure dose from the Lu-177 patient.

  9. Interferon-gamma (IFN-gamma) and interleukin-2 in the generation of lymphokine-activated killer cell cytotoxicity--IFN-gamma-induced suppressive activity.

    PubMed

    Toledano, M; Mathiot, C; Michon, J; Andreu, G; Lando, D; Brandely, M; Fridman, W H

    1989-01-01

    Incubation of human lymphocytes with recombinant interleukin-2 (rIL-2) results in the generation of lymphokine-activated killer (LAK) cells capable of lysing a wide variety of tumor cells. The present study was undertaken to examine the effect of recombinant gamma interferon (rIFN-gamma) on LAK cell cytotoxicity generated from different peripheral blood mononuclear cell (PBMC) subpopulations. When unseparated PBMC were stimulated by rIL-2 and rIFN-gamma, the latter induced a transient enhancement after 2 days followed by a suppression of LAK cell cytotoxicity at day 6. Enhancement of LAK cell cytotoxicity was moderate and inconstant, whereas the inhibition was strong and observed with all the donors tested. This suppression was not associated with a decrease in the [3H]thymidine uptake. PBMC depleted of adherent cells were more sensitive to the stimulation by rIL-2 and the induced cytotoxicity was not modified by rIFN-gamma. Monocyte-enriched plastic-adherent cells, when incubated with rIL-2 and rIFN-gamma, became cytotoxic after 2-3 days of culture and inhibited LAK cell activity after 5-6 days. Collectively, our results suggest that rIFN-gamma affects LAK cell cytotoxicity through the activation of plastic-adherent, monocyte-rich, cells which modulate natural killer cells, first in a positive, then in a negative way. PMID:2513112

  10. Secondary production of neutral pi-mesons and the diffuse galactic gamma radiation

    NASA Technical Reports Server (NTRS)

    Dermer, C. D.

    1986-01-01

    Isobaric and scaling model predictions of the secondary spectra of neutral pi-mesons produced in proton-proton collisions, at energies between threshold and a few GeV, are compared on the basis of accelerator data and found to show the isobaric model to be superior. This model is accordingly used, in conjuction with a scaling model representation at high energies, in a recalculation of the pi exp (0) gamma-radiation's contribution to the diffuse galactic gamma background; the cosmic ray-induced production of photons (whose energy exceeds 100 MeV) by such radiation occurs at a rate of 1.53 x 10 to the -25 photons/(s-H atom). These results are compared with previous calculations of this process as well as with COS-B observations of the diffuse galactic gamma-radiation.

  11. SAS-2 observations of the high energy gamma radiation from the Vela region

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Bignami, G. F.; Fichtel, C. E.; Kniffen, D. A.

    1974-01-01

    Data from a scan of the galactic plane by the SAS-B high energy gamma ray experiment in the region 250 deg smaller than 12 smaller than 290 deg show a statistically significant excess over the general radiation from the galactic plane for gamma radiation of energy larger than 100 MeV. If the enhanced gamma radiation results from interactions of cosmic rays with galactic matter, as the energy spectrum suggests, it seems reasonable to associate the enhancement with large scale galactic features, such as spiral arm segments in that direction, or with the region surrounding the Vela supernova remnant with which PSR 0833-45 is associated. If the excess is attributed to cosmic rays released from the supernova interacting with the interstellar matter in that region, than on the order of 3 x 10 to the 50th power ergs would have been released by that supernova in the form of cosmic rays.

  12. Controlling absorption of gamma radiation via nuclear level anticrossing.

    PubMed

    Coussement, R; Rostovtsev, Y; Odeurs, J; Neyens, G; Muramatsu, H; Gheysen, S; Callens, R; Vyvey, K; Kozyreff, G; Mandel, P; Shakhmuratov, R; Kocharovskaya, O

    2002-09-01

    A significant reduction of absorption for single gamma photons has been experimentally observed by studying Mssbauer spectra of 57Fe in a FeCO3 crystal. The experimental results have been explained in terms of a quantum interference effect involving nuclear level anticrossing due to the presence of a combined magnetic dipole and electric quadrupole interaction. PMID:12225226

  13. (Gamma scattering in condensed matter with high intensity Moessbauer radiation)

    SciTech Connect

    Not Available

    1992-01-01

    This report discusses: quasielastic scattering studies on glycerol; gamma-ray scattering from alkali halides; lattice dynamics in metals; Moessbauer neutron scattering, x-ray diffraction, and macroscopic studies of high {Tc} superconductors containing tungsten; NiAl scattering studies; and atomic interference factors and nuclear Casimir effect.

  14. Slow elimination of phosphorylated histone {gamma}-H2AX from DNA of terminally differentiated mouse heart cells in situ

    SciTech Connect

    Gavrilov, Boris; Vezhenkova, Irina; Firsanov, Denis; Solovjeva, Liudmila; Svetlova, Maria; Mikhailov, Vyacheslav; Tomilin, Nikolai . E-mail: nvtom@hotmail.com

    2006-09-08

    Phosphorylation of replacement histone H2AX occurs in megabase chromatin domains around double-strand DNA breaks (DSBs) and this modification (called {gamma}-H2AX) may serve as a useful marker of genome damage and repair in terminally differentiated cells. Here using immunohistochemistry we studied kinetics of {gamma}-H2AX formation and elimination in the X-irradiated mouse heart and renal epithelial tissues in situ. Unirradiated tissues have 3-5% {gamma}-H2AX-positive cells and in tissues fixed 1 h after X-irradiation {gamma}-H2AX-positive nuclei are induced in a dose-dependent manner approaching 20-30% after 3 Gy of IR. Analysis of mouse tissues at different times after 3 Gy of IR showed that maximal induction of {gamma}-H2AX in heart is observed 20 min after IR and then is decreased slowly with about half remaining 23 h later. In renal epithelium maximum of the {gamma}-H2AX-positive cells is observed 40 min after IR and then decreases to control values in 23 h. This indicates that there are significant variations between non-proliferating mammalian tissues in the initial H2AX phosphorylation rate as well as in the rate of {gamma}-H2AX elimination after X-irradiation, which should be taken into account in the analysis of radiation responses.

  15. Peroxisome proliferator-activated receptor gamma overexpression suppresses proliferation of human colon cancer cells

    SciTech Connect

    Tsukahara, Tamotsu; Haniu, Hisao

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer We examined the correlation between PPAR{gamma} expression and cell proliferation. Black-Right-Pointing-Pointer PPAR{gamma} overexpression reduces cell viability. Black-Right-Pointing-Pointer We show the synergistic effect of cell growth inhibition by a PPAR{gamma} agonist. -- Abstract: Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) plays an important role in the differentiation of intestinal cells and tissues. Our previous reports indicate that PPAR{gamma} is expressed at considerable levels in human colon cancer cells. This suggests that PPAR{gamma} expression may be an important factor for cell growth regulation in colon cancer. In this study, we investigated PPAR{gamma} expression in 4 human colon cancer cell lines, HT-29, LOVO, DLD-1, and Caco-2. Real-time polymerase chain reaction (PCR) and Western blot analysis revealed that the relative levels of PPAR{gamma} mRNA and protein in these cells were in the order HT-29 > LOVO > Caco-2 > DLD-1. We also found that PPAR{gamma} overexpression promoted cell growth inhibition in PPAR{gamma} lower-expressing cell lines (Caco-2 and DLD-1), but not in higher-expressing cells (HT-29 and LOVO). We observed a correlation between the level of PPAR{gamma} expression and the cells' sensitivity for proliferation.

  16. Multiple fractions of gamma rays induced resistance to cis-dichloro-diammineplatinum (II) and methotrexate in human HeLa cells

    SciTech Connect

    Osmak, M.; Perovic, S. )

    1989-06-01

    Previous irradiation could induce changes in the cell-sensitivity to additional cytotoxic agents. In this study we examined whether the sensitivity to additional cytotoxic agents was affected in cells irradiated with multiple fractions of gamma rays if these agents were given at the time when the lesions induced in DNA by radiation have already been repaired. Human cervix carcinoma HeLa cells were irradiated daily with 0.5 Gy of gamma rays five times a week for 6 weeks. When the fractionation regimen was completed, that is when the cells had accumulated the total dose of 15 Gy of gamma rays, the sensitivity of these cells to gamma rays, UV light, cis-dichlorodiammineplatinum (II) (cis-DDP), methotrexate (MTX), and hydroxyurea (HU) was examined and compared to control cells. Results revealed that preirradiated cells did not change sensitivity to gamma rays and UV light, but that they increased the resistance to cis-DDP, and MTX (especially for higher concentrations of MTX), and increased sensitivity to HU (for lower concentrations of HU). The increased resistance to cis-DDP was also measurable up to 30 days after the last dose of gamma rays. The results indicate that preirradiation of HeLa cells with multiple fractions of gamma rays could change their sensitivity to additional cytotoxic agents, and that this is a relatively long-lasting effect. Our results suggest that caution is needed in medical application of radiation combined with chemical treatment.

  17. Gamma-radiation induced interstrand cross-links in PNA:DNA heteroduplexes.

    PubMed

    Gantchev, Tsvetan G; Girouard, Sonia; Dodd, David W; Wojciechowski, Filip; Hudson, Robert H E; Hunting, Darel J

    2009-07-28

    Peptide nucleic acids (PNAs) efficiently hybridize with DNA and are promoted as versatile gene-targeting analytical tools and pharmaceuticals. However, PNAs have never been exploited as radiopharmaceuticals, and radiation-induced physicochemical modifications of PNA:DNA heteroduplexes have not been studied. Drug- and radiation-induced creation of covalent cross-links in DNA obstruct crucial cell survival processes such as transcription and replication and are thus considered genotoxic events with a high impact in anticancer therapies. Here we report that gamma-irradiation of complementary PNA:DNA heteroduplexes, wherein the PNA contains l-lysine, free amino, or N-methylmorpholinium N- and C-capping groups, results in the formation of irreversible interstrand cross-links (ICL). The number of detected ICL corresponds to the number of available amino functional groups on the PNA. The effect of DNA sequence on the formation of ICL was studied by modifying the terminal nucleotides of the DNA oligonucleotide to create deletions and overhangs. The involvement of abasic sites (ABS) on the DNA strand in the cross-linking reaction was confirmed by independent experiments with synthetic ABS-containing oligonucleotides. Molecular modeling and molecular dynamics (MD) simulations were applied to elucidate the conformation of the N- and C-capping groups of the PNA oligomer and their interactions with the proximal terminus of the DNA. Good agreement between experimental and modeling results was achieved. Modeling indicated that the presence of positively charged capping groups on the PNA increases the conformational flexibility of the PNA:DNA terminal base pairs and often leads to their melting. This disordered orientation of the duplex ends provides conditions for multiple encounters of the short (amino) and bulky (Lys) side chains with nucleobases and the DNA backbone up to the third base pair along the duplex stem. Dangling duplex ends offer favorable conditions for increased accessibility of the radiation-induced free radicals to terminal nucleotides and their damage. It is suggested that the ICL are produced by initial formation of Schiff base adducts between the PNA amino functions and the opposed DNA oxidation-damaged bases or abasic 2'-deoxyribose-derived aldehydic groups. The subsequent reduction by solvated electrons (e(-)(aq)) or other radiation-produced reducing species results in irreversible covalent interstrand cross-links. The simultaneous involvement of oxidizing, (*)OH, and reducing, e(-)(aq), radicals presents a case in which multiple ionization events along a gamma-particle path lead to DNA injuries that also encompass ICL as part of the multiply damaged sites (MDS). The obtained results may find applications in the development of a new generation of gene-targeted radiosensitizers based on PNA vectors. PMID:19469551

  18. Effective gamma-ray doses due to natural radiation from soils of southeastern Brazil

    SciTech Connect

    Silveira, M. A. G.; Moreira, R. H.; Bellini, B. S.; Medina, N. H.; Aguiar, V. A. P.

    2010-08-04

    We have used gamma-ray spectrometry to study the distribution of natural radiation from soils of southeastern Brazil: Billings reservoir, Sao Bernardo do Campo Parks, Diadema Parks, Interlagos region, Sao Paulo, and soil from Sao Paulo and Rio de Janeiro beaches. In most of the regions studied we have found that the dose due the external exposure to gamma-rays, proceeding from natural terrestrial elements, are between the values 0.3 and 0.6 mSv/year, established by the United Nations Scientific Committee on the Effects of Atomic Radiation.

  19. Inactivation of aflatoxin B1 by using the synergistic effect of hydrogen peroxide and gamma radiation

    SciTech Connect

    Patel, U.D.; Govindarajan, P.; Dave, P.J. )

    1989-02-01

    Inactivation of aflatoxin B1 was studied by using gamma radiation and hydrogen peroxide. A 100-krad dose of gamma radiation was sufficient to inactivate 50 micrograms of aflatoxin B1 in the presence of 5% hydrogen peroxide, and 400 krad was required for total degradation of 100 micrograms of aflatoxin in the same system. Degradation of aflatoxin B1 was confirmed by high-pressure liquid chromatographic and thin-layer chromatographic analysis. Ames microsomal mutagenicity test showed loss of aflatoxin activity. This method of detoxification also reduces the toxin levels effectively in artificially contaminated groundnuts.

  20. Unraveling low-level gamma radiation--responsive changes in expression of early and late genes in leaves of rice seedlings at Iitate Village, Fukushima.

    PubMed

    Hayashi, Gohei; Shibato, Junko; Imanaka, Tetsuji; Cho, Kyoungwon; Kubo, Akihiro; Kikuchi, Shoshi; Satoh, Kouji; Kimura, Shinzo; Ozawa, Shoji; Fukutani, Satoshi; Endo, Satoru; Ichikawa, Katsuki; Agrawal, Ganesh Kumar; Shioda, Seiji; Fukumoto, Manabu; Rakwal, Randeep

    2014-01-01

    In the summer of 2012, 1 year after the nuclear accident in March 2011 at the Fukushima Daiichi nuclear power plant, we examined the effects of gamma radiation on rice at a highly contaminated field of Iitate village in Fukushima, Japan. We investigated the morphological and molecular changes on healthy rice seedlings exposed to continuous low-dose gamma radiation up to 4 Sv h(-1), about 80 times higher than natural background level. After exposure to gamma rays, expression profiles of selected genes involved in DNA replication/repair, oxidative stress, photosynthesis, and defense/stress functions were examined by RT-PCR, which revealed their differential expression in leaves in a time-dependent manner over 3 days (6, 12, 24, 48, and 72 h). For example, OsPCNA mRNA rapidly increased at 6, 12, and 24 h, suggesting that rice cells responded to radiation stress by activating a gene involved in DNA repair mechanisms. At 72 h, genes related to the phenylpropanoid pathway (OsPAL2) and cell death (OsPR1oa) were strongly induced, indicating activation of defense/stress responses. We next profiled the transcriptome using a customized rice whole-genome 444K DNA microarray at early (6h) and late (72 h) time periods. Low-level gamma radiation differentially regulated rice leaf gene expression (induced 4481 and suppressed 3740 at 6 h and induced 2291 and suppressed 1474 genes at 72 h) by at least 2-fold. Using the highly upregulated and downregulated gene list, MapMan bioinformatics tool generated diagrams of early and late pathways operating in cells responding to gamma ray exposure. An inventory of a large number of gamma radiation-responsive genes provides new information on novel regulatory processes in rice. PMID:25124817

  1. Gadolinium-doped water cerenkov-based neutron and high energy gamma-ray detector and radiation portal monitoring system

    SciTech Connect

    Dazeley, Steven A; Svoboda, Robert C; Bernstein, Adam; Bowden, Nathaniel

    2013-02-12

    A water Cerenkov-based neutron and high energy gamma ray detector and radiation portal monitoring system using water doped with a Gadolinium (Gd)-based compound as the Cerenkov radiator. An optically opaque enclosure is provided surrounding a detection chamber filled with the Cerenkov radiator, and photomultipliers are optically connected to the detect Cerenkov radiation generated by the Cerenkov radiator from incident high energy gamma rays or gamma rays induced by neutron capture on the Gd of incident neutrons from a fission source. The PMT signals are then used to determine time correlations indicative of neutron multiplicity events characteristic of a fission source.

  2. Response of thyroid follicular cells to gamma irradiation compared to proton irradiation. I. Initial characterization of DNA damage, micronucleus formation, apoptosis, cell survival, and cell cycle phase redistribution

    NASA Technical Reports Server (NTRS)

    Green, L. M.; Murray, D. K.; Bant, A. M.; Kazarians, G.; Moyers, M. F.; Nelson, G. A.; Tran, D. T.

    2001-01-01

    The RBE of protons has been assumed to be equivalent to that of photons. The objective of this study was to determine whether radiation-induced DNA and chromosome damage, apoptosis, cell killing and cell cycling in organized epithelial cells was influenced by radiation quality. Thyroid-stimulating hormone-dependent Fischer rat thyroid cells, established as follicles, were exposed to gamma rays or proton beams delivered acutely over a range of physical doses. Gamma-irradiated cells were able to repair DNA damage relatively rapidly so that by 1 h postirradiation they had approximately 20% fewer exposed 3' ends than their counterparts that had been irradiated with proton beams. The persistence of free ends of DNA in the samples irradiated with the proton beam implies that either more initial breaks or a quantitatively different type of damage had occurred. These results were further supported by an increased frequency of chromosomal damage as measured by the presence of micronuclei. Proton-beam irradiation induced micronuclei at a rate of 2.4% per gray, which at 12 Gy translated to 40% more micronuclei than in comparable gamma-irradiated cultures. The higher rate of micronucleus formation and the presence of larger micronuclei in proton-irradiated cells was further evidence that a qualitatively more severe class of damage had been induced than was induced by gamma rays. Differences in the type of damage produced were detected in the apoptosis assay, wherein a significant lag in the induction of apoptosis occurred after gamma irradiation that did not occur with protons. The more immediate expression of apoptotic cells in the cultures irradiated with the proton beam suggests that the damage inflicted was more severe. Alternatively, the cell cycle checkpoint mechanisms required for recovery from such damage might not have been invoked. Differences based on radiation quality were also evident in the alpha components of cell survival curves (0.05 Gy(-1) for gamma rays, 0.12 Gy(-1) for protons), which suggests that the higher level of survival of gamma-irradiated cells could be attributed to the persistence of nonlethally irradiated thyrocytes and/or the capacity to repair damage more effectively than cells exposed to equal physical doses of protons. The final assessment in this study was radiation-induced cell cycle phase redistribution. Gamma rays and protons produced a similar dose-dependent redistribution toward a predominantly G(2)-phase population. From our cumulative results, it seems likely that a majority of the proton-irradiated cells would not continue to divide. In conclusion, these findings suggest that there are quantitative and qualitative differences in the biological effects of proton beams and gamma rays. These differences could be due to structured energy deposition from the tracks of primary protons and the associated high-LET secondary particles produced in the targets. The results suggest that a simple dose-equivalent approach to dosimetry may be inadequate to compare the biological responses of cells to photons and protons.

  3. Gamma evaluation combined with isocenter optimal matching in intensity modulated radiation therapy quality assurance

    NASA Astrophysics Data System (ADS)

    Bak, Jino; Choi, Jin Hwa; Park, Suk Won; Park, Kwangwoo; Park, Sungho

    2015-12-01

    Two-dimensional (2D) dose comparisons are widely performed by using a gamma evaluation with patient-specific intensity modulated radiation therapy quality assurance (IMRT QA) or dose delivery quality assurance (DQA). In this way, a pass/fail determination is made for a particular treatment plan. When gamma evaluation results are close to the failure criterion, the pass/fail decision may change applying a small shift to the center of the 2D dose distribution. In this study, we quantitatively evaluated the meaning of such a small relative shift in a 2D dose distribution comparison. In addition, we propose the use of a small shift for a pass/fail criterion in gamma analysis, where the concept of isocenter optimal matching (IOM) is applied to IMRT QA of 20 patients. Gamma evaluations were performed to compare two dose distributions, one with and the other without IOM. In-house software was developed in C++ in order to find IOM values including both translational and rotational shifts. Upon gamma evaluation failure, further investigation was initiated using IOM. In this way, three groups were categorized: group 1 for `pass' on gamma evaluation, group 21 for `fail' on the gamma evaluation and `pass' on the gamma the evaluation with IOM, and group 22 for `fail' on the both gamma evaluations and the IOM calculation. IOM results revealed that some failures could be considered as a `pass'. In group 21, 88.98% (fail) of the averaged gamma pass rate changed to 90.45% (pass) when IOM was applied. On average, a ratio of γ ≥ 1 was reduced by 11.06% in 20 patients. We propose that gamma evaluations that do not pass with a rate of 85% to 90% may be augmented with IOM to reveal a potential pass result.

  4. Measurement of gamma and neutron radiations inside spent fuel assemblies with passive detectors

    NASA Astrophysics Data System (ADS)

    Viererbl, L.; Lahodová, Z.; Voljanskij, A.; Klupák, V.; Koleška, M.; Cabalka, M.; Turek, K.

    2011-10-01

    During operation of a fission nuclear reactor, many radionuclides are generated in fuel by fission and activation of 235U, 238U and other nuclides present in the assembly. After removal of a fuel assembly from the core, these radionuclides are sources of different types of radiation. Gamma and neutron radiation emitted from an assembly can be non-destructively detected with different types of detectors. In this paper, a new method of measurement of radiation from a spent fuel assembly is presented. It is based on usage of passive detectors, such as alanine dosimeters for gamma radiation and track detectors for neutron radiation. Measurements are made on the IRT-2M spent fuel assemblies used in the LVR-15 research reactor. During irradiation of detectors, the fuel assembly is located in a water storage pool at a depth of 6 m. Detectors are inserted into central hole of the assembly, irradiated for a defined time interval, and after the detectors removed from the assembly, gamma dose or neutron fluence are evaluated. Measured profiles of gamma dose rate and neutron fluence rate inside of the spent fuel assembly are presented. This measurement can be used to evaluate relative fuel burn-up.

  5. Argon laser phototherapy could eliminate the damage effects induced by the ionizing radiation "gamma radiation" in irradiated rabbits.

    PubMed

    Abdul-Aziz, Karolin Kamel; Tuorkey, M J

    2010-04-01

    The ionizing radiations could be taken in considerate as an integral part in our life, since, living organisms are actually exposed to a constant shower of ionizing radiations whether from the natural or artificial resources. The radio-protective efficiency of several chemicals has been confirmed in animal trails, whereas, due to their accumulative toxicity, their clinical utility is limited. Therefore, we aimed in the present work to investigate the possibility of using argon laser to recuperate the damaged tissues due to exposing to the ionizing radiation. The rabbits were used in this study, and they were designed as control, gamma irradiated, laser, and gamma plus laser groups. Lipid peroxidation, reduced glutathione (GSH), glutathione peroxidase (GSH-Px) and glucose-6-phosphate dehydrogenase (G-6-PD) in blood and liver were evaluated. As well as, the level of protein thiol was evaluated in the plasma among each group. Results of this study revealed the potential therapeutic performance of the treatment by laser argon to decline the damaging effect of the ionized radiation whether at systematic or local levels. In conclusion, argon laser therapy appears propitious protective effect against the hazard effects of gamma radiation. PMID:20202857

  6. Calculated thickness of tungsten alloy required for specified attenuation of gamma radiation from sup 137 CS

    SciTech Connect

    Chiles, M.M.; Allin, G.W.; Pace, J.V. III.

    1991-01-01

    The traditional method of evaluating and calibrating health physics instruments is to use a calibrator that consists of a single high-activity gamma radiation source with different attenuators to select the radiation level desired for tesing. To have accurate radiation intensities inside the calibrator cavity, the attenuators must be designed from precise absorption calculations. This paper reports calculations made to determine the thickness of tungsten alloy metal required for specific attenuation. These calculations include the buildup contribution by secondary scattering radiation, and they are compared to values calculated with the buildup factor omitted. 3 refs., 2 figs., 3 tabs.

  7. A biotechnological project with a gamma radiation source of 100,000 Ci

    NASA Astrophysics Data System (ADS)

    Lombardo, J. H.; Smolko, E. E.

    A project for the production of radiovaccines and other bio-medical products is presented which includes a radiation facility provided with a gamma ray source equivalent to 100,000 Ci of Co-60. The whole process incorporates novel basic features in virus production and inactivation steps. The former is carried out in animals previously subjected to immunodepression through electromagnetic radiation. The later is obtained at low temperatures by using either electromagnetic or particle radiations. A vaccine manufacture process is shown to illustrate the utilization of ionizing radiations to obtain a foot and mouth disease virus (FMDV) vaccine with good antigenic quality and low cost.

  8. Radiation detection system for portable gamma-ray spectroscopy

    DOEpatents

    Rowland, Mark S. (Alamo, CA); Howard, Douglas E. (Livermore, CA); Wong, James L. (Dublin, CA); Jessup, James L. (Tracy, CA); Bianchini, Greg M. (Livermore, CA); Miller, Wayne O. (Livermore, CA)

    2006-06-20

    A portable gamma ray detection apparatus having a gamma ray detector encapsulated by a compact isolation structure having at least two volumetrically-nested enclosures where at least one is a thermal shield. The enclosures are suspension-mounted to each other to successively encapsulate the detector without structural penetrations through the thermal shields. A low power cooler is also provided capable of cooling the detector to cryogenic temperatures without consuming cryogens, due to the heat load reduction by the isolation structure and the reduction in the power requirements of the cooler. The apparatus also includes a lightweight portable power source for supplying power to the apparatus, including to the cooler and the processing means, and reducing the weight of the apparatus to enable handheld operation or toting on a user's person.

  9. Microwave and gamma radiation observations of soil moisture

    NASA Technical Reports Server (NTRS)

    Schmugge, T. J.; Njoku, E. G.; Peck, E.; Ulaby, F. T.

    1979-01-01

    The unique dielectric properties of water at microwave wavelengths afford the possibility for remotely sensing the moisture content in the surface layer of the soil. The surface emissivity and reflectivity for the soils at these wavelengths are strong functions of its moisture content. The changes in emissivity can be observed by passive microwave techniques (radiometry) and the change in reflectivity can be observed by active microwave techniques (radar). The difference in the natural terrestrial gamma ray flux measured for wet and dry soil may be used to determine soil moisture. The presence of water moisture in the soil causes an effective increase in soil density, resulting in an increased attenuation of the gamma flux for wet soil and a corresponding lower flux above the ground surface.

  10. Gamma radiation and photospheric white-light flare continuum

    NASA Technical Reports Server (NTRS)

    Hudson, H. S.; Dwivedi, B. N.

    1982-01-01

    It is noted that recent gamma-ray observations of solar flares have provided a better means for estimating the heating of the solar atmosphere by energetic protons. This type of heating has been suggested as the explanation of the continuum emission of the white-light flare. The effects on the photosphere of high-energy particles capable of producing the intense gamma-ray emission observed in the flare of July 11, 1978, are analyzed. A simple energy-balance argument is used, and hydrogen ionization is taken into account. It is found that energy deposition increases with height for the inferred proton spectra and is not strongly dependent upon the assumed angle of incidence. At the top of the photosphere, the computed energy inputs fall in the range 10-100 ergs/cu cm-s.

  11. Measurement of gamma radiation levels in soil samples from Thanjavur using gamma-ray spectrometry and estimation of population exposure.

    PubMed

    Senthilkumar, B; Dhavamani, V; Ramkumar, S; Philominathan, P

    2010-01-01

    This study assesses the level of terrestrial gamma radiation and associated dose rates from the naturally occurring radionuclides (232)Th, (238)U and (40)K in 10 soil samples collected from Thanjavur (Tamil Nadu, India) using gamma-ray spectrometry. The activity profile of radionuclides has clearly showed the existence of low level activity in Thanjavur. The geometric mean activity concentrations of (232)Th, (238)U and (40)K is 42.9+/-9.4 Bq.kg(-1), 14.7+/-1.7 Bq.kg(-1) and 149.5+/-3.1 Bq.kg(-1) respectively are derived from all the soil samples studied. The activity concentration of (232)Th, (238)U and (40)K in soil is due to the presence of metamorphic rocks like shale, hornblende-biotite gneiss and quartzofeldspathic gneiss in these areas. Gamma absorbed dose rates in air outdoors were calculated to be in the range between 32 nGy.h(-1) and 59.1 nGy.h(-1) with an arithmetic mean of 43.3 +/-9 nGy.h(-1). This value is lesser than the population weighted world-averaged of 60 nGy.h(-1). Inhabitants of Thanjavur are subjected to external gamma radiation exposure (effective dose) ranging between 39.2 and 72.6 muSv.y(-1) with an arithmetic mean of 53.1+/-11 muSv.y(-1). The values of the external hazard index determined from the soil radioactivity of the study area are less than the recommended safe levels. PMID:20177570

  12. Radioactivity of building materials and the gamma radiation in dwellings.

    PubMed

    Stranden, E

    1979-09-01

    Measurements of the radioactivity in some common building materials in Norway are reported, together with calculations of the gamma-ray exposure from walls of different materials. Model rooms are used in calculations of the mean exposure inside concrete, brick and light-weight expanded clay aggregate buildings. These calculations give very good agreement with previous experimental results. The radiological implications of using building materials with high concentrations of radioactivity are also discussed. PMID:515178

  13. High-energy gamma radiation from extragalactic radio sources

    NASA Technical Reports Server (NTRS)

    Dermer, C. D.; Schlickeiser, R.; Mastichiadis, A.

    1992-01-01

    We propose that the important relationship between 3C 273 and 3C 279, the first two extragalactic sources detected at over 100 MeV energies, is their superluminal nature. In support of this conjecture, we propose a kinematic focusing mechanism, based on Compton scattering of accretion-disk photons by relativistic nonthermal electrons in the jet, that preferentially emits gamma rays in the superluminal direction.

  14. Energetic Gamma Radiation from Rapidly Rotating Black Holes

    NASA Astrophysics Data System (ADS)

    Hirotani, Kouichi; Pu, Hung-Yi

    2016-02-01

    Supermassive black holes (BHs) are believed to be the central powerhouse of active galactic nuclei. Applying the pulsar outer-magnetospheric particle accelerator theory to BH magnetospheres, we demonstrate that an electric field is exerted along the magnetic field lines near the event horizon of a rotating BH. In this particle accelerator (or a gap), electrons and positrons are created by photon–photon collisions and accelerated in the opposite directions by this electric field, efficiently emitting gamma-rays via curvature and inverse-Compton processes. It is shown that a gap arises around the null-charge surface formed by the frame-dragging effect, provided that there is no current injection across the gap boundaries. The gap is dissipating a part of the hole’s rotational energy, and the resultant gamma-ray luminosity increases with decreasing plasma accretion from the surroundings. Considering an extremely rotating supermassive BH, we show that such a gap reproduces the significant very-high-energy (VHE) gamma-ray flux observed from the radio galaxy IC 310, provided that the accretion rate becomes much less than the Eddington rate particularly during its flare phase. It is found that the curvature process dominates the inverse-Compton process in the magnetosphere of IC 310, and that the observed power-law-like spectrum in VHE gamma-rays can be explained to some extent by a superposition of the curvature emissions with varying curvature radius. It is predicted that the VHE spectrum extends into higher energies with increasing VHE photon flux.

  15. Poly (DADMAC) encapsulation in PES microcapsules utilizing gamma radiation

    NASA Astrophysics Data System (ADS)

    Francis, Sanju; Varshney, Lalit; Tirumalesh, Keesari; Sabharwal, Sunil

    2009-01-01

    In this communication, a method for encapsulation of a polymeric resin using radiation technology is reported. The quaternary ammonium resin, polydiallyldimethylammonium chloride (PDADMAC) was incorporated in the core of a preformed hollow polyethersulfone microcapsule, using radiation technology, for the extraction of anions from aqueous solutions. The idea was to introduce the monomer into the porous microcapsules and initiate polymerization by radiation to trap the polymer formed inside the capsule. The resultant capsule was able to take up and exchange some anions (F -, Cl -, Br -, NO 32- and SO 42-) at relatively low concentrations.

  16. Immunotherapy of acute radiation syndromes with antiradiation gamma G globulin.

    NASA Astrophysics Data System (ADS)

    Popov, Dmitri; Maliev, Vecheslav; Casey, Rachael; Jones, Jeffrey; Kedar, Prasad

    Introduction: If an immunotherapy treatment approach to treatment of acute radiation syndromes (ARS) were to be developed; consideration could be given to neutralization of radiation toxins (Specific Radiation Determinants- SRD) by specific antiradiation antibodies. To accomplish this objective, irradiated animals were injected with a preparation of antiradiation immunoglobulin G (IgG) obtained from hyperimmune donors. Radiation-indeced toxins that we call Specific Radiation Determinants (SRD) possess toxic (neurotoxic, haemotoxic and enterotoxic) characteristics as well as specific antigenic properties that combined with the direct physiochemical direct radiation damage, induce the development of many of the pathological processes associated with ARS. We tested several specific hyperimmune IgG preparations against these radiation toxins and observed that their toxic properties were neutralized by specific antiradiation IgGs. Material and Methods: Rabbits were inoculated with SRD radiation toxins to induce hyperimmune serum. The hyperimmune serum was pooled from several animals, purified, and concentrated. Enzyme-linked immunosorbent assays of the hyperimmune serum revealed high titers of IgG with specific binding to radiation toxins. The antiradiation IgG preparation was injected into laboratory animals one hour before and three hours after irradiation, and was evaluated for its ability to protect inoculated animals against the development of acute radiation syndromes. Results: Animals that were inoculated with specific antiradiation antibodies before receiving lethal irradiation at LD 100/30 exhibited 60-75% survival rate at 30 days, whereas all control animals expired by 30 days following exposure. These inoculated animals also exhibited markedly reduced clinical symptoms of ARS, even those that did not survive irradiation. Discussion: The results of our experiments demonstrate that rabbit hyperimmune serum directed against SRD toxins afford significant, albeit incomplete, protection against high doses of radiation. In comparison, the mortality rate of irradiated control animals was 100% in the same time period. The mortality rates of hyperimmune serum-treated animals varied in different groups of animals and different forms of ARS; however, significant radioprotection was observed in each group treated with IgGs activated against specific radiation toxins.

  17. Heterogeneity in the radiation survival curves and biochemical properties of human lung cancer cell lines

    SciTech Connect

    Morstyn, G.; Russo, A.; Carney, D.N.; Karawya, E.; Wilson, S.H.; Mitchell, J.B.

    1984-10-01

    Human lung cancers of distinct histology exhibit different responses to radiation therapy in vivo. For examination of the basis of this phenomenon, the radiation survival curves and levels of relevant enzymes were determined in 16 lung cancer cell lines derived from tumors of different histology. These included lines from 5 adenocarcinomas, 7 small cell tumors, 3 variant small cell tumors, and 1 large cell tumor. These findings were compared to those obtained with the use of a normal skin fibroblast cell line. Whether cloned in liquid culture or soft agarose, cell lines had similar radiation survival curves. These curves were consistent with the apparent in vivo radiation responsiveness of the tumors. Although considerable heterogeneity in radiation survival curves was observed among the cell lines, cells from large cell lines and small variant lines had pronounced shoulders and extrapolation numbers (n) from 5.6 to 14. In contrast, cells from small cell lines and adenocarcinoma cell lines were more sensitive (-n values of 1-3.3). In these cell lines, levels of DNA polymerase beta, glutathione (GSH), GSH transferase, GSH reductase (NAD(P)H), gamma-glutamyltransferase did not correlate with radiation parameters of sensitivity. DNA polymerase beta and GSH levels were, however, higher than those in a line of normal skin fibroblasts. These cell lines may be useful in identifying the basis of the variable responsiveness of human lung cancer cells to ionizing radiation.

  18. GaAs Solar Cell Radiation Handbook

    NASA Technical Reports Server (NTRS)

    Anspaugh, B. E.

    1996-01-01

    The handbook discusses the history of GaAs solar cell development, presents equations useful for working with GaAs solar cells, describes commonly used instrumentation techniques for assessing radiation effects in solar cells and fundamental processes occurring in solar cells exposed to ionizing radiation, and explains why radiation decreases the electrical performance of solar cells. Three basic elements required to perform solar array degradation calculations: degradation data for GaAs solar cells after irradiation with 1 MeV electrons at normal incidence; relative damage coefficients for omnidirectional electron and proton exposure; and the definition of the space radiation environment for the orbit of interest, are developed and used to perform a solar array degradation calculation.

  19. Papain incorporated chitin dressings for wound debridement sterilized by gamma radiation

    NASA Astrophysics Data System (ADS)

    Singh, Durgeshwer; Singh, Rita

    2012-11-01

    Wound debridement is essential for the removal of necrotic or nonviable tissue from the wound surface to create an environment conducive to healing. Nonsurgical enzymatic debridement is an attractive method due to its effectiveness and ease of use. Papain is a proteolytic enzyme derived from the fruit of Carica papaya and is capable of breaking down a variety of necrotic tissue substrates. The present study was focused on the use of gamma radiation for sterilization of papain dressing with wound debriding activity. Membranes with papain were prepared using 0.5% chitin in lithium chloride/dimethylacetamide solvent and sterilized by gamma radiation. Fluid absorption capacity of chitin-papain membranes without glycerol was 14.30±6.57% in 6 h. Incorporation of glycerol resulted in significant (p<0.001) increase in the absorption capacity. Moisture vapour transmission rate of the membranes was 4285.77±455.61 g/m2/24 h at 24 h. Gamma irradiation at 25 kGy was found suitable for sterilization of the dressings. Infrared (IR) spectral scanning has shown that papain was stable on gamma irradiation at 25-35 kGy. The irradiated chitin-papain membranes were impermeable to different bacterial strains and also exhibited strong bactericidal action against both Gram-positive and Gram-negative bacteria. The fluid handling characteristics and the antimicrobial properties of chitin-papain membranes sterilized by gamma radiation were found suitable for use as wound dressing with debriding activity.

  20. Comparison between the Spectra of Gamma Radiation for Climate Dry Periods and Rainy in the Southeast of Brazil

    NASA Astrophysics Data System (ADS)

    Gomes, M. P.; Martin, I. M.

    2013-05-01

    Through this work, present themselves the results obtained for the spectra of ionizing radiation (X-rays and gamma) environmental southeast Brazil for the periods of dry and rainy climate, respectively. One of the objectives this work is promoting through analysis of the results a better understand, in the educational area, the physical processes related to the background radiation of the places where measurements were made. In Brazil, there is still little information about the radiation from soil, radon gas atmospheric, cosmic and artificial origin. Measurements of gamma radiation spectra were performed with a scintillator of NaI (Tl) (volume 300 cm3) mounted within an aluminum cell and coupled to a photomultiplier tube, which in turn is coupled through an interface to specify a notebook for storage of data. The measurement of X and gamma rays photons occur of way omnidirectional without distinction as to direction. The data acquisition was performed at fixed intervals of 1 minute continuously for the entire period of dry climate (June to October) and rainy (December 2012 to January 2013). Figures 1 and 2 show the results obtained for both periods, dry and rainy, respectively. Regarding the graph of Figure 1, is evidenced a cycle of 24 hours in the radiation spectrum. In this period without rain the radiation increases always between sunrise sunset until 11 - 12 hours local, due to the increased presence of radon gas (222Rn) which decays after 3.8 days in 214Pb and 214Bi, emitting photons in the range of energy the detector is measuring (0.030 to 3.0 MeV). The graph in Figure 2 shows that during the rainy period, there was a significant increase in radiation intensity, in addition to that already shown in the dry times that for certain time intervals. This increase is due to when occurs precipitation, the amount of radon gas increases because of the phenomenon of washing the lower atmosphere where the gas is suspended and diluted in water droplets. In the rainy period, the periodicity that is present in the spectrum of the dry climate is practically destroyed due to the interference of photons gamma of radon gas from the rain.

  1. Mechanism of induction of nuclear anomalies by gamma-radiation in the colonic epithelium of the mouse

    SciTech Connect

    Duncan, A.M.; Heddle, J.A.; Blakey, D.H.

    1985-01-01

    The induction of karyorrhexis and nuclear anomalies in colonic crypt cells has been correlated positively with the induction of colonic tumors by chemical treatment. These nuclear anomalies occur in the proliferative region of the crypt and exhibit a variety of morphological characteristics. Some nuclear anomalies resemble the micronuclei that arise from chromosomal fragments after mitosis. Here, we report that the nuclear anomalies observed within the first few hr of insult with gamma-radiation are independent of mitosis for their expression, as evidenced by failure of colchicine to inhibit their induction, and do not arise from chromosomal material lost during mitosis.

  2. Repair of radiation damage in mammalian cells

    SciTech Connect

    Setlow, R.B.

    1981-01-01

    The responses, such as survival, mutation, and carcinogenesis, of mammalian cells and tissues to radiation are dependent not only on the magnitude of the damage to macromolecular structures - DNA, RNA, protein, and membranes - but on the rates of macromolecular syntheses of cells relative to the half-lives of the damages. Cells possess a number of mechanisms for repairing damage to DNA. If the repair systems are rapid and error free, cells can tolerate much larger doses than if repair is slow or error prone. It is important to understand the effects of radiation and the repair of radiation damage because there exist reasonable amounts of epidemiological data that permits the construction of dose-response curves for humans. The shapes of such curves or the magnitude of the response will depend on repair. Radiation damage is emphasized because: (a) radiation dosimetry, with all its uncertainties for populations, is excellent compared to chemical dosimetry; (b) a number of cancer-prone diseases are known in which there are defects in DNA repair and radiation results in more chromosomal damage in cells from such individuals than in cells from normal individuals; (c) in some cases, specific radiation products in DNA have been correlated with biological effects, and (d) many chemical effects seem to mimic radiation effects. A further reason for emphasizing damage to DNA is the wealth of experimental evidence indicating that damages to DNA can be initiating events in carcinogenesis.

  3. Response of organic liquid scintillators to fast neutrons and gamma radiation

    NASA Astrophysics Data System (ADS)

    Hoertz, Paul G.; Mills, Karmann; Davis, Lynn; Baldasaro, Nicholas; Gupta, Vijay

    2013-03-01

    Liquid organic scintillators are cocktails of aromatic fluorophores in an aromatic solvent. They find widespread use in Liquid Scintillation Counters with applications in medical diagnostics as well as fundamental nuclear and particle physics. Ultima Gold XR, a commercially available organic liquid scintillator from Perkin Elmer, can be used in both aqueous and non-aqueous systems and is typically used for beta detection in medical diagnostics. Its performance under gamma radiation and neutron radiation is less well-characterized. Special and normal Ultima Gold XR liquid scintillators were exposed in separate experiments to fast neutrons and high energy photons from a nuclear reactor and to gamma rays from a Co-60 source. To perform the measurements in the radiation chamber, a custom light collection system consisting of a fiber optic cable, spectrometer and a diffuse reflecting optical cavity was fabricated. Advanced calibration procedures, traceable to NIST standards, were developed to determine photon fluxes and flux densities of the scintillators under ionizing radiation conditions. The scintillator emission spectra under gamma radiation from a Co-60 source and neutron radiation from a pool-type nuclear reactor were recorded and compared. Results on the spectrometer design and comparison of the spectra under different exposure are presented.

  4. Orbital Observatory GLAST - New Step in the Study of Cosmic Gamma Radiation: Mission Overview

    NASA Technical Reports Server (NTRS)

    Moiseev, Alexander

    2008-01-01

    This viewgraph presentation is a overview of the Gamma-ray Large Area Space Telescope (GLAST), now named Fermi Space Telescope. The new telescope is scheduled for launch in the middle of 2008. It contains the high energy gamma-ray telescope LAT (Large Area Telescope) and the GMB (GLAST Burst Monitor). The science objectives of GLAST cover almost every area of high energy astrophysics, including Active Galactic Nuclei (AGN), including Extragalactic background light (EBL), Gamma-ray bursts (GRB), Pulsars, Diffuse gamma-radiation, EGRET unidentified sources, Solar physics, Origin of Cosmic Rays and, Dark Matter and New Physics. Also included in this overview is a discussion of the preparation to the analysis of the science data.

  5. Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

    NASA Astrophysics Data System (ADS)

    Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo

    2007-07-01

    Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.

  6. Production of hydrogel wound dressings using gamma radiation

    NASA Astrophysics Data System (ADS)

    Ajji, Z.; Othman, I.; Rosiak, J. M.

    2005-04-01

    Hydrogel wound dressings have been prepared using the gamma rays irradiation technique. The dressings are composed of poly(vinyl pyrrolidone) (PVP), poly(ethylene glycol) (PEG) and agar. The influence of some process parameters on the properties of the dressings has been investigated as: the gel fraction, maximum swelling, swelling kinetics, and mechanical properties. The gel fraction increases with increasing PVP concentration due to increased crosslink density, and decreases with increasing the PEG concentration. PEG seems to act not only as plasticizer but also to modify the gel properties as gelation% and maximum swelling. The prepared hydrogels dressings could be considered as a good barrier against microbes.

  7. Use of gamma radiation as a form of preservation of sweet potatoes

    NASA Astrophysics Data System (ADS)

    The effects of (GAMMA) radiation on the sweet potato weevil, organoleptic properties of sweet potatoes, protein content of same, and sweet potato quality (vitamins, color, texture, and carbohydrates) are discussed. Evaluation of preliminary results indicate that changes should be made in irradiation procedures/conditions and analyses.

  8. Use of gamma radiation as a form of preservation of sweet potatoes. Quarterly progress report

    SciTech Connect

    Not Available

    1985-01-01

    This progress report covers: harvest and conditioning following harvest; effects of ..gamma.. radiation on the sweet potato weevil, organoleptic properties of sweet potatoes, protein content of same, and sweet potato quality (vitamins, color, texture, and carbohydrates). Evaluation of preliminary results indicate that changes should be made in irradiation procedures/conditions and analyses. (DLC)

  9. The production and composition of rat sebum is unaffected by 3 Gy gamma radiation

    PubMed Central

    Lanz, Christian; Ledermann, Monika; Slavk, Josef; Idle, Jeffrey R.

    2013-01-01

    Purpose The aim of this work was to use metabolomics to evaluate sebum as a source of biomarkers for gamma-radiation exposure in the rat, and potentially in man. Proof of concept of radiation metabolomics was previously demonstrated in both mouse and rat urine, from the radiation dose- and time-dependent excretion of a set of urinary biomarkers. Materials and methods Rats were gamma-irradiated (3 Gy) or sham irradiated and groups of rats were euthanised at 1 h or 24 h post-irradiation. Sebum was collected by multiple washings of the carcasses with acetone. Nonpolar lipids were extracted, methylated, separated and quantitated using gas chromatography-mass spectrometry (GCMS). Metabolomic analysis of the GCMS data was performed using both orthogonal projection to latent structures-discriminant analysis and random forests machine learning algorithm. Results Irradiation did not alter sebum production. A total of 35 lipids were identified in rat sebum, 29 fatty acids, five fatty aldehydes, and cholesterol. Metabolomics showed that three fatty acids, palmitic, 2-hydroxypalmitic, and stearic acids were potential biomarkers. Sebaceous palmitic acid was marginally statistically significantly elevated (7.58.4%) at 24 h post-irradiation. Conclusions Rat sebaceous gland appears refractory to 3 Gy gamma-irradiation. Unfortunately, collection of sebum shortly after gamma-irradiation is unlikely to form the basis of high-throughput non-invasive radiation biodosimetry in man. PMID:21158499

  10. MICRONUCLEI IN BINUCLEATED LYMPHOCYTES OF MICE FOLLOWING EXPOSURE TO GAMMA RADIATION

    EPA Science Inventory

    Experiments were designed to investigate the induction of micronuclei (MN) in mouse peripheral blood lymphocytes (PBLs) after in vitro or in vivo exposure to 60Co gamma radiation. or the in vitro experiments, 4 ml of blood from male C57BL/6J mice were either irradiated in 6 ml Fa...

  11. Gamma radiation induced oxidation and tocopherols decrease in in-shell, peeled and blanched peanuts.

    PubMed

    de Camargo, Adriano Costa; de Souza Vieira, Thais Maria Ferreira; Regitano-D'Arce, Marisa Aparecida Bismara; de Alencar, Severino Matias; Calori-Domingues, Maria Antonia; Canniatti-Brazaca, Solange Guidolin

    2012-01-01

    In-shell, peeled and blanched peanut samples were characterized in relation to proximate composition and fatty acid profile. No difference was found in relation to its proximate composition. The three major fatty acids were palmitic acid, oleic acid, and linoleic acid. In order to investigate irradiation and storage effects, peanut samples were submitted to doses of 0.0, 5.0, 7.5 or 10.0 kGy, stored for six months at room temperature and monitored every three months. Peanuts responded differently to irradiation, particularly with regards to tocopherol contents, primary and secondary oxidation products and oil stability index. Induction periods and tocopherol contents were negatively correlated with irradiation doses and decreased moderately during storage. ?-Tocopherol was the most gamma radiation sensitive and peeled samples were the most affected. A positive correlation was found among tocopherol contents and the induction period of the oils extracted from irradiated samples. Gamma radiation and storage time increased oxidation compounds production. If gamma radiation is considered an alternative for industrial scale peanut conservation, in-shell samples are the best feedstock. For the best of our knowledge this is the first article with such results; this way it may be helpful as basis for future studies on gamma radiation of in-shell crops. PMID:22489128

  12. Inactivation of foodborne pathogens on crawfish tail meat using cryogenic freezing and gamma radiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Foodborne illness outbreaks occasionally occur as a result of microbiologically contaminated crustaceans, including crawfish. Cryogenic freezing and gamma radiation are two technologies which can be used to improve the microbiological safety and shelf-life of foods. In the U.S. the majority of non-c...

  13. Short-lived variations in the background gamma-radiation dose.

    PubMed

    Burnett, J L; Croudace, I W; Warwick, P E

    2010-09-01

    Sudden increases in the background gamma-radiation dose may occur due to the removal of (222)Rn and (220)Rn progeny from the atmosphere by wet deposition mechanisms. This contribution has been measured using a Geiger-Muller detector at the Atomic Weapons Establishment (Aldermaston, UK) during July 2005-April 2006. The results are approximated by a log-normal distribution and there were nine separate occurrences of the gamma-radiation dose exceeding 125% of the geometric mean value. The increases were associated with periods of heavy rainfall, although no correlation was evident between the dose rate and the amount of rainfall, as increased rainfall dilutes the activity further rather than increasing its atmospheric removal. The events were preceded by periods of fine weather and atmospheric stability that allow for the build-up of (222)Rn and (220)Rn progeny. Similar increases in gamma-radiation dose have been measured at a nearby monitoring station situated approximately 11 miles from Aldermaston. Increases in gamma-radiation dose during heavy rainfall have also been observed throughout the UK, that followed the trajectory of an air mass. All events decreased to typical values within 1-2 h as the water permeated into the ground below and the radioactivity decayed away. PMID:20826890

  14. Comparison of antibodies raised against heat-and gamma radiation-killed bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For antibody generation, pathogenic bacteria are often heat-treated prior to inoculation into host animals in order to prevent infection and subsequently, premature death of the host. Inoculation of host rabbits with gamma radiation-killed pathogenic bacteria was employed with the hopes of generati...

  15. Gamma Radiation Induced Oxidation and Tocopherols Decrease in In-Shell, Peeled and Blanched Peanuts

    PubMed Central

    de Camargo, Adriano Costa; de Souza Vieira, Thais Maria Ferreira; Regitano-D’Arce, Marisa Aparecida Bismara; de Alencar, Severino Matias; Calori-Domingues, Maria Antonia; Canniatti-Brazaca, Solange Guidolin

    2012-01-01

    In-shell, peeled and blanched peanut samples were characterized in relation to proximate composition and fatty acid profile. No difference was found in relation to its proximate composition. The three major fatty acids were palmitic acid, oleic acid, and linoleic acid. In order to investigate irradiation and storage effects, peanut samples were submitted to doses of 0.0, 5.0, 7.5 or 10.0 kGy, stored for six months at room temperature and monitored every three months. Peanuts responded differently to irradiation, particularly with regards to tocopherol contents, primary and secondary oxidation products and oil stability index. Induction periods and tocopherol contents were negatively correlated with irradiation doses and decreased moderately during storage. α-Tocopherol was the most gamma radiation sensitive and peeled samples were the most affected. A positive correlation was found among tocopherol contents and the induction period of the oils extracted from irradiated samples. Gamma radiation and storage time increased oxidation compounds production. If gamma radiation is considered an alternative for industrial scale peanut conservation, in-shell samples are the best feedstock. For the best of our knowledge this is the first article with such results; this way it may be helpful as basis for future studies on gamma radiation of in-shell crops. PMID:22489128

  16. Gamma radiation inactivation of non-0157:H7 shiga-toxin producing Escherichia coli in foods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Non-O157:H7 serovars of shiga-toxin producing Escherichia coli are emerging foodborne pathogens that have been associated with illness outbreaks and food product recalls on a global basis. Ionizing (gamma) radiation is a nonthermal food safety intervention technology that has been approved for use i...

  17. CDDO-Me Protects Normal Lung and Breast Epithelial Cells but Not Cancer Cells from Radiation

    PubMed Central

    El-Ashmawy, Mariam; Delgado, Oliver; Cardentey, Agnelio; Wright, Woodring E.; Shay, Jerry W.

    2014-01-01

    Although radiation therapy is commonly used for treatment for many human diseases including cancer, ionizing radiation produces reactive oxygen species that can damage both cancer and healthy cells. Synthetic triterpenoids, including CDDO-Me, act as anti-inflammatory and antioxidant modulators primarily by inducing the transcription factor Nrf2 to activate downstream genes containing antioxidant response elements (AREs). In the present series of experiments, we determined if CDDO-Me can be used as a radioprotector in normal non-cancerous human lung and breast epithelial cells, in comparison to lung and breast cancer cell lines. A panel of normal non-cancerous, partially cancer progressed, and cancer cell lines from both lung and breast tissue was exposed to gamma radiation with and without pre-treatment with CDDO-Me. CDDO-Me was an effective radioprotector when given ∼18 hours before radiation in epithelial cells (average dose modifying factor (DMF) = 1.3), and Nrf2 function was necessary for CDDO-Me to exert these radioprotective effects. CDDO-Me did not protect cancer lines tested from radiation-induced cytotoxicity, nor did it protect experimentally transformed human bronchial epithelial cells (HBECs) with progressive oncogenic manipulations. CDDO-Me also protected human lymphocytes against radiation-induced DNA damage. A therapeutic window exists in which CDDO-Me protects normal cells from radiation by activating the Nrf2 pathway, but does not protect experimentally transformed or cancer cell lines. This suggests that use of this oral available, non-toxic class of drug can protect non-cancerous healthy cells during radiotherapy, resulting in better outcomes and less toxicity for patients. PMID:25536195

  18. Radiation measurement above the lunar surface by Kaguya gamma-ray spectrometer

    NASA Astrophysics Data System (ADS)

    Hasebe, Nobuyuki; Nagaoka, Hiroshi; Kusano, Hiroki; Hareyama, Matoko; Ideguchi, Yusuke; Shimizu, Sota; Shibamura, Eido

    The lunar surface is filled with various ionizing radiations such as high energy galactic particles, albedo particles and secondary radiations of neutrons, gamma rays and other elementary particles. A high-resolution Kaguya Gamma-Ray Spectrometer (KGRS) was carried on the Japans lunar explorer SELENE (Kaguya), the largest lunar orbiter since the Apollo missions. The KGRS instrument employed, for the first time in lunar exploration, a high-purity Ge crystal to increase the identification capability of elemental gamma-ray lines. The Ge detector is surrounded by BGO and plastic counters as for anticoincidence shields. The KGRS measured gamma rays in the energy range from 200 keV to 13 MeV with high precision to determine the chemical composition of the lunar surface. It provided data on the abundance of major elements over the entire lunar surface. In addition to the gamma-ray observation by the KGRS, it successfully measured the global distribution of fast neutrons. In the energy spectra of gamma-rays observed by the KGRS, several saw-tooth- peaks of Ge are included, which are formed by the collision interaction of lunar fast neutrons with Ge atoms in the Ge crystal. With these saw-tooth-peaks analysis, global distribution of neutrons emitted from the lunara surface was successfully created, which was compared with the previous results obtained by Lunar Prospector neutron maps. Another anticoincidence counter, the plastic counter with 5 mm thickness, was used to veto radiation events mostly generated by charged particles. A single photomultiplier serves to count scintillation light from the plastic scintillation counter. The global map of counting rates observed by the plastic counter was also created, implying that the radiation counting rate implies the geological distribution, in spite that the plastic counter mostly measures high energy charged particles and energetic neutrons. These results are presented and discussed.

  19. Asymmetrical SRAM Cells For Radiation Tests

    NASA Technical Reports Server (NTRS)

    Buehler, Martin G.

    1989-01-01

    Features of circuits altered to increase or decrease sensitivity to radiation. State-space analysis used to analyze single-event-upset behavior of memory cell. When voltage on node a is set at one of indicated initial values Vao and then released, voltages on nodes a and b then follow indicated trajectory to final logic "one" or logic "zero" state. Ability to do this important for design of radiation-detecting integrated circuits (deliberately made more sensitive to ionizing radiation) and "radiation-hardened" integrated circuits - those intended to be relatively invulnerable to intense radiation.

  20. Gamma Radiation Effects on Carbon Nanotube-Polymer Composites

    NASA Astrophysics Data System (ADS)

    Harmon, Julie; Muisener, Patricia Anne; Clayton, Lanetra; D'Angelo, John; Skider, Arun; Kumar, Ashok; Meyyappan, Meyya; Chen, Bin; Cassell, Alan

    2002-03-01

    The purpose of this research is to examine the effects of ionizing radiation on various carbon nanotube/polymer composites. Composites of single walled carbon nanotubes, SWNT, with a variety of polymers were fabricated and exposed to ionizing radiation with a Ce157 source in an air environment. Both irradiated and non-irradiated samples were compared. Glass transition temperatures were characterized by differential scanning calorimetry. Dynamic mechanical analysis and dielectric analysis evidenced changes in relaxations induced by irradiation. Irradiated composites exhibited radiation induced chemistry distinct from degradation effects noted in the pure polymer. Nano-indentation experiments were performed on the composites and pure polymers to determine their respective hardness and modulus characteristics. Tribology was used to determine the friction coefficient and the wear behavior of the composites. Confocal Raman Microscopy was used to characterize the nanotube composites and the effect of radiation. Scanning electron microscopy, transmission electron microscopy and atomic force microscopy provided evidence of the morphology of the SWNTs and SWNT/polymer interface before and after irradiation. This investigation imparts insight into the nature of radiation induced events in nanotubes and nanotube composites.

  1. Radiation Enhances Regulatory T Cell Representation

    SciTech Connect

    Kachikwu, Evelyn L.; Iwamoto, Keisuke S.; Liao, Yu-Pei; DeMarco, John J.; Agazaryan, Nzhde; Economou, James S.; McBride, William H.; Schaue, Doerthe

    2011-11-15

    Purpose: Immunotherapy could be a useful adjunct to standard cytotoxic therapies such as radiation in patients with micrometastatic disease, although successful integration of immunotherapy into treatment protocols will require further understanding of how standard therapies affect the generation of antitumor immune responses. This study was undertaken to evaluate the impact of radiation therapy (RT) on immunosuppressive T regulatory (Treg) cells. Methods and Materials: Treg cells were identified as a CD4{sup +}CD25{sup hi}Foxp3{sup +} lymphocyte subset, and their fate was followed in a murine TRAMP C1 model of prostate cancer in mice with and without RT. Results: CD4{sup +}CD25{sup hi}Foxp3{sup +} Treg cells increased in immune organs after local leg or whole-body radiation. A large part, but not all, of this increase after leg-only irradiation could be ascribed to radiation scatter and Treg cells being intrinsically more radiation resistant than other lymphocyte subpopulations, resulting in their selection. Their functional activity on a per-cell basis was not affected by radiation exposure. Similar findings were made with mice receiving local RT to murine prostate tumors growing in the leg. The importance of the Treg cell population in the response to RT was shown by systemic elimination of Treg cells, which greatly enhanced radiation-induced tumor regression. Conclusions: We conclude that Treg cells are more resistant to radiation than other lymphocytes, resulting in their preferential increase. Treg cells may form an important homeostatic mechanism for tissues injured by radiation, and in a tumor context, they may assist in immune evasion during therapy. Targeting this population may allow enhancement of radiotherapeutic benefit through immune modulation.

  2. Naturally induced secondary radiation in interplanetary space: Preliminary analyses for gamma radiation and radioisotope production from thermal neutron activation

    NASA Technical Reports Server (NTRS)

    Plaza-Rosado, Heriberto

    1991-01-01

    Thermal neutron activation analyses were carried out for various space systems components to determine gamma radiation dose rates and food radiation contamination levels. The space systems components selected were those for which previous radiation studies existed. These include manned space vehicle radiation shielding, liquid hydrogen propellant tanks for a Mars mission, and a food supply used as space vehicle radiation shielding. The computational method used is based on the fast neutron distribution generated by the BRYNTRN and HZETRN transport codes for Galactic Cosmic Rays (GCR) at solar minimum conditions and intense solar flares in space systems components. The gamma dose rates for soft tissue are calculated for water and aluminum space vehicle slab shields considering volumetric source self-attenuation and exponential buildup factors. In the case of the lunar habitat with regolith shielding, a completely exposed spherical habitat was assumed for mathematical convenience and conservative calculations. Activation analysis of the food supply used as radiation shielding is presented for four selected nutrients: potassium, calcium, sodium, and phosphorus. Radioactive isotopes that could represent a health hazard if ingested are identified and their concentrations are identified. For nutrients soluble in water, it was found that all induced radioactivity was below the accepted maximum permissible concentrations.

  3. Naturally induced secondary radiation in interplanetary space: Preliminary analyses for gamma radiation and radioisotope production from thermal neutron activation

    NASA Astrophysics Data System (ADS)

    Plaza-Rosado, Heriberto

    1991-09-01

    Thermal neutron activation analyses were carried out for various space systems components to determine gamma radiation dose rates and food radiation contamination levels. The space systems components selected were those for which previous radiation studies existed. These include manned space vehicle radiation shielding, liquid hydrogen propellant tanks for a Mars mission, and a food supply used as space vehicle radiation shielding. The computational method used is based on the fast neutron distribution generated by the BRYNTRN and HZETRN transport codes for Galactic Cosmic Rays (GCR) at solar minimum conditions and intense solar flares in space systems components. The gamma dose rates for soft tissue are calculated for water and aluminum space vehicle slab shields considering volumetric source self-attenuation and exponential buildup factors. In the case of the lunar habitat with regolith shielding, a completely exposed spherical habitat was assumed for mathematical convenience and conservative calculations. Activation analysis of the food supply used as radiation shielding is presented for four selected nutrients: potassium, calcium, sodium, and phosphorus. Radioactive isotopes that could represent a health hazard if ingested are identified and their concentrations are identified. For nutrients soluble in water, it was found that all induced radioactivity was below the accepted maximum permissible concentrations.

  4. Effect of gamma radiation on micromechanical hardness of lead-free solder joint

    NASA Astrophysics Data System (ADS)

    Paulus, Wilfred; Rahman, Irman Abdul; Jalar, Azman; Kamil, Insan; Yusoff, Wan Yusmawati Wan; Bakar, Maria Abu

    2015-09-01

    Lead-free solders are important material in nano and microelectronic surface mounting technology for various applications in bio medicine, environmental monitoring, spacecraft and satellite instrumentation. Nevertheless solder joint in radiation environment needs higher reliability and resistance to any damage caused by ionizing radiations. In this study a lead-free 99.0Sn0.3Ag0.7Cu wt.% (SAC) solder joint was developed and subjected to various doses of gamma radiation to investigate the effects of the ionizing radiation to micromechanical hardness of the solder. Averaged hardness of the SAC joint was obtained from nanoindentation test. The results show a relationship between hardness values of indentations and the increment of radiation dose. Highest mean hardness, 0.2290 0.0270 GPa was calculated on solder joint which was exposed to 5 Gray dose of gamma radiation. This value indicates possible radiation hardening effect on irradiated solder. The hardness gradually decreased to 0.1933 0.0210 GPa and 0.1631 0.0173 GPa when exposed to doses 50 and 500 gray respectively. These values are also lower than the hardness of non irradiated sample which was calculated as 0.2084 0.0.3633 GPa indicating possible radiation damage and needs further related atomic dislocation study.

  5. The effect of gamma radiation on the Common carp (Cyprinus carpio): In vivo genotoxicity assessment with the micronucleus and comet assays.

    PubMed

    M K, Praveen Kumar; Soorambail K, Shyama; Bhagatsingh Harisingh, Sonaye; D'costa, Avelyno; Ramesh Chandra, Chaubey

    2015-10-01

    Radioactive wastes may be leached into freshwater, either accidentally or in industrial effluents. We have studied gamma radiation-induced DNA damage in the freshwater fish Cyprinus carpio. Fish were irradiated with 2-10Gy gamma radiation and genotoxic effects in blood cells were studied with the micronucleus (MN) and comet assays. Micronuclei and a dose-dependent increase in comet-tail DNA were seen in dose- and time-dependent studies. The highest % tail DNA was observed at 24h, declining until 72h, which may indicate the repair of radiation-induced DNA single-strand breaks after gamma radiation. However, double-stranded DNA damage may not have been repaired, as indicated by increased micronuclei at later periods. A positive correlation was observed between the comet and micronucleus assay results. This study confirms the mutagenic/genotoxic potential of gamma radiation in the Common carp, as well as the possible combined use of the micronucleus and comet assays for in vivo laboratory studies with fresh-water fish for screening the genotoxic potential of radioactive pollution. PMID:26433258

  6. The effects of. gamma. -ray ultrastructure and ethylene biosynthesis in apple pulp cells

    SciTech Connect

    Xin Zhi Jiao )

    1989-04-01

    Ultrastructural changes caused by gamma-ray (Co-60) irradiation were investigated in preclimacteric apple fruits during storage. Under the electron microscope, the cellulose in the cell walls was reduced to a line when treated with 40 Krad gamma radiation for 38 hr, and disappeared completely after treatment with 100 Krad. The disintegration of plasmalemma and mitochondria membranes was observed. Plasmalemma membranes were impaired after 10 Krads for 38 hr, while in the mitochondria the destruction of the original structure and its inner membrane spine began at 40 Krads for 38 hr. Moreover, the size of starch granules was reduced by the irradiation, disappearing after treatment with 100 Krads. Both ethylene production and respiration rate were drastically reduced. The reduction of ethylene production in treated apple fruit was found to be due to the decrease of ACC content and the inhibition of ethylene-forming enzyme activity. MACC content was also decreased. Fruits treated with 40 Krad gamma radiation and stored at 0-2 degrees C maintained their quality for six months.

  7. Low-Dose Gamma Radiation Does Not Induce an Adaptive Response for Micronucleus Induction in Mouse Splenocytes.

    PubMed

    Bannister, L A; Serran, M L; Mantha, R R

    2015-11-01

    Low-dose ionizing radiation is known to induce radioadaptive responses in cells in vitro as well as in mice in vivo. Low-dose radiation decreases the incidence and increases latency for spontaneous and radiation-induced tumors in mice, potentially as a result of enhanced cellular DNA repair efficiency or a reduction in genomic instability. In this study, the cytokinesis-block micronucleus (CBMN) assay was used to examine dose response and potential radioadaptive response for cytogenetic damage and cell survival in C57BL/6 and BALB/c spleen cells exposed in vitro or in vivo to low-dose 60Co gamma radiation. The effects of genetic background, radiation dose and dose rate, sampling time and cell cycle were investigated with respect to dose response and radioadaptive response. In C57BL/6 mice, a linear-quadratic dose-response relationship for the induction of micronuclei (MN) was observed for doses between 100 mGy and 2 Gy. BALB/c mice exhibited increased radiosensitivity for MN induction compared to C57BL/6 mice. A 20 mGy dose had no effect on MN frequencies in splenocytes of either mouse strain, however, increased spleen weight and a reduced number of dead cells were noted in the C57BL/6 strain only. Multiple experimental parameters were investigated in radioadaptive response studies, including dose and dose rate of the priming dose (20 mGy at 0.5 mGy/min and 100 mGy at 10 mGy/min), time interval (4 and 24 h) between priming and challenge doses, cell cycle stage (resting or proliferating) at exposure and kinetics after the challenge dose. Radioadaptive responses were not observed for MN induction for either mouse strain under any of the experimental conditions investigated. In contrast, a synergistic response for radiation-induced micronuclei in C57BL/6 spleen was detected after in vivo 20 mGy irradiation. This increase in the percentage of cells with cytogenetic damage was associated with a reduction in the number of nonviable spleen cells, suggesting that low-dose irradiation led to a reduction in the turnover of damaged cells within the spleen of C57BL/6 mice. Overall, these results indicate that long-term protective effects against tumor latency and other beneficial health outcomes observed after low-dose irradiation are not mediated by a reduction of the proportion of cells harboring radiation-induced cytogenetic damage. PMID:26495871

  8. Inactivation of foodborne pathogens on seafood by gamma radiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ionizing radiation is used on a global basis to improve the phytosanitary and microbial safety and shelf-life of foods. In recent years progress has been made in the commercial application of irradiation to sterilize destructive invasive insects and to irradiate produce to improve its microbiologica...

  9. An automated system for gamma radiation field mapping

    NASA Astrophysics Data System (ADS)

    Gould, Robert; Tarpinian, James E.; Kenney, Edward S.

    1990-12-01

    Remote radiation survey equipment was sorely needed at Chernobyl but adequate systems did not exist. The current state of the art still consists of a survey meter mounted on a robotic carriage, which scans an area at many points on a grid. This process is both time consuming and somewhat inaccurate. The system we have developed will overcome these limitations, and would provide significant savings in man-hours and man-rem over manual survey techniques. The system we have developed consists of a collimated ionization chamber mounted in a scanning head. The measurement process is similar to that used in medical computed tomography (CT) imaging and consists of a series of collimator rotations and translations. The key to this work is the use of a collimator to provide position information with a position insensitive detector. In addition, an inverse filter image reconstruction technique has been used to reduce the distortion effects due to the scanner and scanning process in the resulting maps. This technique models the distortion as a linear, space invariant degrading function which is removed in a deconvolution process. We have constructed first- and second-generation prototype scanners, and developed software to produce three-dimensional radiation field "iso-dose" maps. The iso-dose maps will be superimposed on three-dimensional computer-aided design and drafting (CADD) drawings of the radiation area, aiding in the characterization of the source of radiation.

  10. Gamma radiation sensitivity of foodborne pathogens on meat and poultry

    SciTech Connect

    Thayer, D.W.; Boyd, G.

    1994-12-31

    Several factors have been identified that may affect the responses of foodborne pathogens to ionizing radiation. Among these are the temperature and atmosphere during the process of irradiation; the medium in which the pathogen is suspended; and the genus, species, serovar, and physiological state of the organism. In addition to these factors, variations in {open_quotes}apparent{close_quotes} radiation sensitivity of bacteria may occur because of the incubation conditions and media used to estimate the number of surviving colony-forming units. Both incubation temperature and culture media frequently affect the ability of injured bacteria to recover. Because there are so many possible variables, it is often difficult to compare data on the radiation sensitivity of foodborne pathogens from different studies. The objectives of the studies reported here were to compare the radiation sensitivities of Bacillus cereus on beef, beef gravy, chicken, pork, and turkey; and of Escherichia coli 0157:H7, Listeria monocytogenes, Salmonella, and Staphylococcus aureus on beef, pork, lamb, turkey breast, and turkey leg meats. Examples of the effects of serovar, irradiation temperature, growth phase, and atmosphere during irradiation were also examined.

  11. Production of a T cell hybridoma that expresses the T cell receptor gamma/delta heterodimer

    PubMed Central

    1987-01-01

    We have produced a T cell hybridoma line by fusion of an IL-2- dependent, long-term T cell receptor (TCR) gamma/delta+ Thy-1+, bone marrow-derived, dendritic epidermal cell line to the BW5147 tumor line. The resultant hybridoma was rapidly growing, lymphokine independent, and expressed T3 in association with the TCR gamma/delta heterodimer. Several subclones of the hybridoma line produced easily detectable levels of IL-2 after stimulation by anti-T3 or Con A. The availability of these cloned cell lines should greatly facilitate further functional, biochemical, and molecular studies of the TCR delta chain. PMID:3108449

  12. Influence of hyperthermia and. gamma. radiation on ADP-ribosyl transferase, NAD/sup +/, and ATP pools in human mononuclear leukocytes

    SciTech Connect

    Jonsson, G.G.; Eriksson, G.; Pero, R.W.

    1985-05-01

    Effects of hyperthermia (42.5/sup 0/C) and ..gamma.. radiation (30 Gy) on ADP-ribosyl transferase, NAD/sup +/, and ATP pools in human mononuclear leukocytes have been investigated. It was found that the ..gamma..-ray activation level of the enzyme was not influenced by this hyperthermia for 45 min. Following deprivation of ATP synthesis by 2,4-dinitrophenol, an uncoupler of the oxidative phosphorylation, and omitting glucose from the culture medium, the NAD/sup +/ pool was reduced to about 60% of control value. The potentiation of ATP production by exogenously supplied adenosine was reduced after a combined treatment of the cells with hyperthermia and ..gamma.. radiation. Mitochondrial and endoplasmic changes within the mononuclear leukocytes were also observed. Based on these findings a model for the hyperthermia effect is proposed.

  13. CARBON FIBRE COMPOSITE MATERIALS PRODUCED BY GAMMA RADIATION INDUCED CURING OF EPOXY RESINS

    SciTech Connect

    Dispenza, C.; Spadaro, G.; Alessi, S.

    2008-08-28

    It is well known that ionizing radiation can initiate polymerization of suitable monomers for many applications. In this work an epoxy difunctional monomer has been used as matrix of a carbon fibre composite in order to produce materials through gamma radiation, for aerospace and advanced automotive applications. Radiation curing has been performed at different absorbed doses and, as comparison, also thermal curing of the same monomer formulations has been done. Furthermore some irradiated samples have been also subjected to a post irradiation thermal curing in order to complete the polymerization reactions. The properties of the cured materials have been studied by moisture absorption isotherms, dynamic mechanical thermal analysis and mechanical flexural tests.

  14. Effect of 60Co-gamma radiation on the binding properties in furs

    NASA Astrophysics Data System (ADS)

    Raina, R. K.

    New Zealand white rabbit pelts were pickled by the usual procedure and were tanned with basic aluminium sulphate, basic chromium sulphate and their combinations. Tanned furs were irradiated with 60Co-gamma radiations in the dose range of 5.0-114.0 kGy. The effect of radiation on the binding properties of various added substances like mineral tannins, fats, moisture and shrinkage temperature has been assessed by their comparison with the control samples. The results of these investigations show that radiation on furs causes detannage, increases the moisture and bound fat content and decreases the shrinkage temperature of the furs.

  15. Carbon Fibre Composite Materials Produced by Gamma Radiation Induced Curing of Epoxy Resins

    NASA Astrophysics Data System (ADS)

    Dispenza, C.; Alessi, S.; Spadaro, G.

    2008-08-01

    It is well known that ionizing radiation can initiate polymerization of suitable monomers for many applications. In this work an epoxy difunctional monomer has been used as matrix of a carbon fibre composite in order to produce materials through gamma radiation, for aerospace and advanced automotive applications. Radiation curing has been performed at different absorbed doses and, as comparison, also thermal curing of the same monomer formulations has been done. Furthermore some irradiated samples have been also subjected to a post irradiation thermal curing in order to complete the polymerization reactions. The properties of the cured materials have been studied by moisture absorption isotherms, dynamic mechanical thermal analysis and mechanical flexural tests.

  16. Combined Effects of Gamma Radiation and High Dietary Iron on Peripheral Leukocyte Distribution and Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian E.; Morgan, Jennifer L. L.; Quiriarte, Heather A.; Sams, Clarence F.; Smith, Scott M.; Zwart, Sara R.

    2012-01-01

    Both radiation and increased iron stores can independently increase oxidative damage, resulting in protein, lipid and DNA oxidation. Oxidative stress increases the risk of many health problems including cancer, cataracts, and heart disease. This study, a subset of a larger interdisciplinary investigation of the combined effect of iron overload on sensitivity to radiation injury, monitored immune parameters in the peripheral blood of rats subjected to gamma radiation, high dietary iron or both. Specific immune measures consisted of: (1) peripheral leukocyte distribution, (2) plasma cytokine levels and (3) cytokine production profiles following whole blood mitogenic stimulation

  17. Response of oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), eggs to gamma radiation

    NASA Astrophysics Data System (ADS)

    Silva, W. D.; Arthur, V.; Mastrangelo, T.

    2010-10-01

    As insects increase in radiotolerance as they develop and usually several developmental stages of the pest may be present in the fresh shipped commodity, it is important to know the radiation susceptibility of the stages of the target insect before the establishment of ionizing radiation quarantine treatments. This study was performed to determine the radiotolerance of eggs of the oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), to gamma radiation. This species is considered as one of the most serious worldwide pests for temperate fruits, especially peaches. Eggs (12 h old) were exposed to 0 (control), 25, 35, 50, 75, 100, 125 and 150 Gy of gamma radiation. Surviving larvae were allowed to feed on an artificial diet. Three days after irradiation, it was verified that larvae's cephalic capsules were significantly affected by gamma radiation, and the estimated mean LD 90 and LD 99 were 66.3 Gy and 125.8 Gy, respectively. Oriental fruit moth eggs revealed to be quite radiosensitive and very low doses as 50 Gy were sufficient to disrupt G. molesta embryogenesis. At 25 Gy, only male adults originated from the surviving larvae and, after mating with untreated fertile females, shown to be sterile.

  18. Modification of silicone sealant to improve gamma radiation resistance, by addition of protective agents

    NASA Astrophysics Data System (ADS)

    Gonzlez-Prez, Giovanni; Burillo, Guillermina

    2013-09-01

    Poly (dimethylsiloxane) (PDMS) sealant (SS) was modified with the addition of different protective compounds to conserve its physical-chemical properties during gamma irradiation. 2-Vinyl naphthalene (2-VN), bisphenol-A (BPA) and poly (vinyl carbazole) (PVK) were used to evaluate radiation protection through the crosslinking effect of radiation. The samples were irradiated with doses from 100 kGy to 500 kGy at room temperature in air, with a 60Co gamma source, and the changes in molecular weight, thermal behavior, elastic properties and infrared spectra (FTIR-ATR) absorbance analysis were determined. The molecular weight of unmodified silicone sealant increases with the absorbed dose because of crosslinking as predominant effect. However, the crosslinking effect was inhibited with the addition of protective agent due to the aromatic compounds present. Modified silicone sealant films present better radiation resistance than unmodified system.

  19. Evaluation of phenolic compounds in mat ( Ilex paraguariensis) processed by gamma radiation

    NASA Astrophysics Data System (ADS)

    Furgeri, C.; Nunes, T. C. F.; Fanaro, G. B.; Souza, M. F. F.; Bastos, D. H. M.; Villavicencio, A. L. C. H.

    2009-07-01

    The radiation food processing has been demonstrating great effectiveness in the attack of pathogenic agents, while little compromising nutritional value and sensorial properties of foods. The mat ( Ilex paraguariensis), widely consumed product in South America, generally in the form of infusions with hot or cold water, calls of chimarro or terer, it is cited in literature as one of the best sources phenolic compounds. The antioxidants action of these constituent has been related to the protection of the organism against the free radicals, generated in alive, currently responsible for the sprouting of some degenerative illness as cancer, arteriosclerosis, rheumatic arthritis and cardiovascular clutters among others. The objective of that work was to evaluate the action of the processing for gamma radiation in phenolic compounds of terer beverage in the doses of 0, 3, 5, 7 and 10 kGy. The observed results do not demonstrate significant alterations in phenolic compounds of terer beverage processed by gamma radiation.

  20. Gamma radiation used as hygienization technique for foods does not induce viable but non-culturable state (VBNC) in Salmonella enterica subsp. enterica serovar Typhimurium.

    PubMed

    Saroj, Sunil; Shashidhar, R; Bandekar, Jayant

    2009-10-01

    Gamma radiation has been widely used for hygienization of food products. Whether gamma radiation stress induces VBNC state in Salmonella is of great concern. Therefore, the study was carried out to determine whether gamma radiation exposure induces VBNC state in Salmonella enterica subsp. enterica serovar Typhimurium (S. typhimurium). The parameters tested were culturability on agar medium, transcriptional activity by RT-PCR, cytoplasmic membrane integrity, and direct viable count using LIVE/DEAD BacLight bacterial viability kit. The LIVE/DEAD BacLight counts for S. typhimurium cells treated with 0.5 and 1.0 kGy radiation dose were 0.8 and 0.1% of the control, respectively. Plate counts for S. typhimurium cells treated with 0.5 and 1.0 kGy radiation dose were 0.7 and 0.05% of the control, respectively. No viable cells of S. typhimurium were detected by both plate count and LIVE/DEAD BacLight after radiation treatment with 2 kGy. No transcriptional activity was detected in cells treated with 2 kGy radiation dose. If there were VBNC cells present, then significant differences in the counts between the LIVE/DEAD BacLight microscopic counts and plate agar counts must be observed. No significant difference (P > 0.05) in the counts were observed. Thus, it can be concluded that treatment with 2 kGy results in complete killing and does not induce VBNC state in S. typhimurium. PMID:19641961

  1. Persistence of gamma-H2AX and 53BP1 foci in proliferating and nonproliferating human mammary epithelial cells after exposure to gamma-rays or iron ions

    SciTech Connect

    Groesser, Torsten; Chang, Hang; Fontenay, Gerald; Chen, James; Costes, Sylvain V.; Barcellos-Hoff, Mary Helen; Parvin, Bahram; Rydberg, Bjorn

    2010-12-22

    To investigate {gamma}-H2AX (phosphorylated histone H2AX) and 53BP1 (tumour protein 53 binding protein No. 1) foci formation and removal in proliferating and non-proliferating human mammary epithelial cells (HMEC) after exposure to sparsely and densely ionizing radiation under different cell culture conditions. HMEC cells were grown either as monolayers (2D) or in extracellular matrix to allow the formation of acinar structures in vitro (3D). Foci numbers were quantified by image analysis at various time points after exposure. Our results reveal that in non-proliferating cells under 2D and 3D cell culture conditions, iron-ion induced {gamma}-H2AX foci were still present at 72 h after exposure, although 53BP1 foci returned to control levels at 48 h. In contrast in proliferating HMEC, both {gamma}-H2AX and 53BP1 foci decreased to control levels during the 24-48 h time interval after irradiation under 2D conditions. Foci numbers decreased faster after {gamma}-ray irradiation and returned to control levels by 12 h regardless of marker, cell proliferation status, and cell culture condition. Conclusions: The disappearance of radiation induced {gamma}-H2AX and 53BP1 foci in HMEC have different dynamics that depend on radiation quality and proliferation status. Notably, the general patterns do not depend on the cell culture condition (2D versus 3D). We speculate that the persistent {gamma}-H2AX foci in iron-ion irradiated non-proliferating cells could be due to limited availability of double strand break (DSB) repair pathways in G0/G1-phase, or that repair of complex DSB requires replication or chromatin remodeling.

  2. Non-pulsed gamma radiation from a binary system with a pulsar

    NASA Astrophysics Data System (ADS)

    Chernyakova, M. A.; Illarionov, A. F.

    1999-04-01

    We consider a binary system with a millisecond pulsar ejecting relativistic particles and an optical star emitting soft photons with energy omega ~= 1-10 eV. These low-energy photons are scattered by the relativistic electrons and positrons of the pulsar wind. The scattered photons form a wide spectrum from the hard X-ray band up to gamma band epsilon ~= 1-1000 GeV. When the pulsar wind is isotropic, the luminosity of gamma radiation L_gamma=L_gamma(psi) depends strongly on the angle psi between the directions to the optical star and the observer from the pulsar. During the orbital motion this angle varies periodically, giving rise to a periodic change of the observed intensity of the gamma radiation and its spectrum. We calculate the spectral shape of the scattered hard photons. Under the assumption that the energy losses of the relativistic particles are small, we derive analytic formulae for the spectra of the photons. We apply our results to the binary system PSR B1259-63 and show that if the wind from the Be star is accounted for then it is possible to reproduce the observed spectrum.

  3. Low Doses of Gamma-Irradiation Induce an Early Bystander Effect in Zebrafish Cells Which Is Sufficient to Radioprotect Cells

    PubMed Central

    Pereira, Sandrine; Malard, Véronique; Ravanat, Jean-Luc; Davin, Anne-Hélène; Armengaud, Jean; Foray, Nicolas; Adam-Guillermin, Christelle

    2014-01-01

    The term “bystander effect” is used to describe an effect in which cells that have not been exposed to radiation are affected by irradiated cells though various intracellular signaling mechanisms. In this study we analyzed the kinetics and mechanisms of bystander effect and radioadaptation in embryonic zebrafish cells (ZF4) exposed to chronic low dose of gamma rays. ZF4 cells were irradiated for 4 hours with total doses of gamma irradiation ranging from 0.01–0.1 Gy. In two experimental conditions, the transfer of irradiated cells or culture medium from irradiated cells results in the occurrence of DNA double strand breaks in non-irradiated cells (assessed by the number of γ-H2AX foci) that are repaired at 24 hours post-irradiation whatever the dose. At low total irradiation doses the bystander effect observed does not affect DNA repair mechanisms in targeted and bystander cells. An increase in global methylation of ZF4 cells was observed in irradiated cells and bystander cells compared to control cells. We observed that pre-irradiated cells which are then irradiated for a second time with the same doses contained significantly less γ-H2AX foci than in 24 h gamma-irradiated control cells. We also showed that bystander cells that have been in contact with the pre-irradiated cells and then irradiated alone present less γ-H2AX foci compared to the control cells. This radioadaptation effect is significantly more pronounced at the highest doses. To determine the factors involved in the early events of the bystander effect, we performed an extensive comparative proteomic study of the ZF4 secretomes upon irradiation. In the experimental conditions assayed here, we showed that the early events of bystander effect are probably not due to the secretion of specific proteins neither the oxidation of these secreted proteins. These results suggest that early bystander effect may be due probably to a combination of multiple factors. PMID:24667817

  4. High-total-dose gamma and neutron radiation tolerance of VCSEL assemblies

    NASA Astrophysics Data System (ADS)

    Berghmans, Francis; Van Uffelen, Marco; Decréton, Marc C.

    2002-09-01

    Optical fiber technology is seriously considered for communication and monitoring applications during the operation and maintenance of future thermonuclear fusion reactors. Their environment is characterized, in particular, by possibly high gamma dose-rates and total doses in excess of 10 MGy. In addition, the maintenance equipment might be stored in close vicinity of the reactor during its operation and therefore the communication devices might also be exposed to a substantial neutron fluence. The feasibility of applying photonic technology in these radiation fields therefore needs to be assessed. Whereas many reports deal with the radiation behavior of a variety of fiber-optic devices, only little information is available on the radiation tolerance at high total dose (e.g. > 1 MGy). We describe our recent results obtained on vertical-cavity surface-emitting laser (VCSEL) assemblies. We have conducted high total dose (up to 20 MGy) irradiation experiments on such devices, which confirmed their excellent gamma radiation hardness. The optical power loss at nominal forward current was less than 2 dB and the threshold current remained unaltered. We have also irradiated these devices with neutrons inside the BR1 reactor (SCK•CEN, Mol, Belgium) up to a total fluence on the order of 1015 n×cm-2. The response of VCSELs to neutrons is, as expected, different from that to gamma radiation. VCSELs previously exposed to gamma rays exhibited an accelerated degradation under neutron radiation compared to not pre-irradiated devices. The beneficial effect of applying a continuous forward bias to the VCSELs is also evidenced.

  5. Sublethal effects in Atlantic salmon (Salmo salar) exposed to mixtures of copper, aluminium and gamma radiation.

    PubMed

    Heier, Lene Sørlie; Teien, Hans Christian; Oughton, Deborah; Tollefsen, Knut-Erik; Olsvik, Pål A; Rosseland, Bjørn Olav; Lind, Ole Christian; Farmen, Eivind; Skipperud, Lindis; Salbu, Brit

    2013-07-01

    The present study was designed to investigate the effects in presmolt of Atlantic salmon (Salmo salar) exposed to copper (Cu), aluminium (Al) and gamma radiation, individually or in combination. Fish were exposed for 48 h to metals added to lake water; 10, 40 and 80 μg Cu/L, 250 μg Al/L and a combination of 40 μg Cu/L and 250 μg Al/L. In addition, gamma radiation (4-70 mGy delivered over 48 h) was added as an additional exposure stressor. Selected endpoints were chosen to reveal different toxic mechanisms and included Cu and Al accumulation on gills, blood chemistry and haematological variables (plasma sodium and chloride, haematocrit, glucose), hepatic levels of reduced and oxidised glutathione (GSH and GSSG) and hepatic transcriptional response of glutathione peroxidase (GPx), gamma-glutamylcysteine synthetase (GCS), metallothionein (MT) and ubiquitin. Exposure to Cu alone resulted in gill accumulation of Cu, reduction of plasma ions and increased transcriptional response of GPx, MT and ubiquitin. Exposure to Al alone reduced plasma ion levels but did not affect any of the hepatic biomarkers except for ubiquitin. The combined metal exposure (Cu + Al) altered the GSH levels, however GPx and MT were not affected suggesting a different mode of detoxification in the combined exposure. Gamma radiation appeared to influence GSH and ubiquitin levels. The observed effects seemed to be both stressor and concentration dependent. PMID:22583837

  6. Using Gamma-Radiation for Drug Releasing from MWNT Vehicle

    NASA Astrophysics Data System (ADS)

    Li, Jun; Sun, Hao; Dai, Yao-Dong

    2010-03-01

    A drug delivery system via multi-walled carbon nanotube (MWNT) vehicle was synthesized in aqueous solution. MWNTs were first noncovalently functionalized with chitosan oligomers (CS) with a molecule weight of 4000-6000, making MWNTs water-soluble, and then a cancer ancillary drug tea polyphenols (TP) was conjugated mainly via the hydrogen bond between CS and TP molecules, making MWNTs efficient vehicle for drug delivering. The release of drug molecules can be realized by pH variation and ?-radiation, leading to new methods for controlling drug release from carbon nanotubes carrier. Due to the high penetrability of ?-rays, ?-radiation shows up new opportunities in controlled drug release, possibly facilitating the future cancer treatment in vivo.

  7. Polymer Composites for Radiation Detection: Di-iodobenzene and light emitting polymer molecular solutions for gamma detection

    SciTech Connect

    Qibing Pei; Yongsheng Zhao; Haizheng Zhong

    2008-07-01

    Conjugated polymers are largely intact by gamma exposure but can be energized in the presence of high-Z compounds. The resulting alteration of the polymer's high optical density and photoluminescence efficiency can be exploited for the detection of gamma radiation with high sensitivity. Di-iodobenzene and conjugated polymers mix on the molecular level in solid thin films. Composite films of various thicknesses were conveniently cast from solution and exposed to gamma radiation. The responses of the films to gamma dosage were observed with dramatic changes in ultraviolet-visible absorption and photoluminescence. (authors)

  8. Clinical Applications of Gamma Delta T Cells with Multivalent Immunity

    PubMed Central

    Deniger, Drew C.; Moyes, Judy S.; Cooper, Laurence J. N.

    2014-01-01

    γδ T cells hold promise for adoptive immunotherapy because of their reactivity to bacteria, viruses, and tumors. However, these cells represent a small fraction (1–5%) of the peripheral T-cell pool and require activation and propagation to achieve clinical benefit. Aminobisphosphonates specifically expand the Vγ9Vδ2 subset of γδ T cells and have been used in clinical trials of cancer where objective responses were detected. The Vγ9Vδ2 T cell receptor (TCR) heterodimer binds multiple ligands and results in a multivalent attack by a monoclonal T cell population. Alternatively, populations of γδ T cells with oligoclonal or polyclonal TCR repertoire could be infused for broad-range specificity. However, this goal has been restricted by a lack of applicable expansion protocols for non-Vγ9Vδ2 cells. Recent advances using immobilized antigens, agonistic monoclonal antibodies (mAbs), tumor-derived artificial antigen presenting cells (aAPC), or combinations of activating mAbs and aAPC have been successful in expanding gamma delta T cells with oligoclonal or polyclonal TCR repertoires. Immobilized major histocompatibility complex Class-I chain-related A was a stimulus for γδ T cells expressing TCRδ1 isotypes, and plate-bound activating antibodies have expanded Vδ1 and Vδ2 cells ex vivo. Clinically sufficient quantities of TCRδ1, TCRδ2, and TCRδ1negTCRδ2neg have been produced following co-culture on aAPC, and these subsets displayed differences in memory phenotype and reactivity to tumors in vitro and in vivo. Gamma delta T cells are also amenable to genetic modification as evidenced by introduction of αβ TCRs, chimeric antigen receptors, and drug-resistance genes. This represents a promising future for the clinical application of oligoclonal or polyclonal γδ T cells in autologous and allogeneic settings that builds on current trials testing the safety and efficacy of Vγ9Vδ2 T cells. PMID:25566249

  9. Observation of the radiative decay J/psi. -->. gamma. phi. omega

    SciTech Connect

    Becker, J.J.; Blaylock, G.T.; Bolton, T.; Brown, J.S.; Bunnell, K.O.; Burnett, T.H.; Cassell, R.E.; Coffman, D.; Cook, V.; Coward, D.H.

    1987-02-01

    The MARK III Collaboration has studied the OZI violating radiative decay J/psi ..-->.. ..gamma.. phi ..omega.., in order to complete the set of measured J/psi ..-->.. ..gamma.. vector vector decays. This channel is then used to search for a new decay mode of the xi(2330) and to study the eta/sub c/ decay mechanism. The phi ..omega.. mass spectrum does not show any significant structure; upper limits for the excitation of the xi and eta/sub c/ particles are obtained. 11 refs., 3 figs.

  10. The COS-B experiment and mission. [high energy extraterrestrial gamma radiation

    NASA Technical Reports Server (NTRS)

    1977-01-01

    The COS-B satellite carries a single experiment, capable of detecting gamma rays with energies greater than 30 MeV to study the spatial, energy, and time characteristics of high-energy radiation of galactic and extragalactic origin. The capability to search for gamma ray pulsations is enhanced by the inclusion in the payload of a proportional counter sensitive of X-rays of 2 to 12 keV. The experiment was calibrated using particle accelerators. The results of these measurements are presented, and the performance of the system in orbit is discussed.

  11. Radiation anomaly detection algorithms for field-acquired gamma energy spectra

    NASA Astrophysics Data System (ADS)

    Mukhopadhyay, Sanjoy; Maurer, Richard; Wolff, Ron; Guss, Paul; Mitchell, Stephen

    2015-08-01

    The Remote Sensing Laboratory (RSL) is developing a tactical, networked radiation detection system that will be agile, reconfigurable, and capable of rapid threat assessment with high degree of fidelity and certainty. Our design is driven by the needs of users such as law enforcement personnel who must make decisions by evaluating threat signatures in urban settings. The most efficient tool available to identify the nature of the threat object is real-time gamma spectroscopic analysis, as it is fast and has a very low probability of producing false positive alarm conditions. Urban radiological searches are inherently challenged by the rapid and large spatial variation of background gamma radiation, the presence of benign radioactive materials in terms of the normally occurring radioactive materials (NORM), and shielded and/or masked threat sources. Multiple spectral anomaly detection algorithms have been developed by national laboratories and commercial vendors. For example, the Gamma Detector Response and Analysis Software (GADRAS) a one-dimensional deterministic radiation transport software capable of calculating gamma ray spectra using physics-based detector response functions was developed at Sandia National Laboratories. The nuisance-rejection spectral comparison ratio anomaly detection algorithm (or NSCRAD), developed at Pacific Northwest National Laboratory, uses spectral comparison ratios to detect deviation from benign medical and NORM radiation source and can work in spite of strong presence of NORM and or medical sources. RSL has developed its own wavelet-based gamma energy spectral anomaly detection algorithm called WAVRAD. Test results and relative merits of these different algorithms will be discussed and demonstrated.

  12. Accumulation of Mn(II) in Deinococcus radiodurans Facilitates Gamma-Radiation Resistance

    SciTech Connect

    Daly, Michael J.; Gaidamakova, E; Matrosova, V; Vasilenko, A; Zhai, M; Venkateswaran, Amudhan; Hess, M; Omelchenko, M V.; Kostandarithes, Heather M.; Makarova, S; Wackett, L. P.; Fredrickson, Jim K.; Ghosal, D

    2004-11-05

    Deinococcus radiodurans is extremely resistant to ionizing radiation. How this bacterium can grow under chronic gamma-radiation (50 Gy/hour) or recover from acute doses greater than 10 kGy is unknown. We show that D. radiodurans accumulates very high intracellular manganese and low iron levels compared to radiation sensitive bacteria, and resistance exhibits a concentration-dependent response to Mn(II). Among the most radiation-resistant bacterial groups reported, Deinococcus, Enterococcus, Lactobacillus and cyanobacteria spp. accumulate Mn(II). In contrast, Shewanella oneidensis and Pseudomonas putida have high Fe but low intracellular Mn concentrations and are very sensitive. We propose that Mn(II) accumulation facilitates recovery from radiation injury.

  13. Modern Methods of Real-Time Gamma Radiation Monitoring for General Personal Protection

    NASA Astrophysics Data System (ADS)

    Korostynska, O.; Arshak, K.; Arshak, A.; Vaseashta, Ashok

    Real-time radiation detectors become an essential part of emergency personnel who may have to respond to unknown accidents, incidents or terrorist attacks, which could involve radioactive material. More and more ordinary citizens are interested in personal radiation protection as well. Reasons include lost sources, nuclear industrial accidents, nuclear or radiological terrorism and the possibility of nuclear weapons being used in a war. People want to have the ability to measure it for themselves and they want to be notified when the radiation levels are increased. To meet this demand, considerable research into new sensors is underway, including efforts to enhance the sensor performance through both the material properties and manufacturing technologies. Deep understanding of physical properties of the materials under the influence of radiation exposure is vital for the effective design of dosimeter devices. Detection of radiation is based on the fact that both the electrical and the optical properties of the materials undergo changes upon the exposure to ionizing radiation. It is believed that radiation causes structural defects. The influence of radiation depends on both the dose and the parameters of the films including their thickness: the degradation is more severe for the higher dose and the thinner films. This paper presents overview of modern methods of real-time gamma radiation monitoring for personal protection of radiation workers and general public and suggests further developments in this area.

  14. Tolerance to Gamma Radiation in the Tardigrade Hypsibius dujardini from Embryo to Adult Correlate Inversely with Cellular Proliferation

    PubMed Central

    Beltrn-Pardo, Eliana; Jnsson, K. Ingemar; Harms-Ringdahl, Mats; Haghdoost, Siamak; Wojcik, Andrzej

    2015-01-01

    Tardigrades are highly tolerant to desiccation and ionizing radiation but the mechanisms of this tolerance are not well understood. In this paper, we report studies on dose responses of adults and eggs of the tardigrade Hypsibius dujardini exposed to gamma radiation. In adults the LD50/48h for survival was estimated at ~ 4200 Gy, and doses higher than 100 Gy reduced both fertility and hatchability of laid eggs drastically. We also evaluated the effect of radiation (doses 50 Gy, 200 Gy, 500 Gy) on eggs in the early and late embryonic stage of development, and observed a reduced hatchability in the early stage, while no effect was found in the late stage of development. Survival of juveniles from irradiated eggs was highly affected by a 500 Gy dose, both in the early and the late stage. Juveniles hatched from eggs irradiated at 50 Gy and 200 Gy developed into adults and produced offspring, but their fertility was reduced compared to the controls. Finally we measured the effect of low temperature during irradiation at 4000 Gy and 4500 Gy on survival in adult tardigrades, and observed a slight delay in the expressed mortality when tardigrades were irradiated on ice. Since H. dujardini is a freshwater tardigrade with lower tolerance to desiccation compared to limno-terrestrial tardigrades, the high radiation tolerance in adults, similar to limno-terrestrial tardigrades, is unexpected and seems to challenge the idea that desiccation and radiation tolerance rely on the same molecular mechanisms. We suggest that the higher radiation tolerance in adults and late stage embryos of H. dujardini (and in other studied tardigrades) compared to early stage embryos may partly be due to limited mitotic activity, since tardigrades have a low degree of somatic cell division (eutely), and dividing cells are known to be more sensitive to radiation. PMID:26208275

  15. Tolerance to Gamma Radiation in the Tardigrade Hypsibius dujardini from Embryo to Adult Correlate Inversely with Cellular Proliferation.

    PubMed

    Beltrn-Pardo, Eliana; Jnsson, K Ingemar; Harms-Ringdahl, Mats; Haghdoost, Siamak; Wojcik, Andrzej

    2015-01-01

    Tardigrades are highly tolerant to desiccation and ionizing radiation but the mechanisms of this tolerance are not well understood. In this paper, we report studies on dose responses of adults and eggs of the tardigrade Hypsibius dujardini exposed to gamma radiation. In adults the LD50/48h for survival was estimated at ~ 4200 Gy, and doses higher than 100 Gy reduced both fertility and hatchability of laid eggs drastically. We also evaluated the effect of radiation (doses 50 Gy, 200 Gy, 500 Gy) on eggs in the early and late embryonic stage of development, and observed a reduced hatchability in the early stage, while no effect was found in the late stage of development. Survival of juveniles from irradiated eggs was highly affected by a 500 Gy dose, both in the early and the late stage. Juveniles hatched from eggs irradiated at 50 Gy and 200 Gy developed into adults and produced offspring, but their fertility was reduced compared to the controls. Finally we measured the effect of low temperature during irradiation at 4000 Gy and 4500 Gy on survival in adult tardigrades, and observed a slight delay in the expressed mortality when tardigrades were irradiated on ice. Since H. dujardini is a freshwater tardigrade with lower tolerance to desiccation compared to limno-terrestrial tardigrades, the high radiation tolerance in adults, similar to limno-terrestrial tardigrades, is unexpected and seems to challenge the idea that desiccation and radiation tolerance rely on the same molecular mechanisms. We suggest that the higher radiation tolerance in adults and late stage embryos of H. dujardini (and in other studied tardigrades) compared to early stage embryos may partly be due to limited mitotic activity, since tardigrades have a low degree of somatic cell division (eutely), and dividing cells are known to be more sensitive to radiation. PMID:26208275

  16. Foods for a Mission to Mars: Investigations of Low-Dose Gamma Radiation Effects

    NASA Technical Reports Server (NTRS)

    Gandolph, J.; Shand, A.; Stoklosa, A.; Ma, A.; Weiss, I.; Alexander, D.; Perchonok, M.; Mauer, L. J.

    2007-01-01

    Food must be safe, nutritious, and acceptable throughout a long duration mission to maintain the health, well-being, and productivity of the astronauts. In addition to a developing a stable pre-packaged food supply, research is required to better understand the ability to convert edible biomass into safe, nutritious, and acceptable food products in a closed system with many restrictions (mass, volume, power, crew time, etc.). An understanding of how storage conditions encountered in a long-term space mission, such as elevated radiation, will impact food quality is also needed. The focus of this project was to contribute to the development of the highest quality food system possible for the duration of a mission, considering shelf-stable extended shelf-life foods, bulk ingredients, and crops to be grown in space. The impacts of space-relevant radiation doses on food, bulk ingredient, and select candidate crop quality and antioxidant capacity were determined. Interestingly, increasing gamma-radiation doses (0 to 1000 Gy) did not always increase dose-related effects in foods. Intermediate radiation doses (10 to 800Gy) often had significantly larger impact on the stability of bulk ingredient oils than higher (1000Gy) radiation doses. Overall, most food, ingredient, and crop systems investigated showed no significant differences between control samples and those treated with 3 Gy of gamma radiation (the upper limit estimated for a mission to Mars). However, this does not mean that all foods will be stable for 3-5 years, nor does it mean that foods are stable to space radiation comprising more than gamma rays.

  17. Radiation Enhances Regulatory T Cell Representation

    PubMed Central

    Kachikwu, Evelyn L.; Iwamoto, Keisuke S.; Liao, Yu-Pei; DeMarco, John J.; Agazaryan, Nzhde; Economou, James S.; McBride, William H.; Schaue, Dörthe

    2010-01-01

    PURPOSE Immunotherapy (IT) could be a useful adjunct to standard cytotoxic therapies such as radiation in patients with micrometastatic disease although successful integration of IT into treatment protocols will require further understanding of how standard therapies affect the generation of anti-tumor immune responses. This study was undertaken to evaluate the impact of radiation therapy on immunosuppressive T regulatory (Treg) cells. MATERIALS and METHODS Tregs were identified as a CD4+CD25hiFoxp3+ lymphocyte subset and their fate followed in a murine TRAMP-C1 model of prostate cancer in mice with and without radiation therapy. RESULTS CD4+CD25hiFoxp3+ Treg cells increased in immune organs following local leg or whole body radiation. A large part, but not all, of this increase following leg-only irradiation could be ascribed to radiation scatter and Tregs being intrinsically more radiation resistant than other lymphocyte subpopulations resulting in their selection. Their functional activity on a per cell basis was not affected by radiation exposure. Similar findings were made with mice receiving local RT to murine prostate tumors growing in the leg. The importance of the Treg population in the response to RT was shown by systemic elimination of Tregs, which greatly enhanced radiation-induced tumor regression. CONCLUSIONS We conclude that Tregs are more resistant to radiation than other lymphocytes resulting in their preferential increase. Treg cells may form an important homeostatic mechanism for tissues injured by radiation, and in a tumor context may assist in immune evasion during therapy. Targeting this population may allow enhancement of radiotherapeutic benefit through immune modulation. PMID:21093169

  18. Sensitometry of the response of a new radiochromic film dosimeter to gamma radiation and electron beams

    NASA Astrophysics Data System (ADS)

    McLaughlin, W. L.; Yun-Dong, Chen; Soares, C. G.; Miller, A.; Van Dyk, G.; Lewis, D. F.

    1991-04-01

    A new radiation-sensitive imaging material, called GafChromic Dosimetry Media, offers advances in high-dose radiation dosimetry and high-resolution radiography for gamma radiation and electrons. The potential uses in radiation processing, radiation sterilization of medical devices, population control of insects by irradiation, food irradiation, blood irradiation for organ-transplant immuno-suppression, clinical radiography, and industrial radiography have led to the present sensitometric study over the breadth of the wide dynamic range of this new routine detector and imaging material, namely, absorbed doses from 10 Gy to 5 10 4 Gy. The thin-coated film is colorless before irradiation, and registers a deep-blue image upon irradiation, with two absorption bands at about 650 nm (major band) and 600 nm (minor band). The response to electrons, in terms of increase in absorbance per unit absorbed dose, is the same as that to gamma radiation within the estimated uncertainty of the measurements ( 5%, 95% confidence level). The spatial resolving power is > 1200 lines/mm. After the first 24 hours, the image is stable over many months (within 5% in absorbance), however, the system should be irradiated and analyzed at approximately the temperatures used during calibration, because of temperature dependence during irradiation and readout, and temperatures greater than 55C should be avoided.

  19. High-efficiency scintillation detector for combined detection of thermal and fast neutrons and gamma radiation

    DOEpatents

    Chiles, M.M.; Mihalczo, J.T.; Blakeman, E.D.

    1987-02-27

    A scintillation based radiation detector for the combined detection of thermal neutrons, high-energy neutrons and gamma rays in a single detecting unit. The detector consists of a pair of scintillators sandwiched together and optically coupled to the light sensitive face of a photomultiplier tube. A light tight radiation pervious housing is disposed about the scintillators and a portion of the photomultiplier tube to hold the arrangement in assembly and provides a radiation window adjacent the outer scintillator through which the radiation to be detected enters the detector. The outer scintillator is formed of a material in which scintillations are produced by thermal-neutrons and the inner scintillator is formed of a material in which scintillations are produced by high-energy neutrons and gamma rays. The light pulses produced by events detected in both scintillators are coupled to the photomultiplier tube which produces a current pulse in response to each detected event. These current pulses may be processed in a conventional manner to produce a count rate output indicative of the total detected radiation event count rate. Pulse discrimination techniques may be used to distinguish the different radiations and their energy distribution.

  20. High-efficiency scintillation detector for combined of thermal and fast neutrons and gamma radiation

    DOEpatents

    Chiles, Marion M. (Knoxville, TN); Mihalczo, John T. (Oak Ridge, TN); Blakeman, Edward D. (Oak Ridge, TN)

    1989-01-01

    A scintillation based radiation detector for the combined detection of thermal neutrons, high-energy neutrons and gamma rays in a single detecting unit. The detector consists of a pair of scintillators sandwiched together and optically coupled to the light sensitive face of a photomultiplier tube. A light tight radiation pervious housing is disposed about the scintillators and a portion of the photomultiplier tube to hold the arrangement in assembly and provides a radiation window adjacent the outer scintillator through which the radiation to be detected enters the detector. The outer scintillator is formed of a material in which scintillations are produced by thermal-neutrons and the inner scintillator is formed of a material in which scintillations are produced by high-energy neutrons and gamma rays. The light pulses produced by events detected in both scintillators are coupled to the photomultiplier tube which produces a current pulse in response to each detected event. These current pulses may be processed in a conventional manner to produce a count rate output indicative of the total detected radiation even count rate. Pulse discrimination techniques may be used to distinguish the different radiations and their energy distribution.

  1. Assessment of Gamma Radiation Resistance of Spores Isolated from the Spacecraft Assembly Facility During MSL Assembly

    NASA Technical Reports Server (NTRS)

    Chopra, Arsh; Ramirez, Gustavo A.; Venkateswaran, Kasthuri J.; Vaishampayan, Parag A.

    2011-01-01

    Spore forming bacteria, a common inhabitant of spacecraft assembly facilities, are known to tolerate extreme environmental conditions such as radiation, desiccation, and high temperatures. Since the Viking era (early 1970's), spores have been utilized to assess the degree and level of microbiological contamination on spacecraft and their associated spacecraft assembly facilities. There is a growing concern that desiccation and extreme radiation resistant spore forming microorganisms associated with spacecraft surfaces can withstand space environmental conditions and subsequently proliferate on another solar body. Such forward contamination would certainly jeopardize future life detection or sample return technologies. It is important to recognize that different classes of organisms are critical while calculating the probability of contamination, and methods must be devised to estimate their abundances. Microorganisms can be categorized based on radiation sensitivity as Type A, B, C, and D. Type C represents spores resistant to radiation (10% or greater survival above 0.8 mRad gamma radiation). To address these questions we have purified 96 spore formers, isolated during planetary protection efforts of Mars Science Laboratory assembly for gamma radiation resistance. The spores purified and stored will be used to generate data that can be used further to model and predict the probability of forward contamination.

  2. Assessment of Gamma Radiation Resistance of Spores Isolated from the Spacecraft Assembly Facility During MSL Assembly

    NASA Technical Reports Server (NTRS)

    Chopra, Arsh; Ramirez, Gustavo A.; Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.

    2011-01-01

    Spore forming bacteria, a common inhabitant of spacecraft assembly facilities, are known to tolerate extreme environmental conditions such as radiation, desiccation, and high temperatures. Since the Viking era (early 1970's), spores have been utilized to assess the degree and level of microbiological contamination on spacecraft and their associated spacecraft assembly facilities. There is a growing concern that desiccation and extreme radiation resistant spore forming microorganisms associated with spacecraft surfaces can withstand space environmental conditions and subsequently proliferate on another solar body. Such forward contamination would certainly jeopardize future life detection or sample return technologies. It is important to recognize that different classes of organisms are critical while calculating the probability of contamination, and methods must be devised to estimate their abundances. Microorganisms can be categorized based on radiation sensitivity as Type A, B, C, and D. Type C represents spores resistant to radiation (10% or greater survival above 0.8 Mrad gamma radiation). To address these questions we have purified 96 spore formers, isolated during planetary protection efforts of Mars Science Laboratory assembly for gamma radiation resistance. The spores purified and stored will be used to generate data that can be used further to model and predict the probability of forward contamination.

  3. Gamma radiation effects on phenolics, antioxidants activity and in vitro digestion of pistachio ( Pistachia vera) hull

    NASA Astrophysics Data System (ADS)

    Behgar, M.; Ghasemi, S.; Naserian, A.; Borzoie, A.; Fatollahi, H.

    2011-09-01

    The effect of gamma radiation (10, 20, 30, 40, 50 and 60 kGy) on tannin, total phenolics, antioxidants activity and in vitro digestion of pistachio hulls has been investigated in this study. The possibility of using the radial diffusion method based on software measurement of the rings area has also been investigated in this study. The software based method in radial diffusion method showed a higher r2 (0.995) value when compared to the traditional method. Irradiation reduced the tannin content ( P<0.01) and activity of antioxidants ( P<0.05) of pistachio hull extracts but increased the total phenolic content ( P<0.05). There was no effect of gamma irradiation on the in vitro digestion of the pistachio hull. Irradiation decreased the digestion rate of the pistachio hull at the dose of 40 kGy when compared to the control. This study showed that gamma irradiation decreased tannin and antioxidants activity of pistachio hull.

  4. Performance of neutron and gamma personnel dosimetry in mixed radiation fields

    SciTech Connect

    Swaja, R.E.; Sims, C.S.

    1981-01-01

    From 1974 to 1980, six personnel dosimetry intercomparison studies (PDIS) were conducted at the Oak Ridge National Laboratory (ORNL) to evaluate the performance of personnel dosimeters in a variety of neutron and gamma fields produced by operating the Health Physics Research Reactor (HPRR) in the steady state mode with and without spectral modifying shields. A total of 58 different organizations participated in these studies which produced approximately 2000 measurements of neutron and gamma dose equivalents on anthropomorphic phantoms for five different reactor spectra. Based on these data, the relative performance of three basic types of neutron dosimeters (nuclear emulsion film, thermoluminescent (TLD), and track-etch) and two basic types of gamma dosimeters (film and TLD) in mixed radiation fields was assessed.

  5. Detection of galactic Al-26 gamma radiation by the SMM spectrometer

    NASA Technical Reports Server (NTRS)

    Share, G. H.; Kinzer, R. L.; Kurfess, J. D.; Forrest, D. J.; Chupp, E. L.; Rieger, E.

    1985-01-01

    The Solar Maximum Mission satellite's gamma-ray spectrometer has detected a line near 1.81 MeV in each of the three years (1980-1982) over which the Galactic center traversed the broad aperture of that instrument. No significant intensity variation is noted over this period. The Galactic center/anticenter intensity ratio is greater than 2.5, and the center of the emission is noted to be consistent with the location of the Galactic center. For an assumed source distribution which follows the more than 100 MeV Galactic gamma radiation, the total flux in the direction of the Galactic center and the measured energy of the line are consistent with the detection of a narrow gamma-ray line from interstellar Al-26 by HEAO 3 in 1979-1980.

  6. Properties of gamma-glutamyl transpeptidase in squamous cell carcinoma.

    PubMed

    Takami, Y; Chiba, M; Takahashi, M

    1993-01-01

    gamma-Glutamyl transpeptidase (GGT) was extracted from squamous cell carcinoma tissues of human skin (SCC) by Triton X-100 and bromelain treatment, and some of its biochemical properties were compared with those of GGT extracted from eccrine gland-rich tissue and normal kidney. GGT activity significantly increased in SCC, but there was no definitive differences in enzymological properties between GGT of SCC and normal tissue enzyme. However, GGT of SCC was distinguishable from those of normal tissues by isoelectric point, electrophoretic mobility, and sensitivity to neuraminidase treatment. These results indicate that GGT of SCC has some variant properties which may be related to skin carcinogenesis. PMID:8097748

  7. Des-Aspartate-Angiotensin I Attenuates Mortality of Mice Exposed to Gamma Radiation via a Novel Mechanism of Action

    PubMed Central

    Wang, Hong; Sethi, Gautam; Loke, Weng-Keong; Sim, Meng-Kwoon

    2015-01-01

    ACE inhibitors and ARBs (angiotensin receptor blockers) have been shown to attenuate radiation injuries in animal models of lethal gamma irradiation. These two classes of drug act by curtailing the actions of angiotensin II-linked inflammatory pathways that are up-regulated during gamma radiation in organ systems such as the brain, lung, kidney, and bone marrow. ACE inhibitors inhibit ACE and attenuate the formation of angiotensin II from angiotensin I; ARBs block the angiotensin AT1 receptor and attenuate the actions of angiotensin II that are elicited through the receptor. DAA-I (des-aspartate-angiotensin I), an orally active angiotensin peptide, also attenuates the deleterious actions of angiotensin II. It acts as an agonist on the angiotensin AT1 receptor and elicits responses that oppose those of angiotensn II. Thus, DAA-I was investigated for its anticipated radioprotection in gamma irradiated mice. DAA-I administered orally at 800 nmole/kg/day for 30 days post exposure (6.4 Gy) attenuated the death of mice during the 30-day period. The attenuation was blocked by losartan (50 nmole/kg/day, i.p.) that was administered sequential to DAA-I administration. This shows that the radioprotection was mediated via the angiotensin AT1 receptor. Furthermore, the radioprotection correlated to an increase in circulating PGE2 of surviving animals, and this suggests that PGE2 is involved in the radioprotection in DAA-I-treated mice. At the hematopoietic level, DAA-I significantly improved two syndromes of myelosuppression (leucopenia and lymphocytopenia), and mice pre-treated with DAA-I prior to gamma irradiation showed significant improvement in the four myelodysplastic syndromes that were investigated, namely leucopenia, lymphocytopenia, monocytopenia and thrombocytopenia. Based on the known ability of PGE2 to attenuate the loss of functional hematopoietic stem and progenitor cells in radiation injury, we hypothesize that PGE2 mediated the action of DAA-I. DAA-I completely attenuated the increase in circulating level of two inflammatory cytokines, TNFα and IL-6, in irradiated mice; and this shows that DAA-I exerted additional anti-inflammatory actions, which could also have contributed to its radioprotection. These findings show that DAA-I acts via a novel mechanism of action on the angiotensin AT1 receptor to specifically release PGE2, which mediates radioprotection in the gamma irradiated mice. PMID:26378927

  8. Radiation-quality dependent cellular response in mutation induction in normal human cells.

    PubMed

    Suzuki, Masao; Tsuruoka, Chizuru; Uchihori, Yukio; Kitamura, Hisashi; Liu, Cui Hua

    2009-09-01

    We studied cellular responses in normal human fibroblasts induced with low-dose (rate) or low-fluence irradiations of different radiation types, such as gamma rays, neutrons and high linear energy transfer (LET) heavy ions. The cells were pretreated with low-dose (rate) or low-fluence irradiations (approximately 1 mGy/7-8 h) of 137Cs gamma rays, 241Am-Be neutrons, helium, carbon and iron ions before irradiations with an X-ray challenging dose (1.5 Gy). Helium (LET = 2.3 keV/microm), carbon (LET = 13.3 keV/microm) and iron (LET = 200 keV/microm) ions were produced by the Heavy Ion Medical Accelerator in Chiba (HIMAC), Japan. No difference in cell-killing effect, measured by a colony forming assay, was observed among the pretreatment with different radiation types. In mutation induction, which was detected in the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus to measure 6-thioguanine resistant clones, there was no difference in mutation frequency induced by the X-ray challenging dose between unpretreated and gamma-ray pretreated cells. In the case of the pretreatment of heavy ions, X-ray-induced mutation was around 1.8 times higher in helium-ion pretreated and 4.0 times higher in carbon-ion pretreated cells than in unpretreated cells (X-ray challenging dose alone). However, the mutation frequency in cells pretreated with iron ions was the same level as either unpretreated or gamma-ray pretreated cells. In contrast, it was reduced at 0.15 times in cells pretreated with neutrons when compared to unpretreated cells. The results show that cellular responses caused by the influence of hprt mutation induced in cells pretreated with low-dose-rate or low-fluence irradiations of different radiation types were radiation-quality dependent manner. PMID:19680011

  9. A new, passive dosemeter for gamma, beta and neutron radiations.

    PubMed

    Jones, L A; Stokes, R P

    2011-03-01

    The Defence Science and Technology Laboratory (Dstl) provides personal radiation dosimetry to the UK Ministry of Defence. Dstl has recently developed a dosemeter that is based on a combination of thermoluminescent and etched-track detectors. The Dstl Combined Dosemeter is capable of assessing doses due to photons, beta particles and neutrons. This paper presents the laboratory type testing results for the Combined Dosemeter, and also describes the procedure for calibrating the dosemeter for use in workplace neutron fields. The Combined Dosemeter meets the type test requirements that are relevant to its intended applications, and gives neutron doses that are within 50% of the true dose in the workplaces in which it is used, even when the wearer has the potential to be exposed to a variety of neutron spectra (e.g. on board nuclear-powered submarines). PMID:21346288

  10. Development and characterization of starch nanoparticles by gamma radiation: potential application as starch matrix filler.

    PubMed

    Lamanna, Melisa; Morales, No J; Garca, Nancy Lis; Goyanes, Silvia

    2013-08-14

    Gamma radiation arises as an advantageous alternative to obtain starch nanoparticles given its low cost, simple methodology and scalability. Starch nanoparticles (SNP) with sizes around 20 and 30 nm were obtained applying a dose of 20 kGy from cassava (CNP-?) and waxy maize (WNP-?) starch, respectively. They showed the same thermal degradation behavior and their maximum mass loss zone was similar to those nanoparticles obtained from acid hydrolysis (WNP-h). Additionally, CNP-? and WNP-? were used as nanofillers in a cassava matrix. Increments of 102% in storage modulus were obtained with the addition of only 2.5 wt.% of WNP-?, showing that gamma radiation is a successful methodology to obtain SNP able to be used as starch reinforcement. PMID:23769521

  11. Three-dimensional radiation dosimetry for gamma knife using a gel dosimeter

    NASA Astrophysics Data System (ADS)

    Hussain, Kazi Muazzam

    The use of three-dimensional radiation dosimetry has been limited. With the use of water phantoms and ionization chambers, it has been possible to determine three dimensional dose distributions on a gross scale for cobalt 60 and linear accelerator sources. This method has been somewhat useful for traditional radiotherapy. There is, however, a need for more precise dosimetry, particularly with stereotactic radiosurgery. Most gamma knife facilities use either thermoluminescant dosimetry or film, neither of which provides three dimensional dose distributions. To overcome this limitation, we have developed a gel dosimetry system that relies on the production of a ferric ion-xylenol orange colored complex. This work demonstrates the use of laser light and a detector to quantify radiation-induced colorimetric changes in absorbance for the gel dosimeter. The absorbance has been reconstructed by the back projection technique to demonstrate the applicability of the gel dosimeter to gamma knife 3D-dose distributions.

  12. Lignocellulolytic mutants of Pleurotus ostreatus induced by gamma-ray radiation and their genetic similarities

    NASA Astrophysics Data System (ADS)

    Lee, Y.-K.; Chang, H.-H.; Kim, J.-S.; Kim, J. K.; Lee, K.-S.

    2000-02-01

    To induce the lignocellulolytic mutants of Pleurotus ostreatus, the mycelia were irradiated by gamma-ray radiation to doses of 1-2 kGy. Five strains were isolated by the criteria of clamp connection, fruiting body formation, growth rate and activities of extracellular enzymes. All isolated strains were able to form the fruiting bodies and grew similarly to the control. The extracellular enzymes activities in liquid media of isolated strains were up to 10 times higher than the control. Genetic similarities of the isolated strains ranged from 64.4% to 93.3% of the control. From these results, it seems that the genetic diversity of P. ostreatus could be changed and useful strains be induced by gamma-ray radiation to recycle or reuse biowastes.

  13. Public exposure due to external gamma background radiation in boundary areas of Iran.

    PubMed

    Pooya, S M Hosseini; Dashtipour, M R; Enferadi, A; Orouji, T

    2015-09-01

    A monitoring program in boundary areas of a country is an appropriate way to indicate the level of public exposure. In this research, gamma background radiation was measured using TL dosimeters at 12 boundary areas as well as in the capital city of Iran during the period 2010 to 2011. The measurements were carried out in semi-annual time intervals from January to June and July to December in each year. The maximum average dose equivalent value measured was approximately 70 μSv/month for Tehran city. Also, the average dose values obtained were less than 40 μSv/month for all the cities located at the sea level except that of high level natural radiation area of Ramsar, and more than 55 μSv/month for the higher elevation cities. The public exposure due to ambient gamma dose equivalent in Iran is within the levels reported by UNSCEAR. PMID:26057985

  14. Extragalactic gamma radiation: Use of galaxy counts as a galactic tracer

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Fichtel, C. E.

    1982-01-01

    A derivation of the extragalactic diffuse gamma radiation with energies above 35 MeV was carried out using galaxy counts as a tracer of galactic matter. The extragalactic radiation has a differential photon number spectrum which may be expressed as a power law with index 2.35 (+0.4, -0.3) and an intensity above 35 MeV of (5.5 + or - 1.3) 0.00001 photons sq cm/s/ster, consistent with previous derivations. Use of a 1/sin of the absolute value of b expression of the galactic component produces a poorer fit, suggesting that the high-latitude galactic gamma-ray production may be dominated by cosmic ray interactions with matter rather than by Compton interactions of cosmic rays with photon fields.

  15. Breast cancer stem cells and radiation

    NASA Astrophysics Data System (ADS)

    Phillips, Tiffany Marie

    2007-12-01

    The present studies explore the response of breast cancer stem cells (BCSC's) to radiation and the implications for clinical cancer treatment. Current cancer therapy eliminates bulky tumor mass but may fail to eradicate a critical tumor initiating cell population termed "cancer stem cells". These cells are potentially responsible for tumor formation, metastasis, and recurrence. Recently cancer stem cells have been prospectively identified in various malignancies, including breast cancer. The breast cancer stem cell has been identified by the surface markers CD44+/CD24 -(low). In vitro mammosphere cultures allow for the enrichment of the cancer stem cell population and were utilized in order to study differential characteristics of BCSC's. Initial studies found that BCSC's display increased radiation resistance as compared to other non-stem tumor cells. This resistance was accompanied by decreased H2AX phosphorylation, decreased reactive oxygen species formation, and increased phosphorylation of the checkpoint protein Chk1. These studies suggest differential DNA damage and repair within the BCSC population. Studies then examined the consequences of fractionated radiation on the BCSC population and found a two-fold increase in BCSC's following 5 x 3Gy. This observation begins to tie cancer stem cell self-renewal to the clinical stem cell phenomenon of accelerated repopulation. Accelerated repopulation is observed when treatment gaps increase between sequential fractions of radiotherapy and may be due to cancer stem cell symmetric self-renewal. The balance between asymmetric and symmetric stem cell division is vital for proper maintenance; deregulation is likely linked to cancer initiation and progression. The developmental Notch-1 pathway was found to regulate BCSC division. Over-expressing the constitutively active Notch-1-ICD in MCF7 cells produced an increase in the BCSC population. Additionally, radiation was observed to increase the expression of the Notch-1 ligand, Jagged-1, and this was complemented by radiation induced Notch-1 activation. Studies also linked hypoxia and BCSC renewal through Epo signaling. Treatment with rhEpo induced an increase in BCSC's, which again was due to rhEpo induced Jagged-1 expression and subsequent Notch-1 activation. This thesis suggests that radiation and rhEpo induce Jagged-1 expression in non-stem cells, which then induce Notch-1 activation in adjacent stem cells, and results in symmetric cancer stem cell self-renewal.

  16. New decay branches of the radiative capture reaction {sup 12}C({sup 16}O,{gamma}){sup 28}Si

    SciTech Connect

    Lebhertz, D.; Courtin, S.; Haas, F.; Salsac, M.-D.; Beck, C.; Michalon, A.; Rousseau, M.; Marley, P. L.; Glover, R. G.; Kent, P. E.; Hutcheon, D. A.; Davis, C.; Pearson, J. E.

    2009-01-28

    Resonances in the {sup 12}C({sup 16}O,{gamma}){sup 28}Si radiative capture process at energies around the Coulomb barrier have been probed using the very selective 0 deg. Dragon spectrometer at Triumf and its associated BGO {gamma}-array. For the first time the full level scheme involved in this process has been measured and shows previously unobserved {gamma}-decay to doorway states around 11 MeV in {sup 28}Si.

  17. Branching Fractions and CP-Violating Asymmetries in Radiative B Decays to eta K gamma

    SciTech Connect

    Aubert, B.

    2008-05-14

    The authors present measurements of the CP-violation parameters S and C for the radiative decay B{sup 0} {yields} {eta}K{sub S}{sup 0}{gamma}; for B {yields} {eta}K{gamma} they also measure the branching fractions and for B{sup +} {yields} {eta}K{sup +}{gamma} the time-integrated charge asymmetry {Alpha}{sub ch}. The data, collected with the BABAR detector at the Stanford Linear Accelerator Center, represent 465 x 10{sup 6} B{bar B} pairs produced in e{sup +}e{sup -} annihilation. The results are S = -0.18{sub -0.46}{sup +0.49} {+-} 0.12, C = -0.32{sub -0.39}{sup +0.40} {+-} 0.07, {Beta}(B{sup 0} {yields} {eta}K{sup 0}{gamma}) = (7.1{sub -2.0}{sup +2.1} {+-} 0.4) x 10{sup -6}, {Beta}(B{sup +} {yields} {eta}K{sup +}{gamma}) = (7.7 {+-} 1.0 {+-} 0.4) x 10{sup -6}, and {Alpha}{sub ch} = (-9.0{sub -9.8}{sup +10.4} {+-} 1.4) x 10{sup -2}. The first error quoted is statistical and the second systematic.

  18. Celestial diffuse gamma radiation above 30 MeV observed by SAS-2

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Kniffen, D. A.; Hartman, R. C.

    1973-01-01

    The Small Astronomy Satellite (SAS)-2, launched on November 15, 1972, carried into orbit a 32-deck magnetic-core digitized spark chamber gamma ray telescope to study celestial gamma radiation in the energy range above 30 MeV. In the study of several regions with b sub 2 15 deg, a finite, diffuse flux of gamma rays with a steep energy spectrum in the energy region from 35 to 200 MeV is observed. Representing the energy spectrum by a power law of the form dJ/dE = AE to - alpha power over this energy range, alpha is found along with the integral flux above 100 MeV. Combining this result with existing low energy gamma ray data yields an energy spectrum which is not a simple power law in energy, as in the X-ray region, but which demonstrates first an increase and then a decrease in slope, consistent within uncertainties with that predicted by cosmological theories, including the continuous production of high energy gamma rays primarily from neutral pi mesons throughout the history of the universe.

  19. A cylindrical xenon ionization chamber detector for high resolution, room temperature gamma radiation spectroscopy

    NASA Astrophysics Data System (ADS)

    Tepper, Gary; Losee, Jon; Palmer, Robert

    A 0.75 l gridded cylindrical ionization chamber gamma radiation detector using highly purified xenon near the critical point as the detection medium is described. The detector operates at room temperature with a noise subtracted intrinsic energy resolution of 1.8% at 662 keV. The detector design and performance variables are discussed in comparison to previous planar and cylindrical xenon detectors.

  20. Gamma radiation from the Crab nebula above 35 MeV

    NASA Technical Reports Server (NTRS)

    Kniffen, D. A.; Hartman, R. C.; Thompson, D. J.; Bignami, G. F.; Fichtel, C. E.; Oegelman, H.; Tuemer, T.

    1974-01-01

    Electromagnetic radiation from the Crab nebula were observed, showing that the Crab is unique among strong X-ray sources in that major component in the low energy range (1 to 10 KeV) shows little or no temporal variation. Observations of the Crab above 35 MeV were made with the high energy gamma ray telescope flown on SAS-2. The detector and technique are described in detail.

  1. Radiosensitivity of nall human melanoma transplanted into nude mice: repair, reoxygenation and dose fractionation. [Gamma radiation

    SciTech Connect

    Guichard, M.; Malaise, E.P.

    1982-06-01

    Split dose and fractionated ..gamma..-rays experiments have been performed on a human melanoma transplanted into nude mice using an in vitro colony assay. Repair of potentially lethal damage observed after a single dose of 20 Gy was found to no longer occur when 7 daily doses of 2.5 Gy were administered. In split-dose experiments, the increase in survival level probably can not be explained by repair of sublethal damage. When a single high dose of radiation is administered a certain reoxygenation is observed; however, there is no reoxygenation when low radiation doses are delivered daily.

  2. Gamma radiation-induced blue shift of resonance peaks of Bragg gratings in pure silica fibres

    NASA Astrophysics Data System (ADS)

    Faustov, A. V.; Gusarov, A. I.; Mégret, P.; Wuilpart, M.; Kinet, D.; Zhukov, A. V.; Novikov, S. G.; Svetukhin, V. V.; Fotiadi, A. A.

    2016-02-01

    We report the first observation of a significant gamma radiation-induced blue shift of the reflection/transmission peak of fibre Bragg gratings inscribed into pure-silica core fibres via multiphoton absorption of femtosecond pulses. At a total dose of ~100 kGy, the shift is ~20 pm. The observed effect is attributable to the ionising radiation-induced decrease in the density of the silica glass when the rate of colour centre formation is slow. We present results of experimental measurements that provide the key parameters of the dynamics of the gratings for remote dosimetry and temperature sensing.

  3. Degradation of Biochemical Activity in Soil Sterilized by Dry Heat and Gamma Radiation

    NASA Technical Reports Server (NTRS)

    Shih, K. L.; Souza, K. A.

    1978-01-01

    The effect of soil sterilization by dry heat (0.08% relative humidity), gamma radiation, or both on soil phosphatase, urease, and decarboxylase activity was studied. Soil sterilized by a long exposure to dry heat at relatively low temperatures (eight weeks at 100.5 C) retained higher activities than did soil exposed to a higher temperature (two weeks at 124.5 C), while all activity was destroyed by four days at 148.5 C. Sterilization with 7.5 Mrads destroyed less activity than did heat sterilization. The effect of several individually nonsterizing doses of heat radiation is described.

  4. Comparison of radiation damage in lead tungstate crystals under pion and gamma irradiation

    SciTech Connect

    Batarin, V.A.; Butler, J.; Davidenko, A.M.; Derevschikov, A.A.; Goncharenko, Y.M.; Grishin, V.N.; Kachanov, V.A.; Khodyrev, V.Y.; Konstantinov, A.S.; Kravtsov, V.I.; Kubota, Y.; Lukanin, V.S.; Matulenko, Y.A.; Melnick, Y.M.; Meschanin, A.P.; Mikhalin, N.E.; Minaev, N.G.; Mochalov, V.V.; Morozov, D.A.; Nogach, L.V.; Ryazantsev, A.V.; /Serpukhov, IHEP /Fermilab /Minnesota U. /Syracuse U. /Nanjing U.

    2003-12-01

    Studies of the radiation hardness of lead tungstate crystals produced by the Bogoroditsk Techno-Chemical Plant in Russia and the Shanghai Institute of Ceramics in China have been carried out at IHEP, Protvino. The crystals were irradiated by a 40 GeV pion beam. After full recovery, the same crystals were irradiated using a {sup 137}Cs {gamma}-ray source. The dose rate profiles along the crystal length were observed to be quite similar. We compare the effects of the two types of radiation on the crystals light output.

  5. Method for detecting water equivalent of snow using secondary cosmic gamma radiation

    DOEpatents

    Condreva, Kenneth J. (1420 Fifth St., Livermore, Alameda County, CA 94550)

    1997-01-01

    Water equivalent of accumulated snow determination by measurement of secondary background cosmic radiation attenuation by the snowpack. By measuring the attentuation of 3-10 MeV secondary gamma radiation it is possible to determine the water equivalent of snowpack. The apparatus is designed to operate remotely to determine the water equivalent of snow in areas which are difficult or hazardous to access during winter, accumulate the data as a function of time and transmit, by means of an associated telemetry system, the accumulated data back to a central data collection point for analysis. The electronic circuitry is designed so that a battery pack can be used to supply power.

  6. Method for detecting water equivalent of snow using secondary cosmic gamma radiation

    DOEpatents

    Condreva, K.J.

    1997-01-14

    Water equivalent of accumulated snow determination by measurement of secondary background cosmic radiation attenuation by the snowpack. By measuring the attenuation of 3-10 MeV secondary gamma radiation it is possible to determine the water equivalent of snowpack. The apparatus is designed to operate remotely to determine the water equivalent of snow in areas which are difficult or hazardous to access during winter, accumulate the data as a function of time and transmit, by means of an associated telemetry system, the accumulated data back to a central data collection point for analysis. The electronic circuitry is designed so that a battery pack can be used to supply power. 4 figs.

  7. Gamma-radiation-induced wood-plastic composites from Syrian tree species

    NASA Astrophysics Data System (ADS)

    Bakraji, Elias Hanna; Salman, Numan; Al-kassiri, Haroun

    2001-05-01

    Wood-plastic composites (WPC) have been prepared with five low-grade woods, native to Syria, using three monomer systems; acrylamide, butylmethacrylate, and styrene, with methanol as the swelling solvent. Polymerization was induced at various radiation doses (10, 20, and 30 kGy) at a dose rate of 3.5 kGy/h using a 60Co gamma radiation source. Some physical properties of WPC, namely polymer loading and compression strength have been measured. The polymer loading decreases approximately with increasing density of the wood species used.

  8. Free radical scavenging alleviates the biomechanical impairment of gamma radiation sterilized bone tissue.

    PubMed

    Akkus, Ozan; Belaney, Ryan M; Das, Prasenjit

    2005-07-01

    Terminal sterilization of bone allografts by gamma radiation is often essential prior to their clinical use to minimize the risk of infection and disease transmission. While gamma radiation has efficacy superior to other sterilization methods it also impairs the material properties of bone allografts, which may result in premature clinical failure of the allograft. The mechanisms by which gamma radiation sterilization damages bone tissue are not well known although there is evidence that the damage is induced via free radical attack on the collagen. In the light of the existing literature, it was hypothesized that gamma radiation induced biochemical damage to bone's collagen that can be reduced by scavenging for the free radicals generated during the ionizing radiation. It was also hypothesized that this lessening of the extent of biochemical degradation of collagen will be accompanied by alleviation in the extent of biomechanical impairment secondary to gamma radiation sterilization. Standardized tensile test specimens machined from human femoral cortical bone and specimens were assigned to four treatment groups: control, scavenger treated-control, irradiated and scavenger treated-irradiated. Thiourea was selected as the free radical scavenger and it was applied in aqueous form at the concentration of 1.5 M. Monotonic and cyclic mechanical tests were conducted to evaluate the mechanical performance of the treatment groups and the biochemical integrity of collagen molecules were assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native mechanical properties of bone tissue did not change by thiourea treatment only. The effect of thiourea treatment on mechanical properties of irradiated specimens were such that the post-yield energy, the fracture energy and the fatigue life of thiourea treated-irradiated treatment group were 1.9-fold, 3.3-fold and 4.7-fold greater than those of the irradiated treatment group, respectively. However, the mechanical function of thiourea treated and irradiated specimens was not to the level of unirradiated controls. The damage occurred through the cleavage of the collagen backbone as revealed by SDS PAGE analysis. Irradiated specimens did not exhibit a noteworthy amount of intact alpha-chains whereas those irradiated in the presence of thiourea demonstrated intact alpha-chains. Results demonstrated that free radical damage is an important pathway of damage, caused by cleaving the collagen backbone. Blocking the activity of free radicals using the scavenger thiourea reduces the extent of damage to collagen, helping to maintain the mechanical strength of sterilized tissue. Therefore, free radical scavenger thiourea has the potential to improve the functional life-time of the allograft component following transplantation. PMID:16022998

  9. Durability and shielding performance of borated Ceramicrete coatings in beta and gamma radiation fields

    NASA Astrophysics Data System (ADS)

    Wagh, Arun S.; Sayenko, S. Yu.; Dovbnya, A. N.; Shkuropatenko, V. A.; Tarasov, R. V.; Rybka, A. V.; Zakharchenko, A. A.

    2015-07-01

    Ceramicrete™, a chemically bonded phosphate ceramic, was developed for nuclear waste immobilization and nuclear radiation shielding. Ceramicrete products are fabricated by an acid-base reaction between magnesium oxide and mono potassium phosphate. Fillers are used to impart desired properties to the product. Ceramicrete's tailored compositions have resulted in several commercial structural products, including corrosion- and fire-protection coatings. Their borated version, called Borobond™, has been studied for its neutron shielding capabilities and is being used in structures built for storage of nuclear materials. This investigation assesses the durability and shielding performance of borated Ceramicrete coatings when exposed to gamma and beta radiations to predict the composition needed for optimal shielding performance in a realistic nuclear radiation field. Investigations were conducted using experimental data coupled with predictive Monte Carlo computer model. The results show that it is possible to produce products for simultaneous shielding of all three types of nuclear radiations, viz., neutrons, gamma-, and beta-rays. Additionally, because sprayable Ceramicrete coatings exhibit excellent corrosion- and fire-protection characteristics on steel, this research also establishes an opportunity to produce thick coatings to enhance the shielding performance of corrosion and fire protection coatings for use in high radiation environment in nuclear industry.

  10. Secondary metabolite perturbations in Phaseolus vulgaris leaves due to gamma radiation.

    PubMed

    Ramabulana, T; Mavunda, R D; Steenkamp, P A; Piater, L A; Dubery, I A; Madala, N E

    2015-12-01

    Oxidative stress is a condition in which the balance between the production and elimination of reactive oxygen species (ROS) is disturbed. However, plants have developed a very sophisticated mechanism to mitigate the effect of ROS by constantly adjusting the concentration thereof to acceptable levels. Electromagnetic radiation is one of the factors which results in oxidative stress. In the current study, ionizing gamma radiation generated from a Cobalt-60 source was used to induce oxidative stress in Phaseolus vulgaris seedlings. Plants were irradiated with several radiation doses, with 2kGy found to be the optimal, non-lethal dose. Metabolite distribution patterns from irradiated and non-irradiated plants were analyzed using UHPLC-qTOF-MS and multivariate data models such as principal component analysis (PCA) and orthogonal projection to latent structures discriminate analysis (OPLS-DA). Metabolites such as hydroxycinnamic phenolic acids, flavonoids, terpenes, and a novel chalcone were found to be perturbed in P.vulgaris seedlings treated with the aforementioned conditions. The results suggest that there is a compensatory link between constitutive protectants and inducible responses to injury as well as defense against oxidative stress induced by ionizing radiation. The current study is also the first to illustrate the power of a metabolomics approach to decipher the effect of gamma radiation on crop plants. PMID:26512968

  11. Diffuse gamma radiation. [intensity, energy spectrum and spatial distribution from SAS 2 observations

    NASA Technical Reports Server (NTRS)

    Fichtel, C. E.; Simpson, G. A.; Thompson, D. J.

    1978-01-01

    Results are reported for an investigation of the intensity, energy spectrum, and spatial distribution of the diffuse gamma radiation detected by SAS 2 away from the galactic plane in the energy range above 35 MeV. The gamma-ray data are compared with relevant data obtained at other wavelengths, including 21-cm emission, radio continuum radiation, and the limited UV and radio information on local molecular hydrogen. It is found that there are two quite distinct components to the diffuse radiation, one of which shows a good correlation with the galactic matter distribution and continuum radiation, while the other has a much steeper energy spectrum and appears to be isotropic at least on a coarse scale. The galactic component is interpreted in terms of its implications for both local and more distant regions of the Galaxy. The apparently isotropic radiation is discussed partly with regard to the constraints placed on possible models by the steep energy spectrum, the observed intensity, and an upper limit on the anisotropy.

  12. SAS-2 observations of the galactic gamma radiation from the Vela region

    NASA Technical Reports Server (NTRS)

    Thompson, D. J.; Bignami, G. F.; Fichtel, C. E.; Kniffen, D. A.

    1974-01-01

    Data from a scan of the galactic plane by the SAS-2 high energy gamma ray experiment in the region 250 deg l2 290 deg show a statistically-significant excess over the general radiation from the galactic plane for gamma radiation of energy 100 MeV in the region 260 deg l2 270 deg and -7.5 deg b2 0 deg. If the enhanced gamma radiation results from interactions of cosmic rays with galactic matter, as the energy spectrum suggests, it seems reasonable to associate the enhancement with large scale galactic features, such as spiral arm segments in that direction, or with the region surrounding the Vela supernova remnant, with which PSR 0833-45 is associated. If the excess is attributed to cosmic rays released from this supernova interacting with the interstellar matter in that region, then on the order of 3.10 to the 50th power ergs would be released by that supernova in the form of cosmic rays.

  13. Activation of PPAR{gamma} is not involved in butyrate-induced epithelial cell differentiation

    SciTech Connect

    Ulrich, S.; Waechtershaeuser, A.; Loitsch, S.; Knethen, A. von; Bruene, B.; Stein, J. . E-mail: j.stein@em.uni-frankfurt.de

    2005-10-15

    Histone deacetylase-inhibitors affect growth and differentiation of intestinal epithelial cells by inducing expression of several transcription factors, e.g. Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) or vitamin D receptor (VDR). While activation of VDR by butyrate mainly seems to be responsible for cellular differentiation, the activation of PPAR{gamma} in intestinal cells remains to be elucidated. The aim of this study was to determine the role of PPAR{gamma} in butyrate-induced cell growth inhibition and differentiation induction in Caco-2 cells. Treatment with PPAR{gamma} ligands ciglitazone and BADGE (bisphenol A diglycidyl) enhanced butyrate-induced cell growth inhibition in a dose- and time-dependent manner, whereas cell differentiation was unaffected after treatment with PPAR{gamma} ligands rosiglitazone and MCC-555. Experiments were further performed in dominant-negative PPAR{gamma} mutant cells leading to an increase in cell growth whereas butyrate-induced cell differentiation was again unaffected. The present study clearly demonstrated that PPAR{gamma} is involved in butyrate-induced inhibition of cell growth, but seems not to play an essential role in butyrate-induced cell differentiation.

  14. Radiation Therapy

    MedlinePLUS

    ... Radiation (also called x-rays, gamma rays, or photons) either kills tumor cells directly or interferes with ... treatment per day, five days a week, for two to seven weeks. Potiential Side Effects Most people ...

  15. Effect of gamma radiation and oregano essential oil on murein and ATP concentration of Escherichia coli O157:H7.

    PubMed

    Caillet, Stphane; Shareck, Franois; Lacroix, Monique

    2005-12-01

    This study was carried out to evaluate the effects of gamma radiation alone or in combination with oregano essential oil on the murein composition of Escherichia coli O157:H7 and on the intracellular and extracellular concentrations of ATP. The bacterial strain was treated with three radiation doses: 0.4 kGy to induce cell damage, 1.1 kGy to obtain a viable but non-culturable state, and 1.3 kGy to cause cell death. Oregano essential oil was used at 0.006 and 0.025% (wt/vol), which is the MIC. All treatments had a significant effect (P < or = 0.05) on the murein composition, although some muropeptides did not seem to be affected by the treatment. Each treatment had a different effect on the relative percentage and number of muropeptides. There was a significant correlation (P < or = 0.05) between the decrease in intracellular ATP and the increase in extracellular ATP following treatment of the cells with oregano oil. The reduction of intracellular ATP was even more important when oregano oil was combined with irradiation, but irradiation alone at a high dose (< or = 1.1 kGy) significantly decreased (P < or = 0.05) the internal ATP without affecting the external ATP. Transmission electron microscopic examination revealed that oregano oil and irradiation have an effect on cell wall structure. PMID:16355828

  16. Single-cell responses to ionizing radiation.

    PubMed

    Ponnaiya, Brian; Amundson, Sally A; Ghandhi, Shanaz A; Smilenov, Lubomir B; Geard, Charles R; Buonanno, Manuela; Brenner, David J

    2013-11-01

    While gene expression studies have proved extremely important in understanding cellular processes, it is becoming more apparent that there may be differences in individual cells that are missed by studying the population as a whole. We have developed a qRT-PCR protocol that allows us to assay multiple gene products in small samples, starting at 100 cells and going down to a single cell, and have used it to study radiation responses at the single-cell level. Since the accuracy of qRT-PCR depends greatly on the choice of "housekeeping" genes used for normalization, initial studies concentrated on determining the optimal panel of such genes. Using an endogenous control array, it was found that for IMR90 cells, common housekeeping genes tend to fall into one of two categories-those that are relatively stably expressed regardless of the number of cells in the sample, e.g., B2M, PPIA, and GAPDH, and those that are more variable (again regardless of the size of the population), e.g., YWHAZ, 18S, TBP, and HPRT1. Further, expression levels in commonly studied radiation-response genes, such as ATF3, CDKN1A, GADD45A, and MDM2, were assayed in 100, 10, and single-cell samples. It is here that the value of single-cell analyses becomes apparent. It was observed that the expression of some genes such as FGF2 and MDM2 was relatively constant over all irradiated cells, while that of others such as FAS was considerably more variable. It was clear that almost all cells respond to ionizing radiation but the individual responses were considerably varied. The analyses of single cells indicate that responses in individual cells are not uniform and suggest that responses observed in populations are not indicative of identical patterns in all cells. This in turn points to the value of single-cell analyses. PMID:23995963

  17. Radiation and taxol effects on synchronized human cervical carcinoma cells

    SciTech Connect

    Geard, C.R.; Jones, J.M. )

    1994-06-15

    The purpose was to evaluate the effectiveness of the plant derived chemotherapeutic agent taxol alone and in combination with ionizing radiation on synchronous and asynchronous human cervical carcinoma cells and to define the mechanistic basis for this cytotoxic response. Asynchronous and synchronous cells (obtained by modified mitotic shake-off) derived from carcinomas of the human uterine cervix were treated with a range of concentrations of taxol (0, 1.0, 2.5, 5.0, 10.0, and 20.0 nM) for either 8, 24, or 48 h. Synchronized cell cycling was evaluated by counting mitotic indices and by uptake of bromodeoxyuridine (BrdUrd). Cells were irradiated ([sup 137]Cs [gamma] rays at 1.12 Gy/min) alone and after taxol treatment and plating efficiencies and radiosensitivity determined. Taxol treatment resulted in a dose time dependent loss of colony forming ability with 10 nM for 24 h producing about 10% cell survival. Irradiating taxol treated cells resulted in a strictly additive response in contrast to previous supra-additive results with astrocytoma and melanoma cells. Mitotically synchronized cells rapidly moved into G[sub 1] phase with a second mitotic peak at 28 h (total cycle time). Taxol treatment resulted in a continued accumulation of mitoses, and a failure and/or delay of entry of a fraction of cells into S phase after a G[sub 1] phase of at least 10 h. That is, taxol effects cell cycling at a stage other than G[sub 2]/M. Irradiating (3 Gy) synchronized cells showed a 10-fold variation in sensitivity, with mitosis as the most sensitive phase with taxol alone resulting in some cytotoxicity and combined effects additive or less than additive. This may explain the failure to obtain taxol radiosensitization with these cells and it may indicate that taxol has a multiplicity of actions with differences in effectiveness likely between cells of different origins. 24 refs., 5 figs.

  18. Cell death (apoptosis) in mouse intestine after continuous irradiation with gamma rays and with beta rays from tritiated water

    SciTech Connect

    Ijiri, K.

    1989-04-01

    Apoptosis is a pattern of cell death involving nuclear pycnosis, cytoplasmic condensation, and karyorrhexis. Apoptosis induced by continuous irradiation with gamma rays (externally given by a 137Cs source) or with beta rays (from tritiated water injected ip) was quantified in the crypts of two portions of mouse bowel, the small intestine and descending colon. The time-course change in the incidence of apoptosis after each type of radiation could be explained on the basis of the innate circadian rhythm of the cells susceptible to apoptotic death and of the excretion of tritiated water (HTO) from the body. For 6-h continuous gamma irradiation at various dose rates (0.6-480 mGy/h) and for 6 h after injection of HTO of various radioactivities (0.15-150 GBq per kg body wt), the relationships between dose and incidence of apoptosis were obtained. Survival curves were then constructed from the curves for dose vs incidence of apoptosis. For the calculation of the absorbed dose from HTO, the water content both of the mouse body and of the cells was assumed to be 70%. One megabecquerel of HTO per mouse (i.e., 40 MBq/kg body wt) gave a dose rate of 0.131 mGy/h. The mean lethal doses (D0) were calculated for gamma rays and HTO, and relative biological effectiveness values of HTO relative to gamma rays were obtained. The D0 values for continuous irradiation with gamma rays were 210 mGy for small intestine and 380 mGy for descending colon, and the respective values for HTO were 130 and 280 mGy, indicating the high radiosensitivity of target cells for apoptotic death. The relative biological effectiveness of HTO relative to 137Cs gamma rays for cell killing in both the small intestine and the descending colon in the mouse was 1.4-2.1.

  19. Effect of 1. 33 Mev gamma radiation and 0. 5 Mev electrons on the mechanical properties of graphite fiber composites

    SciTech Connect

    Fornes, R.E.; Memory, J.D.; Naranong, N.

    1982-01-01

    Epoxy/graphite fiber, polyimide/graphite fiber, and polysulfone/graphite fiber composites were exposed to 1.33 Mev gamma irradiation and 0.5 Mev electron bombardment for varying periods of time. The effects of the irradiation treatments on the breaking stress and Young's modulus were studied by a three point bending test. Effects were small. Both electron radiation up to 5000 Mrad and gamma radiation up to 350 Mrad resulted in slight increases in both stress and modulus.

  20. Resistance of a cultured fish cell line (CAF-MM1) to. gamma. irradiation

    SciTech Connect

    Mitani, H.; Etoh, H.; Egami, N.

    1982-02-01

    Fish are generally more resistant to whole-body ionizing radiation than mammals. To study the radiosensitivity of fish in vitro, CAF-MM1 cells derived from the fin of the goldfish, Carassius auratus, were used. The survival parameters of CAF-MM1 obtained after ..gamma.. irradiation at 26/sup 0/C were 325 rad for D/sub o/, 975 rad for Dq, and 15 for n. No mammalian cell line with such a low sensitivity in the presence of O/sub 2/ has been reported. It was found that the large initial shoulder of the survival curve was paralleled by substantial repair of sublethal damage as evidenced by split-dose experiments. This low sensitivity to ..gamma.. irradiation did not change upon the administration of caffeine or postirradiation illumination, although these treatments were effective after uv irradiation. The decrease in the mitotic index in CAF-MM1 occurred immediately after irradiation, and it recovered within a very short time. This indicated that the duration of G2 arrest was shorter than that observed in mammalian cells. The data also suggest that the resistance of fish to whole-body irradiation is attributable to resistance at the cellular level.

  1. Atypical radiation response of SCID cells

    NASA Astrophysics Data System (ADS)

    Chawapun, Nisa

    Murine SCID (severe combined immune deficiency) cells are well known for their defect in DNA double-strand break repair and in variable(diversity)joining [V(D)J] recombination due to a mutation in a catalytic subunit of DNA-dependent protein kinase (DNA-PKcs). As a consequence, scid cells are hypersensitive to ionizing radiation. The present study showed that asynchronous populations of scid cells were about two-fold more sensitive than Balb/c with respect to cell killing and the defect in scid cells was corrected by complementation with human chromosome 8. Analysis of the survival of synchronized populations as a function of the cell cycle revealed that while scid cells were hypersensitive in all cell cycle phases compared to wild-type cells, this hypersensitivity is even more pronounced in G1 phase. The hypersensitivity reduced as the cells progressed into S phase suggested that homologous recombination repair plays a role. The results imply that there are at least two pathways for the repair of DSB DNA, consistent with a model previously proposed by others. The scid cells were also more sensitive to UVC light (254 nm) killing as compared to wild type cells by clonogenic survival. Using a host cell reactivation (HCR) assay to study the nucleotide excision repair (NER) which is the major repair pathway for UV-photoproducts, the results showed that NER in scid cells was not as efficient as CB- 17. This suggests that DNA-PK is involved in NER as well as non-homologous end-joining (NHEJ) DSB repair which is responsible for ionizing radiation sensitivity in scid cells. Repair in scid cells was not totally absent as shown by low dose rate sparing of cell killing after exposure to 137Cs γ-rays at dose rate of 0.6 cGy/h, 1.36 cGy/h, 6 cGy/h as compared to high dose rate at 171 cGy/min, although this phenomenon could be explained partly by proliferation. However, for radiation induced transformation, no significant dose rate effect was seen. A plot of transformation versus survival revealed that the transformation induction was inversely proportional to radiation dose rate. Lower dose rates were more effective in inducing transformation in scid cells. This finding could lead to the influence of cancer risk estimation in an irradiated population consisting of a subpopulation(s) with genetic disorders predisposing those individuals to cancer.

  2. Age and radiation sensitivity of rat mammary clonogenic cells.

    PubMed

    Shimada, Y; Yasukawa-Barnes, J; Kim, R Y; Gould, M N; Clifton, K H

    1994-01-01

    The relative risk of breast cancer is very high among women who were exposed to ionizing radiation during or before puberty. In the current studies, the surviving fractions of clonogenic mammary cells of groups of virgin rats were estimated after single exposures to 137Cs gamma rays at intervals from 1 to 12 weeks after birth. The radiosensitivity of clonogens from prepubertal rats was high and changed with the onset of puberty at between 4 and 6 weeks of age. By this time, the increase in the size of the clonogenic cell subpopulation was slowing and differentiation of terminal mammary end buds and alveolar structures was occurring. Analysis of the relationship of clonogen survival and radiation dose according to the alpha/beta model showed that the exponential alpha D term predominated at the second and fourth weeks of age. By the eighth week of age, the beta D2 term had come to predominate and the survival curve had a pronounced initial convex shoulder. Further experiments are required to determine whether there is an association between the high sensitivity of the prepubertal and pubertal mammary clonogens to radiation killing and a high susceptibility to radiogenic initiation of cancer. PMID:8265781

  3. Levels of naturally occurring gamma radiation measured in British homes and their prediction in particular residences.

    PubMed

    Kendall, G M; Wakeford, R; Athanson, M; Vincent, T J; Carter, E J; McColl, N P; Little, M P

    2016-03-01

    Gamma radiation from natural sources (including directly ionising cosmic rays) is an important component of background radiation. In the present paper, indoor measurements of naturally occurring gamma rays that were undertaken as part of the UK Childhood Cancer Study are summarised, and it is shown that these are broadly compatible with an earlier UK National Survey. The distribution of indoor gamma-ray dose rates in Great Britain is approximately normal with mean 96 nGy/h and standard deviation 23 nGy/h. Directly ionising cosmic rays contribute about one-third of the total. The expanded dataset allows a more detailed description than previously of indoor gamma-ray exposures and in particular their geographical variation. Various strategies for predicting indoor natural background gamma-ray dose rates were explored. In the first of these, a geostatistical model was fitted, which assumes an underlying geologically determined spatial variation, superimposed on which is a Gaussian stochastic process with Matérn correlation structure that models the observed tendency of dose rates in neighbouring houses to correlate. In the second approach, a number of dose-rate interpolation measures were first derived, based on averages over geologically or administratively defined areas or using distance-weighted averages of measurements at nearest-neighbour points. Linear regression was then used to derive an optimal linear combination of these interpolation measures. The predictive performances of the two models were compared via cross-validation, using a randomly selected 70 % of the data to fit the models and the remaining 30 % to test them. The mean square error (MSE) of the linear-regression model was lower than that of the Gaussian-Matérn model (MSE 378 and 411, respectively). The predictive performance of the two candidate models was also evaluated via simulation; the OLS model performs significantly better than the Gaussian-Matérn model. PMID:26880257

  4. Predominant expansion of V gamma 9/V delta 2 T cells in a tularemia patient.

    PubMed Central

    Sumida, T; Maeda, T; Takahashi, H; Yoshida, S; Yonaha, F; Sakamoto, A; Tomioka, H; Koike, T; Yoshida, S

    1992-01-01

    We describe a 58-year-old man with tularemia and expanding gamma delta T cells in his peripheral blood lymphocytes (PBL) (32.7% of total PBL). In the present work, we analyzed the T-cell receptor V gamma/V delta repertoire of these cells by making use of the polymerase chain reaction and flow cytometry and found that they were mostly CD4- CD8- CD3+ V gamma 9/V delta 2+. The sequence analysis of 16 cDNA clones encoding the V gamma 9-J region revealed that the V gamma 9-Jp combination was strikingly overrepresented but that the junctional (N) region was heterogeneous. This suggested that the gamma delta T cells in PBL from a patient with tularemia were polyclonally expanded. Images PMID:1534075

  5. Biological radiation dose from secondary particles in a Milky Way gamma-ray burst

    NASA Astrophysics Data System (ADS)

    Atri, Dimitra; Melott, Adrian L.; Karam, Andrew

    2014-07-01

    Gamma-ray bursts (GRBs) are a class of highly energetic explosions emitting radiation in a very short timescale of a few seconds and with a very narrow opening angle. Although, all GRBs observed so far are extragalactic in origin, there is a high probability of a GRB of galactic origin beaming towards the Earth in the past ~0.5 Gyr. We define the level of catastrophic damage to the biosphere as approximation 100 kJ m-2, based on Thomas et al. (2005a, b). Using results in Melott & Thomas (2011), we estimate the probability of the Earth receiving this fluence from a GRB of any type, as 87% during the last 500 Myr. Such an intense burst of gamma rays would ionize the atmosphere and deplete the ozone (O3) layer. With depleted O3, there will be an increased flux of Solar UVB on the Earth's surface with potentially harmful biological effects. In addition to the atmospheric damage, secondary particles produced by gamma ray-induced showers will reach the surface. Among all secondary particles, muons dominate the ground-level secondary particle flux (99% of the total number of particles) and are potentially of biological significance. Using the Monte Carlo simulation code CORSIKA, we modelled the air showers produced by gamma-ray primaries up to 100 GeV. We found that the number of muons produced by the electromagnetic component of hypothetical galactic GRBs significantly increases the total muon flux. However, since the muon production efficiency is extremely low for photon energies below 100 GeV, and because GRBs radiate strongly for only a very short time, we find that the biological radiation dose from secondary muons is negligible. The main mechanism of biological damage from GRBs is through Solar UVB irradiation from the loss of O3 in the upper atmosphere.

  6. Terrestrial gamma radiation baseline mapping using ultra low density sampling methods.

    PubMed

    Kleinschmidt, R; Watson, D

    2016-01-01

    Baseline terrestrial gamma radiation maps are indispensable for providing basic reference information that may be used in assessing the impact of a radiation related incident, performing epidemiological studies, remediating land contaminated with radioactive materials, assessment of land use applications and resource prospectivity. For a large land mass, such as Queensland, Australia (over 1.7 million km(2)), it is prohibitively expensive and practically difficult to undertake detailed in-situ radiometric surveys of this scale. It is proposed that an existing, ultra-low density sampling program already undertaken for the purpose of a nationwide soil survey project be utilised to develop a baseline terrestrial gamma radiation map. Geoelement data derived from the National Geochemistry Survey of Australia (NGSA) was used to construct a baseline terrestrial gamma air kerma rate map, delineated by major drainage catchments, for Queensland. Three drainage catchments (sampled at the catchment outlet) spanning low, medium and high radioelement concentrations were selected for validation of the methodology using radiometric techniques including in-situ measurements and soil sampling for high resolution gamma spectrometry, and comparative non-radiometric analysis. A Queensland mean terrestrial air kerma rate, as calculated from the NGSA outlet sediment uranium, thorium and potassium concentrations, of 4969nGyh(-1) (n=311, 3? 99% confidence level) is proposed as being suitable for use as a generic terrestrial air kerma rate background range. Validation results indicate that catchment outlet measurements are representative of the range of results obtained across the catchment and that the NGSA geoelement data is suitable for calculation and mapping of terrestrial air kerma rate. PMID:26063584

  7. Alloreactive gamma delta thymocytes utilize distinct costimulatory signals from peripheral T cells.

    PubMed

    Penninger, J M; Timms, E; Shahinian, A; Jezo-Bremond, A; Nishina, H; Ionescu, J; Hedrick, S M; Mak, T W

    1995-10-15

    Interactions between CD28/CTLA-4 on T cells and CD80 (B7.1) and CD86 (B7.2) counter receptors provide crucial costimulatory signals for TCR-alpha beta+ lymphocytes. To test the role of CD28 in thymic development and activation of TCR-gamma delta+ T cells, we introduced the alloreactive V gamma 2V alpha 11.3 TCR into CD28-deficient mice (CD28-/-). We show that positive and negative selection of gamma delta Tg thymocytes proceeded normally in the absence of CD28. Although mature Tg gamma delta+ thymocytes required a second costimulatory signal for proliferation, gamma delta+ thymocytes from CD28-/- and CD28+/- littermates responded equally well to the alloantigen Tlab. Alloreactivity of CD28-/- and CD28+/- Tg gamma delta+ thymocytes could not be blocked with mAbs against CD80 and CD86 ligands. Thus gamma delta thymocytes utilize a costimulatory system during development and alloresponses that is independent of CD28/CD80 and CD28/CD86 interactions. By contrast to V gamma 2V alpha 11.3+ thymocytes, alloreactivity of V gamma 2V alpha 11.3+ lymph node T cells depended on CD28 costimulation and was severely impaired in CD28-/- mice. These data provide functional evidence that maturation and selection of gamma delta cells is independent of CD28. These results also indicate that distinct costimulatory pathways are operational in mature thymocytes and peripheral T cells. PMID:7561091

  8. The TP53 dependence of radiation-induced chromosome instability in human lymphoblastoid cells

    NASA Technical Reports Server (NTRS)

    Schwartz, Jeffrey L.; Jordan, Robert; Evans, Helen H.; Lenarczyk, Marek; Liber, Howard

    2003-01-01

    The dose and TP53 dependence for the induction of chromosome instability were examined in cells of three human lymphoblastoid cell lines derived from WIL2 cells: TK6, a TP53-normal cell line, NH32, a TP53-knockout created from TK6, and WTK1, a WIL2-derived cell line that spontaneously developed a TP53 mutation. Cells of each cell line were exposed to (137)Cs gamma rays, and then surviving clones were isolated and expanded in culture for approximately 35 generations before the frequency and characteristics of the instability were analyzed. The presence of dicentric chromosomes, formed by end-to-end fusions, served as a marker of chromosomal instability. Unexposed TK6 cells had low levels of chromosomal instability (0.002 +/- 0.001 dicentrics/cell). Exposure of TK6 cells to doses as low as 5 cGy gamma rays increased chromosome instability levels nearly 10-fold to 0.019 +/- 0.008 dicentrics/cell. There was no further increase in instability levels beyond 5 cGy. In contrast to TK6 cells, unexposed cultures of WTK1 and NH32 cells had much higher levels of chromosome instability of 0.034 +/- 0.007 and 0.041 +/- 0.009, respectively, but showed little if any effect of radiation on levels of chromosome instability. The results suggest that radiation exposure alters the normal TP53-dependent cell cycle checkpoint controls that recognize alterations in telomere structure and activate apoptosis.

  9. 1989 neutron and gamma personnel dosimetry intercomparison study using RADCAL (Radiation Calibration Laboratory) sources

    SciTech Connect

    Sims, C.S.; Casson, W.H.; Patterson, G.R. ); Murakami, H. . Dept. of Health Physics); Liu, J.C. )

    1990-10-01

    The fourteenth Personnel Dosimetry Intercomparison Study (i.e., PDIS 14) was conducted during May 1-5, 1989. A total of 48 organizations (33 from the US and 15 from abroad) participated in PDIS 14. Participants submitted by mail a total of 1,302 neutron and gamma dosimeters for this mixed field study. The type of neutron dosimeter and the percentage of participants submitting that type are as follows: TLD-albedo (40%), direct interaction TLD (22%), track (20%), film (7%), combination (7%), and bubble detectors (4%). The type of gamma dosimeter and the percentage of participants submitting that type are as follows: TLD (84%) and film (16%). Radiation sources used in the six PDIS 14 exposures included {sup 252}Cf moderated by 15-cm D{sub 2}O, {sup 252}Cf moderated by 15-cm polyethylene (gamma-enhanced with {sup 137}Cs), and {sup 238}PuBe. Neutron dose equivalents ranged from 0.44--2.63 mSv and gamma doses ranged from 0. 01-1.85 mSv. One {sup 252}Cf(D{sub 2}O) exposure was performed at a 60{degree} angle of incidence (most performance tests are at perpendicular incidence). The average neutron dosimeter response for this exposure was 70% of that at normal incidence. The average gamma dosimeter response was 96% of that at normal incidence. A total of 70% of individual reported neutron dosimeter measurements were within {plus minus}50% of reference values. If the 0.01 mSv data are omitted, approximately 90% of the individual reported gamma measurements were within {plus minus}50% of reference values. 33 refs., 9 figs., 27 tabs.

  10. Empowering gamma delta T cells with antitumor immunity by dendritic cell-based immunotherapy

    PubMed Central

    Van Acker, Heleen H; Anguille, Sébastien; Van Tendeloo, Viggo F; Lion, Eva

    2015-01-01

    Gamma delta (γδ) T cells are the all-rounders of our immune-system with their major histocompatibility complex-unrestricted cytotoxicity, capacity to secrete immunosti-mulatory cytokines and ability to promote the generation of tumor antigen-specific CD8+ and CD4+ T cell responses. Dendritic cell (DC)-based vaccine therapy has the prospective to harness these unique features of the γδ T cells in the fight against cancer. In this review, we will discuss our current knowledge on DC-mediated γδ T cell activation and related opportunities for tumor immunologists. PMID:26405575

  11. Neurobehavioral effects of head-only gamma-radiation exposure in rats.

    PubMed

    Hienz, Robert D; Brady, Joseph V; Gooden, Virginia L; Vazquez, Marcelo E; Weed, Michael R

    2008-09-01

    The present report describes initial steps in the development of an animal model for assessing the effects of low levels of radiation encountered in the space environment on human cognitive function by examining the effects of radiation on a range of neurobehavioral functions in rodents that are similar to a number of basic human cognitive functions. The present report presents baseline data on the effects of gamma radiation on neurobehavioral functions in rodents (psychomotor speed, discrimination accuracy and inhibitory control) that are similar to those in humans. Two groups of eight Long-Evans rats were trained to perform a reaction-time task that required them to depress a lever for 1-3 s and to release the lever within 1.5 s of a release stimulus (correct trial) to receive a reward. Releasing the lever prior to the release stimulus (error) terminated the trial. One group was exposed to head-only gamma radiation (5 Gy at a dose rate of 1 Gy/min), while the second group was sham-irradiated using the same anesthesia protocol. The irradiated group showed significant deficits in both performance accuracy (percentage correct scores) and performance reliability (false alarm scores) from 1 to 4 months after irradiation, indicating clear performance impairments. The increase in false alarm scores is consistent with reduced inhibitory control and a shift toward increased anticipatory responses at the cost of decreased accuracy. The nonirradiated group showed no such changes over the same period. PMID:18763858

  12. Size effects on gamma radiation response of magnetic properties of barium hexaferrite powders

    SciTech Connect

    McCloy, John; Kukkadapu, Ravi; Crum, Jarrod; Johnson, Brad; Droubay, Tim

    2011-12-01

    Little is currently known about the effects of gamma-ray irradiation on oxide magnet materials. In particular, the effect of particle size on radiation susceptibility was investigated. Two commercial powders of BaFe{sub 12}O{sub 19} were thoroughly characterized, then exposed to 1 MGy of gamma radiation from a {sup 60}Co source. AC susceptibility and DC magnetometry and Moessbauer spectroscopy were performed after irradiation and compared to pre-irradiated measurements. DC magnetization and AC susceptibility decreased for both samples with the relative change of DC magnetization being larger for the micrometer-sized particles and the relative change of the AC susceptibility being larger for the nanometer-sized particles. Moessbauer spectroscopy indicated a decrease in both the hyperfine fields and in their distribution for each Fe site, particularly in the larger particle sample. Decreases in susceptibility are believed to be due to radiation-induced amorphization at the particle surfaces as well as amorphization and nucleation of new crystallites at internal crystallite boundaries, resulting in overall reduction in the particle magnetic moment. This radiation damage mechanism is different than that seen in previous studies of neutron and heavy ion irradiation of BaFe{sub 12}O{sub 19}.

  13. Gamma radiation impact on performance of OOK, DPSK and homodyne BPSK based optical inter-satellite communication system

    NASA Astrophysics Data System (ADS)

    Liu, Yun; Zhao, Shanghong; Gong, Zizheng; Hou, Rui; Qiang, Ruoxin

    2015-09-01

    Performance of optical inter-satellite communication system is influenced by the harsh space radiation environment. Gamma radiation effects on main devices of communication system are analyzed and on the basis of existing experimental data, performance degradation of on off keying (OOK), differential phase shift keying (DPSK) and homodyne binary phase shift keying (BPSK) based system under 1 kGy gamma irradiation is simulated. Variation of Q factors and bit error ratio of these systems with different radiation position are achieved and discussed. The result shows that it is more urgent to improve the radiation hardness of transmitter, and the introduction of local laser is a considerable method to reduce gamma radiation impact on system performance.

  14. M-BAND Study of Radiation-Induced Chromosome Aberrations in Human Epithelial Cells: Radiation Quality and Dose Rate Effects

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Cucinotta, Francis; Wu, Honglu

    2009-01-01

    The advantage of the multicolor banding in situ hybridization (mBAND) technique is its ability to identify both inter- (translocation to unpainted chromosomes) and intra- (inversions and deletions within a single painted chromosome) chromosome aberrations simultaneously. To study the detailed rearrangement of low- and high-LET radiation induced chromosome aberrations in human epithelial cells (CH184B5F5/M10) in vitro, we performed a series of experiments with Cs-137 gamma rays of both low and high dose rates, neutrons of low dose rate and 600 MeV/u Fe ions of high dose rate, with chromosome 3 painted with multi-binding colors. We also compared the chromosome aberrations in both 2- and 3-dimensional cell cultures. Results of these experiments revealed the highest chromosome aberration frequencies after low dose rate neutron exposures. However, detailed analysis of the radiation induced inversions revealed that all three radiation types induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intra-chromosomal aberrations but few inversions were accompanied by inter-chromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both inter- and intrachromosomal exchanges. The location of the breaks involved in chromosome exchanges was analyzed along the painted chromosome. The breakpoint distribution was found to be randomly localized on chromosome 3 after neutron or Fe ion exposure, whereas non-random distribution with clustering breakpoints was observed after -ray exposure. Our comparison of chromosome aberration yields between 2- and 3-dimensional cell cultures indicated a significant difference for gamma exposures, but not for Fe ion exposures. These experimental results indicated that the track structure of the radiation and the cellular/chromosome structure can both affect radiation-induced chromosome aberrations.

  15. Effect of SPE-like Proton or Photon Radiation on the Kinetics of Mouse Peripheral Blood Cells and Radiation Biological Effectiveness Determinations

    PubMed Central

    Romero-Weaver, A.L.; Wan, X.S.; Diffenderfer, E.S.; Lin, L.

    2013-01-01

    Abstract Exploration missions outside low-Earth orbit are being planned; therefore, it is critical to understand the risk astronauts would be exposed to in the space environment, especially during extravehicular activities (EVAs). Reductions in white blood cell (WBC) numbers can occur as a result of exposure to solar particle event (SPE) radiation. The aim of the present study was to determine the duration of the effects on blood cell numbers from exposure to a single whole-body dose of SPE-like proton radiation or photon radiation as well as to determine the radiation biological effectiveness (RBE) values at those times when radiation exposure causes blood cell numbers to experience the most critical effects when using mice as a model. Our results indicate that both types of radiation cause significant reductions in the numbers of all blood cell types at different times post-irradiation. The RBE values were not significantly different from 1.0. These results indicate that the risk estimations for astronauts from exposure of mice to SPE-like proton radiation are comparable to those previously made for doses of standard reference radiations, suggesting that countermeasures should be developed for the decreases in blood cell counts observed following the exposure of mice to SPE radiation. Key Words: Proton radiationGamma radiationBlood cell countsSolar particle event. Astrobiology 13, 570577. PMID:23980767

  16. Effect of Gender on the Radiation Sensitivity of Murine Blood Cells

    PubMed Central

    Billings, Paul C; Romero-Weaver, Ana L; Kennedy, Ann R

    2014-01-01

    Space travel beyond the Earth’s protective magnetosphere risks exposing astronauts to ionizing radiation, such as that generated during a solar particle event (SPE). Ionizing radiation has well documented effects on blood cells and it is generally assumed that these effects contribute to the hematopoietic syndrome (HS), observed in animals and humans, following exposure to total body irradiation (TBI). The purpose of the current study was to assess the role of gender on the effects of gamma radiation on blood cells. C3H/HeN mice were irradiated with a 137Cs gamma source. Radiation had similar effects on white blood cells (WBCs), lymphocytes, and granulocytes in male and female C3H/HeN mice, while red blood cell (RBC) counts and hematocrit values remained stable following radiation exposure. Non-irradiated male mice had 13% higher platelet counts, compared with their female counterparts, and showed enhanced recovery of platelets on day 16 following radiation exposure. Hence, gender differences influence the response of platelets to TBI exposure. PMID:25221782

  17. Effect of Gender on the Radiation Sensitivity of Murine Blood Cells.

    PubMed

    Billings, Paul C; Romero-Weaver, Ana L; Kennedy, Ann R

    2014-08-01

    Space travel beyond the Earth's protective magnetosphere risks exposing astronauts to ionizing radiation, such as that generated during a solar particle event (SPE). Ionizing radiation has well documented effects on blood cells and it is generally assumed that these effects contribute to the hematopoietic syndrome (HS), observed in animals and humans, following exposure to total body irradiation (TBI). The purpose of the current study was to assess the role of gender on the effects of gamma radiation on blood cells. C3H/HeN mice were irradiated with a (137)Cs gamma source. Radiation had similar effects on white blood cells (WBCs), lymphocytes, and granulocytes in male and female C3H/HeN mice, while red blood cell (RBC) counts and hematocrit values remained stable following radiation exposure. Non-irradiated male mice had 13% higher platelet counts, compared with their female counterparts, and showed enhanced recovery of platelets on day 16 following radiation exposure. Hence, gender differences influence the response of platelets to TBI exposure. PMID:25221782

  18. Radiation-induced degradation of cyclohexanebutyric acid in aqueous solutions by gamma ray irradiation

    NASA Astrophysics Data System (ADS)

    Jia, Wenbao; He, Yanquan; Ling, Yongsheng; Hei, Daqian; Shan, Qing; Zhang, Yan; Li, Jiatong

    2015-04-01

    The radiation-induced degradation of cyclohexanebutyric acid under gamma ray irradiation was investigated. Degradation experiments were performed with 100 mL sealed Pyrex glass vessels loaded with 80 mL of cyclohexanebutyric acid solutions at various initial concentrations of 10, 20, and 40 mg L-1. The absorbed doses were controlled at 0, 0.65, 1.95, 3.25, 6.5, 9.75, and 13 kGy. The results showed that gamma ray irradiation could effectively degrade cyclohexanebutyric acid in aqueous solutions. The removal rate of cyclohexanebutyric acid increased significantly with the increase of absorbed dose and the decrease of its initial concentration. At the same time, the removal of chemical oxygen demand (COD) was as effective as that of cyclohexanebutyric acid. The kinetic studies showed that the degradation of cyclohexanebutyric acid followed pseudo first-order reaction. Above all, the proposed mechanism obtained when NaNO2, NaNO3 and tert-butanol were added showed that the OH radical played a major role in the gamma degradation process of cyclohexanebutyric acid, while H and eaq- played a minor role in the gamma degradation process. The degradation products were identified by Fourier transform infrared spectroscopy (FTIR) and gas chromatography/mass spectrometry (GC/MS) during cyclohexanebutyric acid degradation.

  19. Effect of gamma radiation on growth and survival of common seed-borne fungi in India

    NASA Astrophysics Data System (ADS)

    Maity, J. P.; Chakraborty, A.; Chanda, S.; Santra, S. C.

    2008-07-01

    The present work describes radiation-induced effects of major seeds like Oryza sativa Cv-2233, Oryza sativa Cv-Shankar, Cicer arietinum Cv-local and seed-borne fungi like Alternaria sp., Aspergillus sp., Trichoderma sp. and Curvularia sp. 60Co gamma source at 25 °C emitting gamma ray at 1173 and 1332 keV energy was used for irradiation. Dose of gamma irradiation up to 3 kGy (0.12 kGy/h) was applied for exposing the seed and fungal spores. Significant depletion of the fungal population was noted with irradiation at 1-2 kGy, whereas germinating potential of the treated grain did not alter significantly. However, significant differential radiation response in delayed seed germination, colony formation of the fungal spores and their depletion of growth were noticed in a dose-dependent manner. The depletion of the fungal viability (germination) was noted within the irradiation dose range of 1-2 kGy for Alternaria sp. and Aspergillus sp., while 0.5-1 kGy for Trichoderma sp. and Curvularia sp. However, complete inhibition of all the selected fungi was observed above 2.5 kGy.

  20. Attenuation of X and Gamma Rays in Personal Radiation Shielding Protective Clothing.

    PubMed

    Kozlovska, Michaela; Cerny, Radek; Otahal, Petr

    2015-11-01

    A collection of personal radiation shielding protective clothing, suitable for use in case of accidents in nuclear facilities or radiological emergency situations involving radioactive agents, was gathered and tested at the Nuclear Protection Department of the National Institute for Nuclear, Chemical and Biological Protection, Czech Republic. Attenuating qualities of shielding layers in individual protective clothing were tested via spectra measurement of x and gamma rays, penetrating them. The rays originated from different radionuclide point sources, the gamma ray energies of which cover a broad energy range. The spectra were measured by handheld spectrometers, both scintillation and High Purity Germanium. Different narrow beam geometries were adjusted using a special testing bench and a set of various collimators. The main experimentally determined quantity for individual samples of personal radiation shielding protective clothing was x and gamma rays attenuation for significant energies of the spectra. The attenuation was assessed comparing net peak areas (after background subtraction) in spectra, where a tested sample was placed between the source and the detector, and corresponding net peak areas in spectra, measured without the sample. Mass attenuation coefficients, which describe attenuating qualities of shielding layers materials in individual samples, together with corresponding lead equivalents, were determined as well. Experimentally assessed mass attenuation coefficients of the samples were compared to the referred ones for individual heavy metals. PMID:26425983

  1. Random amplified polymorphic DNA analysis of salt-tolerant tobacco mutants generated by gamma radiation.

    PubMed

    elik, ; Atak,

    2015-01-01

    Salinity is one of the major problems limiting the yield of agricultural products. Radiation mutagenesis is used to improve salt-tolerant mutant plants. In this study, we aimed to improve salt-tolerant mutants of two oriental tobacco varieties. One thousand seeds of each variety (M?) were irradiated with 100, 200, 300, and 400 Gy gamma rays by Cs-137 gamma. In the M? generation, 2999 single plants were harvested. The next season, these seeds were bulked and planted to obtain M? progeny. The seeds of 1900 M? plants were picked separately. Salinity tolerance was tested in the M? generation. Among M? plantlets, 10 salt-tolerant tobacco mutants were selected. According to the results of the selection studies, 100- and 200-Gy gamma radiation doses were the effective doses to obtain the desired mutants. Glutathione reductase enzyme activities of salt-tolerant tobacco mutants were determined biochemically as a stress-tolerance marker. The differences between control and salt-tolerant mutants belonging to the Akhisar 97 and ?zmir zba? tobacco varieties were evaluated by random amplified polymorphic DNA analysis. The total polymorphism rate was 73.91%. PMID:25730072

  2. Measurements of gamma radiation levels and spectra in the San Francisco Bay Area

    NASA Astrophysics Data System (ADS)

    Lo, B. T.; Brozek, K. P.; Angell, C. T.; Norman, E. B.

    2011-10-01

    Much of the radiation received by an average person is emitted by naturally-occurring radioactive isotopes from the thorium, actinium, and uranium decay series, or potassium. In this study, we have measured gamma radiation levels at various locations in the San Francisco Bay Area and the UC Berkeley campus from spectra taken using an ORTEC NOMAD portable data acquisition system and a large-volume coaxial HPGe detector. We have identified a large number of gamma rays originating from natural sources. The most noticeable isotopes are 214Bi, 40K, and 208Tl. We have observed variations in counting rates by factors of two to five between different locations due to differences in local conditions - such as building, concrete, grass, and soil compositions. In addition, in a number of outdoor locations, we have observed 604-, 662-, and 795-keV gamma rays from 134,137Cs, which we attribute to fallout from the recent Fukushima reactor accident. The implications of these results will be discussed. This work was supported in part by a grant from the U. S. Dept. of Homeland Security.

  3. Fatigue performance of ultra-high-molecular-weight polyethylene: effect of gamma radiation sterilization.

    PubMed

    Sauer, W L; Weaver, K D; Beals, N B

    1996-10-01

    Ultra-high-molecular-weight polyethylene (UHMWPE) failure presents a significant materials concern in the orthopaedic community. Clinical failure following joint arthroplasty can result from the biological response to wear debris as well as structural failure owing to UHMWPE fatigue. In this study, cantilever rotating beam fatigue testing was conducted on GUR 415 UHMWPE in both the unsterilized and gamma radiation sterilized conditions. Calculations of flexural fatigue stresses were based on extreme fibre stresses and assumed negligible plastic deformation. Both material conditions exhibited similar fatigue strengths at 250,000 cycles (approximately 41 MPa) and at one million cycles (approximately 36 MPa), but a large difference developed after two million cycles. At ten million cycles, the unsterilized condition exhibited a fatigue strength of approximately 31 MPa, while the gamma-sterilized condition exhibited a reduced fatigue strength of approximately 18 MPa, an approximate decrease of 42%. High-cycle fatigue testing was necessary to fully characterize this behaviour owing to the pronounced difference in fatigue behaviour beyond two million cycles. These results suggest that gamma radiation sterilization of UHMWPE medical implants reduces their resistance to cyclic loading and, subsequently, may contribute to the associated fatigue-related failures which have been reported clinically. PMID:8894083

  4. Verification by the FISH translocation assay of historic doses to Mayak workers from external gamma radiation.

    PubMed

    Sotnik, Natalia V; Azizova, Tamara V; Darroudi, Firouz; Ainsbury, Elizabeth A; Moquet, Jayne E; Fomina, Janna; Lloyd, David C; Hone, Pat A; Edwards, Alan A

    2015-11-01

    The aim of this study was to apply the fluorescence in situ hybridization (FISH) translocation assay in combination with chromosome painting of peripheral blood lymphocytes for retrospective biological dosimetry of Mayak nuclear power plant workers exposed chronically to external gamma radiation. These data were compared with physical dose estimates based on monitoring with badge dosimeters throughout each person's working life. Chromosome translocation yields for 94 workers of the Mayak production association were measured in three laboratories: Southern Urals Biophysics Institute, Leiden University Medical Center and the former Health Protection Agency of the UK (hereinafter Public Health England). The results of the study demonstrated that the FISH-based translocation assay in workers with prolonged (chronic) occupational gamma-ray exposure was a reliable biological dosimeter even many years after radiation exposure. Cytogenetic estimates of red bone marrow doses from external gamma rays were reasonably consistent with dose measurements based on film badge readings successfully validated in dosimetry system "Doses-2005" by FISH, within the bounds of the associated uncertainties. PMID:26319788

  5. Terrestrial gamma radiation dose rate in Ryukyu Islands, subtropical region of Japan.

    PubMed

    Furukawa, M; Kina, S; Shiroma, M; Shiroma, Y; Masuda, N; Motomura, D; Hiraoka, H; Fujioka, S; Kawakami, T; Yasuda, Y; Arakawa, K; Fukahori, K; Jyunicho, M; Ishikawa, S; Ohomoto, T; Shingaki, R; Akata, N; Zhuo, W; Tokonami, S

    2015-11-01

    In order to explain the distribution of natural radiation level in the Asia, in situ measurements of dose rate in air due to terrestrial gamma radiation have been conducted in a total of 21 islands that belong to Ryukyu Islands (Ryukyu Archipelago), subtropical rejoin of southwest Japan. Car-borne surveys have also been carried out in Okinawa-jima, the biggest island of the archipelago. Based on the results for these measurements, arithmetic mean, the maximum and the minimum of the dose rates at 1 m in height from the unpaved soil ground in the archipelago were estimated to be 47, 165 and 8 nGy h(-1), respectively. A comparative study of car-borne data obtained prior to and subsequent to the 2011 Fukushima nuclear accident, as for Okinawa-jima, indicated that the nuclear accident has no impact on the environmental radiation at the present time. PMID:26065703

  6. Gravitational Radiations from the Precession Central Engine in Gamma-Ray Bursts

    NASA Astrophysics Data System (ADS)

    Sun, Mou-Yuan; Liu, Tong; Gu, Wei-Min; Lu, Ju-Fu

    2013-01-01

    The ultra-relativistic precessing jet in gamma-ray bursts (GRBs) may be responsible for the complex structure in GRBs' light curves. In this work, we study the gravitational radiations of jet precession induced by neutrino-dominated accretion disks around black holes. In our model, the jet and the inner part of the disk may precess along with the black hole, which is driven by the outer part of the disk. Gravitational radiations are therefore expected to be significant from this precession system. Based our numerical results, we find that it is possible for DECIGO and BBO to detect such gravitational radiations regardless of GRBs' black hole masses, particularly for GRBs in the Local Group.

  7. a Study of the Characteristics of High-Energy Gamma Radiation Following the Fusion of CHLORINE-35 + Iron -54.

    NASA Astrophysics Data System (ADS)

    Herman, Michael Gordon

    The characteristics of high energy gamma radiation from the decay of heavy-ion fusion induced compound nucleus formation are investigated. The compound nucleus of ('89)Tc was formed with a ('35)Cl projectile and an ('54)Fe target. Laboratory energies ranged from the Coulomb barrier to the fission limit. The highest energy photons are believed to result from the decay of giant resonances built on lower lying excited nuclear states. The origin of these transitions and their relationship to the structure of the excited nucleus are discussed. Measurements using a 4(pi) NaI sum spectrometer, two small solid-angle NaI gamma detectors and a recoil mass spectrometer yielded gamma strength, average gamma multiplicity, total gamma cascade energy, multiplicity as a function of gamma ray energy, fusion cross sections and the above stated gamma quantities gated by residual mass. Evidence for statistical emission of high energy gamma rays following equilibrated compound nucleus fusion is presented. The dependence of the Giant Dipole resonance characteristics on angular momentum and excitation energy is deduced. Competition between high energy gamma decay and particle evaporation is observed. The statistical model treatment of compound nucleus formation and decay is compared to the data using the computer code CASCADE. Significantly higher than average multiplicities for the highest energy photons can not be reproduced by the statistical model. The possibility of spin dependent radiative capture or GDR coupling to a non-Yrast band is discussed.

  8. Induced ICER I{gamma} down-regulates cyclin A expression and cell proliferation in insulin-producing {beta} cells

    SciTech Connect

    Inada, Akari; Weir, Gordon C.; Bonner-Weir, Susan . E-mail: susan.bonner-weir@joslin.harvard.edu

    2005-04-15

    We have previously found that cyclin A expression is markedly reduced in pancreatic {beta}-cells by cell-specific overexpression of repressor inducible cyclic AMP early repressor (ICER I{gamma}) in transgenic mice. Here we further examined regulatory effects of ICER I{gamma} on cyclin A gene expression using Min6 cells, an insulin-producing cell line. The cyclin A promoter luciferase assay showed that ICER I{gamma} directly repressed cyclin A gene transcription. In addition, upon ICER I{gamma} overexpression, cyclin A mRNA levels markedly decreased, thereby confirming an inhibitory effect of ICER I{gamma} on cyclin A expression. Suppression of cyclin A results in inhibition of BrdU incorporation. Under normal culture conditions endogenous cyclin A is abundant in these cells, whereas ICER is hardly detectable. However, serum starvation of Min6 cells induces ICER I{gamma} expression with a concomitant very low expression level of cyclin A. Cyclin A protein is not expressed unless the cells are in active DNA replication. These results indicate a potentially important anti-proliferative effect of ICER I{gamma} in pancreatic {beta} cells. Since ICER I{gamma} is greatly increased in diabetes as well as in FFA- or high glucose-treated islets, this effect may in part exacerbate diabetes by limiting {beta}-cell proliferation.

  9. Inhibition of radiation-enhanced expression of integrin and metastatic potential in B16 melanoma cells by a lipoxygenase inhibitor

    SciTech Connect

    Onoda, J.M.; Honn, K.V. |; Kantak, S.S.; Piechocki, M.P.; Awad, W.; Chea, R.; Liu, B.

    1994-12-01

    Low-dose {gamma} radiation stimulates expression of phenotypic characteristics in B16 melanoma cells which regulate metastatic potential. A transient increase in the expression of an integrin receptor ({alpha}{sub IIb}{beta}{sub 3}) was observed after exposure of B16 melanoma cells to 0.25 to 2.0 Gy of {gamma} radiation. This increased receptor expression resulted in enhanced adhesion of tumor cells to fibronectin in vitro and increased experimentally induced metastasis in vivo. In this report, we determined a role for the 12-lipoxygenase metabolite, 12-HETE, in radiation-enhanced metastasis. A significant increase in biosynthesis of 12-HETE in B16 melanoma cells was detected <5 min after exposure to 0.5 Gy {gamma} radiation. We then determined that radiation-enhanced expression of {alpha}{sub IIb}{beta}{sub 3} integrin and adhesion of B16 melanoma cells to fibronectin in vitro and metastasis in vivo were reduced by treatment of the cells with the lipoxygenase inhibitor NDGA prior to irradiation. These findings suggest that low-dose radiation, at levels comparable to those used in fractionated or hyperfractionated radiotherapy, increases the metastatic potential of surviving tumor cells via a rapid and transient alteration in lipoxygenase metabolism of arachidonic acid and surface expression of an integrin receptor. 30 refs., 5 figs., 1 tab.

  10. CCL20, (gamma)(delta) T cells, and IL-22 in corneal epithelial healing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    After corneal epithelial abrasion, leukocytes and platelets rapidly enter the corneal stroma, and CCR6 (+) IL-17(+) gamma delta T cells migrate into the epithelium. Gamma delta T-cell-deficient (TCRd(-/-)) mice have significantly reduced inflammation and epithelial wound healing. Epithelial CCL20 mR...

  11. Complete suppression of reverse annealing of neutron radiation damage during active gamma irradiation in MCZ Si detectors

    NASA Astrophysics Data System (ADS)

    Li, Z.; Verbitskaya, E.; Chen, W.; Eremin, V.; Gul, R.; Hrknen, J.; Hoeferkamp, M.; Kierstead, J.; Metcalfe, J.; Seidel, S.

    2013-01-01

    For the development of radiation-hard Si detectors for the SiD BeamCal (Si Detector Beam Calorimeter) program for International Linear Collider (ILC), n-type Magnetic Czochralski Si detectors have been irradiated first by fast neutrons to fluences of 1.51014 and 31014 neq/cm2, and then by gamma up to 500 Mrad. The motivation of this mixed radiation project is to test the radiation hardness of MCZ detectors that may utilize the gamma/electron radiation to compensate the negative effects caused by neutron irradiation, all of which exists in the ILC radiation environment. By using the positive space charge created by gamma radiation in MCZ Si detectors, one can cancel the negative space charge created by neutrons, thus reducing the overall net space charge density and therefore the full depletion voltage of the detector. It has been found that gamma radiation has suppressed the room temperature reverse annealing in neutron-irradiated detectors during the 5.5 month of time needed to reach a radiation dose of 500 Mrad. The room temperature annealing (RTA) was verified in control samples (irradiated to the same neutron fluences, but going through this 5.5 month RTA without gamma radiation). This suppression is in agreement with our previous predictions, since negative space charge generated during the reverse annealing was suppressed by positive space charge induced by gamma radiation. The effect is that regardless of the received neutron fluence the reverse annealing is totally suppressed by the same dose of gamma rays (500 Mrad). It has been found that the full depletion voltage for the two detectors irradiated to two different neutron fluences stays the same before and after gamma radiation. Meanwhile, for the control samples also irradiated to two different neutron fluences, full depletion voltages have gone up during this period. The increase in full depletion voltage in the control samples corresponds to the generation of negative space charge, and this increase in concentration of negative space charge goes up with the neutron fluence. If we assume the reverse annealing is also taking place for the two gamma-irradiated samples with similarly different concentrations of negative space charge generated, the observed effect of no changes in space charge (no changes in Vfd) in these two gamma-irradiated samples would imply that concentrations of positive space charge created in these two control samples are different at the same gamma dose, and gamma irradiation effectively "switched off", the RT (room temperature) reverse annealing of neutron irradiation. It has also been found that as soon as the gamma irradiation stops, the RT reverse annealing of neutron irradiation-induced defects resumes with same rate as that of the control detectors. This behavior in mixed radiation samples (neutron plus gamma) would suggest some nonlinear effect (defects induced by mixed-radiations are not additive of those by individual radiation alone), or interaction of radiation induced acceptor-type and donor-type defects.

  12. [Malignant transformation of human fibroblasts by neutrons and by gamma radiation: Relationship to mutations induced

    SciTech Connect

    1993-12-31

    A brief overview if provided of selected reports presented at the International Symposium on Molecular Mechanisms of Radiation- and Chemical Carcinogen-Induced Cell Transformation held at Mackinac Island, Michigan on September 19-23, 1993.

  13. Caffeine sensitization of cultured mammalian cells and human lymphocytes irradiated with gamma rays and fast neutrons: a study of relative biological effectiveness in relation to cellular repair

    SciTech Connect

    Hannan, M.A.; Gibson, D.P.

    1985-10-01

    The sensitizing effects of caffeine were studied in baby hamster kidney (BHK-21) cells and human lymphocytes following irradiation with gamma rays and fast neutrons. Caffeine sensitization occurred only when log-phase BHK cells and mitogen-stimulated lymphocytes were exposed to the two radiations. Noncycling (confluent) cells of BHK resulted in a shouldered survival curve following gamma irradiation while a biphasic curve was obtained with the log-phase cells. Survival in the case of lymphocytes was estimated by measurement of (TH)thymidine uptake. The relative biological effectiveness (RBE) of fast neutrons was found to be greater at survival levels corresponding to the resistant portions of the survival curves (shoulder or resistant tail). In both cell types, no reduction in RBE was observed when caffeine was present, because caffeine affected both gamma and neutron survival by the same proportion.

  14. Radiative-neutron-capture gamma-ray analysis by a linear combination technique

    USGS Publications Warehouse

    Tanner, A.B.; Bhargava, R.C.; Senftle, F.E.; Brinkerhoff, J.M.

    1972-01-01

    The linear combination technique, when applied to a gamma-ray spectrum, gives a single number indicative of the extent to which the spectral lines of a sought element are present in a complex spectrum. Spectra are taken of the sought element and of various other substances whose spectra interfere with that of the sought element. A weighting function is then computed for application to spectra of unknown materials. The technique was used to determine calcium by radiative-neutron-capture gamma-ray analysis in the presence of interfering elements, notably titanium, and the results were compared with those for two popular methods of peak area integration. Although linearity of response was similar for the methods, the linear combination technique was much better at rejecting interferences. For analyses involving mixtures of unknown composition the technique consequently offers improved sensitivity. ?? 1972.

  15. Gamma-ray escape peak characteristics of radiation-damaged reverse-electrode germanium coaxial detectors

    NASA Astrophysics Data System (ADS)

    Pehl, Richard H.; Hull, Ethan L.; Madden, Norman W.; Xing, Jingshu; Friesel, Dennis L.

    1996-02-01

    A comparison of the characteristics of full-energy gamma-ray peaks and their corresponding escape peaks when high energy photons interact in radiation damaged reverse-electrode (n-type) germanium coaxial detectors is presented. Coaxial detector geometry is the dominant factor, causing charge collection to be dramatically better for interactions occurring near the outer periphery of the detector as well as increasing of the probability of escape events occurring in this region. It follows that the resolution of escape peaks is better than that of ordinary gamma-ray peaks. This is experimentally verified. A nearly identical but undamaged detector exhibited significant Doppler broadening of single escape peaks. Because double escape events preferentially occur at outer radii, energy shifts of double escape reflect extremely small amounts of charge trapping in undamaged detectors.

  16. Gamma-Ray Escape Peak Characteristics of Radiation Damaged Reverse-Electrode Germanium Detectors

    NASA Astrophysics Data System (ADS)

    Hull, E. L.; Xing, J. S.; Friesel, D. L.; Pehl, R. H.; Madden, N. M.

    1996-05-01

    A comparison between the characteristics of escape peaks and ordinary, multiple Compton and photoelectrically interacting, full-energy gamma-ray peaks from radiation damaged reverse-electrode (n-type) germanium coaxial detectors is presented. Coaxial detector geometry is the dominant factor, causing charge collection to be dramatically better near the outer periphery of the detector as well as increasing the probability of escape events occurring in this region. It follows that the resolution of escape peaks is better than that of ordinary gamma-ray peaks. This is experimentally verified. However, a nearly identical but undamaged detector exhibited significant Doppler broadening of single escape peaks. Because double escape events preferentially occur at outer radii, energy shifts in double escape peaks reflect extremely small amounts of charge trapping.

  17. Thermoluminescence behavior of KClXBr1-X: In mixed crystals exposed to gamma radiation

    NASA Astrophysics Data System (ADS)

    Rezaee Ebrahim Saraee, Kh.; Hosseini, S. A.; Faripour, H.; Faiez, M. R.; Abdi, M. R.; Soltani, N.; Aghay Khareiky, A.

    2014-09-01

    In-doped KClXBr1-X (X=1, 0.75, 0.5, 0.25 and 0) mixed crystal has been grown by the Czochralski method. The segregation coefficient of In was studied by the inductively coupled plasma atomic emission spectrometry (ICP-OES). The crystal structure has been determined using X-ray diffraction (XRD) analysis. The thermoluminescence (TL) characterization of KClXBr1-X mixed crystals, exposed to gamma radiation has been performed. The results show the introduction of the dopants ions induced changes in the TL glow curve structure. The TL results suggest that doped KClXBr1-X mixed crystal has good potential active dosimeter applications for gamma ray irradiation.

  18. Detection of DNA Damage by Space Radiation in Human Fibroblast Cells Flown on the International Space Station

    NASA Technical Reports Server (NTRS)

    Wu, Honglu; Lu, Tao; Wong, Michael; Beno, Jonathan; Countryman, Stefanie; Stodieck, Louis; Karouia, Fathi; Zhang, Ye

    2015-01-01

    Although charged particles in space have been detected with radiation detectors on board spacecraft since the early discovery of the Van Allen Belt, reports on effects of direct exposure to space radiation in biological systems have been limited. Measurement of biological effects of space radiation has been difficult due to the low dose and low dose rate nature of the radiation environment, and the difficulty in separating the radiation effects from microgravity and other space environmental factors. In astronauts, only a small number of changes, such as increased chromosome aberrations in lymphocytes and early onset of cataracts, attributed primarily to the exposure to space radiation. In a recent experiment, human fibroblast cells were flown on the International Space Station (ISS). Cells fixed on Days 3 and 14 after reaching orbit were analyzed for phosphorylation of a histone protein H2AX by immunofluorescent staining of cells, which is a widely used marker for DNA double strand breaks. The 3-dimensional gamma-H2AX foci were captured with a laser confocal microscope. Quantitative analysis revealed a small fraction of foci that were larger and displayed a track pattern in the flight samples in comparison to the ground control. Human fibroblast cells were also exposed to low dose rate gamma rays, as well as to protons and Fe ions. Comparison of the pattern and distribution of the foci after gamma ray and charged particle exposure to our flight results confirmed that the foci found in the flown cells were indeed induced by space radiation.

  19. Gallium Arsenide solar cell radiation damage experiment

    NASA Technical Reports Server (NTRS)

    Maurer, R. H.; Kinnison, J. D.; Herbert, G. A.; Meulenberg, A.

    1991-01-01

    Gallium arsenide (GaAs) solar cells for space applications from three different manufactures were irradiated with 10 MeV protons or 1 MeV electrons. The electrical performance of the cells was measured at several fluence levels and compared. Silicon cells were included for reference and comparison. All the GaAs cell types performed similarly throughout the testing and showed a 36 to 56 percent power areal density advantage over the silicon cells. Thinner (8-mil versus 12-mil) GaAs cells provide a significant weight reduction. The use of germanium (Ge) substrates to improve mechanical integrity can be implemented with little impact on end of life performance in a radiation environment.

  20. Gamma radiation and magnetic field mediated delay in effect of accelerated ageing of soybean.

    PubMed

    Kumar, Mahesh; Singh, Bhupinder; Ahuja, Sumedha; Dahuja, Anil; Anand, Anjali

    2015-08-01

    Soybean seeds were exposed to gamma radiation (0.5, 1, 3 and 5kGy), static magnetic field (50, 100 and 200 mT) and a combination of gamma radiation and magnetic energy (0.5kGy?+?200 mT and 5kGy?+?50 mT) and stored at room temperature for six months. These seeds were later subjected to accelerated ageing treatment at 42C temperature and 95-100% relative humidity and were compared for various physical and biochemical characteristics between the untreated and the energized treatments. Energy treatment protected the quality of stored seeds in terms of its protein and oil content . Accelerated aging conditions, however, affected the oil and protein quantity and quality of seed negatively. Antioxidant enzymes exhibited a decline in their activity during aging while the LOX activity, which reflects the rate of lipid peroxidation, in general, increased during the aging. Gamma irradiated (3 and 5kGy) and magnetic field treated seeds (100 and 200 mT) maintained a higher catalase and ascorbate peroxidase activity which may help in efficient scavenging of deleterious free radical produced during the aging. Aging caused peroxidative changes to lipids, which could be contributed to the loss of oil quality. Among the electromagnetic energy treatments, a dose of 1-5kGy of gamma and 100 mT, 200mT magnetic field effectively slowed the rate of biochemical degradation and loss of cellular integrity in seeds stored under conditions of accelerated aging and thus, protected the deterioration of seed quality. Energy combination treatments did not yield any additional protection advantage. PMID:26243899

  1. Protective effects of erdosteine against nephrotoxicity caused by gamma radiation in male albino rats.

    PubMed

    Elkady, A A; Ibrahim, I M

    2016-01-01

    The aim of this study was focused on investigating the possible protective effect of erdosteine against gamma radiation-induced renal lesions in male albino rats. Twenty-eight albino rats were divided into four equal groups as follows: control group, irradiated group (animals subjected to whole-body gamma irradiation at a dose of 5 Gy), treated group (each rat received 100 mg/kg body weight once daily, orally by gastric tube, erdosteine for 1 week), and treated irradiated group (each rat received 100 mg/kg body weight once daily, orally by gastric tube, erdosteine for 1 week, then exposed to whole-body gamma irradiation at a dose of 5 Gy). The results revealed that the administration of erdosteine to rats before irradiation significantly ameliorated the changes occurred in kidney function (creatinine and urea) compared with irradiated group. Also the changes in serum tumor necrosis factor ?, interleukin 1?, and interleukin 6 activities were markedly improved compared with the corresponding values of irradiated group. Kidney catalase and glutathione peroxidase (GPx) activities and reduced glutathione concentration showed approximately normal level when compared with the irradiated group. The histopathological results showed distinctive pattern of renal lesions in irradiated group, while in treated irradiated group the renal tissues showed relatively well-preserved architecture. Erdosteine acts in the kidney as a potent scavenger of free radicals to prevent or ameliorate the toxic effects of gamma irradiation as shown in the biochemical and histopathological changes and might provide substantial protection against radiation-induced inflammatory damage. PMID:25716170

  2. Induction of transpositions of MGE Dm412 by {gamma}-radiation in an isogenic line of Drosophila melanogaster

    SciTech Connect

    Zabanov, S.A.; Vasil`eva, L.A.; Ratner, V.A. |

    1995-06-01

    In an isogenic line of Drosophila, transpositions of mobile genetic elements (MGE) Dm412 were induced by {gamma}-radiation at doses of 300, 800, and 1300 R. The rates of induced transpositions were (for each dose, respectively) 3.9 x 10{sup {minus}3}, 1.0 x 10{sup {minus}2}, and 1.87 x 10{sup {minus}2} events per occupied site per haploid genome of the isogenic line per generation. Thus, the transposition rate increased linearly with the radiation dose. The specific rate of {gamma}-radiation-induced transpositions was (1.3 {+-} 0.6) x 10{sup {minus}5} per occupied site per haploid genome of the isogenic line per Roentgen per generation. {gamma}-Radiation-induced hot transposition sites and haplotypes, very similar to those induced by heat shock, were found. It was suggested that the mechanism of induction by {gamma}-radiation involves the heat shock system. Thus, it is more similar to the mechanism of temperature induction than to the direct mutational effect of {gamma}-radiation. Estimates of induced transposition rates per genome for each dose were calculated as 1.1, 3.0, and 5.6 events, respectively, per genome per generation. This level probably corresponds to the subthreshold level of genomes near the {open_quotes}catastrophic border of transpositional losses.{close_quotes} 21 refs., 1 fig., 4 tabs.

  3. Detailed characterization of gamma delta T cells within the organs in mice: classification into three groups.

    PubMed Central

    Sato, K; Ohtsuka, K; Watanabe, H; Asakura, H; Abo, T

    1993-01-01

    gamma delta T cells are known to localize preferentially in the epithelial regions and the hepatic sinusoids, and exhibit highly restricted V gene usage depending on their location. In the present study, gamma delta T cells in mice were further characterized in terms of their expression of the interleukin-2 receptor beta-chain (IL-2R beta), CD4 and CD8, and CD8 alpha and beta. This experiment was arranged to investigate whether gamma delta T cells have different properties depending on the organs and how gamma delta T cells are different from extrathymic alpha beta T cells, i.e. alpha beta T cells in the liver and intraepithelial lymphocytes in the intestine, in terms of the above phenotypes. Three-colour immunofluorescence tests using monoclonal antibodies revealed that gamma delta T cells can be classified into three groups: gamma delta T cells of the liver type are all IL-2R beta+, are comprised of double-negative (DN) CD8-CD4- and single-positive CD8+ (no CD4+) cells, and express CD8 alpha+ beta-; gamma delta T cells of the thymus type are a mixture of IL-2R beta+ and IL-2R beta-, are mainly DN, and express CD8 alpha+ beta+ if they carry CD8 antigens; and gamma delta T cells of the intestine type are also IL-2R beta+ or IL-2R beta-, are all CD8+, and express CD8 alpha+ beta-. gamma delta T cells in the spleen of normal mice are of the thymus type, while gamma delta T cells in the spleen of athymic nude mice seem to be of the liver type. All these properties of gamma delta T cells resemble those of extrathymic alpha beta T cells rather than regular alpha beta T cells of thymic origin. The present results reveal that gamma delta T cells and other extrathymic alpha beta T cells have many properties in common as primitive lymphocytes in phylogenetic development. PMID:8288314

  4. Mechanisms of linear energy transfer-dependent radiation resistance in myeloid leukemia cells

    NASA Astrophysics Data System (ADS)

    Haro, Kurtis John

    Ionizing radiations (IRs) of high linear energy transfer (LET), such as alpha particles, produce fundamentally different forms of DNA damage in cells than conventional low LET radiation, such as gamma rays. Alpha particle therapies have recently emerged as important potential treatments of cancer, particularly for relatively easily-accessible malignancies of the hematopoietic system. Therefore, we created stable radioresistant myeloid leukemia HL60 cell clones derived after irradiation from either gamma rays (RG) or alpha particles (RA) in order to understand whether resistance to high LET (IR) was possible and the potential differences in radioresistance that could arise from radiations of different LET. Repeated irradiations yielded radioresistant HL60 clones and, regardless of derivation, displayed similar levels of resistance to IR of either type of radiation. The resistant phenotype in each type of radioresistant clone was driven by similar, multifactorial changes that included significant reductions in apoptosis, a decreased late G2/M checkpoint accumulation that was indicative of increased genomic instability, as well as more robust repair of specific types of DNA lesions that included DNA double-strand breaks (DSBs). The relative changes in resistance to alpha particles, however, were substantially lower than the increase in resistance to gamma rays. The data suggest that these processes were interdependent, as inhibition of homology directed repair in the resistant clones sensitized them to gamma IR to a larger extent than naive HL60 cells. Finally, we identified the downregulation of iron regulatory protein 1 (IRP1) in gamma-resistant cells but not in alpha-resistant cells. Short-hairpin RNA-mediated reductions in expression of IRP1 in radiation-naive HL60 cells led to significant radioresistance to gamma rays, but not alpha particles. The IRP1-mediated radioresistance was associated with changes in iron-mediated oxidative stress that led to significant reductions in IR-induced apoptosis and faster DNA repair, and appeared to be specific to cytotoxic agents dependent on oxidative-type stress. The data suggest that many similarities exist between radioresistant cells derived from fundamentally different types of IR, but that there are also LET-specific changes in cellular adaptation to repeated IR exposure. The data also underscore the potent cytotoxicity of alpha particles and warrant their continued investigation as cancer therapies.

  5. Increase in bacteriophage radiation resistance as a result of enhanced expression of stress systems in host cells

    SciTech Connect

    Verbenko, V.N.; Kalinin, V.L.

    1995-12-01

    By means of polyacrylamide gel electrophoresis (PAGE) of proteins from radiation-resistant Gam{sup r} mutants of Escherichia coli, it was shown that induction and elimination of RecA protein in these mutants are kinetically more rapid than in wild type cells, and heat-shock proteins (HSP) are hyperproduced even at a normal temperature (32{degrees}C). {gamma}- and UV-irradiated bacteriophages were used to study the results of simultaneous enhanced expression of two stress repair systems. Radiation-resistant mutants are similar to wild type cells in their ability to reactivate phages {Lambda}cI, {phi}80 vir, and T4D inactivated by {gamma}-rays and UV-light. W-reactivation of {gamma}-irradiated phages {Lambda} and {phi}80 is respectively 1.5 and 1.2 times higher in Gam{sup r} cells in which maximal W-reactivation was observed at wide range of doses (from 300 to 2000 Gy), whereas in wild type cells the peak C of W-reactivation was registered at doses of 400 to 450 Gy. The phage {Lambda}, {gamma}-irradiated upon adsorption on the cells of a radiation-resistant mutant, was two times more resistant to {gamma}-rays (DMF = 2 at LD{sub 10}) than when irradiated upon adsorption on wild type cells. Postirradiation degradation of the phage {Lambda} DNA, when irradiated within Gam{sup r} cells, was significantly lower than in wild type cells, and preirradiation of the cells decreased phage DNA degradation (12% in Gam{sup r} cells and 30% in wild-type cells). The role of an increased HSP level and expression of SOS-regulon in radiation resistance and possible interaction of stress systems in bacterial cells are discussed. 18 refs., 6 figs.

  6. Airborne gamma radiation measurements of soil moisture during FIFE: Activities and results

    NASA Technical Reports Server (NTRS)

    Peck, Eugene L.

    1992-01-01

    Soil moisture measurements were obtained during the summer of 1987 and 1989 near Manhattan, Kansas, using the National Weather Service (NWS) airborne gamma radiation system. A network of 24 flight lines were established over the research area. Airborne surveys were flown daily during two intensive field campaigns. The data collected was sufficient to modify the NWS standard operational method for estimating soil moisture for the Field Experiment (FIFE) flight lines. The average root mean square error of the soil moisture estimates for shorter FIFE flight lines was found to be 2.5 percent, compared with a reported value of 3.9 percent for NWS flight lines. Techniques were developed to compute soil moisture estimates for portions of the flight lines. Results of comparisons of the airborne gamma radiation soil moisture estimates with those obtained using the NASA Pushbroom Microwave Radiation (PBMR) system and hydrological model are presented. The airborne soil moisture measurements, and real averages computed using all remotely sensed and ground data, have been in support of the research of the many FIFE investigators whose overall goal was the upscale integration of models and the application of satellite remote sensing.

  7. Size Effects on Gamma Radiation Response of Magnetic Properties of Barium Hexaferrite Powders

    SciTech Connect

    McCloy, John S.; Kukkadapu, Ravi K.; Crum, Jarrod V.; Johnson, Bradley R.; Droubay, Timothy C.

    2011-12-08

    Little is currently known about the effects of gamma-ray irradiation on oxide magnet materials. In particular, the effect of particle size on radiation susceptibility was investigated. Two commercial powders of BaFe12O19 were thoroughly characterized, then exposed to 1 MGy of gamma radiation from a 60Co source. AC susceptibility and DC magnetometry and Mssbauer spectroscopy were performed after irradiation and compared to pre-irradiated measurements. DC magnetization and AC susceptibility decreased for both samples with the relative change of DC magnetization being larger for the micrometer-sized particles and the relative change of the AC susceptibility being larger for the nanometer-sized particles. Mssbauer spectroscopy indicated a decrease in both the hyperfine fieldsand in the distribution of hyperfine fields for each Fe site, particularly in the larger particle sample. Decreases in susceptibility are believed to be due to recrystallization of the particles and redistribution of an amorphous component, in the bulk or on the surface, and consequent reduction in the particle magnetic moment. This radiation damage mechanism is different than that seen in previous studies of neutron and heavy ion irradiation of BaFe12O19.

  8. Effect of gamma radiation on chlorobutyl rubber vulcanized by three different crosslinking systems

    NASA Astrophysics Data System (ADS)

    Scagliusi, Sandra R.; Cardoso, Elisabeth L. C.; Lugao, Ademar B.

    2012-09-01

    The development of halogenated butyl rubber (chlorobutyl) in the 1950s and 1960s greatly extended the usefulness of butyl. Their properties allowed the development of more durable tubeless tires with the air retaining innerliner, chemically bonded to the body of the tire. Tire innerliners are by far the largest application for halobutyl. When polymers are subjected to high energy radiation, a number of chemical reactions may occur following the initial ionization and excitation events. These reactions lead to changes in the molecular weight of the polymer through scission (S) and crosslinking (X) of the molecules and affect the physical and mechanical properties. In the halobutyl rubbers the chain scission may predominate. This work aims to show effects of gamma radiation in properties of chlorobutyl rubbers vulcanized with sulfur, sulfur donor and phenolic resin. The butyl rubber has been already studied by us previously. The samples were characterized before and after irradiation. Gamma radiation doses used were: 25 kGy, 50 kGy, 100 kGy, 150 kGy and 200 kGy, in order to identify which cure system is the most stable under irradiation. In this study we observed that the properties of all samples were affected irrespective of the vulcanization system.

  9. Radiation induced genomic instability in bystander cells

    NASA Astrophysics Data System (ADS)

    Zhou, H.; Gu, S.; Randers-Pehrson, G.; Hei, T.

    There is considerable evidence that exposure to ionizing radiation may induce a heritable genomic instability that leads to a persisting increased frequency of genetic and functional changes in the non-irradiated progeny of a wide variety of irradiated cells Genomic instability is measured as delayed expressions in chromosomal alterations micronucleus formation gene mutations and decreased plating efficiency During the last decade numerous studies have shown that radiation could induce bystander effect in non-irradiated neighboring cells similar endpoints have also been used in genomic instability studies Both genomic instability and the bystander effect are phenomena that result in a paradigm shift in our understanding of radiation biology In the past it seemed reasonable to assume that the production of single- and double-strand DNA breaks are due to direct energy deposition of energy by a charged particle to the nucleus It turns out that biology is not quite that simple Using the Columbia University charged particle microbeam and the highly sensitive human hamster hybrid AL cell mutagenic assay we irradiated 10 of the cells with a lethal dose of 30 alpha particles through the nucleus After overnight incubation the remaining viable bystander cells were replated in dishes for colony formation Clonal isolates were expanded and cultured for 6 consecutive weeks to assess plating efficiency and mutation frequency Preliminary results indicated that there was no significant decrease in plating efficiency among the bystander colonies when compared with

  10. The Effects of Ionizing Radiation on Mammalian Cells.

    ERIC Educational Resources Information Center

    Biaglow, John E.

    1981-01-01

    Discusses the effects of radiation on dividing cells and factors influencing these effects; also briefly reviews the radical mechanism for radiation damage. Emphasizes the importance of oxygen in radiation effects. (CS)

  11. Study of radiation dose induced by cosmic-ray origin low-energy gamma rays and electrons near sea level

    NASA Astrophysics Data System (ADS)

    Mrdja, D.; Bikit, I.; Bikit, K.; Slivka, J.; Anicin, I.

    2015-02-01

    For a long time, it has been known that low-energy continuous gamma radiation is present in open air at the Earth's surface. In previous investigations it was assumed that this radiation is produced almost exclusively by gamma photons emitted due to the natural radioactivity, which are backscattered by air above ground. We show that significant amount of this radiation (related to energy region 30-300 keV) that peaks at about 90 keV, is produced by cosmic-rays, with the photon flux of about 3000 m-2 s-1. We find that the contribution of this omnipresent low-energy gamma radiation of cosmic-ray origin, including the corresponding low-energy electron flux, to the doses of general population are non-negligible components of overall doses induced by cosmic rays near sea level.

  12. A broadband gamma-ray spectrometry using novel unfolding algorithms for characterization of laser wakefield-generated betatron radiation

    NASA Astrophysics Data System (ADS)

    Jeon, Jong Ho; Nakajima, Kazuhisa; Kim, Hyung Taek; Rhee, Yong Joo; Pathak, Vishwa Bandhu; Cho, Myung Hoon; Shin, Jung Hun; Yoo, Byung Ju; Hojbota, Calin; Jo, Sung Ha; Shin, Kang Woo; Sung, Jae Hee; Lee, Seung Ku; Cho, Byeoung Ick; Choi, Il Woo; Nam, Chang Hee

    2015-12-01

    We present a high-flux, broadband gamma-ray spectrometry capable of characterizing the betatron radiation spectrum over the photon energy range from 10 keV to 20 MeV with respect to the peak photon energy, spectral bandwidth, and unique discrimination from background radiations, using a differential filtering spectrometer and the unfolding procedure based on the Monte Carlo code GEANT4. These properties are experimentally verified by measuring betatron radiation from a cm-scale laser wakefield accelerator (LWFA) driven by a 1-PW laser, using a differential filtering spectrometer consisting of a 15-filter and image plate stack. The gamma-ray spectra were derived by unfolding the photostimulated luminescence (PSL) values recorded on the image plates, using the spectrometer response matrix modeled with the Monte Carlo code GEANT4. The accuracy of unfolded betatron radiation spectra was assessed by unfolding the test PSL data simulated with GEANT4, showing an ambiguity of less than 20% and clear discrimination from the background radiation with less than 10%. The spectral analysis of betatron radiation from laser wakefield-accelerated electron beams with energies up to 3 GeV revealed radiation spectra characterized by synchrotron radiation with the critical photon energy up to 7 MeV. The gamma-ray spectrometer and unfolding method presented here facilitate an in-depth understanding of betatron radiation from LWFA process and a novel radiation source of high-quality photon beams in the MeV regime.

  13. A broadband gamma-ray spectrometry using novel unfolding algorithms for characterization of laser wakefield-generated betatron radiation.

    PubMed

    Jeon, Jong Ho; Nakajima, Kazuhisa; Kim, Hyung Taek; Rhee, Yong Joo; Pathak, Vishwa Bandhu; Cho, Myung Hoon; Shin, Jung Hun; Yoo, Byung Ju; Hojbota, Calin; Jo, Sung Ha; Shin, Kang Woo; Sung, Jae Hee; Lee, Seung Ku; Cho, Byeoung Ick; Choi, Il Woo; Nam, Chang Hee

    2015-12-01

    We present a high-flux, broadband gamma-ray spectrometry capable of characterizing the betatron radiation spectrum over the photon energy range from 10 keV to 20 MeV with respect to the peak photon energy, spectral bandwidth, and unique discrimination from background radiations, using a differential filtering spectrometer and the unfolding procedure based on the Monte Carlo code GEANT4. These properties are experimentally verified by measuring betatron radiation from a cm-scale laser wakefield accelerator (LWFA) driven by a 1-PW laser, using a differential filtering spectrometer consisting of a 15-filter and image plate stack. The gamma-ray spectra were derived by unfolding the photostimulated luminescence (PSL) values recorded on the image plates, using the spectrometer response matrix modeled with the Monte Carlo code GEANT4. The accuracy of unfolded betatron radiation spectra was assessed by unfolding the test PSL data simulated with GEANT4, showing an ambiguity of less than 20% and clear discrimination from the background radiation with less than 10%. The spectral analysis of betatron radiation from laser wakefield-accelerated electron beams with energies up to 3 GeV revealed radiation spectra characterized by synchrotron radiation with the critical photon energy up to 7 MeV. The gamma-ray spectrometer and unfolding method presented here facilitate an in-depth understanding of betatron radiation from LWFA process and a novel radiation source of high-quality photon beams in the MeV regime. PMID:26724015

  14. Gamma-H2AX as a biomarker of DNA damage induced by ionizing radiation in targeted and bystander human artificial skin models and peripheral blood lymphocytes

    NASA Astrophysics Data System (ADS)

    Redon, Christophe; Dickey, Jennifer; Bonner, William; Sedelnikova, Olga

    Ionizing radiation (IR) exposure is inevitable. In addition to exposure from cosmic rays, the sun and radioactive substances, modern society has created new sources of radiation exposure such as space and high altitude journeys, X-ray diagnostics, radiological treatments and the increasing threat of radiobiological terrorism. For these reasons, a reliable, reproducible and sensitive assessment of dose and time exposure to IR is essential. We developed a minimally invasive diagnostic test for IR exposure based on detection of a phosphorylated variant of histone H2AX (gamma-H2AX), which occurs specifically at sites of DNA double-strand breaks (DSBs). The phosphorylation of thousands of H2AX molecules forms a gamma-H2AX focus in the chromatin flanking the DSB site that can be detected in situ. We analyzed gamma- H2AX focus formation in both directly irradiated cells as well as in un-irradiated "bystanders" in close contact with irradiated cells. In order to insure minimal invasiveness, we examined commercially available artificial skin models as a surrogate for human skin biopsies as well as peripheral blood lymphocytes. In human skin models, cells in a thin plane were microbeamirradiated and gamma-H2AX formation was measured both in irradiated and in distal bystander cells over time. In irradiated cells DSB formation reached a maximum at 15-30 minutes post- IR and then declined within several hours; all cells were affected. In marked contrast, the incidence of DSBs in bystander cells reached a maximum by 12-48 hours post-irradiation, gradually decreasing over the 7 day time course. At the maxima, 40-60% of bystander cells were affected. Similarly, we analyzed blood samples exposed to IR ex vivo at doses ranging from 0.02 to 3 Gy. The amount of DNA damage was linear in respect to radiation dose and independent of the age or sex of the blood donor. The method is highly reproducible and highly sensitive. In directly irradiated cells, the number of gamma-H2AX foci peaked 30 min after irradiation and then declined at a relatively steady pace as the cell repaired the DNA damage. Radiation effects were still detectable after 48 hrs for doses greater than 1 Gy and remained linear to initial dose. Activated bystander lymphocytes cultured with media from irradiated lymphocytes exhibited a two-fold increased damage response as seen by gamma- H2AX formation. The effect reached a maximum 3 hrs post-exposure and was retained for over 24 hrs. Thus, detection of gamma-H2AX formation to determine DNA damage in a minimally invasive skin test and a non-invasive blood test could be useful and promising tools to analyze direct and indirect effects of radiation exposure.

  15. gamma-Glutamyl transpeptidase expression in Ewing's sarcoma cells: up-regulation by interferons.

    PubMed Central

    Bouman, Lena; Sancau, Josiane; Rouillard, Dany; Bauvois, Brigitte

    2002-01-01

    The genetic hallmark of Ewing's sarcoma family of tumours (ET) is the presence of the translocation t(11;22)(q24;q12), which creates the ET fusion gene, leading to cellular transformation. Five human gamma-glutamyl transpeptidase (gamma-GT) genes are located near the chromosomal translocation in ET. gamma-GT is a major enzyme involved in glutathione homoeostasis. Five human cell lines representative of primary or metastatic tumours were investigated to study whether gamma-GT alterations could occur at the chromosomal breaks and rearrangements in ET. As shown by enzymic assays and FACS analyses, all ET cell lines consistently expressed a functional gamma-GT which however did not discriminate steps of ET progression. As shown previously [Sancau, Hiscott, Delattre and Wietzerbin (2000) Oncogene 19, 3372-3383], ET cells respond to the antiproliferative effects of interferons (IFNs) type I (alpha and beta) and to a much less degree to IFN type II (gamma). IFN-alpha and -beta arrested cells in the S-phase of the cell cycle. We found an enhancement of gamma-GT mRNA species with IFN-alpha and -beta by reverse transcriptase-PCR analyses. This is reflected by up-regulation of gamma-GT protein, which coincides with the increase in gamma-GT-specific enzymic activity. Similarly, IFNs up-regulate the levels of gamma-GT in another IFN-responsive B cell line. Whether this up-regulation of gamma-GT by IFNs is of physiological relevance to cell behaviour remains to be studied. PMID:12049636

  16. Alpha and gamma radiation effects on air-water systems at high gas/liquid ratios

    SciTech Connect

    Wronkiewicz, D.J.; Bates, J.K.

    1993-08-01

    Radiolysis tests were conducted on air-water systems to examine the effects of radiation on liquid phase chemistry under high gas/liquid volume (G/L) ratios that are characteristic of an unsaturated nuclear waste repository setting. Test parameters included temperatures of 25, 90, and 200{degrees}C; gamma vs. alpha radiation; dose rates of {approximately}3500 and 50,000 rad/h; and G/L ratios of 10 and 100. Formate, oxalate, and total organic carbon contents increased during irradiation of the air-water systems in gamma and alpha tests at low-dose rate ({approximately}3500 rad/h). Increases in organic components were not observed for tests run at 200{degrees}C or high-dose rates (50,000 rad/h). In the tests where increases in organics occurred, the formate and oxalate were preferentially enriched in solutions that were rinsed from the test vessel walls. Nitrate (NO{sub 3}{sup {minus}}) is the dominant anion produced during the radiolysis reactions. Significant nitrite (NO{sub 2}{sup {minus}}) also occurs in some high-dose rate tests, with the reduced form of nitrogen possibly resulting from reactions with the test vessels. These results indicate that nitrogen acids are being produced and concentrated in the limited quantities of solution present in the tests. Nitrate + nitrite production varied inversely with temperature, with the lowest quantities being detected for the higher temperature tests. The G(NO{sub 3}{sup {minus}} + NO{sub 2}{sup {minus}}) values for the 25, 90, and 200{degrees}C experiments with gamma radiation are 3.2 {+-} 0.7, 1.3 {+-} 1.0, and 0.4 {+-} 0.3, respectively. Thus, the elevated temperatures expected early in the life of a repository may counteract pH decreases resulting from nitrogen acid production. Little variation was observed in G values as a function of dose rate or gas/liquid ratio.

  17. Dysregulation of IRP1-Mediated Iron Metabolism Causes Gamma Ray-specific Radioresistance in Leukemia Cells

    PubMed Central

    Haro, Kurtis J.; Sheth, Aneesh; Scheinberg, David A.

    2012-01-01

    Iron is required for nearly all organisms, playing important roles in oxygen transport and many enzymatic reactions. Excess iron, however, can be cytotoxic. Emerging evidence suggests that radioresistance can be achieved in lower organisms by the protection of proteins, but not DNA, immediately following ionizing radiation (IR) exposure, allowing for improved DNA repair. One potential mechanism for protein protection is controlling and limiting the amount of free iron in cells, as has been demonstrated in the extremophile Deinococcus Radiodurans, reducing the potential for oxidative damage to proteins during exposure to IR. We found that iron regulatory protein 1 (IRP1) expression was markedly reduced in human myeloid leukemia HL60 cells resistant to low linear energy transfer (LET) gamma rays, but not to high LET alpha particles. Stable knockdown of IRP1 by short-hairpin RNA (shRNA) interference in radiosensitive parental cells led to radioresistance to low LET IR, reduced intracellular Fenton chemistry, reduced protein oxidation, and more rapid DNA double-strand break (DSB) repair. The mechanism of radioresistance appeared to be related to attenuated free radical-mediated cell death. Control of intracellular iron by IRPs may be a novel radioresistance mechanism in mammalian cells. PMID:23155415

  18. IFN-gamma treatment increases insulin binding and MHC class I expression in erythroleukemia cells.

    PubMed

    Ferm, M; Grnberg, A; Tally, M

    1996-01-01

    We have investigated if interferon-gamma (IFN-gamma) treatment of human K562 tumor cells, which upregulates the expression of MHC class I antigens (MHC-I), simultaneously would influence insulin binding. Treatment of K562 cells with recombinant human IFN-gamma for 48 h caused a significant increase of insulin binding at 37 degrees C. Recombinant human tumor necrosis factor-alpha (TNF-alpha) alone had no effect but acted synergistically with IFN-gamma, leading to a two-fold increase of insulin binding. No change in affinity, number of binding sites or cell surface expression of insulin receptors (IR) after IFN-gamma treatment could be detected. The increased insulin binding observed at 37 degrees C was not seen at 4 degrees C, suggesting alteration of insulin internalization. The dose-response curve, as well as the time curve, for the increase in insulin binding after IFN-gamma treatment correlated with enhanced cell surface expression of MHC-I antigens. However, the correlation was not absolute. Our results show that IFN-gamma treatment alone or together with TNF-alpha, can alter the insulin binding to K562 cells without changing the expression or affinity of the IR. This correlates with the effect of IFN-gamma on MHC-I expression. These results support the findings that MHC-I molecules associate and interact with the IR at the cell surface. PMID:8675233

  19. Effective Atomic Numbers of Lanthanides with Gamma Radiation for Photon Energy Absorption

    NASA Astrophysics Data System (ADS)

    Shantappa, Anil; Hanagodimath, S. M.

    Effective atomic numbers for photon energy absorption, ZPEA,eff have been calculated for photon from 1 keV to 20 MeV for selected oxides of lanthanides, such as Lanthanum oxide, Cerium oxide, Samarium oxide, Europium oxide, Dysprosium oxide, Thulium oxide, Ytterbium oxide. The ZPEA,eff values then compared with ZPI,eff for photon interaction. The ZPEA,eff values have been found to change with energy and composition of selected lanthanides. Oxides of lanthanides are considered as better shielding materials to the exposure of gamma radiation. The values of effective atomic number for photon energy absorption help in the calculation of absorbed dose.

  20. Use of gamma ray radiation to parallel the plates of a Fabry-Perot interferometer

    NASA Technical Reports Server (NTRS)

    Skinner, Wilbert R.; Hays, Paul B.; Anderson, Sally M.

    1987-01-01

    The use of gamma radiation to parallel the plates of a Fabry-Perot etalon is examined. The method for determining the etalon parallelism, and the procedure for irradiating the posts are described. Changes in effective gap for the etalon over the surface are utilized to measure the parallelism of the Fabry-Perot etalon. An example in which this technique is applied to an etalon of fused silica plates, which are 132 mm in diameter and coded with zinc sulfide and cryolite, with Zerodur spaces 2 cm in length. The effect of the irradiation of the posts on the thermal performance of the etalon is investigated.

  1. Use of gamma ray radiation to parallel the plates of a Fabry-Perot interferometer

    NASA Astrophysics Data System (ADS)

    Skinner, Wilbert R.; Hays, Paul B.; Anderson, Sally M.

    1987-03-01

    The use of gamma radiation to parallel the plates of a Fabry-Perot etalon is examined. The method for determining the etalon parallelism, and the procedure for irradiating the posts are described. Changes in effective gap for the etalon over the surface are utilized to measure the parallelism of the Fabry-Perot etalon. An example in which this technique is applied to an etalon of fused silica plates, which are 132 mm in diameter and coded with zinc sulfide and cryolite, with Zerodur spaces 2 cm in length. The effect of the irradiation of the posts on the thermal performance of the etalon is investigated.

  2. Estimation of external gamma radiation dose in the area of Bory Stobrawskie forests (PL).

    PubMed

    Do?ha?czuk-?rdka, Agnieszka

    2012-09-01

    The study assessed the radiological risks associated with the presence of natural and artificial radionuclides in the Bory Stobrawskie forests (PL). Using the conversion factors given by UNSCEAR and the measurements results of (232)Th series, (238)U series, (40)K, and (137)Cs specific activities in the 10-cm soil layer the values of absorbed dose (D) and the annual effective dose equivalent derived from terrestrial gamma radiation (E) were calculated. The calculated dose was compared with doses directly measured on the area studied. PMID:21972034

  3. Gamma radiation effects on the dynamic fatigue measurements of glass discs

    NASA Technical Reports Server (NTRS)

    Ananaba, T. O. J.; Kinser, D. L.

    1985-01-01

    Circular specimens of low iron soda lime silicate glass were blasted with grit after having a circular notch etched into their centers. After separation into two groups, one group was exposed to gamma radiation. The fracture strengths of all samples were then tested by the biaxial technique, i.e., specimens were balanced on three balls and loaded in the center by a piston. The irradiated samples had received a 140,000 Gy dose from a Co-60 source. An enhanced interaction between the ambient moisture and the grit-blasted central notch was observed in the irradiated samples, which displayed accelerated corrosion.

  4. Experimental investigation of gamma ray radiation effects on 1550nm single mode fiber

    NASA Astrophysics Data System (ADS)

    Liu, Qingfeng; Ma, Jing; Tan, Liying; Zhou, Yanping; Che, Chi; Yang, Qingbo

    2015-03-01

    We compared the degradation of two kinds of 1550nm single-mode optical fibers following the irradiation by gamma ray (60Co). Over a total dose of 9.06104 rad, the absorption coefficient increased while the rates were different between samples. The influence of ionizing radiation is theoretically analyzed. In room temperature annealing experiment, the absorption coefficient of Corning sample was recovered visibly, but Alcatel sample continues to deteriorate. It is suggested that different producing technology and doping are clearly influence the generation and recombination process of color center.

  5. Gamma radiation response of MWIR and LWIR HgCdTe photodiodes

    SciTech Connect

    Williams, G.M.; Vanderwyck, A.H.B.; Blazejewski, E.R.; Ginn, R.P.; Li, C.C.; Nelson, S.J.

    1987-12-01

    This paper describes the results of experimental investigation of the gamma radiation response of HgCdTe photodiodes. The devices were fabricated in material grown by liquid phase epitaxy; the p-n junctions were made by ion implantation and passivated with ZnS. The MWIR devices tested at 120K, showed transient response in reasonable agreement with existing theory and total dose hardness greater than 1 Mrad(Si). The LWIR detectors, tested at 40K, showed a degradation threshold at 1- Krad(H/sub 2/O). This degradation is not a result of surface inversion resulting from charge trapping in the insulator.

  6. Radiative {{\\Sigma }_{b}}\\to \\Sigma \\gamma decay in SM and BSM

    NASA Astrophysics Data System (ADS)

    Azizi, K.; Kartal, S.; Olgun, A. T.; Tavuko?lu, Z.

    2014-09-01

    Using transition form factors calculated via light cone QCD sum rules in full theory, we comparatively analyze the rare radiative {{\\Sigma }_{b}}\\to \\Sigma \\gamma decay in the standard model (SM) and models with one or two universal extra dimensions, such as beyond the SM scenarios. We estimate the total decay width and branching ratio associated with this decay channel in the SM and compare the obtained results with those of scenarios with one or two universal extra dimensions. We discuss how the results of universal extra dimensional models approach the SM predictions when the compactification factor of extra dimension is increased.

  7. Phospholipase C-gamma2 is essential for NK cell cytotoxicity and innate immunity to malignant and virally infected cells.

    PubMed

    Caraux, Anouk; Kim, Nayoung; Bell, Sarah E; Zompi, Simona; Ranson, Thomas; Lesjean-Pottier, Sarah; Garcia-Ojeda, Marcos E; Turner, Martin; Colucci, Francesco

    2006-02-01

    Phospholipase C-gamma2 (PLC-gamma2) is a key component of signal transduction in leukocytes. In natural killer (NK) cells, PLC-gamma2 is pivotal for cellular cytotoxicity; however, it is not known which steps of the cytolytic machinery it regulates. We found that PLC-gamma2-deficient NK cells formed conjugates with target cells and polarized the microtubule-organizing center, but failed to secrete cytotoxic granules, due to defective calcium mobilization. Consequently, cytotoxicity was completely abrogated in PLC-gamma2-deficient cells, regardless of whether targets expressed NKG2D ligands, missed self major histocompatibility complex (MHC) class I, or whether NK cells were stimulated with IL-2 and antibodies specific for NKR-P1C, CD16, CD244, Ly49D, and Ly49H. Defective secretion was specific to cytotoxic granules because release of IFN-gamma on stimulation with IL-12 was normal. Plcg2-/- mice could not reject MHC class I-deficient lymphoma cells nor could they control CMV infection, but they effectively contained Listeria monocytogenes infection. Our results suggest that exocytosis of cytotoxic granules, but not cellular polarization toward targets, depends on intracellular calcium rise during NK cell cytotoxicity. In vivo, PLC-gamma2 regulates selective facets of innate immunity because it is essential for NK cell responses to malignant and virally infected cells but not to bacterial infections. PMID:16204312

  8. DNA microarray analyses reveal a post-irradiation differential time-dependent gene expression profile in yeast cells exposed to X-rays and {gamma}-rays

    SciTech Connect

    Kimura, Shinzo; Ishidou, Emi; Kurita, Sakiko; Suzuki, Yoshiteru; Shibato, Junko; Rakwal, Randeep . E-mail: rakwal-68@aist.go.jp; Iwahashi, Hitoshi

    2006-07-21

    Ionizing radiation (IR) is the most enigmatic of genotoxic stress inducers in our environment that has been around from the eons of time. IR is generally considered harmful, and has been the subject of numerous studies, mostly looking at the DNA damaging effects in cells and the repair mechanisms therein. Moreover, few studies have focused on large-scale identification of cellular responses to IR, and to this end, we describe here an initial study on the transcriptional responses of the unicellular genome model, yeast (Saccharomyces cerevisiae strain S288C), by cDNA microarray. The effect of two different IR, X-rays, and gamma ({gamma})-rays, was investigated by irradiating the yeast cells cultured in YPD medium with 50 Gy doses of X- and {gamma}-rays, followed by resuspension of the cells in YPD for time-course experiments. The samples were collected for microarray analysis at 20, 40, and 80 min after irradiation. Microarray analysis revealed a time-course transcriptional profile of changed gene expressions. Up-regulated genes belonged to the functional categories mainly related to cell cycle and DNA processing, cell rescue defense and virulence, protein and cell fate, and metabolism (X- and {gamma}-rays). Similarly, for X- and {gamma}-rays, the down-regulated genes belonged to mostly transcription and protein synthesis, cell cycle and DNA processing, control of cellular organization, cell fate, and C-compound and carbohydrate metabolism categories, respectively. This study provides for the first time a snapshot of the genome-wide mRNA expression profiles in X- and {gamma}-ray post-irradiated yeast cells and comparatively interprets/discusses the changed gene functional categories as effects of these two radiations vis-a-vis their energy levels.

  9. Gallium arsenide solar cell radiation damage study

    NASA Technical Reports Server (NTRS)

    Maurer, R. H.; Herbert, G. A.; Kinnison, J. D.; Meulenberg, A.

    1989-01-01

    A thorough analysis has been made of electron- and proton- damaged GaAs solar cells suitable for use in space. It is found that, although some electrical parametric data and spectral response data are quite similar, the type of damage due to the two types of radiation is different. An I-V analysis model shows that electrons damage the bulk of the cell and its currents relatively more, while protons damage the junction of the cell and its voltages more. It is suggested that multiple defects due to protons in a strong field region such as a p/n junction cause the greater degradation in cell voltage, whereas the individual point defects in the quasi-neutral minority-carrier-diffusion regions due to electrons cause the greater degradation in cell current and spectral response.

  10. The use of gamma radiation for the elimination of Salmonella from frozen meat.

    PubMed

    Ley, F J; Kennedy, T S; Kawashima, K; Roberts, D; Hobbs, B C

    1970-06-01

    The use of a gamma radiation process for the elimination of Salmonella from frozen meat is considered with particular reference to the treatment of boned-out horsemeat and kangaroo meat imported into the UK and intended for use as pet meat.Examination of dose/survival curves produced for several serotypes of Salmonella in frozen meat shows that a radiation dose of 0.6 Mrad. will reduce a population by at least a factor of 10(5). The influence on the radiation resistance of salmonellas of such factors as preirradiation growth in the meat and temperature during irradiation have been examined and considered. It is also demonstrated with both preinoculated and naturally contaminated meat that postirradiation storage in the frozen state does not lead to the revival of irradiated salmonellas.The properties of Salmonella survivors deliberately produced in meat using conditions of irradiation designed to simulate a commercial process are studied after six recycling treatments through the process. There were no important changes in characteristics normally used for identification of Salmonella but radiation resistance was lowered. Survivors grown in situ in meat after irradiation showed an abnormally long lag phase, and removal of competitive microflora in meat by the radiation treatment can influence the growth of salmonellas. PMID:4914090

  11. Modulation of radiation-induced apoptosis and G{sub 2}/M block in murine T-lymphoma cells

    SciTech Connect

    Palayoor, S.T.; Macklis, R.M.; Bump, E.A.; Coleman, C.N.

    1995-03-01

    Radiation-induced apoptosis in lymphocyte-derived cell lines is characterized by endonucleolytic cleavage of cellular DNA within hours after radiation exposure. We have studied this phenomenon qualitatively (DNA gel electrophoresis) and quantitatively (diphenylamine reagent assay) in murine EL4 T-lymphoma cells exposed to {sup 137}Cs {gamma} irradiation. Fragmentation was discernible within 18-24 h after exposure. It increased with time and dose and reached a plateau after 8 Gy of {gamma} radiation. We studied the effect of several pharmacological agents on the radiation-induced G{sub 2}/M block and DNA fragmentation. The agents which reduced the radiation-induced G{sub 2}/M-phase arrest (caffeine, theobromine, theophylline and 2-aminopurine) enhanced the degree of DNA fragmentation at 24 h. In contrast, the agents which sustained the radiation-induced G{sub 2}/M-phase arrest (TPA, DBcAMP, IBMX and 3-aminobenzamide) inhibited the DNA fragmentation at 24 h. These studies on EL4 lymphoma cells are consistent with the hypothesis that cells with radiation-induced genetic damage are eliminated by apoptosis subsequent to a G{sub 2}/M block. Furthermore, it may be possible to modulate the process of radiation-induced apoptosis in lymphoma cells with pharmacological agents that modify the radiation-induced G{sub 2}/M block, and to use this effect in the treatment of patients with malignant disease. 59 refs., 7 figs.

  12. Estrogens decrease {gamma}-ray-induced senescence and maintain cell cycle progression in breast cancer cells independently of p53

    SciTech Connect

    Toillon, Robert-Alain . E-mail: robert.toillon@univ-lille1.fr; Magne, Nicolas; Laios, Ioanna; Castadot, Pierre; Kinnaert, Eric; Van Houtte, Paul; Desmedt, Christine B.Sc.; Leclercq, Guy; Lacroix, Marc

    2007-03-15

    Purpose: Sequential administration of radiotherapy and endocrine therapy is considered to be a standard adjuvant treatment of breast cancer. Recent clinical reports suggest that radiotherapy could be more efficient in association with endocrine therapy. The aim of this study was to evaluate the estrogen effects on irradiated breast cancer cells (IR-cells). Methods and Materials: Using functional genomic analysis, we examined the effects of 17-{beta}-estradiol (E{sub 2}, a natural estrogen) on MCF-7 breast cancer cells. Results: Our results showed that E{sub 2} sustained the growth of IR-cells. Specifically, estrogens prevented cell cycle blockade induced by {gamma}-rays, and no modification of apoptotic rate was detected. In IR-cells we observed the induction of genes involved in premature senescence and cell cycle progression and investigated the effects of E{sub 2} on the p53/p21{sup waf1/cip1}/Rb pathways. We found that E{sub 2} did not affect p53 activation but it decreased cyclin E binding to p21{sup waf1/cip1} and sustained downstream Rb hyperphosphorylation by functional inactivation of p21{sup waf1/cip1}. We suggest that Rb inactivation could decrease senescence and allow cell cycle progression in IR-cells. Conclusion: These results may help to elucidate the molecular mechanism underlying the maintenance of breast cancer cell growth by E{sub 2} after irradiation-induced damage. They also offer clinicians a rational basis for the sequential administration of ionizing radiation and endocrine therapies.

  13. Spectral analysis of paramagnetic centers induced in human tooth enamel by x-rays and gamma radiation

    NASA Astrophysics Data System (ADS)

    Kirillov, V. A.; Kuchuro, I. I.

    2010-03-01

    Based on study of spectral and relaxation characteristics, we have established that paramagnetic centers induced in tooth enamel by x-rays and gamma radiation are identical in nature. We show that for the same exposure dose, the intensity of the electron paramagnetic resonance (EPR) signal induced by x-radiation with effective energy 34 keV is about an order of magnitude higher than the amplitude of the signal induced by gamma radiation. We have identified a three-fold attenuation of the EPR signal along the path of the x-radiation from the buccal to the lingual side of a tooth, which is evidence that the individual had undergone diagnostic x-ray examination of the dentition or skull. We have shown that the x-ray exposure doses reconstructed from the EPR spectra are an order of magnitude higher than the applied doses, while the dose loads due to gamma radiation are equal to the applied doses. The data obtained indicate that for adequate reconstruction of individual absorbed doses from EPR spectra of tooth enamel in the population subjected to the combined effect of x-radiation and accidental external gamma radiation as a result of the disaster at the Chernobyl nuclear power plant, we need to take into account the contribution to the dose load from diagnostic x-rays in examination of the teeth, jaw, or skull.

  14. Preliminary results on soil-emitted gamma radiation and its relation with the local atmospheric electric field at Amieira (Portugal)

    NASA Astrophysics Data System (ADS)

    Lopes, F.; Silva, H. G.; Bárias, S.; Barbosa, S. M.

    2015-10-01

    The atmospheric electric field near the Earth's surface is dominated by atmospheric pollutants and natural radioactivity, with the latter directly linked to radon (222Rn) gas. For a better comprehension on the temporal variability of both the atmospheric electric field and the radon concentration and its relation with local atmospheric variables, simultaneous measurements of soil-emitted gamma radiation and potential gradient (defined from the vertical component of the atmospheric electric field) were taken every minute, along with local meteorological parameters (e.g., temperature, atmospheric pressure, relative humidity and daily solar radiation). The study region is Amieira, part of the Alqueva lake in Alentejo Portugal, where an interdisciplinary meteorological campaign, ALEX2014, took place from June to August 2014. Soil gamma radiation is more sensitive to small concentrations of radon as compared with alpha particles measurements, for that reason it is more suited for sites with low radon levels, as expected in this case. Preliminary results are presented here: statistical and spectral analysis show that i) the potential gradient has a stronger daily cycle as compared with the gamma radiation, ii) most of the energy of the gamma signal is concentrated in the low frequencies (close to 0), contrary to the potential gradient that has most of the energy in frequency 1 (daily cycle) and iii) a short-term relation between gamma radiation and the potential gradient has not been found. Future work and plans are also discussed.

  15. Bystander responses in low dose irradiated cells treated with plasma from gamma irradiated blood

    NASA Astrophysics Data System (ADS)

    Acheva, A.; Georgieva, R.; Rupova, I.; Boteva, R.; Lyng, F.

    2008-02-01

    There are two specific low-dose radiation-induced responses that have been the focus of radiobiologists' interest in recent years. These are the bystander effect in non-irradiated cells and the adaptive response to a challenge dose after prior low dose irradiation. In the present study we have investigated if plasma from irradiated blood can act as a 'challenge dose' on low dose irradiated reporter epithelial cells (HaCaT cell line). The main aim was to evaluate the overall effect of low dose irradiation (0.05 Gy) of reporter cells and the influence of bystander factors in plasma from 0.5 Gy gamma irradiated blood on these cells. The effects were estimated by clonogenic survival of the reporter cells. We also investigated the involvement of reactive oxygen species (ROS) as potential factors involved in the bystander signaling. Calcium fluxes and mitochondrial membrane potential (MMP) depolarization were also examined as a marker for initiation of apoptosis in the reporter cells. The results show that there are large individual differences in the production of bystander effects and adaptive responses between different donors. These may be due to the specific composition of the donor plasma. The observed effects generally could be divided into two groups: adaptive responses and additive effects. ROS appeared to be involved in the responses of the low dose pretreated reporter cells. In all cases there was a significant decrease in MMP which may be an early event in the apoptotic process. Calcium signaling also appeared to be involved in triggering apoptosis in the low dose pretreated reporter cells. The heterogeneity of the bystander responses makes them difficult to be modulated for medical uses. Specific plasma characteristics that cause these large differences in the responses would need to be identified to make them useful for radiotherapy.

  16. Response of a. gamma. -ray ''telescope'' dosimeter to the (n +. gamma. ) radiation from a /sup 239/Pu-Be source

    SciTech Connect

    Attix, F.H.; Pearson, D.W.; DeLuca, P.M. Jr.

    1985-01-01

    The design, construction, and investigation of a gamma-ray telescope that can tell the direction of incident photons is reported. The dosimeter is based on LiF thermoluminescence. The gamma-ray telescope dosimeter was tested with a /sup 239/Pu-Be source and found to perform satisfactorily. For a high-energy neutron field the gamma-ray telescope dosimeter contributes very little to the total dose equivalent. (LEW)

  17. SIMILAR RADIATION MECHANISM IN GAMMA-RAY BURSTS AND BLAZARS: EVIDENCE FROM TWO LUMINOSITY CORRELATIONS

    SciTech Connect

    Wang, F. Y.; Yi, S. X.; Dai, Z. G.

    2014-05-01

    Active galactic nuclei and gamma-ray bursts (GRBs) are powerful astrophysical events with relativistic jets. In this Letter, the broadband spectral properties of GRBs and well-observed blazars are compared. The distribution of GRBs is consistent with the well-known blazar sequence including the νL {sub ν}(5 GHz) – α{sub RX} and νL {sub ν}(5 GHz) – ν{sub peak} correlations, where α{sub RX} is defined as the broadband spectral slope in radio-to-X-ray bands, and ν{sub peak} is defined as the spectral peak frequency. Moreover, GRBs occupy the low radio luminosity end of these sequences. These two correlations suggest that GRBs could have a radiation process, i.e., synchrotron radiation, similar to blazars both in the prompt emission and afterglow phases.

  18. The effects of electron and gamma radiation on epoxy-based materials

    NASA Astrophysics Data System (ADS)

    Fornes, R. E.; Memory, J. D.; Gilbert, R. D.; Long, E. R., Jr.

    1982-03-01

    Specimens of graphite/epoxy composites and epoxy resins were exposed to electron and gamma radiation, followed by mechanical property and fundamental measurements. Measurement techniques included: scanning electron microscopy, X-ray diffraction analysis, and electron spin resonance spectroscopic analysis. Results indicate little or no change in flexural properties of miniature specimens of a graphite/epoxy composite and no change in failure mode at the fiber-resin interface and in the crystallinity of the fiber and the resin. Some doubt in the observation of stable flexural properties is cast by electron paramagnetic resonance spectra of a relatively large number of radiation-generated radicals. These generally lead to a change in cross-linking and in chain-scissioning which should alter mechanical properties.

  19. Natural killer cell and gamma delta T cell alterations in enthesitis related arthritis category of juvenile idiopathic arthritis.

    PubMed

    Gaur, Priyanka; Misra, Ramnath; Aggarwal, Amita

    2015-12-01

    Enthesitis related arthritis (ERA) is associated with increased frequency of Th17 cells and synovial fluid (SF) IL-17 levels. Natural killer (NK) and gamma delta T cells have been recently shown to produce IL-17, thus we studied the NK and gamma delta-T cells in peripheral blood (PB) of 50 ERA, 16 other JIA patients and 19 healthy controls. We have analyzed the frequency of NK (total, CD56dim, CD56bright) and gamma delta-T cells, perforin and KIR3DL1/2 expression on NK cells and IL-17 and IFN-gamma production by them using flow cytometry. ERA patients had more NK cells with reduced perforin expression and IFN-gamma production but increased KIR3DL1/2 expression and IL-17 production as compared to controls. Also IL-17 producing gamma delta-T were increased in PB of ERA patients. Paired SF samples had NK cells with reduced perforin and KIR3DL expression. Thus increased NK and gamma delta-T cells may contribute to the inflammation in ERA by producing IL-17. PMID:26244610

  20. Spectroscopic evaluation of painted layer structural changes induced by gamma radiation in experimental models

    NASA Astrophysics Data System (ADS)

    Manea, Mihaela M.; Moise, Ioan V.; Virgolici, Marian; Negut, Constantin D.; Barbu, Olimpia-Hinamatsuri; Cutrubinis, Mihalis; Fugaru, Viorel; Stanculescu, Ioana R.; Ponta, Corneliu C.

    2012-02-01

    The degradation of cultural heritage objects by insects and microorganisms is an important issue for conservators, art specialists and humankind in general. Gamma irradiation is an efficient method of polychrome wooden artifacts disinfestation. Color changes and other modifications in the physical chemical properties of materials induced by gamma irradiation are feared by cultural heritage responsible committees and they have to be evaluated objectively and precisely. In this paper FTIR and FT-Raman spectroscopy methods were used to investigate the structural changes in some experimental models of tempera paint layers on wood following 11 kGy gamma irradiation at two dose rates. Radiation chemistry depends on the particular pigment, matrix formed by protein, resin (in case of varnished samples) and water presence. For the majority of painted layer in experimental models very small spectral variations were observed. Small changes in the FTIR spectra were observed for the raw sienna experimental model: for the higher dose rate the egg yolk protein oxidation peaks and the CH stretching bands due to lipids degradation products increased.

  1. Aflatoxins and ochratoxin a reduction in black and white pepper by gamma radiation

    NASA Astrophysics Data System (ADS)

    Jalili, M.; Jinap, S.; Noranizan, M. A.

    2012-11-01

    Irradiation is an important means of decontamination of food commodities, especially spices. The aim of the current study was to investigate the efficacy of gamma radiation (60Co) for decontaminating ochratoxin A (OTA) and aflatoxins B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) residues in artificially contaminated black and white pepper samples. The moisture content of the pepper samples was set at 12% or 18%, and the applied gamma dose ranged from 5 to 30 kGy. Mycotoxin levels were determined by high-performance liquid chromatography (HPLC) after immunoaffinity column (IAC) chromatography. Both the gamma irradiation dose and moisture content showed significant effects (P<0.05) on mycotoxin reduction. The maximum toxin reductions, found at 18% moisture content and 30 kGy, were 55.2%, 50.6%, 39.2%, 47.7% and 42.9% for OTA, AFB1, AFB2, AFG1 and AFG2, respectively.

  2. A meta-analysis of leukaemia risk from protracted exposure to low-dose gamma radiation

    PubMed Central

    Schubauer-Berigan, M K

    2010-01-01

    Context More than 400 000 workers annually receive a measurable radiation dose and may be at increased risk of radiation-induced leukaemia. It is unclear whether leukaemia risk is elevated with protracted, low-dose exposure. Objective We conducted a meta-analysis examining the relationship between protracted low-dose ionising radiation exposure and leukaemia. Data sources Reviews by the National Academies and United Nations provided a summary of informative studies published before 2005. PubMed and Embase databases were searched for additional occupational and environmental studies published between 2005 and 2009. Study selection We selected 23 studies that: (1) examined the association between protracted exposures to ionising radiation and leukaemia excluding chronic lymphocytic subtype; (2) were a cohort or nested case–control design without major bias; (3) reported quantitative estimates of exposure; and (4) conducted exposure–response analyses using relative or excess RR per unit exposure. Methods Studies were further screened to reduce information overlap. Random effects models were developed to summarise between-study variance and obtain an aggregate estimate of the excess RR at 100 mGy. Publication bias was assessed by trim and fill and Rosenthal's file drawer methods. Results We found an ERR at 100 mGy of 0.19 (95% CI 0.07 to 0.32) by modelling results from 10 studies and adjusting for publication bias. Between-study variance was not evident (p=0.99). Conclusions Protracted exposure to low-dose gamma radiation is significantly associated with leukaemia. Our estimate agreed well with the leukaemia risk observed among exposed adults in the Life Span Study (LSS) of atomic bomb survivors, providing increased confidence in the current understanding of leukaemia risk from ionising radiation. However, unlike the estimates obtained from the LSS, our model provides a precise, quantitative summary of the direct estimates of excess risk from studies of protracted radiation exposures. PMID:20935290

  3. Breeding biology of Tree Swallows and House Wrens in a gradient of gamma radiation

    SciTech Connect

    Zach, R.; Mayoh, K.R.

    1982-12-01

    In a gradient of gamma radiation from 38.7 mC kg/sup -1/.d/sup -1/ to background levels of 0.05 ..mu..C. kg/sup -1/ . d/sup -1/ to background levels of 0.05 ..mu..C . kg/sup -1/ . d/sup -1/, Tree Swallows (Iridoprocne bicolor) and House Wrens (Troglodytes aedon) avoided nesting in areas of high radiation. Nest boxes selected by swallows and wrens had a mean exposure rate of only 9.3 and 6.6 ..mu..C . kg/sup -1/ . d/sup -1/, respectively. Lateral and canopy vegetation indices and nest hole height and direction could not explain the observed pattern of box selection. Of the boxes with low exposure rates, swallows selected those with little vegetation cover, whereas wrens chose boxes and heavy cover. It appears that the birds responded to radiation levels as low as 100 times background, but it is not clear whether they actually detected radiation or simply responded to secondary clues. The number of swallows and wrens fledged per box was unrelated to radiation exposure. The same was true for number of eggs, hatching success, fledging success, incubation time, and nestling time. Breeding success was reduced because of infertile eggs, eggs with dead embryos, cracked eggs, predation, adverse weather, abandonment, and parasites. The logistic model was ideally suited for describing gains in mass in nestling swallows and wrens. Growth of nestlings was not related to radiation exposure as indicated by the growth rate constant, asymptotic mass, and the proportion of variation explained by the logistic model. Breeding and growth performance were similar in studies not involving experimental radiation.

  4. Breeding biology of tree swallows and house wrens in a gradient of gamma radiation

    SciTech Connect

    Zach, R.; Mayoh, K.R.

    1982-12-01

    In a gradient of gamma radiation ranging from 38.7 mC.kg/sup -1/.d/sup -1/ to background levels of 0.05 ..mu..C.kg/sup -1/.d/sup -1/, Tree Swallows (Iridoprocne bicolor) and House Wrens (Troglodytes aedon) avoided nesting in areas of high radiation. Nest boxes selected by swallows and wrens had a mean exposure rate of only 9.3 and 6.6 ..mu..C.kg/sup -1/.d/sup -1/, respectively. Lateral and canopy vegetation indices and nest hole height and direction could not explain the observed pattern of box selection. Of the boxes with low exposure rates, swallows selected those with little vegetation cover, whereas wrens chose boxes with heavy cover. It appears that the birds responded to radiaton levels as low as 100 times background but it is not clear whether they actually detected radiation or simply responded to secondary clues. The number of swallows and wrens fledged per box was unrelated to radiation exposure. The same was true for number of eggs, hatching success, fledging success, incubation time, and nestling time. Breeding success was reduced because of infertile eggs, eggs with dead embryos, cracked eggs, predation, adverse weather, abandonment, and parasites. The logistic model was ideally suited for describing gains in mass in nestling swallows and wrens. Growth of nestlings was not related to radiation exposure as indicated by the growth rate constant, asymptotic mass, and the proportion of variation explained by the logistic model. The data show that birds avoided adverse effects of radiation by judicious box selection. However, there were indications that at higher breeding densities birds may use high-exposure boxes, where breeding success or growth of nestlings may become reduced due to radiation.

  5. Cell to Cell Variability of Radiation-Induced Foci: Relation between Observed Damage and Energy Deposition

    PubMed Central

    Voisin, Pascale; Clairand, Isabelle; Benderitter, Marc; Bottollier-Depois, Jean-François; Barquinero, Joan Francesc

    2016-01-01

    Most studies that aim to understand the interactions between different types of photon radiation and cellular DNA assume homogeneous cell irradiation, with all cells receiving the same amount of energy. The level of DNA damage is therefore generally determined by averaging it over the entire population of exposed cells. However, evaluating the molecular consequences of a stochastic phenomenon such as energy deposition of ionizing radiation by measuring only an average effect may not be sufficient for understanding some aspects of the cellular response to this radiation. The variance among the cells associated with this average effect may also be important for the behaviour of irradiated tissue. In this study, we accurately estimated the distribution of the number of radiation-induced γH2AX foci (RIF) per cell nucleus in a large population of endothelial cells exposed to 3 macroscopic doses of gamma rays from 60Co. The number of RIF varied significantly and reproducibly from cell to cell, with its relative standard deviation ranging from 36% to 18% depending on the macroscopic dose delivered. Interestingly, this relative cell-to-cell variability increased as the dose decreased, contrary to the mean RIF count per cell. This result shows that the dose effect, in terms of the number of DNA lesions indicated by RIF is not as simple as a purely proportional relation in which relative SD is constant with dose. To analyse the origins of this observed variability, we calculated the spread of the specific energy distribution for the different target volumes and subvolumes in which RIF can be generated. Variances, standard deviations and relative standard deviations all changed similarly from dose to dose for biological and calculated microdosimetric values. This similarity is an important argument that supports the hypothesis of the conservation of the association between the number of RIF per nucleus and the specific energy per DNA molecule. This comparison allowed us to calculate a volume of 1.6 μm3 for which the spread of the specific energy distribution could explain the entire variability of RIF counts per cell in an exposed cell population. The definition of this volume may allow to use a microdosimetric quantity to predict heterogeneity in DNA damage. Moreover, this value is consistent with the order of magnitude of the volume occupied by the hydrated sugar-phosphate backbone of the DNA molecule, which is the part of the DNA molecule responsible for strand breaks. PMID:26727594

  6. Cell to Cell Variability of Radiation-Induced Foci: Relation between Observed Damage and Energy Deposition.

    PubMed

    Gruel, Gatan; Villagrasa, Carmen; Voisin, Pascale; Clairand, Isabelle; Benderitter, Marc; Bottollier-Depois, Jean-Franois; Barquinero, Joan Francesc

    2016-01-01

    Most studies that aim to understand the interactions between different types of photon radiation and cellular DNA assume homogeneous cell irradiation, with all cells receiving the same amount of energy. The level of DNA damage is therefore generally determined by averaging it over the entire population of exposed cells. However, evaluating the molecular consequences of a stochastic phenomenon such as energy deposition of ionizing radiation by measuring only an average effect may not be sufficient for understanding some aspects of the cellular response to this radiation. The variance among the cells associated with this average effect may also be important for the behaviour of irradiated tissue. In this study, we accurately estimated the distribution of the number of radiation-induced ?H2AX foci (RIF) per cell nucleus in a large population of endothelial cells exposed to 3 macroscopic doses of gamma rays from 60Co. The number of RIF varied significantly and reproducibly from cell to cell, with its relative standard deviation ranging from 36% to 18% depending on the macroscopic dose delivered. Interestingly, this relative cell-to-cell variability increased as the dose decreased, contrary to the mean RIF count per cell. This result shows that the dose effect, in terms of the number of DNA lesions indicated by RIF is not as simple as a purely proportional relation in which relative SD is constant with dose. To analyse the origins of this observed variability, we calculated the spread of the specific energy distribution for the different target volumes and subvolumes in which RIF can be generated. Variances, standard deviations and relative standard deviations all changed similarly from dose to dose for biological and calculated microdosimetric values. This similarity is an important argument that supports the hypothesis of the conservation of the association between the number of RIF per nucleus and the specific energy per DNA molecule. This comparison allowed us to calculate a volume of 1.6 ?m3 for which the spread of the specific energy distribution could explain the entire variability of RIF counts per cell in an exposed cell population. The definition of this volume may allow to use a microdosimetric quantity to predict heterogeneity in DNA damage. Moreover, this value is consistent with the order of magnitude of the volume occupied by the hydrated sugar-phosphate backbone of the DNA molecule, which is the part of the DNA molecule responsible for strand breaks. PMID:26727594

  7. Solar cell radiation handbook. Addendum 1: 1982-1988

    NASA Technical Reports Server (NTRS)

    Anspaugh, Bruce E.

    1989-01-01

    The Solar Cell Radiation Handbook (JPL Publication 82-69) is updated. In order to maintain currency of solar cell radiation data, recent solar cell designs have been acquired, irradiated with 1 MeV electrons, and measured. The results of these radiation experiments are reported.

  8. Modification of fecundity and fertility during oogenesis by. gamma. radiation and/or ozone with a cytological analysis in the ectoparasitic wasp, Habrobracon juglandis (Ashmead)

    SciTech Connect

    Ofuoku, E.E.

    1984-01-01

    In Experiment I, adult female wasps were exposed to ozone for 0, 2, 4, 6, 8, 10, 12, 16, 24, and 27 h. The results indicated that the 27 h of ozone exposure produced 100% lethality on the first day. Exposures below 27 h progressively decreased life span with increasing length of exposure. In Experiment II A, adult virgin Habrobracon females were exposed to ozone for 0, 2, 4, 6, 8, 10, 12, 16, and 24 h to determine the effects of ozone on fecundity (egg laying ability) and fertility (egg hatching ability). The results showed that ozone significantly decreased fecundity and fertility in all meiotic stages except metaphase I. In Experiment II B, adult virgin Habrobracon females were exposed to Co-60 ..gamma.. radiation. All treated wasps showed significant progressive decreases in fecundity and fertility with increases in radiation dose. In Experiment II C, adult virgin Habrobracon females were exposed to Co-60 ..gamma.. radiation, to ozone, or to combinations thereof to determine the effects of these insults on fecundity and fertility. Together or singly ozone and radiation reduced fecundity and fertility. In Experiment III, adult virgin Habrobracon females were exposed to the conditions of Experiment II C to correlate by cytological examination of the ovarioles the effects of ionizing radiation and/or ozone on the germ cells at specific meiotic stages. Results obtained from the cytological study explain the fecundity and fertility observations.

  9. Isolation and characterization of mold fungi and insects infecting sawmill wood, and their inhibition by gamma radiation

    NASA Astrophysics Data System (ADS)

    Kalawate, Aparna; Mehetre, Sayaji

    2015-12-01

    This article describes the isolation, identification, and characterization of wood-rotting fungi and insects, and their inhibition was studied using gamma radiation. Products manufactured from plantation timber species are deteriorated by wood-rotting fungi such as Hypocrea lixii, Fusarium proliferatum, and Aspergillus flavus, and insects such as powderpost beetles. Proper preservation methods are necessary for ensuring a long service life of wood products. In this study, wood samples were treated with 2.5% copper ethanolamine boron (CEB) (10% w/v) and subsequently irradiated with gamma rays (10 kGy). It was observed that CEB-treated and gamma-irradiated samples controlled fungi and powderpost beetles significantly. As wood is a dead organic material, penetration of chemicals into it is very difficult. Gamma rays easily pass through wooden objects with hidden eggs and dormant spores of insects and fungi, respectively. Gamma irradiation was proved very effective in reducing damage caused by both fungi and insects.

  10. Low doses of gamma radiation in the management of postharvest Lasiodiplodia theobromae in mangos.

    PubMed

    Santos, Alice Maria Gonalves; Lins, Severina Rodrigues Oliveira; Silva, Josenilda Maria da; Oliveira, Snia Maria Alves de

    2015-01-01

    The postharvest life of mango is limited by the development of pathogens, especially fungi that cause rot, among which stands out the Lasiodiplodia theobromae. Several control methods have been employed to minimize the damages caused by this fungus, chemical control can leave residues to man and nature; physical control by the use of gamma radiation in combination with modified atmosphere and cold storage. The use of gamma radiation helps to reduce the severity of the pathogen assist in the ripening process of fruits, even at low doses (0.25, 0.35 and 0.45 kGy) chemical properties such as pH, soluble solids, acid ascorbic, titratable acidity and also the quality parameters of the pulp showed no damage that are ideal for trade and consumption of mangoes. This treatment can be extended for use in the management of diseases such as natural infections for penducular rot complex that has as one of L. theobroma pathogens involved. PMID:26413068

  11. Advances in commercial application of gamma radiation in tropical fruits at Brazil

    NASA Astrophysics Data System (ADS)

    Sabato, S. F.; Silva, J. M.; Cruz, J. N.; Broisler, P. O.; Rela, P. R.; Salmieri, S.; Lacroix, M.

    2009-07-01

    All regions of Brazil are potential areas for growing tropical fruits. As this country is already a great producer and exporter of tropical fruits, ionizing radiation has been the subject of studies in many commodities. An important project has been carried out to increase the commercial use of gamma radiation in our country. Instituto de Pesquisas Energeticas e Nucleares (IPEN)-CNEN/SP together with field producers in northeast region and partners like International Atomic Energy Agency (IAEA), CIC, Empresa Brasileira Pesquisa na Agricultura (EMBRAPA) joined to demonstrate this technology, its application and commercial feasibility. The objective of this study is to show advances in feasibility demonstrate the quality of the irradiated fruits in an international consignment from Brazil to Canada. In this work, Tommy Atkins mangoes harvested in northeast region of Brazil were sent to Canada. The fruits were treated in a gamma irradiation facility at doses 0.4 and 1.0 kGy. The control group was submitted to hydrothermal treatment (46 °C for 110 min). The fruits were stored at 11 °C for 10 days until the international transportation and kept at an environmental condition (22 °C) for 12 days, where their physical-chemical and sensorial properties were evaluated. The financial part of the feasibility study covers the scope of the investment, including the net working capital and production costs.

  12. Low doses of gamma radiation in the management of postharvest Lasiodiplodia theobromae in mangos

    PubMed Central

    Santos, Alice Maria Gonçalves; Lins, Severina Rodrigues Oliveira; da Silva, Josenilda Maria; de Oliveira, Sônia Maria Alves

    2015-01-01

    The postharvest life of mango is limited by the development of pathogens, especially fungi that cause rot, among which stands out the Lasiodiplodia theobromae. Several control methods have been employed to minimize the damages caused by this fungus, chemical control can leave residues to man and nature; physical control by the use of gamma radiation in combination with modified atmosphere and cold storage. The use of gamma radiation helps to reduce the severity of the pathogen assist in the ripening process of fruits, even at low doses (0.25, 0.35 and 0.45 kGy) chemical properties such as pH, soluble solids, acid ascorbic, titratable acidity and also the quality parameters of the pulp showed no damage that are ideal for trade and consumption of mangoes. This treatment can be extended for use in the management of diseases such as natural infections for penducular rot complex that has as one of L. theobroma pathogens involved. PMID:26413068

  13. Radiation damage and charge collection effects in Si(Li) gamma-ray detectors

    NASA Astrophysics Data System (ADS)

    Hull, Ethan L.; Pehl, Richard H.; Tindall, Craig; Luke, Paul N.; Kurfess, James D.

    2003-01-01

    The spectroscopy performance of 6-mm thick Si(Li) planar detectors was studied as a function of operating temperature and electric field. The energy resolution of the 662-keV gamma-ray peak from a 137Cs source was used to monitor the spectroscopy performance of the detectors. The efficiency, depletion voltage, leakage current, and noise were also monitored. The effects of radiation damage caused by 200-MeV protons were studied to determine the viability of operation in space. Four detectors, two maintained at 88 K and two maintained at 212 K, were irradiated to a fluence of 8.710 8 p/cm 2. No effects were observed. The two detectors irradiated at 212 K were subsequently irradiated with an additional 8.710 9 p/cm 2, again at 212 K. These detectors then exhibited slight energy resolution degradation. No other radiation damage effects were observed. The resolution degradation increased at higher operating temperature and decreased with higher electric field. Cycling the detectors to room temperature for 14 h eliminated the resolution degradation. The resolution of these detectors is limited by the combination of ballistic deficit and parallel noise in the 220 K range. A significant decrease in the gamma-ray peak count rate, almost certainly caused by surface channel effects, was the most dramatic temperature-dependent effect observed.

  14. Decay strength distributions in {sup 12}C({sup 12}C,{gamma}) radiative capture

    SciTech Connect

    Jenkins, D. G.; Fulton, B. R.; Marley, P.; Fox, S. P.; Glover, R.; Wadsworth, R.; Watson, D. L.; Courtin, S.; Haas, F.; Lebhertz, D.; Beck, C.; Papka, P.; Rousseau, M.; Sanchez i Zafra, A.; Hutcheon, D. A.; Davis, C.; Ottewell, D.; Pavan, M. M.; Pearson, J.; Ruiz, C.

    2007-10-15

    The heavy-ion radiative capture reaction, {sup 12}C({sup 12}C,{gamma}), has been investigated at energies both on- and off-resonance, with a particular focus on known resonances at E{sub c.m.}=6.0, 6.8, 7.5, and 8.0 MeV. Gamma rays detected in a BGO scintillator array were recorded in coincidence with {sup 24}Mg residues at the focal plane of the DRAGON recoil separator at TRIUMF. In this manner, the relative strength of all decay pathways through excited states up to the particle threshold could be examined for the first time. Isovector M1 transitions are found to be a important component of the radiative capture from the E{sub c.m.}=6.0 and 6.8 MeV resonances. Comparison with Monte Carlo simulations suggests that these resonances may have either J=0 or 2, with a preference for J=2. The higher energy resonances at E{sub c.m.}=7.5 and 8.0 MeV have a rather different decay pattern. The former is a clear candidate for a J=4 resonance, whereas the latter has a dominant J=4 character superposed on a J=2 resonant component underneath. The relationship between these resonances and the well-known quasimolecular resonances as well as resonances in breakup and electrofission of {sup 24}Mg into two {sup 12}C nuclei are discussed.

  15. Radiation grafting of methyl methacrylate monomer on natural rubber latex. [Gamma radiation

    SciTech Connect

    Sundardi, F.; Kadariah, S.

    1984-05-01

    A method of radiation grafting of methyl methacrylate (MMA) monomer on natural rubber (NR) latex has been studied. The irradiation dose in radiation emulsion polymerization of MMA monomer was lower compared to the irradiation dose for grafting of MMA monomer on NR latex, in order to obtain the same degree of conversion. This is due to the size of the rubber particles which are quite large and, hence, not sufficient to ensure an ideal emulsion polymerization. The irradiation dose for radiation grafting of MMA monomer on latex was around 300 krad to obtain a 75% degree of conversion. However, this irradiation dose was lower compared to the irradiation dose for bulk polymerization of MMA momomer, in order to obtain the same degree of conversion. This is due to the gel effect in the viscous media. Radiation grafting of MMA monomer on NR latex does not influence the pH of the latex, but influences the viscosity significantly. The viscosity of the NR latex increased with an increase in irradiation dose, due to the increase of the total solid content in the latex. The MMA monomer converted to P-MMA in NR latex was largely grafted on the NR, or at least insoluble in a solvent for P-MMA, such as acetone or toluene. The hardness of the pure gum vulcanizate increased with an increase in the degree of grafting or P-MMA content, but the other physical properties, such as tensile strength, modulus, elongation at break, and thermal stability, were not greatly influenced by the degree of grafting. 9 references, 3 figures, 5 tables.

  16. Study on the structure and electrical behaviour of zinc aluminate ceramics irradiated with gamma radiation

    NASA Astrophysics Data System (ADS)

    Abd El All, S.; Fawzy, Y. H. A.; Radwan, R. M.

    2007-09-01

    The preparation process of zinc aluminate (ZnAl2 O4) ceramic powder, as well as the sintering temperature have been consequently governed using scanning electron microscopy (SEM) and x-ray diffraction (XRD) techniques. A broad exothermic peak in the range 223-310 C is observed due to the crystallization of ZnAl2O4 powder. Then the final resultant powder was irradiated with gamma rays at different doses from 30 to 150 kGy. The effect of gamma irradiation on the structure and the electrical behaviour of ZnAl2O4 ceramics has been obtained. The induced changes in the structure have been studied via SEM, XRD and FTIR spectrometers. The obtained results reveal no changes in the spinel phase of ZnAl2O4, while some displacements of the constituent individual atoms for the irradiated samples are observed. The I-V characteristic curves and the dielectric properties of the prepared ceramic powder have been measured for unirradiated and irradiated samples. These curves exhibit nonlinearity of this type of ceramics, where the dc current gradually increases with the increase in the dose. The irradiation of ZnAl2O4 with gamma radiation was found to increase the nonlinearity of the I-V curves. The dielectric constant and loss were found to decrease as the dose increases. Therefore, the irradiation of ZnAl2O4 with gamma rays can improve its utility as an electronic protector in electrical circuits against sudden overvoltage.

  17. Effect of gamma radiation on the inactivation of aflatoxin B1 in food and feed crops

    PubMed Central

    Ghanem, I.; Orfi, M.; Shamma, M.

    2008-01-01

    Samples of food crops (peanut, peeled pistachio, unpeeled pistachio, rice, and corn) and feed (barley, bran, corn) were autoclave-sterilized, and inoculated with 106 of spore suspension of an isolate of Aspergillus flavus fungus known to produce aflatoxin B1 (AFB1) . Following a 10-day period of incubation at 27 C to allow for fungal growth, food and feed samples were irradiated with gamma radiation at the doses 4, 6, and 10 kGy. Results indicated that degradation of AFB1 was positively correlated with the increase in the applied dose of gamma ray for each tested sample. At a dose of 10 kGy percentages of AFB1 degradation reached highest values at 58.6, 68.8, 84.6, 81.1 and 87.8% for peanuts, peeled pistachios, unpeeled pistachios, corn and rice samples, respectively. In feed samples percentages of AFB1 degradation were 45, 66, and 90% in barley, 47, 75, and 86% in bran, and 31, 72, and 84% in corn for the doses of 4, 6, and 10 kGy, respectively. AFB1 degradation in food samples correlated negatively with oil content in irradiated samples. Thus, in peanuts, which contained the highest oil content, percentage of AFB1 degradation at 10 kGy was not more than 56.6%, whereas, the corresponding value in corn, which contained the lowest oil content, reached as high as 80%. The above results indicate the possibility of using gamma radiation as a means of degradation of AFB1 in food and feed crops to levels lower than the maximum allowed levels. PMID:24031308

  18. Pilot scale-up and shelf stability of hydrogel wound dressings obtained by gamma radiation

    NASA Astrophysics Data System (ADS)

    Soler, Dulce Mara; Rodrguez, Yanet; Correa, Hector; Moreno, Ailed; Carrizales, Lila

    2012-08-01

    This study is aimed of producing pilot batches of hydrogel wound dressings by gamma radiation and evaluating their shelf stability. Six batches of 3L capacity were prepared based on poly(vinyl pyrrolidone), agar and polyethylene glycol and they were dispensed in polyester trays, covered with polyester films and sealed in two types of materials: polyethylene bags and vacuum polyethylene bags. Dressings were formed in a single step process for the hydrogel formation and sterilization at 25-30 kGy gamma radiation dose in a JS-9500 Gamma Irradiator (Nordion, Canada). The six batches were initially physicochemical characterized in terms of dimensions and appearance, gel fraction, morphology analysis, hydrogel strength, moisture retention capability and swelling capacity. They were kept under two storage conditions: room temperature (T: 302 C/RH: 70 5%) and refrigerated temperature (T: 53 C) during 24 months and sterility test was performed. The appearance of membranes was transparent, clear, uncut and flexible; the gel fraction of batches was higher than 75% and the hydrogel surface showed a porous structure. There was a slow decrease of the compression rate 20% until 7 h and about 70% at 24 h. Moisture retention capability in 5 h was similar for all the batches, about 40% and 60% at 37 C and at room temperature respectively. The swelling of hydrogels in acidic media was strong and in alkaline media the weight variation remains almost stable until 24 h and then there is a loss of weight. The six batches remained sterile during the stability study in the conditions tested. The pilot batches were consistent from batch to batch and remained stable during 24 months.

  19. Latent murine gamma-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages.

    PubMed

    Flao, E; Husain, S M; Sample, J T; Woodland, D L; Blackman, M A

    2000-07-15

    Intranasal infection of mice with the murine gamma-herpesvirus MHV-68 results in an acute lytic infection in the lung, followed by the establishment of lifelong latency. Development of an infectious mononucleosis-like syndrome correlates with the establishment of latency and is characterized by splenomegaly and the appearance of activated CD8+ T cells in the peripheral blood. Interestingly, a large population of activated CD8+ T cells in the peripheral blood expresses the V beta 4+ element in their TCR. In this report we show that MHV-68 latency in the spleen after intranasal infection is harbored in three APC types: B cells, macrophages, and dendritic cells. Surprisingly, since latency has not previously been described in dendritic cells, these cells harbored the highest frequency of latent virus. Among B cells, latency was preferentially associated with activated B cells expressing the phenotype of germinal center B cells, thus formally linking the previously reported association of latency gene expression and germinal centers to germinal center B cells. Germinal center formation, however, was not required for the establishment of latency. Significantly, although three cell types were latently infected, the ability to stimulate V beta 4+CD8+ T cell hybridomas was limited to latently infected, activated B cells. PMID:10878386

  20. The diffuse galactic gamma radiation - The Compton contribution and component separation by energy interval and galactic coordinates

    NASA Technical Reports Server (NTRS)

    Kniffen, D. A.; Fichtel, C. E.

    1981-01-01

    The diffuse high-energy galactic gamma radiation to be expected from cosmic ray interactions with matter and photons is considered with particular emphasis on the contribution of Compton radiation from cosmic ray electrons. The intensity, spectrum and spatial distribution of the expected galactic gamma radiation are estimated based on models of the matter, cosmic ray and photon distributions to take into account the contributions of bremsstrahlung, high-energy cosmic-ray nucleon and interstellar matter interactions as well as Compton interactions between cosmic ray electrons and background photons. Results suggest that the Compton gamma ray contribution from cosmic ray electron interactions with galactic visible and infrared photons is substantially larger than previously believed. Analysis of the energy spectra and latitude dependence of the various sources reveals that the Compton radiation, bremsstrahlung and nuclear cosmic ray-matter interaction radiation should be separable, with Compton radiation dominating at energies from 10 to 100 MeV at galactic latitudes greater than several degrees. Results demonstrate the potential of gamma ray observations in studies of galactic structure, cosmic ray electrons and galactic photon density.