Acquisition of a natural resistance gene renders a clinical strain of methicillin-resistant Staphylococcus aureus resistant to the synthetic antibiotic linezolid.

PubMed

Toh, Seok-Ming; Xiong, Liqun; Arias, Cesar A; Villegas, Maria V; Lolans, Karen; Quinn, John; Mankin, Alexander S

2007-06-01

Linezolid, which targets the ribosome, is a new synthetic antibiotic that is used for treatment of infections caused by Gram-positive pathogens. Clinical resistance to linezolid, so far, has been developing only slowly and has involved exclusively target site mutations. We have discovered that linezolid resistance in a methicillin-resistant Staphylococcus aureus hospital strain from Colombia is determined by the presence of the cfr gene whose product, Cfr methyltransferase, modifies adenosine at position 2503 in 23S rRNA in the large ribosomal subunit. The molecular model of the linezolid-ribosome complex reveals localization of A2503 within the drug binding site. The natural function of cfr likely involves protection against natural antibiotics whose site of action overlaps that of linezolid. In the chromosome of the clinical strain, cfr is linked to ermB, a gene responsible for dimethylation of A2058 in 23S rRNA. Coexpression of these two genes confers resistance to all the clinically relevant antibiotics that target the large ribosomal subunit. The association of the ermB/cfr operon with transposon and plasmid genetic elements indicates its possible mobile nature. This is the first example of clinical resistance to the synthetic drug linezolid which involves a natural resistance gene with the capability of disseminating among Gram-positive pathogenic strains.

Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

PubMed

Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

2017-12-01

To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

RNA Cap Methyltransferase Activity Assay

PubMed Central

Trotman, Jackson B.; Schoenberg, Daniel R.

2018-01-01

Methyltransferases that methylate the guanine-N7 position of the mRNA 5′ cap structure are ubiquitous among eukaryotes and commonly encoded by viruses. Here we provide a detailed protocol for the biochemical analysis of RNA cap methyltransferase activity of biological samples. This assay involves incubation of cap-methyltransferase-containing samples with a [32P]G-capped RNA substrate and S-adenosylmethionine (SAM) to produce RNAs with N7-methylated caps. The extent of cap methylation is then determined by P1 nuclease digestion, thin-layer chromatography (TLC), and phosphorimaging. The protocol described here includes additional steps for generating the [32P]G-capped RNA substrate and for preparing nuclear and cytoplasmic extracts from mammalian cells. This assay is also applicable to analyzing the cap methyltransferase activity of other biological samples, including recombinant protein preparations and fractions from analytical separations and immunoprecipitation/pulldown experiments. PMID:29644259

Clonal Spread of 16S rRNA Methyltransferase-Producing Klebsiella pneumoniae ST37 with High Prevalence of ESBLs from Companion Animals in China

PubMed Central

Xia, Jing; Fang, Liang-Xing; Cheng, Ke; Xu, Guo-Hao; Wang, Xi-Ran; Liao, Xiao-Ping; Liu, Ya-Hong; Sun, Jian

2017-01-01

We screened 30 Klebsiella pneumoniae isolates from dogs and cats at a single animal hospital in Guangdong Province, China. Among them, 12 K. pneumoniae strains possessed high-level resistance to amikacin and gentamicin and these were screened for 16S rRNA methyltransferase (16S-RMTase) genes. And then the genes positive isolates were detected for ESBLs (extended spectrum β-lactamases) and analyzed by pulsed-field gel electrophoresis, multilocus sequence typing, PCR-based replicon typing and plasmid analysis. The genetic profiles of rmtB were also determined by PCR mapping. The twelve 16S-RMTase gene-positive isolates were rmtB (11/30) and armA (2/30) with one isolate carrying both genes. Extended spectrum β-lactamases genes were represented by blaCTX-M-55 (9/12), blaCTX-M-27 (2/12) and blaCTX-M-14 (1/12). The twelve 16S-RMTase containing strains were grouped into five clonal patterns and ST37 was the most prevalent sequence type. Ten rmtB-bearing plasmids conjugated successfully and all belonged to IncN and IncF (F33:A-:B-) incompatibility groups. Nine of the transconjugants carried a 97 kb plasmid and the other harbored both ∼60 and ∼200 kb plasmids. rmtB and blaCTX-M-55 were present on the same plasmid and indicated the co-transfer of these two genes, with the rmtB gene showing highly relevant relationships with IS26 and Tn3. Our findings suggested a high prevalence of 16S-RMTase genes in K. pneumonia ST37 from dogs and cats. Additional studies are needed to trace the evolutionary path of this type of resistance among the K. pneumonia isolates, and to determine whether they have been transferred to humans. PMID:28446899

Linezolid-Resistant Staphylococcus aureus Strain 1128105, the First Known Clinical Isolate Possessing the cfr Multidrug Resistance Gene

PubMed Central

Zuill, Douglas E.; Scharn, Caitlyn R.; Deane, Jennifer; Sahm, Daniel F.; Denys, Gerald A.; Goering, Richard V.; Shaw, Karen J.

2014-01-01

The Cfr methyltransferase confers resistance to six classes of drugs which target the peptidyl transferase center of the 50S ribosomal subunit, including some oxazolidinones, such as linezolid (LZD). The mobile cfr gene was identified in European veterinary isolates from the late 1990s, although the earliest report of a clinical cfr-positive strain was the 2005 Colombian methicillin-resistant Staphylococcus aureus (MRSA) isolate CM05. Here, through retrospective analysis of LZDr clinical strains from a U.S. surveillance program, we identified a cfr-positive MRSA isolate, 1128105, from January 2005, predating CM05 by 5 months. Molecular typing of 1128105 revealed a unique pulsed-field gel electrophoresis (PFGE) profile most similar to that of USA100, spa type t002, and multilocus sequence type 5 (ST5). In addition to cfr, LZD resistance in 1128105 is partially attributed to the presence of a single copy of the 23S rRNA gene mutation T2500A. Transformation of the ∼37-kb conjugative p1128105 cfr-bearing plasmid from 1128105 into S. aureus ATCC 29213 background strains was successful in recapitulating the Cfr antibiogram, as well as resistance to aminoglycosides and trimethoprim. A 7-kb cfr-containing region of p1128105 possessed sequence nearly identical to that found in the Chinese veterinary Proteus vulgaris isolate PV-01 and in U.S. clinical S. aureus isolate 1900, although the presence of IS431-like sequences is unique to p1128105. The cfr gene environment in this early clinical cfr-positive isolate has now been identified in Gram-positive and Gram-negative strains of clinical and veterinary origin and has been associated with multiple mobile elements, highlighting the versatility of this multidrug resistance gene and its potential for further dissemination. PMID:25155597

Yeast proteins Gar1p, Nop1p, Npl3p, Nsr1p, and Rps2p are natively methylated and are substrates of the arginine methyltransferase Hmt1p.

PubMed

Yagoub, Daniel; Hart-Smith, Gene; Moecking, Jonas; Erce, Melissa A; Wilkins, Marc R

2015-09-01

The Hmt1 methyltransferase is the predominant arginine methyltransferase in Saccharomyces cerevisiae. There are 18 substrate proteins described for this methyltransferase, however native sites of methylation have only been identified on two of these proteins. Here we used peptide immunoaffinity enrichment, followed by LC-ETD-MS/MS, to discover 21 native sites of arginine methylation on five putative Hmt1 substrate proteins, namely Gar1p (H/ACA ribonucleoprotein complex subunit 1), Nop1p (rRNA 2'-O-methyltransferase fibrillarin), Npl3p (nucleolar protein 3), Nsr1p (nuclear localization sequence-binding protein), and Rps2p (40S ribosomal protein S2). The sites, many of which were found to be mono- or di-methylated, were predominantly found in RGG (Arg-Gly-Gly) motifs. Heavy methyl-SILAC validated the majority of these peptides. The above proteins, and relevant sites of methylation, were subsequently validated by in vitro methylation with recombinant Hmt1. This brings the total of Hmt1 substrate proteins for which native methylation sites have been identified to five. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of a cfr(B) Variant in German Enterococcus faecium Clinical Isolates and the Impact on Linezolid Resistance in Enterococcus spp.

PubMed

Bender, Jennifer K; Fleige, Carola; Klare, Ingo; Fiedler, Stefan; Mischnik, Alexander; Mutters, Nico T; Dingle, Kate E; Werner, Guido

2016-01-01

The National Reference Centre for Staphylococci and Enterococci in Germany has received an increasing number of clinical linezolid-resistant E. faecium isolates in recent years. Five isolates harbored a cfr(B) variant gene locus the product of which is capable of conferring linezolid resistance. The cfr(B)-like methyltransferase gene was also detected in Clostridium difficile. Antimicrobial susceptibility was determined for cfr(B)-positive and linezolid-resistant E. faecium isolates and two isogenic C. difficile strains. All strains were subjected to whole genome sequencing and analyzed with respect to mutations in the 23S rDNA, rplC, rplD and rplV genes and integration sites of the cfr(B) variant locus. To evaluate methyltransferase function, the cfr(B) variant of Enterococcus and Clostridium was expressed in both E. coli and Enterococcus spp. Ribosomal target site mutations were detected in E. faecium strains but absent in clostridia. Sequencing revealed 99.9% identity between cfr(B) of Enterococcus and cfr of Clostridium. The methyltransferase gene is encoded by transposon Tn6218 which was present in C. difficile Ox3196, truncated in some E. faecium and absent in C. difficile Ox3206. The latter finding explains the lack of linezolid and chloramphenicol resistance in C. difficile Ox3206 and demonstrates for the first time a direct correlation of elevated linezolid MICs in C. difficile upon cfr acquisition. Tn6218 insertion sites revealed novel target loci for integration, both within the bacterial chromosome and as an integral part of plasmids. Importantly, the very first plasmid-association of a cfr(B) variant was observed. Although we failed to measure cfr(B)-mediated resistance in transformed laboratory strains the occurrence of the multidrug resistance gene cfr on putatively highly mobile and/or extrachromosomal DNA in clinical isolates is worrisome with respect to dissemination of antibiotic resistances.

Detection of a cfr(B) Variant in German Enterococcus faecium Clinical Isolates and the Impact on Linezolid Resistance in Enterococcus spp.

PubMed Central

Fleige, Carola; Klare, Ingo; Fiedler, Stefan; Mischnik, Alexander; Mutters, Nico T.; Dingle, Kate E.; Werner, Guido

2016-01-01

The National Reference Centre for Staphylococci and Enterococci in Germany has received an increasing number of clinical linezolid-resistant E. faecium isolates in recent years. Five isolates harbored a cfr(B) variant gene locus the product of which is capable of conferring linezolid resistance. The cfr(B)-like methyltransferase gene was also detected in Clostridium difficile. Antimicrobial susceptibility was determined for cfr(B)-positive and linezolid-resistant E. faecium isolates and two isogenic C. difficile strains. All strains were subjected to whole genome sequencing and analyzed with respect to mutations in the 23S rDNA, rplC, rplD and rplV genes and integration sites of the cfr(B) variant locus. To evaluate methyltransferase function, the cfr(B) variant of Enterococcus and Clostridium was expressed in both E. coli and Enterococcus spp. Ribosomal target site mutations were detected in E. faecium strains but absent in clostridia. Sequencing revealed 99.9% identity between cfr(B) of Enterococcus and cfr of Clostridium. The methyltransferase gene is encoded by transposon Tn6218 which was present in C. difficile Ox3196, truncated in some E. faecium and absent in C. difficile Ox3206. The latter finding explains the lack of linezolid and chloramphenicol resistance in C. difficile Ox3206 and demonstrates for the first time a direct correlation of elevated linezolid MICs in C. difficile upon cfr acquisition. Tn6218 insertion sites revealed novel target loci for integration, both within the bacterial chromosome and as an integral part of plasmids. Importantly, the very first plasmid-association of a cfr(B) variant was observed. Although we failed to measure cfr(B)-mediated resistance in transformed laboratory strains the occurrence of the multidrug resistance gene cfr on putatively highly mobile and/or extrachromosomal DNA in clinical isolates is worrisome with respect to dissemination of antibiotic resistances. PMID:27893790

Characterization of Zea mays endosperm C-24 sterol methyltransferase: one of two types of sterol methyltransferase in higher plants.

PubMed

Grebenok, R J; Galbraith, D W; Penna, D D

1997-08-01

We report the characterization of a higher-plant C-24 sterol methyltransferase by yeast complementation. A Zea mays endosperm expressed sequence tag (EST) was identified which, upon complete sequencing, showed 46% identity to the yeast C-24 methyltransferase gene (ERG6) and 75% and 37% amino acid identity to recently isolated higher-plant sterol methyltransferases from soybean and Arabidopsis, respectively. When placed under GALA regulation, the Z. mays cDNA functionally complemented the erg6 mutation, restoring ergosterol production and conferring resistance to cycloheximide. Complementation was both plasmid-dependent and galactose-inducible. The Z. mays cDNA clone contains an open reading frame encoding a 40 kDa protein containing motifs common to a large number of S-adenosyl-L-methionine methyltransferases (SMTs). Sequence comparisons and functional studies of the maize, soybean and Arabidopsis cDNAs indicates two types of C-24 SMTs exist in higher plants.

Small Molecule Inhibitors That Selectively Block Dengue Virus Methyltransferase*

PubMed Central

Lim, Siew Pheng; Sonntag, Louis Sebastian; Noble, Christian; Nilar, Shahul H.; Ng, Ru Hui; Zou, Gang; Monaghan, Paul; Chung, Ka Yan; Dong, Hongping; Liu, Boping; Bodenreider, Christophe; Lee, Gladys; Ding, Mei; Chan, Wai Ling; Wang, Gang; Jian, Yap Li; Chao, Alexander Theodore; Lescar, Julien; Yin, Zheng; Vedananda, T. R.; Keller, Thomas H.; Shi, Pei-Yong

2011-01-01

Crystal structure analysis of Flavivirus methyltransferases uncovered a flavivirus-conserved cavity located next to the binding site for its cofactor, S-adenosyl-methionine (SAM). Chemical derivatization of S-adenosyl-homocysteine (SAH), the product inhibitor of the methylation reaction, with substituents that extend into the identified cavity, generated inhibitors that showed improved and selective activity against dengue virus methyltransferase (MTase), but not related human enzymes. Crystal structure of dengue virus MTase with a bound SAH derivative revealed that its N6-substituent bound in this cavity and induced conformation changes in residues lining the pocket. These findings demonstrate that one of the major hurdles for the development of methyltransferase-based therapeutics, namely selectivity for disease-related methyltransferases, can be overcome. PMID:21147775

Expression of exogenous DNA methyltransferases: application in molecular and cell biology.

PubMed

Dyachenko, O V; Tarlachkov, S V; Marinitch, D V; Shevchuk, T V; Buryanov, Y I

2014-02-01

DNA methyltransferases might be used as powerful tools for studies in molecular and cell biology due to their ability to recognize and modify nitrogen bases in specific sequences of the genome. Methylation of the eukaryotic genome using exogenous DNA methyltransferases appears to be a promising approach for studies on chromatin structure. Currently, the development of new methods for targeted methylation of specific genetic loci using DNA methyltransferases fused with DNA-binding proteins is especially interesting. In the present review, expression of exogenous DNA methyltransferase for purposes of in vivo analysis of the functional chromatin structure along with investigation of the functional role of DNA methylation in cell processes are discussed, as well as future prospects for application of DNA methyltransferases in epigenetic therapy and in plant selection.

COBALAMIN- AND COBAMIDE-DEPENDENT METHYLTRANSFERASES

PubMed Central

Matthews, Rowena G.; Koutmos, Markos; Datta, Supratim

2008-01-01

Methyltransferases that employ cobalamin cofactors, or their analogues the cobamides, as intermediates in catalysis of methyl transfer play vital roles in energy generation in anaerobic unicellular organisms. In a broader range of organisms they are involved in the conversion of homocysteine to methionine. Although the individual methyl transfer reactions catalyzed are simple SN2 displacements, the required change in coordination at the cobalt of the cobalamin or cobamide cofactors and the lability of the reduced Co+1 intermediates introduces the necessity for complex conformational changes during the catalytic cycle. Recent spectroscopic and structural studies on several of these methyltransferases have helped to reveal the strategies by which these conformational changes are facilitated and controlled. PMID:19059104

A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase

DOE PAGES

Ticak, Tomislav; Kountz, D. J.; Girosky, K. E.; ...

2014-10-13

COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptorsmore » such as nitrate or fumarate, producing dimethylglycine and CO 2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. Additionally, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. Lastly, they are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.« less

Structural Chemistry of Human RNA Methyltransferases.

PubMed

Schapira, Matthieu

2016-03-18

RNA methyltransferases (RNMTs) play important roles in RNA stability, splicing, and epigenetic mechanisms. They constitute a promising target class that is underexplored by the medicinal chemistry community. Information of relevance to drug design can be extracted from the rich structural coverage of human RNMTs. In this work, the structural chemistry of this protein family is analyzed in depth. Unlike most methyltransferases, RNMTs generally feature a substrate-binding site that is largely open on the cofactor-binding pocket, favoring the design of bisubstrate inhibitors. Substrate purine or pyrimidines are often sandwiched between hydrophobic walls that can accommodate planar ring systems. When the substrate base is laying on a shallow surface, a 5' flanking base is sometimes anchored in a druggable cavity. The cofactor-binding site is structurally more diverse than in protein methyltransferases and more druggable in SPOUT than in Rossman-fold enzymes. Finally, conformational plasticity observed both at the substrate and cofactor binding sites may be a challenge for structure-based drug design. The landscape drawn here may inform ongoing efforts toward the discovery of the first human RNMT inhibitors.

The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

PubMed

Sardana, Richa; White, Joshua P; Johnson, Arlen W

2013-06-01

Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

Chemical Probes of Histone Lysine Methyltransferases

PubMed Central

2015-01-01

Growing evidence suggests that histone methyltransferases (HMTs, also known as protein methyltransferases (PMTs)) play an important role in diverse biological processes and human diseases by regulating gene expression and the chromatin state. Therefore, HMTs have been increasingly recognized by the biomedical community as a class of potential therapeutic targets. High quality chemical probes of HMTs, as tools for deciphering their physiological functions and roles in human diseases and testing therapeutic hypotheses, are critical for advancing this promising field. In this review, we focus on the discovery, characterization, and biological applications of chemical probes for HMTs. PMID:25423077

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

RNA-methyltransferase TrmA is a dual-specific enzyme responsible for C5-methylation of uridine in both tmRNA and tRNA

PubMed Central

Ranaei-Siadat, Ehsan; Fabret, Céline; Seijo, Bili; Dardel, Frédéric; Grosjean, Henri; Nonin-Lecomte, Sylvie

2013-01-01

In bacteria, trans-translation rescues stalled ribosomes by the combined action of tmRNA (transfer-mRNA) and its associated protein SmpB. The tmRNA 5′ and 3′ ends fold into a tRNA-like domain (TLD), which shares structural and functional similarities with tRNAs. As in tRNAs, the UUC sequence of the T-arm of the TLD is post-transcriptionally modified to m5UψC. In tRNAs of gram-negative bacteria, formation of m5U is catalyzed by the SAM-dependent methyltransferase TrmA, while formation of m5U at two different positions in rRNA is catalyzed by distinct site-specific methyltransferases RlmC and RlmD. Here, we show that m5U formation in tmRNAs is exclusively due to TrmA and should be considered as a dual-specific enzyme. The evidence comes from the lack of m5U in purified tmRNA or TLD variants recovered from an Escherichia coli mutant strain deleted of the trmA gene. Detection of m5U in RNA was performed by NMR analysis. PMID:23603891

Protein arginine N-methyltransferase 1 promotes the proliferation and metastasis of hepatocellular carcinoma cells.

PubMed

Gou, Qing; He, ShuJiao; Zhou, ZeJian

2017-02-01

Hepatocellular carcinoma is the most common subtype of liver cancer. Protein arginine N-methyltransferase 1 was shown to be upregulated in various cancers. However, the role of protein arginine N-methyltransferase 1 in hepatocellular carcinoma progression remains incompletely understood. We investigated the clinical and functional significance of protein arginine N-methyltransferase 1 in a series of clinical hepatocellular carcinoma samples and a panel of hepatocellular carcinoma cell lines. We performed suppression analysis of protein arginine N-methyltransferase 1 using small interfering RNA to determine the biological roles of protein arginine N-methyltransferase 1 in hepatocellular carcinoma. In addition, the expression of epithelial-mesenchymal transition indicators was verified by western blotting in hepatocellular carcinoma cell lines after small interfering RNA treatment. Protein arginine N-methyltransferase 1 expression was found to be significantly upregulated in hepatocellular carcinoma cell lines and clinical tissues. Moreover, downregulation of protein arginine N-methyltransferase 1 in hepatocellular carcinoma cells by small interfering RNA could inhibit cell proliferation, migration, and invasion in vitro. These results indicate that protein arginine N-methyltransferase 1 may contribute to hepatocellular carcinoma progression and serves as a promising target for the treatment of hepatocellular carcinoma patients.

Evolution of novel O-methyltransferases from the Vanilla planifolia caffeic acid O-methyltransferase.

PubMed

Li, Huaijun Michael; Rotter, David; Hartman, Thomas G; Pak, Fulya E; Havkin-Frenkel, Daphna; Belanger, Faith C

2006-06-01

The biosynthesis of many plant secondary compounds involves the methylation of one or more hydroxyl groups, catalyzed by O-methyltransferases (OMTs). Here, we report the characterization of two OMTs, Van OMT-2 and Van OMT-3, from the orchid Vanilla planifolia Andrews. These enzymes catalyze the methylation of a single outer hydroxyl group in substrates possessing a 1,2,3-trihydroxybenzene moiety, such as methyl gallate and myricetin. This is a substrate requirement not previously reported for any OMTs. Based on sequence analysis these enzymes are most similar to caffeic acid O-methyltransferases (COMTs), but they have negligible activity with typical COMT substrates. Seven of 12 conserved substrate-binding residues in COMTs are altered in Van OMT-2 and Van OMT-3. Phylogenetic analysis of the sequences suggests that Van OMT-2 and Van OMT-3 evolved from the V. planifolia COMT. These V. planifolia OMTs are new instances of COMT-like enzymes with novel substrate preferences.

Challenges in profiling and lead optimization of drug discovery for methyltransferases.

PubMed

Horiuchi, Kurumi Y

2015-11-01

The importance of epigenetics in the initiation and progression of disease has attracted many investigators to incorporate this novel and exciting field in drug development. Protein methyltransferases are one of the target classes which have gained attention as potential therapeutic targets after promising results of inhibitors for EZH2 and DOT1L in clinical trials. There are many technologies developed in order to find small molecule inhibitors for protein methyltransferases. However, in contrast to high throughput screening, profiling against different methyltransferases is challenging since each enzyme has a different substrate preference so that it is hard to profile in one assay format. Here, different technologies for methyltransferase assays will be overviewed, and the advantages and disadvantages of each will be discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization of the Drosophila protein arginine methyltransferases DART1 and DART4.

PubMed

Boulanger, Marie-Chloé; Miranda, Tina Branscombe; Clarke, Steven; Di Fruscio, Marco; Suter, Beat; Lasko, Paul; Richard, Stéphane

2004-04-15

The role of arginine methylation in Drosophila melanogaster is unknown. We identified a family of nine PRMTs (protein arginine methyltransferases) by sequence homology with mammalian arginine methyltransferases, which we have named DART1 to DART9 ( Drosophila arginine methyltransferases 1-9). In keeping with the mammalian PRMT nomenclature, DART1, DART4, DART5 and DART7 are the putative homologues of PRMT1, PRMT4, PRMT5 and PRMT7. Other DART family members have a closer resemblance to PRMT1, but do not have identifiable homologues. All nine genes are expressed in Drosophila at various developmental stages. DART1 and DART4 have arginine methyltransferase activity towards substrates, including histones and RNA-binding proteins. Amino acid analysis of the methylated arginine residues confirmed that both DART1 and DART4 catalyse the formation of asymmetrical dimethylated arginine residues and they are type I arginine methyltransferases. The presence of PRMTs in D. melanogaster suggest that flies are a suitable genetic system to study arginine methylation.

Structure and function of flavivirus NS5 methyltransferase.

PubMed

Zhou, Yangsheng; Ray, Debashish; Zhao, Yiwei; Dong, Hongping; Ren, Suping; Li, Zhong; Guo, Yi; Bernard, Kristen A; Shi, Pei-Yong; Li, Hongmin

2007-04-01

The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m7GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA-->m7GpppA-->m7GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m7GpppA-RNA can be readily methylated to m7GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 A resolution showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K61-D146-K182-E218 motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.

Structure and Function of Flavivirus NS5 Methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou,Y.; Ray, D.; Zhao, Y.

2007-01-01

The plus-strand RNA genome of flavivirus contains a 5' terminal cap 1 structure (m{sup 7}GpppAmG). The flaviviruses encode one methyltransferase, located at the N-terminal portion of the NS5 protein, to catalyze both guanine N-7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus methyltransferases from dengue, yellow fever, and West Nile virus (WNV) sequentially generate GpppA {yields} m{sup 7}GpppA {yields} m{sup 7}GpppAm. The 2'-O methylation can be uncoupled from the N-7 methylation, since m{sup 7}GpppA-RNA can be readily methylated to m{sup 7}GpppAm-RNA. Despite exhibiting two distinct methylation activities, the crystal structure of WNV methyltransferase at 2.8 {angstrom} resolution showedmore » a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. Therefore, substrate GpppA-RNA should be repositioned to accept the N-7 and 2'-O methyl groups from SAM during the sequential reactions. Electrostatic analysis of the WNV methyltransferase structure showed that, adjacent to the SAM-binding pocket, is a highly positively charged surface that could serve as an RNA binding site during cap methylations. Biochemical and mutagenesis analyses show that the N-7 and 2'-O cap methylations require distinct buffer conditions and different side chains within the K{sub 61}-D{sub 146}-K{sub 182}-E{sub 218} motif, suggesting that the two reactions use different mechanisms. In the context of complete virus, defects in both methylations are lethal to WNV; however, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N-7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel target for flavivirus therapy.« less

DNA methyltransferase-3 like protein expression in various histological types of testicular germ cell tumor.

PubMed

Matsuoka, Taeko; Kawai, Koji; Ando, Satoshi; Sugita, Shintaro; Kandori, Shuya; Kojima, Takahiro; Miyazaki, Jun; Nishiyama, Hiroyuki

2016-05-01

DNA methyltransferase 3-like plays an important role in germ cell development. The aim of this study was to analyse the DNA methyltransferase 3-like protein expression in testicular germ cell tumors. The immunohistochemical expression of DNA methyltransferase 3-like was examined in 86 testicular germ cell tumor specimens in various clinical settings. The association between DNA methyltransferase 3-like expression and disease stage was analyzed. DNA methyltransferase 3-like was strongly expressed in seven of the eight pure embryonal carcinomas (87.5%). Partial DNA methyltransferase 3-like expression was observed in 6 of 23 (26.1%) pure seminomas. Various degrees of DNA methyltransferase 3-like expression was observed in all four pure yolk sac tumors, of which three were prepubertal yolk sac tumors. In mixed germ cell tumors, DNA methyltransferase 3-like protein was expressed in various degrees in elements of the embryonal carcinoma (14/18, 77.8%), seminoma (4/11, 36.4%), teratoma (4/7, 57.1%) and choriocarcinoma (3/3, 100%) but not in the yolk sac tumors (0/4). When DNA methyltransferase 3-like expression was analyzed according to disease stages, it was significantly correlated with advanced seminoma rather than Stage I seminoma (46.2 vs. 0%, P = 0.019), whereas there was no significant difference in the DNA methyltransferase 3-like-positive proportion between Stage I and advanced disease in the mixed germ cell tumors. Our findings suggest that DNA methyltransferase 3-like protein may play roles not only in the development of embryonal carcinoma but also in the development of advanced pure seminoma and pure yolk sac tumor. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Structural characterization of the mitomycin 7-O-methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Shanteri; Chang, Aram; Goff, Randal D.

2014-10-02

Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylationmore » to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.« less

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Characterization of the Drosophila protein arginine methyltransferases DART1 and DART4.

PubMed Central

Boulanger, Marie-Chloé; Miranda, Tina Branscombe; Clarke, Steven; Di Fruscio, Marco; Suter, Beat; Lasko, Paul; Richard, Stéphane

2004-01-01

The role of arginine methylation in Drosophila melanogaster is unknown. We identified a family of nine PRMTs (protein arginine methyltransferases) by sequence homology with mammalian arginine methyltransferases, which we have named DART1 to DART9 ( Drosophila arginine methyltransferases 1-9). In keeping with the mammalian PRMT nomenclature, DART1, DART4, DART5 and DART7 are the putative homologues of PRMT1, PRMT4, PRMT5 and PRMT7. Other DART family members have a closer resemblance to PRMT1, but do not have identifiable homologues. All nine genes are expressed in Drosophila at various developmental stages. DART1 and DART4 have arginine methyltransferase activity towards substrates, including histones and RNA-binding proteins. Amino acid analysis of the methylated arginine residues confirmed that both DART1 and DART4 catalyse the formation of asymmetrical dimethylated arginine residues and they are type I arginine methyltransferases. The presence of PRMTs in D. melanogaster suggest that flies are a suitable genetic system to study arginine methylation. PMID:14705965

Aurora-B Regulates RNA Methyltransferase NSUN2

PubMed Central

Sakita-Suto, Shiho; Kanda, Akifumi; Suzuki, Fumio; Sato, Sunao; Takata, Takashi

2007-01-01

Disassembly of the nucleolus during mitosis is driven by phosphorylation of nucleolar proteins. RNA processing stops until completion of nucleolar reformation in G1 phase. Here, we describe the RNA methyltransferase NSUN2, a novel substrate of Aurora-B that contains an NOL1/NOP2/sun domain. NSUN2 was concentrated in the nucleolus during interphase and was distributed in the perichromosome and cytoplasm during mitosis. Aurora-B phosphorylated NSUN2 at Ser139. Nucleolar proteins NPM1/nucleophosmin/B23 and nucleolin/C23 were associated with NSUN2 during interphase. In mitotic cells, association between NPM1 and NSUN2 was inhibited, but NSUN2-S139A was constitutively associated with NPM1. The Aurora inhibitor Hesperadin induced association of NSUN2 with NPM1 even in mitosis, despite the silver staining nucleolar organizer region disassembly. In vitro methylation experiments revealed that the Aurora-B-phosphorylation and the phosphorylation-mimic mutation (S139E) suppressed methyltransferase activities of NSUN2. These results indicate that Aurora-B participates to regulate the assembly of nucleolar RNA-processing machinery and the RNA methyltransferase activity of NSUN2 via phosphorylation at Ser139 during mitosis. PMID:17215513

Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster.

PubMed

Panikar, Chitra S; Rajpathak, Shriram N; Abhyankar, Varada; Deshmukh, Saniya; Deobagkar, Deepti D

2015-12-01

Drosophila melanogaster lacks DNMT1/DNMT3 based methylation machinery. Despite recent reports confirming the presence of low DNA methylation in Drosophila; little is known about the methyltransferase. Therefore, in this study, we have aimed to investigate the possible functioning of DNA methyltransferase in Drosophila. The 14 K oligo microarray slide was incubated with native cell extract from adult Drosophila to check the presence of the methyltransferase activity. After incubation under appropriate conditions, the methylated oligo sequences were identified by the binding of anti 5-methylcytosine monoclonal antibody. The antibody bound to the methylated oligos was detected using Cy3 labeled secondary antibody. Methylation sensitive restriction enzyme mediated PCR was used to assess the methylation at a few selected loci identified on the array. It could be seen that a few of the total oligos got methylated under the assay conditions. Analysis of methylated oligo sequences provides evidence for the presence of de novo methyltransferase activity and allows identification of its sequence specificity in adult Drosophila. With the help of methylation sensitive enzymes we could detect presence of CpC methylation in the selected genomic regions. This study reports presence of an active DNA methyltransferase in adult Drosophila, which exhibits sequence specificity confirmed by presence of asymmetric methylation at corresponding sites in the genomic DNA. It also provides an innovative approach to investigate methylation specificity of a native methyltransferase.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Characterization of a plasma membrane-associated prenylcysteine-directed alpha carboxyl methyltransferase in human neutrophils.

PubMed

Pillinger, M H; Volker, C; Stock, J B; Weissmann, G; Philips, M R

1994-01-14

Signal transduction in human neutrophils requires prenylcysteine-directed carboxyl methylation of ras-related low molecular weight GTP-binding proteins. We now report the subcellular localization and characterization of a neutrophil prenylcysteine alpha carboxyl methyltransferase. The highest carboxyl methyltransferase activity copurified with biotinylated neutrophil surface membranes, supporting a plasma membrane localization of the enzyme. Neutrophil nuclear fractions contained little or no methyltransferase activity. Methyltransferase activity was detergent-sensitive but could be reconstituted by removal of detergent in the presence of phosphatidyl choline and an anionic phospholipid. N-Acetyl-S-trans,trans-farnesyl-L-cysteine (AFC) and N-acetyl-S-all-trans-geranylgeranyl-L-cysteine (AGGC) were effective substrates for neutrophil prenylcysteine-directed methyltransferase; Vmax values for AFC and AGGC (16.4 and 22.1 pmol of methylated/mg protein/min, respectively) are among the highest yet reported. Although both GTP gamma S and the chemoattractant fMet-Leu-Phe stimulated methylation of ras-related proteins, neither affected methylation of AFC. These data suggest that neutrophil plasma membranes contain a phospholipid-dependent, prenylcysteine-directed carboxyl methyltransferase of relatively high specific activity that modifies ras-related protein substrates in the GTP-bound, activated state.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Shuhei; Department of Obstetrics and Gynecology, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8574; Sawatsubashi, Shun

2008-07-11

Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressedmore » EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly.« less

A Picrinine N-Methyltransferase Belongs to a New Family of γ-Tocopherol-Like Methyltransferases Found in Medicinal Plants That Make Biologically Active Monoterpenoid Indole Alkaloids1[OPEN

PubMed Central

Levac, Dylan; Cázares, Paulo; Yu, Fang

2016-01-01

Members of the Apocynaceae plant family produce a large number of monoterpenoid indole alkaloids (MIAs) with different substitution patterns that are responsible for their various biological activities. A novel N-methyltransferase involved in the vindoline pathway in Catharanthus roseus showing distinct similarity to γ-tocopherol C-methyltransferases was used in a bioinformatic screen of transcriptomes from Vinca minor, Rauvolfia serpentina, and C. roseus to identify 10 γ-tocopherol-like N-methyltransferases from a large annotated transcriptome database of different MIA-producing plant species (www.phytometasyn.ca). The biochemical function of two members of this group cloned from V. minor (VmPiNMT) and R. serpentina (RsPiNMT) have been characterized by screening their biochemical activities against potential MIA substrates harvested from the leaf surfaces of MIA-accumulating plants. The approach was validated by identifying the MIA picrinine from leaf surfaces of Amsonia hubrichtii as a substrate of VmPiNMT and RsPiNMT. Recombinant proteins were shown to have high substrate specificity and affinity for picrinine, converting it to N-methylpicrinine (ervincine). Developmental studies with V. minor and R. serpentina showed that RsPiNMT and VmPiNMT gene expression and biochemical activities were highest in younger leaf tissues. The assembly of at least 150 known N-methylated MIAs within members of the Apocynaceae family may have occurred as a result of the evolution of the γ-tocopherol-like N-methyltransferase family from γ-tocopherol methyltransferases. PMID:26848097

Monolignol 4-O-methyltransferases and uses thereof

DOEpatents

Liu, Chang-Jun; Bhuiya, Mohammad-Wadud; Zhang, Kewei

2014-11-18

Modified (iso)eugenol 4-O-methyltransferase enzymes having novel capacity for methylation of monolignols and reduction of lignin polymerization in plant cell wall are disclosed. Sequences encoding the modified enzymes are disclosed.

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

PubMed

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

Arsenic (+3 Oxidation State) Methyltransferase and the Methylation of Arsenicals

PubMed Central

Thomas, David J.; Li, Jiaxin; Waters, Stephen B.; Xing, Weibing; Adair, Blakely M.; Drobna, Zuzana; Devesa, Vicenta; Styblo, Miroslav

2008-01-01

Metabolic conversion of inorganic arsenic into methylated products is a multistep process that yields mono-, di-, and trimethylated arsenicals. In recent years, it has become apparent that formation of methylated metabolites of inorganic arsenic is not necessarily a detoxification process. Intermediates and products formed in this pathway may be more reactive and toxic than inorganic arsenic. Like all metabolic pathways, understanding the pathway for arsenic methylation involves identification of each individual step in the process and the characterization of the molecules which participate in each step. Among several arsenic methyltransferases that have been identified, arsenic (+3 oxidation state) methyltransferase is the one best characterized at the genetic and functional levels. This review focuses on phylogenetic relationships in the deuterostomal lineage for this enzyme and on the relation between genotype for arsenic (+3 oxidation state) methyltransferase and phenotype for conversion of inorganic arsenic to methylated metabolites. Two conceptual models for function of arsenic (+3 oxidation state) methyltransferase which posit different roles for cellular reductants in the conversion of inorganic arsenic to methylated metabolites are compared. Although each model accurately represents some aspects of enzyme’s role in the pathway for arsenic methylation, neither model is a fully satisfactory representation of all the steps in this metabolic pathway. Additional information on the structure and function of the enzyme will be needed to develop a more comprehensive model for this pathway. PMID:17202581

Discovery of reversible DNA methyltransferase and lysine methyltransferase G9a inhibitors with antitumoral in vivo efficacy.

PubMed

Rabal, Obdulia; San José-Eneriz, Edurne; Agirre, Xabier; Sánchez-Arias, Juan A; Vilas-Zornoza, Amaia; Ugarte, Ana; De Miguel, Irene; Miranda, Estibaliz; Garate, Leire; Fraga, Mario; Santamarina, Pablo; Fernandez Perez, Raul; Ordoñez, Raquel; Sáez, Elena; Roa, Sergio; Garcia-Barchino, Maria Jose; Martinez-Climent, Jose Angel; Liu, Yingying; Wu, Wei; Xu, Musheng; Prosper, Felipe; Oyarzabal, Julen

2018-06-28

Using knowledge- and structure-based approaches, we designed and synthesized reversible chemical probes that simultaneously inhibit the activity of two epigenetic targets, histone 3 lysine 9 methyltransferase (G9a) and DNA methyltransferases (DNMT), at nanomolar ranges. Enzymatic competition assays confirmed our design strategy: substrate competitive inhibitors. Next, an initial exploration around our hit 11 was pursued to identify an adequate tool compound for in vivo testing. In vitro treatment of different hematological neoplasia cell lines led to the identification of molecules with clear anti-proliferative efficacies (GI50 values in the nanomolar range). Based on epigenetic functional cellular responses (levels of lysine 9 methylation and 5-methylcytosine), an acceptable therapeutic window (around 1 log unit) and a suitable pharmacokinetic profile, 12 was selected for in vivo proof-of-concept (ref 53). Herein, 12 achieved a significant in vivo efficacy: 70% overall tumor growth inhibition of a human AML (Acute Myeloid Leukemia) xenograft in a mouse model.

Neural crest specification and migration independently require NSD3-related lysine methyltransferase activity

PubMed Central

Jacques-Fricke, Bridget T.; Gammill, Laura S.

2014-01-01

Neural crest precursors express genes that cause them to become migratory, multipotent cells, distinguishing them from adjacent stationary neural progenitors in the neurepithelium. Histone methylation spatiotemporally regulates neural crest gene expression; however, the protein methyltransferases active in neural crest precursors are unknown. Moreover, the regulation of methylation during the dynamic process of neural crest migration is unclear. Here we show that the lysine methyltransferase NSD3 is abundantly and specifically expressed in premigratory and migratory neural crest cells. NSD3 expression commences before up-regulation of neural crest genes, and NSD3 is necessary for expression of the neural plate border gene Msx1, as well as the key neural crest transcription factors Sox10, Snail2, Sox9, and FoxD3, but not gene expression generally. Nevertheless, only Sox10 histone H3 lysine 36 dimethylation requires NSD3, revealing unexpected complexity in NSD3-dependent neural crest gene regulation. In addition, by temporally limiting expression of a dominant negative to migratory stages, we identify a novel, direct requirement for NSD3-related methyltransferase activity in neural crest migration. These results identify NSD3 as the first protein methyltransferase essential for neural crest gene expression during specification and show that NSD3-related methyltransferase activity independently regulates migration. PMID:25318671

The O-methyltransferase PMT2 mediates methylation of pinosylvin in Scots pine.

PubMed

Paasela, Tanja; Lim, Kean-Jin; Pietiäinen, Milla; Teeri, Teemu H

2017-06-01

Heartwood extractives are important determinants of the natural durability of pine heartwood. The most important phenolic compounds affecting durability are the stilbenes pinosylvin and its monomethylether, which in addition have important functions as phytoalexins in active defense. A substantial portion of the synthesized pinosylvin is 3-methoxylated but the O-methyltransferase responsible for this modification has not been correctly identified. We studied the expression of the stilbene pathway during heartwood development as well as in response to wounding of xylem and UV-C treatment of needles. We isolated and enzymatically characterized a novel O-methyltransferase, PMT2. The methylated product was verified as pinosylvin monomethylether using ultra performance liquid chromatography-tandem mass spectrometry and high performance liquid chromatography analyses. The PMT2 enzyme was highly specific for stilbenes as substrate, in contrast to caffeoyl-CoA O-methyltransferase (CCoAOMT) and PMT1 that were multifunctional. Expression profile and multifunctional activity of CCoAOMT suggest that it might have additional roles outside lignin biosynthesis. PMT1 is not involved in the stilbene pathway and its biological function remains an open question. We isolated a new specific O-methyltransferase responsible for 3-methoxylation of pinosylvin. Expression of PMT2 closely follows stilbene biosynthesis during developmental and stress induction. We propose that PMT2 is responsible for pinosylvin methylation in Scots pine (Pinus sylvestris), instead of the previously characterized methyltransferase, PMT1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Floral benzenoid carboxyl methyltransferases: From in vitro to in planta function

PubMed Central

Effmert, Uta; Saschenbrecker, Sandra; Ross, Jeannine; Negre, Florence; Fraser, Chris M.; Noel, Joseph P.; Dudareva, Natalia; Piechulla, Birgit

2010-01-01

Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT’s three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in planta depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

Detection of a New cfr-Like Gene, cfr(B), in Enterococcus faecium Isolates Recovered from Human Specimens in the United States as Part of the SENTRY Antimicrobial Surveillance Program.

PubMed

Deshpande, Lalitagauri M; Ashcraft, Deborah S; Kahn, Heather P; Pankey, George; Jones, Ronald N; Farrell, David J; Mendes, Rodrigo E

2015-10-01

Two linezolid-resistant Enterococcus faecium isolates (MICs, 8 μg/ml) from unique patients of a medical center in New Orleans were included in this study. Isolates were initially investigated for the presence of mutations in the V domain of 23S rRNA genes and L3, L4, and L22 ribosomal proteins, as well as cfr. Isolates were subjected to pulsed-field gel electrophoresis (just one band difference), and one representative strain was submitted to whole-genome sequencing. Gene location was also determined by hybridization, and cfr genes were cloned and expressed in a Staphylococcus aureus background. The two isolates had one out of six 23S rRNA alleles mutated (G2576T), had wild-type L3, L4, and L22 sequences, and were positive for a cfr-like gene. The sequence of the protein encoded by the cfr-like gene was most similar (99.7%) to that found in Peptoclostridium difficile, which shared only 74.9% amino acid identity with the proteins encoded by genes previously identified in staphylococci and non-faecium enterococci and was, therefore, denominated Cfr(B). When expressed in S. aureus, the protein conferred a resistance profile similar to that of Cfr. Two copies of cfr(B) were chromosomally located and embedded in a Tn6218 similar to the cfr-carrying transposon described in P. difficile. This study reports the first detection of cfr genes in E. faecium clinical isolates in the United States and characterization of a new cfr variant, cfr(B). cfr(B) has been observed in mobile genetic elements in E. faecium and P. difficile, suggesting potential for dissemination. However, further analysis is necessary to access the resistance levels conferred by cfr(B) when expressed in enterococci. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Crystal structure of SAM-dependent methyltransferase from Pyrococcus horikoshii.

PubMed

Pampa, K J; Madan Kumar, S; Hema, M K; Kumara, Karthik; Naveen, S; Kunishima, Naoki; Lokanath, N K

2017-12-01

Methyltransferases (MTs) are enzymes involved in methylation that are needed to perform cellular processes such as biosynthesis, metabolism, gene expression, protein trafficking and signal transduction. The cofactor S-adenosyl-L-methionine (SAM) is used for catalysis by SAM-dependent methyltransferases (SAM-MTs). The crystal structure of Pyrococcus horikoshii SAM-MT was determined to a resolution of 2.1 Å using X-ray diffraction. The monomeric structure consists of a Rossmann-like fold (domain I) and a substrate-binding domain (domain II). The cofactor (SAM) molecule binds at the interface between adjacent subunits, presumably near to the active site(s) of the enzyme. The observed dimeric state might be important for the catalytic function of the enzyme.

Methylated nucleosides in tRNA and tRNA methyltransferases

PubMed Central

Hori, Hiroyuki

2014-01-01

To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon-anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed. PMID:24904644

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

Conservation and functional importance of carbon-oxygen hydrogen bonding in AdoMet-dependent methyltransferases.

PubMed

Horowitz, Scott; Dirk, Lynnette M A; Yesselman, Joseph D; Nimtz, Jennifer S; Adhikari, Upendra; Mehl, Ryan A; Scheiner, Steve; Houtz, Robert L; Al-Hashimi, Hashim M; Trievel, Raymond C

2013-10-16

S-adenosylmethionine (AdoMet)-based methylation is integral to metabolism and signaling. AdoMet-dependent methyltransferases belong to multiple distinct classes and share a catalytic mechanism that arose through convergent evolution; however, fundamental determinants underlying this shared methyl transfer mechanism remain undefined. A survey of high-resolution crystal structures reveals that unconventional carbon-oxygen (CH···O) hydrogen bonds coordinate the AdoMet methyl group in different methyltransferases irrespective of their class, active site structure, or cofactor binding conformation. Corroborating these observations, quantum chemistry calculations demonstrate that these charged interactions formed by the AdoMet sulfonium cation are stronger than typical CH···O hydrogen bonds. Biochemical and structural studies using a model lysine methyltransferase and an active site mutant that abolishes CH···O hydrogen bonding to AdoMet illustrate that these interactions are important for high-affinity AdoMet binding and transition-state stabilization. Further, crystallographic and NMR dynamics experiments of the wild-type enzyme demonstrate that the CH···O hydrogen bonds constrain the motion of the AdoMet methyl group, potentially facilitating its alignment during catalysis. Collectively, the experimental findings with the model methyltransferase and structural survey imply that methyl CH···O hydrogen bonding represents a convergent evolutionary feature of AdoMet-dependent methyltransferases, mediating a universal mechanism for methyl transfer.

RamA, a Protein Required for Reductive Activation of Corrinoid-dependent Methylamine Methyltransferase Reactions in Methanogenic Archaea*S⃞

PubMed Central

Ferguson, Tsuneo; Soares, Jitesh A.; Lienard, Tanja; Gottschalk, Gerhard; Krzycki, Joseph A.

2009-01-01

Archaeal methane formation from methylamines is initiated by distinct methyltransferases with specificity for monomethylamine, dimethylamine, or trimethylamine. Each methylamine methyltransferase methylates a cognate corrinoid protein, which is subsequently demethylated by a second methyltransferase to form methyl-coenzyme M, the direct methane precursor. Methylation of the corrinoid protein requires reduction of the central cobalt to the highly reducing and nucleophilic Co(I) state. RamA, a 60-kDa monomeric iron-sulfur protein, was isolated from Methanosarcina barkeri and is required for in vitro ATP-dependent reductive activation of methylamine:CoM methyl transfer from all three methylamines. In the absence of the methyltransferases, highly purified RamA was shown to mediate the ATP-dependent reductive activation of Co(II) corrinoid to the Co(I) state for the monomethylamine corrinoid protein, MtmC. The ramA gene is located near a cluster of genes required for monomethylamine methyltransferase activity, including MtbA, the methylamine-specific CoM methylase and the pyl operon required for co-translational insertion of pyrrolysine into the active site of methylamine methyltransferases. RamA possesses a C-terminal ferredoxin-like domain capable of binding two tetranuclear iron-sulfur proteins. Mutliple ramA homologs were identified in genomes of methanogenic Archaea, often encoded near methyltrophic methyltransferase genes. RamA homologs are also encoded in a diverse selection of bacterial genomes, often located near genes for corrinoid-dependent methyltransferases. These results suggest that RamA mediates reductive activation of corrinoid proteins and that it is the first functional archetype of COG3894, a family of redox proteins of unknown function. PMID:19043046

Association between TPMT*3C and decreased thiopurine S-methyltransferase activity in patients with neuromyelitis optica spectrum disorders in China.

PubMed

Gong, Xiaoqing; Mei, Shenghui; Li, Xindi; Li, Xingang; Zhou, Heng; Liu, Yonghong; Zhou, Anna; Yang, Li; Zhao, Zhigang; Zhang, Xinghu

2018-06-01

Thiopurines are effective drugs in treating neuromyelitis optica spectrum disorders and other diseases. Thiopurines' toxicity is mainly imputed to thiopurine S-methyltransferase activity. In Chinese population, the most common and important variation of thiopurine S-methyltransferase is TPMT*3C (rs1142345). This study aims to reveal the association between thiopurine S-methyltransferase activity and genetic polymorphisms of thiopurine S-methyltransferase in patients with neuromyelitis optica spectrum disorders in China. A liquid chromatography tandem mass/mass method was used to evaluate the thiopurine S-methyltransferase activity by using 6-mercapthioprine as the substrate in human erythrocyte haemolysate via 1 h incubation at 37 °C to form its methylated product 6-methylmercaptopurine. The amount of 6-methylmercaptopurine was adjusted by haematocrit and normalized to 8 × 10 8 erythrocytes. The selected polymorphisms of thiopurine S-methyltransferase were identified using MassARRAY system (Sequenom) and multiple SNaPshot technique. In 69 patients with neuromyelitis optica spectrum disorders, thiopurine S-methyltransferase activity was 80.29-154.53 (127.51 ± 16.83) pmol/h/8 × 10 8 erythrocytes. TPMT*3C (rs1142345) was associated with lower thiopurine S-methyltransferase activity (BETA = -25.37, P = 0.011). Other selected variants were not associated with thiopurine S-methyltransferase activity. TPMT*3C affects TPMT activity in Chinese patients with neuromyelitis optica spectrum disorders. Further studies are warranted to confirm the results. TPRs = thiopurines; NMOSD = neuromyelitis optica spectrum disorders; TPMT = thiopurine S-methyltransferase; LC-MS/MS = liquid chromatography tandem mass/mass; 6-MMP = 6-methylmercaptopurine; IS = internal standard; SNP = single nucleotide polymorphism; MAF = minor allele frequency; HWE = Hardy-Weinberg equilibrium; BETA = regression coefficients; UTR-3 = untranslated region 3.

Evolution of the Phosphatidylcholine Biosynthesis Pathways in Green Algae: Combinatorial Diversity of Methyltransferases.

PubMed

Hirashima, Takashi; Toyoshima, Masakazu; Moriyama, Takashi; Sato, Naoki

2018-01-01

Phosphatidylcholine (PC) is one of the most common phospholipids in eukaryotes, although some green algae such as Chlamydomonas reinhardtii are known to lack PC. Recently, we detected PC in four species in the genus Chlamydomonas: C. applanata NIES-2202, C. asymmetrica NIES-2207, C. debaryana NIES-2212, and C. sphaeroides NIES-2242. To reveal the PC biosynthesis pathways in green algae and the evolutionary scenario involved in their diversity, we analyzed the PC biosynthesis genes in these four algae using draft genome sequences. Homology searches suggested that PC in these species is synthesized by phosphoethanolamine-N-methyltransferase (PEAMT) and/or phosphatidylethanolamine-N-methyltransferase (PEMT), both of which are absent in C. reinhardtii. Recombinant PEAMTs from these algae showed methyltransferase activity for phosphoethanolamine but not for monomethyl phosphoethanolamine in vitro, in contrast to land plant PEAMT, which catalyzes the three methylations from phosphoethanolamine to phosphocholine. This suggested an involvement of other methyltransferases in PC biosynthesis. Here, we characterized the putative phospholipid-N-methyltransferase (PLMT) genes of these species by genetic and phylogenetic analysis. Complementation assays using a PC biosynthesis-deficient yeast suggested that the PLMTs of these algae can synthesize PC from phosphatidylethanolamine. These results indicated that the PC biosynthesis pathways in green algae differ from those of land plants, although the enzymes involved are homologous. Phylogenetic analysis suggested that the PEAMTs and PLMTs in these algae were inherited from the common ancestor of green algae. The absence of PC biosynthesis in many Chlamydomonas species is likely a result of parallel losses of PEAMT and PLMT in this genus.

Two distinct arginine methyltransferases are required for biogenesis of Sm-class ribonucleoproteins.

PubMed

Gonsalvez, Graydon B; Tian, Liping; Ospina, Jason K; Boisvert, François-Michel; Lamond, Angus I; Matera, A Gregory

2007-08-27

Small nuclear ribonucleoproteins (snRNPs) are core components of the spliceosome. The U1, U2, U4, and U5 snRNPs each contain a common set of seven Sm proteins. Three of these Sm proteins are posttranslationally modified to contain symmetric dimethylarginine (sDMA) residues within their C-terminal tails. However, the precise function of this modification in the snRNP biogenesis pathway is unclear. Several lines of evidence suggest that the methyltransferase protein arginine methyltransferase 5 (PRMT5) is responsible for sDMA modification of Sm proteins. We found that in human cells, PRMT5 and a newly discovered type II methyltransferase, PRMT7, are each required for Sm protein sDMA modification. Furthermore, we show that the two enzymes function nonredundantly in Sm protein methylation. Lastly, we provide in vivo evidence demonstrating that Sm protein sDMA modification is required for snRNP biogenesis in human cells.

Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity

PubMed Central

Rotili, Dante; Tarantino, Domenico; Marrocco, Biagina; Gros, Christina; Masson, Véronique; Poughon, Valérie; Ausseil, Fréderic; Chang, Yanqi; Labella, Donatella; Cosconati, Sandro; Di Maro, Salvatore; Novellino, Ettore; Schnekenburger, Michael; Grandjenette, Cindy; Bouvy, Celine; Diederich, Marc; Cheng, Xiaodong; Arimondo, Paola B.; Mai, Antonello

2014-01-01

Chemical manipulations performed on the histone H3 lysine 9 methyltransferases (G9a/GLP) inhibitor BIX-01294 afforded novel desmethoxyquinazolines able to inhibit the DNA methyltransferase DNMT3A at low micromolar levels without any significant inhibition of DNMT1 and G9a. In KG-1 cells such compounds, when tested at sub-toxic doses, induced the luciferase re-expression in a stable construct controlled by a cytomegalovirus (CMV) promoter silenced by methylation (CMV-luc assay). Finally, in human lymphoma U-937 and RAJI cells, the N-(1-benzylpiperidin-4-yl)-2-(4-phenylpiperazin-1-yl)quinazolin-4-amine induced the highest proliferation arrest and cell death induction starting from 10 µM, in agreement with its DNMT3A inhibitory potency. PMID:24810902

Site-specific bioalkylation of rapamycin by the RapM 16-O-methyltransferase.

PubMed

Law, Brian J C; Struck, Anna-Winona; Bennett, Matthew R; Wilkinson, Barrie; Micklefield, Jason

2015-05-01

The methylation of natural products by S -adenosyl methionine (AdoMet, also known as SAM)-dependent methyltransferase enzymes is a common tailoring step in many biosynthetic pathways. The introduction of methyl substituents can affect the biological and physicochemical properties of the secondary metabolites produced. Recently it has become apparent that some AdoMet-dependent methyltransferases exhibit promiscuity and will accept AdoMet analogues enabling the transfer of alternative alkyl groups. In this study we have characterised a methyltransferase, RapM, which is involved in the biosynthesis of the potent immunosuppressive agent rapamycin. We have shown that recombinant RapM regioselectively methylates the C16 hydroxyl group of desmethyl rapamycin precursors in vitro and is promiscuous in accepting alternative co-factors in addition to AdoMet. A coupled enzyme system was developed, including a mutant human enzyme methionine adenosyl transferase (MAT), along with RapM, which was used to prepare alkylated rapamycin derivatives (rapalogs) with alternative ethyl and allyl ether groups, derived from simple S -ethyl or S -allyl methionine analogues. There are two other methyltransferases RapI and RapQ which provide methyl substituents of rapamycin. Consequently, using the enzymatic approach described here, it should be possible to generate a diverse array of alkylated rapalogs, with altered properties, that would be difficult to obtain by traditional synthetic approaches.

Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1*

PubMed Central

Lee, Byron H.; Yegnasubramanian, Srinivasan; Lin, Xiaohui; Nelson, William G.

2007-01-01

CpG island hypermethylation occurs in most cases of cancer, typically resulting in the transcriptional silencing of critical cancer genes. Procainamide has been shown to inhibit DNA methyltransferase activity and reactivate silenced gene expression in cancer cells by reversing CpG island hypermethylation. We report here that procainamide specifically inhibits the hemimethylase activity of DNA methyltransferase 1 (DNMT1), the mammalian enzyme thought to be responsible for maintaining DNA methylation patterns during replication. At micromolar concentrations, procainamide was found to be a partial competitive inhibitor of DNMT1, reducing the affinity of the enzyme for its two substrates, hemimethylated DNA and S-adenosyl-l-methionine. By doing so, procainamide significantly decreased the processivity of DNMT1 on hemimethylated DNA. Procainamide was not a potent inhibitor of the de novo methyltransferases DNMT3a and DNMT3b2. As further evidence of the specificity of procainamide for DNMT1, procainamide failed to lower genomic 5-methyl-2′-deoxycytidine levels in HCT116 colorectal cancer cells when DNMT1 was genetically deleted but significantly reduced genomic 5-methyl-2′-deoxycyti-dine content in parental HCT116 cells and in HCT116 cells where DNMT3b was genetically deleted. Because many reports have strongly linked DNMT1 with epigenetic alterations in carcinogenesis, procainamide may be a useful drug in the prevention of cancer. PMID:16230360

Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

PubMed

Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

2010-09-20

KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer. 2009 Elsevier GmbH. All rights reserved.

Two distinct arginine methyltransferases are required for biogenesis of Sm-class ribonucleoproteins

PubMed Central

Gonsalvez, Graydon B.; Tian, Liping; Ospina, Jason K.; Boisvert, François-Michel; Lamond, Angus I.; Matera, A. Gregory

2007-01-01

Small nuclear ribonucleoproteins (snRNPs) are core components of the spliceosome. The U1, U2, U4, and U5 snRNPs each contain a common set of seven Sm proteins. Three of these Sm proteins are posttranslationally modified to contain symmetric dimethylarginine (sDMA) residues within their C-terminal tails. However, the precise function of this modification in the snRNP biogenesis pathway is unclear. Several lines of evidence suggest that the methyltransferase protein arginine methyltransferase 5 (PRMT5) is responsible for sDMA modification of Sm proteins. We found that in human cells, PRMT5 and a newly discovered type II methyltransferase, PRMT7, are each required for Sm protein sDMA modification. Furthermore, we show that the two enzymes function nonredundantly in Sm protein methylation. Lastly, we provide in vivo evidence demonstrating that Sm protein sDMA modification is required for snRNP biogenesis in human cells. PMID:17709427

The genome-wide identification and transcriptional levels of DNA methyltransferases and demethylases in globe artichoke.

PubMed

Gianoglio, Silvia; Moglia, Andrea; Acquadro, Alberto; Comino, Cinzia; Portis, Ezio

2017-01-01

Changes to the cytosine methylation status of DNA, driven by the activity of C5 methyltransferases (C5-MTases) and demethylases, exert an important influence over development, transposon movement, gene expression and imprinting. Three groups of C5-MTase enzymes have been identified in plants, namely MET (methyltransferase 1), CMT (chromomethyltransferases) and DRM (domains rearranged methyltransferases). Here the repertoire of genes encoding C5-MTase and demethylase by the globe artichoke (Cynara cardunculus var. scolymus) is described, based on sequence homology, a phylogenetic analysis and a characterization of their functional domains. A total of ten genes encoding C5-MTase (one MET, five CMTs and four DRMs) and five demethylases was identified. An analysis of their predicted product's protein structure suggested an extensive level of conservation has been retained by the C5-MTases. Transcriptional profiling based on quantitative real time PCR revealed a number of differences between the genes encoding maintenance and de novo methyltransferases, sometimes in a tissue- or development-dependent manner, which implied a degree of functional specialization.

Monomethylioarsenicals are substratres for human arsenic (+3 oxidation state) methyltransferase

EPA Science Inventory

Monomethylthioarsenicals are substrates for human arsenic (+3 oxida1tion state) methyltransferase Methylated thioarsenicals are structural analogs of methylated oxyarsenic in which one or more oxygen atom bound t...

Transfer RNA methyltransferases from Thermoplasma acidophilum, a thermoacidophilic archaeon.

PubMed

Kawamura, Takuya; Anraku, Ryou; Hasegawa, Takahiro; Tomikawa, Chie; Hori, Hiroyuki

2014-12-23

We investigated tRNA methyltransferase activities in crude cell extracts from the thermoacidophilic archaeon Thermoplasma acidophilum. We analyzed the modified nucleosides in native initiator and elongator tRNAMet, predicted the candidate genes for the tRNA methyltransferases on the basis of the tRNAMet and tRNALeu sequences, and characterized Trm5, Trm1 and Trm56 by purifying recombinant proteins. We found that the Ta0997, Ta0931, and Ta0836 genes of T. acidophilum encode Trm1, Trm56 and Trm5, respectively. Initiator tRNAMet from T. acidophilum strain HO-62 contained G+, m1I, and m22G, which were not reported previously in this tRNA, and the m2G26 and m22G26 were formed by Trm1. In the case of elongator tRNAMet, our analysis showed that the previously unidentified G modification at position 26 was a mixture of m2G and m22G, and that they were also generated by Trm1. Furthermore, purified Trm1 and Trm56 could methylate the precursor of elongator tRNAMet, which has an intron at the canonical position. However, the speed of methyl-transfer by Trm56 to the precursor RNA was considerably slower than that to the mature transcript, which suggests that Trm56 acts mainly on the transcript after the intron has been removed. Moreover, cellular arrangements of the tRNA methyltransferases in T. acidophilum are discussed.

Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases

PubMed Central

Elhai, Jeff

2015-01-01

The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences. PMID:25789551

Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases.

PubMed

Elhai, Jeff

2015-03-17

The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences.

Identification of phosphomethylethanolamine N-methyltransferase from Arabidopsis and its role in choline and phospholipid metabolism.

PubMed

BeGora, Michael D; Macleod, Mitchell J R; McCarry, Brian E; Summers, Peter S; Weretilnyk, Elizabeth A

2010-09-17

Three sequential methylations of phosphoethanolamine (PEA) are required for the synthesis of phosphocholine (PCho) in plants. A cDNA encoding an N-methyltransferase that catalyzes the last two methylation steps was cloned from Arabidopsis by heterologous complementation of a Saccharomyces cerevisiae cho2, opi3 mutant. The cDNA encodes phosphomethylethanolamine N-methyltransferase (PMEAMT), a polypeptide of 475 amino acids that is organized as two tandem methyltransferase domains. PMEAMT shows 87% amino acid identity to a related enzyme, phosphoethanolamine N-methyltransferase, an enzyme in plants that catalyzes all three methylations of PEA to PCho. PMEAMT cannot use PEA as a substrate, but assays using phosphomethylethanolamine as a substrate result in both phosphodimethylethanolamine and PCho as products. PMEAMT is inhibited by the reaction products PCho and S-adenosyl-l-homocysteine, a property reported for phosphoethanolamine N-methyltransferase from various plants. An Arabidopsis mutant with a T-DNA insertion associated with locus At1g48600 showed no transcripts encoding PMEAMT. Shotgun lipidomic analyses of leaves of atpmeamt and wild-type plants generated phospholipid profiles showing the content of phosphatidylmethylethanolamine to be altered relative to wild type with the content of a 34:3 lipid molecular species 2-fold higher in mutant plants. In S. cerevisiae, an increase in PtdMEA in membranes is associated with reduced viability. This raises a question regarding the role of PMEAMT in plants and whether it serves to prevent the accumulation of PtdMEA to potentially deleterious levels.

Characterization of a candidate tetravalent vaccine based on 2'-O-methyltransferase mutants

PubMed Central

Züst, Roland; Li, Shi-Hua; Xie, Xuping; Velumani, Sumathy; Chng, Melissa; Toh, Ying-Xiu; Zou, Jing; Dong, Hongping; Shan, Chao; Pang, Jassia; Qin, Cheng-Feng; Newell, Evan W.; Shi, Pei-Yong

2018-01-01

Dengue virus (DENV) is one of the most widespread arboviruses. The four DENV serotypes infect about 400 million people every year, causing 96 million clinical dengue cases, of which approximately 500’000 are severe and potentially life-threatening. The only licensed vaccine has a limited efficacy and is only recommended in regions with high endemicity. We previously reported that 2’-O-methyltransferase mutations in DENV-1 and DENV-2 block their capacity to inhibit type I IFNs and render the viruses attenuated in vivo, making them amenable as vaccine strains; here we apply this strategy to all four DENV serotypes to generate a tetravalent, non-chimeric live-attenuated dengue vaccine. 2’-O-methyltransferase mutants of all four serotypes are highly sensitive to type I IFN inhibition in human cells. The tetravalent formulation is attenuated and immunogenic in mice and cynomolgus macaques and elicits a response that protects from virus challenge. These results show the potential of 2’-O-methyltransferase mutant viruses as a safe, tetravalent, non-chimeric dengue vaccine. PMID:29298302

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

A SAM-dependent methyltransferase cotranscribed with arsenate reductase alters resistance to peptidyl transferase center-binding antibiotics in Azospirillum brasilense Sp7.

PubMed

Singh, Sudhir; Singh, Chhaya; Tripathi, Anil Kumar

2014-05-01

The genome of Azospirillum brasilense harbors a gene encoding S-adenosylmethionine-dependent methyltransferase, which is located downstream of an arsenate reductase gene. Both genes are cotranscribed and translationally coupled. When they were cloned and expressed individually in an arsenate-sensitive strain of Escherichia coli, arsenate reductase conferred tolerance to arsenate; however, methyltransferase failed to do so. Sequence analysis revealed that methyltransferase was more closely related to a PrmB-type N5-glutamine methyltransferase than to the arsenate detoxifying methyltransferase ArsM. Insertional inactivation of prmB gene in A. brasilense resulted in an increased sensitivity to chloramphenicol and resistance to tiamulin and clindamycin, which are known to bind at the peptidyl transferase center (PTC) in the ribosome. These observations suggested that the inability of prmB:km mutant to methylate L3 protein might alter hydrophobicity in the antibiotic-binding pocket of the PTC, which might affect the binding of chloramphenicol, clindamycin, and tiamulin differentially. This is the first report showing the role of PrmB-type N5-glutamine methyltransferases in conferring resistance to tiamulin and clindamycin in any bacterium.

New enzymes from environmental cassette arrays: Functional attributes of a phosphotransferase and an RNA-methyltransferase

PubMed Central

Nield, Blair S.; Willows, Robert D.; Torda, Andrew E.; Gillings, Michael R.; Holmes, Andrew J.; Nevalainen, K.M. Helena; Stokes, H.W.; Mabbutt, Bridget C.

2004-01-01

By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7″) from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%–28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg2+-binding residues. Unlike related APH(4) or APH(7″) enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins. PMID:15152095

New enzymes from environmental cassette arrays: functional attributes of a phosphotransferase and an RNA-methyltransferase.

PubMed

Nield, Blair S; Willows, Robert D; Torda, Andrew E; Gillings, Michael R; Holmes, Andrew J; Nevalainen, K M Helena; Stokes, H W; Mabbutt, Bridget C

2004-06-01

By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7") from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%-28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg(2+)-binding residues. Unlike related APH(4) or APH(7") enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins.

Biosynthesis of estragole and methyl-eugenol in sweet basil (Ocimum basilicum L). Developmental and chemotypic association of allylphenol O-methyltransferase activities.

PubMed

Lewinsohn, E; Ziv-Raz, I; Dudai, N; Tadmor, Y; Lastochkin, E; Larkov, O; Chaimovitsh, D; Ravid, U; Putievsky, E; Pichersky, E; Shoham, Y

2000-12-07

Sweet basil (Ocimum basilicum L., Lamiaceae) is a common herb, used for culinary and medicinal purposes. The essential oils of different sweet basil chemotypes contain various proportions of the allyl phenol derivatives estragole (methyl chavicol), eugenol, and methyl eugenol, as well as the monoterpene alcohol linalool. To monitor the developmental regulation of estragole biosynthesis in sweet basil, an enzymatic assay for S-adenosyl-L-methionine (SAM):chavicol O-methyltransferase activity was developed. Young leaves display high levels of chavicol O-methyltransferase activity, but the activity was negligible in older leaves, indicating that the O-methylation of chavicol primarily occurs early during leaf development. The O-methyltransferase activities detected in different sweet basil genotypes differed in their substrate specificities towards the methyl acceptor substrate. In the high-estragole-containing chemotype R3, the O-methyltransferase activity was highly specific for chavicol, while eugenol was virtually not O-methylated. In contrast, chemotype 147/97, that contains equal levels of estragole and methyl eugenol, displayed O-methyltransferase activities that accepted both chavicol and eugenol as substrates, generating estragole and methyl eugenol, respectively. Chemotype SW that contains high levels of eugenol, but lacks both estragole and methyl eugenol, had apparently no allylphenol dependent O-methyltransferase activities. These results indicate the presence of at least two types of allylphenol-specific O-methyltransferase activities in sweet basil chemotypes, one highly specific for chavicol; and a different one that can accept eugenol as a substrate. The relative availability and substrate specificities of these O-methyltransferase activities biochemically rationalizes the variation in the composition of the essential oils of these chemotypes.

The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.

2012-03-26

Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whethermore » Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.« less

A glutamate/aspartate switch controls product specificity in a protein arginine methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Debler, Erik W.; Jain, Kanishk; Warmack, Rebeccah A.

Trypanosoma brucei PRMT7 (TbPRMT7) is a protein arginine methyltransferase (PRMT) that strictly monomethylates various substrates, thus classifying it as a type III PRMT. However, the molecular basis of its unique product specificity has remained elusive. Here, we present the structure of TbPRMT7 in complex with its cofactor product S-adenosyl-L-homocysteine (AdoHcy) at 2.8 Å resolution and identify a glutamate residue critical for its monomethylation behavior. TbPRMT7 comprises the conserved methyltransferase and β-barrel domains, an N-terminal extension, and a dimerization arm. The active site at the interface of the N-terminal extension, methyltransferase, and β-barrel domains is stabilized by the dimerization arm ofmore » the neighboring protomer, providing a structural basis for dimerization as a prerequisite for catalytic activity. Mutagenesis of active-site residues highlights the importance of Glu181, the second of the two invariant glutamate residues of the double E loop that coordinate the target arginine in substrate peptides/proteins and that increase its nucleophilicity. Strikingly, mutation of Glu181 to aspartate converts TbPRMT7 into a type I PRMT, producing asymmetric dimethylarginine (ADMA). Isothermal titration calorimetry (ITC) using a histone H4 peptide showed that the Glu181Asp mutant has markedly increased affinity for monomethylated peptide with respect to the WT, suggesting that the enlarged active site can favorably accommodate monomethylated peptide and provide sufficient space for ADMA formation. In conclusion, these findings yield valuable insights into the product specificity and the catalytic mechanism of protein arginine methyltransferases and have important implications for the rational (re)design of PRMTs.« less

A glutamate/aspartate switch controls product specificity in a protein arginine methyltransferase.

PubMed

Debler, Erik W; Jain, Kanishk; Warmack, Rebeccah A; Feng, You; Clarke, Steven G; Blobel, Günter; Stavropoulos, Pete

2016-02-23

Trypanosoma brucei PRMT7 (TbPRMT7) is a protein arginine methyltransferase (PRMT) that strictly monomethylates various substrates, thus classifying it as a type III PRMT. However, the molecular basis of its unique product specificity has remained elusive. Here, we present the structure of TbPRMT7 in complex with its cofactor product S-adenosyl-l-homocysteine (AdoHcy) at 2.8 Å resolution and identify a glutamate residue critical for its monomethylation behavior. TbPRMT7 comprises the conserved methyltransferase and β-barrel domains, an N-terminal extension, and a dimerization arm. The active site at the interface of the N-terminal extension, methyltransferase, and β-barrel domains is stabilized by the dimerization arm of the neighboring protomer, providing a structural basis for dimerization as a prerequisite for catalytic activity. Mutagenesis of active-site residues highlights the importance of Glu181, the second of the two invariant glutamate residues of the double E loop that coordinate the target arginine in substrate peptides/proteins and that increase its nucleophilicity. Strikingly, mutation of Glu181 to aspartate converts TbPRMT7 into a type I PRMT, producing asymmetric dimethylarginine (ADMA). Isothermal titration calorimetry (ITC) using a histone H4 peptide showed that the Glu181Asp mutant has markedly increased affinity for monomethylated peptide with respect to the WT, suggesting that the enlarged active site can favorably accommodate monomethylated peptide and provide sufficient space for ADMA formation. In conclusion, these findings yield valuable insights into the product specificity and the catalytic mechanism of protein arginine methyltransferases and have important implications for the rational (re)design of PRMTs.

A glutamate/aspartate switch controls product specificity in a protein arginine methyltransferase

PubMed Central

Debler, Erik W.; Jain, Kanishk; Warmack, Rebeccah A.; Feng, You; Clarke, Steven G.; Blobel, Günter; Stavropoulos, Pete

2016-01-01

Trypanosoma brucei PRMT7 (TbPRMT7) is a protein arginine methyltransferase (PRMT) that strictly monomethylates various substrates, thus classifying it as a type III PRMT. However, the molecular basis of its unique product specificity has remained elusive. Here, we present the structure of TbPRMT7 in complex with its cofactor product S-adenosyl-l-homocysteine (AdoHcy) at 2.8 Å resolution and identify a glutamate residue critical for its monomethylation behavior. TbPRMT7 comprises the conserved methyltransferase and β-barrel domains, an N-terminal extension, and a dimerization arm. The active site at the interface of the N-terminal extension, methyltransferase, and β-barrel domains is stabilized by the dimerization arm of the neighboring protomer, providing a structural basis for dimerization as a prerequisite for catalytic activity. Mutagenesis of active-site residues highlights the importance of Glu181, the second of the two invariant glutamate residues of the double E loop that coordinate the target arginine in substrate peptides/proteins and that increase its nucleophilicity. Strikingly, mutation of Glu181 to aspartate converts TbPRMT7 into a type I PRMT, producing asymmetric dimethylarginine (ADMA). Isothermal titration calorimetry (ITC) using a histone H4 peptide showed that the Glu181Asp mutant has markedly increased affinity for monomethylated peptide with respect to the WT, suggesting that the enlarged active site can favorably accommodate monomethylated peptide and provide sufficient space for ADMA formation. In conclusion, these findings yield valuable insights into the product specificity and the catalytic mechanism of protein arginine methyltransferases and have important implications for the rational (re)design of PRMTs. PMID:26858449

A Sensitive Luminescent Assay for the Histone Methyltransferase NSD1 and Other SAM-Dependent Enzymes

PubMed Central

Drake, Katherine M.; Watson, Venita G.; Kisielewski, Anne; Glynn, Rebecca

2014-01-01

Abstract A major focus of our pediatric cancer research is the discovery of chemical probes to further our understanding of the biology of leukemia harboring fusion proteins arising from chromosomal rearrangements, and to develop novel specifically targeted therapies. The NUP98-NSD1 fusion protein occurs in a highly aggressive subtype of acute myeloid leukemia after rearrangement of the genes NUP98 and NSD1. The methyltransferase activity of NSD1 is retained in the fusion, and it gives rise to abnormally high levels of methylation at lysine 36 on histone 3, enforcing oncogene activation. Therefore, inhibition of the methyltransferase activity of NUP98-NSD1 may be considered a viable therapeutic strategy. Here, we report the development and validation of a highly sensitive and robust luminescence-based assay for NSD1 and other methyltransferases that use S-adenosylmethionine (SAM) as a methyl donor. The assay quantifies S-adenosylhomocysteine (SAH), which is produced during methyl transfer from SAM. SAH is converted enzymatically to adenosine monophosphate (AMP); in the process, adenosine triphosphate (ATP) is consumed and the amount of ATP remaining is measured using a luminescent assay kit. The assay was validated by pilot high-throughput screening (HTS), dose-response confirmation of hits, and elimination of artifacts through counterscreening against SAH detection in the absence of NSD1. The known methyltransferase inhibitor suramin was identified, and profiled for selectivity against the histone methyltransferases EZH2, SETD7, and PRMT1. HTS using the luminescent NSD1 assay described here has the potential to deliver selective NSD1 inhibitors that may serve as leads in the development of targeted therapies for NUP98-NSD1-driven leukemias. PMID:24927133

Radiometric assay for phenylethanolamine N-methyltransferase and catechol O-methyltransferase in a single tissue sample: application to rat hypothalamic nuclei, pineal gland, and heart

DOE Office of Scientific and Technical Information (OSTI.GOV)

Culman, J.; Torda, T.; Weise, V.K.

A simple and highly sensitive method for simultaneous assay of phenylethanolamine N-methyltransferase (PNMT) and catechol O-methyltransferase (COMT) is described. These enzymes are determined in a single tissue homogenate using S-(methyl-/sup 3/H) adenosyl-L-methionine as methyl donor and sequentially incubating with the substrates phenylethanolamine and epinephrine. The radioactive products of the enzymatic reactions, N-methylphenylethanolamine and metanephrine, are extracted and then separated by thin-layer chromatography. The identity of the reaction products has been established chromatographically and the conditions for both enzymatic reactions in the assay procedure have been defined. Measurement of PNMT activity in the rat pineal gland or in minute fragments ofmore » other tissues (e.g., brain nuclei) has not been possible using previously described methods. Activities of PNMT and COMT in the rat pineal gland, various hypothalamic nuclei, and the auricular and ventricular myocardia are herein reported.« less

Mechanism of activation of methyltransferases involved in translation by the Trm112 'hub' protein.

PubMed

Liger, Dominique; Mora, Liliana; Lazar, Noureddine; Figaro, Sabine; Henri, Julien; Scrima, Nathalie; Buckingham, Richard H; van Tilbeurgh, Herman; Heurgué-Hamard, Valérie; Graille, Marc

2011-08-01

Methylation is a common modification encountered in DNA, RNA and proteins. It plays a central role in gene expression, protein function and mRNA translation. Prokaryotic and eukaryotic class I translation termination factors are methylated on the glutamine of the essential and universally conserved GGQ motif, in line with an important cellular role. In eukaryotes, this modification is performed by the Mtq2-Trm112 holoenzyme. Trm112 activates not only the Mtq2 catalytic subunit but also two other tRNA methyltransferases (Trm9 and Trm11). To understand the molecular mechanisms underlying methyltransferase activation by Trm112, we have determined the 3D structure of the Mtq2-Trm112 complex and mapped its active site. Using site-directed mutagenesis and in vivo functional experiments, we show that this structure can also serve as a model for the Trm9-Trm112 complex, supporting our hypothesis that Trm112 uses a common strategy to activate these three methyltransferases.

Rauvolfia serpentina N-methyltransferases involved in ajmaline and Nβ -methylajmaline biosynthesis belong to a gene family derived from γ-tocopherol C-methyltransferase.

PubMed

Cázares-Flores, Paulo; Levac, Dylan; De Luca, Vincenzo

2016-08-01

Ajmaline biosynthesis in Rauvolfia serpentina has been one of the most studied monoterpenoid indole alkaloid (MIA) pathways within the plant family Apocynaceae. Detailed molecular and biochemical information on most of the steps involved in the pathway has been generated over the last 30 years. Here we report the identification, molecular cloning and functional expression in Escherichia coli of two R. serpentinacDNAs that are part of a recently discovered γ-tocopherol-like N-methyltransferase (γ-TLMT) family and are involved in indole and side-chain N-methylation of ajmaline. Recombinant proteins showed remarkable substrate specificity for molecules with an ajmalan-type backbone and strict regiospecific N-methylation. Furthermore, N-methyltransferase gene transcripts and enzyme activity were enriched in R. serpentina roots which correlated with accumulation of ajmaline alkaloid. This study elucidates the final step in the ajmaline biosynthetic pathway and describes the enzyme responsible for the formation of Nβ -methylajmaline, an unusual charged MIA found in R. serpentina. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

A Panoptic Uncovering of the Dynamical Evolution of the Zika Virus NS5 Methyltransferase Binding Site Loops- Zeroing in on the Molecular Landscape.

PubMed

Devnarain, Nikita; Soliman, Mahmoud E S

2018-06-20

The global threat of the Zika virus to humanity is real. Innovative and potent anti-Zika virus drugs are still at large, due to the lack of anti-Zika virus drugs that have passed phase 1 trials. Experimental research has revealed novel inhibitors of Zika virus NS5 methyltransferase enzyme. This study has taken a step further to provide insight into the molecular dynamics of Zika virus and inhibitor binding, which have not been established experimentally. Movements of the methyltransferase binding site loops have a large role to play in the methylation of the viral mRNA cap, which is essential for Zika virus replication. Here we pinpoint the binding interactions between each potential inhibitor and the methyltransferase, residues that are responsible for binding, as well as which inhibitor-bound complex renders the methyltransferase more stable. We also highlight the conformational changes that occur within the methyltransferase to accommodate binding of inhibitors and consequences of those changes upon the RNA- and cap-binding sites in the methyltransferase. This research will improve the understanding of the Zika virus NS5 methyltransferase enzyme, and will be beneficial in driving the development of anti-Zika virus drugs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

IDENTIFYING CRITICAL CYSTEINE RESIDUES IN ARSENIC (+3 OXIDATION STATE) METHYLTRANSFERASE

EPA Science Inventory

Arsenic (+3 oxidation state) methyltransferase (AS3MT) catalyzes methylation of inorganic arsenic to mono, di, and trimethylated arsenicals. Orthologous AS3MT genes in genomes ranging from simple echinoderm to human predict a protein with five conserved cysteine (C) residues. In ...

Arabidopsis DNA methyltransferase AtDNMT2 associates with histone deacetylase AtHD2s activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Yuan; Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON, Canada N5V4T3; Wu, Keqiang

2010-05-28

DNA methyltransferase2 (DNMT2) is always deemed to be enigmatic, because it contains highly conserved DNA methyltransferase motifs but lacks the DNA methylation catalytic capability. Here we show that Arabidopsis DNA methyltransferase2 (AtDNMT2) is localized in nucleus and associates with histone deacetylation. Bimolecular fluorescence complementation and pull-down assays show AtDNMT2 interacts with type-2 histone deacetylases (AtHD2s), a unique type of histone deacetylase family in plants. Through analyzing the expression of AtDNMT2: ss-glucuronidase (GUS) fusion protein, we demonstrate that AtDNMT2 has the ability to repress gene expression at transcription level. Meanwhile, the expression of AtDNMT2 gene is altered in athd2c mutant plants.more » We propose that AtDNMT2 possibly involves in the activity of histone deacetylation and plant epigenetic regulatory network.« less

Ergothioneine biosynthetic methyltransferase EgtD reveals the structural basis of aromatic amino acid betaine biosynthesis.

PubMed

Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian P

2015-01-02

Ergothioneine is an N-α-trimethyl-2-thiohistidine derivative that occurs in human, plant, fungal, and bacterial cells. Biosynthesis of this redox-active betaine starts with trimethylation of the α-amino group of histidine. The three consecutive methyl transfers are catalyzed by the S-adenosylmethionine-dependent methyltransferase EgtD. Three crystal structures of this enzyme in the absence and in the presence of N-α-dimethylhistidine and S-adenosylhomocysteine implicate a preorganized array of hydrophilic interactions as the determinants for substrate specificity and apparent processivity. We identified two active site mutations that change the substrate specificity of EgtD 10(7)-fold and transform the histidine-methyltransferase into a proficient tryptophan-methyltransferase. Finally, a genomic search for EgtD homologues in fungal genomes revealed tyrosine and tryptophan trimethylation activity as a frequent trait in ascomycetous and basidomycetous fungi. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Plant isoflavone and isoflavanone O-methyltransferase genes

DOEpatents

Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

2014-08-19

The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

Insights into Methyltransferase Specificity and Bioactivity of Derivatives of the Antibiotic Plantazolicin

DOE PAGES

Hao, Yue; Blair, Patricia M.; Sharma, Abhishek; ...

2015-01-30

Peptide antibiotics represent a class of conformationally-constrained natural products of growing pharmaceutical interest. Plantazolicin (PZN) is a linear, polyheterocyclic natural product with highly selective and potent activity against the anthrax-causing bacterium, Bacillus anthracis. The bioactivity of PZN is contingent on dimethylation of its N-terminal Arg residue by an S-adenosylmethionine-dependent methyltransferase. Here in this paper, we explore the substrate tolerances of two homologous PZN methyltransferases by carrying out kinetic analyses of the enzymes against a synthetic panel of truncated PZN analogs containing the N-terminal Arg residue. X-ray cocrystal structures of the PZN methyltransferases with each of these heterocycle-containing substrates provide amore » rationale for understanding the strict substrate specificity of these enzymes. Kinetic studies of structure-guided, site-specific variants allowed for the assignment of residues governing catalysis and substrate scope. Microbiological testing further revealed that upon dimethylation of the N-terminal Arg, a pentaheterocyclized PZN analog retained potent anti-B. anthracis activity, nearly equal to that of full-length PZN. These studies may be useful in the biosynthetic engineering of natural product analogs with different bioactivity profiles, as demonstrated by our identification of a truncated plantazolicin derivative that is active against methicillin-resistant Staphylococcus aureus (MRSA).« less

Insights into Methyltransferase Specificity and Bioactivity of Derivatives of the Antibiotic Plantazolicin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hao, Yue; Blair, Patricia M.; Sharma, Abhishek

Peptide antibiotics represent a class of conformationally-constrained natural products of growing pharmaceutical interest. Plantazolicin (PZN) is a linear, polyheterocyclic natural product with highly selective and potent activity against the anthrax-causing bacterium, Bacillus anthracis. The bioactivity of PZN is contingent on dimethylation of its N-terminal Arg residue by an S-adenosylmethionine-dependent methyltransferase. Here in this paper, we explore the substrate tolerances of two homologous PZN methyltransferases by carrying out kinetic analyses of the enzymes against a synthetic panel of truncated PZN analogs containing the N-terminal Arg residue. X-ray cocrystal structures of the PZN methyltransferases with each of these heterocycle-containing substrates provide amore » rationale for understanding the strict substrate specificity of these enzymes. Kinetic studies of structure-guided, site-specific variants allowed for the assignment of residues governing catalysis and substrate scope. Microbiological testing further revealed that upon dimethylation of the N-terminal Arg, a pentaheterocyclized PZN analog retained potent anti-B. anthracis activity, nearly equal to that of full-length PZN. These studies may be useful in the biosynthetic engineering of natural product analogs with different bioactivity profiles, as demonstrated by our identification of a truncated plantazolicin derivative that is active against methicillin-resistant Staphylococcus aureus (MRSA).« less

A SABATH Methyltransferase from the moss Physcomitrella patens catalyzes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Nan; Ferrer, Jean-Luc; Moon, Hong S

2012-01-01

Known SABATH methyltransferases, all of which were identified from seed plants, catalyze methylation of either the carboxyl group of a variety of low molecular weight metabolites or the nitrogen moiety of precursors of caffeine. In this study, the SABATH family from the bryophyte Physcomitrella patens was identified and characterized. Four SABATH-like sequences (PpSABATH1, PpSABATH2, PpSABATH3, and PpSABATH4) were identified from the P. patens genome. Only PpSABATH1 and PpSABATH2 showed expression in the leafy gametophyte of P. patens. Full-length cDNAs of PpSABATH1 and PpSABATH2 were cloned and expressed in soluble form in Escherichia coli. Recombinant PpSABATH1 and PpSABATH2 were tested formore » methyltransferase activity with a total of 75 compounds. While showing no activity with carboxylic acids or nitrogen-containing compounds, PpSABATH1 displayed methyltransferase activity with a number of thiols. PpSABATH2 did not show activity with any of the compounds tested. Among the thiols analyzed, PpSABATH1 showed the highest level of activity with thiobenzoic acid with an apparent Km value of 95.5 lM, which is comparable to those of known SABATHs. Using thiobenzoic acid as substrate, GC MS analysis indicated that the methylation catalyzed by PpSABATH1 is on the sulfur atom. The mechanism for S-methylation of thiols catalyzed by PpSABATH1 was partially revealed by homology-based structural modeling. The expression of PpSABATH1 was induced by the treatment of thiobenzoic acid. Further transgenic studies showed that tobacco plants overexpressing PpSABATH1 exhibited enhanced tolerance to thiobenzoic acid, suggesting that PpSABATH1 have a role in the detoxification of xenobiotic thiols.« less

Recruitment of DNA methyltransferase I to DNA repair sites.

PubMed

Mortusewicz, Oliver; Schermelleh, Lothar; Walter, Joachim; Cardoso, M Cristina; Leonhardt, Heinrich

2005-06-21

In mammalian cells, the replication of genetic and epigenetic information is directly coupled; however, little is known about the maintenance of epigenetic information in DNA repair. Using a laser microirradiation system to introduce DNA lesions at defined subnuclear sites, we tested whether the major DNA methyltransferase (Dnmt1) or one of the two de novo methyltransferases (Dnmt3a, Dnmt3b) are recruited to sites of DNA repair in vivo. Time lapse microscopy of microirradiated mammalian cells expressing GFP-tagged Dnmt1, Dnmt3a, or Dnmt3b1 together with red fluorescent protein-tagged proliferating cell nuclear antigen (PCNA) revealed that Dnmt1 and PCNA accumulate at DNA damage sites as early as 1 min after irradiation in S and non-S phase cells, whereas recruitment of Dnmt3a and Dnmt3b was not observed. Deletion analysis showed that Dnmt1 recruitment was mediated by the PCNA-binding domain. These data point to a direct role of Dnmt1 in the restoration of epigenetic information during DNA repair.

Hsl7 is a substrate-specific type II protein arginine methyltransferase in yeast

PubMed Central

Sayegh, Joyce; Clarke, Steven G.

2008-01-01

The Saccharomyces cerevisiae protein Hsl7 is a regulator of the Swe1 protein kinase in cell cycle checkpoint control. Hsl7 has been previously described as a type III protein arginine methyltransferase, catalyzing the formation of ω-monomethylarginine residues on non-physiological substrates. However, we show here that Hsl7 can also display type II activity, generating symmetric dimethylarginine residues on calf thymus histone H2A. Symmetric dimethylation is only observed when enzyme and the methyl-accepting substrate were incubated for extended times. We confirmed the Hsl7-dependent formation of symmetric dimethylarginine by amino acid analysis and thin layer chromatography with wild type and mutant recombinant enzymes expressed from both bacteria and yeast. This result is significant because no type II activity has been previously demonstrated in S. cerevisiae. We also show that Hsl7 has little or no activity on GST-GAR, a commonly used substrate for protein arginine methyltransferases, and only minimal activity on myelin basic protein. This enzyme thus may only recognize only a small subset of potential substrate proteins in yeast, in contrast to the situation with Rmt1, the major type I methyltransferase. PMID:18515076

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Mechanism of activation of methyltransferases involved in translation by the Trm112 ‘hub’ protein

PubMed Central

Liger, Dominique; Mora, Liliana; Lazar, Noureddine; Figaro, Sabine; Henri, Julien; Scrima, Nathalie; Buckingham, Richard H.; van Tilbeurgh, Herman; Heurgué-Hamard, Valérie; Graille, Marc

2011-01-01

Methylation is a common modification encountered in DNA, RNA and proteins. It plays a central role in gene expression, protein function and mRNA translation. Prokaryotic and eukaryotic class I translation termination factors are methylated on the glutamine of the essential and universally conserved GGQ motif, in line with an important cellular role. In eukaryotes, this modification is performed by the Mtq2-Trm112 holoenzyme. Trm112 activates not only the Mtq2 catalytic subunit but also two other tRNA methyltransferases (Trm9 and Trm11). To understand the molecular mechanisms underlying methyltransferase activation by Trm112, we have determined the 3D structure of the Mtq2-Trm112 complex and mapped its active site. Using site-directed mutagenesis and in vivo functional experiments, we show that this structure can also serve as a model for the Trm9-Trm112 complex, supporting our hypothesis that Trm112 uses a common strategy to activate these three methyltransferases. PMID:21478168

Metadynamics Simulation Study on the Conformational Transformation of HhaI Methyltransferase: An Induced-Fit Base-Flipping Hypothesis

PubMed Central

Ye, Fei; Zhao, Dan; Chen, Shijie; Jiang, Ren-Wang; Jiang, Hualiang; Luo, Cheng

2014-01-01

DNA methyltransferases play crucial roles in establishing and maintenance of DNA methylation, which is an important epigenetic mark. Flipping the target cytosine out of the DNA helical stack and into the active site of protein provides DNA methyltransferases with an opportunity to access and modify the genetic information hidden in DNA. To investigate the conversion process of base flipping in the HhaI methyltransferase (M.HhaI), we performed different molecular simulation approaches on M.HhaI-DNA-S-adenosylhomocysteine ternary complex. The results demonstrate that the nonspecific binding of DNA to M.HhaI is initially induced by electrostatic interactions. Differences in chemical environment between the major and minor grooves determine the orientation of DNA. Gln237 at the target recognition loop recognizes the GCGC base pair from the major groove side by hydrogen bonds. In addition, catalytic loop motion is a key factor during this process. Our study indicates that base flipping is likely to be an “induced-fit” process. This study provides a solid foundation for future studies on the discovery and development of mechanism-based DNA methyltransferases regulators. PMID:25045662

Inhibition and Regulation of the Ergothioneine Biosynthetic Methyltransferase EgtD.

PubMed

Misson, Laëtitia; Burn, Reto; Vit, Allegra; Hildesheim, Julia; Beliaeva, Mariia A; Blankenfeldt, Wulf; Seebeck, Florian P

2018-05-18

Ergothioneine is an emerging factor in cellular redox homeostasis in bacteria, fungi, plants, and animals. Reports that ergothioneine biosynthesis may be important for the pathogenicity of bacteria and fungi raise the question as to how this pathway is regulated and whether the corresponding enzymes may be therapeutic targets. The first step in ergothioneine biosynthesis is catalyzed by the methyltransferase EgtD that converts histidine into N-α-trimethylhistidine. This report examines the kinetic, thermodynamic and structural basis for substrate, product, and inhibitor binding by EgtD from Mycobacterium smegmatis. This study reveals an unprecedented substrate binding mechanism and a fine-tuned affinity landscape as determinants for product specificity and product inhibition. Both properties are evolved features that optimize the function of EgtD in the context of cellular ergothioneine production. On the basis of these findings, we developed a series of simple histidine derivatives that inhibit methyltransferase activity at low micromolar concentrations. Crystal structures of inhibited complexes validate this structure- and mechanism-based design strategy.

Neuronal DNA Methyltransferases: Epigenetic Mediators between Synaptic Activity and Gene Expression?

PubMed Central

Bayraktar, Gonca; Kreutz, Michael R.

2017-01-01

DNMT3A and 3B are the main de novo DNA methyltransferases (DNMTs) in the brain that introduce new methylation marks to non-methylated DNA in postmitotic neurons. DNA methylation is a key epigenetic mark that is known to regulate important cellular processes in neuronal development and brain plasticity. Accumulating evidence disclosed rapid and dynamic changes in DNA methylation of plasticity-relevant genes that are important for learning and memory formation. To understand how DNMTs contribute to brain function and how they are regulated by neuronal activity is a prerequisite for a deeper appreciation of activity-dependent gene expression in health and disease. This review discusses the functional role of de novo methyltransferases and in particular DNMT3A1 in the adult brain with special emphasis on synaptic plasticity, memory formation, and brain disorders. PMID:28513272

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Crystal structures of the methyltransferase and helicase from the ZIKA 1947 MR766 Uganda strain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukrejewska, Malgorzata; Derewenda, Urszula; Radwanska, Malwina

2017-08-15

Two nonstructural proteins encoded byZika virusstrain MR766 RNA, a methyltransferase and a helicase, were crystallized and their structures were solved and refined at 2.10 and 2.01 Å resolution, respectively. The NS5 methyltransferase contains a boundS-adenosyl-L-methionine (SAM) co-substrate. The NS3 helicase is in the apo form. Comparison with published crystal structures of the helicase in the apo, nucleotide-bound and single-stranded RNA (ssRNA)-bound states suggests that binding of ssRNA to the helicase may occur through conformational selection rather than induced fit.

Eukaryotic 5S rRNA biogenesis

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

PubMed

Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

2017-04-01

Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

Preliminary characterization of (nucleoside-2′-O-)-methyltransferase crystals from Meaban and Yokose flaviviruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mastrangelo, Eloise; Bollati, Michela; Milani, Mario

2006-08-01

Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed,more » purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.« less

A Continuous, Quantitative Fluorescent Assay for Plant Caffeic acid O-Methyltransferases

USDA-ARS?s Scientific Manuscript database

Plant caffeic acid O-methyltransferases (COMTs) use s-adenosylmethionine (ado-met), as a methyl donor to transmethylate their preferred (phenolic) substrates in-vivo, and will generally utilize a range of phenolic compounds in-vitro. Collazo et al. (2005; Analytical Biochemistry 342: 86-92) have pu...

The Ether-Cleaving Methyltransferase System of the Strict Anaerobe Acetobacterium dehalogenans: Analysis and Expression of the Encoding Genes▿

PubMed Central

Schilhabel, Anke; Studenik, Sandra; Vödisch, Martin; Kreher, Sandra; Schlott, Bernhard; Pierik, Antonio Y.; Diekert, Gabriele

2009-01-01

Anaerobic O-demethylases are inducible multicomponent enzymes which mediate the cleavage of the ether bond of phenyl methyl ethers and the transfer of the methyl group to tetrahydrofolate. The genes of all components (methyltransferases I and II, CP, and activating enzyme [AE]) of the vanillate- and veratrol-O-demethylases of Acetobacterium dehalogenans were sequenced and analyzed. In A. dehalogenans, the genes for methyltransferase I, CP, and methyltransferase II of both O-demethylases are clustered. The single-copy gene for AE is not included in the O-demethylase gene clusters. It was found that AE grouped with COG3894 proteins, the function of which was unknown so far. Genes encoding COG3894 proteins with 20 to 41% amino acid sequence identity with AE are present in numerous genomes of anaerobic microorganisms. Inspection of the domain structure and genetic context of these orthologs predicts that these are also reductive activases for corrinoid enzymes (RACEs), such as carbon monoxide dehydrogenase/acetyl coenzyme A synthases or anaerobic methyltransferases. The genes encoding the O-demethylase components were heterologously expressed with a C-terminal Strep-tag in Escherichia coli, and the recombinant proteins methyltransferase I, CP, and AE were characterized. Gel shift experiments showed that the AE comigrated with the CP. The formation of other protein complexes with the O-demethylase components was not observed under the conditions used. The results point to a strong interaction of the AE with the CP. This is the first report on the functional heterologous expression of acetogenic phenyl methyl ether-cleaving O-demethylases. PMID:19011025

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Discovery and characterization of new O-methyltransferase from the genome of the lignin-degrading fungus Phanerochaete chrysosporium for enhanced lignin degradation.

PubMed

Thanh Mai Pham, Le; Kim, Yong Hwan

2016-01-01

Using bioinformatic homology search tools, this study utilized sequence phylogeny, gene organization and conserved motifs to identify members of the family of O-methyltransferases from lignin-degrading fungus Phanerochaete chrysosporium. The heterologous expression and characterization of O-methyltransferases from P. chrysosporium were studied. The expressed protein utilized S-(5'-adenosyl)-L-methionine p-toluenesulfonate salt (SAM) and methylated various free-hydroxyl phenolic compounds at both meta and para site. In the same motif, O-methyltransferases were also identified in other white-rot fungi including Bjerkandera adusta, Ceriporiopsis (Gelatoporia) subvermispora B, and Trametes versicolor. As free-hydroxyl phenolic compounds have been known as inhibitors for lignin peroxidase, the presence of O-methyltransferases in white-rot fungi suggested their biological functions in accelerating lignin degradation in white-rot basidiomycetes by converting those inhibitory groups into non-toxic methylated phenolic ones. Copyright © 2015 Elsevier Inc. All rights reserved.

Computational fishing of new DNA methyltransferase inhibitors from natural products.

PubMed

Maldonado-Rojas, Wilson; Olivero-Verbel, Jesus; Marrero-Ponce, Yovani

2015-07-01

DNA methyltransferase inhibitors (DNMTis) have become an alternative for cancer therapies. However, only two DNMTis have been approved as anticancer drugs, although with some restrictions. Natural products (NPs) are a promising source of drugs. In order to find NPs with novel chemotypes as DNMTis, 47 compounds with known activity against these enzymes were used to build a LDA-based QSAR model for active/inactive molecules (93% accuracy) based on molecular descriptors. This classifier was employed to identify potential DNMTis on 800 NPs from NatProd Collection. 447 selected compounds were docked on two human DNA methyltransferase (DNMT) structures (PDB codes: 3SWR and 2QRV) using AutoDock Vina and Surflex-Dock, prioritizing according to their score values, contact patterns at 4 Å and molecular diversity. Six consensus NPs were identified as virtual hits against DNMTs, including 9,10-dihydro-12-hydroxygambogic, phloridzin, 2',4'-dihydroxychalcone 4'-glucoside, daunorubicin, pyrromycin and centaurein. This method is an innovative computational strategy for identifying DNMTis, useful in the identification of potent and selective anticancer drugs. Copyright © 2015 Elsevier Inc. All rights reserved.

DNA (Cytosine-C5) methyltransferase inhibition by oligodeoxyribonucleotides containing 2-(1H)-pyrimidinone (zebularine aglycon) at the enzymatic target site.

PubMed

van Bemmel, Dana M; Brank, Adam S; Eritja, Ramon; Marquez, Victor E; Christman, Judith K

2009-09-15

Aberrant cytosine methylation in promoter regions leads to gene silencing associated with cancer progression. A number of DNA methyltransferase inhibitors are known to reactivate silenced genes; including 5-azacytidine and 2-(1H)-pyrimidinone riboside (zebularine). Zebularine is a more stable, less cytotoxic inhibitor compared to 5-azacytidine. To determine the mechanistic basis for this difference, we carried out a detailed comparisons of the interaction between purified DNA methyltransferases and oligodeoxyribonucleotides (ODNs) containing either 5-azacytosine or 2-(1H)-pyrimidinone in place of the cytosine targeted for methylation. When incorporated into small ODNs, the rate of C5 DNA methyltransferase inhibition by both nucleosides is essentially identical. However, the stability and reversibility of the enzyme complex in the absence and presence of cofactor differs. 5-Azacytosine ODNs form complexes with C5 DNA methyltransferases that are irreversible when the 5-azacytosine ring is intact. ODNs containing 2-(1H)-pyrimidinone at the enzymatic target site are competitive inhibitors of both prokaryotic and mammalian DNA C5 methyltransferases. We determined that the ternary complexes between the enzymes, 2-(1H)-pyrimidinone inhibitor, and the cofactor S-adenosyl methionine are maintained through the formation of a reversible covalent interaction. The differing stability and reversibility of the covalent bonds may partially account for the observed differences in cytotoxicity between zebularine and 5-azacytidine inhibitors.

DNA (Cytosine-C5) Methyltransferase Inhibition by Oligodeoxyribonucleotides Containing 2-(1H)-Pyrimidinone (Zebularine Aglycon) at the Enzymatic Target Site

PubMed Central

van Bemmel, Dana M.; Brank, Adam S.; Eritja, Ramon; Marquez, Victor E.; Christman, Judith K.

2009-01-01

Aberrant cytosine methylation in promoter regions leads to gene silencing associated with cancer progression. A number of DNA methyltransferase inhibitors are known to reactivate silenced genes; including 5-azacytidine and 2-(1H)-pyrimidinone riboside (zebularine). Zebularine is a more stable, less cytotoxic inhibitor compared to 5-azacytidine. To determine the mechanistic basis for this difference, we carried out a detailed comparisons of the interaction between purified DNA methyltransferases and oligodeoxyribonucleotides (ODNs) containing either 5-azacytosine or 2-(1H)-pyrimidinone in place of the cytosine targeted for methylation. When incorporated into small ODNs, the rate of C5 DNA methyltransferase inhibition by both nucleosides is essentially identical. However, the stability and reversibility of the enzyme complex in the absence and presence of cofactor differs. 5-Azacytosine ODNs form complexes with C5 DNA methyltransferases that are irreversible when the 5-azacytosine ring is intact. ODNs containing 2-(1H)-pyrimidinone at the enzymatic target site are competitive inhibitors of both prokaryotic and mammalian DNA C5 methyltransferases. We determined that the ternary complexes between the enzymes, 2-(1H)-pyrimidinone inhibitor, and the cofactor S-adenosyl methionine are maintained through the formation of a reversible covalent interaction. The differing stability and reversibility of the covalent bonds may partially account for the observed differences in cytotoxicity between zebularine and 5-azacytidine inhibitors. PMID:19467223

Noncompetitive inhibition of indolethylamine-N-methyltransferase by N,N-dimethyltryptamine and N,N-dimethylaminopropyltryptamine.

PubMed

Chu, Uyen B; Vorperian, Sevahn K; Satyshur, Kenneth; Eickstaedt, Kelsey; Cozzi, Nicholas V; Mavlyutov, Timur; Hajipour, Abdol R; Ruoho, Arnold E

2014-05-13

Indolethylamine-N-methyltransferase (INMT) is a Class 1 transmethylation enzyme known for its production of N,N-dimethyltryptamine (DMT), a hallucinogen with affinity for various serotonergic, adrenergic, histaminergic, dopaminergic, and sigma-1 receptors. DMT is produced via the action of INMT on the endogenous substrates tryptamine and S-adenosyl-l-methionine (SAM). The biological, biochemical, and selective small molecule regulation of INMT enzyme activity remain largely unknown. Kinetic mechanisms for inhibition of rabbit lung INMT (rabINMT) by the product, DMT, and by a new novel tryptamine derivative were determined. After Michaelis-Menten and Lineweaver-Burk analyses had been applied to study inhibition, DMT was found to be a mixed competitive and noncompetitive inhibitor when measured against tryptamine. The novel tryptamine derivative, N-[2-(1H-indol-3-yl)ethyl]-N',N'-dimethylpropane-1,3-diamine (propyl dimethyl amino tryptamine or PDAT), was shown to inhibit rabINMT by a pure noncompetitive mechanism when measured against tryptamine with a Ki of 84 μM. No inhibition by PDAT was observed at 2 mM when it was tested against structurally similar Class 1 methyltransferases, such as human phenylethanolamine-N-methyltransferase (hPNMT) and human nicotinamide-N-methyltransferase (hNNMT), indicating selectivity for INMT. The demonstration of noncompetitive mechanisms for INMT inhibition implies the presence of an inhibitory allosteric site. In silico analyses using the computer modeling software Autodock and the rabINMT sequence threaded onto the human INMT (hINMT) structure (Protein Data Bank entry 2A14 ) identified an N-terminal helix-loop-helix non-active site binding region of the enzyme. The energies for binding of DMT and PDAT to this region of rabINMT, as determined by Autodock, were -6.34 and -7.58 kcal/mol, respectively. Assessment of the allosteric control of INMT may illuminate new biochemical pathway(s) underlying the biology of INMT.

Structure and expression of dna methyltransferase genes from apomictic and sexual Boechera species.

PubMed

Taşkin, Kemal Melik; Özbilen, Aslıhan; Sezer, Fatih; Hürkan, Kaan; Güneş, Şebnem

2017-04-01

In this study, we determined the structure of DNA methyltransferase (DNMT) genes in apomict and sexual Boechera species and investigated the expression levels during seed development. Protein and DNA sequences of diploid sexual Boechera stricta DNMT genes obtained from Phytozome 10.3 were used to identify the homologues in apomicts, Boechera holboellii and Boechera divaricarpa. Geneious R8 software was used to map the short-paired reads library of B. holboellii whole genome or B. divaricarpa transcriptome reads to the reference gene sequences. We determined three DNMT genes; for Boechera spp. METHYLTRANSFERASE1 (MET1), CHROMOMETHYLASE 3 (CMT3) and DOMAINS REARRANGED METHYLTRANSFERASE 1/2 (DRM2). We examined the structure of these genes with bioinformatic tools and compared with other DNMT genes in plants. We also examined the levels of expression in silique tissues after fertilization by semi-quantitative PCR. The structure of DNMT proteins in apomict and sexual Boechera species share common features. However, the expression levels of DNMT genes were different in apomict and sexual Boechera species. We found that DRM2 was upregulated in apomictic Boechera species after fertilization. Phylogenetic trees showed that three genes are conserved among green algae, monocotyledons and dicotyledons. Our results indicated a deregulation of DNA methylation machinery during seed development in apomicts. Copyright © 2016 Elsevier Ltd. All rights reserved.

7-Methylxanthine methyltransferase of coffee plants. Gene isolation and enzymatic properties.

PubMed

Ogawa, M; Herai, Y; Koizumi, N; Kusano, T; Sano, H

2001-03-16

Caffeine is synthesized through sequential three-step methylation of xanthine derivatives at positions 7-N, 3-N, and 1-N. However, controversy exists as to the number and properties of the methyltransferases involved. Using primers designed on the basis of conserved amino acid regions of tea caffeine synthase and Arabidopsis hypothetical proteins, a particular DNA fragment was amplified from an mRNA population of coffee plants. Subsequently, this fragment was used as a probe, and four independent clones were isolated from a cDNA library derived from coffee young leaves. Upon expression in Escherichia coli, one of them was found to encode a protein possessing 7-methylxanthine methyltransferase activity and was designated as CaMXMT. It consists of 378 amino acids with a relative molecular mass of 42.7 kDa and shows similarity to tea caffeine synthase (35.8%) and salicylic acid methyltransferase (34.1%). The bacterially expressed protein exhibited an optimal pH for activity ranging between 7 and 9 and methylated almost exclusively 7-methylxanthine with low activity toward paraxanthine, indicating a strict substrate specificity regarding the 3-N position of the purine ring. K(m) values were estimated to be 50 and 12 microM for 7-methylxanthine and S-adenosyl-l-methionine, respectively. Transcripts of CaMXMT could be shown to accumulate in young leaves and stems containing buds, and green fluorescent protein fusion protein assays indicated localization in cytoplasmic fractions. The results suggest that, in coffee plants, caffeine is synthesized through three independent methylation steps from xanthosine, in which CaMXMT catalyzes the second step to produce theobromine.

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

MtrA of the sodium ion pumping methyltransferase binds cobalamin in a unique mode

PubMed Central

Wagner, Tristan; Ermler, Ulrich; Shima, Seigo

2016-01-01

In the three domains of life, vitamin B12 (cobalamin) is primarily used in methyltransferase and isomerase reactions. The methyltransferase complex MtrA–H of methanogenic archaea has a key function in energy conservation by catalysing the methyl transfer from methyl-tetrahydromethanopterin to coenzyme M and its coupling with sodium-ion translocation. The cobalamin-binding subunit MtrA is not homologous to any known B12-binding proteins and is proposed as the motor of the sodium-ion pump. Here, we present crystal structures of the soluble domain of the membrane-associated MtrA from Methanocaldococcus jannaschii and the cytoplasmic MtrA homologue/cobalamin complex from Methanothermus fervidus. The MtrA fold corresponds to the Rossmann-type α/β fold, which is also found in many cobalamin-containing proteins. Surprisingly, the cobalamin-binding site of MtrA differed greatly from all the other cobalamin-binding sites. Nevertheless, the hydrogen-bond linkage at the lower axial-ligand site of cobalt was equivalently constructed to that found in other methyltransferases and mutases. A distinct polypeptide segment fixed through the hydrogen-bond linkage in the relaxed Co(III) state might be involved in propagating the energy released upon corrinoid demethylation to the sodium-translocation site by a conformational change. PMID:27324530

The U6 snRNA m6A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention.

PubMed

Pendleton, Kathryn E; Chen, Beibei; Liu, Kuanqing; Hunter, Olga V; Xie, Yang; Tu, Benjamin P; Conrad, Nicholas K

2017-05-18

Maintenance of proper levels of the methyl donor S-adenosylmethionine (SAM) is critical for a wide variety of biological processes. We demonstrate that the N 6 -adenosine methyltransferase METTL16 regulates expression of human MAT2A, which encodes the SAM synthetase expressed in most cells. Upon SAM depletion by methionine starvation, cells induce MAT2A expression by enhanced splicing of a retained intron. Induction requires METTL16 and its methylation substrate, a vertebrate conserved hairpin (hp1) in the MAT2A 3' UTR. Increasing METTL16 occupancy on the MAT2A 3' UTR is sufficient to induce efficient splicing. We propose that, under SAM-limiting conditions, METTL16 occupancy on hp1 increases due to inefficient enzymatic turnover, which promotes MAT2A splicing. We further show that METTL16 is the long-unknown methyltransferase for the U6 spliceosomal small nuclear RNA (snRNA). These observations suggest that the conserved U6 snRNA methyltransferase evolved an additional function in vertebrates to regulate SAM homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

Characterization of a Cross-Linked Protein–Nucleic Acid Substrate Radical in the Reaction Catalyzed by RlmN

PubMed Central

2015-01-01

RlmN and Cfr are methyltransferases/methylsynthases that belong to the radical S-adenosylmethionine superfamily of enzymes. RlmN catalyzes C2 methylation of adenosine 2503 (A2503) of 23S rRNA, while Cfr catalyzes C8 methylation of the exact same nucleotide, and will subsequently catalyze C2 methylation if the site is unmethylated. A key feature of the unusual mechanisms of catalysis proposed for these enzymes is the attack of a methylene radical, derived from a methylcysteine residue, onto the carbon center undergoing methylation to generate a paramagnetic protein–nucleic acid cross-linked species. This species has been thoroughly characterized during Cfr-dependent C8 methylation, but does not accumulate to detectible levels in RlmN-dependent C2 methylation. Herein, we show that inactive C118S/A variants of RlmN accumulate a substrate-derived paramagnetic species. Characterization of this species by electron paramagnetic resonance spectroscopy in concert with strategic isotopic labeling shows that the radical is delocalized throughout the adenine ring of A2503, although predominant spin density is on N1 and N3. Moreover, 13C hyperfine interactions between the radical and the methylene carbon of the formerly [methyl-13C]Cys355 residue show that the radical species exists in a covalent cross-link between the protein and the nucleic acid substrate. X-ray structures of RlmN C118A show that, in the presence of SAM, the substitution does not alter the active site structure compared to that of the wild-type enzyme. Together, these findings have new mechanistic implications for the role(s) of C118 and its counterpart in Cfr (C105) in catalysis, and suggest involvement of the residue in resolution of the cross-linked species via a radical mediated process. PMID:24806349

Characterization of a Cross-Linked Protein-Nucleic Acid Substrate Radical in the Reaction Catalyzed by RlmN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silakov, Alexey; Grove, Tyler L.; Radle, Matthew I.

2014-08-14

RlmN and Cfr are methyltransferases/methylsynthases that belong to the radical S-adenosylmethionine superfamily of enzymes. RlmN catalyzes C2 methylation of adenosine 2503 (A2503) of 23S rRNA, while Cfr catalyzes C8 methylation of the exact same nucleotide, and will subsequently catalyze C2 methylation if the site is unmethylated. A key feature of the unusual mechanisms of catalysis proposed for these enzymes is the attack of a methylene radical, derived from a methylcysteine residue, onto the carbon center undergoing methylation to generate a paramagnetic protein–nucleic acid cross-linked species. This species has been thoroughly characterized during Cfr-dependent C8 methylation, but does not accumulate tomore » detectible levels in RlmN-dependent C2 methylation. Herein, we show that inactive C118S/A variants of RlmN accumulate a substrate-derived paramagnetic species. Characterization of this species by electron paramagnetic resonance spectroscopy in concert with strategic isotopic labeling shows that the radical is delocalized throughout the adenine ring of A2503, although predominant spin density is on N1 and N3. Moreover, 13C hyperfine interactions between the radical and the methylene carbon of the formerly [methyl- 13C]Cys355 residue show that the radical species exists in a covalent cross-link between the protein and the nucleic acid substrate. X-ray structures of RlmN C118A show that, in the presence of SAM, the substitution does not alter the active site structure compared to that of the wild-type enzyme. Together, these findings have new mechanistic implications for the role(s) of C118 and its counterpart in Cfr (C105) in catalysis, and suggest involvement of the residue in resolution of the cross-linked species via a radical mediated process« less

Identification of critical residues in Hepatitis E virus macro domain involved in its interaction with viral methyltransferase and ORF3 proteins

PubMed Central

Anang, Saumya; Subramani, Chandru; Nair, Vidya P.; Kaul, Sheetal; Kaushik, Nidhi; Sharma, Chandresh; Tiwari, Ashutosh; Ranjith-Kumar, CT; Surjit, Milan

2016-01-01

Hepatitis E virus (HEV) is a major cause of hepatitis in normal and organ transplant individuals. HEV open reading frame-1 encodes a polypeptide comprising of the viral nonstructural proteins as well as domains of unknown function such as the macro domain (X-domain), V, DUF3729 and Y. The macro domain proteins are ubiquitously present from prokaryotes to human and in many positive-strand RNA viruses, playing important roles in multiple cellular processes. Towards understanding the function of the HEV macro domain, we characterized its interaction partners among other HEV encoded proteins. Here, we report that the HEV X-domain directly interacts with the viral methyltransferase and the ORF3 proteins. ORF3 association with the X-domain was mediated through two independent motifs, located within its N-terminal 35aa (amino acids) and C-terminal 63-123aa. Methyltransferase interaction domain was mapped to N-terminal 30-90aa. The X-domain interacted with both ORF3 and methyltransferase through its C-terminal region, involving 66th,67th isoleucine and 101st,102nd leucine, conserved across HEV genotypes. Furthermore, ORF3 and methyltransferase competed with each other for associating with the X-domain. These findings provide molecular understanding of the interaction between the HEV macro domain, methyltransferase and ORF3, suggesting an important role of the macro domain in the life cycle of HEV. PMID:27113483

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

Molecular cloning and functional expression of a stress-induced multifunctional O-methyltransferase with pinosylvin methyltransferase activity from Scots pine (Pinus sylvestris L.).

PubMed

Chiron, H; Drouet, A; Claudot, A C; Eckerskorn, C; Trost, M; Heller, W; Ernst, D; Sandermann, H

2000-12-01

Formation of pinosylvin (PS) and pinosylvin 3-O-monomethyl ether (PSM), as well as the activities of stilbene synthase (STS) and S-adenosyl-1-methionine (SAM):pinosylvin O-methyltransferase (PMT), were induced strongly in needles of Scots pine seedlings upon ozone treatment, as well as in cell suspension cultures of Scots pine upon fungal elicitation. A SAM-dependent PMT protein was purified and partially characterised. A cDNA encoding PMT was isolated from an ozone-induced Scots pine cDNA library. Southern blot analysis of the genomic DNA suggested the presence of a gene family. The deduced protein sequence showed the typical highly conserved regions of O-methyltransferases (OMTs), and average identities of 20-56% to known OMTs. PMT expressed in Escherichia coli corresponded to that of purified PMT (40 kDa) from pine cell cultures. The recombinant enzyme catalysed the methylation of PS, caffeic acid, caffeoyl-CoA and quercetin. Several other substances, such as astringenin, resveratrol, 5-OH-ferulic acid, catechol and luteolin, were also methylated. Recombinant PMT thus had a relatively broad substrate specificity. Treatment of 7-year old Scots pine trees with ozone markedly increased the PMT mRNA level. Our results show that PMT represents a new SAM-dependent OMT for the methylation of stress-induced pinosylvin in Scots pine needles.

Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

PubMed Central

Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius

2012-01-01

DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

Time-dependent inactivation of human phenylethanolamine N-methyltransferase by 7-isothiocyanatotetrahydroisoquinoline

PubMed Central

Wu, Qian; Caine, Joanne M.; Thomson, Stuart A.; Slavica, Meri; Grunewald, Gary L.

2009-01-01

Inhibitors of phenylethanolamine N-methyltransferase [PNMT, the enzyme that catalyzes the final step in the biosynthesis of epinephrine (Epi)] may be of use in determining the role of Epi in the central nervous system. Here we describe the synthesis and characterization of 7-SCN tetrahydroisoquinoline as an affinity label for human PNMT. PMID:19171483

PRMT7, a new protein arginine methyltransferase that synthesizes symmetric dimethylarginine.

PubMed

Lee, Jin-Hyung; Cook, Jeffry R; Yang, Zhi-Hong; Mirochnitchenko, Olga; Gunderson, Samuel I; Felix, Arthur M; Herth, Nicole; Hoffmann, Ralf; Pestka, Sidney

2005-02-04

The cDNA for PRMT7, a recently discovered human protein-arginine methyltransferase (PRMT), was cloned and expressed in Escherichia coli and mammalian cells. Immunopurified PRMT7 actively methylated histones, myelin basic protein, a fragment of human fibrillarin (GAR) and spliceosomal protein SmB. Amino acid analysis showed that the modifications produced were predominantly monomethylarginine and symmetric dimethylarginine (SDMA). Examination of PRMT7 expressed in E. coli demonstrated that peptides corresponding to sequences contained in histone H4, myelin basic protein, and SmD3 were methylated. Furthermore, analysis of the methylated proteins showed that symmetric dimethylarginine and relatively small amounts of monomethylarginine and asymmetric dimethylarginine were produced. SDMA was also formed when a GRG tripeptide was methylated by PRMT7, indicating that a GRG motif is by itself sufficient for symmetric dimethylation to occur. Symmetric dimethylation is reduced dramatically compared with monomethylation as the concentration of the substrate is increased. The data demonstrate that PRMT7 (like PRMT5) is a Type II methyltransferase capable of producing SDMA modifications in proteins.

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

rRNA fragmentation induced by a yeast killer toxin.

PubMed

Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

2014-02-01

Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

Plasmodium falciparum PfSET7: enzymatic characterization and cellular localization of a novel protein methyltransferase in sporozoite, liver and erythrocytic stage parasites

PubMed Central

Chen, Patty B.; Ding, Shuai; Zanghì, Gigliola; Soulard, Valérie; DiMaggio, Peter A.; Fuchter, Matthew J.; Mecheri, Salah; Mazier, Dominique; Scherf, Artur; Malmquist, Nicholas A.

2016-01-01

Epigenetic control via reversible histone methylation regulates transcriptional activation throughout the malaria parasite genome, controls the repression of multi-copy virulence gene families and determines sexual stage commitment. Plasmodium falciparum encodes ten predicted SET domain-containing protein methyltransferases, six of which have been shown to be refractory to knock-out in blood stage parasites. We have expressed and purified the first recombinant malaria methyltransferase in sufficient quantities to perform a full enzymatic characterization and reveal the ill-defined PfSET7 is an AdoMet-dependent histone H3 lysine methyltransferase with highest activity towards lysines 4 and 9. Steady-state kinetics of the PfSET7 enzyme are similar to previously characterized histone methyltransferase enzymes from other organisms, however, PfSET7 displays specific protein substrate preference towards nucleosomes with pre-existing histone H3 lysine 14 acetylation. Interestingly, PfSET7 localizes to distinct cytoplasmic foci adjacent to the nucleus in erythrocytic and liver stage parasites, and throughout the cytoplasm in salivary gland sporozoites. Characterized recombinant PfSET7 now allows for target based inhibitor discovery. Specific PfSET7 inhibitors can aid in further investigating the biological role of this specific methyltransferase in transmission, hepatic and blood stage parasites, and may ultimately lead to the development of suitable antimalarial drug candidates against this novel class of essential parasite enzymes. PMID:26902486

Noncompetitive Inhibition of Indolethylamine-N-methyltransferase by N,N-Dimethyltryptamine and N,N-Dimethylaminopropyltryptamine

PubMed Central

2015-01-01

Indolethylamine-N-methyltransferase (INMT) is a Class 1 transmethylation enzyme known for its production of N,N-dimethyltryptamine (DMT), a hallucinogen with affinity for various serotonergic, adrenergic, histaminergic, dopaminergic, and sigma-1 receptors. DMT is produced via the action of INMT on the endogenous substrates tryptamine and S-adenosyl-l-methionine (SAM). The biological, biochemical, and selective small molecule regulation of INMT enzyme activity remain largely unknown. Kinetic mechanisms for inhibition of rabbit lung INMT (rabINMT) by the product, DMT, and by a new novel tryptamine derivative were determined. After Michaelis–Menten and Lineweaver–Burk analyses had been applied to study inhibition, DMT was found to be a mixed competitive and noncompetitive inhibitor when measured against tryptamine. The novel tryptamine derivative, N-[2-(1H-indol-3-yl)ethyl]-N′,N′-dimethylpropane-1,3-diamine (propyl dimethyl amino tryptamine or PDAT), was shown to inhibit rabINMT by a pure noncompetitive mechanism when measured against tryptamine with a Ki of 84 μM. No inhibition by PDAT was observed at 2 mM when it was tested against structurally similar Class 1 methyltransferases, such as human phenylethanolamine-N-methyltransferase (hPNMT) and human nicotinamide-N-methyltransferase (hNNMT), indicating selectivity for INMT. The demonstration of noncompetitive mechanisms for INMT inhibition implies the presence of an inhibitory allosteric site. In silico analyses using the computer modeling software Autodock and the rabINMT sequence threaded onto the human INMT (hINMT) structure (Protein Data Bank entry 2A14) identified an N-terminal helix–loop–helix non-active site binding region of the enzyme. The energies for binding of DMT and PDAT to this region of rabINMT, as determined by Autodock, were −6.34 and −7.58 kcal/mol, respectively. Assessment of the allosteric control of INMT may illuminate new biochemical pathway(s) underlying the biology of INMT

Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

PubMed

Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

2014-12-01

Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

MicroRNA-29a Alleviates Bile Duct Ligation Exacerbation of Hepatic Fibrosis in Mice through Epigenetic Control of Methyltransferases.

PubMed

Yang, Ya-Ling; Wang, Feng-Sheng; Li, Sung-Chou; Tiao, Mao-Meng; Huang, Ying-Hsien

2017-01-18

MicroRNA-29 (miR-29) is found to modulate hepatic stellate cells' (HSCs) activation and, thereby, reduces liver fibrosis pathogenesis. Histone methyltransferase regulation of epigenetic reactions reportedly participates in hepatic fibrosis. This study is undertaken to investigate the miR-29a regulation of the methyltransferase signaling and epigenetic program in hepatic fibrosis progression. miR-29a transgenic mice (miR-29aTg mice) and wild-type littermates were subjected to bile duct-ligation (BDL) to develop cholestatic liver fibrosis. Primary HSCs were transfected with a miR-29a mimic and antisense inhibitor. Profibrogenic gene expression, histone methyltransferases and global genetic methylation were probed with real-time quantitative RT-PCR, immunohistochemical stain, Western blot and ELISA. Hepatic tissue in miR-29aTg mice displayed weak fibrotic matrix as evidenced by Sirius Red staining concomitant with low fibrotic matrix collagen 1α1 expression within affected tissues compared to the wild-type mice. miR-29a overexpression reduced the BDL exaggeration of methyltransferases, DNMT1, DNMT3b and SET domain containing 1A (SET1A) expression. It also elevated phosphatase and tensin homolog deleted on chromosome 10 (PTEN) signaling within liver tissue. In vitro, miR-29a mimic transfection lowered collagen 1α1, DNMT1, DNMT3b and SET1A expression in HSCs. Gain of miR-29a signaling resulted in DNA hypomethylation and high PTEN expression. This study shines a new light on miR-29a inhibition of methyltransferase, a protective effect to maintain the DNA hypomethylation state that decreases fibrogenic activities in HSC. These robust analyses also highlight the miR-29a regulation of epigenetic actions to ameliorate excessive fibrosis during cholestatic liver fibrosis development.

Determination of the order of substrate addition to MspI DNA methyltransferase using a novel mechanism-based inhibitor.

PubMed Central

Taylor, C; Ford, K; Connolly, B A; Hornby, D P

1993-01-01

The cloning and overexpression of the MspI DNA methyltransferase as a functional fusion with glutathione S-transferase is described. The fusion enzyme retains full biological activity and has been used to investigate the interaction of substrates and inhibitors with MspI DNA methyltransferase. The fusion enzyme has been purified to homogeneity in a single step on GSH-agarose and is free from contaminating exonuclease activity. The enzyme can be photolabelled with S-adenosyl-L-methionine and the level of incorporation of label is enhanced by the presence of a nonspecific DNA duplex. In the presence of a cognate oligodeoxynucleotide, no photolabelling was observed since methyl transfer occurs instead. The inclusion of a mechanism-based inhibitor of C-5 deoxycytidine DNA methylation (an oligodeoxynucleotide containing the base 2-pyrimidinone-1-beta-D-2'-deoxyribofuranoside in the position of the deoxycytidine to which methyl addition occurs), which is thought to form a covalent interaction with the reactive cysteine of such enzymes, led to an enhancement of S-adenosyl-L-methionine photolabelling which suggests that, in contrast with results obtained with EcoRII DNA methyltransferase [Som and Friedman (1991) J. Biol. Chem. 266, 2937-2945], methylcysteine is not the photolabelled product. The implications of the results obtained with this mechanism-based inhibitor are discussed with respect to other C-5-specific DNA methyltransferases. Gel-retardation assays in the presence of cognate oligodeoxynucleotides that contain the reactive pyrimidinone base in place of the deoxycytidine target base are described. These demonstrate that most probably a stable covalent bond is formed between the methyltransferase and this oligodeoxynucleotide. However, the alternative of extremely tight non-covalent binding cannot be rigorously excluded. Furthermore, the results from these experiments indicate that the reaction mechanism proceeds in a manner similar to that of HhaI DNA

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Roles of phospholipid methyltransferases in pycnidia development, stress tolerance and secondary metabolism in the taxol-producing fungus Pestalotiopsis microspore.

PubMed

Akhberdi, Oren; Zhang, Qian; Wang, Haichuan; Li, Yingying; Chen, Longfei; Wang, Dan; Yu, Xi; Wei, Dongsheng; Zhu, Xudong

2018-05-01

Phosphatidylcholine (PC) is an important membrane component of the eukaryotic cell. In yeast fungi, two phospholipid methyltransferases catalyze consecutive steps of methylation in the formation of phosphatidylcholine from phosphatidylethanolamine. However, roles of phospholipid methyltransferases in filamentous fungi remains less investigated. We report here the characterization of two genes, choA and choC, that putatively encoded phospholipid methyltransferases in the taxol-producing fungus Pestalotiopsis microspora. Deletion of choC resulted in defects in PC production, vegetative growth and development of asexual structure. The mutant strains exhibited multiple morphological abnormalities, e.g. swollen hyphal tips and enhanced hyphal branching, and even mycelial autolysis. Some novel roles for the genes were also revealed, for instance, the deletion of either choC or choA impaired the development of pycnidia and conidia, the cell wall integrity. The mutant strains displayed a hypersensitivity to stress conditions, e.g. osmotic stress, cold and metal ions. The osmotic hypersensitivity indicates a crosstalk of PC pathways to other signaling pathways, such as the HOG pathway. Still more, choA, but not choC, was required for the production of secondary metabolites, e.g. pestalotiollide B, suggesting distinct roles of the two genes. This work would contribute to better understanding the function of phospholipid methyltransferases in fungi. Copyright © 2018 Elsevier GmbH. All rights reserved.

Inhibitors of Protein Methyltransferases and Demethylases

PubMed Central

2017-01-01

Post-translational modifications of histones by protein methyltransferases (PMTs) and histone demethylases (KDMs) play an important role in the regulation of gene expression and transcription and are implicated in cancer and many other diseases. Many of these enzymes also target various nonhistone proteins impacting numerous crucial biological pathways. Given their key biological functions and implications in human diseases, there has been a growing interest in assessing these enzymes as potential therapeutic targets. Consequently, discovering and developing inhibitors of these enzymes has become a very active and fast-growing research area over the past decade. In this review, we cover the discovery, characterization, and biological application of inhibitors of PMTs and KDMs with emphasis on key advancements in the field. We also discuss challenges, opportunities, and future directions in this emerging, exciting research field. PMID:28338320

Recent advances in targeting protein arginine methyltransferase enzymes in cancer therapy.

PubMed

Smith, Emily; Zhou, Wei; Shindiapina, Polina; Sif, Said; Li, Chenglong; Baiocchi, Robert A

2018-05-21

Exploration in the field of epigenetics has revealed the diverse roles of the protein arginine methyltransferase (PRMT) family of proteins in multiple disease states. These findings have led to the development of specific inhibitors and discovery of several new classes of drugs with potential to treat both benign and malignant conditions. Areas covered: We provide an overview on the role of PRMT enzymes in healthy and malignant cells, highlighting the role of arginine methylation in specific pathways relevant to cancer pathogenesis. Additionally, we describe structure and catalytic activity of PRMT and discuss the mechanisms of action of novel small molecule inhibitors of specific members of the arginine methyltransferase family. Expert opinion: As the field of PRMT biology advances, it's becoming clear that this class of enzymes is highly relevant to maintaining normal physiologic processes as well and disease pathogenesis. We discuss the potential impact of PRMT inhibitors as a broad class of drugs, including the pleiotropic effects, off target effects the need for more detailed PRMT-centric interactomes, and finally, the potential for targeting this class of enzymes in clinical development of experimental therapeutics for cancer.

Host Methyltransferases and Demethylases: Potential New Epigenetic Targets for HIV Cure Strategies and Beyond.

PubMed

Boehm, Daniela; Ott, Melanie

2017-11-01

A successful HIV cure strategy may require reversing HIV latency to purge hidden viral reservoirs or enhancing HIV latency to permanently silence HIV transcription. Epigenetic modifying agents show promise as antilatency therapeutics in vitro and ex vivo, but also affect other steps in the viral life cycle. In this review, we summarize what we know about cellular DNA and protein methyltransferases (PMTs) as well as demethylases involved in HIV infection. We describe the biology and function of DNA methyltransferases, and their controversial role in HIV infection. We further explain the biology of PMTs and their effects on lysine and arginine methylation of histone and nonhistone proteins. We end with a focus on protein demethylases, their unique modes of action and their emerging influence on HIV infection. An outlook on the use of methylation-modifying agents in investigational HIV cure strategies is provided.

Guanidinoacetate Methyltransferase (GAMT) Deficiency: Late Onset of Movement Disorder and Preserved Expressive Language

ERIC Educational Resources Information Center

O'Rourke, Declan J.; Ryan, Stephanie; Salomons, Gajja; Jakobs, Cornelis; Monavari, Ahmad; King, Mary D.

2009-01-01

Guanidinoacetate methyltransferase (GAMT) deficiency is a disorder of creatine biosynthesis, characterized by early-onset learning disability and epilepsy in most affected children. Severe expressive language delay is a constant feature even in the mildest clinical phenotypes. We report the clinical, biochemical, imaging, and treatment data of two…

CHARACTERIZATION OF HUMAN URINARY BLADDER CELL LINE UROTSA TRANSDUCED WITH RAT ASLLL-METHYLTRANSFERASE

EPA Science Inventory

In humans, the biomethylation of arsenic (As) is catalyzed by an As(III)-methyltransferase (Cyt19) and yields pentavalent and trivalent methylated arsenicals. Cyt19 activity and expression levels vary among tissues. For example, Cyt19 mRNA is not detected in UROtsa cells, a h...

A critical role for noncoding 5S rRNA in regulating Mdmx stability.

PubMed

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis.

PubMed

Rivera-Millot, Alex; Lesne, Elodie; Solans, Luis; Coutte, Loic; Bertrand-Michel, Justine; Froguel, Philippe; Dhennin, Véronique; Hot, David; Locht, Camille; Antoine, Rudy; Jacob-Dubuisson, Françoise

2017-01-01

The whooping cough agent Bordetella pertussis controls the expression of its large virulence regulon in a coordinated manner through the two-component signal transduction system BvgAS. In addition to the genes coding for bona fide virulence factors, the Bvg regulon comprises genes of unknown function. In this work, we characterized a new Bvg-activated gene called BP2936. Homologs of BP2936 are found in other pathogenic Bordetellae and in several other species, including plant pathogens and environmental bacteria. We showed that the gene product of BP2936 is a membrane-associated methyl-transferase of free fatty acids. We thus propose to name it FmtB, for fatty acid methyl-transferase of Bordetella. The role of this protein was tested in cellular and animal models of infection, but the loss of BP2936 did not appear to affect host-pathogen interactions in those assays. The high level of conservation of BP2936 among B. pertussis isolates nevertheless argues that it probably plays a role in the life cycle of this pathogen.

Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis

PubMed Central

Rivera-Millot, Alex; Lesne, Elodie; Solans, Luis; Coutte, Loic; Bertrand-Michel, Justine; Froguel, Philippe; Dhennin, Véronique; Hot, David; Locht, Camille; Antoine, Rudy

2017-01-01

The whooping cough agent Bordetella pertussis controls the expression of its large virulence regulon in a coordinated manner through the two-component signal transduction system BvgAS. In addition to the genes coding for bona fide virulence factors, the Bvg regulon comprises genes of unknown function. In this work, we characterized a new Bvg-activated gene called BP2936. Homologs of BP2936 are found in other pathogenic Bordetellae and in several other species, including plant pathogens and environmental bacteria. We showed that the gene product of BP2936 is a membrane-associated methyl-transferase of free fatty acids. We thus propose to name it FmtB, for fatty acid methyl-transferase of Bordetella. The role of this protein was tested in cellular and animal models of infection, but the loss of BP2936 did not appear to affect host-pathogen interactions in those assays. The high level of conservation of BP2936 among B. pertussis isolates nevertheless argues that it probably plays a role in the life cycle of this pathogen. PMID:28493897

Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence.

PubMed

James, Allison E; Rogovskyy, Artem S; Crowley, Michael A; Bankhead, Troy

2016-01-01

DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence.

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases

PubMed Central

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-01-01

Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases.

PubMed

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-03-01

Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that d

Small-molecule histone methyltransferase inhibitors display rapid antimalarial activity against all blood stage forms in Plasmodium falciparum

PubMed Central

Malmquist, Nicholas A.; Moss, Thomas A.; Mecheri, Salah; Scherf, Artur; Fuchter, Matthew J.

2012-01-01

Epigenetic factors such as histone methylation control the developmental progression of malaria parasites during the complex life cycle in the human host. We investigated Plasmodium falciparum histone lysine methyltransferases as a potential target class for the development of novel antimalarials. We synthesized a compound library based upon a known specific inhibitor (BIX-01294) of the human G9a histone methyltransferase. Two compounds, BIX-01294 and its derivative TM2-115, inhibited P. falciparum 3D7 parasites in culture with IC50 values of ∼100 nM, values at least 22-fold more potent than their apparent IC50 toward two human cell lines and one mouse cell line. These compounds irreversibly arrested parasite growth at all stages of the intraerythrocytic life cycle. Decrease in parasite viability (>40%) was seen after a 3-h incubation with 1 µM BIX-01294 and resulted in complete parasite killing after a 12-h incubation. Additionally, mice with patent Plasmodium berghei ANKA strain infection treated with a single dose (40 mg/kg) of TM2-115 had 18-fold reduced parasitemia the following day. Importantly, treatment of P. falciparum parasites in culture with BIX-01294 or TM2-115 resulted in significant reductions in histone H3K4me3 levels in a concentration-dependent and exposure time-dependent manner. Together, these results suggest that BIX-01294 and TM2-115 inhibit malaria parasite histone methyltransferases, resulting in rapid and irreversible parasite death. Our data position histone lysine methyltransferases as a previously unrecognized target class, and BIX-01294 as a promising lead compound, in a presently unexploited avenue for antimalarial drug discovery targeting multiple life-cycle stages. PMID:23011794

Mammalian Protein Arginine Methyltransferase 7 (PRMT7) Specifically Targets RXR Sites in Lysine- and Arginine-rich Regions*

PubMed Central

Feng, You; Maity, Ranjan; Whitelegge, Julian P.; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T.; Bedford, Mark T.; Masson, Jean-Yves; Clarke, Steven G.

2013-01-01

The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7. PMID:24247247

Mammalian protein arginine methyltransferase 7 (PRMT7) specifically targets RXR sites in lysine- and arginine-rich regions.

PubMed

Feng, You; Maity, Ranjan; Whitelegge, Julian P; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T; Bedford, Mark T; Masson, Jean-Yves; Clarke, Steven G

2013-12-27

The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7.

A Tetrahydrofolate-Dependent Methyltransferase Catalyzing the Demethylation of Dicamba in Sphingomonas sp. Strain Ndbn-20

PubMed Central

Yao, Li; Yu, Lin-Lu; Zhang, Jun-Jie; Xie, Xiang-Ting; Tao, Qing; Yan, Xin; Hong, Qing; Qiu, Ji-Guo

2016-01-01

ABSTRACT Sphingomonas sp. strain Ndbn-20 degrades and utilizes the herbicide dicamba as its sole carbon and energy source. In the present study, a tetrahydrofolate (THF)-dependent dicamba methyltransferase gene, dmt, was cloned from the strain, and three other genes, metF, dhc, and purU, which are involved in THF metabolism, were found to be located downstream of dmt. A transcriptional study revealed that the four genes constituted one transcriptional unit that was constitutively transcribed. Lysates of cells grown with glucose or dicamba exhibited almost the same activities, which further suggested that the dmt gene is constitutively expressed in the strain. Dmt shared 46% and 45% identities with the methyltransferases DesA and LigM from Sphingomonas paucimobilis SYK-6, respectively. The purified Dmt catalyzed the transfer of methyl from dicamba to THF to form the herbicidally inactive metabolite 3,6-dichlorosalicylic acid (DCSA) and 5-methyl-THF. The activity of Dmt was inhibited by 5-methyl-THF but not by DCSA. The introduction of a codon-optimized dmt gene into Arabidopsis thaliana enhanced resistance against dicamba. In conclusion, this study identified a THF-dependent dicamba methyltransferase, Dmt, with potential applications for the genetic engineering of dicamba-resistant crops. IMPORTANCE Dicamba is a very important herbicide that is widely used to control more than 200 types of broadleaf weeds and is a suitable target herbicide for the engineering of herbicide-resistant transgenic crops. A study of the mechanism of dicamba metabolism by soil microorganisms will benefit studies of its dissipation, transformation, and migration in the environment. This study identified a THF-dependent methyltransferase, Dmt, capable of catalyzing dicamba demethylation in Sphingomonas sp. Ndbn-20, and a preliminary study of its enzymatic characteristics was performed. Introduction of a codon-optimized dmt gene into Arabidopsis thaliana enhanced resistance against dicamba

A NOVEL S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE FROM RAT LIVER CYTOSOL

EPA Science Inventory

A Novel S-Adenosyl-L-methionine: Arsenic(III) Methyltransferase from Rat Liver Cytosol
Shan Lin, Qing Shi, F. Brent Nix, Miroslav Styblo, Melinda A. Beck, Karen M. Herbin-Davis, Larry L. Hall, Josef B. Simeonsson, and David J. Thomas
S-adenosyl-L-methionine (AdoMet): ar...

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

Polymorphisms in arsenic(+III oxidation state) methyltransferase (AS3MT) predict gene expression of AS3MT as well as arsenic metabolism.

PubMed

Engström, Karin; Vahter, Marie; Mlakar, Simona Jurkovic; Concha, Gabriela; Nermell, Barbro; Raqib, Rubhana; Cardozo, Alejandro; Broberg, Karin

2011-02-01

Arsenic (As) occurs as monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA) in humans, and the methylation pattern demonstrates large interindividual differences. The fraction of urinary MMA is a marker for susceptibility to As-related diseases. We evaluated the impact of polymorphisms in five methyltransferase genes on As metabolism in two populations, one in South America and one in Southeast Asia. The methyltransferase genes were arsenic(+III oxidation state) methyltransferase (AS3MT), DNA-methyltransferase 1a and 3b (DNMT1a and DNMT3b, respectively), phosphatidylethanolamine N-methyltransferase (PEMT), and betaine-homocysteine methyltransferase (BHMT). AS3MT expression was analyzed in peripheral blood. Subjects were women exposed to As in drinking water in the Argentinean Andes [n = 172; median total urinary As (U-As), 200 µg/L] and in rural Bangladesh (n = 361; U-As, 100 µg/L; all in early pregnancy). Urinary As metabolites were measured by high-pressure liquid chromatography/inductively coupled plasma mass spectrometry. Polymorphisms (n = 22) were genotyped with Sequenom, and AS3MT expression was measured by quantitative real-time polymerase chain reaction using TaqMan expression assays. Six AS3MT polymorphisms were significantly associated with As metabolite patterns in both populations (p ≤ 0.01). The most frequent AS3MT haplotype in Bangladesh was associated with a higher percentage of MMA (%MMA), and the most frequent haplotype in Argentina was associated with a lower %MMA and a higher percentage of DMA. Four polymorphisms in the DNMT genes were associated with metabolite patterns in Bangladesh. Noncoding AS3MT polymorphisms affected gene expression of AS3MT in peripheral blood, demonstrating that one functional impact of AS3MT polymorphisms may be altered levels of gene expression. Polymorphisms in AS3MT significantly predicted As metabolism across these two very different populations, suggesting that AS3MT may have an impact on As metabolite

Polymorphisms in Arsenic(+III Oxidation State) Methyltransferase (AS3MT) Predict Gene Expression of AS3MT as Well as Arsenic Metabolism

PubMed Central

Engström, Karin; Vahter, Marie; Mlakar, Simona Jurkovic; Concha, Gabriela; Nermell, Barbro; Raqib, Rubhana; Cardozo, Alejandro; Broberg, Karin

2011-01-01

Background Arsenic (As) occurs as monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA) in humans, and the methylation pattern demonstrates large interindividual differences. The fraction of urinary MMA is a marker for susceptibility to As-related diseases. Objectives We evaluated the impact of polymorphisms in five methyltransferase genes on As metabolism in two populations, one in South America and one in Southeast Asia. The methyltransferase genes were arsenic(+III oxidation state) methyltransferase (AS3MT), DNA-methyltransferase 1a and 3b (DNMT1a and DNMT3b, respectively), phosphatidylethanolamine N-methyltransferase (PEMT), and betaine-homocysteine methyltransferase (BHMT). AS3MT expression was analyzed in peripheral blood. Methods Subjects were women exposed to As in drinking water in the Argentinean Andes [n = 172; median total urinary As (U-As), 200 μg/L] and in rural Bangladesh (n = 361; U-As, 100 μg/L; all in early pregnancy). Urinary As metabolites were measured by high-pressure liquid chromatography/inductively coupled plasma mass spectrometry. Polymorphisms (n = 22) were genotyped with Sequenom, and AS3MT expression was measured by quantitative real-time polymerase chain reaction using TaqMan expression assays. Results Six AS3MT polymorphisms were significantly associated with As metabolite patterns in both populations (p ≤ 0.01). The most frequent AS3MT haplotype in Bangladesh was associated with a higher percentage of MMA (%MMA), and the most frequent haplotype in Argentina was associated with a lower %MMA and a higher percentage of DMA. Four polymorphisms in the DNMT genes were associated with metabolite patterns in Bangladesh. Noncoding AS3MT polymorphisms affected gene expression of AS3MT in peripheral blood, demonstrating that one functional impact of AS3MT polymorphisms may be altered levels of gene expression. Conclusions Polymorphisms in AS3MT significantly predicted As metabolism across these two very different populations

RmtA, a putative arginine methyltransferase, regulates secondary metabolism and development in Aspergillus flavus

USDA-ARS?s Scientific Manuscript database

Aspergillus flavus is found colonizing numerous oil seed crops such as corn, peanuts, sorghum, treenuts and cotton worldwide, contaminating them with aflatoxin and other harmful potent toxins. In the phylogenetically related model fungus Aspergillus nidulans, the methyltransferase, RmtA, has been de...

Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

ERIC Educational Resources Information Center

Guan, Min-Xin

2005-01-01

The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

Quercetin-Induced Lifespan Extension in Podospora anserina Requires Methylation of the Flavonoid by the O-Methyltransferase PaMTH1.

PubMed

Warnsmann, Verena; Hainbuch, Saskia; Osiewacz, Heinz D

2018-01-01

Quercetin is a flavonoid that is ubiquitously found in vegetables and fruits. Like other flavonoids, it is active in balancing cellular reactive oxygen species (ROS) levels and has a cyto-protective function. Previously, a link between ROS balancing, aging, and the activity of O -methyltransferases was reported in different organisms including the aging model Podospora anserina. Here we describe a role of the S -adenosylmethionine-dependent O -methyltransferase PaMTH1 in quercetin-induced lifespan extension. We found that effects of quercetin treatment depend on the methylation state of the flavonoid. Specifically, we observed that quercetin treatment increases the lifespan of the wild type but not of the PaMth1 deletion mutant. The lifespan increasing effect is not associated with effects of quercetin on mitochondrial respiration or ROS levels but linked to the induction of the PaMth1 gene. Overall, our data demonstrate a novel role of O -methyltransferase in quercetin-induced longevity and identify the underlying pathway as part of a network of longevity assurance pathways with the perspective to intervene into mechanisms of biological aging.

Case study for the evaluation of current treatment recommendations of guanidinoacetate methyltransferase deficiency: ineffectiveness of sodium benzoate.

PubMed

Mercimek-Mahmutoglu, Saadet; Salomons, Gajja S; Chan, Alicia

2014-07-01

Guanidinoacetate methyltransferase deficiency is an autosomal recessively inherited disorder of creatine biosynthesis. We report a new patient with guanidinoacetate methyltransferase deficiency and her >3-year treatment outcome. This is a 6-year-old girl who was diagnosed with guanidinoacetate methyltransferase deficiency at the age of 28 months. She presented with moderate global developmental delay, one afebrile seizure, and hypotonia between 6 and 18 months of life. She was treated with creatine and ornithine supplementation and a strict arginine-restricted diet for 42 months. Mutation analysis (compound heterozygous mutations, a known c.327G>A and a novel c.58dupT [p.Trp20LeufsX65]) and enzyme studies in primary fibroblasts confirmed the diagnosis. After 33 months of therapy, her cerebrospinal fluid guanidinoacetate level decreased from 47 to 5.3 times the normal level. Brain creatine by proton magnetic resonance spectroscopy increased by >75% but did not normalize in the basal ganglia and white matter after 3 years of therapy. Additional treatment with sodium benzoate for 17 months did not further improve plasma guanidinoacetate levels, which questions the relevance of this therapy. Treatment did not improve moderate intellectual disability or normalize guanidinoacetate accumulation in the central nervous system. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

The testis-specific factor CTCFL cooperates with the protein methyltransferase PRMT7 in H19 imprinting control region methylation.

PubMed

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-10-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation-DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation.

The Testis-Specific Factor CTCFL Cooperates with the Protein Methyltransferase PRMT7 in H19 Imprinting Control Region Methylation

PubMed Central

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-01-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation—DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation. PMID:17048991

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT S-ADENOSYL-1-METHIONINE: ARSENIC (III) METHYLTRANSFERASE

EPA Science Inventory

CLONING, EXPRESSION, AND MUTATIONAL ANALYSIS OF RAT
S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE

Stephen B. Waters, Ph.D., Miroslav Styblo, Ph.D., Melinda A. Beck, Ph.D., University of North Carolina at Chapel Hill; David J. Thomas, Ph.D., U.S. Environmental...

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Kinetic isotope effects reveal early transition state of protein lysine methyltransferase SET8

PubMed Central

Linscott, Joshua A.; Kapilashrami, Kanishk; Wang, Zhen; Senevirathne, Chamara; Bothwell, Ian R.; Blum, Gil; Luo, Minkui

2016-01-01

Protein lysine methyltransferases (PKMTs) catalyze the methylation of protein substrates, and their dysregulation has been linked to many diseases, including cancer. Accumulated evidence suggests that the reaction path of PKMT-catalyzed methylation consists of the formation of a cofactor(cosubstrate)–PKMT–substrate complex, lysine deprotonation through dynamic water channels, and a nucleophilic substitution (SN2) transition state for transmethylation. However, the molecular characters of the proposed process remain to be elucidated experimentally. Here we developed a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) method and corresponding mathematic matrix to determine precisely the ratios of isotopically methylated peptides. This approach may be generally applicable for examining the kinetic isotope effects (KIEs) of posttranslational modifying enzymes. Protein lysine methyltransferase SET8 is the sole PKMT to monomethylate histone 4 lysine 20 (H4K20) and its function has been implicated in normal cell cycle progression and cancer metastasis. We therefore implemented the MS-based method to measure KIEs and binding isotope effects (BIEs) of the cofactor S-adenosyl-l-methionine (SAM) for SET8-catalyzed H4K20 monomethylation. A primary intrinsic 13C KIE of 1.04, an inverse intrinsic α-secondary CD3 KIE of 0.90, and a small but statistically significant inverse CD3 BIE of 0.96, in combination with computational modeling, revealed that SET8-catalyzed methylation proceeds through an early, asymmetrical SN2 transition state with the C-N and C-S distances of 2.35–2.40 Å and 2.00–2.05 Å, respectively. This transition state is further supported by the KIEs, BIEs, and steady-state kinetics with the SAM analog Se-adenosyl-l-selenomethionine (SeAM) as a cofactor surrogate. The distinct transition states between protein methyltransferases present the opportunity to design selective transition-state analog inhibitors. PMID

mRNA Cap Methyltransferase, RNMT-RAM, Promotes RNA Pol II-Dependent Transcription.

PubMed

Varshney, Dhaval; Lombardi, Olivia; Schweikert, Gabriele; Dunn, Sianadh; Suska, Olga; Cowling, Victoria H

2018-05-01

mRNA cap addition occurs early during RNA Pol II-dependent transcription, facilitating pre-mRNA processing and translation. We report that the mammalian mRNA cap methyltransferase, RNMT-RAM, promotes RNA Pol II transcription independent of mRNA capping and translation. In cells, sublethal suppression of RNMT-RAM reduces RNA Pol II occupancy, net mRNA synthesis, and pre-mRNA levels. Conversely, expression of RNMT-RAM increases transcription independent of cap methyltransferase activity. In isolated nuclei, recombinant RNMT-RAM stimulates transcriptional output; this requires the RAM RNA binding domain. RNMT-RAM interacts with nascent transcripts along their entire length and with transcription-associated factors including the RNA Pol II subunits SPT4, SPT6, and PAFc. Suppression of RNMT-RAM inhibits transcriptional markers including histone H2BK120 ubiquitination, H3K4 and H3K36 methylation, RNA Pol II CTD S5 and S2 phosphorylation, and PAFc recruitment. These findings suggest that multiple interactions among RNMT-RAM, RNA Pol II factors, and RNA along the transcription unit stimulate transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Evolutionary transitions to new DNA methyltransferases through target site expansion and shrinkage.

PubMed

Rockah-Shmuel, Liat; Tawfik, Dan S

2012-12-01

DNA-binding and modifying proteins show high specificity but also exhibit a certain level of promiscuity. Such latent promiscuous activities comprise the starting points for new protein functions, but this hypothesis presents a paradox: a new activity can only evolve if it already exists. How then, do novel activities evolve? DNA methyltransferases, for example, are highly divergent in their target sites, but how transitions toward novel sites occur remains unknown. We performed laboratory evolution of the DNA methyltransferase M.HaeIII. We found that new target sites emerged primarily through expansion of the original site, GGCC, and the subsequent shrinkage of evolved expanded sites. Variants evolved for sites that are promiscuously methylated by M.HaeIII [GG((A)/(T))CC and GGCGCC] carried mutations in 'gate-keeper' residues. They could thereby methylate novel target sites such as GCGC and GGATCC that were neither selected for nor present in M.HaeIII. These 'generalist' intermediates were further evolved to obtain variants with novel target specificities. Our results demonstrate the ease by which new DNA-binding and modifying specificities evolve and the mechanism by which they occur at both the protein and DNA levels.

An Iterative O-Methyltransferase Catalyzes 1,11-Dimethylation of Aspergillus fumigatus Fumaric Acid Amides.

PubMed

Kalb, Daniel; Heinekamp, Thorsten; Schieferdecker, Sebastian; Nett, Markus; Brakhage, Axel A; Hoffmeister, Dirk

2016-10-04

S-adenosyl-l-methionine (SAM)-dependent methyltransfer is a common biosynthetic strategy to modify natural products. We investigated the previously uncharacterized Aspergillus fumigatus methyltransferase FtpM, which is encoded next to the bimodular fumaric acid amide synthetase FtpA. Structure elucidation of two new A. fumigatus natural products, the 1,11-dimethyl esters of fumaryl-l-tyrosine and fumaryl-l-phenylalanine, together with ftpM gene disruption suggested that FtpM catalyzes iterative methylation. Final evidence that a single enzyme repeatedly acts on fumaric acid amides came from an in vitro biochemical investigation with recombinantly produced FtpM. Size-exclusion chromatography indicated that this methyltransferase is active as a dimer. As ftpA and ftpM homologues are found clustered in other fungi, we expect our work will help to identify and annotate natural product biosynthesis genes in various species. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The C. elegans PRMT-3 possesses a type III protein arginine methyltransferase activity.

PubMed

Takahashi, Yuta; Daitoku, Hiroaki; Yokoyama, Atsuko; Nakayama, Kimihiro; Kim, Jun-Dal; Fukamizu, Akiyoshi

2011-04-01

Protein arginine methylation is a common post-translational modification in eukaryotes that is catalyzed by a family of the protein arginine methyltransferases (PRMTs). PRMTs are classified into three types: type I and type II add asymmetrically and symmetrically dimethyl groups to arginine, respectively, while type III adds solely monomethyl group to arginine. However, although the enzymatic activity of type I and type II PRMTs have been reported, the substrate specificity and the methylation activity of type III PRMTs still remains unknown. Here, we report the characterization of Caenorhabditis elegans PRMT-2 and PRMT-3, both of which are highly homologous to human PRMT7. We find that these two PRMTs can bind to S-adenosyl methionine (SAM), but only PRMT-3 has methyltransferase activity for histone H2A depending on its SAM-binding domain. Importantly, thin-layer chromatographic analysis demonstrates that PRMT-3 catalyzes the formation of monomethylated, but not dimethylated arginine. Our study thus identifies the first type III PRMT in C. elegans and provides a means to elucidate the physiological significance of arginine monomethylation in multicellular organisms.

Flavivirus RNA cap methyltransferase: structure, function, and inhibition.

PubMed

Liu, Lihui; Dong, Hongping; Chen, Hui; Zhang, Jing; Ling, Hua; Li, Zhong; Shi, Pei-Yong; Li, Hongmin

2010-08-01

Many flaviviruses are significant human pathogens. The plus-strand RNA genome of a flavivirus contains a 5' terminal cap 1 structure (m(7)GpppAmG). The flavivirus encodes one methyltransferase (MTase), located at the N-terminal portion of the NS5 RNA-dependent RNA polymerase (RdRp). Here we review recent advances in our understanding of flaviviral capping machinery and the implications for drug development. The NS5 MTase catalyzes both guanine N7 and ribose 2'-OH methylations during viral cap formation. Representative flavivirus MTases, from dengue, yellow fever, and West Nile virus (WNV), sequentially generate GpppA → m(7)GpppA → m(7)GpppAm. Despite the existence of two distinct methylation activities, the crystal structures of flavivirus MTases showed a single binding site for S-adenosyl-L-methionine (SAM), the methyl donor. This finding indicates that the substrate GpppA-RNA must be repositioned to accept the N7 and 2'-O methyl groups from SAM during the sequential reactions. Further studies demonstrated that distinct RNA elements are required for the methylations of guanine N7 on the cap and of ribose 2'-OH on the first transcribed nucleotide. Mutant enzymes with different methylation defects can trans complement one another in vitro, demonstrating that separate molecules of the enzyme can independently catalyze the two cap methylations in vitro. In the context of the infectious virus, defects in both methylations, or a defect in the N7 methylation alone, are lethal to WNV. However, viruses defective solely in 2'-O methylation are attenuated and can protect mice from later wild-type WNV challenge. The results demonstrate that the N7 methylation activity is essential for the WNV life cycle and, thus, methyltransferase represents a novel and promising target for flavivirus therapy.

Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

USDA-ARS?s Scientific Manuscript database

Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate Ciona intestinalis

EPA Science Inventory

Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+3 oxidation state) methyltransferase (As3mt), yielding mono- , di- , and trimethylated arsenicals. To investigate the evolution of molecular mechanisms that mediate arsenic biotransformation,...

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

2′-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase

PubMed Central

Dong, Hongping; Chang, David C.; Hua, Maggie Ho Chia; Lim, Siew Pheng; Chionh, Yok Hian; Hia, Fabian; Lee, Yie Hou; Kukkaro, Petra; Lok, Shee-Mei; Dedon, Peter C.; Shi, Pei-Yong

2012-01-01

RNA modification plays an important role in modulating host-pathogen interaction. Flavivirus NS5 protein encodes N-7 and 2′-O methyltransferase activities that are required for the formation of 5′ type I cap (m7GpppAm) of viral RNA genome. Here we reported, for the first time, that flavivirus NS5 has a novel internal RNA methylation activity. Recombinant NS5 proteins of West Nile virus and Dengue virus (serotype 4; DENV-4) specifically methylates polyA, but not polyG, polyC, or polyU, indicating that the methylation occurs at adenosine residue. RNAs with internal adenosines substituted with 2′-O-methyladenosines are not active substrates for internal methylation, whereas RNAs with adenosines substituted with N6-methyladenosines can be efficiently methylated, suggesting that the internal methylation occurs at the 2′-OH position of adenosine. Mass spectroscopic analysis further demonstrated that the internal methylation product is 2′-O-methyladenosine. Importantly, genomic RNA purified from DENV virion contains 2′-O-methyladenosine. The 2′-O methylation of internal adenosine does not require specific RNA sequence since recombinant methyltransferase of DENV-4 can efficiently methylate RNAs spanning different regions of viral genome, host ribosomal RNAs, and polyA. Structure-based mutagenesis results indicate that K61-D146-K181-E217 tetrad of DENV-4 methyltransferase forms the active site of internal methylation activity; in addition, distinct residues within the methyl donor (S-adenosyl-L-methionine) pocket, GTP pocket, and RNA-binding site are critical for the internal methylation activity. Functional analysis using flavivirus replicon and genome-length RNAs showed that internal methylation attenuated viral RNA translation and replication. Polymerase assay revealed that internal 2′-O-methyladenosine reduces the efficiency of RNA elongation. Collectively, our results demonstrate that flavivirus NS5 performs 2′-O methylation of internal adenosine of

Molecular Evolution of the Substrate Specificity of Chloroplastic Aldolases/Rubisco Lysine Methyltransferases in Plants.

PubMed

Ma, Sheng; Martin-Laffon, Jacqueline; Mininno, Morgane; Gigarel, Océane; Brugière, Sabine; Bastien, Olivier; Tardif, Marianne; Ravanel, Stéphane; Alban, Claude

2016-04-04

Rubisco and fructose-1,6-bisphosphate aldolases (FBAs) are involved in CO2 fixation in chloroplasts. Both enzymes are trimethylated at a specific lysine residue by the chloroplastic protein methyltransferase LSMT. Genes coding LSMT are present in all plant genomes but the methylation status of the substrates varies in a species-specific manner. For example, chloroplastic FBAs are naturally trimethylated in both Pisum sativum and Arabidopsis thaliana, whereas the Rubisco large subunit is trimethylated only in the former species. The in vivo methylation status of aldolases and Rubisco matches the catalytic properties of AtLSMT and PsLSMT, which are able to trimethylate FBAs or FBAs and Rubisco, respectively. Here, we created chimera and site-directed mutants of monofunctional AtLSMT and bifunctional PsLSMT to identify the molecular determinants responsible for substrate specificity. Our results indicate that the His-Ala/Pro-Trp triad located in the central part of LSMT enzymes is the key motif to confer the capacity to trimethylate Rubisco. Two of the critical residues are located on a surface loop outside the methyltransferase catalytic site. We observed a strict correlation between the presence of the triad motif and the in vivo methylation status of Rubisco. The distribution of the motif into a phylogenetic tree further suggests that the ancestral function of LSMT was FBA trimethylation. In a recent event during higher plant evolution, this function evolved in ancestors of Fabaceae, Cucurbitaceae, and Rosaceae to include Rubisco as an additional substrate to the archetypal enzyme. Our study provides insight into mechanisms by which SET-domain protein methyltransferases evolve new substrate specificity. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

The Set1/COMPASS histone H3 methyltransferase helps regulate mitosis with the CDK1 and NIMA mitotic kinases in Aspergillus nidulans.

PubMed

Govindaraghavan, Meera; Anglin, Sarah Lea; Osmani, Aysha H; Osmani, Stephen A

2014-08-01

Mitosis is promoted and regulated by reversible protein phosphorylation catalyzed by the essential NIMA and CDK1 kinases in the model filamentous fungus Aspergillus nidulans. Protein methylation mediated by the Set1/COMPASS methyltransferase complex has also been shown to regulate mitosis in budding yeast with the Aurora mitotic kinase. We uncover a genetic interaction between An-swd1, which encodes a subunit of the Set1 protein methyltransferase complex, with NIMA as partial inactivation of nimA is poorly tolerated in the absence of swd1. This genetic interaction is additionally seen without the Set1 methyltransferase catalytic subunit. Importantly partial inactivation of NIMT, a mitotic activator of the CDK1 kinase, also causes lethality in the absence of Set1 function, revealing a functional relationship between the Set1 complex and two pivotal mitotic kinases. The main target for Set1-mediated methylation is histone H3K4. Mutational analysis of histone H3 revealed that modifying the H3K4 target residue of Set1 methyltransferase activity phenocopied the lethality seen when either NIMA or CDK1 are partially functional. We probed the mechanistic basis of these genetic interactions and find that the Set1 complex performs functions with CDK1 for initiating mitosis and with NIMA during progression through mitosis. The studies uncover a joint requirement for the Set1 methyltransferase complex with the CDK1 and NIMA kinases for successful mitosis. The findings extend the roles of the Set1 complex to include the initiation of mitosis with CDK1 and mitotic progression with NIMA in addition to its previously identified interactions with Aurora and type 1 phosphatase in budding yeast. Copyright © 2014 by the Genetics Society of America.

Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

PubMed Central

Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

2009-01-01

Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

PubMed

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate Ciona intestinalis

EPA Science Inventory

The biotransformation of inorganic arsenic (iAs) involves methylation by an arsenic (+3 oxidation state) methyltransferase (AS3MT), yielding methyl arsenic (MA), dimethyl arsenic (DMA), and trimethylarsenic (TMA). To identify molecular mechanisms that coordinate arsenic biotra...

Chromosomal Organization of Rrna Operons in Bacillus Subtilis

PubMed Central

Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

1988-01-01

Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

*Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals in the invertebrate chordate ciona intestinalis

EPA Science Inventory

Biotransformation of inorganic arsenic (iAs) involves methylation catalyzed by arsenic (+3 oxidation state) methyltransferase (As3mt) , yielding mono-, di-, and trimethylated arsenicals. A comparative genomic approach focused on Ciona intestinaJis, an invertebrate chordate, was u...

Association of Catechol-O-Methyltransferase (COMT) Polymorphism and Academic Achievement in a Chinese Cohort

ERIC Educational Resources Information Center

Yeh, Ting-Kuang; Chang, Chun-Yen; Hu, Chung-Yi; Yeh, Ting-Chi; Lin, Ming-Yeh

2009-01-01

Catechol-O-methyltransferase (COMT) is a methylation enzyme that catalyzes the degradation pathway and inactivation of dopamine. It is accepted widely as being involved in the modulation of dopaminergic physiology and prefrontal cortex (PFC) function. The COMT Val158Met polymorphism is associated with variation in COMT activity. COMT 158Met allele…

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC (III) METHYLTRANSFERASE (CYT19)

EPA Science Inventory

CLONING, EXPRESSION, AND CHARACTERIZATION OF RAT S-ADENOSYL-L-METHIONINE: ARSENIC(III) METHYLTRANSFERASE (cyt19)

Stephen B. Waters1 , Felicia Walton1 , Miroslav Styblo1 , Karen Herbin-Davis2, and David J. Thomas2 1 School of Medicine, University of North Carolina at Chape...

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

2010-07-23

Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

Identification of white campion (Silene latifolia) guaiacol O-methyltransferase involved in the biosynthesis of veratrole, a key volatile for pollinator attraction

PubMed Central

2012-01-01

Background Silene latifolia and its pollinator, the noctuid moth Hadena bicruris, represent an open nursery pollination system wherein floral volatiles, especially veratrole (1, 2-dimethoxybenzene), lilac aldehydes, and phenylacetaldehyde are of key importance for floral signaling. Despite the important role of floral scent in ensuring reproductive success in S. latifolia, the molecular basis of scent biosynthesis in this species has not yet been investigated. Results We isolated two full-length cDNAs from S. latifolia that show similarity to rose orcinol O-methyltransferase. Biochemical analysis showed that both S. latifolia guaiacol O-methyltransferase1 (SlGOMT1) &S. latifolia guaiacol O-methyltransferase2 (SlGOMT2) encode proteins that catalyze the methylation of guaiacol to form veratrole. A large Km value difference between SlGOMT1 (~10 μM) and SlGOMT2 (~501 μM) resulted that SlGOMT1 is 31-fold more catalytically efficient than SlGOMT2. qRT-PCR expression analysis showed that the SlGOMT genes are specifically expressed in flowers and male S. latifolia flowers had 3- to 4-folds higher level of GOMT gene transcripts than female flower tissues. Two related cDNAs, S. dioica O-methyltransferase1 (SdOMT1) and S. dioica O-methyltransferase2 (SdOMT2), were also obtained from the sister species Silene dioica, but the proteins they encode did not methylate guaiacol, consistent with the lack of veratrole emission in the flowers of this species. Our evolutionary analysis uncovered that SlGOMT1 and SlGOMT2 genes evolved under positive selection, whereas SdOMT1 and SdOMT2 genes show no evidence for selection. Conclusions Altogether, we report the identification and functional characterization of the gene, SlGOMT1 that efficiently catalyzes veratrole formation, whereas another copy of this gene with only one amino acid difference, SlGOMT2 was found to be less efficient for veratrole synthesis in S. latifolia. PMID:22937972

Novel Broad Spectrum Inhibitors Targeting the Flavivirus Methyltransferase

PubMed Central

Liu, Binbin; Banavali, Nilesh K.; Jones, Susan A.; Zhang, Jing; Li, Zhong; Kramer, Laura D.; Li, Hongmin

2015-01-01

The flavivirus methyltransferase (MTase) is an essential enzyme that sequentially methylates the N7 and 2’-O positions of the viral RNA cap, using S-adenosyl-L-methionine (SAM) as a methyl donor. We report here that small molecule compounds, which putatively bind to the SAM-binding site of flavivirus MTase and inhibit its function, were identified by using virtual screening. In vitro methylation experiments demonstrated significant MTase inhibition by 13 of these compounds, with the most potent compound displaying sub-micromolar inhibitory activity. The most active compounds showed broad spectrum activity against the MTase proteins of multiple flaviviruses. Two of these compounds also exhibited low cytotoxicity and effectively inhibited viral replication in cell-based assays, providing further structural insight into flavivirus MTase inhibition. PMID:26098995

Development of fluorescent methods for DNA methyltransferase assay

NASA Astrophysics Data System (ADS)

Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

2017-03-01

DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.

PubMed Central

McClelland, M; Nelson, M; Raschke, E

1994-01-01

Restriction endonucleases have site-specific interactions with DNA that can often be inhibited by site-specific DNA methylation and other site-specific DNA modifications. However, such inhibition cannot generally be predicted. The empirically acquired data on these effects are tabulated for over 320 restriction endonucleases. In addition, a table of known site-specific DNA modification methyltransferases and their specificities is presented along with EMBL database accession numbers for cloned genes. PMID:7937074

Betaine:homocysteine methyltransferase--a new assay for the liver enzyme and its absence from human skin fibroblasts and peripheral blood lymphocytes.

PubMed

Wang, J A; Dudman, N P; Lynch, J; Wilcken, D E

1991-12-31

Chronic elevation of plasma homocysteine is associated with increased atherogenesis and thrombosis, and can be lowered by betaine (N,N,N-trimethylglycine) treatment which is thought to stimulate activity of the enzyme betaine:homocysteine methyltransferase. We have developed a new assay for this enzyme, in which the products of the enzyme-catalysed reaction between betaine and homocysteine are oxidised by performic acid before being separated and quantified by amino acid analysis. This assay confirmed that human liver contains abundant betaine:homocysteine methyltransferase (33.4 nmol/h/mg protein at 37 degrees C, pH 7.4). Chicken and lamb livers also contain the enzyme, with respective activities of 50.4 and 6.2 nmol/h/mg protein. However, phytohaemagglutinin-stimulated human peripheral blood lymphocytes and cultured human skin fibroblasts contained no detectable betaine:homocysteine methyltransferase (less than 1.4 nmol/h/mg protein), even after cells were pre-cultured in media designed to stimulate production of the enzyme. The results emphasize the importance of the liver in mediating the lowering of elevated circulating homocysteine by betaine.

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

PubMed

Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

2017-11-02

One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

Identification of an S-adenosylmethionine (SAM) dependent arsenic methyltransferase in Danio rerio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamdi, Mohamad; Yoshinaga, Masafumi; Packianathan, Charles

2012-07-15

Arsenic methylation is an important cellular metabolic process that modulates arsenic toxicity and carcinogenicity. Biomethylation of arsenic produces a series of mono-, di- and tri-methylated arsenic metabolites that can be detected in tissues and excretions. Here we report that zebrafish exposed to arsenite (As{sup III}) produces organic arsenicals, including MMA{sup III}, MMA{sup V} and DMA{sup V} with characteristic tissue ratios, demonstrating that an arsenic methylation pathway exists in zebrafish. In mammals, cellular inorganic arsenic is methylated by a SAM-dependent arsenic methyltransferase, AS3MT. A zebrafish arsenic methyltransferase homolog, As3mt, was identified by sequence alignment. Western blotting analysis showed that As3mt wasmore » universally expressed in zebrafish tissues. Prominent expression in liver and intestine correlated with methylated arsenic metabolites detected in those tissues. As3mt was expressed in and purified from Escherichia coli for in vitro functional studies. Our results demonstrated that As3mt methylated As{sup III} to DMA{sup V} as an end product and produced MMA{sup III} and MMA{sup V} as intermediates. The activity of As3mt was inhibited by elevated concentrations of the substrate As{sup III} as well as the metalloid selenite, which is a well-known antagonistic micronutrient of arsenic toxicity. The activity As3mt was abolished by substitution of either Cys160 or Cys210, which corresponds to conserved cysteine residues in AS3MT homologs, suggesting that they are involved in catalysis. Expression in zebrafish of an enzyme that has a similar function to human and rodent orthologs in catalyzing intracellular arsenic biomethylation validates the applicability of zebrafish as a valuable vertebrate model for understanding arsenic-associated diseases in humans. -- Highlights: ► Zebrafish methylated As{sup III} to MMA{sup III}, MMA{sup V} and DMA{sup V}. ► A zebrafish arsenic methyltransferase (As3mt) was purified in E

Crystal structure of MboIIA methyltransferase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipiuk, J.; Walsh, M. A.; Joachimiak, A.

2003-09-15

DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules inmore » the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.« less

Crystal structure of MboIIA methyltransferase.

PubMed

Osipiuk, Jerzy; Walsh, Martin A; Joachimiak, Andrzej

2003-09-15

DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 A resolution the crystal structure of a beta-class DNA MTase MboIIA (M.MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M.MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules in the asymmetric unit which we propose to resemble the dimer when M.MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M.RsrI. However, the cofactor-binding pocket in M.MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.

Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

PubMed

Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

2016-02-08

Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

DOMAINS REARRANGED METHYLTRANSFERASE3 controls DNA methylation and regulates RNA polymerase V transcript abundance in Arabidopsis

PubMed Central

Zhong, Xuehua; Hale, Christopher J.; Nguyen, Minh; Ausin, Israel; Groth, Martin; Hetzel, Jonathan; Vashisht, Ajay A.; Henderson, Ian R.; Wohlschlegel, James A.; Jacobsen, Steven E.

2015-01-01

DNA methylation is a mechanism of epigenetic gene regulation and genome defense conserved in many eukaryotic organisms. In Arabidopsis, the DNA methyltransferase DOMAINS REARRANGED METHYLASE 2 (DRM2) controls RNA-directed DNA methylation in a pathway that also involves the plant-specific RNA Polymerase V (Pol V). Additionally, the Arabidopsis genome encodes an evolutionarily conserved but catalytically inactive DNA methyltransferase, DRM3. Here, we show that DRM3 has moderate effects on global DNA methylation and small RNA abundance and that DRM3 physically interacts with Pol V. In Arabidopsis drm3 mutants, we observe a lower level of Pol V-dependent noncoding RNA transcripts even though Pol V chromatin occupancy is increased at many sites in the genome. These findings suggest that DRM3 acts to promote Pol V transcriptional elongation or assist in the stabilization of Pol V transcripts. This work sheds further light on the mechanism by which long noncoding RNAs facilitate RNA-directed DNA methylation. PMID:25561521

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

LLY-507, a cell-active, potent, and selective inhibitor of protein-lysine methyltransferase SMYD2

DOE PAGES

Nguyen, Hannah; Allali-Hassani, Abdellah; Antonysamy, Stephen; ...

2015-03-30

SMYD2 is a lysine methyltransferase that catalyzes the monomethylation of several protein substrates including p53. SMYD2 is overexpressed in a significant percentage of esophageal squamous primary carcinomas, and that overexpression correlates with poor patient survival. However, the mechanism(s) by which SMYD2 promotes oncogenesis is not understood. A small molecule probe for SMYD2 would allow for the pharmacological dissection of this biology. In this report, we disclose LLY-507, a cell-active, potent small molecule inhibitor of SMYD2. LLY-507 is >100-fold selective for SMYD2 over a broad range of methyltransferase and non-methyltransferase targets. A 1.63-Å resolution crystal structure of SMYD2 in complex withmore » LLY-507 shows the inhibitor binding in the substrate peptide binding pocket. LLY-507 is active in cells as measured by reduction of SMYD2-induced monomethylation of p53 Lys(370) at submicromolar concentrations. We used LLY-507 to further test other potential roles of SMYD2. Mass spectrometry-based proteomics showed that cellular global histone methylation levels were not significantly affected by SMYD2 inhibition with LLY-507, and subcellular fractionation studies indicate that SMYD2 is primarily cytoplasmic, suggesting that SMYD2 targets a very small subset of histones at specific chromatin loci and/or non-histone substrates. Breast and liver cancers were identified through in silico data mining as tumor types that display amplification and/or overexpression of SMYD2. LLY-507 inhibited the proliferation of several esophageal, liver, and breast cancer cell lines in a dose-dependent manner. As a result, these findings suggest that LLY-507 serves as a valuable chemical probe to aid in the dissection of SMYD2 function in cancer and other biological processes.« less

LLY-507, a cell-active, potent, and selective inhibitor of protein-lysine methyltransferase SMYD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Hannah; Allali-Hassani, Abdellah; Antonysamy, Stephen

SMYD2 is a lysine methyltransferase that catalyzes the monomethylation of several protein substrates including p53. SMYD2 is overexpressed in a significant percentage of esophageal squamous primary carcinomas, and that overexpression correlates with poor patient survival. However, the mechanism(s) by which SMYD2 promotes oncogenesis is not understood. A small molecule probe for SMYD2 would allow for the pharmacological dissection of this biology. In this report, we disclose LLY-507, a cell-active, potent small molecule inhibitor of SMYD2. LLY-507 is >100-fold selective for SMYD2 over a broad range of methyltransferase and non-methyltransferase targets. A 1.63-Å resolution crystal structure of SMYD2 in complex withmore » LLY-507 shows the inhibitor binding in the substrate peptide binding pocket. LLY-507 is active in cells as measured by reduction of SMYD2-induced monomethylation of p53 Lys(370) at submicromolar concentrations. We used LLY-507 to further test other potential roles of SMYD2. Mass spectrometry-based proteomics showed that cellular global histone methylation levels were not significantly affected by SMYD2 inhibition with LLY-507, and subcellular fractionation studies indicate that SMYD2 is primarily cytoplasmic, suggesting that SMYD2 targets a very small subset of histones at specific chromatin loci and/or non-histone substrates. Breast and liver cancers were identified through in silico data mining as tumor types that display amplification and/or overexpression of SMYD2. LLY-507 inhibited the proliferation of several esophageal, liver, and breast cancer cell lines in a dose-dependent manner. As a result, these findings suggest that LLY-507 serves as a valuable chemical probe to aid in the dissection of SMYD2 function in cancer and other biological processes.« less

Discovery of Potent and Selective Inhibitors for G9a-Like Protein (GLP) Lysine Methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Yan; Li, Fengling; Babault, Nicolas

G9a-like protein (GLP) and G9a are highly homologous protein lysine methyltransferases (PKMTs) sharing approximately 80% sequence identity in their catalytic domains. GLP and G9a form a heterodimer complex and catalyze mono- and dimethylation of histone H3 lysine 9 and nonhistone substrates. Although they are closely related, GLP and G9a possess distinct physiological and pathophysiological functions. Thus, GLP or G9a selective small-molecule inhibitors are useful tools to dissect their distinct biological functions. We previously reported potent and selective G9a/GLP dual inhibitors including UNC0638 and UNC0642. Here we report the discovery of potent and selective GLP inhibitors including 4 (MS0124) and 18more » (MS012), which are >30-fold and 140-fold selective for GLP over G9a and other methyltransferases, respectively. The cocrystal structures of GLP and G9a in the complex with either 4 or 18 displayed virtually identical binding modes and interactions, highlighting the challenges in structure-based design of selective inhibitors for either enzyme.« less

Cloning, expression, purification and preliminary X-ray crystallographic analysis of mouse protein arginine methyltransferase 7.

PubMed

Cura, Vincent; Troffer-Charlier, Nathalie; Lambert, Marie-Annick; Bonnefond, Luc; Cavarelli, Jean

2014-01-01

Protein arginine methyltransferase 7 (PRMT7) is a unique but less characterized member of the family of protein arginine methyltransferases (PRMTs) that plays a role in male germline gene imprinting. PRMT7 is the only known PRMT member that catalyzes the monomethylation but not the dimethylation of the target arginine residues and harbours two catalytic domains in tandem. PRMT7 genes from five different species were cloned and expressed in Escherichia coli and Sf21 insect cells. Four gave soluble proteins from Sf21 cells, of which two were homogeneous and one gave crystals. The mouse PRMT7 structure was solved by the single anomalous dispersion method using a crystal soaked with thimerosal that diffracted to beyond 2.1 Å resolution. The crystal belonged to space group P4(3)2(1)2, with unit-cell parameters a = b = 97.4, c = 168.1 Å and one PRMT7 monomer in the asymmetric unit. The structure of another crystal form belonging to space group I222 was solved by molecular replacement.

Production of Se-methylselenocysteine in transgenic plants expressing selenocysteine methyltransferase

PubMed Central

Ellis, Danielle R; Sors, Thomas G; Brunk, Dennis G; Albrecht, Carrie; Orser, Cindy; Lahner, Brett; Wood, Karl V; Harris, Hugh H; Pickering, Ingrid J; Salt, David E

2004-01-01

Background It has become increasingly evident that dietary Se plays a significant role in reducing the incidence of lung, colorectal and prostate cancer in humans. Different forms of Se vary in their chemopreventative efficacy, with Se-methylselenocysteine being one of the most potent. Interestingly, the Se accumulating plant Astragalus bisulcatus (Two-grooved poison vetch) contains up to 0.6% of its shoot dry weight as Se-methylselenocysteine. The ability of this Se accumulator to biosynthesize Se-methylselenocysteine provides a critical metabolic shunt that prevents selenocysteine and selenomethionine from entering the protein biosynthetic machinery. Such a metabolic shunt has been proposed to be vital for Se tolerance in A. bisulcatus. Utilization of this mechanism in other plants may provide a possible avenue for the genetic engineering of Se tolerance in plants ideally suited for the phytoremediation of Se contaminated land. Here, we describe the overexpression of a selenocysteine methyltransferase from A. bisulcatus to engineer Se-methylselenocysteine metabolism in the Se non-accumulator Arabidopsis thaliana (Thale cress). Results By over producing the A. bisulcatus enzyme selenocysteine methyltransferase in A. thaliana, we have introduced a novel biosynthetic ability that allows the non-accumulator to accumulate Se-methylselenocysteine and γ-glutamylmethylselenocysteine in shoots. The biosynthesis of Se-methylselenocysteine in A. thaliana also confers significantly increased selenite tolerance and foliar Se accumulation. Conclusion These results demonstrate the feasibility of developing transgenic plant-based production of Se-methylselenocysteine, as well as bioengineering selenite resistance in plants. Selenite resistance is the first step in engineering plants that are resistant to selenate, the predominant form of Se in the environment. PMID:15005814

O6-Methylguanine DNA Methyltransferase Status Does Not Predict Response or Resistance to Alkylating Agents in Well-Differentiated Pancreatic Neuroendocrine Tumors.

PubMed

Raj, Nitya; Klimstra, David S; Horvat, Natally; Zhang, Liying; Chou, Joanne F; Capanu, Marinela; Basturk, Olca; Do, Richard Kinh Gian; Allen, Peter J; Reidy-Lagunes, Diane

2017-07-01

Alkylating agents have activity in well-differentiated pancreatic neuroendocrine tumors (WD panNETs). In glioblastoma multiforme, decreased activity of O-methylguanine DNA methyltransferase (MGMT) predicts response; in panNETs, MGMT relevance is unknown. We identified patients with WD panNETs treated with alkylating agents, determined best overall response by Response Evaluation Criteria In Solid Tumors (RECIST) 1.1, and performed MGMT activity testing. Fifty-six patients were identified; 26 (46%) of the 56 patients experienced partial response, 24 (43%) of 56 experienced stable disease, and 6 (11%) of 56 experienced progression of disease. O-methylguanine DNA methyltransferase status was available for 36 tumors. For tumors with partial response, 10 (67%) of 15 were MGMT deficient, and 5 (33%) of 15 were MGMT intact. For tumors with stable disease, 7 (47%) of 15 were MGMT deficient, and 8 (53%) of 15 were MGMT intact. For tumors with progression of disease, 3 (50%) of 6 were MGMT deficient, and 3 (50%) of 6 were MGMT intact. We observed response and resistance to alkylating agents in MGMT-deficient and MGMT-intact tumors. O-methylguanine DNA methyltransferase status should not guide alkylating agent therapy in WD panNETs.

A novel BLAST-Based Relative Distance (BBRD) method can effectively group members of protein arginine methyltransferases and suggest their evolutionary relationship.

PubMed

Wang, Yi-Chun; Wang, Jing-Doo; Chen, Chin-Han; Chen, Yi-Wen; Li, Chuan

2015-03-01

We developed a novel BLAST-Based Relative Distance (BBRD) method by Pearson's correlation coefficient to avoid the problems of tedious multiple sequence alignment and complicated outgroup selection. We showed its application on reconstructing reliable phylogeny for nucleotide and protein sequences as exemplified by the fmr-1 gene and dihydrolipoamide dehydrogenase, respectively. We then used BBRD to resolve 124 protein arginine methyltransferases (PRMTs) that are homologues of nine mammalian PRMTs. The tree placed the uncharacterized PRMT9 with PRMT7 in the same clade, outside of all the Type I PRMTs including PRMT1 and its vertebrate paralogue PRMT8, PRMT3, PRMT6, PRMT2 and PRMT4. The PRMT7/9 branch then connects with the type II PRMT5. Some non-vertebrates contain different PRMTs without high sequence homology with the mammalian PRMTs. For example, in the case of Drosophila arginine methyltransferase (DART) and Trypanosoma brucei methyltransferases (TbPRMTs) in the analyses, the BBRD program grouped them with specific clades and thus suggested their evolutionary relationships. The BBRD method thus provided a great tool to construct a reliable tree for members of protein families through evolution. Copyright © 2015 Elsevier Inc. All rights reserved.

Dimethylsulfoniopropionate biosynthesis in a diatom Thalassiosira pseudonana: Identification of a gene encoding MTHB-methyltransferase.

PubMed

Kageyama, Hakuto; Tanaka, Yoshito; Shibata, Ayumi; Waditee-Sirisattha, Rungaroon; Takabe, Teruhiro

2018-05-01

Dimethylsulfoniopropionate (DMSP) is one of the most abundant molecules on earth and plays a pivotal role in the marine sulfur cycle. DMSP is believed to be synthesized from methionine by a four-step reaction pathway in marine algae. The genes responsible for biosynthesis of DMSP remain unidentified. A diatom Thalassiosira pseudonana CCMP1335 is an important component of marine ecosystems and contributes greatly to the world's primary production. In this study, through genome search, in vivo activity and functional studies of cDNA products, a gene encoding Thalassiosira methyltransferase (TpMMT) which catalyzes the key step of DMSP synthesis formation of 4-methylthio-2-hydroxybutyrate (DMSHB) from 4-methylthio-2-oxobutyrate (MTHB), was identified. The amino acid sequence of TpMMT was homologous to the methyltransferase from Phaeodactylum tricornutum CCAP 1055/1, but not the recently identified bacterium gene. High salinity and nitrogen limitation stresses caused the increase of DMSP content and TpMMT protein in Thalassiosira. In addition to TpMMT, the enzyme activities for the first three steps could be detected and enhanced under high salinity, suggesting the importance of four-step DMSP synthetic pathway in Thalassiosira. Copyright © 2018 Elsevier Inc. All rights reserved.

TERRA and the histone methyltransferase Dot1 cooperate to regulate senescence in budding yeast

PubMed Central

Wanat, Jennifer J.; Logsdon, Glennis A.; Driskill, Jordan H.; Deng, Zhong; Lieberman, Paul M.

2018-01-01

The events underlying senescence induced by critical telomere shortening are not fully understood. Here we provide evidence that TERRA, a non-coding RNA transcribed from subtelomeres, contributes to senescence in yeast lacking telomerase (tlc1Δ). Levels of TERRA expressed from multiple telomere ends appear elevated at senescence, and expression of an artificial RNA complementary to TERRA (anti-TERRA) binds TERRA in vivo and delays senescence. Anti-TERRA acts independently from several other mechanisms known to delay senescence, including those elicited by deletions of EXO1, TEL1, SAS2, and genes encoding RNase H enzymes. Further, it acts independently of the senescence delay provided by RAD52-dependent recombination. However, anti-TERRA delays senescence in a fashion epistatic to inactivation of the conserved histone methyltransferase Dot1. Dot1 associates with TERRA, and anti-TERRA disrupts this interaction in vitro and in vivo. Surprisingly, the anti-TERRA delay is independent of the C-terminal methyltransferase domain of Dot1 and instead requires only its N-terminus, which was previously found to facilitate release of telomeres from the nuclear periphery. Together, these data suggest that TERRA and Dot1 cooperate to drive senescence. PMID:29649255

Comparative Distribution and Retention of Arsenic in Arsenic (+3 Oxidation State) Methyltransferase Knockout and Wild Type Mice

EPA Science Inventory

The mouse arsenic (+3 oxidation state) methyltransferase (As3mt) gene encodes a ~ 43 kDa protein that catalyzes conversion of inorganic arsenic into methylated products. Heterologous expression of AS3MT or its silencing by RNA interference controls arsenic methylation phenotypes...

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

PubMed Central

Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

1994-01-01

Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

An easy-to-perform photometric assay for methyltransferase activity measurements.

PubMed

Schäberle, Till F; Siba, Christian; Höver, Thomas; König, Gabriele M

2013-01-01

Methyltransferases (MTs) catalyze the transfer of a methyl group from S-adenosylmethionine (SAM) to a suitable substrate. Such methylations are important modifications in secondary metabolisms, especially on natural products produced by polyketide synthases and nonribosomal peptide synthetases, many of which are of special interest due to their prominent pharmacological activities (e.g., lovastatin, cyclosporin). To gain basic biochemical knowledge on the methylation process, it is of immense relevance to simplify methods concerning experimental problems caused by a large variety in substrates. Here, we present a photometric method to analyze MT activity by measuring SAM consumption in a coupled enzyme assay. Copyright © 2012 Elsevier Inc. All rights reserved.

Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

PubMed

Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

2014-07-24

The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp; Matsuzaki, Masahiro; Kanazawa, Shiho

Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that themore » production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate

Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

PubMed

Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

2018-05-03

The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

USDA-ARS?s Scientific Manuscript database

We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Molecular Characterization of a Novel Temperate Sinorhizobium Bacteriophage, ФLM21, Encoding DNA Methyltransferase with CcrM-Like Specificity

PubMed Central

Dziewit, Lukasz; Oscik, Karolina; Bartosik, Dariusz

2014-01-01

ABSTRACT ΦLM21 is a temperate phage isolated from Sinorhizobium sp. strain LM21 (Alphaproteobacteria). Genomic analysis and electron microscopy suggested that ΦLM21 is a member of the family Siphoviridae. The phage has an isometric head and a long noncontractile tail. The genome of ΦLM21 has 50,827 bp of linear double-stranded DNA encoding 72 putative proteins, including proteins responsible for the assembly of the phage particles, DNA packaging, transcription, replication, and lysis. Virion proteins were characterized using mass spectrometry, leading to the identification of the major capsid and tail components, tape measure, and a putative portal protein. We have confirmed the activity of two gene products, a lytic enzyme (a putative chitinase) and a DNA methyltransferase, sharing sequence specificity with the cell cycle-regulating methyltransferase (CcrM) of the bacterial host. Interestingly, the genome of Sinorhizobium phage ΦLM21 shows very limited similarity to other known phage genome sequences and is thus considered unique. IMPORTANCE Prophages are known to play an important role in the genomic diversification of bacteria via horizontal gene transfer. The influence of prophages on pathogenic bacteria is very well documented. However, our knowledge of the overall impact of prophages on the survival of their lysogenic, nonpathogenic bacterial hosts is still limited. In particular, information on prophages of the agronomically important Sinorhizobium species is scarce. In this study, we describe the isolation and molecular characterization of a novel temperate bacteriophage, ΦLM21, of Sinorhizobium sp. LM21. Since we have not found any similar sequences, we propose that this bacteriophage is a novel species. We conducted a functional analysis of selected proteins. We have demonstrated that the phage DNA methyltransferase has the same sequence specificity as the cell cycle-regulating methyltransferase CcrM of its host. We point out that this phenomenon of

The role of protein methyltransferases as potential novel therapeutic targets in squamous cell carcinoma of the head and neck.

PubMed

Saloura, Vassiliki; Vougiouklakis, Theodore; Sievers, Cem; Burkitt, Kyunghee; Nakamura, Yusuke; Hager, Gordon; van Waes, Carter

2018-06-01

Squamous cell carcinoma of the head and neck is a lethal disease with suboptimal survival outcomes and standard therapies with significant comorbidities. Whole exome sequencing data recently revealed an abundance of genetic and expression alterations in a family of enzymes known as protein methyltransferases in a variety of cancer types, including squamous cell carcinoma of the head and neck. These enzymes are mostly known for their chromatin-modifying functions through methylation of various histone substrates, though evidence supports their function also through methylation of non-histone substrates. This review summarizes the current knowledge on the function of protein methyltransferases in squamous cell carcinoma of the head and neck and highlights their promising potential as the next generation of therapeutic targets in this disease. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

METABOLISM AND TOXICITY OF AS IN HUMAN UROTHELIAL CELLS EXPRESSING RAT ARSENIC (+3 OXIDATION STATE)-METHYLTRANSFERASE

EPA Science Inventory

The enzymatic methylation of inorganic As (iAs) is catalyzed by As(+3 oxidation state)-methyltransferase (AS3MT). AS3MT is expressed in rat liver and in human hepatocytes However, AS3MT is not expressed in UROtsa, human urothelial cells that do not methylate iAs. Thus, UROtsa ce...

Ethnic differences in DNA methyltransferases expression in patients with systemic lupus erythematosus.

PubMed

Wiley, Kenneth L; Treadwell, Edward; Manigaba, Kayihura; Word, Beverly; Lyn-Cook, Beverly D

2013-02-01

Systemic lupus erythematous (SLE) is a systemic autoimmune inflammatory disease with both genetic and epigenetic etiologies. Evidence suggests that deregulation of specific genes through epigenetic mechanisms may be a contributing factor to SLE pathology. There is increasing evidence that DNA methyltransferase activity may be involved. This study demonstrated modulation in expression of DNA methyltransferases (DNMTs) according to ethnicity in patients diagnosed with SLE. Furthermore, differential expression in one of the DNMTs was found in a subset of lupus patients on dehydroepiandrosterone (DHEA) therapy. Real-time PCR analyses of DNMT1, DNMT3A and DNMT3B in peripheral blood mononuclear cells from a cohort of African American and European American lupus and non-lupus women were conducted. Also, global DNA methylation was assessed using the MethylFlash(TM) methylated quantification colorimetric assay. Significant increase in DNMT3A (p < 0.001) was shown in lupus patients when compared to age-matched healthy controls. This increase was associated with a higher SLEDI index. More striking was that expression levels for African American (AA) women were higher than European American women in the lupus populations. A subset of AA women on DHEA therapy showed a significant decrease (p < 0.05) in DNMT3A expression in comparison to lupus patients not on the therapy. DHEA is an androgenic steroid found in low levels in the serum of lupus patients. Supplementation of this hormone has been shown to be beneficial to some lupus patients. DHEA was not shown to effect DNMT1 or DNMT3B expression. Increased expression was also noted in DNMT3B (p < 0.05) in lupus patients compared to age-matched healthy controls. However, no significant difference was noted in DNMT1 (p = 0.2148) expression between lupus patients and healthy controls. Although increases were detected in de novo methyltransferases, a global decrease (p < 0.001) in 5-methycytosine was observed in

Isolation of DNA methyltransferase from plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehrlich, K.; Malbroue, C.

1987-05-01

DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less

[Definition of the specificity of DNA-methyltransferase M.Bsc4I in cell lysate by blocking of restriction endonucleases and computer modeling].

PubMed

Dedkov, V S

2009-01-01

The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.

Short peptides derived from the interaction domain of SARS coronavirus nonstructural protein nsp10 can suppress the 2'-O-methyltransferase activity of nsp10/nsp16 complex.

PubMed

Ke, Min; Chen, Yu; Wu, Andong; Sun, Ying; Su, Ceyang; Wu, Hao; Jin, Xu; Tao, Jiali; Wang, Yi; Ma, Xiao; Pan, Ji-An; Guo, Deyin

2012-08-01

Coronaviruses are the etiological agents of respiratory and enteric diseases in humans and livestock, exemplified by the life-threatening severe acute respiratory syndrome (SARS) caused by SARS coronavirus (SARS-CoV). However, effective means for combating coronaviruses are still lacking. The interaction between nonstructural protein (nsp) 10 and nsp16 has been demonstrated and the crystal structure of SARS-CoV nsp16/10 complex has been revealed. As nsp10 acts as an essential trigger to activate the 2'-O-methyltransferase activity of nsp16, short peptides derived from nsp10 may have inhibitory effect on viral 2'-O-methyltransferase activity. In this study, we revealed that the domain of aa 65-107 of nsp10 was sufficient for its interaction with nsp16 and the region of aa 42-120 in nsp10, which is larger than the interaction domain, was needed for stimulating the nsp16 2'-O-methyltransferase activity. We further showed that two short peptides derived from the interaction domain of nsp10 could inhibit the 2'-O-methyltransferase activity of SARS-CoV nsp16/10 complex, thus providing a novel strategy and proof-of-principle study for developing peptide inhibitors against SARS-CoV. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

PubMed

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Rational design of a live attenuated dengue vaccine: 2'-o-methyltransferase mutants are highly attenuated and immunogenic in mice and macaques.

PubMed

Züst, Roland; Dong, Hongping; Li, Xiao-Feng; Chang, David C; Zhang, Bo; Balakrishnan, Thavamalar; Toh, Ying-Xiu; Jiang, Tao; Li, Shi-Hua; Deng, Yong-Qiang; Ellis, Brett R; Ellis, Esther M; Poidinger, Michael; Zolezzi, Francesca; Qin, Cheng-Feng; Shi, Pei-Yong; Fink, Katja

2013-01-01

Dengue virus is transmitted by Aedes mosquitoes and infects at least 100 million people every year. Progressive urbanization in Asia and South-Central America and the geographic expansion of Aedes mosquito habitats have accelerated the global spread of dengue, resulting in a continuously increasing number of cases. A cost-effective, safe vaccine conferring protection with ideally a single injection could stop dengue transmission. Current vaccine candidates require several booster injections or do not provide protection against all four serotypes. Here we demonstrate that dengue virus mutants lacking 2'-O-methyltransferase activity are highly sensitive to type I IFN inhibition. The mutant viruses are attenuated in mice and rhesus monkeys and elicit a strong adaptive immune response. Monkeys immunized with a single dose of 2'-O-methyltransferase mutant virus showed 100% sero-conversion even when a dose as low as 1,000 plaque forming units was administrated. Animals were fully protected against a homologous challenge. Furthermore, mosquitoes feeding on blood containing the mutant virus were not infected, whereas those feeding on blood containing wild-type virus were infected and thus able to transmit it. These results show the potential of 2'-O-methyltransferase mutant virus as a safe, rationally designed dengue vaccine that restrains itself due to the increased susceptibility to the host's innate immune response.

Identification and Characterization of a Novel Human Methyltransferase Modulating Hsp70 Protein Function through Lysine Methylation*

PubMed Central

Jakobsson, Magnus E.; Moen, Anders; Bousset, Luc; Egge-Jacobsen, Wolfgang; Kernstock, Stefan; Melki, Ronald; Falnes, Pål Ø.

2013-01-01

Hsp70 proteins constitute an evolutionarily conserved protein family of ATP-dependent molecular chaperones involved in a wide range of biological processes. Mammalian Hsp70 proteins are subject to various post-translational modifications, including methylation, but for most of these, a functional role has not been attributed. In this study, we identified the methyltransferase METTL21A as the enzyme responsible for trimethylation of a conserved lysine residue found in several human Hsp70 (HSPA) proteins. This enzyme, denoted by us as HSPA lysine (K) methyltransferase (HSPA-KMT), was found to catalyze trimethylation of various Hsp70 family members both in vitro and in vivo, and the reaction was stimulated by ATP. Furthermore, we show that HSPA-KMT exclusively methylates 70-kDa proteins in mammalian protein extracts, demonstrating that it is a highly specific enzyme. Finally, we show that trimethylation of HSPA8 (Hsc70) has functional consequences, as it alters the affinity of the chaperone for both the monomeric and fibrillar forms of the Parkinson disease-associated protein α-synuclein. PMID:23921388

Cloning, expression, purification and preliminary X-­ray crystallographic analysis of mouse protein arginine methyltransferase 7

PubMed Central

Cura, Vincent; Troffer-Charlier, Nathalie; Lambert, Marie-Annick; Bonnefond, Luc; Cavarelli, Jean

2014-01-01

Protein arginine methyltransferase 7 (PRMT7) is a unique but less characterized member of the family of protein arginine methyltransferases (PRMTs) that plays a role in male germline gene imprinting. PRMT7 is the only known PRMT member that catalyzes the monomethylation but not the dimethylation of the target arginine residues and harbours two catalytic domains in tandem. PRMT7 genes from five different species were cloned and expressed in Escherichia coli and Sf21 insect cells. Four gave soluble proteins from Sf21 cells, of which two were homogeneous and one gave crystals. The mouse PRMT7 structure was solved by the single anomalous dispersion method using a crystal soaked with thimerosal that diffracted to beyond 2.1 Å resolution. The crystal belonged to space group P43212, with unit-cell parameters a = b = 97.4, c = 168.1 Å and one PRMT7 monomer in the asymmetric unit. The structure of another crystal form belonging to space group I222 was solved by molecular replacement. PMID:24419624

The putative protein methyltransferase LAE1 controls cellulase gene expression in Trichoderma reesei

PubMed Central

Seiboth, Bernhard; Karimi, Razieh Aghcheh; Phatale, Pallavi A; Linke, Rita; Hartl, Lukas; Sauer, Dominik G; Smith, Kristina M; Baker, Scott E; Freitag, Michael; Kubicek, Christian P

2012-01-01

Summary Trichoderma reesei is an industrial producer of enzymes that degrade lignocellulosic polysaccharides to soluble monomers, which can be fermented to biofuels. Here we show that the expression of genes for lignocellulose degradation are controlled by the orthologous T. reesei protein methyltransferase LAE1. In a lae1 deletion mutant we observed a complete loss of expression of all seven cellulases, auxiliary factors for cellulose degradation, β-glucosidases and xylanases were no longer expressed. Conversely, enhanced expression of lae1 resulted in significantly increased cellulase gene transcription. Lae1-modulated cellulase gene expression was dependent on the function of the general cellulase regulator XYR1, but also xyr1 expression was LAE1-dependent. LAE1 was also essential for conidiation of T. reesei. Chromatin immunoprecipitation followed by high-throughput sequencing (‘ChIP-seq’) showed that lae1 expression was not obviously correlated with H3K4 di- or trimethylation (indicative of active transcription) or H3K9 trimethylation (typical for heterochromatin regions) in CAZyme coding regions, suggesting that LAE1 does not affect CAZyme gene expression by directly modulating H3K4 or H3K9 methylation. Our data demonstrate that the putative protein methyltransferase LAE1 is essential for cellulase gene expression in T. reesei through mechanisms that remain to be identified. PMID:22554051

Crystal structure of the avilamycin resistance-conferring methyltransferase AviRa from Streptomyces viridochromogenes.

PubMed

Mosbacher, Tanja G; Bechthold, Andreas; Schulz, Georg E

2003-05-23

The emergence of antibiotic-resistant bacterial strains is a widespread problem in contemporary medical practice and drug design. It is therefore important to elucidate the underlying mechanism in each case. The methyltransferase AviRa from Streptomyces viridochromogenes mediates resistance to the antibiotic avilamycin, which is closely related to evernimicin, an oligosaccharide antibiotic that has been used in medical studies. The structure of AviRa was determined by X-ray diffraction at 1.5A resolution. Phases were obtained from one selenomethionine residue introduced by site-directed mutagenesis. The chain-fold is similar to that of most methyltransferases, although AviRa contains two additional helices as a specific feature. A putative-binding site for the cofactor S-adenosyl-L-methionine was derived from homologous structures. It agrees with the conserved pattern of interacting amino acid residues. AviRa methylates a specific guanine base within the peptidyltransferase loop of the 23S ribosomal RNA. Guided by the target, the enzyme was docked to the cognate ribosomal surface, where it fit well into a deep cleft without contacting any ribosomal protein. The two additional alpha-helices of AviRa filled a depression in the surface. Since the transferred methyl group of the cofactor is in a pocket beneath the enzyme surface, the targeted guanine base has to flip out for methylation.

Transcriptional regulation by the Set7 lysine methyltransferase

PubMed Central

Keating, Samuel; El-Osta, Assam

2013-01-01

Posttranslational histone modifications define chromatin structure and function. In recent years, a number of studies have characterized many of the enzymatic activities and diverse regulatory components required for monomethylation of histone H3 lysine 4 (H3K4me1) and the expression of specific genes. The challenge now is to understand how this specific chemical modification is written and the Set7 methyltransferase has emerged as a key regulatory enzyme mediating methylation of lysine residues of histone and non-histone proteins. In this review, we comprehensively explore the regulatory proteins modified by Set7 and highlight mechanisms of specific co-recruitment of the enzyme to activating promoters. With a focus on signaling and transcriptional control in disease we discuss recent experimental data emphasizing specific components of diverse regulatory complexes that mediate chromatin modification and reinterpretation of Set7-mediated gene expression. PMID:23478572

Structure and Biocatalytic Scope of Coclaurine N-Methyltransferase.

PubMed

Bennett, Matthew; Thompson, Mark; Shepherd, Sarah; Dunstan, Mark; Herbert, Abigail; Smith, Duncan; Cronin, Victoria; Menon, Binuraj; Levy, Colin; Micklefield, Jason

2018-05-23

Benzylisoquinoline alkaloids (BIAs) are a structurally diverse family of plant secondary metabolites which have been exploited to develop analgesics, antibiotics, antitumor agents and other therapeutic agents. Biosynthesis of BIAs proceeds via a common pathway from tyrosine to (S)-reticulene at which point the pathway diverges. Coclaurine N-methyltransferase (CNMT) is a key enzyme in the pathway to (S)-reticulene, installing the N-methyl substituent that is essential for the bioactivity of many BIAs. In this paper, we describe the first crystal structure of CNMT which, along with mutagenesis studies, defines the enzymes active site architecture. The specificity of CNMT was also explored with a range of natural and synthetic substrates as well as co-factor analogues. Knowledge from this study could be used to generate improved CNMT variants required to produce BIAs or synthetic derivatives. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

PubMed

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

PubMed Central

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-01-01

AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

A novel arsenic methyltransferase gene of Westerdykella aurantiaca isolated from arsenic contaminated soil: phylogenetic, physiological, and biochemical studies and its role in arsenic bioremediation.

PubMed

Verma, Shikha; Verma, Pankaj Kumar; Meher, Alok Kumar; Dwivedi, Sanjay; Bansiwal, Amit Kumar; Pande, Veena; Srivastava, Pankaj Kumar; Verma, Praveen Chandra; Tripathi, Rudra Deo; Chakrabarty, Debasis

2016-03-01

Elevated arsenic concentration in the environment and agricultural soil is a serious concern to crop production and human health. Among different detoxification mechanisms, the methylation of arsenic is a widespread phenomenon in nature. A number of microorganisms are able to methylate arsenic, but less is known about the arsenic metabolism in fungi. We identified a novel arsenic methyltransferase (WaarsM) gene from a soil fungus, Westerdykella aurantiaca. WaarsM showed sequence homology with all known arsenic methyltransferases having three conserved SAM binding motifs. The expression of WaarsM enhanced arsenic resistance in E. coli (Δars) and S. cerevisiae (Δacr2) strains by biomethylation and required endogenous reductants, preferably GSH, for methyltransferase activity. The purified WaarsM catalyzes the production of methylated arsenicals from both AsIII and AsV, and also displays AsV reductase activity. It displayed higher methyltransferase activity and lower KM 0.1945 ± 0.021 mM and KM 0.4034 ± 0.078 mM for AsIII and AsV, respectively. S. cerevisiae (Δacr2) cells expressing WaarsM produced 2.2 ppm volatile arsenic and 0.64 ppm DMA(v) with 0.58 ppm volatile arsenicals when exposed to 20 ppm AsV and 2 ppm AsIII, respectively. Arsenic tolerance in rice after co-culture with genetically engineered yeast suggested its potential role in arsenic bioremediation. Thus, characterization of WaarsM provides a potential strategy to reduce arsenic concentration in soil with reduced arsenic accumulation in crops grown in arsenic contaminated areas, and thereby alleviating human health risks.

An integrated epigenetic and genetic analysis of DNA methyltransferase genes (DNMTs) in tumor resistant and susceptible chicken lines

USDA-ARS?s Scientific Manuscript database

Both epigenetic alterations and genetic variations play essential roles in tumorigenesis. The epigenetic modification of DNA methylation is catalyzed and maintained by the DNA methyltransferases (DNMT3a, DNMT3b and DNMT1). DNA mutations and DNA methylation profiles of DNMTs themselves and their rela...

Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

PubMed Central

Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

2006-01-01

Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

PubMed Central

Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

2014-01-01

Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

Crystal structure of a suicidal DNA repair protein: the Ada O6-methylguanine-DNA methyltransferase from E. coli.

PubMed

Moore, M H; Gulbis, J M; Dodson, E J; Demple, B; Moody, P C

1994-04-01

The mutagenic and carcinogenic effects of simple alkylating agents are mainly due to methylation at the O6 position of guanine in DNA. O6-methylguanine directs the incorporation of either thymine or cytosine without blocking DNA replication, resulting in GC to AT transition mutations. In prokaryotic and eukaryotic cells antimutagenic repair is effected by direct reversal of this DNA damage. A suicidal methyltransferase repair protein removes the methyl group from DNA to one of its own cysteine residues. The resulting self-methylation of the active site cysteine renders the protein inactive. Here we report the X-ray structure of the 19 kDa C-terminal domain of the Escherichia coli ada gene product, the prototype of these suicidal methyltransferases. In the crystal structure the active site cysteine is buried. We propose a model for the significant conformational change that the protein must undergo in order to bind DNA and effect methyl transfer.

Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.

PubMed

Wolfe, C J; Haygood, M G

1993-08-01

Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.

Structure and possible mechanism of the CcbJ methyltransferase from Streptomyces caelestis.

PubMed

Bauer, Jacob; Ondrovičová, Gabriela; Najmanová, Lucie; Pevala, Vladimír; Kameník, Zdeněk; Koštan, Július; Janata, Jiří; Kutejová, Eva

2014-04-01

The S-adenosyl-L-methionine (SAM)-dependent methyltransferase CcbJ from Streptomyces caelestis catalyzes one of the final steps in the biosynthesis of the antibiotic celesticetin, methylation of the N atom of its proline moiety, which greatly enhances the activity of the antibiotic. Since several celesticetin variants exist, this enzyme may be able to act on a variety of substrates. The structures of CcbJ determined by MAD phasing at 3.0 Å resolution, its native form at 2.7 Å resolution and its complex with S-adenosyl-L-homocysteine (SAH) at 2.9 Å resolution are reported here. Based on these structures, three point mutants, Y9F, Y17F and F117G, were prepared in order to study its behaviour as well as docking simulations of both CcbJ-SAM-substrate and CcbJ-SAH-product complexes. The structures show that CcbJ is a class I SAM-dependent methyltransferase with a wide active site, thereby suggesting that it may accommodate a number of different substrates. The mutation results show that the Y9F and F117G mutants are almost non-functional, while the Y17F mutant has almost half of the wild-type activity. In combination with the docking studies, these results suggest that Tyr9 and Phe117 are likely to help to position the substrate for the methyl-transfer reaction and that Tyr9 may also facilitate the reaction by removing an H(+) ion. Tyr17, on the other hand, seems to operate by helping to stabilize the SAM cofactor.

Transient Kinetics Define a Complete Kinetic Model for Protein Arginine Methyltransferase 1*

PubMed Central

Hu, Hao; Luo, Cheng; Zheng, Y. George

2016-01-01

Protein arginine methyltransferases (PRMTs) are the enzymes responsible for posttranslational methylation of protein arginine residues in eukaryotic cells, particularly within the histone tails. A detailed mechanistic model of PRMT-catalyzed methylation is currently lacking, but it is essential for understanding the functions of PRMTs in various cellular pathways and for efficient design of PRMT inhibitors as potential treatments for a range of human diseases. In this work, we used stopped-flow fluorescence in combination with global kinetic simulation to dissect the transient kinetics of PRMT1, the predominant type I arginine methyltransferase. Several important mechanistic insights were revealed. The cofactor and the peptide substrate bound to PRMT1 in a random manner and then followed a kinetically preferred pathway to generate the catalytic enzyme-cofactor-substrate ternary complex. Product release proceeded in an ordered fashion, with peptide dissociation followed by release of the byproduct S-adenosylhomocysteine. Importantly, the dissociation rate of the monomethylated intermediate from the ternary complex was much faster than the methyl transfer. Such a result provided direct evidence for distributive arginine dimethylation, which means the monomethylated substrate has to be released to solution and rebind with PRMT1 before it undergoes further methylation. In addition, cofactor binding involved a conformational transition, likely an open-to-closed conversion of the active site pocket. Further, the histone H4 peptide bound to the two active sites of the PRMT1 homodimer with differential affinities, suggesting a negative cooperativity mechanism of substrate binding. These findings provide a new mechanistic understanding of how PRMTs interact with their substrates and transfer methyl groups. PMID:27834681

Specialized (iso)eugenol-4-O-methyltransferases (s-IEMTs) and methods of making and using the same

DOEpatents

Liu, Chang-Jun; Cai, Yuanheng

2017-01-31

Specialized (iso)eugenol 4-O-methyltransferase (s-IEMT) enzymes having increased capacity for methylation of monolignols are disclosed. The s-IEMTs have unique activity favoring methylation of coniferyl alcohol versus sinapyl alcohol. Various s-IEMTs methylate ferulic acid. Means for producing the various s-IEMTs are provided. The s-IEMTs are useful for modification of lignin content and production of aromatic compounds.

SAM/SAH Analogs as Versatile Tools for SAM-Dependent Methyltransferases.

PubMed

Zhang, Jing; Zheng, Yujun George

2016-03-18

S-Adenosyl-L-methionine (SAM) is a sulfonium molecule with a structural hybrid of methionine and adenosine. As the second largest cofactor in the human body, its major function is to serve as methyl donor for SAM-dependent methyltransferases (MTases). The resultant transmethylation of biomolecules constitutes a significant biochemical mechanism in epigenetic regulation, cellular signaling, and metabolite degradation. Recently, numerous SAM analogs have been developed as synthetic cofactors to transfer the activated groups on MTase substrates for downstream ligation and identification. Meanwhile, new compounds built upon or derived from the SAM scaffold have been designed and tested as selective inhibitors for important MTase targets. Here, we summarized the recent development and application of SAM analogs as chemical biology tools for MTases.

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Mouse arsenic (+3 oxidation state) methyltransferase genotype affects metabolism and tissue dosimetry of arsenicals after arsenite administration in drinking water

EPA Science Inventory

Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes methylation of inorganic arsenic producing a number of methylated arsenic metabolites. Although methylation has been commonly considered a pathway for detoxification of arsenic, some highly reactive methylated ars...

Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase and method of inactivating ribulose-1,5-bisphosphatase carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase activity

DOEpatents

Houtz, Robert L.

1999-01-01

The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

Arsenic (+3 oxidation state) methyltransferase genotype affects steady-state distribution and clearance of arsenic in arsenate-treated mice

EPA Science Inventory

Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes formation of mono-, di-, and tri-methylated metabolites of inorganic arsenic. Distribution and retention of arsenic were compared in adult female As3mt knockout mice and wild-type C57BL/6 mice using a regimen in whi...

Crystal structure of phosphoethanolamine methyltransferase from Plasmodium falciparum in complex with amodiaquine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Soon Goo; Alpert, Tara D.; Jez, Joseph M.

2012-07-17

Phosphoethanolamine N-methyltransferase (PMT) is essential for phospholipid biogenesis in the malarial parasite Plasmodium falciparum. PfPMT catalyzes the triple methylation of phosphoethanolamine to produce phosphocholine, which is then used for phosphatidylcholine synthesis. Here we describe the 2.0 {angstrom} resolution X-ray crystal structure of PfPMT in complex with amodiaquine. To better characterize inhibition of PfPMT by amodiaquine, we determined the IC{sub 50} values of a series of aminoquinolines using a direct radiochemical assay. Both structural and functional analyses provide a possible approach for the development of new small molecule inhibitors of PfPMT.

Type II protein arginine methyltransferase 5 (PRMT5) is required for circadian period determination in Arabidopsis thaliana.

PubMed

Hong, Sunghyun; Song, Hae-Ryong; Lutz, Kerry; Kerstetter, Randall A; Michael, Todd P; McClung, C Robertson

2010-12-07

Posttranslational modification is an important element in circadian clock function from cyanobacteria through plants and mammals. For example, a number of key clock components are phosphorylated and thereby marked for subsequent ubiquitination and degradation. Through forward genetic analysis we demonstrate that protein arginine methyltransferase 5 (PRMT5; At4g31120) is a critical determinant of circadian period in Arabidopsis. PRMT5 is coregulated with a set of 1,253 genes that shows alterations in phase of expression in response to entrainment to thermocycles versus photocycles in constant temperature. PRMT5 encodes a type II protein arginine methyltransferase that catalyzes the symmetric dimethylation of arginine residues (Rsme2). Rsme2 modification has been observed in many taxa, and targets include histones, components of the transcription complex, and components of the spliceosome. Neither arginine methylation nor PRMT5 has been implicated previously in circadian clock function, but the period lengthening associated with mutational disruption of prmt5 indicates that Rsme2 is a decoration important for the Arabidopsis clock and possibly for clocks in general.

Regulation of DNA methylation turnover at LTR retrotransposons and imprinted loci by the histone methyltransferase Setdb1.

PubMed

Leung, Danny; Du, Tingting; Wagner, Ulrich; Xie, Wei; Lee, Ah Young; Goyal, Preeti; Li, Yujing; Szulwach, Keith E; Jin, Peng; Lorincz, Matthew C; Ren, Bing

2014-05-06

During mammalian development, DNA methylation patterns need to be reset in primordial germ cells (PGCs) and preimplantation embryos. However, many LTR retrotransposons and imprinted genes are impervious to such global epigenetic reprogramming via hitherto undefined mechanisms. Here, we report that a subset of such genomic regions are resistant to widespread erasure of DNA methylation in mouse embryonic stem cells (mESCs) lacking the de novo DNA methyltransferases (Dnmts) Dnmt3a and Dnmt3b. Intriguingly, these loci are enriched for H3K9me3 in mESCs, implicating this mark in DNA methylation homeostasis. Indeed, deletion of the H3K9 methyltransferase SET domain bifurcated 1 (Setdb1) results in reduced H3K9me3 and DNA methylation levels at specific loci, concomitant with increased 5-hydroxymethylation (5hmC) and ten-eleven translocation 1 binding. Taken together, these data reveal that Setdb1 promotes the persistence of DNA methylation in mESCs, likely reflecting one mechanism by which DNA methylation is maintained at LTR retrotransposons and imprinted genes during developmental stages when DNA methylation is reprogrammed.

Arginine methyltransferase inhibitor 1 inhibits gastric cancer by downregulating eIF4E and targeting PRMT5.

PubMed

Zhang, Baolai; Zhang, Su; Zhu, Lijuan; Chen, Xue; Zhao, Yunfeng; Chao, Li; Zhou, Juanping; Wang, Xing; Zhang, Xinyang; Ma, Nengqian

2017-12-01

Arginine methylation is carried out by protein arginine methyltransferase (PRMTs) family. Arginine methyltransferase inhibitor 1 (AMI-1) is mainly used to inhibit type I PRMT activity in vitro. However, the effects of AMI-1 on type II PRMT5 activity and gastric cancer (GC) remain unclear. In this study, we provided the first evidence that AMI-1 significantly inhibited GC cell proliferation and migration while induced GC cell apoptosis, and reduced the expression of PRMT5, eukaryotic translation initiation factor 4E (eIF4E), symmetric dimethylation of histone 3 (H3R8me2s) and histone 4 (H4R3me2s). In addition, AMI-1 inhibited tumor growth, downregulated eIF4E, H4R3me2s and H3R8me2s expression in mice xenografts model of GC. Collectively, our results suggest that AMI-1 inhibits GC by downregulating eIF4E and targeting type II PRMT5. Copyright © 2017 Elsevier Inc. All rights reserved.

Type II protein arginine methyltransferase 5 (PRMT5) is required for circadian period determination in Arabidopsis thaliana

PubMed Central

Hong, Sunghyun; Lutz, Kerry; Kerstetter, Randall A.; Michael, Todd P.; McClung, C. Robertson

2010-01-01

Posttranslational modification is an important element in circadian clock function from cyanobacteria through plants and mammals. For example, a number of key clock components are phosphorylated and thereby marked for subsequent ubiquitination and degradation. Through forward genetic analysis we demonstrate that protein arginine methyltransferase 5 (PRMT5; At4g31120) is a critical determinant of circadian period in Arabidopsis. PRMT5 is coregulated with a set of 1,253 genes that shows alterations in phase of expression in response to entrainment to thermocycles versus photocycles in constant temperature. PRMT5 encodes a type II protein arginine methyltransferase that catalyzes the symmetric dimethylation of arginine residues (Rsme2). Rsme2 modification has been observed in many taxa, and targets include histones, components of the transcription complex, and components of the spliceosome. Neither arginine methylation nor PRMT5 has been implicated previously in circadian clock function, but the period lengthening associated with mutational disruption of prmt5 indicates that Rsme2 is a decoration important for the Arabidopsis clock and possibly for clocks in general. PMID:21097700

Molecular cloning and characterization of tetrahydroprotoberberine cis-N-methyltransferase, an enzyme involved in alkaloid biosynthesis in opium poppy.

PubMed

Liscombe, David K; Facchini, Peter J

2007-05-18

S-Adenosyl-l-methionine:tetrahydroprotoberberine cis-N-methyltransferase (EC 2.1.1.122) catalyzes the conversion of (S)-stylopine to the quaternary ammonium alkaloid, (S)-cis-N-methylstylopine, as a key step in the biosynthesis of protopine and benzophenanthridine alkaloids in plants. A full-length cDNA encoding a protein exhibiting 45 and 48% amino acid identity with coclaurine N-methyltransferase from Papaver somniferum (opium poppy) and Coptis japonica, respectively, was identified in an elicitor-treated opium poppy cell culture expressed sequence tag data base. Phylogenetic analysis showed that the protein belongs to a unique clade of enzymes that includes coclaurine N-methyltransferase, the predicated translation products of the Arabidopsis thaliana genes, At4g33110 and At4g33120, and bacterial S-adenosyl-L-methionine-dependent cyclopropane fatty acid synthases. Expression of the cDNA in Escherichia coli produced a recombinant enzyme able to convert the protoberberine alkaloids stylopine, canadine, and tetrahydropalmatine to their corresponding N-methylated derivatives. However, the protoberberine alkaloids tetrahydroxyberbine and scoulerine, and simple isoquinoline, benzylisoquinoline, and pavine alkaloids were not accepted as substrates, demonstrating the strict specificity of the enzyme. The apparent K(m) values for (R,S)-stylopine and S-adenosyl-L-methionine were 0.6 and 11.5 microm, respectively. TNMT gene transcripts and enzyme activity were detected in opium poppy seedlings and all mature plant organs and were induced in cultured opium poppy cells after treatment with a fungal elicitor. The enzyme was detected in cell cultures of other members of the Papaveraceae but not in species of related plant families that do not accumulate protopine and benzophenanthridine alkaloids.

A novel multifunctional O-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine

PubMed Central

Li, Laigeng; Popko, Jacqueline L.; Zhang, Xing-Hai; Osakabe, Keishi; Tsai, Chung-Jui; Joshi, Chandrashekhar P.; Chiang, Vincent L.

1997-01-01

S-adenosyl-l-methionine (SAM)-dependent O-methyltransferases (OMTs) catalyze the methylation of hydroxycinnamic acid derivatives for the synthesis of methylated plant polyphenolics, including lignin. The distinction in the extent of methylation of lignins in angiosperms and gymnosperms, mediated by substrate-specific OMTs, represents one of the fundamental differences in lignin biosynthesis between these two classes of plants. In angiosperms, two types of structurally and functionally distinct lignin pathway OMTs, caffeic acid 3-O-methyltransferases (CAOMTs) and caffeoyl CoA 3-O-methyltransferases (CCoAOMTs), have been reported and extensively studied. However, little is known about lignin pathway OMTs in gymnosperms. We report here the first cloning of a loblolly pine (Pinus taeda) xylem cDNA encoding a multifunctional enzyme, SAM:hydroxycinnamic Acids/hydroxycinnamoyl CoA Esters OMT (AEOMT). The deduced protein sequence of AEOMT is partially similar to, but clearly distinguishable from, that of CAOMTs and does not exhibit any significant similarity with CCoAOMT protein sequences. However, functionally, yeast-expressed AEOMT enzyme catalyzed the methylation of CAOMT substrates, caffeic and 5-hydroxyferulic acids, as well as CCoAOMT substrates, caffeoyl CoA and 5-hydroxyferuloyl CoA esters, with similar specific activities and was completely inactive with substrates associated with flavonoid synthesis. The lignin-related substrates were also efficiently methylated in crude extracts of loblolly pine secondary xylem. Our results support the notion that, in the context of amino acid sequence and biochemical function, AEOMT represents a novel SAM-dependent OMT, with both CAOMT and CCoAOMT activities and thus the potential to mediate a dual methylation pathway in lignin biosynthesis in loblolly pine xylem. PMID:9144260

A novel multifunctional O-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine.

PubMed

Li, L; Popko, J L; Zhang, X H; Osakabe, K; Tsai, C J; Joshi, C P; Chiang, V L

1997-05-13

S-adenosyl-L-methionine (SAM)-dependent O-methyltransferases (OMTs) catalyze the methylation of hydroxycinnamic acid derivatives for the synthesis of methylated plant polyphenolics, including lignin. The distinction in the extent of methylation of lignins in angiosperms and gymnosperms, mediated by substrate-specific OMTs, represents one of the fundamental differences in lignin biosynthesis between these two classes of plants. In angiosperms, two types of structurally and functionally distinct lignin pathway OMTs, caffeic acid 3-O-methyltransferases (CAOMTs) and caffeoyl CoA 3-O-methyltransferases (CCoAOMTs), have been reported and extensively studied. However, little is known about lignin pathway OMTs in gymnosperms. We report here the first cloning of a loblolly pine (Pinus taeda) xylem cDNA encoding a multifunctional enzyme, SAM:hydroxycinnamic Acids/hydroxycinnamoyl CoA Esters OMT (AEOMT). The deduced protein sequence of AEOMT is partially similar to, but clearly distinguishable from, that of CAOMTs and does not exhibit any significant similarity with CCoAOMT protein sequences. However, functionally, yeast-expressed AEOMT enzyme catalyzed the methylation of CAOMT substrates, caffeic and 5-hydroxyferulic acids, as well as CCoAOMT substrates, caffeoyl CoA and 5-hydroxyferuloyl CoA esters, with similar specific activities and was completely inactive with substrates associated with flavonoid synthesis. The lignin-related substrates were also efficiently methylated in crude extracts of loblolly pine secondary xylem. Our results support the notion that, in the context of amino acid sequence and biochemical function, AEOMT represents a novel SAM-dependent OMT, with both CAOMT and CCoAOMT activities and thus the potential to mediate a dual methylation pathway in lignin biosynthesis in loblolly pine xylem.

Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

NASA Astrophysics Data System (ADS)

MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

2012-12-01

Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

Unique Features of Human Protein Arginine Methyltransferase 9 (PRMT9) and Its Substrate RNA Splicing Factor SF3B2*

PubMed Central

Hadjikyriacou, Andrea; Yang, Yanzhong; Espejo, Alexsandra; Bedford, Mark T.; Clarke, Steven G.

2015-01-01

Human protein arginine methyltransferase (PRMT) 9 symmetrically dimethylates arginine residues on splicing factor SF3B2 (SAP145) and has been functionally linked to the regulation of alternative splicing of pre-mRNA. Site-directed mutagenesis studies on this enzyme and its substrate had revealed essential unique residues in the double E loop and the importance of the C-terminal duplicated methyltransferase domain. In contrast to what had been observed with other PRMTs and their physiological substrates, a peptide containing the methylatable Arg-508 of SF3B2 was not recognized by PRMT9 in vitro. Although amino acid substitutions of residues surrounding Arg-508 had no great effect on PRMT9 recognition of SF3B2, moving the arginine residue within this sequence abolished methylation. PRMT9 and PRMT5 are the only known mammalian enzymes capable of forming symmetric dimethylarginine (SDMA) residues as type II PRMTs. We demonstrate here that the specificity of these enzymes for their substrates is distinct and not redundant. The loss of PRMT5 activity in mouse embryo fibroblasts results in almost complete loss of SDMA, suggesting that PRMT5 is the primary SDMA-forming enzyme in these cells. PRMT9, with its duplicated methyltransferase domain and conserved sequence in the double E loop, appears to have a unique structure and specificity among PRMTs for methylating SF3B2 and potentially other polypeptides. PMID:25979344

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Characterization of regioselective flavonoid O-methyltransferase from the Streptomyces sp. KCTC 0041BP.

PubMed

Darsandhari, Sumangala; Dhakal, Dipesh; Shrestha, Biplav; Parajuli, Prakash; Seo, Joo-Hyun; Kim, Tae-Su; Sohng, Jae Kyung

2018-06-01

A flavonoid comprises polyphenol compounds with pronounced antiviral, antioxidant, anticarcinogenic, and anti-inflammatory effects. The flavonoid modification by methylation provides a greater stability and improved pharmacokinetic properties. The methyltransferase from plants or microorganisms is responsible for such substrate modifications in a regiospecific or a promiscuous manner. GerMIII, originally characterized as a putative methyltransferase in a dihydrochalcomycin biosynthetic gene cluster of the Streptomyces sp. KCTC 0041BP, was tested for the methylation of the substrates of diverse chemical structures. Among the various tested substrates, flavonoids emerged as the favored substrates for methylation. Further, among the flavonoids, quercetin is the most favorable substrate, followed by luteolin, myricetin, quercetin 3-O-β-D-glucoside, and fisetin, while only a single product was formed in each case. The products were confirmed by HPLC and mass-spectrometry analyses. A detailed NMR spectrometric analysis of the methylated quercetin and luteolin derivatives confirmed the regiospecific methylation at the 4'-OH position. Modeling and molecular docking provided further insight regarding the most favorable mechanism and substrate architecture for the enzymatic catalysis. Accordingly, a double bond between the C 2 and the C 3 and a single-ring-appended conjugate-hydroxyl group are crucial for the favorable enzymatic conversions of the GerMIII catalysis. Thus, in this study, the enzymatic properties of GerMIII and a mechanistic overview of the regiospecific modification that was implemented for the acceptance of quercetin as the most favorable substrate are presented. Copyright © 2018 Elsevier Inc. All rights reserved.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Molecular cloning and functional identification of sterol C24-methyltransferase gene from Tripterygium wilfordii.

PubMed

Guan, Hongyu; Zhao, Yujun; Su, Ping; Tong, Yuru; Liu, Yujia; Hu, Tianyuan; Zhang, Yifeng; Zhang, Xianan; Li, Jia; Wu, Xiaoyi; Huang, Luqi; Gao, Wei

2017-09-01

Sterol C24-methyltransferase (SMT) plays multiple important roles in plant growth and development. SMT1, which belongs to the family of transferases and transforms cycloartenol into 24-methylene cycloartenol, is involved in the biosynthesis of 24-methyl sterols. Here, we report the cloning and characterization of a cDNA encoding a sterol C24-methyltransferase from Tripterygium wilfordii ( TwSMT1 ). TwSMT1 (GenBank access number KU885950) is a 1530 bp cDNA with a 1041 bp open reading frame predicted to encode a 346-amino acid, 38.62 kDa protein. The polypeptide encoded by the SMT1 cDNA was expressed and purified as a recombinant protein from Escherichia coli ( E. coli ) and showed SMT activity. The expression of TwSMT1 was highly up-regulated in T. wilfordii cell suspension cultures treated with methyl jasmonate (MeJA). Tissue expression pattern analysis showed higher expression in the phellem layer compared to the other four organs (leaf, stem, xylem and phloem), which is about ten times that of the lowest expression in leaf. The results are meaningful for the study of sterol biosynthesis of T. wilfordii and will further lay the foundations for the research in regulating both the content of other main compounds and growth and development of T. wilfordii.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

The Ca2+-induced methyltransferase xPRMT1b controls neural fate in amphibian embryo.

PubMed

Batut, Julie; Vandel, Laurence; Leclerc, Catherine; Daguzan, Christiane; Moreau, Marc; Néant, Isabelle

2005-10-18

We have previously shown that an increase in intracellular Ca2+ is both necessary and sufficient to commit ectoderm to a neural fate in Xenopus embryos. However, the relationship between this Ca2+ increase and the expression of early neural genes has yet to be defined. Using a subtractive cDNA library between untreated and caffeine-treated animal caps, i.e., control ectoderm and ectoderm induced toward a neural fate by a release of Ca2+, we have isolated the arginine N-methyltransferase, xPRMT1b, a Ca2+-induced target gene, which plays a pivotal role in this process. First, we show in embryo and in animal cap that xPRMT1b expression is Ca2+-regulated. Second, overexpression of xPRMT1b induces the expression of early neural genes such as Zic3. Finally, in the whole embryo, antisense approach with morpholino oligonucleotide against xPRMT1b impairs neural development and in animal caps blocks the expression of neural markers induced by a release of internal Ca2+. Our results implicate an instructive role of an enzyme, an arginine methyltransferase protein, in the embryonic choice of determination between epidermal and neural fate. The results presented provide insights by which a Ca2+ increase induces neural fate.

Disruption of the methyltransferase-like 23 gene METTL23 causes mild autosomal recessive intellectual disability

PubMed Central

Bernkopf, Marie; Webersinke, Gerald; Tongsook, Chanakan; Koyani, Chintan N.; Rafiq, Muhammad A.; Ayaz, Muhammad; Müller, Doris; Enzinger, Christian; Aslam, Muhammad; Naeem, Farooq; Schmidt, Kurt; Gruber, Karl; Speicher, Michael R.; Malle, Ernst; Macheroux, Peter; Ayub, Muhammad; Vincent, John B.; Windpassinger, Christian; Duba, Hans-Christoph

2014-01-01

We describe the characterization of a gene for mild nonsyndromic autosomal recessive intellectual disability (ID) in two unrelated families, one from Austria, the other from Pakistan. Genome-wide single nucleotide polymorphism microarray analysis enabled us to define a region of homozygosity by descent on chromosome 17q25. Whole-exome sequencing and analysis of this region in an affected individual from the Austrian family identified a 5 bp frameshifting deletion in the METTL23 gene. By means of Sanger sequencing of METTL23, a nonsense mutation was detected in a consanguineous ID family from Pakistan for which homozygosity-by-descent mapping had identified a region on 17q25. Both changes lead to truncation of the putative METTL23 protein, which disrupts the predicted catalytic domain and alters the cellular localization. 3D-modelling of the protein indicates that METTL23 is strongly predicted to function as an S-adenosyl-methionine (SAM)-dependent methyltransferase. Expression analysis of METTL23 indicated a strong association with heat shock proteins, which suggests that these may act as a putative substrate for methylation by METTL23. A number of methyltransferases have been described recently in association with ID. Disruption of METTL23 presented here supports the importance of methylation processes for intact neuronal function and brain development. PMID:24626631

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

PubMed Central

Chen, Z. Jeffrey; Pikaard, Craig S.

1997-01-01

Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

PubMed

Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

2012-07-17

In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

16S rRNA beacons for bacterial monitoring during human space missions.

PubMed

Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

2007-04-01

Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

The inhibition of the mammalian DNA methyltransferase 3a (Dnmt3a) by dietary black tea and coffee polyphenols

PubMed Central

2011-01-01

Background Black tea is, second only to water, the most consumed beverage globally. Previously, the inhibition of DNA methyltransferase 1 was shown by dietary polyphenols and epi-gallocatechin gallate (EGCG), the main polyphenolic constituent of green tea, and 5-caffeoyl quinic acid, the main phenolic constituent of the green coffee bean. Results We studied the inhibition of DNA methyltransferase 3a by a series of dietary polyphenols from black tea such as theaflavins and thearubigins and chlorogenic acid derivatives from coffee. For theaflavin 3,3 digallate and thearubigins IC50 values in the lower micro molar range were observed, which when compared to pharmacokinetic data available, suggest an effect of physiological relevance. Conclusions Since Dnnmt3a has been associated with development, cancer and brain function, these data suggest a biochemical mechanism for the beneficial health effect of black tea and coffee and a possible molecular mechanism for the improvement of brain performance and mental health by dietary polyphenols. PMID:21510884

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed Central

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

A Type III Protein Arginine Methyltransferase from the Protozoan Parasite Trypanosoma brucei*

PubMed Central

Fisk, John C.; Sayegh, Joyce; Zurita-Lopez, Cecilia; Menon, Sarita; Presnyak, Vladimir; Clarke, Steven G.; Read, Laurie K.

2009-01-01

Arginine methylation is a widespread post-translational modification of proteins catalyzed by a family of protein arginine methyltransferases (PRMTs). The ancient protozoan parasite, Trypanosoma brucei, possesses five putative PRMTs, a relatively large number for a single-celled eukaryote. Trypanosomatids lack gene regulation at the level of transcription, instead relying on post-transcriptional control mechanisms that act at the levels of RNA turnover, translation, and editing, all processes that likely involve multiple RNA-binding proteins, which are common targets of arginine methylation. Here, we report the characterization of a trypanosome PRMT, TbPRMT7, which is homologous to human PRMT7. Interestingly, trypanosomatids are the only single-celled eukaryotes known to harbor a PRMT7 homologue. TbPRMT7 differs dramatically from all known metazoan PRMT7 homologues in lacking the second AdoMet binding-like domain that is required for activity of the human enzyme. Nevertheless, bacterially expressed TbPRMT7 exhibits robust methyltransferase activity toward multiple targets in vitro. High resolution ion exchange chromatography analysis of methylated substrates reveals that TbPRMT7 is a type III PRMT, catalyzing the formation of only monomethylarginine, thereby representing the only exclusively type III PRMT identified to date. TbPRMT7 is expressed in both mammalian and insect stage T. brucei and is apparently dispensable for growth in both life cycle stages. The enzyme is cytoplasmically localized and is a component of several higher order complexes in vivo. Together, our studies indicate that TbPRMT7 is a Type III PRMT, and its robust activity and presence in numerous complexes suggest it plays multiple roles during the complex T. brucei life cycle. PMID:19254949

A type III protein arginine methyltransferase from the protozoan parasite Trypanosoma brucei.

PubMed

Fisk, John C; Sayegh, Joyce; Zurita-Lopez, Cecilia; Menon, Sarita; Presnyak, Vladimir; Clarke, Steven G; Read, Laurie K

2009-04-24

Arginine methylation is a widespread post-translational modification of proteins catalyzed by a family of protein arginine methyltransferases (PRMTs). The ancient protozoan parasite, Trypanosoma brucei, possesses five putative PRMTs, a relatively large number for a single-celled eukaryote. Trypanosomatids lack gene regulation at the level of transcription, instead relying on post-transcriptional control mechanisms that act at the levels of RNA turnover, translation, and editing, all processes that likely involve multiple RNA-binding proteins, which are common targets of arginine methylation. Here, we report the characterization of a trypanosome PRMT, TbPRMT7, which is homologous to human PRMT7. Interestingly, trypanosomatids are the only single-celled eukaryotes known to harbor a PRMT7 homologue. TbPRMT7 differs dramatically from all known metazoan PRMT7 homologues in lacking the second AdoMet binding-like domain that is required for activity of the human enzyme. Nevertheless, bacterially expressed TbPRMT7 exhibits robust methyltransferase activity toward multiple targets in vitro. High resolution ion exchange chromatography analysis of methylated substrates reveals that TbPRMT7 is a type III PRMT, catalyzing the formation of only monomethylarginine, thereby representing the only exclusively type III PRMT identified to date. TbPRMT7 is expressed in both mammalian and insect stage T. brucei and is apparently dispensable for growth in both life cycle stages. The enzyme is cytoplasmically localized and is a component of several higher order complexes in vivo. Together, our studies indicate that TbPRMT7 is a Type III PRMT, and its robust activity and presence in numerous complexes suggest it plays multiple roles during the complex T. brucei life cycle.

Rational Design of a Live Attenuated Dengue Vaccine: 2′-O-Methyltransferase Mutants Are Highly Attenuated and Immunogenic in Mice and Macaques

PubMed Central

Chang, David C.; Zhang, Bo; Balakrishnan, Thavamalar; Toh, Ying-Xiu; Jiang, Tao; Li, Shi-Hua; Deng, Yong-Qiang; Ellis, Brett R.; Ellis, Esther M.; Poidinger, Michael; Zolezzi, Francesca; Qin, Cheng-Feng; Shi, Pei-Yong; Fink, Katja

2013-01-01

Dengue virus is transmitted by Aedes mosquitoes and infects at least 100 million people every year. Progressive urbanization in Asia and South-Central America and the geographic expansion of Aedes mosquito habitats have accelerated the global spread of dengue, resulting in a continuously increasing number of cases. A cost-effective, safe vaccine conferring protection with ideally a single injection could stop dengue transmission. Current vaccine candidates require several booster injections or do not provide protection against all four serotypes. Here we demonstrate that dengue virus mutants lacking 2′-O-methyltransferase activity are highly sensitive to type I IFN inhibition. The mutant viruses are attenuated in mice and rhesus monkeys and elicit a strong adaptive immune response. Monkeys immunized with a single dose of 2′-O-methyltransferase mutant virus showed 100% sero-conversion even when a dose as low as 1,000 plaque forming units was administrated. Animals were fully protected against a homologous challenge. Furthermore, mosquitoes feeding on blood containing the mutant virus were not infected, whereas those feeding on blood containing wild-type virus were infected and thus able to transmit it. These results show the potential of 2′-O-methyltransferase mutant virus as a safe, rationally designed dengue vaccine that restrains itself due to the increased susceptibility to the host's innate immune response. PMID:23935499

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Uncovering human METTL12 as a mitochondrial methyltransferase that modulates citrate synthase activity through metabolite-sensitive lysine methylation.

PubMed

Małecki, Jędrzej; Jakobsson, Magnus E; Ho, Angela Y Y; Moen, Anders; Rustan, Arild C; Falnes, Pål Ø

2017-10-27

Lysine methylation is an important and much-studied posttranslational modification of nuclear and cytosolic proteins but is present also in mitochondria. However, the responsible mitochondrial lysine-specific methyltransferases (KMTs) remain largely elusive. Here, we investigated METTL12, a mitochondrial human S -adenosylmethionine (AdoMet)-dependent methyltransferase and found it to methylate a single protein in mitochondrial extracts, identified as citrate synthase (CS). Using several in vitro and in vivo approaches, we demonstrated that METTL12 methylates CS on Lys-395, which is localized in the CS active site. Interestingly, the METTL12-mediated methylation inhibited CS activity and was blocked by the CS substrate oxaloacetate. Moreover, METTL12 was strongly inhibited by the reaction product S -adenosylhomocysteine (AdoHcy). In summary, we have uncovered a novel human mitochondrial KMT that introduces a methyl modification into a metabolic enzyme and whose activity can be modulated by metabolic cues. Based on the established naming nomenclature for similar enzymes, we suggest that METTL12 be renamed CS-KMT (gene name CSKMT ). © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Automethylation of protein arginine methyltransferase 7 and its impact on breast cancer progression.

PubMed

Geng, Pengyu; Zhang, Yu; Liu, Xiaoqing; Zhang, Na; Liu, Yingqi; Liu, Xin; Lin, Cong; Yan, Xu; Li, Zhongwei; Wang, Guannan; Li, Yuxin; Tan, Jiang; Liu, Dong-Xu; Huang, Baiqu; Lu, Jun

2017-06-01

Protein arginine methyltransferases (PRMTs) catalyze protein arginine methylation and are linked to carcinogenesis and metastasis. Some members of PRMTs have been found to undergo automethylation; however, the biologic significance of this self-modification is not entirely clear. In this report, we demonstrate that R531 of PRMT7 is self-methylated, both in vitro and in vivo Automethylation of PRMT7 plays a key role in inducing the epithelial-mesenchymal transition (EMT) program and in promoting the migratory and invasive behavior of breast cancer cells. We also prove in a nude mouse model that expression of wild-type PRMT7 in MCF7 breast cancer cells promotes metastasis in vivo , in contrast to the PRMT7 R531K mutant (a mimic of the unmethylated status). Moreover, our immunohistochemical data unravel a close link between PRMT7 automethylation and the clinical outcome of breast carcinomas. Mechanistically, we determine that loss of PRMT7 automethylation leads to the reduction of its recruitment to the E-cadherin promoter by YY1, which consequently derepresses the E-cadherin expression through decreasing the H4R3me2s level. The findings in this work define a novel post-translational modification of PRMT7 that has a promoting impact on breast cancer metastasis.-Geng, P., Zhang, Y., Liu, X., Zhang, N., Liu, Y., Liu, X., Lin, C., Yan, X., Li, Z., Wang, G., Li, Y., Tan, J., Liu, D.-X., Huang, B., Lu, J. Automethylation of protein arginine methyltransferase 7 and its impact on breast cancer progression. © FASEB.

Accelerated degradation of lignin by lignin peroxidase isozyme H8 (LiPH8) from Phanerochaete chrysosporium with engineered 4-O-methyltransferase from Clarkia breweri.

PubMed

Pham, Le Thanh Mai; Kim, Yong Hwan

2014-11-01

Free-hydroxyl phenolic units can decrease or even abort the catalytic activity of lignin peroxidase H8 during oxidation of veratryl alcohol and model lignin dimers, resulting in slow and inefficient lignin degradation. In this study we applied engineered 4-O-methyltransferase from Clarkia breweri to detoxify the inhibiting free-hydroxyl phenolic groups by converting them to methylated phenolic groups. The multistep, enzyme-catalyzed process that combines 4-O-methyltransferase and lignin peroxidase H8 suggested in this work can increase the efficiency of lignin-degradation. This study also suggests approaching the field of multi-enzyme in vitro systems to improve the understanding and development of plant biomass in biorefinery operations. Copyright © 2014 Elsevier Inc. All rights reserved.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

PubMed

Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

2003-12-06

Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

Catechol-O-Methyltransferase "Val[superscript 158]Met" Genotype, Parenting Practices and Adolescent Alcohol Use: Testing the Differential Susceptibility Hypothesis

ERIC Educational Resources Information Center

Laucht, Manfred; Blomeyer, Dorothea; Buchmann, Arlette F.; Treutlein, Jens; Schmidt, Martin H.; Esser, Gunter; Jennen-Steinmetz, Christine; Rietschel, Marcella; Zimmermann, Ulrich S.; Banaschewski, Tobias

2012-01-01

Background: Recently, first evidence has been reported for a gene-parenting interaction (G x E) with regard to adolescent alcohol use. The present investigation set out to extend this research using the catechol-O-methyltransferase ("COMT") "Val[superscript 158]Met" polymorphism as a genetic susceptibility factor. Moreover, the current study…

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

A histone H3K9M mutation traps histone methyltransferase Clr4 to prevent heterochromatin spreading

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shan, Chun-Min; Wang, Jiyong; Xu, Ke

2016-09-20

Histone lysine-to-methionine (K-to-M) mutations are associated with multiple cancers, and they function in a dominant fashion to block the methylation of corresponding lysines on wild type histones. However, their mechanisms of function are controversial. Here we show that in fission yeast, introducing the K9M mutation into one of the three histone H3 genes dominantly blocks H3K9 methylation on wild type H3 across the genome. In addition, H3K9M enhances the interaction of histone H3 tail with the H3K9 methyltransferase Clr4 in a SAM (S-adenosyl-methionine)-dependent manner, and Clr4 is trapped at nucleation sites to prevent its spreading and the formation of largemore » heterochromatin domains. We further determined the crystal structure of an H3K9M peptide in complex with human H3K9 methyltransferase G9a and SAM, which reveales that the methionine side chain had enhanced van der Waals interactions with G9a. Therefore, our results provide a detailed mechanism by which H3K9M regulates H3K9 methylation.« less

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Miniaturization of High-Throughput Epigenetic Methyltransferase Assays with Acoustic Liquid Handling.

PubMed

Edwards, Bonnie; Lesnick, John; Wang, Jing; Tang, Nga; Peters, Carl

2016-02-01

Epigenetics continues to emerge as an important target class for drug discovery and cancer research. As programs scale to evaluate many new targets related to epigenetic expression, new tools and techniques are required to enable efficient and reproducible high-throughput epigenetic screening. Assay miniaturization increases screening throughput and reduces operating costs. Echo liquid handlers can transfer compounds, samples, reagents, and beads in submicroliter volumes to high-density assay formats using only acoustic energy-no contact or tips required. This eliminates tip costs and reduces the risk of reagent carryover. In this study, we demonstrate the miniaturization of a methyltransferase assay using Echo liquid handlers and two different assay technologies: AlphaLISA from PerkinElmer and EPIgeneous HTRF from Cisbio. © 2015 Society for Laboratory Automation and Screening.

Nicotinamide N-methyltransferase: more than a vitamin B3 clearance enzyme

PubMed Central

Pissios, Pavlos

2017-01-01

Nicotinamide N-methyltransferase (NNMT) was originally identified as the enzyme responsible for the methylation of nicotinamide (NAM), one of the forms of vitamin B3. Methylated NAM (MNAM) is eventually excreted from the body. Recent evidence has expanded the role of NNMT beyond clearance of excess vitamin B3. NNMT has been implicated in the regulation of multiple metabolic pathways in tissues such as the adipose tissue and liver, as well as cancer cells, through consumption of methyl donors and generation of active metabolites. This review examines recent findings regarding the function of NNMT in physiology and disease and highlights potential new avenues for therapeutic intervention. Finally, key gaps in our knowledge for this enzymatic system and future areas of investigation are discussed. PMID:28291578

Characterization of two in vivo-expressed methyltransferases of the Mycobacterium tuberculosis complex: antigenicity and genetic regulation

PubMed Central

Golby, Paul; Nunez, Javier; Cockle, Paul J.; Ewer, Katie; Logan, Karen; Hogarth, Philip; Vordermeier, H. Martin; Hinds, Jason; Hewinson, R. Glyn; Gordon, Stephen V.

2011-01-01

Genome sequencing of Mycobacterium tuberculosis complex members has accelerated the search for new disease-control tools. Antigen mining is one area that has benefited enormously from access to genome data. As part of an ongoing antigen mining programme, we screened genes that were previously identified by transcriptome analysis as upregulated in response to an in vitro acid shock for their in vivo expression profile and antigenicity. We show that the genes encoding two methyltransferases, Mb1438c/Rv1403c and Mb1440c/Rv1404c, were highly upregulated in a mouse model of infection, and were antigenic in M. bovis-infected cattle. As the genes encoding these antigens were highly upregulated in vivo, we sought to define their genetic regulation. A mutant was constructed that was deleted for their putative regulator, Mb1439/Rv1404; loss of the regulator led to increased expression of the flanking methyltransferases and a defined set of distal genes. This work has therefore generated both applied and fundamental outputs, with the description of novel mycobacterial antigens that can now be moved into field trials, but also with the description of a regulatory network that is responsive to both in vivo and in vitro stimuli. PMID:18375799

Disruption of the methyltransferase-like 23 gene METTL23 causes mild autosomal recessive intellectual disability.

PubMed

Bernkopf, Marie; Webersinke, Gerald; Tongsook, Chanakan; Koyani, Chintan N; Rafiq, Muhammad A; Ayaz, Muhammad; Müller, Doris; Enzinger, Christian; Aslam, Muhammad; Naeem, Farooq; Schmidt, Kurt; Gruber, Karl; Speicher, Michael R; Malle, Ernst; Macheroux, Peter; Ayub, Muhammad; Vincent, John B; Windpassinger, Christian; Duba, Hans-Christoph

2014-08-01

We describe the characterization of a gene for mild nonsyndromic autosomal recessive intellectual disability (ID) in two unrelated families, one from Austria, the other from Pakistan. Genome-wide single nucleotide polymorphism microarray analysis enabled us to define a region of homozygosity by descent on chromosome 17q25. Whole-exome sequencing and analysis of this region in an affected individual from the Austrian family identified a 5 bp frameshifting deletion in the METTL23 gene. By means of Sanger sequencing of METTL23, a nonsense mutation was detected in a consanguineous ID family from Pakistan for which homozygosity-by-descent mapping had identified a region on 17q25. Both changes lead to truncation of the putative METTL23 protein, which disrupts the predicted catalytic domain and alters the cellular localization. 3D-modelling of the protein indicates that METTL23 is strongly predicted to function as an S-adenosyl-methionine (SAM)-dependent methyltransferase. Expression analysis of METTL23 indicated a strong association with heat shock proteins, which suggests that these may act as a putative substrate for methylation by METTL23. A number of methyltransferases have been described recently in association with ID. Disruption of METTL23 presented here supports the importance of methylation processes for intact neuronal function and brain development. © The Author 2014. Published by Oxford University Press.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

PubMed Central

Triman, K L

1995-01-01

Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

Linezolid-resistant Staphylococcus haemolyticus and Staphylococcus hominis: single and double mutations at the domain V of 23S rRNA among isolates from a Rio de Janeiro hospital.

PubMed

Chamon, Raiane Cardoso; Iorio, Natalia Lopes Pontes; Cavalcante, Fernanda Sampaio; Teodoro, Cristiane R S; de Oliveira, Ana Paula Chaves; Maia, Fernanda; dos Santos, Kátia Regina Netto

2014-12-01

In this work, the molecular and phenotypic antimicrobial resistance and clonal diversity of 10 linezolid-resistant Staphylococcus spp. isolates were investigated. The 7 Staphylococcus haemolyticus isolates presented Staphylococcal cassete chromosome mec (SCCmec) V and belonged to the same pulsed-field gel electrophoresis pulsotype. Their MICs for oxacillin, vancomycin, and linezolid were ≥ 256 μg/mL, 1-4 μg/mL, and 8-16 μg/mL, respectively. The 3 S. hominis presented MIC values 32 to >256 μg/mL, 2-4 μg/mL, and 12-24 μg/mL, and all carried the nontypeable SCCmec (ccr1 + mecA class) and belonged to 2 different genotypes. The cfr gene was not found, but the mutation G2603T was detected in S. haemolyticus and C2190T and G2603T in Staphylococcus hominis in 23S rRNA. This study demonstrates the spread of a linezolid-resistant S. haemolyticus genotype and, for the first time, describes the mutation C2190T among S. hominis isolates with a double mutation in Brazil. Copyright © 2014 Elsevier Inc. All rights reserved.

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

Reviving the RNA World: An Insight into the Appearance of RNA Methyltransferases

PubMed Central

Rana, Ajay K.; Ankri, Serge

2016-01-01

RNA, the earliest genetic and catalytic molecule, has a relatively delicate and labile chemical structure, when compared to DNA. It is prone to be damaged by alkali, heat, nucleases, or stress conditions. One mechanism to protect RNA or DNA from damage is through site-specific methylation. Here, we propose that RNA methylation began prior to DNA methylation in the early forms of life evolving on Earth. In this article, the biochemical properties of some RNA methyltransferases (MTases), such as 2′-O-MTases (Rlml/RlmN), spOUT MTases and the NSun2 MTases are dissected for the insight they provide on the transition from an RNA world to our present RNA/DNA/protein world. PMID:27375676

Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man.

PubMed Central

Stöckler, S.; Isbrandt, D.; Hanefeld, F.; Schmidt, B.; von Figura, K.

1996-01-01

In two children with an accumulation of guanidinoacetate in brain and a deficiency of creatine in blood, a severe deficiency of guanidinoacetate methyltransferase (GAMT) activity was detected in the liver. Two mutant GAMT alleles were identified that carried a single base substitution within a 5' splice site or a 13-nt insertion and gave rise to four mutant transcripts. Three of the transcripts encode truncated polypeptides that lack a residue known to be critical for catalytic activity of GAMT. Deficiency of GAMT is the first inborn error of creatine metabolism. It causes a severe developmental delay and extrapyramidal symptoms in early infancy and is treatable by oral substitution with creatine. Images Figure 2 PMID:8651275

Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

PubMed

Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

2017-11-02

Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had

Small Molecule Inhibitors of Protein Arginine Methyltransferases

PubMed Central

Hu, Hao; Qian, Kun; Ho, Meng-Chiao; Zheng, Y. George

2016-01-01

Introduction Arginine methylation is an abundant posttranslational modification occurring in mammalian cells and catalyzed by protein arginine methyltransferases (PRMTs). Misregulation and aberrant expression of PRMTs are associated with various disease states, notably cancer. PRMTs are prominent therapeutic targets in drug discovery. Areas covered The authors provide an updated review of the research on the development of chemical modulators for PRMTs. Great efforts are seen in screening and designing potent and selective PRMT inhibitors, and a number of micromolar and submicromolar inhibitors have been obtained for key PRMT enzymes such as PRMT1, CARM1, and PRMT5. The authors provide a focus on their chemical structures, mechanism of action, and pharmacological activities. Pros and cons of each type of inhibitors are also discussed. Expert opinion Several key challenging issues exist in PRMT inhibitor discovery. Structural mechanisms of many PRMT inhibitors remain unclear. There lacks consistency in potency data due to divergence of assay methods and conditions. Physiologically relevant cellular assays are warranted. Substantial engagements are needed to investigate pharmacodynamics and pharmacokinetics of the new PRMT inhibitors in pertinent disease models. Discovery and evaluation of potent, isoform-selective, cell-permeable and in vivo-active PRMT modulators will continue to be an active arena of research in years ahead. PMID:26789238

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

Human Calmodulin Methyltransferase: Expression, Activity on Calmodulin, and Hsp90 Dependence

PubMed Central

Magen, Sophia; Magnani, Roberta; Haziza, Sitvanit; Hershkovitz, Eli; Houtz, Robert; Cambi, Franca; Parvari, Ruti

2012-01-01

Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34) has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2nd known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes. PMID:23285036

Human calmodulin methyltransferase: expression, activity on calmodulin, and Hsp90 dependence.

PubMed

Magen, Sophia; Magnani, Roberta; Haziza, Sitvanit; Hershkovitz, Eli; Houtz, Robert; Cambi, Franca; Parvari, Ruti

2012-01-01

Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34) has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2(nd) known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes.

Location of rRNA transcription to the nucleolar components: disappearance of the fibrillar centers in nucleoli of regenerating rat hepatocytes.

PubMed

Montanaro, Lorenzo; Govoni, Marzia; Orrico, Catia; Treré, Davide; Derenzini, Massimo

2011-01-01

The precise location of rDNA transcription to the components of mammalian cell nucleolus is still debated. This was due to the fact that all the molecules necessary for rRNA synthesis are located in two of the three components, the fibrillar centers (FCs) and the dense fibrillar component (DFC), which together with the granular component (GC) are considered to be constantly present in mammalian cell nucleoli. In the present study we demonstrated that in nucleoli of many regenerating rat hepatocytes at 15 h after partial hepatectomy the FCs were no longer present, only the DFC and the GC being detected. At this time of regeneration the rRNA transcriptional activity was three fold that of resting hepatocytes, while the synthesis of DNA was not yet significantly increased, indicating that these nucleolar changes were due to the rRNA synthesis up-regulation. The DFC appeared to be organized in numerous, small, roundish tufts of fibrils. The silver staining procedure for AgNOR proteins, which are associated with the ribosomal genes, selectively and homogeneously stained these fibrillar tufts. Immuno-gold visualization of the Upstream Binding Factor (UBF), which is associated with the promoter region and the transcribed portion of the rRNA 45S gene, demonstrated that UBF was selectively located in the fibrillar tufts. We concluded that in proliferating rat hepatocytes the increased synthesis of rRNA induced an activation of the rRNA transcription machinery located in the fibrillar centers which, by becoming associated with the ribonucleoprotein transcripts, assumed the morphological pattern of the DFC.

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

A novel non-SET domain multi-subunit methyltransferase required for sequential nucleosomal histone H3 methylation by the mixed lineage leukemia protein-1 (MLL1) core complex.

PubMed

Patel, Anamika; Vought, Valarie E; Dharmarajan, Venkatasubramanian; Cosgrove, Michael S

2011-02-04

Gene expression within the context of eukaryotic chromatin is regulated by enzymes that catalyze histone lysine methylation. Histone lysine methyltransferases that have been identified to date possess the evolutionarily conserved SET or Dot1-like domains. We previously reported the identification of a new multi-subunit histone H3 lysine 4 methyltransferase lacking homology to the SET or Dot1 family of histone lysine methyltransferases. This enzymatic activity requires a complex that includes WRAD (WDR5, RbBP5, Ash2L, and DPY-30), a complex that is part of the MLL1 (mixed lineage leukemia protein-1) core complex but that also exists independently of MLL1 in the cell. Here, we report that the minimal complex required for WRAD enzymatic activity includes WDR5, RbBP5, and Ash2L and that DPY-30, although not required for enzymatic activity, increases the histone substrate specificity of the WRAD complex. We also show that WRAD requires zinc for catalytic activity, displays Michaelis-Menten kinetics, and is inhibited by S-adenosyl-homocysteine. In addition, we demonstrate that WRAD preferentially methylates lysine 4 of histone H3 within the context of the H3/H4 tetramer but does not methylate nucleosomal histone H3 on its own. In contrast, we find that MLL1 and WRAD are required for nucleosomal histone H3 methylation, and we provide evidence suggesting that each plays distinct structural and catalytic roles in the recognition and methylation of a nucleosome substrate. Our results indicate that WRAD is a new H3K4 methyltransferase with functions that include regulating the substrate and product specificities of the MLL1 core complex.

Structure, Function and Inhibition of the Phosphoethanolamine Methyltransferases of the Human Malaria Parasites Plasmodium vivax and Plasmodium knowlesi

DOE PAGES

Garg, Aprajita; Lukk, Tiit; Kumar, Vidya; ...

2015-03-12

Phosphoethanolamine methyltransferases (PMTs) catalyze the three-step methylation of phosphoethanolamine to form phosphocholine, a critical step in the synthesis of phosphatidylcholine in a select number of eukaryotes including human malaria parasites, nematodes and plants. Genetic studies in the malaria parasite Plasmodium falciparum have shown that the methyltransferase PfPMT plays a critical function in parasite development and differentiation. The presence of PMT orthologs in other malaria parasites that infect humans and their absence in mammals make them ideal targets for the development of selective antimalarials with broad specificity against different Plasmodium species. Here we describe the X-ray structures and biochemical properties ofmore » PMT orthologs from Plasmodium vivax and Plasmodium knowlesi and show that both enzymes are inhibited by amodiaquine and NSC158011, two drugs with potent antimalarial activity. Metabolic studies in a yeast mutant that relies on PkPMT or PvPMT for survival demonstrated that these compounds inhibit phosphatidylcholine biosynthesis from ethanolamine. Our structural and functional data provide insights into the mechanism of catalysis and inhibition of PMT enzymes and set the stage for a better design of more specific and selective antimalarial drugs.« less

Structure, Function and Inhibition of the Phosphoethanolamine Methyltransferases of the Human Malaria Parasites Plasmodium vivax and Plasmodium knowlesi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garg, Aprajita; Lukk, Tiit; Kumar, Vidya

Phosphoethanolamine methyltransferases (PMTs) catalyze the three-step methylation of phosphoethanolamine to form phosphocholine, a critical step in the synthesis of phosphatidylcholine in a select number of eukaryotes including human malaria parasites, nematodes and plants. Genetic studies in the malaria parasite Plasmodium falciparum have shown that the methyltransferase PfPMT plays a critical function in parasite development and differentiation. The presence of PMT orthologs in other malaria parasites that infect humans and their absence in mammals make them ideal targets for the development of selective antimalarials with broad specificity against different Plasmodium species. Here we describe the X-ray structures and biochemical properties ofmore » PMT orthologs from Plasmodium vivax and Plasmodium knowlesi and show that both enzymes are inhibited by amodiaquine and NSC158011, two drugs with potent antimalarial activity. Metabolic studies in a yeast mutant that relies on PkPMT or PvPMT for survival demonstrated that these compounds inhibit phosphatidylcholine biosynthesis from ethanolamine. Our structural and functional data provide insights into the mechanism of catalysis and inhibition of PMT enzymes and set the stage for a better design of more specific and selective antimalarial drugs.« less

A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

PubMed

Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

2015-02-01

The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

Chromatin structure and methylation of rat rRNA genes studied by formaldehyde fixation and psoralen cross-linking.

PubMed Central

Stancheva, I; Lucchini, R; Koller, T; Sogo, J M

1997-01-01

By using formaldehyde cross-linking of histones to DNA and gel retardation assays we show that formaldehyde fixation, similar to previously established psoralen photocross-linking, discriminates between nucleosome- packed (inactive) and nucleosome-free (active) fractions of ribosomal RNA genes. By both cross-linking techniques we were able to purify fragments from agarose gels, corresponding to coding, enhancer and promoter sequences of rRNA genes, which were further investigated with respect to DNA methylation. This approach allows us to analyse independently and in detail methylation patterns of active and inactive rRNA gene copies by the combination of Hpa II and Msp I restriction enzymes. We found CpG methylation mainly present in enhancer and promoter regions of inactive rRNA gene copies. The methylation of one single Hpa II site, located in the promoter region, showed particularly strong correlation with the transcriptional activity. PMID:9108154

Biotechnological Production of Dimethoxyflavonoids Using a Fusion Flavonoid O-Methyltransferase Possessing Both 3'- and 7-O-Methyltransferase Activities.

PubMed

Lee, Danbi; Park, Hye Lin; Lee, Sang-Won; Bhoo, Seong Hee; Cho, Man-Ho

2017-05-26

Although they are less abundant in nature, methoxyflavonoids have distinct physicochemical and pharmacological properties compared to common nonmethylated flavonoids. Thus, enzymatic conversion and biotransformation using genetically engineered microorganisms of flavonoids have been attempted for the efficient production of methoxyflavonoids. Because of their regiospecificity, more than two flavonoid O-methyltransferases (FOMTs) and enzyme reactions are required to biosynthesize di(or poly)-methoxyflavonoids. For the one-step biotechnological production of bioactive di-O-methylflavonoids, we generated a multifunctional FOMT fusing a 3'-OMT (SlOMT3) and a 7-OMT (OsNOMT). The SlOMT3/OsNOMT fusion enzyme possessed both 3'- and 7-OMT activities to diverse flavonoid substrates, which were comparable to those of individual SlOMT3 and OsNOMT. The SlOMT3/OsNOMT enzyme also showed 3'- and 7-OMT activity for 7- or 3'-O-methylflavonoids, respectively, suggesting that the fusion enzyme can sequentially methylate flavonoids into di-O-methylflavonoids. The biotransformation of the flavonoids quercetin, luteolin, eriodictyol, and taxifolin using SlOMT3/OsNOMT-transformed Escherichia coli generated corresponding di-O-methylflavonoids, rhamnazin, velutin, 3',7-di-O-methyleriodictyol, and 3',7-di-O-methyltaxifolin, respectively. These results indicate that dimethoxyflavonoids may be efficiently produced from nonmethylated flavonoid precursors through a one-step biotransformation using the engineered E. coli harboring the SlOMT3/OsNOMT fusion gene.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse

Melatonin production in Escherichia coli by dual expression of serotonin N-acetyltransferase and caffeic acid O-methyltransferase.

PubMed

Byeon, Yeong; Back, Kyoungwhan

2016-08-01

Melatonin is a well-known bioactive molecule produced in animals and plants and a well-studied natural compound. Two enzymatic steps are required for the biosynthesis of melatonin from serotonin. First, serotonin N-acetyltransferase (SNAT) catalyzes serotonin to N-acetylserotonin (NAS) followed by the action of N-acetylserotonin O-methyltransferase (ASMT), resulting in the synthesis of O-methylated NAS, also known as melatonin. Attempts to document melatonin production in Escherichia coli have been unsuccessful to date due to either low enzyme activity or inactive ASMT expression. Here, we employed caffeic acid O-methyltransferase (COMT) instead of ASMT, as COMT is a multifunctional enzyme that has ASMT activity as well. Among several combinations of dual expression cassettes, recombinant E. coli that expressed sheep SNAT with rice COMT produced a high quantity of melatonin, which was measured in a culture medium (1.46 mg/L in response to 1 mM serotonin). This level was several orders of magnitude higher than that produced in transgenic rice and tomato overexpressing sheep SNAT and ASMT, respectively. This heterologous expression system can be widely employed to screen various putative SNAT or ASMT genes from animals and plants as well as to overproduce melatonin in various useful microorganisms.

The RNA Methyltransferase Complex of WTAP, METTL3, and METTL14 Regulates Mitotic Clonal Expansion in Adipogenesis.

PubMed

Kobayashi, Masatoshi; Ohsugi, Mitsuru; Sasako, Takayoshi; Awazawa, Motoharu; Umehara, Toshihiro; Iwane, Aya; Kobayashi, Naoki; Okazaki, Yukiko; Kubota, Naoto; Suzuki, Ryo; Waki, Hironori; Horiuchi, Keiko; Hamakubo, Takao; Kodama, Tatsuhiko; Aoe, Seiichiro; Tobe, Kazuyuki; Kadowaki, Takashi; Ueki, Kohjiro

2018-06-04

Adipocyte differentiation is regulated by various mechanisms, of which the mitotic clonal expansion (MCE) is a key step. Although this process is known to be regulated by the cell cycle modulators, the precise mechanism remains unclear. N 6 -methyladenosine (m 6 A) post-transcriptional RNA modification, whose methylation and demethylation is performed by respective enzymal molecules, has recently been suggested to be involved in the regulation of adipogenesis. Here, we show that an RNA N 6 -adenosine methyltransferase complex consisting of Wilms' tumor 1-associating protein (WTAP), methyltransferase like (METTL) 3 and METTL14 positively control adipogenesis, by promoting cell cycle transition in MCE during adipogenesis. WTAP, coupled with METTL3 and METTL14, is increased and distributed in nucleus by the induction of adipogenesis dependently on RNA in vitro Knockdown of each of these three proteins leads to cell cycle arrest and impaired adipogenesis associated with suppression of Cyclin A2 upregulation during MCE, whose knockdown also impairs adipogenesis. Consistently, Wtap heterozygous knockout mice are protected from diet-induced obesity with smaller size and number of adipocytes, leading to improved insulin sensitivity. These data provide a mechanism for adipogenesis through WTAP-METTL3-METTL14 complex and a potential strategy for treatment of obesity and associated disorders. Copyright © 2018 Kobayashi et al.

Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme.

PubMed Central

Motorin, Y; Grosjean, H

1999-01-01

Several genes encoding putative RNA:5-methylcytidine-transferases (m5C-transferases) from different organisms, including yeast, have been identified by sequence homology with the recently identified 16S rRNA:m5C967-methyltransferase (gene SUN) from Escherichia coli. One of the yeast ORFs (YBL024w) was amplified by PCR, inserted in the expression vector pET28b, and the corresponding protein was hyperexpressed in E. coli BL21 (DE3). The resulting N-terminally His6-tagged recombinant Ybl024p was purified to apparent homogeneity by one-step affinity chromatography on Ni2+-NTA-agarose column. The activity and substrate specificity of the purified Ybl024p were tested in vitro using T7 transcripts of different yeast tRNAs as substrates and S-adenosyl-L-methionine as a donor of the methyl groups. The results indicate that yeast ORF YBL024w encodes S-adenosyl-L-methionine-dependent tRNA: m5C-methyltransferase that is capable of methylating cytosine to m5C at several positions in different yeast tRNAs and pre-tRNAs containing intron. Modification of tRNA occurs at all four positions (34, 40, 48, and 49) at which m5C has been found in yeast tRNAs sequenced so far. Disruption of the ORF YBL024w leads to the complete absence of m5C in total yeast tRNA. Moreover no tRNA:m5C-methyltransferase activity towards all potential m5C methylation sites was detected in the extract of the disrupted yeast strain. These results demonstrate that the protein product of a single gene is responsible for complete m5C methylation of yeast tRNA. Because this newly characterized multisite-specific modification enzyme Ybl024p is the fourth tRNA-specific methyltransferase identified in yeast, we suggest designating it as TRM4, the gene corresponding to ORF YBL024w. PMID:10445884

Enhanced detoxification and degradation of herbicide atrazine by a group of O-methyltransferases in rice.

PubMed

Lu, Yi Chen; Luo, Fang; Pu, Zhong Ji; Zhang, Shuang; Huang, Meng Tian; Yang, Hong

2016-12-01

Atrazine (ATR) as a toxic herbicide has become one of the seriously environmental contaminants worldwide due to its long-term intensive use in crop production. This study identified novel methyltransferases (MTs) involved in detoxification and degradation of ATR residues in rice plants. From a subset of MTs differentially expressed in ATR-exposed rice, forty-four O-methyltransferase genes were investigated. Total activities were significantly enhanced by ATR in rice tissues. To prove detoxifying capacity of the MTs in rice plants, two rice O-MTs (LOC_Os04g09604 and LOC_Os11g15040) were selected and transformed into yeast cells (Pichia pastoris X-33). The positive transformants accumulated less ATR and showed less toxicity. Using UPLC-TOF-MS/MS, ATR-degraded products in rice and yeast cells were characterized. A novel O-methylated-modified metabolite (atraton) and six other ATR-derivatives were detected. The topological interaction between LOC_Os04g09604 enzyme and its substrate was specially analyzed by homology modeling programs, which was well confirmed by the molecular docking analysis. The significance of the study is to provide a better understanding of mechanisms for the specific detoxification and degradation of ATR residues in rice growing in environmentally relevant ATR-contaminated soils and may hold a potential engineering perspective for generating ATR-resistant rice that helps to minimize ATR residues in crops. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka

The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6more » but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.« less

Catechol-O-Methyltransferase Val158Met Polymorphism on Striatum Structural Covariance Networks in Alzheimer's Disease.

PubMed

Chang, Chiung-Chih; Tsai, Shih-Jen; Chen, Nai-Ching; Huang, Chi-Wei; Hsu, Shih-Wei; Chang, Ya-Ting; Liu, Mu-En; Chang, Wen-Neng; Tsai, Wan-Chen; Lee, Chen-Chang

2018-06-01

The catechol-O-methyltransferase enzyme metabolizes dopamine in the prefrontal axis, and its genetic polymorphism (rs4680; Val158Met) is a known determinant of dopamine signaling. In this study, we investigated the possible structural covariance networks that may be modulated by this functional polymorphism in patients with Alzheimer's disease. Structural covariance networks were constructed by 3D T1 magnetic resonance imaging. The patients were divided into two groups: Met-carriers (n = 91) and Val-homozygotes (n = 101). Seed-based analysis was performed focusing on triple-network models and six striatal networks. Neurobehavioral scores served as the major outcome factors. The role of seed or peak cluster volumes, or a covariance strength showing Met-carriers > Val-homozygotes were tested for the effect on dopamine. Clinically, the Met-carriers had higher mental manipulation and hallucination scores than the Val-homozygotes. The volume-score correlations suggested the significance of the putaminal seed in the Met-carriers and caudate seed in the Val-homozygotes. Only the dorsal-rostral and dorsal-caudal putamen interconnected peak clusters showed covariance strength interactions (Met-carriers > Val-homozygotes), and the peak clusters also correlated with the neurobehavioral scores. Although the triple-network model is important for a diagnosis of Alzheimer's disease, our results validated the role of the dorsal-putaminal-anchored network by the catechol-O-methyltransferase Val158Met polymorphism in predicting the severity of cognitive and behavior in subjects with Alzheimer's disease.

DsaV methyltransferase and its isoschizomers contain a conserved segment that is similar to the segment in Hhai methyltransferase that is in contact with DNA bases.

PubMed Central

Gopal, J; Yebra, M J; Bhagwat, A S

1994-01-01

The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279

Egg-specific expression of protein with DNA methyltransferase activity in the biocarcinogenic liver fluke Clonorchis sinensis.

PubMed

Kim, Seon-Hee; Cho, Hye-Jeong; Sohn, Woon-Mok; Ahn, Chun-Seob; Kong, Yoon; Yang, Hyun-Jong; Bae, Young-An

2015-08-01

Despite recent reports regarding the biology of cytosine methylation in Schistosoma mansoni, the impact of the regulatory machinery remains unclear in diverse platyhelminthes. This ambiguity is reinforced by discoveries of DNA methyltransferase 2 (DNMT2)-only organisms and the substrate specificity of DNMT2 preferential to RNA molecules. Here, we characterized a novel DNA methyltransferase, named CsDNMT2, in a liver fluke Clonorchis sinensis. The protein exhibited structural properties conserved in other members of the DNMT2 family. The native and recombinant CsDNMT2 exhibited considerable enzymatic activity on DNA. The spatiotemporal expression of CsDNMT2 mirrored that of 5-methylcytosine (5 mC), both of which were elevated in the C. sinensis eggs. However, CsDNMT2 and 5 mC were marginally detected in other histological regions of C. sinensis adults including ovaries and seminal receptacle. The methylation site seemed not related to genomic loci occupied by progenies of an active long-terminal-repeat retrotransposon. Taken together, our data strongly suggest that C. sinensis has preserved the functional DNA methylation machinery and that DNMT2 acts as a genuine alternative to DNMT1/DNMT3 to methylate DNA in the DNMT2-only organism. The epigenetic regulation would target functional genes primarily involved in the formation and/or maturation of eggs, rather than retrotransposons.

Structure analysis of geranyl pyrophosphate methyltransferase and the proposed reaction mechanism of SAM-dependent C-methylation.

PubMed

Ariyawutthiphan, Orapin; Ose, Toyoyuki; Minami, Atsushi; Shinde, Sandip; Sinde, Sandip; Tsuda, Muneya; Gao, Yong-Gui; Yao, Min; Oikawa, Hideaki; Tanaka, Isao

2012-11-01

In the typical isoprenoid-biosynthesis pathway, condensation of the universal C(5)-unit precursors isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) occurs via the common intermediates prenyl pyrophosphates (C(10)-C(20)). The diversity of isoprenoids reflects differences in chain length, cyclization and further additional modification after cyclization. In contrast, the biosynthesis of 2-methylisonorneol (2-MIB), which is responsible for taste and odour problems in drinking water, is unique in that it primes the enzymatic methylation of geranyl pyrophosphate (GPP) before cyclization, which is catalyzed by an S-adenosyl-L-methionine-dependent methyltransferase (GPPMT). The substrate of GPPMT contains a nonconjugated olefin and the reaction mechanism is expected to be similar to that of the steroid methyltransferase (SMT) family. Here, structural analysis of GPPMT in complex with its cofactor and substrate revealed the mechanisms of substrate recognition and possible enzymatic reaction. Using the structures of these complexes, methyl-group transfer and the subsequent proton-abstraction mechanism are discussed. GPPMT and SMTs contain a conserved glutamate residue that is likely to play a role as a general base. Comparison with the reaction mechanism of the mycolic acid cyclopropane synthase (MACS) family also supports this result. This enzyme represented here is the first model of the enzymatic C-methylation of a nonconjugated olefin in the isoprenoid-biosynthesis pathway. In addition, an elaborate system to avoid methylation of incorrect substrates is proposed.

Expression, purification, crystallization and preliminary crystallographic study of isolated modules of the mouse coactivator-associated arginine methyltransferase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Troffer-Charlier, Nathalie; Cura, Vincent; Hassenboehler, Pierre

2007-04-01

Isolated modules of mouse coactivator-associated arginine methyltransferase 1 encompassing the protein arginine N-methyltransferase catalytic domain have been overexpressed, purified and crystallized. X-ray diffraction data have been collected and have enabled determination of the structures by multiple isomorphous replacement using anomalous scattering. Coactivator-associated arginine methyltransferase 1 (CARM1) plays a crucial role in gene expression as a coactivator of several nuclear hormone receptors and also of non-nuclear receptor systems. Its recruitment by the transcriptional machinery induces protein methylation, leading to chromatin remodelling and gene activation. CARM1{sub 28–507} and two structural states of CARM1{sub 140–480} were expressed, purified and crystallized. Crystals of CARM1{submore » 28–507} belong to space group P6{sub 2}22, with unit-cell parameters a = b = 136.0, c = 125.3 Å; they diffract to beyond 2.5 Å resolution using synchrotron radiation and contain one monomer in the asymmetric unit. The structure of CARM1{sub 28–507} was solved by multiple isomorphous replacement and anomalous scattering methods. Crystals of apo CARM1{sub 140–480} belong to space group I222, with unit-cell parameters a = 74.6, b = 99.0, c = 207.4 Å; they diffract to beyond 2.7 Å resolution and contain two monomers in the asymmetric unit. Crystals of CARM1{sub 140–480} in complex with S-adenosyl-l-homocysteine belong to space P2{sub 1}2{sub 1}2, with unit-cell parameters a = 74.6, b = 98.65, c = 206.08 Å; they diffract to beyond 2.6 Å resolution and contain four monomers in the asymmetric unit. The structures of apo and holo CARM1{sub 140–480} were solved by molecular-replacement techniques from the structure of CARM1{sub 28–507}.« less

Chloroplast overexpression of rice caffeic acid O-methyltransferase increases melatonin production in chloroplasts via the 5-methoxytryptamine pathway in transgenic rice plants.

PubMed

Choi, Geun-Hee; Lee, Hyoung Yool; Back, Kyoungwhan

2017-08-01

Recent analyses of the enzymatic features of various melatonin biosynthetic genes from bacteria, animals, and plants have led to the hypothesis that melatonin could be synthesized via the 5-methoxytryptamine (5-MT) pathway. 5-MT is known to be synthesized in vitro from serotonin by the enzymatic action of O-methyltransferases, including N-acetylserotonin methyltransferase (ASMT) and caffeic acid O-methyltransferase (COMT), leading to melatonin synthesis by the subsequent enzymatic reaction with serotonin N-acetyltransferase (SNAT). Here, we show that 5-MT was produced and served as a precursor for melatonin synthesis in plants. When rice seedlings were challenged with senescence treatment, 5-MT levels and melatonin production were increased in transgenic rice seedlings overexpressing the rice COMT in chloroplasts, while no such increases were observed in wild-type or transgenic seedlings overexpressing the rice COMT in the cytosol, suggesting a 5-MT transport limitation from the cytosol to chloroplasts. In contrast, cadmium treatment led to results different from those in senescence. The enhanced melatonin production was not observed in the chloroplast COMT lines relative over the cytosol COMT lines although 5-MT levels were equally induced in all genotypes upon cadmium treatment. The transgenic seedlings with enhanced melatonin in their chloroplasts exhibited improved seedling growth vs the wild type under continuous light conditions. This is the first report describing enhanced melatonin production in chloroplasts via the 5-MT pathway with the ectopic overexpression of COMT in chloroplasts in plants. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

PubMed Central

Xin, De-Dong; Wen, Jian-Fan

2012-01-01

Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

PubMed

Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

2007-04-01

International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

PubMed Central

Gaal, T; Gourse, R L

1990-01-01

rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Electrochemistry Shows DNMT1 Methyltransferase Hyperactivity in Colorectal Tumors.

PubMed

Furst, Ariel L; Barton, Jacqueline K

2015-07-23

DNMT1, the most abundant human methyltransferase, is responsible for translating the correct methylation pattern during DNA replication, and aberrant methylation by DNMT1 has been linked to tumorigenesis. We have developed a sensitive signal-on electrochemical assay for the measurement of DNMT1 activity in crude tissue lysates. We have further analyzed ten tumor sets and have found a direct correlation between DNMT1 hyperactivity and tumorous tissue. In the majority of samples analyzed, the tumorous tissue has significantly higher DNMT1 activity than the healthy adjacent tissue. No such correlation is observed in measurements of DNMT1 expression by qPCR, DNMT1 protein abundance by western blotting, or DNMT1 activity using a radiometric DNA labeling assay. DNMT1 hyperactivity can result from both protein overexpression and enzyme hyperactivity. DNMT1 activity measured electrochemically provides a direct measure of activity in cell lysates and, as a result, provides a sensitive and early indication of cancerous transformation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

PubMed

Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

2011-05-01

A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

Purification, crystallization and preliminary X-ray analysis of the BseCI DNA methyltransferase from Bacillus stearothermophilus in complex with its cognate DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary

2007-01-01

The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Discovery and Characterization of a Highly Potent and Selective Aminopyrazoline-Based in Vivo Probe (BAY-598) for the Protein Lysine Methyltransferase SMYD2.

PubMed

Eggert, Erik; Hillig, Roman C; Koehr, Silke; Stöckigt, Detlef; Weiske, Jörg; Barak, Naomi; Mowat, Jeffrey; Brumby, Thomas; Christ, Clara D; Ter Laak, Antonius; Lang, Tina; Fernandez-Montalvan, Amaury E; Badock, Volker; Weinmann, Hilmar; Hartung, Ingo V; Barsyte-Lovejoy, Dalia; Szewczyk, Magdalena; Kennedy, Steven; Li, Fengling; Vedadi, Masoud; Brown, Peter J; Santhakumar, Vijayaratnam; Arrowsmith, Cheryl H; Stellfeld, Timo; Stresemann, Carlo

2016-05-26

Protein lysine methyltransferases have recently emerged as a new target class for the development of inhibitors that modulate gene transcription or signaling pathways. SET and MYND domain containing protein 2 (SMYD2) is a catalytic SET domain containing methyltransferase reported to monomethylate lysine residues on histone and nonhistone proteins. Although several studies have uncovered an important role of SMYD2 in promoting cancer by protein methylation, the biology of SMYD2 is far from being fully understood. Utilization of highly potent and selective chemical probes for target validation has emerged as a concept which circumvents possible limitations of knockdown experiments and, in particular, could result in an improved exploration of drug targets with a complex underlying biology. Here, we report the development of a potent, selective, and cell-active, substrate-competitive inhibitor of SMYD2, which is the first reported inhibitor suitable for in vivo target validation studies in rodents.

Histone methyltransferase Dot1L plays a role in postembryonic development in Xenopus tropicalis

PubMed Central

Wen, Luan; Fu, Liezhen; Guo, Xiaogang; Chen, Yonglong; Shi, Yun-Bo

2015-01-01

Histone methylations have been implicated to play important roles in diverse cellular processes. Of particular interest is the methylation of histone H3K79, which is catalyzed by an evolutionarily conserved methyltransferase, disruptor of telomeric silencing (Dot1)-like (Dot1L). To investigate the role of Dot1L during vertebrate development, we have generated a Dot1L-specific transcription activator-like effector nuclease (TALEN) nuclease to knockdown endogenous Dot1L in Xenopus tropicalis, a diploid species highly related to the well-known developmental model Xenopus laevis, a pseudotetraploid amphibian. We show that the TALEN was extremely efficient in mutating Dot1L when expressed in fertilized eggs, creating essentially Dot1L knockout embryos with little H3K79 methylation. Importantly, we observed that Dot1L knockdown had no apparent effect on embryogenesis because normally feeding tadpoles were formed, consistent with the lack of maternal Dot1L expression. On the other hand, Dot1L knockdown severely retarded the growth of the tadpoles and led to tadpole lethality prior to metamorphosis. These findings suggest that Dot1L and H3K79 methylation play an important role for tadpole growth and development prior to metamorphosis into a frog. Our findings further reveal interesting similarities and differences between Xenopus and mouse development and suggest the existence of 2 separate phases of vertebrate development with distinct requirements for epigenetic modifications.—Wen, L., Fu, L., Guo, X., Chen, Y., Shi, Y.-B. Histone methyltransferase Dot1L plays a role in postembryonic development in Xenopus tropicalis. PMID:25366346

Epigenetic Guardian: A Review of the DNA Methyltransferase DNMT3A in Acute Myeloid Leukaemia and Clonal Haematopoiesis.

PubMed

Chaudry, Sabah F; Chevassut, Timothy J T

2017-01-01

Acute myeloid leukaemia (AML) is a haematological malignancy characterized by clonal stem cell proliferation and aberrant block in differentiation. Dysfunction of epigenetic modifiers contributes significantly to the pathogenesis of AML. One frequently mutated gene involved in epigenetic modification is DNMT3A (DNA methyltransferase-3-alpha), a DNA methyltransferase that alters gene expression by de novo methylation of cytosine bases at CpG dinucleotides. Approximately 22% of AML and 36% of cytogenetically normal AML cases carry DNMT3A mutations and around 60% of these mutations affect the R882 codon. These mutations have been associated with poor prognosis and adverse survival outcomes for AML patients. Advances in whole-exome sequencing techniques have recently identified a large number of DNMT3A mutations present in clonal cells in normal elderly individuals with no features of haematological malignancy. Categorically distinct from other preleukaemic conditions, this disorder has been termed clonal haematopoiesis of indeterminate potential (CHIP). Further insight into the mutational landscape of CHIP may illustrate the consequence of particular mutations found in DNMT3A and identify specific "founder" mutations responsible for clonal expansion that may contribute to leukaemogenesis. This review will focus on current research and understanding of DNMT3A mutations in both AML and CHIP.

Turning a Substrate Peptide into a Potent Inhibitor for the Histone Methyltransferase SETD8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Judge, Russell A.; Zhu, Haizhong; Upadhyay, Anup K.

SETD8 is a histone H4–K20 methyltransferase that plays an essential role in the maintenance of genomic integrity during mitosis and in DNA damage repair, making it an intriguing target for cancer research. While some small molecule inhibitors for SETD8 have been reported, the structural binding modes for these inhibitors have not been revealed. Using the complex structure of the substrate peptide bound to SETD8 as a starting point, different natural and unnatural amino acid substitutions were tested, and a potent (Ki 50 nM, IC50 0.33 μM) and selective norleucine containing peptide inhibitor has been obtained.

Selective and membrane-permeable small molecule inhibitors of nicotinamide N-methyltransferase reverse high fat diet-induced obesity in mice.

PubMed

Neelakantan, Harshini; Vance, Virginia; Wetzel, Michael D; Wang, Hua-Yu Leo; McHardy, Stanton F; Finnerty, Celeste C; Hommel, Jonathan D; Watowich, Stanley J

2018-01-01

There is a critical need for new mechanism-of-action drugs that reduce the burden of obesity and associated chronic metabolic comorbidities. A potentially novel target to treat obesity and type 2 diabetes is nicotinamide-N-methyltransferase (NNMT), a cytosolic enzyme with newly identified roles in cellular metabolism and energy homeostasis. To validate NNMT as an anti-obesity drug target, we investigated the permeability, selectivity, mechanistic, and physiological properties of a series of small molecule NNMT inhibitors. Membrane permeability of NNMT inhibitors was characterized using parallel artificial membrane permeability and Caco-2 cell assays. Selectivity was tested against structurally-related methyltransferases and nicotinamide adenine dinucleotide (NAD + ) salvage pathway enzymes. Effects of NNMT inhibitors on lipogenesis and intracellular levels of metabolites, including NNMT reaction product 1-methylnicotianamide (1-MNA) were evaluated in cultured adipocytes. Effects of a potent NNMT inhibitor on obesity measures and plasma lipid were assessed in diet-induced obese mice fed a high-fat diet. Methylquinolinium scaffolds with primary amine substitutions displayed high permeability from passive and active transport across membranes. Importantly, methylquinolinium analogues displayed high selectivity, not inhibiting related SAM-dependent methyltransferases or enzymes in the NAD + salvage pathway. NNMT inhibitors reduced intracellular 1-MNA, increased intracellular NAD + and S-(5'-adenosyl)-l-methionine (SAM), and suppressed lipogenesis in adipocytes. Treatment of diet-induced obese mice systemically with a potent NNMT inhibitor significantly reduced body weight and white adipose mass, decreased adipocyte size, and lowered plasma total cholesterol levels. Notably, administration of NNMT inhibitors did not impact total food intake nor produce any observable adverse effects. These results support development of small molecule NNMT inhibitors as therapeutics to

Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

PubMed

Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

2006-01-01

Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

PubMed Central

Ryals, J; Little, R; Bremer, H

1982-01-01

The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

PubMed

Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

2008-10-31

A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

PubMed

Hotto, Amber M; Huston, Zoe E; Stern, David B

2010-09-29

The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Zirong; Department of Molecular Genetics and Microbiology, Shands Cancer Center, University of Florida, Gainesville, FL 32610; Jin, Guorong

2012-06-08

Highlights: Black-Right-Pointing-Pointer CDA-II inhibits myogenic differentiation in a dose-dependent manner. Black-Right-Pointing-Pointer CDA-II repressed expression of muscle transcription factors and structural proteins. Black-Right-Pointing-Pointer CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiationmore » of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.« less

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

Methylation of Arsenic by Recombinant Human Wild-Type Arsenic (+3 Oxidation State) Methyltransferase and its Methionine 287 Threonine (M287T) Polymorph

EPA Science Inventory

ABSTRACT Arsenic (+3 oxidation state) methyltransferase (AS3MT) is the key enzyme in the pathway for methylation of arsenicals. A common polymorphism in the AS3MT gene that replaces a threonyl residue in position 287 with a methionyl residue (AS3MT/M287T) occurs at a frequency...

hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

PubMed Central

Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

2015-01-01

Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

Severe systemic toxicity and urinary bladder cytotoxicity and regenerative hyperplasia induced by arsenite in arsenic (+3 oxidation state) methyltransferase knockout mice. A preliminary report

EPA Science Inventory

Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes reactions which convert inorganic arsenic to methylated metabolites. This study determined whether the As3mt null genotype in the mouse modifies cytotoxic and proliferative effects seen in urinary bladders of wild t...

Effect of Sodium Arsenite Dose Administered in the Drinking Water on the Urinary Bladder Epithelium of Female Arsenic (+3 oxidation state) Methyltransferase Knockout Mice

EPA Science Inventory

The enzyme arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes reactions converting inorganic arsenic to methylated metabolites, some of which are highly cytotoxic. In a previous study, we evaluated whether the As3mt null genotype in mice modified cytotoxic and proli...

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

5-methylcytosine promotes mRNA export — NSUN2 as the methyltransferase and ALYREF as an m5C reader

PubMed Central

Yang, Xin; Yang, Ying; Sun, Bao-Fa; Chen, Yu-Sheng; Xu, Jia-Wei; Lai, Wei-Yi; Li, Ang; Wang, Xing; Bhattarai, Devi Prasad; Xiao, Wen; Sun, Hui-Ying; Zhu, Qin; Ma, Hai-Li; Adhikari, Samir; Sun, Min; Hao, Ya-Juan; Zhang, Bing; Huang, Chun-Min; Huang, Niu; Jiang, Gui-Bin; Zhao, Yong-Liang; Wang, Hai-Lin; Sun, Ying-Pu; Yang, Yun-Gui

2017-01-01

5-methylcytosine (m5C) is a post-transcriptional RNA modification identified in both stable and highly abundant tRNAs and rRNAs, and in mRNAs. However, its regulatory role in mRNA metabolism is still largely unknown. Here, we reveal that m5C modification is enriched in CG-rich regions and in regions immediately downstream of translation initiation sites and has conserved, tissue-specific and dynamic features across mammalian transcriptomes. Moreover, m5C formation in mRNAs is mainly catalyzed by the RNA methyltransferase NSUN2, and m5C is specifically recognized by the mRNA export adaptor ALYREF as shown by in vitro and in vivo studies. NSUN2 modulates ALYREF's nuclear-cytoplasmic shuttling, RNA-binding affinity and associated mRNA export. Dysregulation of ALYREF-mediated mRNA export upon NSUN2 depletion could be restored by reconstitution of wild-type but not methyltransferase-defective NSUN2. Our study provides comprehensive m5C profiles of mammalian transcriptomes and suggests an essential role for m5C modification in mRNA export and post-transcriptional regulation. PMID:28418038

Modulation of microRNA expression in human lung cancer cells by the G9a histone methyltransferase inhibitor BIX01294

PubMed Central

PANG, ALAN LAP-YIN; TITLE, ALEXANDRA C.; RENNERT, OWEN M.

2014-01-01

MicroRNAs (miRNAs) are small non-coding RNAs that regulate the expression of their target genes at the post-transcriptional level. In cancer cells, miRNAs, depending on the biological functions of their target genes, may have a tumor-promoting or -suppressing effect. Treatment of cancer cells with inhibitors of DNA methylation and/or histone deacetylation modulates the expression level of miRNAs, which provides evidence for epigenetic regulation of miRNA expression. The consequences of inhibition of histone methyltransferase on miRNA expression, however, have not been thoroughly investigated. The present study examined the expression pattern of miRNAs in the non-small cell lung cancer cell line, H1299 with or without treatment of BIX01294, a potent chemical inhibitor of G9a methyltransferase that catalyzes the mono-and di-methylation of the lysine 9 residue of histone H3. By coupling microarray analysis with quantitative real-time polymerase chain reaction analysis, two miRNAs were identified that showed consistent downregulation following BIX01294 treatment. The results indicate that histone H3 methylation regulates miRNA expression in lung cancer cells, which may provide additional insight for future chemical treatment of lung cancer. PMID:24932239

DNA Methyltransferase Activity Assays: Advances and Challenges

PubMed Central

Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

2016-01-01

DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice. PMID:26909112

Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

PubMed

Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

2015-06-01

Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

PubMed Central

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-01-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

rRNA and poly-beta-hydroxybutyrate dynamics in bioreactors subjected to feast and famine cycles.

PubMed

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-04-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-beta-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase

PubMed Central

Patra, Niladri; Ioannidis, Efthymios I.

2016-01-01

Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21–22 kcal/mol, in good agreement with experiment (18–19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are

rRNA gene restriction patterns as an epidemiological marker in nosocomial outbreaks of Staphylococcus aureus infections.

PubMed

Meugnier, H; Fernandez, M P; Bes, M; Brun, Y; Bornstein, N; Freney, J; Fleurette, J

1993-01-01

rRNA gene restriction patterns (ribotyping) were compared with phage typing, serotyping, enterotoxins and exfoliatin production in the analysis of 26 Staphylococcus aureus strains isolated from two different nosocomial outbreaks. Total DNA was cleaved by EcoRI restriction endonuclease. After agarose gel electrophoresis and Southern transfer, the hybridization of the membranes was done with radiolabelled 16S rRNA gene from Bacillus subtilis inserted into a plasmid vector. Six to 13 fragments were visualized. A core of common fragments was discerned for all strains tested. A full correlation between ribotyping and conventional markers was observed in only one of the outbreaks studied. In both outbreaks, ribotyping proved helpful in characterizing otherwise untypable strains.

Determination of the structure and catalytic mechanism of Sorghum bicolor caffeic acid O-methyltransferase and the structural impact of three brown midrib12 mutations

USDA-ARS?s Scientific Manuscript database

With S-adenosylmethionine (SAM) acting as the methyl donor, caffeic acid O-methyltransferase from Sorghum bicolor (SbCOMT) methylates the 5-hydroxyl group of its preferred substrate, 5-hydroxyconiferaldehyde, to form sinapaldehyde. In order to determine the mechanism of SbCOMT and understand the red...

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the

Nucleosome Translational Position, Not Histone Acetylation, Determines TFIIIA Binding to Nucleosomal Xenopus laevis 5S rRNA Genes

PubMed Central

Howe, LeAnn; Ausió, Juan

1998-01-01

We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430

Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

NASA Technical Reports Server (NTRS)

Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

1992-01-01

A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

Asymmetric arginine dimethylation of heterogeneous nuclear ribonucleoprotein K by protein-arginine methyltransferase 1 inhibits its interaction with c-Src.

PubMed

Ostareck-Lederer, Antje; Ostareck, Dirk H; Rucknagel, Karl P; Schierhorn, Angelika; Moritz, Bodo; Huttelmaier, Stefan; Flach, Nadine; Handoko, Lusy; Wahle, Elmar

2006-04-21

Arginine methylation is a post-translational modification found in many RNA-binding proteins. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) from HeLa cells was shown, by mass spectrometry and Edman degradation, to contain asymmetric N(G),N(G)-dimethylarginine at five positions in its amino acid sequence (Arg256, Arg258, Arg268, Arg296, and Arg299). Whereas these five residues were quantitatively modified, Arg303 was asymmetrically dimethylated in <33% of hnRNP K and Arg287 was monomethylated in <10% of the protein. All other arginine residues were unmethylated. Protein-arginine methyltransferase 1 was identified as the only enzyme methylating hnRNP K in vitro and in vivo. An hnRNP K variant in which the five quantitatively modified arginine residues had been substituted was not methylated. Methylation of arginine residues by protein-arginine methyltransferase 1 did not influence the RNA-binding activity, the translation inhibitory function, or the cellular localization of hnRNP K but reduced the interaction of hnRNP K with the tyrosine kinase c-Src. This led to an inhibition of c-Src activation and hnRNP K phosphorylation. These findings support the role of arginine methylation in the regulation of protein-protein interactions.

Functional and Structural Characterization of a Cation-dependent O-Methyltransferase from the Cyanobacterium Synechocystis sp. Strain PCC 6803*S⃞

PubMed Central

Kopycki, Jakub Grzegorz; Stubbs, Milton T.; Brandt, Wolfgang; Hagemann, Martin; Porzel, Andrea; Schmidt, Jürgen; Schliemann, Willibald; Zenk, Meinhart H.; Vogt, Thomas

2008-01-01

The coding sequence of the cyanobacterium Synechocystis sp. strain PCC 6803 slr0095 gene was cloned and functionally expressed in Escherichia coli. The corresponding enzyme was classified as a cation- and S-adenosyl-l-methionine-dependent O-methyltransferase (SynOMT), consistent with considerable amino acid sequence identities to eukaryotic O-methyltransferases (OMTs). The substrate specificity of SynOMT was similar with those of plant and mammalian CCoAOMT-like proteins accepting a variety of hydroxycinnamic acids and flavonoids as substrates. In contrast to the known mammalian and plant enzymes, which exclusively methylate the meta-hydroxyl position of aromatic di- and trihydroxy systems, Syn-OMT also methylates the para-position of hydroxycinnamic acids like 5-hydroxyferulic and 3,4,5-trihydroxycinnamic acid, resulting in the formation of novel compounds. The x-ray structure of SynOMT indicates that the active site allows for two alternative orientations of the hydroxylated substrates in comparison to the active sites of animal and plant enzymes, consistent with the observed preferred para-methylation and position promiscuity. Lys3 close to the N terminus of the recombinant protein appears to play a key role in the activity of the enzyme. The possible implications of these results with respect to modifications of precursors of polymers like lignin are discussed. PMID:18502765

The conformational changes of Zika virus methyltransferase upon converting SAM to SAH.

PubMed

Zhou, Han; Wang, Fenghua; Wang, Haofeng; Chen, Cheng; Zhang, Tianqing; Han, Xu; Wang, Deping; Chen, Chen; Wu, Chen; Xie, Wei; Wang, Zefang; Zhang, Lei; Wang, Lanfeng; Yang, Haitao

2017-02-28

An outbreak of Zika virus (ZIKV) infection has been reported in South and Central America and the Caribbean. Neonatal microcephaly potentially associated with ZIKV infection has already caused a public health emergency of international concern. Currently, there are no clinically effective vaccines or antiviral drugs available to treat ZIKV infection. The methyltransferase domain (MTase) of ZIKV nonstructural protein 5 (NS5) can sequentially methylate guanine N-7 and ribose 2'-O to form m7NGpppA2'Om cap structure in the new RNA transcripts. This methylation step is crucial for ZIKV replication cycle and evading the host immune system, making it a target for drug design. Here, we present the 1.76 Å crystal structure of ZIKV MTase in complex with the byproduct SAH, providing insight into the elegant methylation process, which will benefit the following antiviral drug development.

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

Pain vulnerability and DNA methyltransferase 3a involved in the affective dimension of chronic pain

PubMed Central

Wang, Wei; Li, Caiyue; Cai, Youqing; Pan, Zhizhong Z

2017-01-01

Chronic pain with comorbid emotional disorders is a prevalent neurological disease in patients under various pathological conditions, yet patients show considerable difference in their vulnerability to developing chronic pain. Understanding the neurobiological basis underlying this pain vulnerability is essential to develop targeted therapies of higher efficiency in pain treatment of precision medicine. However, this pain vulnerability has not been addressed in preclinical pain research in animals to date. In this study, we investigated individual variance in both sensory and affective/emotional dimensions of pain behaviors in response to chronic neuropathic pain condition in a mouse model of chronic pain. We found that mice displayed considerably diverse sensitivities in the chronic pain-induced anxiety- and depression-like behaviors of affective pain. Importantly, the mouse group that was more vulnerable to developing anxiety was also more vulnerable to developing depressive behavior under the chronic pain condition. In contrast, there was relatively much less variance in individual responses in the sensory dimension of pain sensitization. Molecular analysis revealed that those mice vulnerable to developing the emotional disorders showed a significant reduction in the protein level of DNA methyltransferase 3a in the emotion-processing central nucleus of the amygdala. In addition, social stress also revealed significant individual variance in anxiety behavior in mice. These findings suggest that individual pain vulnerability may be inherent mostly in the emotional/affective component of chronic pain and remain consistent in different aspects of negative emotion, in which adaptive changes in the function of DNA methyltransferase 3a for DNA methylation in central amygdala may play an important role. This may open a new avenue of basic research into the neurobiological mechanisms underlying pain vulnerability. PMID:28849714

Inheritance of Adrenal Phenylethanolamine N-Methyltransferase Activity in the Rat

PubMed Central

Stolk, Jon M.; Vantini, Guido; Guchhait, Ras B.; Hurst, Jeffrey H.; Perry, Bruce D.; U'Prichard, David C.; Elston, Robert C.

1984-01-01

Phenylethanolamine N-methyltransferase (PNMT) is the enzyme that catalyzes the S-adenosyl-l-methionine-dependent methylation of (-)norepinephrine to (-)epinephrine in the adrenal medulla. Adrenal PNMT activity is markedly different in two highly inbred rat strains; enzyme activity in the F344 strain is more than fivefold greater than that in the Buf strain. Initial characterization of the enzyme in the two inbred strains reveals evidence for catalytic and structural differences, as reflected in dissimilar Km values for the cosubstrate (S-adenosyl-l-methionine) and prominent differences in thermal inactivation curves. To assess adrenal PNMT activity in an F344 x Buf pedigree, we employed a statistical procedure to test for one- and two-locus hypotheses in the presence of within-class correlations due to cage or litter effects. The PNMT data in the pedigree are best accounted for by segregation at a simple major locus superimposed upon a polygenic background; data obtained from the biochemical studies suggest that the major locus is a structural gene locus. PMID:6149973

Catalytic mechanism of human N-acetylserotonin methyltransferase: a theoretical investigation

NASA Astrophysics Data System (ADS)

Wang, Li; Zhang, Ting; Li, Jieqiong; He, Chaozheng; He, Hongqing; Zhang, Jinglai

2015-11-01

The methyl-transfer mechanism of human N-acetylserotonin methyltransferase and the roles of several residues around the active sites are investigated by density function theory method. This enzyme will catalyse the conversion of N-acetylserotonin and S-adenosyl-L-methionine (SAM) into melatonin and S-asenosylhomocysteine, which is the terminal step in the melatonin (N-acetyl-5-methoxytryptamine) biosynthesis. The calculated results confirm that the methyl transfer and proton transfer will take place via a SN2 step with a concerted mechanism, which is different from the experimental estimation via a water bridge. The residues H255, D256, E311, and R252 play an important role in reducing the barrier height and inducing methyl transfer. In addition, a full SAM molecule is considered in this work, which is never explored in previous reports. We find that some residues around the SAM in the centre of active site are essential factors to influence the mechanism and barrier height. So a truncated SAM model may not be suitable for all reactions.

Substrate Specificity of Human Protein Arginine Methyltransferase 7 (PRMT7)

PubMed Central

Feng, You; Hadjikyriacou, Andrea; Clarke, Steven G.

2014-01-01

Protein arginine methyltransferase 7 (PRMT7) methylates arginine residues on various protein substrates and is involved in DNA transcription, RNA splicing, DNA repair, cell differentiation, and metastasis. The substrate sequences it recognizes in vivo and the enzymatic mechanism behind it, however, remain to be explored. Here we characterize methylation catalyzed by a bacterially expressed GST-tagged human PRMT7 fusion protein with a broad range of peptide and protein substrates. After confirming its type III activity generating only ω-NG-monomethylarginine and its distinct substrate specificity for RXR motifs surrounded by basic residues, we performed site-directed mutagenesis studies on this enzyme, revealing that two acidic residues within the double E loop, Asp-147 and Glu-149, modulate the substrate preference. Furthermore, altering a single acidic residue, Glu-478, on the C-terminal domain to glutamine nearly abolished the activity of the enzyme. Additionally, we demonstrate that PRMT7 has unusual temperature dependence and salt tolerance. These results provide a biochemical foundation to understanding the broad biological functions of PRMT7 in health and disease. PMID:25294873

Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

PubMed

Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

2010-06-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

MethylViewer: computational analysis and editing for bisulfite sequencing and methyltransferase accessibility protocol for individual templates (MAPit) projects.

PubMed

Pardo, Carolina E; Carr, Ian M; Hoffman, Christopher J; Darst, Russell P; Markham, Alexander F; Bonthron, David T; Kladde, Michael P

2011-01-01

Bisulfite sequencing is a widely-used technique for examining cytosine DNA methylation at nucleotide resolution along single DNA strands. Probing with cytosine DNA methyltransferases followed by bisulfite sequencing (MAPit) is an effective technique for mapping protein-DNA interactions. Here, MAPit methylation footprinting with M.CviPI, a GC methyltransferase we previously cloned and characterized, was used to probe hMLH1 chromatin in HCT116 and RKO colorectal cancer cells. Because M.CviPI-probed samples contain both CG and GC methylation, we developed a versatile, visually-intuitive program, called MethylViewer, for evaluating the bisulfite sequencing results. Uniquely, MethylViewer can simultaneously query cytosine methylation status in bisulfite-converted sequences at as many as four different user-defined motifs, e.g. CG, GC, etc., including motifs with degenerate bases. Data can also be exported for statistical analysis and as publication-quality images. Analysis of hMLH1 MAPit data with MethylViewer showed that endogenous CG methylation and accessible GC sites were both mapped on single molecules at high resolution. Disruption of positioned nucleosomes on single molecules of the PHO5 promoter was detected in budding yeast using M.CviPII, increasing the number of enzymes available for probing protein-DNA interactions. MethylViewer provides an integrated solution for primer design and rapid, accurate and detailed analysis of bisulfite sequencing or MAPit datasets from virtually any biological or biochemical system.

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

Construction of plasmid, bacterial expression, purification, and assay of dengue virus type 2 NS5 methyltransferase.

PubMed

Boonyasuppayakorn, Siwaporn; Padmanabhan, Radhakrishnan

2014-01-01

Dengue virus (DENV), a member of mosquito-borne flavivirus, causes self-limiting dengue fever as well as life-threatening dengue hemorrhagic fever and dengue shock syndrome. Its positive sense RNA genome has a cap at the 5'-end and no poly(A) tail at the 3'-end. The viral RNA encodes a single polyprotein, C-prM-E-NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5. The polyprotein is processed into 3 structural proteins (C, prM, and E) and 7 nonstructural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5). NS3 and NS5 are multifunctional enzymes performing various tasks in viral life cycle. The N-terminal domain of NS5 has distinct GTP and S-adenosylmethionine (SAM) binding sites. The role of GTP binding site is implicated in guanylyltransferase (GTase) activity of NS5. The SAM binding site is involved in both N-7 and 2'-O-methyltransferase (MTase) activities involved in formation of type I cap. The C-terminal domain of NS5 catalyzes RNA-dependent RNA polymerase (RdRp) activity involved in RNA synthesis. We describe the construction of the MTase domain of NS5 in an E. coli expression vector, purification of the enzyme, and conditions for enzymatic assays of N7- and 2'O-methyltransferase activities that yield the final type I 5'-capped RNA ((7Me)GpppA2'OMe-RNA).

Label-Free Sensitive Detection of DNA Methyltransferase by Target-Induced Hyperbranched Amplification with Zero Background Signal.

PubMed

Zhang, Yan; Wang, Xin-Yan; Zhang, Qianyi; Zhang, Chun-Yang

2017-11-21

DNA methyltransferases (MTases) may specifically recognize the short palindromic sequences and transfer a methyl group from S-adenosyl-l-methionine to target cytosine/adenine. The aberrant DNA methylation is linked to the abnormal DNA MTase activity, and some DNA MTases have become promising targets of anticancer/antimicrobial drugs. However, the reported DNA MTase assays often involve laborious operation, expensive instruments, and radio-labeled substrates. Here, we develop a simple and label-free fluorescent method to sensitively detect DNA adenine methyltransferase (Dam) on the basis of terminal deoxynucleotidyl transferase (TdT)-activated Endonuclease IV (Endo IV)-assisted hyperbranched amplification. We design a hairpin probe with a palindromic sequence in the stem as the substrate and a NH 2 -modified 3' end for the prevention of nonspecific amplification. The substrate may be methylated by Dam and subsequently cleaved by DpnI, producing three single-stranded DNAs, two of which with 3'-OH termini may be amplified by hyperbranched amplification to generate a distinct fluorescence signal. Because high exactitude of TdT enables the amplification only in the presence of free 3'-OH termini and Endo IV only hydrolyzes the intact apurinic/apyrimidinic sites in double-stranded DNAs, zero background signal can be achieved. This method exhibits excellent selectivity and high sensitivity with a limit of detection of 0.003 U/mL for pure Dam and 9.61 × 10 -6 mg/mL for Dam in E. coli cells. Moreover, it can be used to screen the Dam inhibitors, holding great potentials in disease diagnosis and drug development.

Inactivation of SAM-methyltransferase is the mechanism of attenuation of a historic louse borne typhus vaccine strain.

PubMed

Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H; Yu, Xue-Jie

2014-01-01

Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine.

Quencher-free fluorescence strategy for detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification.

PubMed

Liu, Haisheng; Ma, Changbei; Zhou, Meijuan; Chen, Hanchun; He, Hailun; Wang, Kemin

2016-11-01

This work demonstrates a novel method for DNA methyltransferase (MTase) activity detection with a quencher-free molecular beacon (MB) probe based on exonuclease (Exo) III-assisted signal amplification. In the presence of Dam MTase and DpnI endonuclease, the elaborately designed hairpin substrate (MB1) was cleaved into two parts (part A and part B). Exo III can then digest part A and release a single-stranded target of the 2-aminopurine-labeled MB (MB2). Subsequently, the MB2 can hybridize with its target to form a double-stranded structure with a protruding 3'-terminus and then trigger the digestion of MB2 by Exo III. During the digestion of MB2, the 2-aminopurine is separated from the DNA strands and released free in solution, inducing an increase of the fluorescent signal. Owing to the presence of a recessed 3'-terminus in the formed double-stranded DNA, Exo III-assisted recyclable cleavage of MB2 was achieved. Therefore, an amplified fluorescence signal was observed. Under the optimized conditions, Dam MTase can be detected in the range of 0.2-40 units/mL with a limit of detection of 0.2 units/mL and good selectivity. Furthermore, the present assay can be used for screening potential DNA MTase inhibitors. Graphical Abstract A quencher-free fluorescence assay for sensitive detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification is reported.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

Cancer.gov

The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

PubMed

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

PubMed Central

Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

2012-01-01

We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

PubMed

Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

2018-05-01

Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

Alkaloids in plants and root cultures of Atropa belladonna overexpressing putrescine N-methyltransferase.

PubMed

Rothe, Grit; Hachiya, Akira; Yamada, Yasuyuki; Hashimoto, Takashi; Dräger, Birgit

2003-09-01

Putrescine N-methyltransferase (PMT) is the first alkaloid-specific enzyme for nicotine and tropane alkaloid formation. The pmt gene from Nicotiana tabacum was fused to the CaMV 35S promoter and integrated into the Atropa belladonna genome. Transgenic plants and derived root cultures were analysed for gene expression and for levels of alkaloids and their precursors. Scopolamine, hyoscyamine, tropine, pseudotropine, tropinone, and calystegines were found unaltered or somewhat decreased in pmt-overexpressing lines compared to controls. When root cultures were treated with 5% sucrose, calystegine levels were elevated in control roots, but were not affected in pmt-overexpressing roots. 1 microM auxin reduced calystegine levels in control roots, while in pmt-overexpressing roots all alkaloids remained unaltered. Expression level of pmt alone is apparently not limiting for tropane alkaloid formation in A. belladonna.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Purification and characterization of rice DNA methyltransferase.

PubMed

Teerawanichpan, Prapapan; Krittanai, Palika; Chauvatcharin, Nopmanee; Narangajavana, Jarunya

2009-08-01

Epigenetic modification is essential for normal development and plays important roles in gene regulation in higher plants. Multiple factors interact to regulate the establishment and maintenance of DNA methylation in plant genome. We had previously cloned and characterized DNA methyltransferase (DNA MTase) gene homologues (OsMET1) from rice. In this present study, determination of DNA MTase activity in different cellular compartments showed that DNA MTase was enriched in nuclei and the activity was remarkably increased during imbibing dry seeds. We had optimized the purification technique for DNA MTase enzyme from shoots of 10-day-old rice seedlings using the three successive chromatographic columns. The Econo-Pac Q, the Hitrap-Heparin and the Superdex-200 columns yielded a protein fraction of a specific activity of 29, 298 and 800 purification folds, compared to the original nuclear extract, respectively. The purified protein preferred hemi-methylated DNA substrate, suggesting the maintenance activity of methylation. The native rice DNA MTase was approximately 160-170 kDa and exhibited a broad pH optimum in the range of 7.6 and 8.0. The enzyme kinetics and inhibitory effects by methyl donor analogs, base analogs, cations, and cationic amines on rice DNA MTase were examined. Global cytosine methylation status of rice genome during development and in various tissue culture systems were monitored and the results suggested that the cytosine methylation level is not directly correlated with the DNA MTase activity. The purification and characterization of rice DNA MTase enzyme are expected to enhance our understanding of this enzyme function and their possible contributions in Gramineae plant development.

Characterization of Sinorhizobium sp. LM21 Prophages and Virus-Encoded DNA Methyltransferases in the Light of Comparative Genomic Analyses of the Sinorhizobial Virome

PubMed Central

Decewicz, Przemyslaw; Radlinska, Monika; Dziewit, Lukasz

2017-01-01

The genus Sinorhizobium/Ensifer mostly groups nitrogen-fixing bacteria that create root or stem nodules on leguminous plants and transform atmospheric nitrogen into ammonia, which improves the productivity of the plants. Although these biotechnologically-important bacteria are commonly found in various soil environments, little is known about their phages. In this study, the genome of Sinorhizobium sp. LM21 isolated from a heavy-metal-contaminated copper mine in Poland was investigated for the presence of prophages and DNA methyltransferase-encoding genes. In addition to the previously identified temperate phage, ΦLM21, and the phage-plasmid, pLM21S1, the analysis revealed the presence of three prophage regions. Moreover, four novel phage-encoded DNA methyltransferase (MTase) genes were identified and the enzymes were characterized. It was shown that two of the identified viral MTases methylated the same target sequence (GANTC) as cell cycle-regulated methyltransferase (CcrM) of the bacterial host strain, LM21. This discovery was recognized as an example of the evolutionary convergence between enzymes of sinorhizobial viruses and their host, which may play an important role in virus cycle. In the last part of the study, thorough comparative analyses of 31 sinorhizobial (pro)phages (including active sinorhizobial phages and novel putative prophages retrieved and manually re-annotated from Sinorhizobium spp. genomes) were performed. The networking analysis revealed the presence of highly conserved proteins (e.g., holins and endolysins) and a high diversity of viral integrases. The analysis also revealed a large number of viral DNA MTases, whose genes were frequently located within the predicted replication modules of analyzed prophages, which may suggest their important regulatory role. Summarizing, complex analysis of the phage protein similarity network enabled a new insight into overall sinorhizobial virome diversity. PMID:28672885

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

PubMed Central

Tadmor, Arbel D.; Tlusty, Tsvi

2008-01-01

We propose a biophysical model of Escherichia coli that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity. PMID:18437222

Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

H Dong; L Liu; G Zou

2011-12-31

The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2'-O positions of the viral RNA cap (GpppA-RNA {yields} m(7)GpppA-RNA {yields} m(7)GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-{angstrom} resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus,more » SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase.« less

Caught in the act: visualization of an intermediate in the DNA base-flipping pathway induced by HhaI methyltransferase | Center for Cancer Research

Cancer.gov

HHAI methyltransferase (blue ribbon) bound to oligonucleotide (strands with bonds colored yellow and green) containing a pseudorotationally constrained sugar analogue at the target position (orange bonds with cyan atoms). The south-constrained pseudosugar is rotated about its flanking phosphodiester bonds, 90° from its initial position in B-form DNA, but short of a completely

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Theileria sp. Infections Associated with Bovine Fatalities in the United States Confirmed by Small-Subunit rRNA Gene Analyses of Blood and Tick Samples

PubMed Central

Chae, Joon-seok; Levy, Michael; Hunt, John; Schlater, Jack; Snider, Glen; Waghela, Suryakant D.; Holman, Patricia J.; Wagner, G. Gale

1999-01-01

Theileria sp.-specific small subunit (SSU) rRNA gene amplification confirmed the presence of the organism in cattle and in Amblyomma americanum and Dermacentor variabilis ticks collected from a cattle herd in Missouri. Blood from the index animal had type A and type D Theileria SSU rRNA genes. The type D gene was also found in blood from two cohort cattle and tick tissues. The type A SSU rRNA gene was previously reported from bovine Theileria isolates from Texas and North Carolina; the type D gene was reported from a Texas cow with theileriosis. PMID:10449501

The fish pathogen Yersinia ruckeri produces holomycin and uses an RNA methyltransferase for self-resistance.

PubMed

Qin, Zhiwei; Baker, Alexander Thomas; Raab, Andrea; Huang, Sheng; Wang, Tiehui; Yu, Yi; Jaspars, Marcel; Secombes, Christopher J; Deng, Hai

2013-05-24

Holomycin and its derivatives belong to a class of broad-spectrum antibacterial natural products containing a rare dithiolopyrrolone heterobicyclic scaffold. The antibacterial mechanism of dithiolopyrrolone compounds has been attributed to the inhibition of bacterial RNA polymerase activities, although the exact mode of action has not been established in vitro. Some dithiopyrrolone derivatives display potent anticancer activities. Recently the biosynthetic gene cluster of holomycin has been identified and characterized in Streptomyces clavuligerus. Here we report that the fish pathogen Yersinia ruckeri is a holomycin producer, as evidenced through genome mining, chemical isolation, and structural elucidation as well as genetic manipulation. We also identified a unique regulatory gene hom15 at one end of the gene cluster encoding a cold-shock-like protein that likely regulates the production of holomycin in low cultivation temperatures. Inactivation of hom15 resulted in a significant loss of holomycin production. Finally, gene disruption of an RNA methyltransferase gene hom12 resulted in the sensitivity of the mutant toward holomycin. A complementation experiment of hom12 restored the resistance against holomycin. Although the wild-type Escherichia coli BL21(DE3) Gold is susceptible to holomycin, the mutant harboring hom12 showed tolerance toward holomycin. High resolution liquid chromatography (LC)-ESI/MS analysis of digested RNA fragments demonstrated that the wild-type Y. ruckeri and E. coli harboring hom12 contain a methylated RNA fragment, whereas the mutated Y. ruckeri and the wild-type E. coli only contain normal non-methylated RNA fragments. Taken together, our results strongly suggest that this putative RNA methyltransferase Hom12 is the self-resistance protein that methylates the RNA of Y. ruckeri to reduce the cytotoxic effect of holomycin during holomycin production.

High expression of DNA methyltransferases in primary human medulloblastoma.

PubMed

Pócza, T; Krenács, T; Turányi, E; Csáthy, J; Jakab, Z; Hauser, P

2016-01-01

Epigenetic alterations have been implicated in cancer development. DNA methylation modulates gene expression, which is catalyzed by DNA methyltransferases (DNMTs). The objective of our study was to evaluate expression of DNMTs in medulloblastoma and analyze its correlation with clinical features. Nuclear expression of DNMT1, DNMT3A and DNMT3B was analyzed in human primary medulloblastoma of 44 patients using immunohistochemistry. Correlation of expression of DNMT levels with classical histological subtypes, novel molecular subgroups and survival of patients was analyzed. Elevated expression of DNMT1, DNMT3A and DNMT3B was observed in 63.64%, 68.18% and 72.73% of all cases, respectively. None of them showed a correlation with classical histology or survival. Concerning molecular subtypes, significantly higher expression of DNMT1 was observed in the SHH group compared to non-SHH samples (p = 0.02), but without significant difference in DNMT3A or DNMT3B levels between any subtypes. In conclusion, DNMT1, DNMT3A and DNMT3B are highly expressed in human medulloblastoma samples, suggesting that promoter hypermethylation may play a role in medulloblastoma development. Demethylation of tumor suppressor gene promoters may be considered as a possible future target in therapy of medulloblastoma.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

The Histone H3 Lysine 9 Methyltransferase DIM-5 Modifies Chromatin at frequency and Represses Light-Activated Gene Expression

PubMed Central

Ruesch, Catherine E.; Ramakrishnan, Mukund; Park, Jinhee; Li, Na; Chong, Hin S.; Zaman, Riasat; Joska, Tammy M.; Belden, William J.

2014-01-01

The transcriptional program controlling the circadian rhythm requires coordinated regulation of chromatin. Characterization of the chromodomain helicase DNA-binding enzyme CHD1 revealed DNA methylation in the promoter of the central clock gene frequency (frq) in Neurospora crassa. In this report, we show that the DNA methylation at frq is not only dependent on the DNA methyltransferase DIM-2 but also on the H3K9 methyltransferase DIM-5 and HP1. Histone H3 lysine 9 trimethylation (H3K9me3) occurs at frq and is most prominent 30 min after light-activated expression. Strains lacking dim-5 have an increase in light-induced transcription, and more White Collar-2 is found associated with the frq promoter. Consistent with the notion that DNA methylation assists in establishing the proper circadian phase, loss of H3K9 methylation results in a phase advance suggesting it delays the onset of frq expression. The dim-5 deletion strain displays an increase in circadian-regulated conidia formation on race tubes and there is a synthetic genetic interaction between dim-5 and ras-1bd. These results indicate DIM-5 has a regulatory role in muting circadian output. Overall, the data support a model where facultative heterochromatic at frq serves to establish the appropriate phase, mute the light response, and repress circadian output. PMID:25429045

The histone H3 lysine 9 methyltransferase DIM-5 modifies chromatin at frequency and represses light-activated gene expression.

PubMed

Ruesch, Catherine E; Ramakrishnan, Mukund; Park, Jinhee; Li, Na; Chong, Hin S; Zaman, Riasat; Joska, Tammy M; Belden, William J

2014-11-25

The transcriptional program controlling the circadian rhythm requires coordinated regulation of chromatin. Characterization of the chromodomain helicase DNA-binding enzyme CHD1 revealed DNA methylation in the promoter of the central clock gene frequency (frq) in Neurospora crassa. In this report, we show that the DNA methylation at frq is not only dependent on the DNA methyltransferase DIM-2 but also on the H3K9 methyltransferase DIM-5 and HP1. Histone H3 lysine 9 trimethylation (H3K9me3) occurs at frq and is most prominent 30 min after light-activated expression. Strains lacking dim-5 have an increase in light-induced transcription, and more White Collar-2 is found associated with the frq promoter. Consistent with the notion that DNA methylation assists in establishing the proper circadian phase, loss of H3K9 methylation results in a phase advance suggesting it delays the onset of frq expression. The dim-5 deletion strain displays an increase in circadian-regulated conidia formation on race tubes and there is a synthetic genetic interaction between dim-5 and ras-1(bd). These results indicate DIM-5 has a regulatory role in muting circadian output. Overall, the data support a model where facultative heterochromatic at frq serves to establish the appropriate phase, mute the light response, and repress circadian output. Copyright © 2015 Ruesch et al.

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

NASA Technical Reports Server (NTRS)

Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

1989-01-01

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

Genotypic variation of Pneumocystis jirovecii isolates in India based on sequence diversity at mitochondrial large subunit rRNA.

PubMed

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla; Iyer, Venkateswaran K

2011-03-01

Pneumocystis pneumonia (PCP), a common and serious opportunistic infection in immunocompromised patients, is caused by Pneumocystis jirovecii (formerly known as Pneumocystis carinii f. sp. hominis). The aim of the present study was to describe the prevalence and distribution of genotypes of P. jirovecii based on sequence polymorphisms at mitochondrial large subunit ribosomal RNA (mt LSU rRNA) region in both HIV and non-HIV immunocompromised individuals with a positive PCR result for PCP in a tertiary health care centre in northern India. From January 2005 to October 2008, 50 patients [22 HIV-seropositive individuals, 10 post-renal transplant (PRT) recipients, 3 cancer patients, and 15 patients with various other kinds of immunosuppression] were found to be positive for P. jirovecii using PCR at the mt LSU rRNA gene. Genotyping of the positive samples was performed at the mt LSU rRNA locus. Genotype 2 was the most common accounting for 42% of total types. This was followed by the genotypes 3 (24%), 1 (20%), and 4 (8%). Mixed infection was observed in 3 cases (6%). The rates of genotype distribution were similar in HIV-seropositive individuals, cancer patients, and in patients with other kinds of immunosuppression. In the PRT recipients, genotype 1 was the most prevalent type (80%). This is the first study describing the prevalence of genotypes in HIV-infected and HIV-uninfected, immunocompromised patients based on the mt LSU rRNA gene from the Indian subcontinent. The most prevalent genotype observed was type 2 in contrast to many studies from other parts of the world where genotype 1 was the most prevalent type, suggesting geographical variation. Copyright © 2010 Elsevier GmbH. All rights reserved.

Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

PubMed

Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

2015-09-01

Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

Associations between arsenic (+3 oxidation state) methyltransferase (AS3MT) and N-6 adenine-specific DNA methyltransferase 1 (N6AMT1) polymorphisms, arsenic metabolism, and cancer risk in a chilean population.

PubMed

de la Rosa, Rosemarie; Steinmaus, Craig; Akers, Nicholas K; Conde, Lucia; Ferreccio, Catterina; Kalman, David; Zhang, Kevin R; Skibola, Christine F; Smith, Allan H; Zhang, Luoping; Smith, Martyn T

2017-07-01

Inter-individual differences in arsenic metabolism have been linked to arsenic-related disease risks. Arsenic (+3) methyltransferase (AS3MT) is the primary enzyme involved in arsenic metabolism, and we previously demonstrated in vitro that N-6 adenine-specific DNA methyltransferase 1 (N6AMT1) also methylates the toxic inorganic arsenic (iAs) metabolite, monomethylarsonous acid (MMA), to the less toxic dimethylarsonic acid (DMA). Here, we evaluated whether AS3MT and N6AMT1 gene polymorphisms alter arsenic methylation and impact iAs-related cancer risks. We assessed AS3MT and N6AMT1 polymorphisms and urinary arsenic metabolites (%iAs, %MMA, %DMA) in 722 subjects from an arsenic-cancer case-control study in a uniquely exposed area in northern Chile. Polymorphisms were genotyped using a custom designed multiplex, ligation-dependent probe amplification (MLPA) assay for 6 AS3MT SNPs and 14 tag SNPs in the N6AMT1 gene. We found several AS3MT polymorphisms associated with both urinary arsenic metabolite profiles and cancer risk. For example, compared to wildtypes, individuals carrying minor alleles in AS3MT rs3740393 had lower %MMA (mean difference = -1.9%, 95% CI: -3.3, -0.4), higher %DMA (mean difference = 4.0%, 95% CI: 1.5, 6.5), and lower odds ratios for bladder (OR = 0.3; 95% CI: 0.1-0.6) and lung cancer (OR = 0.6; 95% CI: 0.2-1.1). Evidence of interaction was also observed for both lung and bladder cancer between these polymorphisms and elevated historical arsenic exposures. Clear associations were not seen for N6AMT1. These results are the first to demonstrate a direct association between AS3MT polymorphisms and arsenic-related internal cancer risk. This research could help identify subpopulations that are particularly vulnerable to arsenic-related disease. Environ. Mol. Mutagen. 58:411-422, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Inhibition of DNA methyltransferases regulates cocaine self-administration by rats: a genome-wide DNA methylation study.

PubMed

Fonteneau, M; Filliol, D; Anglard, P; Befort, K; Romieu, P; Zwiller, J

2017-03-01

DNA methylation is a major epigenetic process which regulates the accessibility of genes to the transcriptional machinery. In the present study, we investigated whether modifying the global DNA methylation pattern in the brain would alter cocaine intake by rats, using the cocaine self-administration test. The data indicate that treatment of rats with the DNA methyltransferase inhibitors 5-aza-2'-deoxycytidine (dAZA) and zebularine enhanced the reinforcing properties of cocaine. To obtain some insights about the underlying neurobiological mechanisms, a genome-wide methylation analysis was undertaken in the prefrontal cortex of rats self-administering cocaine and treated with or without dAZA. The study identified nearly 189 000 differentially methylated regions (DMRs), about half of them were located inside gene bodies, while only 9% of DMRs were found in the promoter regions of genes. About 99% of methylation changes occurred outside CpG islands. Gene expression studies confirmed the inverse correlation usually observed between increased methylation and transcriptional activation when methylation occurs in the gene promoter. This inverse correlation was not observed when methylation took place inside gene bodies. Using the literature-based Ingenuity Pathway Analysis, we explored how the differentially methylated genes were related. The analysis showed that increase in cocaine intake by rats in response to DNA methyltransferase inhibitors underlies plasticity mechanisms which mainly concern axonal growth and synaptogenesis as well as spine remodeling. Together with the Akt/PI3K pathway, the Rho-GTPase family was found to be involved in the plasticity underlying the effect of dAZA on the observed behavioral changes. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Inactivation of SAM-Methyltransferase is the Mechanism of Attenuation of a Historic Louse Borne Typhus Vaccine Strain

PubMed Central

Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H.; Yu, Xue-jie

2014-01-01

Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine. PMID:25412248

How Large Should the QM Region Be in QM/MM Calculations? The Case of Catechol O -Methyltransferase

DOE PAGES

Kulik, Heather J.; Zhang, Jianyu; Klinman, Judith P.; ...

2016-10-05

Hybrid quantum mechanical–molecular mechanical (QM/MM) simulations are widely used in studies of enzymatic catalysis. Until recently, it has been cost prohibitive to determine the asymptotic limit of key energetic and structural properties with respect to increasingly large QM regions. Here, leveraging recent advances in electronic structure efficiency and accuracy, we investigate catalytic properties in catechol O-methyltransferase, a prototypical methyltransferase critical to human health. Using QM regions ranging in size from reactants-only (64 atoms) to nearly one-third of the entire protein (940 atoms), we show that properties such as the activation energy approach within chemical accuracy of the large-QM asymptotic limitsmore » rather slowly, requiring approximately 500–600 atoms if the QM residues are chosen simply by distance from the substrate. This slow approach to asymptotic limit is due to charge transfer from protein residues to the reacting substrates. Our large QM/MM calculations enable identification of charge separation for fragments in the transition state as a key component of enzymatic methyl transfer rate enhancement. We introduce charge shift analysis that reveals the minimum number of protein residues (approximately 11–16 residues or 200–300 atoms for COMT) needed for quantitative agreement with large-QM simulations. The identified residues are not those that would be typically selected using criteria such as chemical intuition or proximity. These results provide a recipe for a more careful determination of QM region sizes in future QM/MM studies of enzymes.« less

A Set of Regioselective O-Methyltransferases Gives Rise to the Complex Pattern of Methoxylated Flavones in Sweet Basil1[C][W][OA

PubMed Central

Berim, Anna; Hyatt, David C.; Gang, David R.

2012-01-01

Polymethoxylated flavonoids occur in a number of plant families, including the Lamiaceae. To date, the metabolic pathways giving rise to the diversity of these compounds have not been studied. Analysis of our expressed sequence tag database for four sweet basil (Ocimum basilicum) lines afforded identification of candidate flavonoid O-methyltransferase genes. Recombinant proteins displayed distinct substrate preferences and product specificities that can account for all detected 7-/6-/4′-methylated, 8-unsubstituted flavones. Their biochemical specialization revealed only certain metabolic routes to be highly favorable and therefore likely in vivo. Flavonoid O-methyltransferases catalyzing 4′- and 6-O-methylations shared high identity (approximately 90%), indicating that subtle sequence changes led to functional differentiation. Structure homology modeling suggested the involvement of several amino acid residues in defining the proteins’ stringent regioselectivities. The roles of these individual residues were confirmed by site-directed mutagenesis, revealing two discrete mechanisms as a basis for the switch between 6- and 4′-O-methylation of two different substrates. These findings delineate major pathways in a large segment of the flavone metabolic network and provide a foundation for its further elucidation. PMID:22923679

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

PubMed

Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

2013-08-01

Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

PubMed

Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

2013-03-01

Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

Catechol-O-methyltransferase (COMT) gene modulates private self-consciousness and self-flexibility.

PubMed

Wang, Bei; Ru, Wenzhao; Yang, Xing; Yang, Lu; Fang, Pengpeng; Zhu, Xu; Shen, Guomin; Gao, Xiaocai; Gong, Pingyuan

2016-08-01

Dopamine levels in the brain influence human consciousness. Inspired by the role of Catechol-O-methyltransferase (COMT) in inactivating dopamine in the brain, we investigated to what extent COMT could modulate individual's self-consciousness dispositions and self-consistency by genotyping the COMT Val158Met (rs4680) polymorphism and measuring self-consciousness and self-consistency and congruence in a college student population. The results indicated that COMT Val158Met polymorphism significantly modulated the private self-consciousness. The individuals with Val/Val genotype, corresponding to lower dopamine levels in the brain, were more likely to be aware of their feelings and beliefs. The results also indicated that this polymorphism modulated one's self-flexibility. The individuals with Val/Val genotype showed higher levels of stereotype in self-concept compared with those with Met/Met genotype. These findings suggest that COMT is a predictor of the individual differences in self-consciousness and self-flexibility. Copyright © 2016 Elsevier Inc. All rights reserved.

Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

PubMed

Burlibașa, Liliana; Suciu, Ilinca

2015-12-01

Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

Global loss of Leucine Carboxyl Methyltransferase-1 causes severe defects in fetal liver hematopoiesis.

PubMed

Lee, Jocelyn A; Wang, Zhengqi; Sambo, Danielle; Bunting, Kevin D; Pallas, David C

2018-05-07

Leucine Carboxyl Methyltransferase-1 (LCMT-1) 3 methylates the carboxy-terminal leucine α-carboxyl group of the catalytic subunits of the protein phosphatase 2A (PP2A) subfamily of protein phosphatases, PP2Ac, PP4c, and PP6c. LCMT-1 differentially regulates the formation and function of a subset of the heterotrimeric complexes that PP2A and PP4 form with their regulatory subunits. Global LCMT-1 knockout causes embryonic lethality in mice, but LCMT-1 function in development is unknown. In the current study, we analyzed the effects of global LCMT-1 loss on embryonic development. LCMT-1 knockout causes loss of PP2Ac methylation, indicating that LCMT-1 is the sole PP2Ac methyltransferase. PP2A heterotrimers containing the Bα and Bδ B-type subunits are dramatically reduced in whole embryos, and the steady-state levels of PP2Ac and the PP2A structural A subunit are also down ~30%. Strikingly, global loss of LCMT-1 causes severe defects in fetal hematopoiesis and death by embryonic day 16.5 (E16.5). Fetal livers of homozygous lcmt-1 knockout embryos display hypocellularity, elevated apoptosis, and greatly reduced numbers of hematopoietic stem and progenitor cell-enriched Kit + Lin - Sca1 + (KLS) cells. The percent cycling cells and mitotic indexes of wild-type and lcmt-1 knockout fetal liver cells are similar, suggesting that hypocellularity may be due to a combination of apoptosis and/or defects in specification, self-renewal, or survival of stem cells. Indicative of a possible intrinsic defect in stem cells, non-competitive and competitive transplantation experiments reveal that lcmt-1 loss causes a severe multi-lineage hematopoietic repopulating defect. Therefore, this study reveals a novel role for LCMT-1 as a key player in fetal liver hematopoiesis. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

DNA methyltransferase3a expression is an independent poor prognostic indicator in gastric cancer

PubMed Central

Cao, Xue-Yuan; Ma, Hong-Xi; Shang, Yan-Hong; Jin, Mei-Shan; Kong, Fei; Jia, Zhi-Fang; Cao, Dong-Hui; Wang, Yin-Ping; Suo, Jian; Jiang, Jing

2014-01-01

AIM: To explore the alteration of DNA methyltransferase expression in gastric cancer and to assess its prognostic value. METHODS: From April 2000 to December 2010, 227 men and 73 women with gastric cancer were enrolled in the study. The expression of DNA methyltransferases (DNMTs), including DNMT1, DNMT3a and DNMT3b, in the 300 cases of gastric carcinoma, of which 85 had paired adjacent normal gastric mucus samples, was evaluated by immunohistochemistry using a tissue microarray. Serum anti-Helicobacter pylori (H. pylori) IgG was detected by enzyme-linked immunosorbent assay (ELISA). The relationships between the above results and the clinicopathological characteristics were analyzed. Their prognostic value was evaluated using the Cox proportional hazards model. RESULTS: In gastric cancer, expression of DNMTs was mainly seen in the nucleus. Weak staining was also observed in the cytoplasm. Expression of DNMT1, DNMT3a and DNMT3b in gastric cancer was significantly higher compared to that in the paired control samples (60.0% vs 37.6%, 61.2% vs 4.7%, and 94.1% vs 71.8%, P < 0.01). The overall survival rate was significantly higher in the DNMT3a negative group than in the DNMT3a positive group in gastric cancer patients (Log-rank test, P = 0.032). No significant correlation was observed between DNMT1 and DNMT3b expression and the overall survival time (Log-rank test, P = 0.289, P = 0.347). Multivariate regression analysis indicated that DNMT3a expression (P = 0.025) and TNM stage (P < 0.001), but not DNMT1 (P = 0.54) or DNMT3b (P = 0.62), were independent prognostic factors in gastric cancer. H. pylori infection did not induce protein expression of DNMTs. CONCLUSION: The results suggest that expression of DNMT3a is an independent poor prognostic indicator in gastric cancer. DNMT3a might play an important role in gastric carcinogenesis. PMID:25009393

The arginine methyltransferase Rmt2 is enriched in the nucleus and co-purifies with the nuclear porins Nup49, Nup57 and Nup100

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olsson, Ida; Berrez, Jean-Marc; Leipus, Arunas

2007-05-15

Arginine methylation is a post-translational modification of proteins implicated in RNA processing, protein compartmentalization, signal transduction, transcriptional regulation and DNA repair. In a screen for proteins associated with the nuclear envelope in the yeast Saccharomyces cerevisiae, we have identified the arginine methyltransferase Rmt2, previously shown to methylate the ribosomal protein L12. By indirect immunofluorescence and subcellular fractionations we demonstrate here that Rmt2 has nuclear and cytoplasmic localizations. Biochemical analysis of a fraction enriched in nuclei reveals that nuclear Rmt2 is resistant to extractions with salt and detergent, indicating an association with structural components. This was supported by affinity purification experimentsmore » with TAP-tagged Rmt2. Rmt2 was found to co-purify with the nucleoporins Nup49, Nup57 and Nup100, revealing a novel link between arginine methyltransferases and the nuclear pore complex. In addition, a genome-wide transcription study of the rmt2{delta} mutant shows significant downregulation of the transcription of MYO1, encoding the Type II myosin heavy chain required for cytokinesis and cell separation.« less

SHPRH regulates rRNA transcription by recognizing the histone code in an mTOR-dependent manner.

PubMed

Lee, Deokjae; An, Jungeun; Park, Young-Un; Liaw, Hungjiun; Woodgate, Roger; Park, Jun Hong; Myung, Kyungjae

2017-04-25

Many DNA repair proteins have additional functions other than their roles in DNA repair. In addition to catalyzing PCNA polyubiquitylation in response to the stalling of DNA replication, SHPRH has the additional function of facilitating rRNA transcription by localizing to the ribosomal DNA (rDNA) promoter in the nucleoli. SHPRH was recruited to the rDNA promoter using its plant homeodomain (PHD), which interacts with histone H3 when the fourth lysine of H3 is not trimethylated. SHPRH enrichment at the rDNA promoter was inhibited by cell starvation, by treatment with actinomycin D or rapamycin, or by depletion of CHD4. SHPRH also physically interacted with the RNA polymerase I complex. Taken together, we provide evidence that SHPRH functions in rRNA transcription through its interaction with histone H3 in a mammalian target of rapamycin (mTOR)-dependent manner.

Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

PubMed

Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

2016-01-01

Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Structural insight into arginine methylation by the mouse protein arginine methyltransferase 7: a zinc finger freezes the mimic of the dimeric state into a single active site.

PubMed

Cura, Vincent; Troffer-Charlier, Nathalie; Wurtz, Jean Marie; Bonnefond, Luc; Cavarelli, Jean

2014-09-01

Protein arginine methyltransferase 7 (PRMT7) is a type III arginine methyltransferase which has been implicated in several biological processes such as transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation and metastasis. PRMT7 is a unique but less characterized member of the family of PRMTs. The crystal structure of full-length PRMT7 from Mus musculus refined at 1.7 Å resolution is described. The PRMT7 structure is composed of two catalytic modules in tandem forming a pseudo-dimer and contains only one AdoHcy molecule bound to the N-terminal module. The high-resolution crystal structure presented here revealed several structural features showing that the second active site is frozen in an inactive state by a conserved zinc finger located at the junction between the two PRMT modules and by the collapse of two degenerated AdoMet-binding loops.

Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

2010-01-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

Caulobacter crescentus Cell Cycle-Regulated DNA Methyltransferase Uses a Novel Mechanism for Substrate Recognition.

PubMed

Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O

2017-08-01

Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.

Congenital thiopurine methyltransferase deficiency and 6-mercaptopurine toxicity during treatment for acute lymphoblastic leukaemia.

PubMed Central

Lennard, L; Gibson, B E; Nicole, T; Lilleyman, J S

1993-01-01

Two children with acute lymphoblastic leukaemia (ALL) taking daily 6-mercaptopurine as part of a national UK therapeutic trial repeatedly developed profound myelosuppression on 25% of the standard protocol dose. Both were found to have undetectable intracellular activity of thiopurine methyltransferase (TPMT), an enzyme controlling one of the major alternative catabolic pathways of 6-mercaptopurine, and both produced higher concentrations of cytotoxic drug metabolites at 10-25% of the protocol dose than other patients taking 100%. It is supposed that these patients represent the 0.33% of the normal population constitutionally lacking TPMT. It is important to recognise such individuals both to avoid fatal bone marrow failure through inadvertent overdosage, and to be reassured that an adequate drug effect can be achieved at around 10% of the standard dose. PMID:8257179

Protein arginine methyltransferase 7 has a novel homodimer-like structure formed by tandem repeats.

PubMed

Hasegawa, Morio; Toma-Fukai, Sachiko; Kim, Jun-Dal; Fukamizu, Akiyoshi; Shimizu, Toshiyuki

2014-05-21

Protein arginine methyltransferase 7 (PRMT7) is a member of a family of enzymes that catalyze the transfer of methyl groups from S-adenosyl-l-methionine to nitrogen atoms on arginine residues. Here, we describe the crystal structure of Caenorhabditis elegans PRMT7 in complex with its reaction product S-adenosyl-L-homocysteine. The structural data indicated that PRMT7 harbors two tandem repeated PRMT core domains that form a novel homodimer-like structure. S-adenosyl-L-homocysteine bound to the N-terminal catalytic site only; the C-terminal catalytic site is occupied by a loop that inhibits cofactor binding. Mutagenesis demonstrated that only the N-terminal catalytic site of PRMT7 is responsible for cofactor binding. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

PubMed

Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

2015-01-15

It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. Copyright © 2014 Elsevier Inc. All rights reserved.

Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana▿

PubMed Central

Lange, Heike; Holec, Sarah; Cognat, Valérie; Pieuchot, Laurent; Le Ret, Monique; Canaday, Jean; Gagliardi, Dominique

2008-01-01

Yeast Rrp6p and its human counterpart, PM/Scl100, are exosome-associated proteins involved in the degradation of aberrant transcripts and processing of precursors to stable RNAs, such as the 5.8S rRNA, snRNAs, and snoRNAs. The activity of yeast Rrp6p is stimulated by the polyadenylation of its RNA substrates. We identified three RRP6-like proteins in Arabidopsis thaliana: AtRRP6L3 is restricted to the cytoplasm, whereas AtRRP6L1 and -2 have different intranuclear localizations. Both nuclear RRP6L proteins are functional, since AtRRP6L1 complements the temperature-sensitive phenotype of a yeast rrp6Δ strain and mutation of AtRRP6L2 leads to accumulation of an rRNA maturation by-product. This by-product corresponds to the excised 5′ part of the 18S-5.8S-25S rRNA precursor and accumulates as a polyadenylated transcript, suggesting that RRP6L2 is involved in poly(A)-mediated RNA degradation in plant nuclei. Interestingly, the rRNA maturation by-product is a substrate of AtRRP6L2 but not of AtRRP6L1. This result and the distinctive subcellular distribution of AtRRP6L1 to -3 indicate a specialization of RRP6-like proteins in Arabidopsis. PMID:18285452

Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

PubMed Central

Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

2014-01-01

Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

Mouse arsenic (+3 oxidation state) methyltransferase genotype affects metabolism and tissue dosimetry of arsenicals after arsenite administration in drinking water.

PubMed

Chen, Baowei; Arnold, Lora L; Cohen, Samuel M; Thomas, David J; Le, X Chris

2011-12-01

Arsenic (+3 oxidation state) methyltransferase (As3mt) catalyzes methylation of inorganic arsenic (iAs) producing a number of methylated arsenic metabolites. Although methylation has been commonly considered a pathway for detoxification of arsenic, some highly reactive methylated arsenicals may contribute to toxicity associated with exposure to inorganic arsenic. Here, adult female wild-type (WT) C57BL/6 mice and female As3mt knockout (KO) mice received drinking water that contained 1, 10, or 25 ppm (mg/l) of arsenite for 33 days and blood, liver, kidney, and lung were taken for arsenic speciation. Genotype markedly affected concentrations of arsenicals in tissues. Summed concentrations of arsenicals in plasma were higher in WT than in KO mice; in red blood cells, summed concentrations of arsenicals were higher in KO than in WT mice. In liver, kidney, and lung, summed concentrations of arsenicals were greater in KO than in WT mice. Although capacity for arsenic methylation is much reduced in KO mice, some mono-, di-, and tri-methylated arsenicals were found in tissues of KO mice, likely reflecting the activity of other tissue methyltransferases or preabsorptive metabolism by the microbiota of the gastrointestinal tract. These results show that the genotype for arsenic methylation determines the phenotypes of arsenic retention and distribution and affects the dose- and organ-dependent toxicity associated with exposure to inorganic arsenic.

Mutations in Mll2, an H3K4 Methyltransferase, Result in Insulin Resistance and Impaired Glucose Tolerance in Mice

PubMed Central

Schröter, David; Matthews, Helen C.; Bogani, Debora; Moir, Lee; Long, Anna; Church, Christopher; Hugill, Alison; Anstee, Quentin M.; Goldin, Rob; Thursz, Mark; Hollfelder, Florian; Cox, Roger D.

2013-01-01

We employed a random mutagenesis approach to identify novel monogenic determinants of type 2 diabetes. Here we show that haplo-insufficiency of the histone methyltransferase myeloid-lineage leukemia (Mll2/Wbp7) gene causes type 2 diabetes in the mouse. We have shown that mice heterozygous for two separate mutations in the SET domain of Mll2 or heterozygous Mll2 knockout mice were hyperglycaemic, hyperinsulinaemic and developed non-alcoholic fatty liver disease. Consistent with previous Mll2 knockout studies, mice homozygous for either ENU mutation (or compound heterozygotes) died during embryonic development at 9.5–14.5 days post coitum. Heterozygous deletion of Mll2 induced in the adult mouse results in a normal phenotype suggesting that changes in chromatin methylation during development result in the adult phenotype. Mll2 has been shown to regulate a small subset of genes, a number of which Neurod1, Enpp1, Slc27a2, and Plcxd1 are downregulated in adult mutant mice. Our results demonstrate that histone H3K4 methyltransferase Mll2 is a component of the genetic regulation necessary for glucose homeostasis, resulting in a specific disease pattern linking chromatin modification with causes and progression of type 2 diabetes, providing a basis for its further understanding at the molecular level. PMID:23826075

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite

A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

PubMed

Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

2000-12-01

Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

PubMed

Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

2011-04-28

The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

Metabolomic profiles of arsenic (+3 oxidation state) methyltransferase knockout mice: Effect of sex and arsenic exposure

PubMed Central

Huang, Madelyn C.; Douillet, Christelle; Su, Mingming; Zhou, Kejun; Wu, Tao; Chen, Wenlian; Galanko, Joseph A.; Drobná, Zuzana; Saunders, R. Jesse; Martin, Elizabeth; Fry, Rebecca C.; Jia, Wei; Stýblo, Miroslav

2016-01-01

Arsenic (+3 oxidation state) methyltransferase (As3mt) is the key enzyme in the pathway for methylation of inorganic arsenic (iAs). Altered As3mt expression and AS3MT polymorphism have been linked to changes in iAs metabolism and in susceptibility to iAs toxicity in laboratory models and in humans. As3mt-knockout mice have been used to study the association between iAs metabolism and adverse effects of iAs exposure. However, little is known about systemic changes in metabolism of these mice and how these changes lead to their increased susceptibility to iAs toxicity. Here, we compared plasma and urinary metabolomes of male and female wild-type (WT) and As3mt-KO (KO) C57BL6 mice and examined metabolomic shifts associated with iAs exposure in drinking water. Surprisingly, exposure to 1 ppm As elicited only small changes in the metabolite profiles of either WT or KO mice. In contrast, comparisons of KO mice with WT mice revealed significant differences in plasma and urinary metabolites associated with lipid (phosphatidylcholines, cytidine, acyl-carnitine), amino acid (hippuric acid, acetylglycine, urea), and carbohydrate (L-sorbose, galactonic acid, gluconic acid) metabolism. Notably, most of these differences were sex-specific. Sex-specific differences were also found between WT and KO mice in plasma triglyceride and lipoprotein cholesterol levels. Some of the differentially changed metabolites (phosphatidylcholines, carnosine, and sarcosine) are substrates or products of reactions catalyzed by other methyltransferases. These results suggest that As3mt KO alters major metabolic pathways in a sex-specific manner, independent of iAs treatment, and that As3mt may be involved in other cellular processes beyond iAs methylation. PMID:26883664

PRMT7 is a member of the protein arginine methyltransferase family with a distinct substrate specificity.

PubMed

Miranda, Tina Branscombe; Miranda, Mark; Frankel, Adam; Clarke, Steven

2004-05-28

We have identified a mammalian arginine N-methyltransferase, PRMT7, that can catalyze the formation of omega-NG-monomethylarginine in peptides. This protein is encoded by a gene on human chromosome 16q22.1 (human locus AK001502). We expressed a full-length human cDNA construct in Escherichia coli as a glutathione S-transferase (GST) fusion protein. We found that GST-tagged PRMT7 catalyzes the S-adenosyl-[methyl-3H]-l-methionine-dependent methylation of the synthetic peptide GGPGGRGGPGG-NH2 (R1). The radiolabeled peptide was purified by high-pressure liquid chromatography and acid hydrolyzed to free amino acids. When the hydrolyzed products were separated by high-resolution cation-exchange chromatography, we were able to detect one tritiated species which co-migrated with an omega-NG-monomethylarginine standard. Surprisingly, GST-PRMT7 was not able to catalyze the in vitro methylation of a GST-fibrillarin (amino acids 1-148) fusion protein (GST-GAR), a methyl-accepting substrate for the previously characterized PRMT1, PRMT3, PRMT4, PRMT5, and PRMT6 enzymes. Nor was it able to methylate myelin basic protein or histone H2A, in vitro substrates of PRMT5. This specificity distinguishes PRMT7 from all of the other known arginine methyltransferases. An additional unique feature of PRMT7 is that it seems to have arisen from a gene duplication event and contains two putative AdoMet-binding motifs. To see if both motifs were necessary for activity, each putative domain was expressed as a GST-fusion and tested for activity with peptides R1 and R2 (acetyl-GGRGG-NH2). These truncated proteins were enzymatically inactive, suggesting that both domains are required for functionality.

Coexistence and gene expression of phenylethanolamine N-methyltransferase, tyrosine hydroxylase, and neuropeptide tyrosine in the rat and bovine adrenal gland: effects of reserpine.

PubMed

Schalling, M; Dagerlind, A; Brené, S; Hallman, H; Djurfeldt, M; Persson, H; Terenius, L; Goldstein, M; Schlesinger, D; Hökfelt, T

1988-11-01

Expression and regulation of the catecholamine-synthesizing enzymes phenylethanolamine N-methyltransferase (PNMTase; S-adenosyl-L-methionine:phenylethanolamine N-methyltransferase, EC 2.1.1.28) and tyrosine hydroxylase [TyrOHase; tyrosine 3-monooxygenase, L-tyrosine, tetrahydropteridine:oxygen oxidoreductase (3-hydroxylating), EC 1.14.16.2] and the coexisting neuropeptide tyrosine (NPY) were studied in rat and bovine adrenal medulla. By using both immunohistochemistry and in situ hybridization, PNMTase- and NPY-positive cells exhibited a close overlap in bovine medulla and were preferentially localized in the outer two-thirds of the medulla. Although TyrOHase and its mRNA were observed in virtually all medullary gland cells, TyrOHase mRNA levels were much higher in the PNMTase- and NPY-positive cells. After administration of the catecholamine-depleting drug reserpine to rats, a brief increase, followed by a dramatic decrease, in the level of PNMTase mRNA was observed in the adrenal medulla. In contrast, mRNA for both TyrOHase and NPY only exhibited an increase, whereby the TyrOHase mRNA peak preceded that of NPY mRNA. Different regulatory mechanisms may thus operate for these three compounds coexisting in the adrenal medulla.

Coexistence and gene expression of phenylethanolamine N-methyltransferase, tyrosine hydroxylase, and neuropeptide tyrosine in the rat and bovine adrenal gland: effects of reserpine.

PubMed Central

Schalling, M; Dagerlind, A; Brené, S; Hallman, H; Djurfeldt, M; Persson, H; Terenius, L; Goldstein, M; Schlesinger, D; Hökfelt, T

1988-01-01

Expression and regulation of the catecholamine-synthesizing enzymes phenylethanolamine N-methyltransferase (PNMTase; S-adenosyl-L-methionine:phenylethanolamine N-methyltransferase, EC 2.1.1.28) and tyrosine hydroxylase [TyrOHase; tyrosine 3-monooxygenase, L-tyrosine, tetrahydropteridine:oxygen oxidoreductase (3-hydroxylating), EC 1.14.16.2] and the coexisting neuropeptide tyrosine (NPY) were studied in rat and bovine adrenal medulla. By using both immunohistochemistry and in situ hybridization, PNMTase- and NPY-positive cells exhibited a close overlap in bovine medulla and were preferentially localized in the outer two-thirds of the medulla. Although TyrOHase and its mRNA were observed in virtually all medullary gland cells, TyrOHase mRNA levels were much higher in the PNMTase- and NPY-positive cells. After administration of the catecholamine-depleting drug reserpine to rats, a brief increase, followed by a dramatic decrease, in the level of PNMTase mRNA was observed in the adrenal medulla. In contrast, mRNA for both TyrOHase and NPY only exhibited an increase, whereby the TyrOHase mRNA peak preceded that of NPY mRNA. Different regulatory mechanisms may thus operate for these three compounds coexisting in the adrenal medulla. Images PMID:2903502

Reaction mechanism of guanidinoacetate methyltransferase, concerted or step-wise.

PubMed

Zhang, Xiaodong; Bruice, Thomas C

2006-10-31

We describe a quantum mechanics/molecular mechanics investigation of the guanidinoacetate methyltransferase catalyzed reaction, which shows that proton transfer from guanidinoacetate (GAA) to Asp-134 and methyl transfer from S-adenosyl-L-methionine (AdoMet) to GAA are concerted. By self-consistent-charge density functional tight binding/molecular mechanics, the bond lengths in the concerted mechanism's transition state are 1.26 A for both the OD1 (Asp-134)-H(E) (GAA) and H(E) (GAA)-N(E) (GAA) bonds, and 2.47 and 2.03 A for the S8 (AdoMet)-C9 (AdoMet) and C9 (AdoMet)-N(E) (GAA) bonds, respectively. The potential-energy barrier (DeltaE++) determined by single-point B3LYP/6-31+G*//MM is 18.9 kcal/mol. The contributions of the entropy (-TDeltaS++) and zero-point energy corrections Delta(ZPE)++ by normal mode analysis are 2.3 kcal/mol and -1.7 kcal/mol, respectively. Thus, the activation enthalpy of this concerted mechanism is predicted to be DeltaH++ = DeltaE++ plus Delta(ZPE)++ = 17.2 kcal/mol. The calculated free-energy barrier for the concerted mechanism is DeltaG++ = 19.5 kcal/mol, which is in excellent agreement with the value of 19.0 kcal/mol calculated from the experimental rate constant (3.8 +/- 0.2.min(-1)).

Reaction mechanism of guanidinoacetate methyltransferase, concerted or step-wise

PubMed Central

Zhang, Xiaodong; Bruice, Thomas C.

2006-01-01

We describe a quantum mechanics/molecular mechanics investigation of the guanidinoacetate methyltransferase catalyzed reaction, which shows that proton transfer from guanidinoacetate (GAA) to Asp-134 and methyl transfer from S-adenosyl-l-methionine (AdoMet) to GAA are concerted. By self-consistent-charge density functional tight binding/molecular mechanics, the bond lengths in the concerted mechanism's transition state are 1.26 Å for both the OD1 (Asp-134)–HE (GAA) and HE (GAA)–NE (GAA) bonds, and 2.47 and 2.03 Å for the S8 (AdoMet)–C9 (AdoMet) and C9 (AdoMet)–NE (GAA) bonds, respectively. The potential-energy barrier (ΔE‡) determined by single-point B3LYP/6–31+G*//MM is 18.9 kcal/mol. The contributions of the entropy (−TΔS‡) and zero-point energy corrections Δ(ZPE)‡ by normal mode analysis are 2.3 kcal/mol and −1.7 kcal/mol, respectively. Thus, the activation enthalpy of this concerted mechanism is predicted to be ΔH‡ = ΔE‡ + Δ(ZPE)‡ = 17.2 kcal/mol. The calculated free-energy barrier for the concerted mechanism is ΔG‡ = 19.5 kcal/mol, which is in excellent agreement with the value of 19.0 kcal/mol calculated from the experimental rate constant (3.8 ± 0.2·min−1). PMID:17053070

Catechol-O-methyltransferase as a target for melanoma destruction?

PubMed

Smit, N P; Latter, A J; Naish-Byfield, S; Westerhof, W; Pavel, S; Riley, P A

1994-08-17

Catechols may interfere in melanogenesis by causing increased levels of toxic quinones. Several catechols and known inhibitors of the enzyme catechol-O-methyltransferase (COMT) were therefore tested for their toxicity towards a pigmented melanoma cell line, UCLA-SO-(M14). The inhibition of thymidine incorporation as a result of exposure to the compounds was measured. All agents were compared to 4-hydroxyanisole (4HA), a depigmenting agent extensively studied as an antimelanoma drug. The compounds were also tested on the epithelial cell line, CNCM-I-(221) in the presence and absence of tyrosinase. All the compounds were more effective than 4HA towards the M14-cells at either 10(-4) M or 10(-5) M. The toxicity of 4HA towards the 221-cells was shown to be completely dependent on the presence of tyrosinase. Effects of the test agents on the 221-cells were also observed in the absence of tyrosinase. Although some of them were shown to be good substrates for tyrosinase only small changes in toxicity were observed as a result of the presence of the enzyme in comparison with 4HA. No direct correlation of the toxicity of the agents and COMT inhibition was observed. The possible mode of action of the compounds through inhibition of COMT and interference in melanogenesis is discussed together with other possibilities and factors involved.

Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

PubMed

Fu, Rao; Gong, Jun

2017-11-01

Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.