Science.gov

Sample records for chartarum induce immunotoxic

  1. Co-cultivation of Streptomyces californicus and Stachybotrys chartarum stimulates the production of cytostatic compound(s) with immunotoxic properties

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Hirvonen, Maija-Riitta

    2006-12-15

    We have recently shown that the actinobacterium Streptomyces californicus and the fungus Stachybotrys chartarum originating from moisture damaged buildings possess both immunotoxic and immunostimulatory characteristics, which are synergistically potentiated by microbial interaction. In the search for the causative agent(s) behind the immunotoxicity, the cytostatic effects of the co-cultivated spores of S. californicus and S. chartarum were compared to those caused by widely used cytostatic agents produced by streptomycetes. The RAW264.7 macrophages were exposed to four doses of doxorubicin (DOX), actinomycin D (AMD), mitomycin C (MMC) or phleomycin (PHLEO) for 24 h. Kinetics of the spores of the co-cultivated and the separately cultivated microbes (1 x 10{sup 6} spores/ml) was compared to DOX (0.15 {mu}M). Apoptotic responses were analyzed by measuring DNA content and mitochondria membrane depolarization with flow cytometer, and by the fluorometric caspase-3 assay. The present data indicate that interactions during co-cultivation of S. californicus and S. chartarum stimulate the production of an unidentified cytostatic compound(s) capable of inducing mitochondria mediated apoptosis and cell cycle arrest at S-G{sub 2}/M. The spores of co-cultivated microbes caused a 4-fold collapse of mitochondrial membrane potential and an almost 6-fold caspase-3 activation and DNA fragmentation when compared to control. Similar responses were induced by DNA cleaving compounds, especially DOX and AMD, at the relatively low concentrations, but not the spores of the same microbes when they were grown separately. These data suggest that when growing in the same habitat, interactions between S. californicus and S. chartarum stimulates the production of an unknown cytostatic compound(s) which evoke immunotoxic effects similar to those by chemotherapeutic drugs.

  2. Microcystin-LR Induced Immunotoxicity in Mammals

    PubMed Central

    Lone, Yaqoob; Bhide, Mangla; Koiri, Raj Kumar

    2016-01-01

    Microcystins are toxic molecules produced by cyanobacterial blooms due to water eutrophication. Exposure to microcystins is a global health problem because of its association with various other pathological effects and people all over the world are exposed to microcystins on a regular basis. Evidence shows that microcystin-LR (MC-LR) may adversely affect the immune system, but its specific effects on immune functions are lacking. In the present review, immunotoxicological effects associated with MC-LR in animals, humans, and in vitro models have been reported. Overall, the data shows that chronic exposure to MC-LR has the potential to impair vital immune responses which could lead to increased risk of various diseases including cancers. Studies in animal and in vitro models have provided some pivotal understanding into the potential mechanisms of MC-LR related immunotoxicity suggesting that further investigation, particularly in humans, is required to better understand the relationship between development of disease and the MC-LR exposure. PMID:26925102

  3. Processed Aloe vera Gel Ameliorates Cyclophosphamide-Induced Immunotoxicity

    PubMed Central

    Im, Sun-A; Kim, Ki-Hyang; Kim, Hee-Suk; Lee, Ki-Hwa; Shin, Eunju; Do, Seon-Gil; Jo, Tae Hyung; Park, Young In; Lee, Chong-Kil

    2014-01-01

    The effects of processed Aloe vera gel (PAG) on cyclophosphamide (CP)-induced immunotoxicity were examined in mice. Intraperitoneal injection of CP significantly reduced the total number of lymphocytes and erythrocytes in the blood. Oral administration of PAG quickly restored CP-induced lymphopenia and erythropenia in a dose-dependent manner. The reversal of CP-induced hematotoxicity by PAG was mediated by the functional preservation of Peyer’s patch cells. Peyer’s patch cells isolated from CP-treated mice, which were administered PAG, produced higher levels of T helper 1 cytokines and colony-stimulating factors (CSF) in response to concanavalin A stimulation as compared with those isolated from CP-treated control mice. PAG-derived polysaccharides directly activated Peyer’s patch cells isolated from normal mice to produce cytokines including interleukin (IL)-6, IL-12, interferon-γ, granulocyte-CSF, and granulocyte-macrophage-CSF. The cytokines produced by polysaccharide-stimulated Peyer’s patch cells had potent proliferation-inducing activity on mouse bone marrow cells. In addition, oral administration of PAG restored IgA secretion in the intestine after CP treatment. These results indicated that PAG could be an effective immunomodulator and that it could prevent CP-induced immunotoxic side effects. PMID:25347273

  4. Systemic immunotoxicity reactions induced by adjuvanted vaccines.

    PubMed

    Batista-Duharte, Alexander; Portuondo, Deivys; Pérez, O; Carlos, Iracilda Zeppone

    2014-05-01

    Vaccine safety is a topic of concern for the treated individual, the family, the health care personnel, and the others involved in vaccination programs as recipients or providers. Adjuvants are necessary components to warrant the efficacy of vaccines, however the overstimulation of the immune system is also associated with adverse effects. Local reactions are the most frequent manifestation of toxicity induced by adjuvanted vaccines and, with the exception of the acute phase response (APR), much less is known about the systemic reactions that follow vaccination. Their low frequency or subclinical expression meant that this matter has been neglected. In this review, various systemic reactions associated with immune stimulation will be addressed, including: APR, hypersensitivity, induction or worsening of autoimmune diseases, modification of hepatic metabolism and vascular leak syndrome (VLS), with an emphasis on the mechanism involved. Finally, the authors analyze the current focus of discussion about vaccine safety and opportunities to improve the design of new adjuvanted vaccines in the future. PMID:24607449

  5. Oxidative stress and immunotoxicity induced by graphene oxide in zebrafish.

    PubMed

    Chen, Minjie; Yin, Junfa; Liang, Yong; Yuan, Shaopeng; Wang, Fengbang; Song, Maoyong; Wang, Hailin

    2016-05-01

    Graphene oxide (GO) has been extensively explored as a promising nanomaterial for applications in biology because of its unique properties. Therefore, systematic investigation of GO toxicity is essential to determine its fate in the environment and potential adverse effects. In this study, acute toxicity, oxidative stress and immunotoxicity of GO were investigated in zebrafish. No obvious acute toxicity was observed when zebrafish were exposed to 1, 5, 10 or 50mg/L GO for 14 days. However, a number of cellular alterations were detected by histological analysis of the liver and intestine, including vacuolation, loose arrangement of cells, histolysis and disintegration of cell boundaries. As evidence for oxidative stress, malondialdehyde levels and superoxide dismutase and catalase activities were increased and glutathione content was decreased in the liver after treatment with GO. GO treatment induced an immune response in zebrafish, as demonstrated by increased expression of tumor necrosis factor α, interleukin-1 β, and interleukin-6 in the spleen. Our findings demonstrated that GO administration in an aquatic system can cause oxidative stress and immune toxicity in adult zebrafish. To our knowledge, this is the first report of immune toxicity of GO in zebrafish. PMID:26921726

  6. Shell-crosslinked knedel-like nanoparticles induce lower immunotoxicity than their non-crosslinked analogs

    PubMed Central

    Elsabahy, Mahmoud; Samarajeewa, Sandani; Raymond, Jeffery E.; Clark, Corrie; Wooley, Karen L.

    2013-01-01

    The development of stable nanoparticles that can withstand the changing conditions experienced in a biological setting and also be of low toxicity and immunogenicity is of particular importance to address the problems associated with currently utilized nanotechnology-based therapeutics and diagnostics. The use of crosslinked nanoparticles continues to receive special impetus, due to their robust structure and high kinetic stability, and they have recently been shown to induce lower cytotoxicity than their non-crosslinked micellar counterparts. In the current study, poly(acrylamidoethylamine)-block-poly(DL-lactide) (PAEA90-b-PDLLA40) copolymers were synthesized, self-assembled in water to yield nanoscopic polymeric micelles, and the effects of decorating the micellar surface with poly(ethylene glycol) (i.e. PEGylation) and crosslinking the PAEA layer to varying extents on the physicochemical characteristics, cytotoxicity and immunotoxicity of the nanoparticles were studied. Herein, we report for the first time that crosslinking can efficiently reduce the immunotoxicity of polymeric nanomaterials. In addition, increasing the degree of crosslinking further reduced the accessibility of biomolecules to the core of the nanoparticles and decreased their cytotoxicity and immunotoxicity. It is also highlighted that crosslinking can be more efficient than PEGylation in reducing the immunotoxicity of nanomaterials. Shell-crosslinking of block copolymer micelles, therefore, is expected to advance their clinical development beyond the earlier known effects, and to broaden the implications in the field of nanomedicine. PMID:24187610

  7. Effect of thyroidectomy and thyroxine on 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced immunotoxicity

    SciTech Connect

    Pazdernik, T.L.; Rozman, K.K.

    1985-02-18

    Radiothyroidectomy protected against 2,3,7,8-tetrachloro dibenzo-p-dioxin (TCDD)-induced immunotoxicity in rats as assessed by the spleen anti-SRBC plaque-forming cell assay. Thyroxin (T/sub 4/) replacement therapy partially reversed the effects of thyroidectomy on T/sub 4/ and triiodothyronine (T/sub 3/) serum levels, body weight and immune function as well as restored TCDD-induced immunotoxicity. Thus, hypothyroidism induced by TCDD exposure can be viewed as a protective response of the organism to reduce the insult caused by TCDD.

  8. Immunotoxicity of monoclonal antibodies

    PubMed Central

    2009-01-01

    Monoclonal antibodies (mAbs) are large molecules intended to bind to specific targets often expressed on the immune system, and to treat various immunopathological conditions. Therefore, mAbs can be considered to have a high potential for immunotoxicity, which is reflected in the clinical experience accumulated on mAbs-induced adverse effects related to immunosuppression, immunostimulation and hypersensitivity (immunogenicity). So far, non clinical immunotoxicity studies have been inadequate to address all safety issues in relation to the possible immunotoxicity of mAbs, because they are fraught with limitations and pitfalls primarily related to the lack of relevant animal species. In addition, clinical studies rarely include validated end-points dedicated to the prediction of immunotoxicity. With the ongoing development of mAbs as novel therapeutic strategies for a wide variety of diseases, efforts should be paid to improve our understanding of mAbs-induced immunotoxic effects and design dedicated strategies to assess their immunological safety, both non clinically and clinically. PMID:20061816

  9. Interactions between Streptomyces californicus and Stachybotrys chartarum can induce apoptosis and cell cycle arrest in mouse RAW264.7 macrophages

    SciTech Connect

    Penttinen, Piia . E-mail: Piia.Penttinen@ktl.fi; Pelkonen, Jukka; Huttunen, Kati; Toivola, Mika; Hirvonen, Maija-Riitta

    2005-02-01

    Exposure to complex mixtures of bacteria and fungi in moisture-damaged buildings is a potential cause of inflammatory related symptoms among occupants. The present study assessed interactions between two characteristic moldy house microbes Streptomyces californicus and Stachybotrys chartarum. Differences in cytotoxic and inflammatory responses in mouse (RAW264.7) macrophages were studied after exposure to the spores of co-cultivated microbes, the mixture of separately cultivated spores, and the spores of either of these microbes cultivated alone. The RAW264.7 cells were exposed to six doses (1 x 10{sup 4} to 3 x 10{sup 6} spores/ml) for 24 h, and the time course of the induced responses was evaluated after 4, 8, 16, and 24 h of exposure (1 x 10{sup 6} spores/ml). The cytotoxic potential of the spores was characterized by the MTT test, DNA content analysis, and enzyme assay for caspase-3 activity. The production of cytokines (IL-1{beta}, IL-6, IL-10, TNF{alpha}, and MIP2) was measured immunochemically and nitric oxide by the Griess method. Co-cultivation increased the ability of the spores to cause apoptosis by more than 4-fold and the proportion of RAW264.7 cells at the G{sub 2}/M stage increased nearly 2-fold when compared to the response induced by the mixture of spores. In contrast, co-cultivation decreased significantly the ability of the spores to trigger the production of NO and IL-6 in RAW264.7 cells. In conclusion, these data suggest that co-culture of S. californicus and S. chartarum can result in microbial interactions that significantly potentiate the ability of the spores to cause apoptosis and cell cycle arrest in mammalian cells.

  10. IS YOUR STACHYBOTRYS CHARTARUM A GENUINE S. CHARTARUM?

    EPA Science Inventory

    The fungus Stachybotrys chartarum is the type species of the genus Stachybotrys. Certain strains of the species are known to produce trichothecene mycotoxins,. It is a celluolytic saprophyte with worldwide distribution and frequently discovered in water-damaged buildings. Evid...

  11. Investigations of immunotoxicity and allergic potential induced by topical application of triclosan in mice

    PubMed Central

    Anderson, Stacey E.; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.

    2016-01-01

    Triclosan is an antimicrobial chemical commonly used occupationally and by the general public. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of triclosan following dermal exposure using a murine model. Triclosan was not identified to be a sensitizer in the murine local lymph node assay (LLNA) when tested at concentrations ranging from 0.75–3.0%. Following a 28-day exposure, triclosan produced a significant increase in liver weight at concentrations of ≥ 1.5%. Exposure to the high dose (3.0%) also produced a significant increase in spleen weights and number of platelets. The absolute number of B-cells, T-cells, dendritic cells and NK cells were significantly increased in the skin draining lymph node, but not the spleen. An increase in the frequency of dendritic cells was also observed in the lymph node following exposure to 3.0% triclosan. The IgM antibody response to sheep red blood cells (SRBC) was significantly increased at 0.75% – but not at the higher concentrations – in the spleen and serum. These results demonstrate that dermal exposure to triclosan induces stimulation of the immune system in a murine model and raise concerns about potential human exposure. PMID:25812624

  12. Differential Immunotoxicity Induced by Two Different Windows of Developmental Trichloroethylene Exposure

    PubMed Central

    Gilbert, Kathleen M.; Woodruff, William; Blossom, Sarah J.

    2014-01-01

    Developmental exposure to environmental toxicants may induce immune system alterations that contribute to adult stage autoimmune disease. We have shown that continuous exposure of MRL+/+ mice to trichloroethylene (TCE) from gestational day (GD) 0 to postnatal day (PND) 49 alters several aspects of CD4+ T cell function. This window of exposure corresponds to conception-adolescence/young adulthood in humans. More narrowly defining the window of TCE developmental exposure causes immunotoxicity that would establish the stage at which avoidance and/or intervention would be most effective. The current study divided continuous TCE exposure into two separate windows, namely, gestation only (GD0 to birth (PND0)) and early-life only (PND0-PND49). The mice were examined for specific alterations in CD4+ T cell function at PND49. One potentially long-lasting effect of developmental exposure, alterations in retrotransposon expression indicative of epigenetic alterations, was found in peripheral CD4+ T cells from both sets of developmentally exposed mice. Interestingly, certain other effects, such as alterations in thymus cellularity, were only found in mice exposed to TCE during gestation. In contrast, expansion of memory/activation cell subset of peripheral CD4+ T cells were only found in mice exposed to TCE during early life. Different windows of developmental TCE exposure can have different functional consequences. PMID:24696780

  13. Immunotoxicity and allergic potential induced by topical application of dimethyl carbonate (DMC) in a murine model.

    PubMed

    Anderson, Stacey E; Franko, Jennifer; Anderson, Katie L; Munson, Albert E; Lukomska, Ewa; Meade, B Jean

    2013-01-01

    Dimethyl carbonate (DMC) is an industrial chemical, used as a paint and adhesive solvent, with the potential for significant increases in production. Using select immune function assays, the purpose of these studies was to evaluate the immunotoxicity of DMC following dermal exposure using a murine model. Following a 28-day exposure, DMC produced a significant decrease in thymus weight at concentrations of 75% and greater. No effects on body weight, hematological parameters (erythrocytes, leukocytes, and their differentials), or immune cell phenotyping (B-cells, T-cells, and T-cell sub-sets) were identified. The IgM antibody response to sheep red blood cell (SRBC) was significantly reduced in the spleen but not the serum. DMC was not identified to be an irritant and evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50-100%, did not identify increases in lymphocyte proliferation. These results demonstrate that dermal exposure to DMC induces immune suppression in a murine model and raise concern about potential human exposure and the need for occupational exposure regulations. PMID:22953780

  14. Tunisian radish (Raphanus sativus) extract prevents cadmium-induced immunotoxic and biochemical alterations in rats.

    PubMed

    ben Salah-Abbès, Jalila; Abbès, Samir; Zohra, Haous; Oueslati, Ridha

    2015-01-01

    Cadmium (Cd), a known carcinogen and potent immunotoxicant in humans and animals, is dispersed throughout the environment as a result of pollution from a variety of sources. Tunisian radish (Raphanus sativus) extract (TRE) is a known anti-oxidant and free radical scavenger that has been shown to help alleviate immune system disorders, including some induced by environmental toxicants. The present study was undertaken to investigate potential protective effects of TRE against Cd-induced immunotoxicities (and general toxicities) in situ. Cadmium chloride (at 2.5 mg CdCl2/kg BW) and TRE (5, 10, or 15 mg/kg BW) were given (alone or in combination [actually, in sequence of Cd and then TRE]) to rats daily by oral gavage for 2 weeks. Results indicated that treatment with CdCl2 alone resulted in significant decreases in plasma levels of total protein, triglycerides, creatine kinase, creatinine, IgG and IgA, T-lymphocyte sub-types (CD4(+), CD3(+), CD56(+), and CD8(+)), and in thymic and hepatic indices (relative weights). In contrast, CdCl2 treatment caused significant increases in serum LDH, AST, and ALT, in the formation/release of pro-inflammatory cytokines (IL-1 and TNFα), and in the relative weights of host spleen and kidneys. Rats treated with TRE alone had no discernable changes compared to the controls with regard to all test parameters. Combined treatment of CdCl2 and TRE-at any dose-resulted in a significant improvement of all test parameters compared to those seen with Cd alone. These results illustrated (and provided further support for a continuing belief in) the beneficial effects of TRE in reducing the harmful outcomes of commonly encountered toxicants (like Cd) on the immune system and on overall host health status. PMID:24524755

  15. Immunotoxicity in mice induced by short-term exposure to methoxychlor, parathion, or piperonyl butoxide.

    PubMed

    Fukuyama, Tomoki; Kosaka, Tadashi; Hayashi, Koichi; Miyashita, Lisa; Tajima, Yukari; Wada, Kunio; Nishino, Risako; Ueda, Hideo; Harada, Takanori

    2013-01-01

    Exposure to environmental agents can compromise numerous immunological functions. Immunotoxicology focuses on the evaluation of the potential adverse effects of xenobiotics on immune mechanisms that can lead to harmful changes in host responses such as: increased susceptibility to infectious diseases and tumorigenesis; the induction of hypersensitivity reactions; or an increased incidence of autoimmune disease. In order to assess the immunosuppressive response to short-term exposure to some commonly used pesticides, the studies here focused on the response of mice after exposures to the organochlorine pesticide methoxychlor, the organophosphorus pesticide parathion, or the agricultural insecticide synergist piperonyl butoxide. In these studies, 7-week-old mice were orally administered (by gavage) methoxychlor, parathion, or piperonyl butoxide daily for five consecutive days. On Day 2, all mice in each group were immunized with sheep red blood cells (SRBC), and their SRBC-specific IgM responses were subsequently assessed. In addition, levels of B-cells in the spleen of each mouse were also analyzed via surface antigen expression. The results of these studies indicated that treatments with these various pesticides induced marked decreases in the production of SRBC-specific IgM antibodies as well as in the expression of surface antigens in IgM- and germinal center-positive B-cells. Based on these outcomes, it is concluded that the short-term exposure protocol was able to detect potential immunosuppressive responses to methoxychlor, parathion, and piperonyl butoxide in situ, and, as a result, may be useful for detecting other environmental chemical-related immunotoxicities. PMID:22834942

  16. Benzanthrone induced immunotoxicity via oxidative stress and inflammatory mediators in Balb/c mice.

    PubMed

    Tewari, Prachi; Roy, Ruchi; Mishra, Sakshi; Mandal, Payal; Yadav, Ashish; Chaudhari, Bhushan P; Chaturvedi, Rajnish K; Dwivedi, Premendra D; Tripathi, Anurag; Das, Mukul

    2015-03-01

    Benzanthrone (BA) is an important dye intermediate which is used in the manufacturing of several polycyclic vat and disperse dyes in textile industries. Several studies have indicated that the general population is also exposed to BA owing to its release from furnace effluents and automobile exhausts in the environment. In several clinical studies, it has been shown that workers exposed to BA developed itching, burning sensation, erythema and hyperpigmentation of the skin, which could be an outcome of the dysregulated immune response. In this study, we have used female Balb/c mice as a model to study the immuno-inflammatory changes after systemic administration of BA (7.5mg/kgb.w. and 15mg/kgb.w.) for one week. BA exposed animals exhibited the signs of intense systemic inflammation as evident by enhanced DTH response, MPO activity, hyperplastic and dysplastic histopathological organization of spleen and lung tissue. Splenic evaluation revealed enhanced oxidative stress, upregulation of prominent inflammatory markers like iNOS and COX-2 and DNA damage. In coherence with the observed immuno-inflammatory alterations, the levels of several inflammatory and regulatory cytokines (IL-17, TNF-α, IFN-γ, IL-1, IL-10, IL-4) were significantly enhanced in serum as well as the spleen. In addition, BA administration significantly induced the activation of ERK1/2, p38, JNK MAPKs and their downstream transcription factors AP-1 (c-fos, c-jun), NF-κB and Nrf2 which comprise important mechanistic pathways involved in inflammatory manifestations. These results suggest the immunotoxic nature of the BA and have implications for the risk assessment and management of occupational workers, and even common masses considering its presence as an environmental contaminant. PMID:25454808

  17. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte.

    PubMed

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  18. Investigations into the Immunotoxicity and Allergic Potential Induced by Topical Application of N-Butylbenzenesulfonamide (NBBS) in a Murine Model

    PubMed Central

    Marrocco, Antonella; Meade, B. Jean; Long, Carrie M.; Lukomska, Ewa; Marshall, Nikki B.; Anderson, Stacey E.

    2015-01-01

    N-Butylbenzene sulfonamide (NBBS) is a commonly used plasticizer found in numerous products. Due to its extensive use, lack of adequate toxicological data, and suspicion of toxicity based on the presence of structural alerts, it was nominated to the National Toxicology Program for comprehensive toxicological testing. The purpose of this study was to evaluate the potential for hypersensitivity and immune suppression following dermal exposure to NBBS using a murine model. NBBS tested negative in a combined irritancy/local lymph node assay (LLNA), classifying it as nonirritating and nonsensitizing. To estimate the immunosuppressive potential of NBBS, assays that assessed immunotoxicity were performed, including the immumnoglobulin (Ig) M response to T-cell-dependent antigen sheep red blood cells (SRBC), using the plaque-forming cell (PFC) assay and immune cell phenotyping. After a 28-d treatment with NBBS, mice exposed to the lowest concentration (25% NBBS) showed a significant increase in IgM-producing B cells in the spleen. No marked changes were identified in immune cell markers in the lymph node. In contrast to body weight, a significant elevation in kidney and liver weight was observed following dermal exposure to all concentrations of NBBS. These results demonstrate that dermal exposure to NBBS, other than liver and kidney toxicity, did not apparently induce immunotoxicity in a murine model. PMID:26291892

  19. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

    PubMed Central

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  20. Carbendazim has the potential to induce oxidative stress, apoptosis, immunotoxicity and endocrine disruption during zebrafish larvae development.

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Wang, Yanhua; An, Xuehua; Cai, Leiming; Zhao, Xueping; Wu, Changxing

    2015-10-01

    Increasing evidence have suggested deleterious effects of carbendazim on reproduction, apoptosis, immunotoxicity and endocrine disruption in mice and rats, however, the developmental toxicity of carbendazim to aquatic organisms remains obscure. In the present study, we utilized zebrafish as an environmental monitoring model to characterize the effects of carbendazim on expression of genes related to oxidative stress, apoptosis, immunotoxicity and endocrine disruption during larval development. Different trends in gene expression were observed upon exposing the larvae to 4, 20, 100, and 500 μg/L carbendazim for 4 and 8d. The mRNA levels of catalase, glutathione peroxidase and manganese superoxide dismutase (CAT, GPX, and Mn/SOD) were up-regulated after exposure to different concentrations of carbendazim for 4 or 8d. The up-regulation of p53, Apaf1, Cas8 and the down-regulation of Bcl2, Mdm2, Cas3 in the apoptosis pathway, as well as the increased expression of cytokines and chemokines, including CXCL-C1C, CCL1, IL-1b, IFN, IL-8, and TNFα, suggested carbendazim might trigger apoptosis and immune response during zebrafish larval development. In addition, the alteration of mRNA expression of VTG, ERα, ERβ1, ERβ2, TRα, TRβ, Dio1, and Dio2 indicated the potential of carbendazim to induce endocrine disruption in zebrafish larvae. These data suggested that carbendazim could simultaneously induce multiple responses during zebrafish larval development, and bidirectional interactions among oxidative stress, apoptosis pathway, immune and endocrine systems might be present. PMID:26055223

  1. Assessing a theoretical risk of dolutegravir-induced developmental immunotoxicity in juvenile rats.

    PubMed

    Rhodes, Melissa; Laffan, Susan; Genell, Caroline; Gower, Jill; Maier, Curtis; Fukushima, Tamio; Nichols, Garrett; Bassiri, Ashlyn Eaton

    2012-11-01

    HIV-1 integrase inhibitors (INIs) are a promising class of antiretrovirals for the treatment of HIV in adults; there is interest in expanding their use into pediatric populations. A theoretical concern for developmental immunotoxicity was raised after a publication suggested that two HIV INI tool compounds inhibited in vitro cleavage activity of recombination activating genes 1 and 2 (RAG1/2) through the inhibition of their binding to recombination signal sequences. RAG1/2 are required for the development of mature B and T lymphocyte populations. The potential effects of the investigational INI dolutegravir on RAG1/2 were addressed by developing assays in juvenile rats to measure T cell receptor (TCR) Vβ usage by flow cytometry as an indicator of TCR repertoire diversity and a T cell dependent antibody response (TDAR) as an indicator of immunosuppression. These endpoints were incorporated into a juvenile rat toxicity study, along with immunophenotyping, hematology, and histopathology of immunologic organs. Dose levels of 0, 0.5, 2, or 75mg/kg/day dolutegravir were given via oral gavage from postnatal day 4 through 66. At the highest dose, there was decreased body weight gain and two preweanling deaths; however, there were no treatment-related effects on developmental parameters. There were no effects on immunologic competence, as measured by TDAR, and no effects on lymphocyte subsets or CD4 and CD8 TCR Vβ usage in peripheral blood. Histopathology of immunologic organs (spleen, thymus, lymph nodes) and hematology evaluation revealed no effects. The no observed adverse effect level for immunotoxicity endpoints was 75mg/kg/day. PMID:22790968

  2. Pretilachlor has the potential to induce endocrine disruption, oxidative stress, apoptosis and immunotoxicity during zebrafish embryo development.

    PubMed

    Jiang, Jinhua; Chen, Yanhong; Yu, Ruixian; Zhao, Xueping; Wang, Qiang; Cai, Leiming

    2016-03-01

    The objectives of the present study were to investigate the toxic effects of pretilachlor on zebrafish during its embryo development. The results demonstrated that the transcription of genes involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis was increased after exposure to 50, 100, 200μg/L pretilachlor for 96h, the aromatase activity, vitellogenin (VTG) and thyroid hormones T3 and T4 levels in zebrafish were also up-regulated simultaneously. Pretilachlor exposure induced a noticeable increase in ROS level, increased the transcription and level of antioxidant proteins (e.g., CAT, SOD and GPX). Moreover, the up-regulation of P53, Mdm2, Bbc3 expression and Caspase3 and Caspase9 activities in the apoptosis pathway suggested pretilachlor might trigger cell apoptosis in zebrafish. In addition, the transcription of CXCL-C1C, IL-1β and IL-8 related to the innate immunity was down-regulated after pretilachlor exposure. These data suggested that pretilachlor could simultaneously induce endocrine disruption, apoptosis, oxidative stress and immunotoxicity during zebrafish embryo development. PMID:26851375

  3. Allergic Potential and Immunotoxicity Induced by Topical Application of 1-Chloro-4-(Trifluoromethyl)Benzene (PCBTF) in a Murine Model

    PubMed Central

    Franko, Jennifer; Jackson, Laurel G.; Meade, B. Jean; Anderson, Stacey E.

    2011-01-01

    The purpose of the studies in this paper was to evaluate the allergic potential, immunotoxicity, and irritancy of the occupationally relevant chemical, 1-chloro-4-(trifluoromethyl)benzene, also known as parachlorobenzotrifluoride (PCBTF), following dermal exposure in a murine model. Evaluation of the sensitization potential, conducted using the local lymph node assay (LLNA) at concentrations ranging from 50% to 100%, identified a dose-dependent increase in lymphocyte proliferation with a calculated EC3 value of 53.1%. While no elevations in total or specific IgE were observed after exposure to any concentration of the chemical, significant increases in IFN-γ protein production by stimulated draining lymphoid cells were observed, indicating a T-cell-mediated response. Dermal exposure to PCBTF was not found to alter the immune response to a T-cell-dependant antigen. These results demonstrate that PCBTF has the potential to induce allergic sensitization following dermal exposure and based on LLNA results would be classified as a weak sensitizer. PMID:21747864

  4. Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio).

    PubMed

    Jiang, Jinhua; Wu, Shenggan; Wu, Changxing; An, Xuehua; Cai, Leiming; Zhao, Xueping

    2014-12-01

    Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 μg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFα which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis including VTG, ERα, ERβ2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 μg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms. PMID:25304545

  5. Introduction to Immunotoxicity

    EPA Science Inventory

    Recognition that the immune system is vulnerable to adverse effects after exposure to xenobiotics led to the discipline of immunotoxicology and the subsequent addition of immunotoxicology testing to regulatory guidelines for toxicity. Immunotoxic effects can result in immunosuppr...

  6. Cytokines as biomarkers of nanoparticle immunotoxicity

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2013-01-01

    Nanoscale objects, whether of biologic origin or synthetically created, are being developed into devices for a variety of bionanotechnology diagnostic and pharmaceutical applications. However, the potential immunotoxicity of these nanomaterials and mechanisms by which they may induce adverse reactions have not received sufficient attention. Nanomaterials, depending on their characteristics and compositions, can interact with the immune system in several ways and either enhance or suppress immune system function. Cytokines perform pleiotropic functions to mediate and regulate the immune response and are generally recognized as biomarkers of immunotoxicity. While the specificity and validity of certain cytokines as markers of adverse immune response has been established for chemicals, small and macromolecular drugs, research on their applicability for predicting and monitoring the immunotoxicity of engineered nanomaterials is still ongoing. The goal of this review is to provide guidelines as to important cytokines that can be utilized for evaluating the immunotoxicity of nanomaterials and to highlight the role of those cytokines in mediating adverse reactions, which is of particular importance for the clinical development of nanopharmaceuticals and other nanotechnology-based products. Importantly, the rational design of nanomaterials of low immunotoxicity will be discussed, focusing on synthetic nanodevices, with emphasis on both the nanoparticle-forming materials and the embedded cargoes. PMID:23549679

  7. Developmental immunotoxicity testing of 4-methyl anisole.

    PubMed

    Tonk, Elisa C M; Verhoef, Aart; Gremmer, Eric R; van Loveren, Henk; Piersma, Aldert H

    2015-07-01

    The developmental immunotoxicity of 4-methyl anisole (4MA) was investigated in the rat. Four study designs were used, with either premating or post-weaning onset of exposure, continued to postnatal day 50, and with or without additional oral gavage of pups from postnatal day 10 onward. Reduced litter size (benchmark dose lower confidence limit (BMDL) 80mg/kg bw/day) was the most sensitive developmental parameter, with pup relative organ weight effects observed at similar BMDLs, in the absence of maternal toxicity. Eosinophil numbers were reduced at lower doses (BMDL 16mg/kg bw/day). KLH challenge resulted in increased IL-13 and TNF-α responses, and variably reduced IgG production (BMDL 27mg/kg bw/day). T4 levels were reduced by 11% at maximum with a BMDL of 73mg/kg bw/day. Differences between exposure cohorts were limited and were considered to be without biological significance. This study shows that 4MA induces developmental immunotoxicity at doses below those inducing developmental and general toxicity. These observations being independent of the study designs applied suggest that the post-weaning period, included in all designs, is the most relevant sensitive period for inducing 4MA mediated developmental immunotoxicity. Moreover, this study stresses the importance of including developmental immunotoxicity testing by default in regulatory toxicology. PMID:25882306

  8. [Cutaneous mold fungus granuloma from Ulocladium chartarum].

    PubMed

    Altmeyer, P; Schon, K

    1981-01-01

    Cutaneous granulomas due to the mold fungus Ulocladium chartarum (Preuss) are described in a 58 year old woman. This fungus is usually harmless for mammalian. It is thought that a consisting immunosuppression (Brill-Symmer's disease, therapy with corticosteroids) was a priming condition for the infection. The route of infection in this patient described is unknown. PMID:7194869

  9. CHARACTERIZATION OF THE HEMOLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage and hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its apparent monomeric form has a molecular mass of 11,920
    Da as determ...

  10. DNA damage, redox changes, and associated stress-inducible signaling events underlying the apoptosis and cytotoxicity in murine alveolar macrophage cell line MH-S by methanol-extracted Stachybotrys chartarum toxins

    SciTech Connect

    Wang Huiyan; Yadav, Jagjit S. . E-mail: Jagjit.Yadav@uc.edu

    2006-08-01

    Spore-extracted toxins of the indoor mold Stachybotrys chartarum (SC) caused cytotoxicity (release of lactate dehydrogenase), inhibition of cell proliferation, and cell death in murine alveolar macrophage cell line MH-S in a dose- and time-dependent manner. Apoptotic cell death, confirmed based on morphological changes, DNA ladder formation, and caspase 3/7 activation, was detectable as early as at 3 h during treatment with a toxin concentration of 1 spore equivalent/macrophage and was preceded by DNA damage beginning at 15 min, as evidenced by DNA comet formation in single cell gel electrophoresis assay. The apoptotic dose of SC toxins did not induce detectable nitric oxide and pro-inflammatory cytokines (IL-1{beta}, IL-6, and TNF-{alpha}) but showed exacerbated cytotoxicity in presence of a non-apoptotic dose of the known pro-inflammatory agent LPS (10 ng/ml). Intracellular reduced glutathione (GSH) level showed a significant decrease beginning at 9 h of the toxin treatment whereas oxidized glutathione (GSSG) showed a corresponding significant increase, indicating a delayed onset of oxidative stress in the apoptosis process. The toxin-treated macrophages accumulated p53, an indicator of DNA damage response, and showed activation of the stress-inducible MAP kinases, JNK, and p38, in a time-dependent manner. Chemical blocking of either p38 or p53 inhibited in part the SC toxin-induced apoptosis whereas blocking of JNK did not show any such effect. This study constitutes the first report on induction of DNA damage and associated p53 activation by SC toxins, and demonstrates the involvement of p38- and p53-mediated signaling events in SC toxin-induced apoptosis of alveolar macrophages.

  11. Biomarkers of immunotoxicity in man.

    PubMed

    Descotes, J; Nicolas, B; Vial, T; Nicolas, J F

    1996-01-01

    Abstract The immunotoxic consequences of chemical exposures include direct immunotoxicity (namely immunosuppression and immunostimulation), hypersensitivity and autoimmunity, and because the mechanisms involved are markedly different, no single immune parameter is likely to ever predict or assess all three types of immunotoxicity. A fairly large number of immunological endpoints have been proposed for use as biomarkers of immunotoxicity in man. Unfortunately, they are often not sensitive enough and/or poorly standardized, so that their relevance for assessing immunotoxic effects in humans is debatable, and actually debated. Immune-mediated sentinel events detected in individuals with a defined history of chemical exposure, may prove helpful until methodological advances, notably with the introduction of technologies derived from molecular biology, provide reliable parameters to be used as biomarkers of immunotoxicity. PMID:23888916

  12. PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    PARTIAL CHARACTERIZATION OF ALLERGENS IN EXTRACTS OF Stachybotrys chartarum. M E Viana1, MJ Selgrade2, and M D Ward2. 1NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.

    Exposure to Stachybotrys chartarum has been associated with the development of serious health ...

  13. Genome sequence of Stachybotrys chartarum Strain 51-11

    EPA Science Inventory

    Stachybotrys chartarum strain 51-11 genome was sequenced by shotgun sequencing utilizing Illumina Hiseq 2000 and PacBio long read technology. Since Stachybotrys chartarum has been implicated in health impacts within water-damaged buildings, any information extracted from the geno...

  14. Photosensitization associated with exposure to Pithomyces chartarum in lambs.

    PubMed

    Hansen, D E; McCoy, R D; Hedstrom, O R; Snyder, S P; Ballerstedt, P B

    1994-05-15

    An epidemic of photosensitization was observed in a group of lambs on irrigated autumn pasture in western Oregon. Signs included crusting, necrosis, and sloughing of the skin over the nostrils, lips, and ears, and of the mucous membranes of the buccal regions. Microscopic examination of plant material from the pasture disclosed spores of Pithomyces chartarum. This fungus has been documented as a causal factor in photosensitization in sheep and cattle (facial eczema) in other parts of the world. An infective agent or other plant material that could have induced the clinical signs in the lambs was not evident. Weather and humidity conditions were ideal for fungal growth during the grazing period, and the fungus was detected in large numbers before and during the epidemic. Even though facial eczema has not been reported previously in northwestern United States, we feel the circumstances surrounding this epidemic warrant such a diagnosis. PMID:8050952

  15. Protective effects of meat from lambs on selenium nanoparticle supplemented diet in a mouse model of polycyclic aromatic hydrocarbon-induced immunotoxicity.

    PubMed

    Ungvári, Éva; Monori, István; Megyeri, Attila; Csiki, Zoltán; Prokisch, József; Sztrik, Attila; Jávor, András; Benkő, Ilona

    2014-02-01

    Increased environmental oxidative stress caused primarily by chemicals like polycyclic aromatic hydrocarbons, plays significant role in human diseases. A representative compound, 7,12-dimethylbenz(a)anthracene (DMBA), was used for modeling oxidative damages including the significant decrease of the antioxidant capacity of the blood. Selenium has antioxidant effects but with a narrow therapeutic window. In our current studies to avoid accidental overdose and toxicity selenium was given to meat-producing animals. The standard rodent diet of mice was replaced by meat from lambs either on standard or selenium-enriched diet. Selenium concentration of lamb meat was enhanced three times by nano-selenium administration and an increase in the antioxidant capacity of the blood of mice was measured after the indirect selenium supplementation. Protective effects were also observed against DMBA-induced immunotoxicity. Twice the amount of white blood cells and among them three times more phagocytes survived. Similarly, in their renewal system in bone marrow twice the amount of cells survived and regenerative capacity of granulopoiesis was four times higher than in control DMBA-damaged mice. Our findings suggest functional dietary benefits of lamb meat enriched with selenium by feeding lambs with nanoparticle selenium supplements. PMID:24315870

  16. Occurrence of Stachybotrys chartarum chemotype S in dried culinary herbs.

    PubMed

    Biermaier, Barbara; Gottschalk, Christoph; Schwaiger, Karin; Gareis, Manfred

    2015-02-01

    Stachybotrys (S.) chartarum is an omnipresent cellulolytic mould which produces secondary metabolites, such as the highly toxic macrocyclic trichothecenes. While it is known to occur in animal feed like hay and straw as well as in water-damaged indoor environments, there is little knowledge about the occurrence of S. chartarum and its secondary metabolites in food. The objective of the present study was to examine selected dried culinary herbs for the presence of S. chartarum chemotype S, to assess the potential risk of a contamination of foods with macrocyclic trichothecenes. In total, 50 Stachybotrys isolates from different types of culinary herbs (n=100) such as marjoram (Origanum majorana Linné (L.)), oregano (Origanum vulgare L.), thyme (Thymus vulgaris L.), and savory (Satureja hortensis L.) were examined by MTT-cell culture test (effect-based bioassay), ELISA, and by liquid chromatography tandem mass spectrometry (LC-MS/MS). Selected toxic and non-toxic isolates (n=15) were genetically characterized by PCR and sequencing. Five isolates (10%) were highly toxic in the MTT-cell culture test, and the production of macrocyclic trichothecenes was proven by ELISA and LC-MS/MS. These five isolates were genetically confirmed as S. chartarum chemotype S. To the best of our knowledge, this is the first report about a contamination of dried culinary herbs with toxigenic S. chartarum. PMID:25346283

  17. Characterization of an extracellular laccase of Leptosphaerulina chartarum.

    PubMed

    Sajben-Nagy, Enikő; Manczinger, László; Škrbić, Biljana; Živančev, Jelena; Antić, Igor; Krisch, Judit; Vágvölgyi, Csaba

    2014-09-01

    Laccase-producing fungi were isolated from air, using selective media with a chromogenic substrate to indicate enzyme activity. The best laccase producer strain proved to be a Leptosphaerulina chartarum isolate. Laccase production was investigated in the presence of various inducers in different cultivation conditions. The extracellular laccase was purified for further investigations. SDS-PAGE showed that this laccase is a monomeric protein of 38 kDa molecular weight. The enzyme is active in the pH-range of 3.5-6, with an optimum at pH 3.8. It is active in the 10-60 °C temperature range, with an optimum at 40 °C. After 20 min incubation at temperatures above 70 °C the enzyme lost its activity. Degradation of seven aniline and phenol compounds (2,4-dichlorophenol; 2-methyl-4-chlorophenol; 3-chloroaniline; 4-chloroaniline; 2,6-dimethylaniline; 3,4-dichloroaniline and 3-chloro-4-methylaniline) was investigated, with or without guaiacol (2-methoxyphenol) as mediator molecule. Addition of a mediator to the system significantly increased the degradation levels. These results confirmed that the isolated laccase is able to convert these harmful xenobiotics at in vitro conditions. PMID:24845167

  18. Immunotoxicity -- The Risk is Real

    EPA Science Inventory

    Several papers published over the last year represent significant progress in closing the gap between rodent immunotoxicity data and human risk and indicate that, at least for the developing immune system, the concern raised by rodent data is justified. The studies reviewed here...

  19. Immunotoxicity of trenbolone acetate in Japanese quail

    USGS Publications Warehouse

    Quinn, M.J.; McKernan, M.; Lavoie, E.T.; Ottinger, M.A.

    2007-01-01

    Trenbolone acetate is a synthetic androgen that is currently used as a growth promoter in many meat-exporting countries. Despite industry laboratories classifying trenbolone as nonteratogenic, data showed that embryonic exposure to this androgenic chemical altered development of the immune system in Japanese quail. Trenbolone is lipophilic, persistent, and released into the environment in manure used as soil fertilizer. This is the first study to date to assess this chemical's immunotoxic effects in an avian species. A one-time injection of trenbolone into yolks was administered to mimic maternal deposition, and subsequent effects on the development and function of the immune system were determined in chicks and adults. Development of the bursa of Fabricius, an organ responsible for development of the humoral arm of the immune system, was disrupted, as indicated by lower masse, and smaller and fewer follicles at day 1 of hatch. Morphological differences in the bursas persisted in adults, although no differences in either two measures of immune function were observed. Total numbers of circulating leukocytes were reduced and heterophil-lymphocyte ratios were elevated in chicks but not adults. This study shows that trenbolone acetate is teratogenic and immunotoxic in Japanese quail, and provides evidence that the quail immune system may be fairly resilient to embryonic endocrine-disrupting chemical-induced alterations following no further exposure posthatch.

  20. STACHYLYSIN MAY BE CAUSE OF HEMORRAHAGING IN STACHYBOTRYS CHARTARUM EXPOSURES

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns like nasal bleeding in adults and pulmonary hemosiderosis (PH) in infants. Stachylysin is a glycosylated protein, with the deglycosylated molecular mass of 21.5 kDa. Seven of eight ...

  1. CHARACTERIZATION OF THE HEMOLYSIN, STACHYLYSIN, FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a toxigenic fungus that has been associated with human health concerns, including pulmonary hemorrhage/hemosiderosis. This fungus produces a hemolysin, stachylysin, which in its monomeric form, has a molecular wieght of 11,920 daltons as determined by m...

  2. New approaches to immunotoxicity testing.

    PubMed Central

    Archer, D L

    1982-01-01

    New approaches to immunotoxicity testing are reviewed and discussed. A method of activating T-cells in vivo is presented which circumvents artifacts dur to viability effects encountered with in vitro mitogen assays. The use of adoptive transfer approaches to combine the advantages of in vitro manipulation with in vivo function assays is discussed relative to natural killer cells. The need for an in vitro metabolic activation step coupled to other in vitro immunologic assays is discussed. PMID:7037382

  3. Roles of ROS mediated oxidative stress and DNA damage in 3-methyl-2-quinoxalin benzenevinylketo-1, 4-dioxide-induced immunotoxicity of Sprague-Dawley rats.

    PubMed

    Gao, Hui; Wang, Di; Zhang, Shun; Xu, Mengjing; Yang, Wei; Yan, Peipei; Liu, Yang; Luo, Xiao; Wu, Hailei; Yao, Ping; Yan, Hong; Liu, Liegang

    2015-11-01

    3-methyl-2-quinoxalin benzenevinylketo-1, 4-dioxide (Quinocetone, QCT) has been broadly used to treat dysentery and promote animal growth in food producing animals. However, its potential toxicity could not been neglected as parts of safety assessment according to the acceptable guidelines for QCT administration. In this study, the immunotoxicity of QCT was investigated in male Sprague-Dawley (SD) rats following a 28-day oral exposure at doses of 0, 50, 800, and 2400 mg/kg/day. The food consumption, body weight gain and relative spleen weight were significantly decreased by QCT in a dose-dependent manner. Treatment of rats with QCT also notably suppressed the T-cell proliferation and natural killer (NK) cell activity, accompanied by intracellular reactive oxygen species (ROS) accumulation, antioxidant system inhibition and DNA damage enhancement. Thus, the primary finding of this study is that QCT exposure (2400 mg/kg/day) could cause immunotoxicity in SD rats due to ROS mediated oxidative stress and DNA damage. PMID:26361855

  4. IMMUNOCYTOCHEMICAL LOCALIZATION OF STACHYLYSIN IN STACHYBOTRYS CHARTARUM SPORES AND SPORE-IMPACTED MOUSE AND RAT LUNG TISSUES

    EPA Science Inventory

    Stachylysin is a proteinaceous hemolytic agent that is producted by S. chartarum. Stachylysin was found, using immunohistochemistical and immunocytochemical methods, to be localized in S. chartarum spores/mycelia primarily in the inner wall suggesting that it is constitutively ...

  5. Transcriptional Profiling of Dibenzo[def,p]chrysene-induced Spleen Atrophy Provides Mechanistic Insights into its Immunotoxicity in MutaMouse.

    PubMed

    Chepelev, Nikolai L; Long, Alexandra S; Williams, Andrew; Kuo, Byron; Gagné, Rémi; Kennedy, Dean A; Phillips, David H; Arlt, Volker M; White, Paul A; Yauk, Carole L

    2016-01-01

    Dibenzo[def,p]chrysene (DBC) is the most carcinogenic polycyclic aromatic hydrocarbon (PAH) examined to date. We investigated the immunotoxicity of DBC, manifested as spleen atrophy, following acute exposure of adult MutaMouse males by oral gavage. Mice were exposed to 0, 2.0, 6.2, or 20.0 mg DBC /kg-bw per day, for 3 days. Genotoxic endpoints (DBC-DNA adducts and lacZ mutant frequency in spleen and bone marrow, and red blood cell micronucleus frequency) and global gene expression changes were measured. All of the genotoxicity measures increased in a dose-dependent manner in spleen and bone marrow. Gene expression analysis showed that DBC activates p53 signaling pathways related to cellular growth and proliferation, which was evident even at the low dose. Strikingly, the expression profiles of DBC exposed mouse spleens were highly inversely correlated with the expression profiles of the only published toxicogenomics dataset of enlarged mouse spleen. This analysis suggested a central role for Bnip3l, a pro-apoptotic protein involved in negative regulation of erythroid maturation. RT-PCR confirmed expression changes in several genes related to apoptosis, iron metabolism, and aryl hydrocarbon receptor signaling that are regulated in the opposite direction during spleen atrophy versus benzo[a]pyrene-mediated splenomegaly. In addition, benchmark dose modeling of toxicogenomics data yielded toxicity estimates that are very close to traditional toxicity endpoints. This work illustrates the power of toxicogenomics to reveal rich mechanistic information for immunotoxic compounds and its ability to provide information that is quantitatively similar to that derived from standard toxicity methods in health risk assessment. PMID:26496743

  6. Modulation of Benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate

    SciTech Connect

    Schellenberger, Mario T.; Grova, Nathalie; Willieme, Stephanie; Farinelle, Sophie; Prodhomme, Emmanuel J.F.

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-{gamma}, IL-12, TNF-{alpha} production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P.

  7. Modulation of benzo[a]pyrene induced immunotoxicity in mice actively immunized with a B[a]P-diphtheria toxoid conjugate.

    PubMed

    Schellenberger, Mario T; Grova, Nathalie; Willième, Stéphanie; Farinelle, Sophie; Prodhomme, Emmanuel J F; Muller, Claude P

    2009-10-01

    Benzo[a]pyrene (B[a]P) is a small molecular weight carcinogen and the prototype of polycyclic aromatic hydrocarbons (PAHs). While these compounds are primarily known for their carcinogenicity, B[a]P and its metabolites are also toxic for mammalian immune cells. To develop a prophylactic immune strategy against detrimental effects of B[a]P, we have immunized mice with a B[a]P-diphtheria toxoid conjugate vaccine. We showed that high levels of antibodies against B[a]P and its metabolites modulate the redistribution of these PAHs in the blood. After immunization, increased levels of B[a]P and its metabolites were recovered in the blood. B[a]P significantly suppressed the proliferative response of both T and B cells after a sub-acute administration, an effect that was completely reversed by vaccination. In immunized mice also the immunotoxic effect of B[a]P on IFN-gamma, IL-12, TNF-alpha production and the reduced B cell activation was restored. Finally, our results showed that specific antibodies inhibited the induction of Cyp1a1 by B[a]P in lymphocytes and Cyp1b1 in the liver, enzymes that are known to convert the procarcinogen B[a]P to the ultimate DNA-adduct forming metabolite, a major risk factor of chemical carcinogenesis. Thus, we demonstrate that vaccination with a B[a]P conjugate vaccine based on a carrier protein used in licensed human vaccines reduces immunotoxicity and possibly other detrimental effects associated with B[a]P. PMID:19573549

  8. GROWTH RESPONSE OF STACHYBOTRYS CHARTARUM TO MOISTURE VARIATION ON COMMON BUILDING MATERIALS

    EPA Science Inventory

    The mold Stachybotrys chartarum has been found to be associated with idiopathic pulmonary hemorrhage in infants and has been studied for toxin production and its occurrence in water damaged buildings. Growth of S. chartarum on building materials such as drywall has been frequentl...

  9. FACTORS RELATING TO THE RELEASE OF STACHYBOTRYS CHARTARUM SPORES FROM CONTAMINATED SOURCES

    EPA Science Inventory

    The paper describes preliminary results of a research project to determine the factors that control the release of S. chartarum spores from a contaminated source and test ways to reduce spore release and thus exposure. As anticipated, S. chartarum spore emissions from gypsum boar...

  10. ELISA MEASUREMENT OF STACHYLYSIN IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Problem- To develop a measurable indicator of human exposure to Stachybotys chartarum.

    Methods- Antibodies were produced against the hemolytic agent stachylysin obtained from the mold S. chartarum. These antibodies were used to develop two enzyme-linked immunosorbent ass...

  11. GERMINATION, VIABILITY AND CLEARANCE OF STACHYBOTRYS CHARTARUM IN THE LUNGS OF INFANT RATS

    EPA Science Inventory

    The fungus Stachybotrys chartarum has been associated with many adverse health effects including the condition known as idiopathic pulmonary hemorrhage in infants. In order to gain some insight into possible mechanisms, viable conidia of S. chartarum were instilled into the lung...

  12. Use of SRBC antibody responses for immunotoxicity testing.

    PubMed

    Ladics, Gregory S

    2007-01-01

    The production of antigen-specific antibodies represents a major defense mechanism of humoral immune responses and involves the cooperation and interaction of several immune cell types: antigen presenting cells, T helper cells, and B cells. Thus, there are several cells or cell products (e.g., interleukins) that may be altered following xenobiotic exposure, making assays that evaluate the production of antigen specific antibody a relatively comprehensive and sensitive assessment of immune function. Data suggest that the primary antibody response to SRBC may be one of the most sensitive endpoints available to assess chemical-induced alterations to the immune system. As a result, this endpoint has become the cornerstone of several recently established guidelines for assessing the potential immunotoxicity of xenobiotics. Five types of antibody may be produced in a humoral immune response (i.e., IgGs of various subtypes, IgM, IgD, IgA, or IgE). For immunotoxicity assessment, the focus has primarily been on assays that assess production of IgM antibodies. Although a number of assays have been developed to evaluate antibody production, the antibody forming cell (AFC) assay and enzyme-linked immunosorbent assay (ELISA) are the two most frequently employed to evaluate the potential immunotoxicity of a xenobiotic. In this manuscript, background information, as well as the pros and cons of each of these assays are discussed and detailed methods on conducting each assay are provided. PMID:17161298

  13. The Peptide Toxin Amylosin of Bacillus amyloliquefaciens from Moisture-Damaged Buildings Is Immunotoxic, Induces Potassium Efflux from Mammalian Cells, and Has Antimicrobial Activity

    PubMed Central

    Teplova, Vera V.; Andersson, Maria A.; Mikkola, Raimo; Kankkunen, Päivi; Matikainen, Sampsa; Gahmberg, Carl G.; Andersson, Leif C.; Salkinoja-Salonen, Mirja

    2015-01-01

    Amylosin, a heat-stable channel-forming non-ribosomally synthesized peptide toxin produced by strains of Bacillus amyloliquefaciens isolated from moisture-damaged buildings, is shown in this paper to have immunotoxic and cytotoxic effects on human cells as well as antagonistic effects on microbes. Human macrophages exposed to 50 ng of amylosin ml−1 secreted high levels of cytokines interleukin-1β (IL-1β) and IL-18 within 2 h, indicating activation of the NLRP3 inflammasome, an integral part of the innate immune system. At the same exposure level, expression of IL-1β and IL-18 mRNA increased. Amylosin caused dose-dependent potassium ion efflux from all tested mammalian cells (human monocytes and keratinocytes and porcine sperm cells) at 1 to 2 μM exposure. Amylosin also inhibited the motility of porcine sperm cells and depolarized the mitochondria of human keratinocytes. Amylosin may thus trigger the activation of the NLRP3 inflammasome and subsequently cytokine release by causing potassium efflux from exposed cells. The results of this study indicate that exposure to amylosin activates the innate immune system, which could offer an explanation for the inflammatory symptoms experienced by occupants of moisture-damaged buildings. In addition, the amylosin-producing B. amyloliquefaciens inhibited the growth of both prokaryotic and eukaryotic indoor microbes, and purified amylosin also had an antimicrobial effect. These antimicrobial effects could make amylosin producers dominant and therefore significant causal agents of health problems in some moisture-damaged sites. PMID:25681192

  14. Immunotoxic effects of cyclophosphamide and cyclosporine in the dog.

    PubMed

    Legrand, Jean-Jacques; Bouchez, Caroline; Mimouni, Cécile; N'Guyen, Armelle; Bouchard, Johanne; Ameller, Thibault; Descotes, Jacques

    2013-01-01

    Limited non-clinical immunotoxicity data are available in the dog, although this is a major non-rodent species in regulatory safety studies. The present study aimed to test whether widely accepted immunotoxicity endpoints including lymphocyte subset immunophenotyping, the anti-KLH TDAR assay, and histological examination of the main lymphoid organs were reliable to detect immunosuppression induced by cyclosporine and cyclophosphamide in dogs and could, therefore, be used for non-clinical immunotoxicity evaluation in this species. Male and female Beagle dogs were treated orally from Day 1 for 4 weeks with 25 mg/kg cyclosporine daily, or with 2 mg/kg cyclophosphamide on 4 consecutive days each week, or the same volume of drinking water daily. Blood samples were withdrawn pre-test and on Days 11, 18, and 23 to measure standard hematology parameters and analyze lymphocyte subsets. All animals received an intramuscular injection of 5 mg KLH on Day 11. Sandwich ELISA assays were used to quantify anti-KLH IgM and anti-KLH IgG levels in blood samples taken pre-test, on Days 18 and 23, and pre-test, on Days 23 and 28, respectively. At the end of the treatment period, all animals were submitted to histological examination of lymphoid organs, liver, and kidneys. No signs of marked toxicity were observed. No changes in lymphocyte subsets, but markedly decreased primary anti-KLH IgM and IgG responses, and a slightly-to-markedly increased cortex/medulla ratio in the thymus were observed in cyclosporine-treated dogs. Lower total WBC counts correlating with lower total and B-lymphocyte subset and decreased germinal center development in mesenteric lymph nodes, but no changes in primary anti-KLH IgM and IgG responses were observed in cyclophosphamide-treated dogs. These results demonstrate that widely accepted immunotoxicity endpoints can adequately detect the effects of known immunosuppressive drugs in the dog and support the conclusion that it is a relevant animal species

  15. From immunotoxicity to carcinogenicity: the effects of carbamate pesticides on the immune system.

    PubMed

    Dhouib, Ines; Jallouli, Manel; Annabi, Alya; Marzouki, Soumaya; Gharbi, Najoua; Elfazaa, Saloua; Lasram, Mohamed Montassar

    2016-05-01

    The immune system can be the target of many chemicals, with potentially severe adverse effects on the host's health. In the literature, carbamate (CM) pesticides have been implicated in the increasing prevalence of diseases associated with alterations of the immune response, such as hypersensitivity reactions, some autoimmune diseases and cancers. CMs may initiate, facilitate, or exacerbate pathological immune processes, resulting in immunotoxicity by induction of mutations in genes coding for immunoregulatory factors and modifying immune tolerance. In the present study, direct immunotoxicity, endocrine disruption and inhibition of esterases activities have been introduced as the main mechanisms of CMs-induced immune dysregulation. Moreover, the evidence on the relationship between CM pesticide exposure, dysregulation of the immune system and predisposition to different types of cancers, allergies, autoimmune and infectious diseases is criticized. In addition, in this review, we will discuss the relationship between immunotoxicity and cancer, and the advances made toward understanding the basis of cancer immune evasion. PMID:26988364

  16. Indoor Mold, Toxigenic Fungi, and Stachybotrys chartarum: Infectious Disease Perspective

    PubMed Central

    Kuhn, D. M.; Ghannoum, M. A.

    2003-01-01

    Damp buildings often have a moldy smell or obvious mold growth; some molds are human pathogens. This has caused concern regarding health effects of moldy indoor environments and has resulted in many studies of moisture- and mold-damaged buildings. Recently, there have been reports of severe illness as a result of indoor mold exposure, particularly due to Stachybotrys chartarum. While many authors describe a direct relationship between fungal contamination and illness, close examination of the literature reveals a confusing picture. Here, we review the evidence regarding indoor mold exposure and mycotoxicosis, with an emphasis on S. chartarum. We also examine possible end-organ effects, including pulmonary, immunologic, neurologic, and oncologic disorders. We discuss the Cleveland infant idiopathic pulmonary hemorrhage reports in detail, since they provided important impetus for concerns about Stachybotrys. Some valid concerns exist regarding the relationship between indoor mold exposure and human disease. Review of the literature reveals certain fungus-disease associations in humans, including ergotism (Claviceps species), alimentary toxic aleukia (Fusarium), and liver disease (Aspergillys). While many papers suggest a similar relationship between Stachybotrys and human disease, the studies nearly uniformly suffer from significant methodological flaws, making their findings inconclusive. As a result, we have not found well-substantiated supportive evidence of serious illness due to Stachybotrys exposure in the contemporary environment. To address issues of indoor mold-related illness, there is an urgent need for studies using objective markers of illness, relevant animal models, proper epidemiologic techniques, and examination of confounding factors. PMID:12525430

  17. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  18. Coexposure to Mercury Increases Immunotoxicity of Trichloroethylene

    PubMed Central

    Gilbert, Kathleen M.; Rowley, Benjamin; Gomez-Acevedo, Horacio; Blossom, Sarah J.

    2011-01-01

    We have shown previously that chronic (32 weeks) exposure to occupationally relevant concentrations of the environmental pollutant trichloroethylene (TCE) induced autoimmune hepatitis (AIH) in autoimmune-prone MRL+/+ mice. In real-life, individuals are never exposed to only one chemical such as TCE. However, very little is known about the effects of chemical mixtures on the immune system. The current study examined whether coexposure to another known immunotoxicant, mercuric chloride (HgCl2), altered TCE-induced AIH. Female MRL+/+ mice were treated for only 8 weeks with TCE (9.9 or 186.9 mg/kg/day in drinking water) and/or HgCl2 (260 μg/kg/day, sc). Unlike mice exposed to either TCE or HgCl2 alone, mice exposed to both toxicants for 8 weeks developed significant liver pathology commensurate with early stages of AIH. Disease development in the coexposed mice was accompanied by a unique pattern of anti-liver and anti-brain antibodies that recognized, among others, a protein of approximately 90 kDa. Subsequent immunoblotting showed that sera from the coexposed mice contained antibodies specific for heat shock proteins, a chaperone protein targeted by antibodies in patients with AIH. Thus, although TCE can promote autoimmune disease following chronic exposure, a shorter exposure to a binary mixture of TCE and HgCl2 accelerated disease development. Coexposure to TCE and HgCl2 also generated a unique liver-specific antibody response not found in mice exposed to a single toxicant. This finding stresses the importance of including mixtures in assessments of chemical immunotoxicity. PMID:21084432

  19. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo

    PubMed Central

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  20. Value of phagocyte function screening for immunotoxicity of nanoparticles in vivo.

    PubMed

    Fröhlich, Eleonore

    2015-01-01

    Nanoparticles (NPs) present in the environment and in consumer products can cause immunotoxic effects. The immune system is very complex, and in vivo studies are the gold standard for evaluation. Due to the increased amount of NPs that are being developed, cellular screening assays to decrease the amount of NPs that have to be tested in vivo are highly needed. Effects on the unspecific immune system, such as effects on phagocytes, might be suitable for screening for immunotoxicity because these cells mediate unspecific and specific immune responses. They are present at epithelial barriers, in the blood, and in almost all organs. This review summarizes the effects of carbon, metal, and metal oxide NPs used in consumer and medical applications (gold, silver, titanium dioxide, silica dioxide, zinc oxide, and carbon nanotubes) and polystyrene NPs on the immune system. Effects in animal exposures through different routes are compared to the effects on isolated phagocytes. In addition, general problems in the testing of NPs, such as unknown exposure doses, as well as interference with assays are mentioned. NPs appear to induce a specific immunotoxic pattern consisting of the induction of inflammation in normal animals and aggravation of pathologies in disease models. The evaluation of particle action on several phagocyte functions in vitro may provide an indication on the potency of the particles to induce immunotoxicity in vivo. In combination with information on realistic exposure levels, in vitro studies on phagocytes may provide useful information on the health risks of NPs. PMID:26060398

  1. Immunotoxicity of zinc oxide nanoparticles with different size and electrostatic charge.

    PubMed

    Kim, Cheol-Su; Nguyen, Hai-Duong; Ignacio, Rosa Mistica; Kim, Jae-Hyun; Cho, Hyeon-Cheol; Maeng, Eun Ho; Kim, Yu-Ri; Kim, Meyoung-Kon; Park, Bae-Keun; Kim, Soo-Ki

    2014-01-01

    While zinc oxide (ZnO) nanoparticles (NPs) have been recognized to have promising applications in biomedicine, their immunotoxicity has been inconsistent and even contradictory. To address this issue, we investigated whether ZnO NPs with different size (20 or 100 nm) and electrostatic charge (positive or negative) would cause immunotoxicity in vitro and in vivo, and explored their underlying molecular mechanism. Using Raw 264.7 cell line, we examined the immunotoxicity mechanism of ZnO NPs as cell viability. We found that in a cell viability assay, ZnO NPs with different size and charge could induce differential cytotoxicity to Raw 264.7 cells. Specifically, the positively charged ZnO NPs exerted higher cytotoxicity than the negatively charged ones. Next, to gauge systemic immunotoxicity, we assessed immune responses of C57BL/6 mice after oral administration of 750 mg/kg/day dose of ZnO NPs for 2 weeks. In parallel, ZnO NPs did not alter the cell-mediated immune response in mice but suppressed innate immunity such as natural killer cell activity. The CD4(+)/CD8(+) ratio, a marker for matured T-cells was slightly reduced, which implies the alteration of immune status induced by ZnO NPs. Accordingly, nitric oxide production from splenocyte culture supernatant in ZnO NP-fed mice was lower than control. Consistently, serum levels of pro/anti-inflammatory (interleukin [IL]-1β, tumor necrosis factor-α, and IL-10) and T helper-1 cytokines (interferon-γ and IL-12p70) in ZnO NP-fed mice were significantly suppressed. Collectively, our results indicate that different sized and charged ZnO NPs would cause in vitro and in vivo immunotoxicity, of which nature is an immunosuppression. PMID:25565837

  2. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements.

    PubMed

    Giannakou, Christina; Park, Margriet Vdz; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  3. A comparison of immunotoxic effects of nanomedicinal products with regulatory immunotoxicity testing requirements

    PubMed Central

    Giannakou, Christina; Park, Margriet VDZ; de Jong, Wim H; van Loveren, Henk; Vandebriel, Rob J; Geertsma, Robert E

    2016-01-01

    Nanomaterials (NMs) are attractive for biomedical and pharmaceutical applications because of their unique physicochemical and biological properties. A major application area of NMs is drug delivery. Many nanomedicinal products (NMPs) currently on the market or in clinical trials are most often based on liposomal products or polymer conjugates. NMPs can be designed to target specific tissues, eg, tumors. In virtually all cases, NMPs will eventually reach the immune system. It has been shown that most NMs end up in organs of the mononuclear phagocytic system, notably liver and spleen. Adverse immune effects, including allergy, hypersensitivity, and immunosuppression, have been reported after NMP administration. Interactions of NMPs with the immune system may therefore constitute important side effects. Currently, no regulatory documents are specifically dedicated to evaluate the immunotoxicity of NMs or NMPs. Their immunotoxicity assessment is performed based on existing guidelines for conventional substances or medicinal products. Due to the unique properties of NMPs when compared with conventional medicinal products, it is uncertain whether the currently prescribed set of tests provides sufficient information for an adequate evaluation of potential immunotoxicity of NMPs. The aim of this study was therefore, to compare the current regulatory immunotoxicity testing requirements with the accumulating knowledge on immunotoxic effects of NMPs in order to identify potential gaps in the safety assessment. This comparison showed that immunotoxic effects, such as complement activation-related pseudoallergy, myelosuppression, inflammasome activation, and hypersensitivity, are not readily detected by using current testing guidelines. Immunotoxicity of NMPs would be more accurately evaluated by an expanded testing strategy that is equipped to stratify applicable testing for the various types of NMPs. PMID:27382281

  4. AN EXTRACT OF STACHYBOTRYS CHARTARUM CAUSES ALLERGIC RESPONSES IN A BALB/C MOUSE MODEL: I. BIOCHEMICAL AND PATHOLOGICAL RESPONSES

    EPA Science Inventory

    Environmental exposure to Stachybotrys chartarum has been associated with adverse health effects in humans. The goal of this study was to assess soluble components of this fungus for allergenic potential. Five isolates of S. chartarum were combined and extracted to form a crude...

  5. In vitro evaluation of the immunotoxic potential of perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Avogadro, Anna; Galbiati, Valentina; Dell'Agli, Mario; Marinovich, Marina; Galli, Corrado L.; Germolec, Dori R.

    2011-01-15

    There is evidence from both epidemiology and laboratory studies that perfluorinated compounds may be immunotoxic, affecting both cell-mediated and humoral immunity. The overall goal of this study was to investigate the mechanisms underlying the immunotoxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctane acid (PFOA), using in vitro assays. The release of the pro-inflammatory cytokines IL-6, IL-8, and TNF-{alpha} was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes and in the human promyelocytic cell line THP-1, while the release of IL-4, IL-10 and IFN-{gamma} was evaluated in phytohaemagglutinin (PHA)-stimulated peripheral blood leukocytes. PFOA and PFOS suppressed LPS-induced TNF-{alpha} production in primary human cultures and THP-1 cells, while IL-8 was suppressed only in THP-1 cells. IL-6 release was decreased only by PFOS. Both PFOA and PFOS decreased T-cell derived, PHA-induced IL-4 and IL-10 release, while IFN-{gamma} release was affected only by PFOS. In all instances, PFOS was more potent than PFOA. Mechanistic investigations carried out in THP-1 cells demonstrated that the effect on cytokine release was pre-transcriptional, as assessed by a reduction in LPS-induced TNF-{alpha} mRNA expression. Using siRNA, a role for PPAR-{alpha} could be demonstrated for PFOA-induced immunotoxicity, while an inhibitory effect on LPS-induced I-{kappa}B degradation could explain the immunomodulatory effect of PFOS. The dissimilar role of PPAR-{alpha} in PFOA and PFOS-induced immunotoxicity was consistent with the differing effects observed on LPS-induced MMP-9 release: PFOA, as the PPAR-{alpha} agonist fenofibrate, modulated the release, while PFOS had no effect. Overall, these studies suggest that PFCs directly suppress cytokine secretion by immune cells, and that PFOA and PFOS have different mechanisms of action.

  6. Microbial volatile organic compound emissions from Stachybotrys chartarum growing on gypsum wallboard and ceiling tile

    PubMed Central

    2013-01-01

    Background Stachybotrys chartarum is a filamentous mold frequently identified among the mycobiota of water-damaged building materials. Growth of S. chartarum on suitable substrates and under favorable environmental conditions leads to the production of secondary metabolites such as mycotoxins and microbial volatile organic compounds (MVOCs). The aim of this study was to characterize MVOC emission profiles of seven toxigenic strains of S. chartarum, isolated from water-damaged buildings, in order to identify unique MVOCs generated during growth on gypsum wallboard and ceiling tile coupons. Inoculated coupons were incubated and monitored for emissions and growth using a closed glass environmental growth chamber maintained at a constant room temperature. Gas samples were collected from the headspace for three to four weeks using Tenax TA tubes. Results Most of the MVOCs identified were alcohols, ketones, ethers and esters. The data showed that anisole (methoxybenzene) was emitted from all of the S. chartarum strains tested on both types of substrates. Maximum anisole concentration was detected after seven days of incubation. Conclusions MVOCs are suitable markers for fungal identification because they easily diffuse through weak barriers like wallpaper, and could be used for early detection of mold growth in hidden cavities. This study identifies the production of anisole by seven toxigenic strains of Stachybotrys chartarum within a period of one week of growth on gypsum wallboard and ceiling tiles. These data could provide useful information for the future construction of a robust MVOC library for the early detection of this mold. PMID:24308451

  7. The effect of spaceflight on growth of Ulocladium chartarum colonies on the international space station.

    PubMed

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  8. The Effect of Spaceflight on Growth of Ulocladium chartarum Colonies on the International Space Station

    PubMed Central

    Gomoiu, Ioana; Chatzitheodoridis, Elias; Vadrucci, Sonia; Walther, Isabelle

    2013-01-01

    The objectives of this 14 days experiment were to investigate the effect of spaceflight on the growth of Ulocladium chartarum, to study the viability of the aerial and submerged mycelium and to put in evidence changes at the cellular level. U. chartarum was chosen for the spaceflight experiment because it is well known to be involved in biodeterioration of organic and inorganic substrates covered with organic deposits and expected to be a possible contaminant in Spaceships. Colonies grown on the International Space Station (ISS) and on Earth were analysed post-flight. This study clearly indicates that U. chartarum is able to grow under spaceflight conditions developing, as a response, a complex colony morphotype never mentioned previously. We observed that spaceflight reduced the rate of growth of aerial mycelium, but stimulated the growth of submerged mycelium and of new microcolonies. In Spaceships and Space Stations U. chartarum and other fungal species could find a favourable environment to grow invasively unnoticed in the depth of surfaces containing very small amount of substrate, posing a risk factor for biodegradation of structural components, as well as a direct threat for crew health. The colony growth cycle of U. chartarum provides a useful eukaryotic system for the study of fungal growth under spaceflight conditions. PMID:23637980

  9. PERFLUORINATED COMPOUNDS: EMERGING POPs WITH POTENTIAL IMMUNOTOXICITY

    PubMed Central

    Corsini, Emanuela; Luebke, Robert W.; Germolec, Dori R.; DeWitt, Jamie C.

    2015-01-01

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, and surfactants. They possess a strong carbon-fluorine bond, which leads to their environmental persistence. There is evidence from both epidemiology and laboratory studies that PFCs may be immunotoxic, affecting both cell-mediated and humoral immunity. Reported effects of PFCs include decreased spleen and thymus weights and cellularity, reduced antibody production, reduced survival after influenza infection, and altered cytokine production. Immunosuppression is a critical effect associated with exposure to PFCs, as it has been reported to reduce antibody responses to vaccination in children. Mounting evidence suggests that immunotoxicity in experimental animals can occur at serum concentrations below, within, or just above the reported range for highly exposed humans and wildlife. Considering bioaccumulation and exposure to multiple PFCs, the risk of immunotoxicity for humans and wildlife cannot be discounted. This review will discuss current and recently published work exploring the immunomodulatory effects of PFCs in experimental animals and humans. PMID:24503008

  10. Immunotoxic Effect of Low-Dose Methylmercury Is Negligible in Mouse Models of Ovalbumin or Mite-Induced Th2 Allergy.

    PubMed

    Nakamura, Ryosuke; Takanezawa, Yasukazu; Sone, Yuka; Uraguchi, Shimpei; Sakabe, Kou; Kiyono, Masako

    2016-01-01

    Methylmercury (MeHg) is one of the most toxic environmental pollutants and presents a serious hazard to health worldwide. Although the adverse effects of MeHg, including neurotoxicity, have been studied, its effects on immune function, in particular the immune response, remain unclear. This study examined the effects of low-dose MeHg on immune responses in mice. Mice were orally immunized with ovalbumin (OVA) or subcutaneously injected with mite extract to induce a T-helper 2 (Th2) allergic response. They were then exposed to MeHg (0, 0.02, 1.0, or 5.0 mg·kg(-1)·d(-1)). Immunization with oral OVA or subcutaneous mite extract increased serum levels of OVA-specific immunoglobulin (Ig) E (OVA-IgE), OVA-IgG1, interleukin (IL)-4, and IL-13, and total IgE, total IgG, and IL-13 when compared with levels in non-immunized mice. However, no interferon (IFN)-γ was detected. By contrast, serum levels of OVA-IgE, OVA-IgG1, IL-4, and IL-13, or total IgE, total IgG, and IL-13 in Th2 allergy model mice subsequently treated with MeHg were no higher than those in MeHg-untreated mice. These results suggest that MeHg exposure has no adverse effects on Th2 immune responses in antigen-immunized mice. PMID:27476942

  11. In vitro immunotoxicity of environmentally representative antibiotics to the freshwater mussel Elliptio complanata.

    PubMed

    Gust, M; Gélinas, M; Fortier, M; Fournier, M; Gagné, F

    2012-10-01

    The separate and combined in vitro toxic effects of antibiotics (ciprofloxacin, erythromycin, novobiocin, oxytetracycline, sulfamethazole and trimethoprim) commonly found in urban wastewater effluents were assessed on the immune parameters of Elliptio complanata at environmentally relevant concentrations. The observed responses were then compared to those produced by the physicochemical-treated wastewater effluent of a major city before and after the removal of microorganisms. Most of the selected antibiotics, separately and as mixture, induced changes in immune responses. The removal of microorganisms and fine particles from the effluent increased or decreased the resulting immunotoxic effects, depending of the observed parameter. The immunotoxic effects of erythromycin, sulfamethoxazole and trimethoprim were closely associated to the antibiotic mixture and the filtered effluent. In conclusion, the data revealed that the removal of fine particles and microorganisms from municipal effluents can alter the toxic nature of the effluent that is closely associated with the cumulative effects of antibiotics. PMID:22683480

  12. Cutaneous infection caused by Ulocladium chartarum in a heart transplant recipient: case report and review.

    PubMed

    Durán, María Teresa; Del Pozo, Jesús; Yebra, María Teresa; Crespo, María Generosa; Paniagua, María Jesús; Cabezón, María Angeles; Guarro, Josep

    2003-01-01

    A cutaneous mycoses caused by Ulocladium chartarum in a heart transplant recipient is reported. The infection cleared after complete surgical excision and 6 months of oral itraconazole therapy. In vitro activity of amphotericin B, fluconazole, itraconazole, voriconazole, ravuconazole and terbinafine against the clinical isolate is shown. PMID:12816160

  13. The relative allergenicity of Stachybotrys chartarum compared to house dust mite extracts in a mouse model

    EPA Science Inventory

    A report by the Institute of Medicine suggested that more research is needed to better understand mold effects on allergic disease, particularly asthma development. The authors compared the ability of the fungus Stachybotrys chartarum (SCE) and house dust mite (HDM) extracts to i...

  14. CHARACTERIZATION OF MICROBIAL VOLATILE ORGANIC COMPOUNDS (MVOC) EMITTED BY STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is a filamentous fungi usually found in water-damaged buildings. Severe illnesses have been reported after indoor exposure to this mold. Toxicity has caused the production of secondary metabolites or mycotoxins, and the emission of by-products, specifically...

  15. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  16. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  17. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  18. Microbial Volatile Organic Compound Emissions from Stachybotrys chartarum growing on Gypsum Wallboard and Ceiling tile

    EPA Science Inventory

    This study compared seven toxigenic strains of S. chartarum found in water-damaged buildings to characterize the microbial volatile organic compound (MVOC) emissions profile while growing on gypsum wallboard (W) and ceiling tile (C) coupons. The inoculated coupons with their sub...

  19. DESTRUCTION OF ASPERGILLUS VERSICOLOR, PENICILLIUM CRYSOGENUM, STACHYBOTRYS CHARTARUM, AND CLADOSPORIUM CLADOSPORIDES SPORES USING CHEMICAL OXIDATION TREATMENT PROCESS

    EPA Science Inventory

    The survival of aqueous suspensions of Penicillium chrysogenum, Stachybotrys chartarum, Aspergillus versicolor, and Cladosporium cladosporioides spores was evaluated using various combinations of hydrogen peroxide and iron (II) as catalyst. Spores were suspended in water and trea...

  20. QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

    EPA Science Inventory

    The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

  1. Immunotoxic sesquiterpene lactone from Carpesium rosulatum Miq.

    PubMed

    Moon, Hyung-In; Zee, Okpyo

    2011-06-01

    The whole plants of Carpesium rosulatum were chloroform extracted and the isolated sesquiterpene lactones and immunotoxicity effects were studied. The structures and stereochemistry of these compounds were established on the basis of analysis of spectra including mp, [α](D)(25), IR, UV, EI-MS, MS, (1)H-NMR, (13)C-NMR and some chemical transformations as follows: 1 (4β,10α-dihydroxy-guaia-8α,12-olide), 2 (4β,10α-dihydroxy-1(2),11 (13)-guaiadien -8α,12-olide), 3 (3β,8β-dihydroxy-1α,5α-guaian-10(14)-ene-6α,12-olide). 4 (2β,5-epoxy-5,10-dihydroxy-6α,9β-diangeloyloxy-germacran-8α,12-olide) The chloroform extracted had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 13.11 ppm and an LC(90) value of 20.33 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20738151

  2. Study on the impact of lead acetate pollutant on immunotoxicity produced by thiamethoxam pesticide

    PubMed Central

    Sinha, Suprita; Thaker, A. M.

    2014-01-01

    Objective: The curtailed knowledge about neonicotinoids that it has low affinity for vertebrate relative to insect nicotinic receptors is a major factor for its widespread use assuming that it is much safer than the previous generation insecticides. But literature regarding effect of thiamethoxam (second generation neonicotinoid)on immune system is not available. Also, there might be chances of interaction of heavy persistent metals in the water table with these pesticides. So, this study was undertaken with the objective to find immunotoxic alterations of lead acetate after exposure with thiamethoxam in animal model. Materials and Methods: For this albino mice were randomly divided into 6 groups (numbered I to VI) each containing 6 mice. Animals of groups I and II were administered 87.1 mg/kg b.w.(body weight) and 43.5 mg/kg b.w. respectively of thiamethoxam. Group III animals, lead acetate was administered orally and IV and V mice were administered combination of lead acetate and thiamethoxam at higher and lower dose level for 28 days. The group VI was control group. On 29th day and humoral and cell mediated immune responses, TLC (Total leukocyte count), DLC (Differential leukocyte count), serum total protein, globulin and albumin, and histopathological studies were conducted. Result: The result obtained clearly indicated that on oral administration of thiamethoxam immunotoxicity was induced in mice in dose related manner. Lead acetate when administered for 28 days showed immunotoxic potential. Thiamethoxam and lead acetate when administered together did not lead to any new altered immunotoxic response but additive toxic effects of both were observed. PMID:25538329

  3. Immunotoxicity of cocaine and crack.

    PubMed

    Stefanidou, Maria; Loutsidou, Ariadni C; Chasapis, Christos T; Spiliopoulou, Chara A

    2011-06-01

    The toxicity of cocaine and crack was studied on the protozoan Tetrahymena pyriformis, using several endpoints, such as the DNA content of the macronuclei and the phagocytic ability. Both forms induced an increase in the DNA content of the protozoan, which indicates the stimulation of the mitotic process. In contrast, the phagocytic activity, of the protozoan was decreased after the administration of cocaine, an effect that was more extensive after the administration of crack. These results, derived from previous experiments, suggest a possible relationship between the observed immunosuppression in cocaine abusers and the immunosuppression found in the protozoan. This suppression subsequently may play a role in the development of other opportunistic infections in drug abusers. This paper, based on in vivo experiments with the protozoan Tetrahymena, suggests the compromised immune response in cocaine addicts and assures the reported effects of cocaine on immune cell function. PMID:21696343

  4. IMMUNOTOXICITY OF INDIVIDUAL ORGANOTIN COMPOUNDS IN SPRAGUE-DAWLEY RATS

    EPA Science Inventory

    Organotins, used as stabilizers for polyvinyl chloride pipe, leach into drinking water from supply pipes and may cause multisystem toxicity, including immunotoxicity. We assessed immune function in Sprague-Dawley rats exposed to dibutyltin dichloride (DBTC) or dimethyltin dichlor...

  5. The immunotoxic effects of dual exposure to PCP and TCDD.

    PubMed

    Chen, Hsiu-Min; Lee, Yu-Hsuan; Chen, Rong-Jane; Chiu, Hui-Wen; Wang, Bour-Jr; Wang, Ying-Jan

    2013-11-25

    Pentachlorophenol (PCP) was a commonly used fungicide, herbicide, insecticide, and bactericide in industrial, agricultural, and domestic settings; however, it was also contaminated with polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). It has been reported that technical grade PCP had immunosuppressive effects and that the immune system was the major target of PCDD/PCDFs toxicity. Although the immune response after exposure to PCP or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has been studied, the toxic effects of exposure to both PCP and TCDD have not yet been reported. The aim of this study was to evaluate the effects on immune cells from mice intraperitoneally immunized with OVA and subsequently treated with PCP or TCDD alone or in combination by gavage. The animals were terminated on day 7 and 14, and the spleen and plasma samples were collected for immunotoxicity evaluation. The numbers and populations of splenocytes, T cell-derived cytokines produced by splenocytes, splenocyte-generated cytotoxicity and OVA-specific antibodies in plasma were investigated. Our results indicate that the spleen/body weight ratio and splenocyte number was reduced by TCDD alone; in addition, this reduction was enhanced when TCDD was combined with PCP. Exposure to TCDD alone or in conjunction with PCP suppressed many ovalbumin (OVA)-stimulated cytokines, including IL-2, IFN-γ, IL-4, IL-5, and IL-10. Furthermore, the immunoglobulins IgG and IgM were suppressed in mice administered by PCP alone, but the suppressive effects were greater in mice treated with TCDD alone or in combination with PCP. Co-exposure to PCP and TCDD resulted in an antagonistic effect on TCDD-induced suppression of IFN-γ and IL-10. Our results demonstrate that PCP alone is immunotoxic, regardless of the presence of TCDD. PCP led to mild changes in cytokine secretion, and it compromised splenocyte-generated cytotoxicity and IgM and IgG antibody production on day 7. The finding

  6. QUANTIFICATION OF SIDEROPHORE AND HEMOLYSIN FROM STACHYBOTRYS CHARTARUM STRAINS, INCLUDING A STRAIN ISOLATED FROM THE LUNG OF A CHILD WITH PULMONARY HEMORRHAGE AND HEMOSIDEROSIS

    EPA Science Inventory

    A strain of Stachybotrys chartarum was recently isolated from the lung of a pulmonary hemorrhage and hemosiderosis (PH) patient in Texas (designated the Houston strain). This is the first time that S. chartarum has been isolated from the lung of a PH patient. In this study, the ...

  7. MALDI-TOF mass spectrometry fingerprinting: A diagnostic tool to differentiate dematiaceous fungi Stachybotrys chartarum and Stachybotrys chlorohalonata.

    PubMed

    Gruenwald, Maike; Rabenstein, Andreas; Remesch, Markko; Kuever, Jan

    2015-08-01

    Stachybotrys chartarum and Stachybotrys chlorohalonata are two closely related species. Unambiguous identification of these two species is a challenging task if relying solely on morphological criteria and therefore smarter and less labor-intensive approaches are needed. Here we show that even such closely related species of fungi as S. chartarum and S. chlorohalonata are unequivocally discriminated by their highly reproducible MALDI-TOF-MS fingerprints (matrix assisted laser desorption/ionization time-of-flight mass spectrometry fingerprints). We examined 19 Stachybotrys and one Aspergillus isolate by MALDI-TOF-MS. All but one isolate produced melanin containing conidia on malt extract agar. Mass spectra were obtained in good quality from the analysis of hyaline and darkly pigmented conidia by circumventing the property of melanin which causes signal suppression. MALDI-TOF fingerprint analysis clearly discriminated not only the two morphologically similar species S. chartarum and S. chlorohalonata from each other but separated them precisely from Stachybotrys bisbyi and Aspergillus versicolor isolates. Furthermore, even S. chartarum chemotypes A and S could be differentiated into two distinct groups by their MALDI-TOF fingerprints. The chemotypes of S. chartarum isolates were identified by trichodiene synthase 5 (tri5) sequences prior to mass spectra analysis. Additionally, species identities of all isolates were verified by their 18S rRNA and tri5 gene sequences. PMID:26036596

  8. High dispersity of carbon nanotubes diminishes immunotoxicity in spleen

    PubMed Central

    Lee, Soyoung; Khang, Dongwoo; Kim, Sang-Hyun

    2015-01-01

    Background From the various physiochemical material properties, the chemical functionalization order of single-walled carbon nanotubes (swCNTs) has not been considered as a critical factor for modulating immunological responses and toxicological aspects in drug delivery applications. Although most nanomaterials, including carbon nanotubes, are specifically accumulated in spleen, few studies have focused on spleen immunotoxicity. For this reason, this study demonstrated that the dispersity of swCNTs significantly influenced immunotoxicity in vitro and in vivo. Materials and methods For cytotoxicity of swCNTs, MTT assay, reactive oxygen species production, superoxide dismutase activity, cellular uptake, and confocal microscopy were used in macrophages. In the in vivo study, female BALB/c mice were intravenously administered with 1 mg/kg/day of swCNTs for 2 weeks. The body weight, organ weight, hematological change, reverse-transcription polymerase chain reaction, and lymphocyte population were evaluated. Results Different orders of chemical functionalization of swCNTs controlled immunotoxicity. In short, less-dispersed swCNTs caused cytotoxicity in macrophages and abnormalities in immune organs such as spleen, whereas highly dispersed swCNTs did not result in immunotoxicity. Conclusion This study clarified that increasing carboxyl groups on swCNTs significantly mitigated immunotoxicity in vitro and in vivo. Our findings clarified the effective immunotoxicological factors of swCNTs by increasing dispersity of swCNTs and provided useful guidelines for the effective use of nanomaterials. PMID:25878502

  9. Evaluation of Apoptosis in Immunotoxicity Testing

    PubMed Central

    Nagarkatti, Mitzi; Rieder, Sadiye Amcaoglu; Vakharia, Dilip; Nagarkatti, Prakash S.

    2014-01-01

    Immunotoxicity testing is important in determining the toxic effects of chemical substances, medicinal products, airborne pollutants, cosmetics, medical devices, and food additives. The immune system of the host is a direct target of these toxicants, and the adverse effects include serious health complications such as susceptibility to infections, cancer, allergic reactions, and autoimmune diseases. One way to investigate the harmful effects of different chemicals is to study apoptosis in immune cell populations. Apoptosis is defined as the programmed cell death, and in general, this process helps in development and maintains homeostasis. However, in the case of an insult by a toxicant, apoptosis of the immune cells can lead to immunosuppression resulting in the development of cancer and the inability to fight infections. Apoptosis is characterized by cell shrinkage, nuclear condensation, changes in cell membrane and mitochondria, DNA fragmentation into 200 base oligomers, and protein degradation by caspases. Various methods are employed in order to investigate apoptosis. These methods include direct measurement of apoptotic cells with flow cytometry and in situ labeling, as well as RNA, DNA, and protein assays that are indicative of apoptotic molecules. PMID:19967519

  10. [Photosensitization in cattle grazing on pastures of Brahciaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis].

    PubMed

    Andrade, S O; da Silva Lopes, H O; de Almeida Barros, M; Leite, G G; Dias, S M; Saueressig, M; Nobre, D; Temperini, J A

    1978-01-01

    Aspects of photosensitization in bovines grazing on pastures of Brachiaria decumbens Stapf infested with Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures 45(2):117-136, 1978. This paper reports experimental studies on photosensitization in bovines grazing on different pastures of Brachiaria decumbens Stapf in the "Cerrados" region (Planaltina, DF). Climatic conditions, zinc content and occurence of fungi on pastures were investigated. Pithomyces chartarum (Berk. & Curt.) M.B. Ellis infested all pastures examined. Photosensitization was observed in one animal maintained on a pasture of B. decumbens formed with seeds from Australia. Clinical and necropsy data were similar to those related in literature for sporidesmin-intoxicated animals. An isolate of P. chartarum and samples of bovine bile were assayed for sporidesmin presence. PMID:573108

  11. Enantioselective developmental toxicity and immunotoxicity of pyraclofos toward zebrafish (Danio rerio).

    PubMed

    Zhuang, Shulin; Zhang, Zhisheng; Zhang, Wenjing; Bao, Lingling; Xu, Chao; Zhang, Hu

    2015-02-01

    Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially affects IL-1β-dependent proinflammatory signal transduction. Our in vitro and in silico studies provided a better insight into the molecular basis for aquatic toxicity and thus improved the risk assessment for pyraclofos and other chiral organophosphorus pesticides. PMID:25540855

  12. Detection of Airborne Stachybotrys chartarum Macrocyclic Trichothecene Mycotoxins in the Indoor Environment

    PubMed Central

    Brasel, T. L.; Martin, J. M.; Carriker, C. G.; Wilson, S. C.; Straus, D. C.

    2005-01-01

    The existence of airborne mycotoxins in mold-contaminated buildings has long been hypothesized to be a potential occupant health risk. However, little work has been done to demonstrate the presence of these compounds in such environments. The presence of airborne macrocyclic trichothecene mycotoxins in indoor environments with known Stachybotrys chartarum contamination was therefore investigated. In seven buildings, air was collected using a high-volume liquid impaction bioaerosol sampler (SpinCon PAS 450-10) under static or disturbed conditions. An additional building was sampled using an Andersen GPS-1 PUF sampler modified to separate and collect particulates smaller than conidia. Four control buildings (i.e., no detectable S. chartarum growth or history of water damage) and outdoor air were also tested. Samples were analyzed using a macrocyclic trichothecene-specific enzyme-linked immunosorbent assay (ELISA). ELISA specificity was tested using phosphate-buffered saline extracts of the fungal genera Aspergillus, Chaetomium, Cladosporium, Fusarium, Memnoniella, Penicillium, Rhizopus, and Trichoderma, five Stachybotrys strains, and the indoor air allergens Can f 1, Der p 1, and Fel d 1. For test buildings, the results showed that detectable toxin concentrations increased with the sampling time and short periods of air disturbance. Trichothecene values ranged from <10 to >1,300 pg/m3 of sampled air. The control environments demonstrated statistically significantly (P < 0.001) lower levels of airborne trichothecenes. ELISA specificity experiments demonstrated a high specificity for the trichothecene-producing strain of S. chartarum. Our data indicate that airborne macrocyclic trichothecenes can exist in Stachybotrys-contaminated buildings, and this should be taken into consideration in future indoor air quality investigations. PMID:16269780

  13. Assessment of immunotoxicity using precision-cut tissue slices

    PubMed Central

    2013-01-01

    1. When the immune system encounters incoming infectious agents, this generally leads to immunity. The evoked immune response is usually robust, but can be severely perturbed by potentially harmful environmental agents such as chemicals, pharmaceuticals and allergens. 2. Immunosuppression, hypersensitivity and autoimmunity may occur due to changed immune activity. Evaluation of the immunotoxic potency of agents as part of risk assessment is currently established in vivo with animal models and in vitro with cell lines or primary cells. 3. Although in vivo testing is usually the most relevant situation for many agents, more and more in vitro models are being developed for assessment of immunotoxicity. In this context, hypersensitivity and immunosuppression are considered to be a primary focus for developing in vitro methods. Three-dimensional organotypic tissue models are also part of current research in immunotoxicology. 4. In recent years, there has been a revival of interest in organotypic tissue models. In the context of immunotoxicity testing, precision-cut lung slices in particular have been intensively studied. Therefore, this review is very much focused on pulmonary immunotoxicology. Respiratory hypersensitivity and inflammation are further highlighted aspects of this review. Immunotoxicity assessment currently is of limited use in other tissue models, which are therefore described only briefly within this review. PMID:23199366

  14. ASSESSMENT OF IMMUNOTOXIC POTENTIAL OF THE FUNGICIDE DINOCAP IN MICE

    EPA Science Inventory

    The immunotoxic potential of dinocap was evaluated in female C57BL/6J mice following in vivo and in vitro exposure to this fungicide. n in vivo studies, groups of mice were dosed by gavage with technical grade dinocap at dosages ranging from 12.5 to 50 mg/kg/d for seven or twelve...

  15. Immunotoxical evaluation of St. Lawrence beluga whales (Deiphinapterus leucas)

    SciTech Connect

    Guise, S. De; Fournier, M.; Martineau, D.; Beland, P.

    1995-12-31

    An isolated population of beluga whales live in the St. Lawrence estuary. From approximately 5,000 at the beginning of the century, they now number 500 and their number has not increased since the last 10 years. High concentrations of environmental contaminants including organohalogens (mostly PCBs and DDT), as well as heavy metals (mostly mercury and lead) and HAP exposure have been demonstrated in tissues of these animals. A high incidence of diverse and severe lesions including infections with mildly pathogenic bacteria and numerous tumors were found upon examination of carcasses from the same population. An immunotoxicological evaluation of St. Lawrence beluga whales compared to relatively unpolluted Arctic animals was undertaken to study the possibility of a contaminants induced immunosuppression which would explain the diversity and severity of those lesions. As a first step, several assays were developed to evaluate immune functions in beluga whales, and baseline data were established using Arctic animals. In vitro exposure of Arctic beluga lymphocytes to single contaminants present in St. Lawrence beluga blubber were also performed and showed a suppression of proliferation of lymphocytes with concentrations of mercury below those found in liver of adult St. Lawrence animals. Animal models were also developed to evaluate the immunotoxic potential of the mixture of contaminants found in blubber of St. Lawrence belugas. Rats were fed lipids from either St. Lawrence or Arctic belugas or a mixture of the two groups, and immune functions will be evaluated in these animals. Finally, the last step of the study will be to catch belugas in the St. Lawrence, evaluate their immune functions, compare them to those of Arctic animals and relate them to concentrations of the different contaminants measured in their blubber and plasma.

  16. N-acetylcysteine reverses immunotoxic effects of methyl mercury and augments murine lymphocyte proliferation in vitro

    SciTech Connect

    Omara, F.; Fournier, M.; Bernier, J.; Blakley, B.

    1995-12-31

    N-Acetylcysteine (NAC) is a thiol antioxidant used clinically to treat chronic inflammatory lung disorders and acetaminophen poisoning in humans. The authors evaluated in vitro the effect of NAC on mitogen-induced blastogenesis in C57BI/6 mouse splenocytes by {sup 3}H-thymidine uptake, and its ability to protect against the immunotoxic effects of methyl mercury on lymphocyte proliferation. Lymphocyte proliferation stimulated by optimal and suboptimal concentrations of concanavalin A (Con A), lipopolysaccharide (LPS), or a combination of calcium ionophore A23187 and phorbol-12-myristate-13-acetate (PMA) were markedly enhanced by NAC. NAC itself was a weak mitogen. The kinetics of the NAC effect on splenocyte proliferation were mitogen dependent. NAC enhanced Con A-induced splenocyte proliferation in a dose-dependent and linear manner but enhanced the LPS-induced response at 50--400 {micro}g/ml of NAC followed by a decline in response to control value at higher concentrations. In splenocytes stimulated with PMA plus A23187, NAC increased proliferation at 50--200 pg/ml followed by a constant response at 200--1,000 {micro}g/ml NAC. When splenocytes were stimulated with higher concentrations of Con A (10 {micro}g/ml) or LPS (150 {micro}g/ml) which markedly suppress splenocyte proliferation, NAC significantly enhanced the Con A-induced response and reversed the inhibitory effect of high concentrations of LPS. NAC also protected lymphocytes against mitogen activation-induced cell death. Methyl mercury at 5 {times} 10{sup {minus}7}--1 {times} 10{sup {minus}6} suppressed Con A- and LPS-induced splenocyte proliferation by over 80%. However, NAC completely reversed the immunotoxic effects of methyl mercury on the mitogen-induced splenocyte proliferation even when the cells were pre-incubated with methyl mercury for 6 or 24 hr before stimulation with the mitogens.

  17. Assessment of Immunotoxicity of Dextran Coated Ferrite Nanoparticles in Albino Mice

    PubMed Central

    Syama, Santhakumar; Gayathri, Viswanathan; Mohanan, Parayanthala Valappil

    2015-01-01

    In this study, dextran coated ferrite nanoparticles (DFNPs) of size <25 nm were synthesized, characterized, and evaluated for cytotoxicity, immunotoxicity, and oxidative stress by in vitro and in vivo methods. Cytotoxicity was performed in vitro using splenocytes with different concentrations of DFNPs. Gene expression of selected cytokines (IL-1, IL-10, and TNF β) secretion by splenocytes was evaluated. Also, 100 mg of DFNPs was injected intraperitoneally to 18 albino mice for immunological stimulations. Six animals each were sacrificed at the end of 7, 14, and 21 days. Spleen was subjected to immunotoxic response and liver was analyzed for antioxidant parameters (lipid peroxidation, reduced glutathione, glutathione peroxidase, superoxide dismutase, and glutathione reductase). The results indicated that DFNPs failed to induce any immunological reactions and no significant alternation in antioxidant defense mechanism. Also, mRNA expression of the cytokines revealed an increase in IL-10 expression and subsequent decreased expression of IL-1 and TNF β. Eventually, DNA sequencing of liver actin gene revealed base alteration in nonconserved regions (10–20 bases) of all the treated groups when compared to control samples. Hence, it can be concluded that the DFNPs were nontoxic at the cellular level and nonimmunotoxic when exposed intraperitoneally to mice. PMID:26576301

  18. Subchronic immunotoxicity and screening of reproductive toxicity and developmental immunotoxicity following single instillation of HIPCO-single-walled carbon nanotubes: purity-based comparison.

    PubMed

    Park, Eun-Jung; Choi, Je; Kim, Jae-Ho; Lee, Byoung-Seok; Yoon, Cheolho; Jeong, Uiseok; Kim, Younghun

    2016-10-01

    Impurity has been suggested as an important factor determining toxicity following exposure to single-walled carbon nanotubes (SWCNTs). In this study, we first compared immunotoxicity based on iron content on day 90 after a single intratracheal instillation of SWCNTs in male and female mice. The inflammatory responses were generally stronger in mice exposed to acid-purified (P)-SWCNTs compared to raw (R)-SWCNTs. In addition, both R- and P-SWCNTs induced Th1-polarized immune responses with apoptotic death of BAL cells and systemically impaired the function of antigen-presenting cells (APC). We also screened reproductive and developmental toxicity by cohabitating male and female mice on day 14 after instillation. Interestingly, the pregnancy rate rapidly decreased following exposure to both types of SWCNTs, especially R-SWCNTs. In addition, we investigated developmental immunotoxicity of the offspring on day 28 after exposure to both types of SWCNTs. Their hematological changes were clearer relative to those of the parents and a significant decrease in the alkaline phosphatase and potassium levels was observed in mice of both sexes exposed to the higher dose of R- and P-SWCNTs. In conclusion, we suggest that SWCNTs may induce Th1-polarized immune responses accompanied by suppression of APC function on day 90 after a single instillation without significant iron content dependance. In addition, the consecutive exposure of SWCNTs to the subsequent generation may exacerbate metabolic and hematological disturbance. Furthermore, our results underscore the need to clarify the reproductive and developmental health effects of SWCNTs. PMID:27310831

  19. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  20. ELISA MEASUREMENT OF STACHYLYSIN (TM) IN SERUM TO QUANTIFY HUMAN EXPOSURES TO THE INDOOR MOLD STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Antibodies were produced against the hemolytic agent stachylysin obtained from the mold Stachybotryis chartarum. These antibodies were used to develop two enzyme-linked immunosorbent assay (ELISA) methods for the analysis of stachylysin in human and rat sera and environmental sa...

  1. RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF STACHYBOTRYS CHARTARUM IN BALB/C MICE

    EPA Science Inventory

    RESPIRATORY PHYSIOLOGICAL AND ALLERGIC-TYPE RESPONSES TO AN EXTRACT OF Stachybotrys chartarum IN BALB/C MICE. ME Viana1, N Haykal-Coates2, S H Gavett2, MJ Selgrade2, and M D W Ward2. 1APR/CVM, NCSU, Raleigh, NC, USA. 2NHEERL, ORD, US EPA, RTP, NC, USA.
    Rationale: assess the ab...

  2. 28-Day dietary exposure of mice to a low total dose (7 mg/kg) of perfluorooctanesulfonate (PFOS) alters neither the cellular compositions of the thymus and spleen nor humoral immune responses: does the route of administration play a pivotal role in PFOS-induced immunotoxicity?

    PubMed

    Qazi, Mousumi Rahman; Nelson, B Dean; Depierre, Joseph W; Abedi-Valugerdi, Manuchehr

    2010-01-12

    Short-term exposure of mice to high doses of perfluorooctanesulfonate (PFOS), an ubiquitous and highly persistent environmental contaminant, induces various metabolic changes and toxic effects, including immunotoxicity. However, extrapolation of these findings to the long-term, low-dose exposures to which humans are subject is highly problematic. In this connection, recent studies have concluded that sub-chronic (28-day) exposure of mice by oral gavage to doses of PFOS that result in serum levels comparable to those found in general human populations suppress adaptive immunity. Because of the potential impact of these findings on environmental research and monitoring, we have examined here whether sub-chronic dietary exposure (a major route of human exposure) to a similarly low-dose of PFOS also suppress adaptive immune responses. Dietary treatment of male B6C3F1 mice for 28 days with a dose of PFOS that resulted in a serum concentration of 11mug/ml (ppm) significantly reduced body weight gain and increased liver mass. However, this treatment did not alter the cellular compositions of the thymus and spleen; the number of splenic cells secreting IgM antibodies against sheep red blood cell (SRBC); serum levels of IgM and IgG antibodies specifically towards SRBC; or circulating levels of IgM antibodies against the T-cell-independent antigen trinitrophenyl conjugated to lipopolysaccharide (TNP-LPS). These findings indicate that such sub-chronic dietary exposure of mice to PFOS resulting in serum levels approximately 8-85-fold greater than those observed in occupationally exposed individuals does not exert adverse effects on adaptive immunity. PMID:19900501

  3. Current status and burning issues in immunotoxicity testing of drugs

    SciTech Connect

    Laan, Jan Willem van der . E-mail: jan-willem.van.der.laan@rivm.nl; Loveren, Henk van

    2005-09-01

    Besides pathology endpoints, additional immune function endpoints have been included in the Note for Guidance on Repeated Dose Toxicity by the European Union (July 2001), which concern the analysis of antibody responses to a T-cell-dependent antigen. Guidance papers of other regulatory authorities are published as well. The main issue is the need for functional immunotoxicity testing to detect unintended immunosuppression. The International Conference on Harmonization (ICH) has surveyed studies from the files of the pharmaceutical industry to find the proportion of compounds that can be detected by additional immunotoxicity testing. Preliminary analysis shows that 10-15% of the compounds in the survey only react positively to the additional tests. More data are requested from the pharmaceutical industry. The Expert Working Group of the ICH has decided to choose a cause-for-concern approach to immmunotoxicity rather than a routine-screening approach. The causes for concern are to be defined during ICH negotiations.

  4. Immunotoxicity and immunogenicity of biopharmaceuticals: design concepts and safety assessment.

    PubMed

    Bhogal, Nirmala

    2010-10-01

    The biopharmaceutical market has grown steadily since the early 1980s and today over 150 protein biopharmaceuticals have been approved for clinical use. These products often exhibit forms of immunotoxicity that often only come to light during clinical studies. The predictive value of animal studies and traditional in vitro screens is questionable, with few existing methods able to predict immunotoxicity in a way that is useful for estimating risk for entire patient populations for a specific, and often unique, product. Here, the relative merits of rational design and alternative strategies for immunotoxicity testing are considered with reference to the outcomes of preclinical and clinical studies on biopharmaceuticals. Specific reference is made to the prediction of immunogenicity using organotypic models, transgenic models of autoimmunity and immunogenicity as well as rodent models of hypersensitivity, immunosuppression and immunostimulation. The role played by human cell-based assays and in silico prediction models that have been developed and validated for the assessment of chemical classes is also appraised. PMID:20615176

  5. EVALUATION OF THE IMMUNOTOXICITY OF ORALLY ADMINISTERED 2-METHOXYACETIC ACID IN FISCHER 344 RATS

    EPA Science Inventory

    We previously demonstrated that the glycol ether 2-methoxyethanol (ME) immunotoxic in the rat. n this study, the immunotoxicity of 2-methoxyacetic acid (MAA), the principal metabolite of ME, was evaluated in adult male Fischer 3 rats. ats were dosed by gavage with MAA on ten cons...

  6. Recurrence of Stachybotrys chartarum during mycological and toxicological study of bioaerosols collected in a dairy cattle shed.

    PubMed

    Lanier, Caroline; André, Véronique; Séguin, Virginie; Heutte, Natacha; El Kaddoumi, Anne; Bouchart, Valérie; Picquet, Rachel; Garon, David

    2012-01-01

    Agricultural occupations associated with animal breeding and the processing of animal materials in confinement systems could potentially lead to bioaerosol exposures. Moulds and mycotoxins could be constituents of bioaerosols and should be studied because of their possible involvement in respiratory diseases and cancers. In order to characterize the fungal contamination of the indoor air in a dairy barn, bioaerosols were collected during 20 days in a cattle farm located in Normandy (France). Mycobiota, mycotoxins and the mutagenicity of bioaerosols were studied. The toxigenic ability of Aspergillus flavus group and Aspergillus fumigatus isolates was also evaluated in vitro. The prevalent airborne moulds were from the following potentially toxigenic species: Aspergillus flavus group, Aspergillus fumigatus, Penicillium chrysogenum, Stachybotrys chartarum, and the allergenic species Ulocladium chartarum, Cladosporium cladosporioides. In comparison with harvesting, grain handling or broiler breeding, the concentrations of viable moulds were lower in the cattle shed. Seasonal variations in levels of several species were also observed. This study revealed that aflatoxins were detected in bioaerosols and, for the first time, showed that farmers are possibly exposed to Stachybotrys chartarum during routine barn work. Moreover, the finding of mutagenicity from bioaerosols needs further investigations on bioaerosol composition. PMID:22462447

  7. Immunotoxicity of nitrobenzene in female B6C3F1 mice.

    PubMed

    Burns, L A; Bradley, S G; White, K L; McCay, J A; Fuchs, B A; Stern, M; Brown, R D; Musgrove, D L; Holsapple, M P; Luster, M I

    1994-01-01

    Nitrobenzene (NBZ) is primarily employed as an oxidizing agent in the synthesis of analine and benzene compounds. It produces myelotoxic effects and effects on erythrocytes in both animal models and man. Reported hepatosplenomegaly and effects on the bone marrow are indicators that NBZ may be immunotoxic. In these studies, female B6C3F1 mice were exposed to 30, 100 and 300 mg/kg of NBZ in corn oil by gavage for 14 consecutive days. To assess the immunotoxic potential of NBZ, body and organ weights were determined and selected immunologic and host resistance responses were studied. In these studies, the liver and spleen appeared to be the primary target organs. Both liver and spleen weights were dose dependently increased. Gross histopathologic examinations revealed significant changes in the spleen, consisting of severe congestion of the red pulp areas with erythrocytes and reticulocytes. Serum chemistry profiles showed increases in alanine aminotransferase and aspartate aminotransferase activities, indicating liver toxicity. Hematologic studies showed a decrease in erythrocyte number and a concomitant increase in mean corpuscular hemoglobin and mean corpuscular volume. A dose-dependent increase in peripheral reticulocytes was also seen. DNA synthesis was enhanced, as was the number of formed elements and the number of monocyte/granulocyte stem cells in the bone marrow of treated mice. IgM responses were decreased and the phagocytic activity of macrophages in the liver was dose dependently increased with a concomitant decrease in the activities in the spleen and lung. Other immunological parameters examined were unchanged. Host resistance to microbial or viral infection was not markedly altered by NBZ; however, there were trends towards increased susceptibility where T-cell function contributes to host defense. These data indicate that NBZ-induced hemolysis and liver injury are linked to the observed alterations in bone marrow activity. PMID:7988385

  8. Safety and immunotoxicity assessment of immunomodulatory monoclonal antibodies

    PubMed Central

    Morton, Laura Dill; Spindeldreher, Sebastian; Kiessling, Andrea; Allenspach, Roy; Hey, Adam; Muller, Patrick Y; Frings, Werner; Sims, Jennifer

    2010-01-01

    Most therapeutic monoclonal antibodies (mAbs) licensed for human use or in clinical development are indicated for treatment of patients with cancer and inflammatory/autoimmune disease and as such, are designed to directly interact with the immune system. A major hurdle for the development and early clinical investigation of many of these immunomodulatory mAbs is their inherent risk for adverse immune-mediated drug reactions in humans such as infusion reactions, cytokine storms, immunosuppression and autoimmunity. A thorough understanding of the immunopharmacology of a mAb in humans and animals is required to both anticipate the clinical risk of adverse immunotoxicological events and to select a safe starting dose for first-in-human (FIH) clinical studies. This review summarizes the most common adverse immunotoxicological events occurring in humans with immunomodulatory mAbs and outlines non-clinical strategies to define their immunopharmacology and assess their immunotoxic potential, as well as reduce the risk of immunotoxicity through rational mAb design. Tests to assess the relative risk of mAb candidates for cytokine release syndrome, innate immune system (dendritic cell) activation and immunogenicity in humans are also described. The importance of selecting a relevant and sensitive toxicity species for human safety assessment in which the immunopharmacology of the mAb is similar to that expected in humans is highlighted, as is the importance of understanding the limitations of the species selected for human safety assessment and supplementation of in vivo safety assessment with appropriate in vitro human assays. A tiered approach to assess effects on immune status, immune function and risk of infection and cancer, governed by the mechanism of action and structural features of the mAb, is described. Finally, the use of immunopharmacology and immunotoxicity data in determining a minimum anticipated biologic effect Level (MABEL) and in the selection of safe human

  9. Assessment of immunotoxicity parameters in individuals occupationally exposed to lead.

    PubMed

    García-Lestón, Julia; Roma-Torres, Joana; Mayan, Olga; Schroecksnadel, Sebastian; Fuchs, Dietmar; Moreira, Ana O; Pásaro, Eduardo; Méndez, Josefina; Teixeira, João Paulo; Laffon, Blanca

    2012-01-01

    Although adverse health effects produced by lead (Pb) have long been recognized, studies regarding the immunotoxic effects of occupational exposure report conflicting results. In a previous study, alterations in some immunological parameters were noted in 70 Pb-exposed workers. In view of these results, it was of interest to extend this study comprising a larger population and increasing the number of immunological endpoints assessed. Accordingly, in this study the immunotoxic effects of occupational exposure to Pb were assessed by analyzing (1) percentages of lymphocyte subsets (CD3⁺, CD4⁺, CD8⁺, CD19⁺, and CD56⁺/16⁺); (2) concentration of plasma cytokines, namely, interleukin (IL) 2, IL4, IL6, IL10, tumor necrosis factor (TNF) α, and interferon (IFN) γ; and (3) plasma concentrations of neopterin, tryptophan (Trp), and kynurenine (Kyn). In addition, the possible influence of genetic polymorphisms in the vitamin D receptor (VDR) and δ-aminolevulinic acid dehydratase (ALAD) genes on immunotoxicity parameters was studied. Exposed workers showed significant decreases in %CD3⁺, %CD4⁺/%CD8⁺ ratio, IL4, TNFα, IFNγ, and Kyn to Trp ratio (Kyn/Trp), and significant increases in %CD8⁺, IL10, and Trp levels. All these parameters, except Trp, were significantly correlated with exposure biomarkers. No significant influence of genetic polymorphisms was observed. Significant correlation between Kyn/Trp and neopterin concentrations suggests an involvement of indoleamine 2,3-dioxygenase in the Trp metabolic alterations, which may contribute to some of the immune alterations observed. Results obtained suggest that occupational exposure to PB may influence the immune system by impairing several mechanisms, which might ultimately produce deregulation of the immune response and diminish immunosurveillance in exposed individuals. PMID:22788368

  10. In vitro characterization of the immunotoxic potential of several perfluorinated compounds (PFCs)

    SciTech Connect

    Corsini, Emanuela; Sangiovanni, Enrico; Avogadro, Anna; Galbiati, Valentina; Viviani, Barbara; Marinovich, Marina; Galli, Corrado L.; Dell'Agli, Mario; Germolec, Dori R.

    2012-01-15

    We have previously shown that PFOA and PFOS directly suppress cytokine secretion in immune cells, with different mechanisms of action. In particular, we have demonstrated a role for PPAR-α in PFOA-induced immunotoxicity, and that PFOS has an inhibitory effect on LPS-induced I-κB degradation. These studies investigate the immunomodulatory effects of four other PFCs, namely PFBS, PFOSA, PFDA, and fluorotelomer using in vitro assays. The release of the pro-inflammatory cytokines IL-6 and TNF-α was evaluated in lipolysaccharide (LPS)-stimulated human peripheral blood leukocytes (hPBL) and in the human promyelocytic cell line THP-1, while the release of IL-10 and IFN-γ was evaluated in phytohemagglutinin (PHA)-stimulated hPBL. All PFCs suppressed LPS-induced TNF-α production in hPBL and THP-1 cells, while IL-6 production was suppressed by PFOSA, PFOS, PFDA and fluorotelomer. PFBS, PFOSA, PFOS, PFDA and fluorotelomer inhibited PHA-induced IL-10 release, while IFN-γ secretion was affected by PFOSA, PFOS, PFDA and fluorotelomer. Leukocytes obtained from female donors appear to be more sensitive to the in vitro immunotoxic effects of PFCs when their responses are compared to the results obtained using leukocytes from male donors. Mechanistic investigations demonstrated that inhibition of TNF-α release in THP-1 cells occurred at the transcriptional level. All PFCs, including PFOA and PFOS, decreased LPS-induced NF-κB activation. With the exception of PFOA, none of the PFCs tested was able to activate PPARα driven transcription in transiently transfected THP-1 cells, excluding a role for PPARα in the immunomodulation observed. PFBS and PFDA prevented LPS-induced I-κB degradation. Overall, these studies suggest that PFCs affect NF-κB activation, which directly suppresses cytokine secretion by immune cells. Our results indicate that PFOA is the least active of the PFCs examined followed by PFBS, PFDA, PFOS, PFOSA and fluorotelomer. -- Research Highlights: ► PFCs

  11. Screening tests for autoimmune-related immunotoxicity.

    PubMed Central

    Pieters, R; Albers, R

    1999-01-01

    A large number of chemicals induce or exacerbate autoimmune-like diseases in man. Because of the complexity of processes involved, these adverse effects are often if not always missed in standard toxicity testing. To date no validated and generally applicable predictive animal model exists and only a few chemicals have actually been shown to induce adverse autoimmune effects in certain animals. The popliteal lymph node assay (PLNA) is a very promising animal test to (pre)screen for systemic immunosensitizing, including autoimmunogenic potential. This review describes the essentials of the various PLNAs against the background of current understanding of chemically induced systemic immunostimulation. The most simple primary PLNA measures enlargement of the popliteal lymph node 6-8 days after subcutaneous injection of a chemical into the footpad. The primary PLNA can distinguish between immunostimulating (both sensitizers and irritants) and innocent chemicals but does not assess the involvement of T cells or immunosensitization. For this, but also for elucidation of relevant mechanisms, detection of anamnestic responses in secondary PLNAs or responses to reporter antigens in the modified PLNA are suitable. To date over 100 compounds (drugs and environmental pollutants) have been tested, and results show a good correlation with reported immunostimulating (both autoimmunogenic and allergic) potential. Importantly, no false-negative chemicals were detected if metabolism was considered. The various types of the PLNA, but in particular the secondary and modified PLNAs, await extensive validation before they can be recommended as a standard test for autoimmunogenic potential. Images Figure 2 Figure 3 PMID:10502529

  12. The immunotoxicity of 3,3{prime},4,4{prime},5-pentachlorobiphenyl (PeCB) and tributyltin (TBT) in channel catfish, Ictalurus punctatus

    SciTech Connect

    Rice, C.D.; Banes, M.M.; Hurt, K.L.

    1994-12-31

    There is considerable evidence that planar PCBs and Tributyltin (TBT) may be immunotoxic to fish. Apparently the immune system is a target organ for both compounds in rodents. The mechanisms of action are different as PeCB immunotoxicity is associated with cytosolic Ah-R binding and induction of several nuclear response elements while TBT immunotoxicity is associated with membrane perturbation and layered calcium homeostasis. The authors have investigated the effects of a single i.p. dose of PeCB and TBT at 0.01, 0.1, 1.0 mg/kg on several innate immune responses including non-specific cytotoxic cell activity, neutrophil activation, and lymphocyte mitogenesis, as well as baseline hematology at days 3 and 7 post treatment. Hematocrits were affected in TBT treated fish at 1.0 mg/kg while neutrophilia and leukopenia were noted at 0.01 and 1.0 mg/kg. These observations are typical of stress hemograms. PeCB had no adverse effect on hematocrits or leukocyte % but did induce neutrophilia at 1.0 mg/kg. Neutrophil activation was suppressed in both PeCB and TBT treated animals but only at 1.0 mg/kg. NCC activity was suppressed at all three doses of PECB but only 1.0 mg/kg in TBT treated animals. Lymphocyte mitogenesis was affected by both compounds but only at 1.0 mg/kg. A note of interest is that both compounds have the same molecular weight and therefore their immunotoxic effects can be compared on a {micro}mole/kg basis.

  13. In vivo immunotoxicity of perfluorooctane sulfonate in BALB/c mice: Identification of T-cell receptor and calcium-mediated signaling pathway disruption through gene expression profiling of the spleen.

    PubMed

    Lv, Qi-Yan; Wan, Bin; Guo, Liang-Hong; Yang, Yu; Ren, Xiao-Min; Zhang, Hui

    2015-10-01

    Perfluorooctane sulfonate (PFOS) is a persistent organic pollutant that is used worldwide and is continuously being detected in biota and the environment, thus presenting potential threats to the ecosystem and human health. Although PFOS is highly immunotoxic, its underlying molecular mechanisms remain largely unknown. The present study examined PFOS-induced immunotoxicity in the mouse spleen and explored its underlying mechanisms by gene expression profiling. Oral exposure of male BALB/c mice for three weeks followed by one-week recovery showed that a 10 mg/kg/day PFOS exposure damaged the splenic architecture, inhibited T-cell proliferation in response to mitogen, and increased the percentages of T helper (CD3(+)CD4(+)) and cytotoxic T (CD3(+)CD8(+)) cells, despite the decrease in the absolute number of these cells. A delayed type of PFOS immunotoxicity was observed, which mainly occurred during the recovery period. Global gene expression profiling of mouse spleens and QRT-PCR analyses suggest that PFOS inhibited the expression of genes involved in cell cycle regulation and NRF2-mediated oxidative stress response, and upregulated those in TCR signaling, calcium signaling, and p38/MAPK signaling pathways. Western blot analysis confirmed that the expressions of CAMK4, THEMIS, and CD3G, which were involved in the upregulated pathways, were induced upon PFOS exposure. Acute PFOS exposure modulated calcium homoeostasis in splenocytes. These results indicate that PFOS exposure can activate TCR signaling and calcium ion influx, which provides a clue for the potential mechanism of PFOS immunotoxicity. The altered signaling pathways by PFOS treatment as revealed in the present study might facilitate in better understanding PFOS immunotoxicity and explain the association between immune disease and PFOS exposure. PMID:26300304

  14. Neurotoxicity and Immunotoxicity Outcomes following Gestational Exposure to Four Lab Drinking Water Concentrates

    EPA Science Inventory

    To evaluate whether developmental exposure to drinking water concentrates altered other endpoints, standard neuro- and immunotoxicity tests were conducted on the offspring. Male and female offspring (10/sex/treatment) exposed to chlorinated concentrated water (CCW) or reverse os...

  15. Successful validation of genomic biomarkers for human immunotoxicity in Jurkat T cells in vitro.

    PubMed

    Schmeits, Peter C J; Shao, Jia; van der Krieken, Danique A; Volger, Oscar L; van Loveren, Henk; Peijnenburg, Ad A C M; Hendriksen, Peter J M

    2015-07-01

    Previously, we identified 25 classifier genes that were able to assess immunotoxicity using human Jurkat T cells. The present study aimed to validate these classifiers. For that purpose, Jurkat cells were exposed for 6 h to subcytotoxic doses of nine immunotoxicants, five non-immunotoxicants and four compounds for which human immunotoxicity has not yet been fully established. RNA was isolated and subjected to Fluidigm quantitative real time (qRT)-PCR analysis. The sensitivity, specificity and accuracy of the screening assay as based on the nine immunotoxicants and five non-immunotoxicants used in this study were 100%, 80% and 93%, respectively, which is better than the performance in our previous study. Only one compound was classified as false positive (benzo-e-pyrene). Of the four potential (non-)immunotoxicants, chlorantraniliprole and Hidrasec were classified immunotoxic and Sunset yellow and imidacloprid as non-immunotoxic. ToxPi analysis of the PCR data provided insight in the molecular pathways that were affected by the compounds. The immunotoxicants 2,3-dichloro-propanol and cypermethrin, although structurally different, affected protein metabolism and cholesterol biosynthesis and transport. In addition, four compounds, i.e. chlorpyrifos, aldicarb, benzo-e-pyrene and anti-CD3, affected genes in cholesterol metabolism and transport, protein metabolism and transcription regulation. qRT-PCR on eight additional genes coding for similar processes as defined in ToxPi analyzes, supported these results. In conclusion, the 25 immunotoxic classifiers performed very well in a screening with new non-immunotoxic and immunotoxic compounds. Therefore, the Jurkat screening assay has great promise to be applied within a tiered approach for animal free testing of human immunotoxicity. PMID:25424538

  16. Selenium reverses Pteridium aquilinum-induced immunotoxic effects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously shown that bracken fern (Pteridium aquilinum) has immunomodulatory effects on mouse natural killer (NK) cells by reducing cytotoxicity. Alternatively, it has been demonstrated that selenium can enhance NK cell activity. Therefore, the aims of the present study were to evaluate if ...

  17. Histological and histometrical evidences for phenol immunotoxicity in mice.

    PubMed

    Louei Monfared, Ali; Jaafari, Afsaneh; Sheibani, Mohammad Taghi

    2014-01-01

    Phenol is a common industrial and ubiquitous environmental chemical which is used to synthesize resins and plastics. Due to its anesthetic and disinfectant properties, phenol is also widely used in pharmaceutical products. Since there were no adequate data about phenol immunotoxicity, the purpose of the present study is to investigate its toxic effects on the histological structures of the lymphoid organs in the mice. A total of 80 mice were randomly distributed into one control group and three experimental groups. The control group received only distilled water, whereas experimental groups were orally administered phenol at the concentrations of 80, 180, and 320 mg/kg/day, respectively. After 28 consecutive days, tissue samples were taken and histological changes of the spleens, thymuses, adrenal glands, and lymph nodes were examined using optical microscopy. The results showed that in the phenol treated animals; splenic megakaryocyte counts increased, the diameter of the splenic follicles decreased, the thymocyte population in both cortex and medulla reduced, the thickness of the reticular layers of adrenal gland increased and lymphatic cells populations in the lymph node were reduced, significantly (P < 0.01). Also, remarkable histological changes were noted in the various lymphatic organs of the treated mice. Overall, present findings give some histological evidences that selected qualitative and quantitative parameters of the lymphatic organs were significantly altered by phenol administration. In conclusion, the significant decreases of the immune cell populations together with histological alterations in the immunocompetent organs of the mice exposed to phenol indicate the immunosuppressive and immunotoxic properties of this chemical material. PMID:24829551

  18. Satratoxin G from the Black Mold Stachybotrys chartarum Evokes Olfactory Sensory Neuron Loss and Inflammation in the Murine Nose and Brain

    PubMed Central

    Islam, Zahidul; Harkema, Jack R.; Pestka, James J.

    2006-01-01

    Satratoxin G (SG) is a macrocyclic trichothecene mycotoxin produced by Stachybotrys chartarum, the “black mold” suggested to contribute etiologically to illnesses associated with water-damaged buildings. Using an intranasal instillation model in mice, we found that acute SG exposure specifically induced apoptosis of olfactory sensory neurons (OSNs) in the olfactory epithelium. Dose–response analysis revealed that the no-effect and lowest-effect levels at 24 hr postinstillation (PI) were 5 and 25 μg/kg body weight (bw) SG, respectively, with severity increasing with dose. Apoptosis of OSNs was identified using immunohistochemistry for caspase-3 expression, electron microscopy for ultrastructural cellular morphology, and real-time polymerase chain reaction for elevated expression of the proapoptotic genes Fas, FasL, p75NGFR, p53, Bax, caspase-3, and CAD. Time-course studies with a single instillation of SG (500 μg/kg bw) indicated that maximum atrophy of the olfactory epithelium occurred at 3 days PI. Exposure to lower doses (100 μg/kg bw) for 5 consecutive days resulted in similar atrophy and apoptosis, suggesting that in the short term, these effects are cumulative. SG also induced an acute, neutrophilic rhinitis as early as 24 hr PI. Elevated mRNA expression for the proinflammatory cytokines tumor necrosis factor-α, interleukin-6 (IL-6), and IL-1 and the chemokine macrophage-inflammatory protein-2 (MIP-2) were detected at 24 hr PI in both the ethmoid turbinates of the nasal airways and the adjacent olfactory bulb of the brain. Marked atrophy of the olfactory nerve and glomerular layers of the olfactory bulb was also detectable by 7 days PI along with mild neutrophilic encephalitis. These findings suggest that neurotoxicity and inflammation within the nose and brain are potential adverse health effects of exposure to satratoxins and Stachybotrys in the indoor air of water-damaged buildings. PMID:16835065

  19. Ability of Lactobacillus rhamnosus GAF01 to remove AFM1 in vitro and to counteract AFM1 immunotoxicity in vivo.

    PubMed

    Abbès, Samir; Salah-Abbès, Jalila Ben; Sharafi, Hakimeh; Jebali, Rania; Noghabi, Kambiz Akbari; Oueslati, Ridha

    2013-01-01

    Aflatoxin M1 (AFM1) has been detected in many parts of the world both in raw milk and many dairy products, causing great economic losses and human disease. Unfortunately, there are few studies dealing with AFM1 immunotoxicity/interactions with lactic acid bacteria for potential application as a natural preventive agent. The aim of this study was to isolate (from dairy products) food-grade probiotic bacteria able to degrade/bind AFM1 in vitro and evaluate whether the same organism(s) could impart a protective role against AFM1-induced immunotoxicity in exposed Balb/c mice. Bacteria (Lactobacillus plantarum MON03 and L. rhamnosus GAF01) were isolated from Tunisian artisanal butter and then tested for abilities to eliminate AFM1 from phosphate-buffered saline (PBS) and reconstituted milk (containing 0.05, 0.10, and 0.20 µg AFM1/ml) after 0, 6, and 24 h at 37°C. Results showed that the selected bacteria could 'remove' AFM1 both in PBS and skimmed milk. The binding abilities of AFM1 by L. plantarum MON03 and L. rhamnosus GAF01 strains (at 10(8) CFU/ml) in PBS and reconstituted milk ranged, respectively, from 16.1-78.6% and 15.3-95.1%; overall, L. rhamnosus showed a better potential for removal than L. plantarum. 'Removal' appeared to be by simple binding; the bacteria/AFM1 complex was stable and only a very small proportion of mycotoxin was released back into the solution. L. rhamnosus GAF01 had the highest binding capacity and was selected for use in the in vivo study. Those results indicated that use of the organism prevented AFM1-induced effects on total white and red blood cells, and lymphocyte subtypes, after 15 days of host treatment. These studies clearly indicated that L. rhamnosus GAF01 was able to bind AFM1 in vitro and-by mechanisms that might also be related to a binding effect-counteract AFM1-induced immunotoxicity. Moreover, by itself, this bacterium was not toxic and could potentially be used as an additive in dairy products and in biotechnology for

  20. Biological Responses of Raw 264.7 Macrophage Exposed to Two Strains of Stachybotrys chartarum Spores Grown on Four Different Wallboard Types

    EPA Science Inventory

    The focus of this research was to provide a better understanding of the health impacts caused by Stachybotrys chartarum (Houston and 51-11) spores grown on four gypsum products two of which were resistant to microbes. Raw 264.7 cells were exposed to whole spores and fragmented 51...

  1. SOLVENT COMPARISON IN THE ISOLATION, SOLUBILIZATION, AND TOXICITY OF STACHYBOTRYS CHARTARUM SPORE TRICHOTHECENE MYCOTOXINS IN AN ESTABLISHED IN VITRO LUMINESCENCE PROTEIN TRANSLATION INHIBITION ASSAY

    EPA Science Inventory

    It is well known that non-viable mold contaminants such as macrocyclic trichothecene mycotoxins of Stachybotrys chartarum are highly toxinigenic to humans. However, there is no agreed upon method of recovering native mycotoxin. The purpose of this study was to provide quantitativ...

  2. Developmental Immunotoxicity, Perinatal Programming, and Noncommunicable Diseases: Focus on Human Studies

    PubMed Central

    Dietert, Rodney R.

    2014-01-01

    Developmental immunotoxicity (DIT) is a term given to encompass the environmentally induced disruption of normal immune development resulting in adverse outcomes. A myriad of chemical, physical, and psychological factors can all contribute to DIT. As a core component of the developmental origins of adult disease, DIT is interlinked with three important concepts surrounding health risks across a lifetime: (1) the Barker Hypothesis, which connects prenatal development to later-life diseases, (2) the hygiene hypothesis, which connects newborns and infants to risk of later-life diseases and, (3) fetal programming and epigenetic alterations, which may exert effects both in later life and across future generations. This review of DIT considers: (1) the history and context of DIT research, (2) the fundamental features of DIT, (3) the emerging role of DIT in risk of noncommunicable diseases (NCDs) and (4) the range of risk factors that have been investigated through human research. The emphasis on the human DIT-related literature is significant since most prior reviews of DIT have largely focused on animal research and considerations of specific categories of risk factors (e.g., heavy metals). Risk factors considered in this review include air pollution, aluminum, antibiotics, arsenic, bisphenol A, ethanol, lead (Pb), maternal smoking and environmental tobacco smoke, paracetamol (acetaminophen), pesticides, polychlorinated biphenyls, and polyfluorinated compounds. PMID:26556429

  3. Immunotoxic effects of perfluorooctane sulfonate and di(2-ethylhexyl) phthalate on the marine fish Oryzias melastigma.

    PubMed

    Huang, Qiansheng; Chen, Yajie; Chi, Yulang; Lin, Yi; Zhang, Huanteng; Fang, Chao; Dong, Sijun

    2015-05-01

    Perfluorooctane sulfonate (PFOS) and di(2-ethylhexyl) phthalate (DEHP) have both been reported to induce adverse effects including immunotoxicity. Despite the widespread presence of these two chemicals in estuaries and seawater, their health effects on marine fish have received little attention. Oryzias melastigma is a potential marine fish model for immunological studies. In the present study, immune-related genes in O. melastigma were enriched at the transcriptome level. Three-month-old fish were exposed to PFOS and DEHP (single or combined) for one week. The liver index-hepatosomatic index (HSI) of the fish was higher in the PFOS-exposed group and combined group than in the control group. This result indicates that PFOS might lead to liver toxicity. The mRNA level of interleukin-1 beta (IL1β) was upregulated after exposure. For catalase (CAT), glutathione peroxidase (GPx) and cluster of differentiation 3 (CD3), single exposure did not affect mRNA levels, but the combined exposure did significantly alter the expression of these genes. In all, our study provides a useful reference for immunotoxicological studies with O. melastigma; it also highlights the importance of assessing the combined effects of pollutant mixtures when determining the risk to aquatic organisms. PMID:25687394

  4. Subchronic Immunotoxicity Assessment of Genetically Modified Virus-Resistant Papaya in Rats.

    PubMed

    Lin, Hsin-Tang; Lee, Wei-Cheng; Tsai, Yi-Ting; Wu, Jhaol-Huei; Yen, Gow-Chin; Yeh, Shyi-Dong; Cheng, Ying-Huey; Chang, Shih-Chieh; Liao, Jiunn-Wang

    2016-07-27

    Papaya is an important fruit that provides a variety of vitamins with nutritional value and also holds some pharmacological properties, including immunomodulation. Genetically modified (GM) papaya plants resistant to Papaya ringspot virus (PRSV) infection have been generated by cloning the coat protein gene of the PRSV which can be used as a valuable strategy to fight PRSV infection and to increase papaya production. In order to assess the safety of GM papaya as a food, this subchronic study was conducted to assess the immunomodulatory responses of the GM papaya line 823-2210, when compared with its parent plant of non-GM papaya, Tainung-2 (TN-2), in Sprague-Dawley (SD) rats. Both non-GM and GM 823-2210 papaya fruits at low (1 g/kg bw) and high (2 g/kg bw) dosages were administered via daily oral gavage to male and female rats consecutively for 90 days. Immunophenotyping, mitogen-induced splenic cell proliferation, antigen-specific antibody response, and histopathology of the spleen and thymus were evaluated at the end of the experiment. Results of immunotoxicity assays revealed no consistent difference between rats fed for 90 days with GM 823-2210 papaya fruits, as opposed to those fed non-GM TN-2 papaya fruits, suggesting that with regard to immunomodulatory responses, GM 823-2210 papaya fruits maintain substantial equivalence to fruits of their non-GM TN-2 parent. PMID:27396727

  5. The immunotoxicity of graphene oxides and the effect of PVP-coating.

    PubMed

    Zhi, Xiao; Fang, Hongliang; Bao, Chenchen; Shen, Guangxia; Zhang, Jiali; Wang, Kan; Guo, Shouwu; Wan, Tao; Cui, Daxiang

    2013-07-01

    Graphene oxide (GO) immunotoxicity is not clarified well up to date. Herein we reported the effects of GOs with and without polyvinylpyrrolidone (PVP) coating on human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages. Human immune cells such as dendritic cells (DCs), T lymphocytes and macrophages were isolated from health donated bloods, PVP-coating GO (PVP-GO) exhibited lower immunogenicity compared with pure GO on the aspect of inducing differentiation and maturation of dendritic cells (DCs), the levels of secreted TNF-α and IL-1β had no obvious difference between two groups, yet the secretion of IL-6 remained in PVP-coating GO group. In addition, PVP-coating GO delayed significantly the apoptotic process of T lymphocytes, at the same time, and exhibited anti-phagocytosis ability against macrophages and markedly enhanced the physiological activity of macrophages. In conclusion, PVP-coating GO possesses good immunological biocompatibility and immunoenhancement effects in vitro, and is likely to be an available candidate of immunoadjuvant in the future. PMID:23566800

  6. Developmental Immunotoxicity, Perinatal Programming, and Noncommunicable Diseases: Focus on Human Studies.

    PubMed

    Dietert, Rodney R

    2014-01-01

    Developmental immunotoxicity (DIT) is a term given to encompass the environmentally induced disruption of normal immune development resulting in adverse outcomes. A myriad of chemical, physical, and psychological factors can all contribute to DIT. As a core component of the developmental origins of adult disease, DIT is interlinked with three important concepts surrounding health risks across a lifetime: (1) the Barker Hypothesis, which connects prenatal development to later-life diseases, (2) the hygiene hypothesis, which connects newborns and infants to risk of later-life diseases and, (3) fetal programming and epigenetic alterations, which may exert effects both in later life and across future generations. This review of DIT considers: (1) the history and context of DIT research, (2) the fundamental features of DIT, (3) the emerging role of DIT in risk of noncommunicable diseases (NCDs) and (4) the range of risk factors that have been investigated through human research. The emphasis on the human DIT-related literature is significant since most prior reviews of DIT have largely focused on animal research and considerations of specific categories of risk factors (e.g., heavy metals). Risk factors considered in this review include air pollution, aluminum, antibiotics, arsenic, bisphenol A, ethanol, lead (Pb), maternal smoking and environmental tobacco smoke, paracetamol (acetaminophen), pesticides, polychlorinated biphenyls, and polyfluorinated compounds. PMID:26556429

  7. Survey: immune function and immunotoxicity assessment in dogs.

    PubMed

    Lebrec, Hervé; O'Lone, Raegan; Freebern, Wendy; Komocsar, Wendy; Moore, Peter

    2012-01-01

    While immunotoxicology evaluations are often conducted in either rodents or non-human primates, findings in standard toxicology studies may trigger additional investigations in dogs. A survey sponsored by the HESI Immunotoxicology Technical Committee, and described herein, was conducted to gather information regarding the extent and nature of immunology and immunotoxicity assessments available in the dog, and the need thereof. The survey was issued via e-mail to scientists affiliated with 39 organizations in industry and academia, including contract research organizations, academic research organizations, pharmaceutical companies, and veterinary practices. Fifteen institutions responded, including 10 biotechnology or pharmaceutical industry organizations, 4 contract research organizations, and 1 academic institution. Responses indicated that indeed, immunological assessments in dogs are necessary for research and/or toxicology purposes. The survey demonstrated that multiple types of assays are used in the dog model, including assessment of T-cell-dependent antibody responses, immunoglobulins, complement CH(50), cytokines and cytokine mRNAs, lymphocyte proliferation in response to T-cell mitogens, neutrophil activation, phagocytosis, and immunophenotyping of several cell types. The survey also revealed that certain assays/endpoints are not available in the dog (complement components, NK immunophenotyping, T-cell activation and memory immunophenotyping) or require further optimization (ex vivo cytolysis assays such as CTL and NK function, B-cell proliferation in response to LPS). In addition, the survey indicated that a greater understanding of the specificity of the available immunophenotyping reagents is needed. PMID:22059464

  8. Biomarkers of Immunotoxicity for Environmental and Public Health Research

    PubMed Central

    Duramad, Paurene; Holland, Nina T.

    2011-01-01

    The immune response plays an important role in the pathophysiology of numerous diseases including asthma, autoimmunity and cancer. Application of biomarkers of immunotoxicity in epidemiology studies and human clinical trials can improve our understanding of the mechanisms that underlie the associations between environmental exposures and development of these immune-mediated diseases. Immunological biomarkers currently used in environmental health studies include detection of key components of innate and adaptive immunity (e.g., complement, immunoglobulin and cell subsets) as well as functional responses and activation of key immune cells. The use of high-throughput assays, including flow cytometry, Luminex, and Multi-spot cytokine detection methods can further provide quantitative analysis of immune effects. Due to the complexity and redundancy of the immune response, an integrated assessment of several components of the immune responses is needed. The rapidly expanding field of immunoinformatics will also aid in the synthesis of the vast amount of data being generated. This review discusses and provides examples of how the identification and development of immunological biomarkers for use in studies of environmental exposures and immune-mediated disorders can be achieved. PMID:21655126

  9. Acephate immunotoxicity in White Leghorn cockerel chicks upon experimental exposure

    USGS Publications Warehouse

    Tripathi, Syamantak Mani; Thaker, A. M.; Joshi, C. G.; Sankhala, Laxmi Narayan

    2012-01-01

    Immunotoxicity for subacute exposure to acephate (O,S-dimethyl-acetylphosphoramidothioate) was assessed in day old White Leghorn (WLH) cockerel chicks. The chicks were divided into five groups. Groups C1 and C2 served as plain control and vehicle control respectively. Chicks of groups T1, T2 and T3 were administered acephate suspended in groundnut oil at 21.3 mg/kg, 28.4 mg/kg and 42.6 mg/kg respectively orally for 28 days. A non-significant reduction in total leukocyte count was observed. Although, anti-Newcastle Disease Virus (NDV) antibody titer, serum total protein (TP), serum globulin, serum albumin and organ:body weight ratios of immune organs were significantly suppressed. The delayed type hypersensitivity response to 2,4-dinitro-1-chlorobenzene (DNCB) was not significantly altered. Histopathologically, bursa and spleen showed mild depletion of lymphocytes. Furthermore, DNA fragmentation assay was performed and detected ladder pattern (180 bp) in DNA. It was concluded that subacute acephate exposure at low concentrations may affect immune responses in avian species.

  10. Cytotoxicity and immunotoxicity of cyclopiazonic acid on human cells.

    PubMed

    Hymery, Nolwenn; Masson, Floriane; Barbier, Georges; Coton, Emmanuel

    2014-08-01

    In this study, in vitro cytotoxicity and immunotoxicity of the mycotoxin cyclopiazonic acid (CPA) was evaluated on human cells. To evaluate cytoxicity, several cellular targets were used (CD34+, monocytes, THP-1 and Caco-2). Monocytes were more sensitive to CPA than the THP-1 monocytic cell line after 48h of incubation in the tested conditions. Half maximal inhibitory concentration (IC50) were determined to be 8.5 × 10(-8) and 1.75 × 10(-7)M for monocytes and THP1, respectively, while IC50>1.25 × 10(-7)M was observed for Caco-2 and CD34+ cells. The CPA effect on macrophage differentiation was also examined at non-cytotoxic concentrations. The monocyte differentiation process was markedly disturbed in the presence of CPA. After 6 days of culture, CD71 expression was downregulated, while CD14 and CD11a expressions did not change. Moreover, activated macrophages showed a raised burst activity and TNF-α secretion. Overall, the results indicated that CPA exhibited toxicity on various human cellular models. Moreover, at non-cytotoxic concentrations, CPA disturbed human monocytes differentiation into macrophages. This work contributes to understanding the immunosuppressive properties of this food-related toxin. PMID:24747294

  11. Perinatal Immunotoxicity: Why Adult Exposure Assessment Fails to Predict Risk

    PubMed Central

    Dietert, Rodney R.; Piepenbrink, Michael S.

    2006-01-01

    Recent research has pointed to the developing immune system as a remarkably sensitive toxicologic target for environmental chemicals and drugs. In fact, the perinatal period before and just after birth is replete with dynamic immune changes, many of which do not occur in adults. These include not only the basic maturation and distribution of immune cell types and selection against autoreactive lymphocytes but also changes designed specifically to protect the pregnancy against immune-mediated miscarriage. The newborn is then faced with critical immune maturational adjustments to achieve an immune balance necessary to combat myriad childhood and later-life diseases. All these processes set the fetus and neonate completely apart from the adult regarding immunotoxicologic risk. Yet for decades, safety evaluation has relied almost exclusively upon exposure of the adult immune system to predict perinatal immune risk. Recent workshops and forums have suggested a benefit in employing alternative exposures that include exposure throughout early life stages. However, issues remain concerning when and where such applications might be required. In this review we discuss the reasons why immunotoxic assessment is important for current childhood diseases and why adult exposure assessment cannot predict the effect of xenobiotics on the developing immune system. It also provides examples of developmental immunotoxicants where age-based risk appears to differ. Finally, it stresses the need to replace adult exposure assessment for immune evaluation with protocols that can protect the developing immune system. PMID:16581533

  12. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  13. Development and evaluation of the mallard duck as a model to investigate the immunotoxicity of environmental chemicals

    SciTech Connect

    Fowles, J.R.

    1993-01-01

    Studies were conducted to characterize the mallard duck (Anas platyrhyncos) as a model for evaluating the immunotoxic effects of environmental chemicals. A battery of immunotoxicity tests was validated for the mallard, including natural killer cell (NKC) activity, lymphocyte mitogenesis, antibody titers to sheep erythrocytes, peripheral differential leukocyte counts, macrophage phagocytosis and prostaglandin-E[sub 2] (PGE2) production. To investigate potential hormonal-immune axes, dexamethasone (DEX), methimazole, and thyroxine (T4) were used to study the influence of glucocorticoid excess, hypo-, and hyperthyroidism on immunity, respectively. Subsequently, the effects of polychlorinated biphenyls (PCBs, Aroclor 1254) on immune, endocrine, and hepatic cytochrome-P450 function were evaluated and interpreted using results from the endocrine/immune studies. Results of these studies showed that antibody production was susceptible to suppression by DEX at doses which also caused significant changes in clinical plasma biochemistry values. NKC activity was enhanced by exposure to DEX in vivo, a phenomenon due to the inhibition of PGE2 production by adherent peripheral blood cells by DEX and mimicked in vitro with addition of indomethacin or DEX. Macrophage phagocytosis was significantly suppressed by DEX in vitro. Macrophage production of PGE2 ex vivo was suppressed in birds treated with DEX. In contrast to DEX, T4 or methimazole treatment elicited only slight physiologic changes in plasma albumin and cholesterol levels. No immune/thyroid axis was observed in mallards. Exposure to Aroclor 1254 induced significant hepatic microsomal ethoxy- and pentoxy-resorufin-O-deethylase activities in addition to increasing total cytochrome P450 content, but did not affect immune function, plasma corticosterone, or clinical biochemistry values. Total triiodothyronine, but not T4, was dose-dependently suppressed by PCB treatment.

  14. Health assessment of gasoline and fuel oxygenate vapors: immunotoxicity evaluation.

    PubMed

    White, Kimber L; Peachee, Vanessa L; Armstrong, Sarah R; Twerdok, Lorraine E; Clark, Charles R; Schreiner, Ceinwen A

    2014-11-01

    Female Sprague Dawley rats were exposed via inhalation to vapor condensates of either gasoline or gasoline combined with various fuel oxygenates to assess potential immunotoxicity of evaporative emissions. Test articles included vapor condensates prepared from "baseline gasoline" (BGVC), or gasoline combined with methyl tertiary butyl ether (G/MTBE), ethyl t-butyl ether (G/ETBE), t-amyl methyl ether (G/TAME), diisopropyl ether (G/DIPE), ethanol (G/EtOH), or t-butyl alcohol (G/TBA). Target concentrations were 0, 2000, 10,000 or 20,000mg/mg(3) administered for 6h/day, 5days/week for 4weeks. The antibody-forming cell (AFC) response to the T-dependent antigen, sheep erythrocyte (sRBC), was used to determine the effects of the gasoline vapor condensates on the humoral components of the immune system. Exposure to BGVC, G/MTBE, G/TAME, and G/TBA did not result in significant changes in the IgM AFC response to sRBC, when evaluated as either specific activity (AFC/10(6) spleen cells) or as total spleen activity (AFC/spleen). Exposure to G/EtOH and G/DIPE resulted in a dose-dependent decrease in the AFC response, reaching the level of statistical significance only at the high 20,000mg/m(3) level. Exposure to G/ETBE resulted in a statistically significant decrease in the AFC response at the middle (10,000mg/m(3)) and high (20,000mg/m(3)) exposure concentrations. PMID:24793263

  15. Immunotoxic effects of environmental pollutants in marine mammals.

    PubMed

    Desforges, Jean-Pierre W; Sonne, Christian; Levin, Milton; Siebert, Ursula; De Guise, Sylvain; Dietz, Rune

    2016-01-01

    immune function in marine mammals exposed to environmental contaminants. Exposure to immunotoxic contaminants may have significant population level consequences as a contributing factor to increasing anthropogenic stress in wildlife and infectious disease outbreaks. PMID:26590481

  16. IMMUNOTOXICITY OF TRIBUTYLTIN OXIDE IN RATS EXPOSED AS ADULTS OR PRE-WEANLINGS

    EPA Science Inventory

    A comparison was made between adult and pre-weanling rats of the immunotoxic effects of acute dosing with bis(tri-n-butyltin) oxide (TBT0). dult (9 week old) male Fischer rats were dosed by oral gavage with TBT0 for 10 consecutive days at 2.5 to 10 mg/kg/dose or three times per w...

  17. IMMUNOTOXICITY OF 2-METHOXYETHANOL FOLLOWING ORAL ADMINISTRATION IN FISCHER 344 RATS

    EPA Science Inventory

    The immunotoxicity of the glycol ether 2-methoxyethanol (ME) as evaluated in adult Fischer 344 rats using a variety of in vitro and in vivo immune function assays. n the first phase of this study, male rats are dosed by oral gavage with ME in water, at dosages ranging from 50 to ...

  18. ENVIRONMENTAL POLLUTION AND THE IMMUNE SYSTEM: MECHANISMS OF IMMUNOTOXICITY ACROSS PHYLA

    EPA Science Inventory

    Environmental pollution and the immune system: Mechanisms of immunotoxicity across phyla. Bob Luebke and Dori Germolec, US EPA, RTP, NC and NIEHS, RTP, NC

    Our current understanding of immunotoxicology comes largely from studies done in rodents or using in vitro systems, a...

  19. EVALUATION OF THE IMMUNOTOXIC POTENTIAL OF CHLORDECONE WITH COMPARISON TO CYCLOPHOSPHAMIDE

    EPA Science Inventory

    The immunotoxic potential of chlordecone was evaluated in male Fischer 344 rats following 10 days of dosing by oral gavage. These results were compared with a comparable dosing regimen with the known immunosuppressive drug cyclophosphamide. Significant changes in the immune param...

  20. Resveratrol (3,5,4'-trihydroxystilbene) protects pregnant mother and fetus from the immunotoxic effects of TCDD

    PubMed Central

    Singh, Narendra P.; Singh, Ugra S.; Nagarkatti, Mitzi; Nagarkatti, Prakash S.

    2011-01-01

    The “fetal basis of adult disease” hypothesis proposes that prenatal exposure to environmental stress can lead to increased susceptibility to clinical disorders later in life. Utero exposure of fetus to TCDD, leads to alterations in T cell differentiation in the thymus and increased susceptibility to autoimmune disease later in life. TCDD triggers a toxicity through activation of AhR and severely affects maternal immune system during pregnancy. In the current study, using a mouse model, we investigated if administration of resveratrol (RES) would inhibit immunotoxicity induced by TCDD during pregnancy in the mother and fetus. We observed that RES protected not only normal non-pregnant mice but also pregnant mothers and their fetuses from TCDD-induced thymic atrophy, apoptosis, and alterations in the expression of T cell receptor (TCR) and costimulatory molecules as well as T cell differentiation. Also, there was significantly reduced expression of CYP1A1 in thymi of both the mother and fetus when RES was used in vivo post-TCDD exposure. In conclusion, these studies demonstrate that consumption of RES, a natural plant product, during pregnancy, may afford protection to the mother and the fetus from the toxicity induced by environmental pollutants that mediate their effects through activation of AhR. PMID:20715097

  1. Immunotoxicity of silver nanoparticles in an intravenous 28-day repeated-dose toxicity study in rats

    PubMed Central

    2014-01-01

    Background Nanosilver is used in a variety of medical and consumer products because of its antibacterial activity. This wide application results in an increased human exposure. Knowledge on the systemic toxicity of nanosilver is, however, relatively scarce. In a previous study, the systemic toxicity of 20 nm silver nanoparticles (Ag-NP) was studied in a 28-day repeated-dose toxicity study in rats. Ag-NP were intravenously administered with a maximum dose of 6 mg/kg body weight (bw)/day. Several immune parameters were affected: reduced thymus weight, increased spleen weight and spleen cell number, a strongly reduced NK cell activity, and reduced IFN-γ production were observed. Methods Prompted by these affected immune parameters, we wished to assess exposure effects on the functional immune system. Therefore, in the present study the T-cell dependent antibody response (TDAR) to keyhole limpet hemocyanin (KLH) was measured in a similar 28-day intravenous repeated-dose toxicity study. In addition, a range of immunological parameters was measured. Data obtained using the benchmark dose (BMD) approach were analyzed by fitting dose-response models to the parameters measured. Results A reduction in KLH-specific IgG was seen, with a lowest 5% lower confidence bound of the BMD (BMDL) of 0.40 mg/kg bw/day. This suggests that Ag-NP induce suppression of the functional immune system. Other parameters sensitive to Ag-NP exposure were in line with our previous study: a reduced thymus weight with a BMDL of 0.76 mg/kg bw/day, and an increased spleen weight, spleen cell number, and spleen cell subsets, with BMDLs between 0.36 and 1.11 mg/kg bw/day. Because the effects on the spleen are not reflected by increased KLH-specific IgG, they, however, do not suggest immune stimulation. Conclusions Intravenous Ag-NP administration in a 28-day repeated-dose toxicity study induces suppression of the functional immune system. This finding underscores the importance to study the TDAR to

  2. Immunotoxicity activity of the major essential oils of Valeriana fauriei Briq against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Moon, Hyung-In

    2011-03-01

    The rhizomes and roots of Valeriana fauriei were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of V. fauriei. The V. fauriei essential oil (VFEO) yield was 1.93%, and GC/MS analysis revealed that its major constituents were bornyl acetate (32.83%), terpinyl acetate (3.82%), bornyl isovalerate (2.11%), β-sesquiphellandrene (2.21%), sesquiterpene alcohol (7.32%), and cedrol (2.45%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 30.44 ppm and an LC(90) value of 82.64 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against Aedes aegypti L. PMID:20462349

  3. Immunotoxicity activity of the major essential oil of Filipendula glaberrima against Aedes aegypti L.

    PubMed

    Lee, Sung-Jae; Moon, Hyung-In

    2010-12-01

    The aerial parts of Filipendula glaberrima were extracted and the composition and immunotoxicity effects of major essential oils were studied. The analyses conducted by gas chromatography and mass spectroscopy (GC-MS) revealed the essential oils of F. glaberrima. The F. glaberrima essential oil (FGEO) yield was 0.046%, and GC/MS analysis revealed that its major constituents were β-farnesol (2.96%), l-α-terpineol (2.43%), benzenemethanol (2.87%), (Z)-3-hexen-1-ol (5.23%), and 2,6-bis(1,1-dimethylethyl)-4-methylphenol (1.91%). The essential oil had a significant toxic effect against early fourth stage larvae of Aedes aegypti L with an LC(50) value of 28.43 ppm and an LC(90) value of 76.21 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20175741

  4. Immunotoxicity activity of sesquiterpenoids from black galingale (Kaempferia parviflora Wall. Ex. Baker) against Aedes aegypti L.

    PubMed

    Moon, Hyung-In; Cho, Sang-Buem; Lee, Jun-Hyeong; Paik, Hyun-Dong; Kim, Soo-Ki

    2011-06-01

    The roots of black galingale (Kaempferia parviflora) were chloroform-extracted and the isolated two sesquiterpene and immunotoxicity effects were studied. The structures and stereochemistry of these compounds were established on the basis of analysis of spectra including UV, MS, (1)H-NMR, and (13)C-NMR as follows: 1 (4α-acetoxycadina-2,9-diene-1,8-dione), 2 (1α,3α,4β-trihydroxy-9-cadinen-8-one). Compound 2 had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L. with an LC(50) value of 0.7 μM and an LC(90) value of 3.8 μM. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20925462

  5. 'Fluorescent Cell Chip' for immunotoxicity testing: Development of the c-fos expression reporter cell lines

    SciTech Connect

    Trzaska, Dominika; Zembek, Patrycja; Olszewski, Maciej; Adamczewska, Violetta; Ulleras, Erik; Dastych, JarosIaw . E-mail: jdastych@cbm.pan.pl

    2005-09-01

    The Fluorescent Cell Chip for in vitro immunotoxicity testing employs cell lines derived from lymphocytes, mast cells, and monocytes-macrophages transfected with various EGFP cytokine reporter gene constructs. While cytokine expression is a valid endpoint for in vitro immunotoxicity screening, additional marker for the immediate-early response gene expression level could be of interest for further development and refinement of the Fluorescent Cell Chip. We have used BW.5147.3 murine thymoma transfected with c-fos reporter constructs to obtain reporter cell lines expressing ECFP under the control of murine c-fos promoter. These cells upon serum withdrawal and readdition and incubation with heavy metal compounds showed paralleled induction of c-Fos expression as evidenced by Real-Time PCR and ECFP fluorescence as evidenced by computer-supported fluorescence microscopy. In conclusion, we developed fluorescent reporter cell lines that could be employed in a simple and time-efficient screening assay for possible action of chemicals on c-Fos expression in lymphocytes. The evaluation of usefulness of these cells for the Fluorescent Cell Chip-based detection of immunotoxicity will require additional testing with a larger number of chemicals.

  6. Biomarkers of Methylmercury Exposure Immunotoxicity among Fish Consumers in Amazonian Brazil

    PubMed Central

    Fillion, Myriam; Barbosa, Fernando; Shirley, Devon L.; Chine, Chiameka; Lemire, Melanie; Mergler, Donna; Silbergeld, Ellen K.

    2011-01-01

    Background: Mercury (Hg) is a ubiquitous environmental contaminant with neurodevelopmental and immune system effects. An informative biomarker of Hg-induced immunotoxicity could aid studies on the potential contribution to immune-related health effects. Objectives: Our objectives were to test the hypothesis that methylmercury (MeHg) exposures affect levels of serum biomarkers and to examine interactions between Hg and selenium (Se) in terms of these responses. Methods: This cross-sectional epidemiological study assessed adults living along the Tapajós River, a system long affected by MeHg. We measured antinuclear (ANA) and antinucleolar (ANoA) autoantibody levels and eight cytokines in serum samples (n = 232). Total Hg (including MeHg) and Se were measured in blood, plasma, hair, and urine. Results: The median (range) total Hg concentrations were 14.1 μg/g (1.1–62.4), 53.5 μg/L (4.3–288.9), 8.8 μg/L (0.2–40), and 3.0 μg/L (0.2–16.1) for hair, blood, plasma, and urine, respectively. Elevated titers of ANA (but not ANoA) were positively associated with MeHg exposure (log-transformed, for blood and plasma), unadjusted [odds ratio (OR) = 2.6; 95% confidence interval (CI): 1.1, 6.2] and adjusted for sex and age (OR = 2.9; 95% CI: 1.1, 7.5). Proinflammatory [interleukin (IL)-6 and interferon (IFN)-©], anti-inflammatory (IL-4), and IL-17 cytokine levels were increased with MeHg exposure; however, in the subset of the population with elevated ANA, proinflammatory IL-1®, IL-6, IFN-©, and tumor necrosis factor (TNF)-〈 and anti-inflammatory (IL-4) cytokine levels were decreased with MeHg exposure. Although Se status was associated with MeHg level (correlation coefficient = 0.86; 95% CI: 0.29, 1.43), Se status was not associated with any changes in ANA and did not modify associations between Hg and ANA titers. Conclusions: MeHg exposure was associated with an increased ANA and changes in serum cytokine profile. Moreover, alterations in serum cytokine profiles

  7. FR901459, a novel immunosuppressant isolated from Stachybotrys chartarum No. 19392. Taxonomy of the producing organism, fermentation, isolation, physico-chemical properties and biological activities.

    PubMed

    Sakamoto, K; Tsujii, E; Miyauchi, M; Nakanishi, T; Yamashita, M; Shigematsu, N; Tada, T; Izumi, S; Okuhara, M

    1993-12-01

    FR901459, a novel immunosuppressant, has been isolated from the fermentation broth of Stachybotrys chartarum No. 19392. The molecular formula of FR901459 was determined as C62H111N11O13. FR901459 was found to be a member of the cyclosporin family. However, it is structurally distinct from any other cyclosporins discovered so far, in that Leu is present at position 5 instead of Val. FR901459 was capable of prolonging the survival time of skin allografts in rats with one third the potency of cyclosporin A. PMID:8294235

  8. The toxicity of chlorpyrifos on the early life stage of zebrafish: a survey on the endpoints at development, locomotor behavior, oxidative stress and immunotoxicity.

    PubMed

    Jin, Yuanxiang; Liu, Zhenzhen; Peng, Tao; Fu, Zhengwei

    2015-04-01

    Chlorpyrifos (CPF) is one of the most toxic pesticides in aquatic ecosystem, but its toxicity mechanisms to fish are still not fully understood. This study examined the toxicity targets of CPF in early life stage of zebrafish on the endpoints at developmental toxicity, neurotoxicity, oxidative stress and immunotoxicity. Firstly, CPF exposure decreased the body length, inhibited the hatchability and heart rate, and resulted in a number of morphological abnormalities, primarily spinal deformities (SD) and pericardial edema (PE), in larval zebrafish. Secondly, the free swimming activities and the swimming behaviors of the larvae in response to the stimulation of light-to-dark photoperiod transition were significantly influenced by the exposure to 100 and 300 μg/L CPF. In addition, the activity of acetylcholinesterase (AChE) and the transcription of some genes related to neurotoxicity were also influenced by CPF exposure. Thirdly, CPF exposure induced oxidative stress in the larval zebrafish. The malondialdehyde (MDA) levels increased and the glutathione (GSH) contents decreased significantly in a concentration-dependent manner after the exposure to CPF for 96 hours post fertilization (hpf). CPF affected not only the activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX) and glutathione S-transferase (GST), but also the transcriptional levels of their respective genes. Finally, the mRNA levels of the main cytokines including tumor necrosis factor α (Tnfα), interferon (Ifn), interleukin-1 beta (Il-1β), interleukin 6 (Il6), complement factor 4 (C4) in the larvae increased significantly after the exposure to 100 or 300 μg/L CPF for 96 hpf, suggesting that the innate immune system disturbed by CPF in larvae. Taken together, our results suggested that CPF had the potential to cause developmental toxicity, behavior alterations, oxidative stress and immunotoxicity in the larval zebrafish. PMID:25634256

  9. Toxicogenomic Profiles in Relation to Maternal Immunotoxic Exposure and Immune Functionality in Newborns

    PubMed Central

    Hochstenbach, Kevin

    2012-01-01

    A crucial period for the development of the immune system occurs in utero. This results in a high fetal vulnerability to immunotoxic exposure, and indeed, immunotoxic effects have been reported, demonstrating negative effects on immune-related health outcomes and immune functionality. Within the NewGeneris cohort BraMat, a subcohort of the Norwegian Mother and Child Cohort Study (MoBa), immunotoxicity was demonstrated for polychlorinated biphenyls and dioxins, showing associations between estimated maternal intake levels and reduced measles vaccination responses in the offspring at the age of 3. The present study aimed to investigate this link at the transcriptomic level within the same BraMat cohort. To this end, whole-genome gene expression in cord blood was investigated and found to be associated with maternal Food Frequency Questionnaires–derived exposure estimates and with vaccination responses in children at 3 years of age. Because the literature reports gender specificity in the innate, humoral, and cell-mediated responses to viral vaccines, separate analysis for males and females was conducted. Separate gene sets for male and female neonates were identified, comprising genes significantly correlating with both 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and polychlorinated biphenyls (PCB) exposure and with measles vaccination response. Noteworthy, genes correlating negatively with exposure in general show positive correlations with antibody levels and vice versa. For both sexes, these included immune-related genes, suggesting immunosuppressive effects of maternal exposure to TCDD and PCB at the transcriptomic level in neonates in relation to measles vaccination response 3 years later. PMID:22738990

  10. Immunotoxic effects of environmental toxicants in fish - how to assess them?

    PubMed

    Segner, Helmut; Wenger, Michael; Möller, Anja Maria; Köllner, Bernd; Casanova-Nakayama, Ayako

    2011-08-01

    Numerous environmental chemicals, both long-known toxicants such as persistent organic pollutants as well as emerging contaminants such as pharmaceuticals, are known to modulate immune parameters of wildlife species, what can have adverse consequences for the fitness of individuals including their capability to resist pathogen infections. Despite frequent field observations of impaired immunocompetence and increased disease incidence in contaminant-exposed wildlife populations, the potential relevance of immunotoxic effects for the ecological impact of chemicals is rarely considered in ecotoxicological risk assessment. A limiting factor in the assessment of immunotoxic effects might be the complexity of the immune system what makes it difficult (1) to select appropriate exposure and effect parameters out of the many immune parameters which could be measured, and (2) to evaluate the significance of the selected parameters for the overall fitness and immunocompetence of the organism. Here, we present - on the example of teleost fishes - a brief discussion of how to assess chemical impact on the immune system using parameters at different levels of complexity and integration: immune mediators, humoral immune effectors, cellular immune defenses, macroscopical and microscopical responses of lymphoid tissues and organs, and host resistance to pathogens. Importantly, adverse effects of chemicals on immunocompetence may be detectable only after immune system activation, e.g., after pathogen challenge, but not in the resting immune system of non-infected fish. Current limitations to further development and implementation of immunotoxicity assays and parameters in ecotoxicological risk assessment are not primarily due to technological constraints, but are related from insufficient knowledge of (1) possible modes of action in the immune system, (2) the importance of intra- and inter-species immune system variability for the response against chemical stressors, and (3

  11. Immunotoxicity evaluation of jet a jet fuel in female rats after 28-day dermal exposure.

    PubMed

    Mann, Cynthia M; Peachee, Vanessa L; Trimmer, Gary W; Lee, Ji-Eun; Twerdok, Lorraine E; White, Kimber L

    2008-01-01

    The potential for jet fuel to modulate immune functions has been reported in mice following dermal, inhalation, and oral routes of exposure; however, a functional evaluation of the immune system in rats following jet fuel exposure has not been conducted. In this study potential effects of commercial jet fuel (Jet A) on the rat immune system were assessed using a battery of functional assays developed to screen potential immunotoxic compounds. Jet A was applied to the unoccluded skin of 6- to 7-wk-old female Crl:CD (SD)IGS BR rats at doses of 165, 330, or 495 mg/kg/d for 28 d. Mineral oil was used as a vehicle to mitigate irritation resulting from repeated exposure to jet fuel. Cyclophosphamide and anti-asialo GM1 were used as positive controls for immunotoxic effects. In contrast to reported immunotoxic effects of jet fuel in mice, dermal exposure of rats to Jet A did not result in alterations in spleen or thymus weights, splenic lymphocyte subpopulations, immunoglobulin (Ig) M antibody-forming cell response to the T-dependent antigen, sheep red blood cells (sRBC), spleen cell proliferative response to anti-CD3 antibody, or natural killer (NK) cell activity. In each of the immunotoxicological assays conducted, the positive control produced the expected results, demonstrating the assay was capable of detecting an effect if one had occurred. Based on the immunological parameters evaluated under the experimental conditions of the study, Jet A did not adversely affect immune responses of female rats. It remains to be determined whether the observed difference between this study and some other studies reflects a difference in the immunological response of rats and mice or is the result of other factors. PMID:18338284

  12. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.

    2008-09-01

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  13. Immunotoxicity in ascidians: antifouling compounds alternative to organotins: III--the case of copper(I) and Irgarol 1051.

    PubMed

    Cima, Francesca; Ballarin, Loriano

    2012-09-01

    After the widespread ban of TBT, due to its severe impact on coastal biocoenoses, mainly related to its immunosuppressive effects on both invertebrates and vertebrates, alternative biocides such as Cu(I) salts and the triazine Irgarol 1051, the latter previously used in agriculture as a herbicide, have been massively introduced in combined formulations for antifouling paints against a wide spectrum of fouling organisms. Using short-term (60 min) haemocyte cultures of the colonial ascidian Botryllus schlosseri exposed to various sublethal concentrations of copper(I) chloride (LC(50)=281 μM, i.e., 17.8 mg Cu L(-1)) and Irgarol 1051 (LC(50)>500 μM, i.e., >127 mg L(-1)), we evaluated their immunotoxic effects through a series of cytochemical assays previously used for organotin compounds. Both compounds can induce dose-dependent immunosuppression, acting on different cellular targets and altering many activities of immunocytes but, unlike TBT, did not have significant effects on cell morphology. Generally, Cu(I) appeared to be more toxic than Irgarol 1051: it significantly (p<0.05) inhibited yeast phagocytosis at 0.1 μM (∼10 μg L(-1)), and affected calcium homeostasis and mitochondrial cytochrome-c oxidase activity at 0.01 μM (∼1 μg L(-1)). Both substances were able to change membrane permeability, induce apoptosis from concentrations of 0.1 μM (∼10 μg L(-1)) and 200 μM (∼50 mg L(-1)) for Cu(I) and Irgarol 1051, respectively, and alter the activity of hydrolases. Both Cu(I) and Irgarol 1051 inhibited the activity of phenoloxidase, but did not show any interactive effect when co-present in the exposure medium, suggesting different mechanisms of action. PMID:22542202

  14. Immunotoxicity and genotoxicity testing for in-flight experiments under microgravity

    NASA Astrophysics Data System (ADS)

    Hansen, Peter-Diedrich; Hansen, Peter-Diedrich; Unruh, Eckehardt

    Life Sciences as Related to Space (F) Influence of Spaceflight Environment on Biological Systems (F44) Immunotoxicity and genotoxicity testing for In-flight experiments under microgravity Sensing approaches for ecosystem and human health Author: Peter D. Hansen Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, a Institute for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany Peter-diedrich.hansen@tu-berlin.de Eckehardt Unruh Technische Universit¨t Berlin, Faculty VI - Planen, Bauen, Umwelt, Institute a for Ecological Research and Technology, Department for Ecotoxicology, Berlin, Germany An immune response by mussel hemocytes is the selective reaction to particles which are identified as foreign by its immune system shown by phagocytosis. Phagocytotic activity is based on the chemotaxis and adhesion, ingestion and phagosome formation. The attachment at the surface of the hemocytes and consequently the uptake of the particles or bacteria can be directly quantified in the format of a fluorescent assay. Another relevant endpoint of phagocytosis is oxidative burst measured by luminescence. Phagocytosis-related production of ROS will be stimulated with opsonised zymosan. The hemocytes will be stored frozen at -80oC and reconstituted in-flight for the experiment. The assay system of the TRIPLELUX-B Experiment has been performed with a well-defined quantification and evaluation of the immune function phagocytosis. The indicator cells are the hemocytes of blue mussels (Mytilus edulis). The signals of the immuno cellular responses are translated into luminescence as a rapid optical reporter system. The results expected will determine whether the observed responses are caused by microgravity and/or radiation (change in permeability, endpoints in genotoxicity: DNA unwinding). The samples for genotoxicity will be processed after returning to earth. The immune system of invertebrates has not been studied so far in space. The

  15. Assessment of the immunotoxic potential of the fungicide dinocap in mice

    SciTech Connect

    Smialowicz, R.J.; Luebke, R.W.; Riddle, M.M.

    1992-01-01

    The immunotoxic potential of dinocap was evaluated in female C57BL/6J mice following in vivo and in vitro exposure to the fungicide. In in vivo studies, groups of mice were dosed with technical grade dinocap at dosages ranging from 12.5 to 50 mg/kg/d and selected immune functions examined. Twelve days of dosing with dinocap at 25 mg/kg/d resulted in decreased thymus weights and cellularity, and increased spleen weights. Lymphoproliferative responses to concanavalin A (Con A) and phytohemagglutinin (PHA) were reduced in thymocytes from mice dosed at 25 mg/kg/d dinocap. The cytotoxic T lymphocyte (CTL) response to P815 mastocytoma cells was enhanced in mice exposed for 7 days to 25 mg/kg/d dinocap. In vitro studies using murine thymocytes cultured with dinocap (10 ug/ml for 72 hr) resulted in suppression of the proliferative response to Con A and PHA. These results suggest that dinocap is immunotoxic in the mouse, causing effects on T lymphocytes.

  16. Ecological impacts of the deepwater horizon oil spill: implications for immunotoxicity.

    PubMed

    Barron, Mace G

    2012-01-01

    The Deepwater Horizon (DWH) oil spill was the largest environmental disaster and response effort in U.S. history, with nearly 800 million liters of crude oil spilled. Vast areas of the Gulf of Mexico were contaminated with oil, including deep-ocean communities and over 1,600 kilometers of shoreline. Multiple species of pelagic, tidal, and estuarine organisms; sea turtles; marine mammals; and birds were affected, and over 20 million hectares of the Gulf of Mexico were closed to fishing. Several large-scale field efforts were performed, including assessments of shoreline and wildlife oiling and of coastal waters and sediments. The assessment of injuries, damages, and restoration options for the DWH spill is ongoing. Although petroleum and the polycyclic aromatic hydrocarbon component of oils are known to affect the immune systems of aquatic organisms and wildlife, immunotoxicity is not typically assessed during oil spills and has not been a focus of the DHW assessment. The effects of oil spill contaminants on immune responses are variable and often exposure dependent, but immunotoxic effects seem likely from the DHW spill based on the reported effects of a variety of oils on both aquatic and wildlife species. PMID:22105647

  17. Acute and subchronic toxic effects of atrazine and chlorpyrifos on common carp (Cyprinus carpio L.): Immunotoxicity assessments.

    PubMed

    Xing, Houjuan; Liu, Tao; Zhang, Ziwei; Wang, Xiaolong; Xu, Shiwen

    2015-08-01

    Atrazine (ATR) and chlorpyrifos (CPF) are widely used pesticides in agricultural practices throughout world. It has resulted in a series of toxicological and environmental problems, such as impacts on many non-target aquatic species, including fish. The spleen and head kidney in the bony fish are the major hematopoietic organs, and play a crucial part in immune responses. This study evaluated the subchronic effects of ATR and CPF on the mRNA and protein levels of HSP60, HSP70 and HSP90 in the immune organs of common carp and compared the acute and subchronic effects of ATR and CPF on the swimming speed (SS) of common carp. The results of acute toxicity tests showed that the 96 h-LC50 of ATR and CPF for common carp was determined to be 2.142 and 0.582 mg/L, respectively. Meanwhile, acute and subacute toxicity of ATR and CPF in common carp resulted in hypoactivity. We also found that the mRNA and protein levels of HSP60, HSP70 and HSP90 genes were induced in the spleen and head kidney of common carp exposed to ATR and CPF in the subchronic toxicity test. Our results indicate that ATR and CPF are highly toxic to common carp, and hypoactivity in common carp by acute and subchronic toxicity of ATR and CPF may provide a useful tool for assessing the toxicity of triazine herbicide and organophosphorous pesticides to aquatic organisms. In addition, the results from the subchronic toxicity test exhibited that increasing concentration of ATR and CPF in the environment causes considerable stress for common carp, suggesting that ATR and CPF exposure cause immunotoxicity to common carp. PMID:25917970

  18. Immunotoxicity of washing soda in a freshwater sponge of India.

    PubMed

    Mukherjee, Soumalya; Ray, Mitali; Ray, Sajal

    2015-03-01

    The natural habitat of sponge, Eunapius carteri faces an ecotoxicological threat of contamination by washing soda, a common household cleaning agent of India. Washing soda is chemically known as sodium carbonate and is reported to be toxic to aquatic organisms. Domestic effluent, drain water and various human activities in ponds and lakes have been identified as the major routes of washing soda contamination of water. Phagocytosis and generation of cytotoxic molecules are important immunological responses offered by the cells of sponges against environmental toxins and pathogens. Present study involves estimation of phagocytic response and generation of cytotoxic molecules like superoxide anion, nitric oxide and phenoloxidase in E. carteri under the environmentally realistic concentrations of washing soda. Sodium carbonate exposure resulted in a significant decrease in the phagocytic response of sponge cells under 4, 8, 16 mg/l of the toxin for 96h and all experimental concentrations of the toxin for 192h. Washing soda exposure yielded an initial increase in the generation of the superoxide anion and nitric oxide followed by a significant decrease in generation of these cytotoxic agents. Sponge cell generated a high degree of phenoloxidase activity under the experimental exposure of 2, 4, 8, 16 mg/l of sodium carbonate for 96 and 192 h. Washing soda induced alteration of phagocytic and cytotoxic responses of E. carteri was indicative to an undesirable shift in their immune status leading to the possible crises of survival and propagation of sponges in their natural habitat. PMID:25497767

  19. Immunotoxicity of silicon dioxide nanoparticles with different sizes and electrostatic charge

    PubMed Central

    Kim, Jae-Hyun; Kim, Cheol-Su; Ignacio, Rosa Mistica Coles; Kim, Dong-Heui; Sajo, Ma Easter Joy; Maeng, Eun Ho; Qi, Xu-Feng; Park, Seong-Eun; Kim, Yu-Ri; Kim, Meyoung-Kon; Lee, Kyu-Jae; Kim, Soo-Ki

    2014-01-01

    Silicon dioxide (SiO2) nanoparticles (NPs) have been widely used in the biomedical field, such as in drug delivery and gene therapy. However, little is known about the biological effects and potential hazards of SiO2. Herein, the colloidal SiO2 NPs with two different sizes (20 nm and 100 nm) and different charges (L-arginine modified: SiO2EN20[R], SiO2EN100[R]; and negative: SiO2EN20[−], SiO2EN100[−] were orally administered (750 mg/kg/day) in female C57BL/6 mice for 14 days. Assessments of immunotoxicity include hematology profiling, reactive oxygen species generation and their antioxidant effect, stimulation assays for B- and T-lymphocytes, the activity of natural killer (NK) cells, and cytokine profiling. In vitro toxicity was also investigated in the RAW 264.7 cell line. When the cellularity of mouse spleen was evaluated, there was an overall decrease in the proliferation of B- and T-cells for all the groups fed with SiO2 NPs. Specifically, the SiO2EN20(−) NPs showed the most pronounced reduction. In addition, the nitric oxide production and NK cell activity in SiO2 NP-fed mice were significantly suppressed. Moreover, there was a decrease in the serum concentration of inflammatory cytokines such as interleukin (IL)-1β, IL-12 (p70), IL-6, tumor necrosis factor-α, and interferon-γ. To elucidate the cytotoxicity mechanism of SiO2 in vivo, an in vitro study using the RAW 264.7 cell line was performed. Both the size and charge of SiO2 using murine macrophage RAW 264.7 cells decreased cell viability dose-dependently. Collectively, our data indicate that different sized and charged SiO2 NPs would cause differential immunotoxicity. Interestingly, the small-sized and negatively charged SiO2 NPs showed the most potent in vivo immunotoxicity by way of suppressing the proliferation of lymphocytes, depressing the killing activity of NK cells, and decreasing proinflammatory cytokine production, thus leading to immunosuppression. PMID:25565836

  20. Immunotoxicity assessment for the novel Spleen tyrosine kinase inhibitor R406

    SciTech Connect

    Zhu Yanhong; Herlaar, Ellen; Masuda, Esteban S.; Burleson, Gary R.; Nelson, Andrew J.; Grossbard, Elliott B.; Clemens, George R. . E-mail: gclemens@rigel.com

    2007-06-15

    Spleen tyrosine kinase (Syk) is a novel pharmaceutical target for treatment of allergic, autoimmune, and neoplastic disorders. Previous studies have indicated that Syk signaling plays critical roles in regulating the lymphohematopoietic system. These observations prompted us to investigate whether inhibition of Syk would promote immunotoxicity. In a series of studies, rats were treated orally with R406, at dose levels up to and including 100 mg/kg/day (or its prodrug R788 at dose levels up to and including 100 mg/kg/day, reduced to 50 mg/kg/day for females as MTD was exceeded), a potent Syk inhibitor, twice daily for 28 days. In addition to standard toxicological assessments, immunophenotyping by flow cytometric analysis, and a study of humoral immune response measuring anti-KLH IgM and IgG levels, were undertaken. Other immunotoxicity studies included three host resistance models in female Balb/c mice to further ascertain effects of R406 on innate and acquired immunity. Following R406 treatment, expected immunomodulating effects (e.g., decreased thymic and spleen weight, hypocellularity of bone marrow, and reduced lymphocyte counts, including T and B cells) were observed in the rat studies. These changes essentially resolved during a 14-day treatment-free recovery period. A KLH challenge in rats demonstrated no adverse effects on IgG or IgM response. R788/406, administered orally at dose levels up to and including 80 mg/kg/day for 28 days, did not affect bacterial or viral clearance in the Listeria, Streptococcal, or Influenza host resistance mouse models, respectively. This correlated with previous in vitro macrophage and neutrophil function assays (assessing migration, phagocytosis, oxidative burst and microbicidal activity), which revealed that R406 did not adversely affect macrophage or neutrophil function in innate immune responses. Collectively, these results demonstrate that R406 has minimal functional immunotoxicity notwithstanding its lymphocytopenic

  1. Composition and immunotoxicity activity of essential oils from Lindera obtusiloba Blume against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Moon, Hyung-In

    2011-03-01

    The leaves of Lindera obtusiloba Blume var. obtusiloba were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of L. obtusiloba. The L. obtusiloba essential oil yield was 4.23%, and GC/MS analysis revealed that its major constituents were α-copaene (31.42%), β-caryophyllene (32.11%), α-humulene (4.12%), β-farnesene (4.15%), α- cadinene (3.21%) and Nerolidol (6.84%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 24.32 ppm and an LC(90) value of 36.42 ppm. PMID:20477554

  2. Immunotoxicity of β-Diketone Antibiotic Mixtures to Zebrafish (Danio rerio) by Transcriptome Analysis

    PubMed Central

    Li, Fanghui; Wang, Hui; Liu, Jinfeng; Lin, Jiebo; Zeng, Aibing; Ai, Weiming; Wang, Xuedong; Dahlgren, Randy A.; Wang, Huili

    2016-01-01

    Fluoroquinolones and tetracyclines are known as β-diketone antibiotics (DKAs) because of bearing a diketone group in their molecular structure. DKAs are the most widely used antibiotics to prevent generation of disease in humans and animals and to suppress bacterial growth in aquaculture. In recent years, overuse of DKAs has caused serious environmental risk due to their pseudo-persistence in the environment, even though their half-lives are not long. So far, no reports were concerned with the joint immunotoxicity of DKAs. Herein, we reported on the immunotoxicity of DKAs on zebrafish after a 3-month DKAs exposure using transcriptomic techniques. According to transcriptome sequencing, 10 differentially expressed genes were screened out among the genes related to KEGG pathways with high enrichment. The identified 7 genes showed to be consistent between RNA-seq and qRT-PCR. Due to DKAs exposure, the content or activity for a series of immune-related biomarkers (Complement 3, lysozyme, IgM and AKP) showed the inconsistent changing trends as compared with the control group. Histopathological observations showed that the number of goblet cells increased sharply, the columnar epithelial cells swelled, the nucleus became slender in intestinal villi, and numerous brown metachromatic granules occurred in spleens of DKAs-exposed groups. Overall, both detection of biomarkers and histopathological observation corroborated that chronic DKAs exposure could result in abnormal expression of immune genes and enzymes, and variable levels of damage to immune-related organs. These complex effects of DKAs may lead to zebrafish dysfunction and occurrence of diseases related to the immune system. PMID:27046191

  3. Immunotoxicity and genotoxicity testing of PLGA-PEO nanoparticles in human blood cell model.

    PubMed

    Tulinska, Jana; Kazimirova, Alena; Kuricova, Miroslava; Barancokova, Magdalena; Liskova, Aurelia; Neubauerova, Eva; Drlickova, Martina; Ciampor, Fedor; Vavra, Ivo; Bilanicova, Dagmar; Pojana, Giulio; Staruchova, Marta; Horvathova, Mira; Jahnova, Eva; Volkovova, Katarina; Bartusova, Maria; Cagalinec, Michal; Dusinska, Maria

    2015-05-01

    A human blood cell model for immunotoxicity and genotoxicity testing was used to measure the response to polylactic-co-glycolic acid (PLGA-PEO) nanoparticle (NP) (0.12, 3, 15 and 75 μg/cm(2) exposure in fresh peripheral whole blood cultures/isolated peripheral blood mononuclear cell cultures from human volunteers (n = 9-13). PLGA-PEO NPs were not toxic up to dose 3 μg/cm(2); dose of 75 μg/cm(2) displays significant decrease in [(3)H]-thymidine incorporation into DNA of proliferating cells after 4 h (70% of control) and 48 h (84%) exposure to NPs. In non-cytotoxic concentrations, in vitro assessment of the immunotoxic effects displayed moderate but significant suppression of proliferative activity of T-lymphocytes and T-dependent B-cell response in cultures stimulated with PWM > CON A, and no changes in PHA cultures. Decrease in proliferative function was the most significant in T-cells stimulated with CD3 antigen (up to 84%). Cytotoxicity of natural killer cells was suppressed moderately (92%) but significantly in middle-dosed cultures (4 h exposure). On the other hand, in low PLGA-PEO NPs dosed cultures, significant stimulation of phagocytic activity of granulocytes (119%) > monocytes (117%) and respiratory burst of phagocytes (122%) was recorded. Genotoxicity assessment revealed no increase in the number of micronucleated binucleated cells and no induction of SBs or oxidised DNA bases in PLGA-PEO-treated cells. To conclude on immuno- and genotoxicity of PLGA-PEO NPs, more experiments with various particle size, charge and composition need to be done. PMID:23859252

  4. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening

    SciTech Connect

    Baken, Kirsten A. Pennings, Jeroen L.A.; Jonker, Martijs J.; Schaap, Mirjam M.; Vries, Annemieke de; Steeg, Harry van; Breit, Timo M.; Loveren, Henk van

    2008-01-01

    In order to investigate immunotoxic effects of a set of model compounds in mice, a toxicogenomics approach was combined with information on macroscopical and histopathological effects on spleens and on modulation of immune function. Bis(tri-n-butyltin)oxide (TBTO), cyclosporin A (CsA), and benzo[a]pyrene (B[a]P) were administered to C57BL/6 mice at immunosuppressive dose levels. Acetaminophen (APAP) was included in the study since indications of immunomodulating properties of this compound have appeared in the literature. TBTO exposure caused the most pronounced effect on gene expression and also resulted in the most severe reduction of body weight gain and induction of splenic irregularities. All compounds caused inhibition of cell division in the spleen as shown by microarray analysis as well as by suppression of lymphocyte proliferation after application of a contact sensitizer as demonstrated in an immune function assay that was adapted from the local lymph node assay. The immunotoxicogenomics approach applied in this study thus pointed to immunosuppression through cell cycle arrest as a common mechanism of action of immunotoxicants, including APAP. Genes related to cell division such as Ccna2, Brca1, Birc5, Incenp, and Cdkn1a (p21) were identified as candidate genes to indicate anti-proliferative effects of xenobiotics in immune cells for future screening assays. The results of our experiments also show the value of group wise pathway analysis for detection of more subtle transcriptional effects and the potency of evaluation of effects in the spleen to demonstrate immunotoxicity.

  5. Enteric reovirus infection as a probe to study immunotoxicity of the gastrointestinal tract.

    PubMed

    Cuff, C F; Fulton, J R; Barnett, J B; Boyce, C S

    1998-04-01

    The gastrointestinal (GI) tract contains a complex immune system that defends the host against a wide range of pathogens and toxins. The GI tract is also exposed to many environmental toxins that could adversely affect intestinal immunity, and few systems to study immunotoxicity of the GI tract have been described. We demonstrate that intestinal reovirus infection can be used as a system to assess the effects of toxins on intestinal and systemic immunity. Mice were given various doses of cyclophosphamide (CY) for 5 days at doses ranging from 100 to 500 mg/kg by the oral route or 200 mg/kg by the intraperitoneal route. On day 3 of dosing, mice were orally infected with reovirus serotype 1, strain Lang. The effects of CY on viral clearance, intestinal and systemic immune responses, and distribution of intestinal lymphocytes were assessed. Mice treated with CY failed to clear the virus in a dose-dependent manner, and serum anti-reovirus antibody titers were suppressed. Virus-specific IgA in cultures of intestinal tissue from CY-treated mice was significantly reduced compared to controls, although total IgA production was not affected. The virus-specific cytotoxic T-cell response in spleen was also suppressed in CY-treated animals. Cyclophosphamide treatment reduced the number and percentage of B-cells in Peyer's patches. Reovirus infection did not increase cellularity of Peyer's patches in CY-treated mice. Cyclophosphamide treatment also had little effect on the phenotype of intestinal intraepithelial lymphocytes. These data demonstrate that intestinal reovirus infection is useful in studying exposure of the GI tract to immunotoxic agents. PMID:9579022

  6. Effects of immunotoxic activity of the major essential oil of Angelica purpuraefolia Chung against Aedes aegypti L.

    PubMed

    Park, Yool-Jin; Chung, Ill-Min; Moon, Hyung-In

    2010-12-01

    The rhizomes parts of Angelica purpuraefolia were extracted and the major essential oils composition and immunotoxic effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of A. purpuraefolia. The A. purpuraefolia essential oil (APEO) yield was 0.37%, and GC/MS analysis revealed that its major constituents were β-Phellandrene (32.11%), Nerolidol (10.11%), Pyrimidine derivative (27.33%), Heptadecane (4.33%), and Celorbicol (6.33%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 31.21 ppm and an LC(90) value of 87.22 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxic agents against A. aegypti. PMID:20163192

  7. Immunotoxicity Studies

    EPA Science Inventory

    Immunotoxicology is a subdiscipline of toxicology that focuses on unintended modulation of the immune system. Effects that may occur include immunosuppression, immunostimulation, hypersensitivity, or autoimmunity, which may result in outcomes such as increased incidences of infec...

  8. IMMUNOTOXICITY STUDIES

    EPA Science Inventory

    Few D/DBPs have been evaluated for effects on the immune system, but certain studies suggest that immunosuppression may follow exposure to D/DBPs. Suppressed immune function is associated with increased susceptibility to infectious disease and certain types of cancer in humans a...

  9. Genotoxic and immunotoxic potential effects of selected psychotropic drugs and antibiotics on blue mussel (Mytilus edulis) hemocytes.

    PubMed

    Lacaze, Emilie; Pédelucq, Julie; Fortier, Marlène; Brousseau, Pauline; Auffret, Michel; Budzinski, Hélène; Fournier, Michel

    2015-07-01

    The potential toxicity of pharmaceuticals towards aquatic invertebrates is still poorly understood and sometimes controversial. This study aims to document the in vitro genotoxicity and immunotoxicity of psychotropic drugs and antibiotics on Mytilus edulis. Mussel hemocytes were exposed to fluoxetine, paroxetine, venlafaxine, carbamazepine, sulfamethoxazole, trimethoprim and erythromycin, at concentrations ranging from μg/L to mg/L. Paroxetine at 1.5 μg/L led to DNA damage while the same concentration of venlafaxine caused immunomodulation. Fluoxetine exposure resulted in genotoxicity, immunotoxicity and cytotoxicity. In the case of antibiotics, trimethoprim was genotoxic at 200 μg/L and immunotoxic at 20 mg/L whereas erythromycin elicited same detrimental effects at higher concentrations. DNA metabolism seems to be a highly sensitive target for psychotropic drugs and antibiotics. Furthermore, these compounds affect the immune system of bivalves, with varying intensity. This attests the relevance of these endpoints to assess the toxic mode of action of pharmaceuticals in the aquatic environment. PMID:25829077

  10. Vitamin E pretreatment prevents the immunotoxicity of dithiocarbamate pesticide mancozeb in vitro: A comparative age-related assessment in mice and chick.

    PubMed

    Singh, Saurabh Kumar; Bano, Farhad; Mohanty, Banalata

    2016-01-01

    Pesticides used for crop protection cause life-threatening diseases affecting the immune system of non-target organisms including birds and mammals. Functionality of immune system is age-dependent; early- as well as old-life stages are more susceptible to toxic exposures because of less competent immune system. Vitamins are so far known to reduce toxic effect of several pesticides and/or xenobiotics. The present in vitro study elucidated immunotoxicity of fungicide mancozeb through comparable stages of immune system maturation in mice (1, 3, and 12months) and chicks (4, 8, and 11weeks). In vitro splenocytes viability on exposure to mancozeb was quantitatively assessed by MTT assay and qualitatively by acridine orange and ethidium bromide (AO/EB) double fluorescence staining. Mancozeb exposure dose dependently (250, 500, 1000, 2500, 5000 and 10,000ng/ml) decreased the splenocytes viability. The in vitro preventive effect of Vitamin E has also been explored on toxicity induced by mancozeb. The increased susceptibility observed both in early and aged groups was due to less/decline competence of the immune system. PMID:26778438

  11. Efficacy of Nigella sativa in alleviating benzo[a]pyrene-induced immunotoxicity in broilers.

    PubMed

    Latif, I K; Karim, A J; Zuki, A B Z; Zamri-Saad, M; Niu, J P; Noordin, M M

    2011-06-01

    The immune response of broiler chickens exposed to intra-tracheal (i.t.) administration of benzo[a]pyrene (BaP) with and without Nigella sativa (Ns) supplementation was investigated. A total of 120 day-old chicks were divided into four groups comprising 30 birds each, into a control, Ns, BaP, and BaP+Ns group. Immune responses to Newcastle disease (ND) were evaluated by haemagglutination inhibition (HI), phytohaemagglutinin (PHA) skin test and carbon clearance assay (CCA). In most instances, there was a significant increase (p<0.05) in the ND-HI antibody titers, PHA skin-swelling response and phagocytic activity in the BaP + Ns group compared to that of the BaP group. Likewise, organ weight and indices of the spleen, bursa of Fabricius and thymus of birds from the BaP + Ns group were also higher (p<0.05) than that of the BaP group from day 1 until day 21. It is concluded that exposure to BaP may exert adverse effects on the immune system of broilers which may increase their susceptibility to disease, and Ns supplementation significantly reduces these alterations. PMID:21472685

  12. The influence of hydrocarbon composition and exposure conditions on jet fuel-induced immunotoxicity.

    PubMed

    Hilgaertner, Jianhua W; He, Xianghui; Camacho, Daniel; Badowski, Michael; Witten, Mark; Harris, David T

    2011-11-01

    Chronic jet fuel exposure could be detrimental to the health and well-being of exposed personnel, adversely affect their work performance and predispose these individuals to increased incidences of infectious disease, cancer and autoimmune disorders. Short-term (7 day) JP-8 jet fuel exposure has been shown to cause lung injury and immune dysfunction. Physiological alterations can be influenced not only by jet fuel exposure concentration (absolute amount), but also are dependent on the type of exposure (aerosol versus vapor) and the composition of the jet fuel (hydrocarbon composition). In the current study, these variables were examined with relation to effects of jet fuel exposure on immune function. It was discovered that real-time, in-line monitoring of jet fuel exposure resulted in aerosol exposure concentrations that were approximately one-eighth the concentration of previously reported exposure systems. Further, the effects of a synthetic jet fuel designed to eliminate polycyclic aromatic hydrocarbons were also examined. Both of these changes in exposure reduced but did not eliminate the deleterious effects on the immune system of exposed mice. PMID:21402657

  13. In vitro immunotoxicity assessment of culture-derived extracellular vesicles in human monocytes.

    PubMed

    Rosas, Lucia E; Elgamal, Ola A; Mo, Xiaokui; Phelps, Mitch A; Schmittgen, Thomas D; Papenfuss, Tracey L

    2016-09-01

    The potential to engineer extracellular vesicles (EV) that target specific cells and deliver a therapeutic payload has propelled a growing interest in their development as promising therapeutics. These EV are often produced from cultured cells. Very little is known about the interaction of cell culture-derived EV with cells of the immune system and their potential immunomodulatory effects. The present study evaluated potential immunotoxic effects of HEK293T-derived EV on the human monocytic cell lines THP-1 and U937. Incubation of cells with different doses of EV for 16-24 h was followed by assessment of cytotoxicity and cell function by flow cytometry. Changes in cell functionality were evaluated by the capacity of cells to phagocytize fluorescent microspheres. In addition, the internalization of labeled EV in THP-1 and U937 cells was evaluated. Exposure to EV did not affect the viability of THP-1 or U937 cells. Although lower doses of the EV increased phagocytic capacity in both cell lines, phagocytic efficiency of individual cells was not affected by EV exposure at any of the doses evaluated. This study also demonstrated that THP-1 and U937 monocytic cells are highly permissive to EV entry in a dose-response manner. These results suggest that, although HEK293T-derived EV are efficiently internalized by human monocytic cells, they do not exert a cytotoxic effect or alter phagocytic efficiency on the cell lines evaluated. PMID:27075513

  14. Immunotoxicity activity from various essential oils of Angelica genus from South Korea against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Kim, Eun-Hye; Lee, Jai-Heon; Lee, Young-Choon; Moon, Hyung-In

    2012-02-01

    The leaves of Angelica anomala Lallemant, Angelica cartilagino-marginata var. distans (Nakai) Kitag, Angelica czernevia (Fisch. et Meyer) Kitagawa, Angelica dahurica Benth. et Hooker, Angelica decursiva (Miq.) Franch. & Sav, Angelica fallax Boissieu, Angelica gigas Nakai, Angelica japonica A. gray were essential oil extracted and immunotoxicity effects were studied. The Angelica anomala, A. cartilagino-marginata var. distans, A. czernevia, A. dahurica, A. decursiva, A. fallax, A. gigas, A. japonica essential oil yield were 4.13, 4.83, 4.45, 3.25, 4.11, 4.73, 4.34 and 4.21%. The A. dahurica essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with a lethal concentration 50 (LC₅₀) value of 43.12 ppm and an LC₉₀ value of 65.23 ppm. The above indicates that essential oil contents may play a more important role in the toxicity of essential oil. PMID:21506693

  15. Immunotoxicity in plaice exposed to marine sediments in Baie des Anglais on the St. Lawrence Estuary

    SciTech Connect

    Lacroix, A.; Nagler, J.; Lee, K.; Lebeuf, M.; Cyr, D.; Fournier, M.

    1995-12-31

    The sediments of Baie des Anglais on the St. Lawrence Estuary have a history of environmental contamination. The purpose of the present study was to determine whether or not the immune system of American Plaice (Hippoglossoides Platessoides) could be affected following in-situ exposure at three different sites in and near Baie des Anglais. These sites vary with their proximity to local industry, Sites 1 and 2 (within the bay) being the closest and Site 3 (outside the bay) the furthest away. Fishes placed in cages at each site for three weeks, displayed head kidney cell immune responses (i.e., phagocytosis) modifications indicating that Site 1 was most immunotoxic and site 3 the least. Sediment chemical analysis show a gradient in contaminant concentrations with the highest levels recorded at Site 1, about 10-fold less at Site 2 and 100-fold less at Site 3. Organics predominated (PAHs, PCBs, PCDFs) with heavy metal concentrations low and representative of background levels for the St. Lawrence Estuary. The results obtained indicate that contaminants present in the sediments are bioavailable to fish and significantly affect their immune system.

  16. Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes: Enzyme assay for immunotoxicity of xenobiotics

    SciTech Connect

    Goven, A.J.; Chen, S.C.; Fitzpatrick, L.C. . Dept. of Biological Sciences); Venables, B.J. . Dept. of Biological Sciences TRAC Laboratories Inc., Denton, TX )

    1994-04-01

    Lysozyme activity in earthworm (Lumbricus terrestris) coelomic fluid and coelomocytes appears sufficiently sensitive for use as a nonmammalian biomarker to detect toxic effects of sublethal body burdens of Cu[sup 2+]. Lysozyme, a phylogenetically conserved enzyme, is capable of bactericidal activity via action on peptidoglycan of gram-positive bacterial cell walls and functions as a component of an organism's innate antimicrobial defense mechanism. Coelomic fluid and coelomocyte lysozyme activities, which exhibit temperature-response patterns similar to those of human saliva, plasma, serum and leukocyte extracts, were sensitive to Cu[sup 2+] exposure. Lysozyme activity of coelomic fluid and coelomocyte extracts from earthworms exposed for 5 d to CuSO[sub 4], using filter paper contact exposure, decreased with increasing sublethal Cu[sup 2+] concentrations of 0.05 and 0.1 [mu]g/cm[sup 2]. Compared to controls, coelomic fluid lysozyme activity was suppressed significantly at both exposure concentrations, whereas coelomocyte extract lysozyme activity was suppressed significantly at the 0.1-[mu]g/cm[sup 2] exposure concentration. Low inherent natural variability and sensitivity to sublethal Cu[sup 2+] body burdens indicate that lysozyme activity has potential as a biomarker for assaying immunotoxicity of metals.

  17. Early life environment and developmental immunotoxicity in inflammatory dysfunction and disease

    PubMed Central

    Leifer, Cynthia A.; Dietert, Rodney R.

    2015-01-01

    Components of the innate immune system such as macrophages and dendritic cells are instrumental in determining the fate of immune responses and are, also, among the most sensitive targets of early life environmental alterations including developmental immunotoxicity (DIT). DIT can impede innate immune cell maturation, disrupt tissue microenvironment, alter immune responses to infectious challenges, and disrupt regulatory responses. Dysregulation of inflammation, such as that observed with DIT, has been linked with an increased risk of chronic inflammatory diseases in both children and adults. In this review, we discuss the relationship between early-life risk factors for innate immune modulation and promotion of dysregulated inflammation associated with chronic inflammatory disease. The health risks from DIT-associated inflammation may extend beyond primary immune dysfunction to include an elevated risk of several later-life, inflammatory-mediated diseases that target a wide range of physiological systems and organs. For this reason, determination of innate immune status should be an integral part of drug and chemical safety evaluation. PMID:26146439

  18. Major essential oils composition and immunotoxicity activity from leaves of Foeniculum vulgare against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Ro, Hee-Myong; Moon, Huyng-In

    2011-09-01

    The leaves of Foeniculum vulgare (Umbelliferae) were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses conducted by gas chromatography and mass spectroscopy (GC-MS) revealed the essential oils of F. vulgare leaves. The F. vulgare essential oil yield was 0.97%, and GC/MS analysis revealed that its major constituents were methyl clavicol (46.3%), α-phellandrene (18.2%), fenchone (10.6%), (E)-anethole (11.3%), myrcene (3.4%), and α-pinene (2.1%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 41.23 ppm and an LC(90) value of 65.24 ppm. Also, methyl clavicol (≥98.0%), α-phellandrene (≥95.0%), fenchone (≥98.0%), (E)-anethole (≥99.0%), myrcene (≥99.0%), and α-pinene (≥99.0%) were tested against the F(21) laboratory strain of A. aegypti. Fenchone (≥98.0%) and (E)-anethole (≥99.0%) have medium activity with an LC(50) value of 73.11 ppm and 102.41 ppm. The above data indicate that major compounds interaction may play a more important role in the toxicity of essential oil. PMID:21077804

  19. Phagocytosis in earthworms: An environmentally acceptable endpoint to assess immunotoxic potential of contaminated soils

    SciTech Connect

    Giggleman, M.A.; Fitzpatrick, L.C.; Goven, A.J.; Venables, B.J.; Callahan, C.A.

    1995-12-31

    Phagocytosis, a host-defense mechanism phylogenetically conserved throughout the animal kingdom, by earthworm (Lumbricus terrestris) coelomocytes has potential as a surrogate for vertebrates to be used as an environmentally acceptable endpoint to assess sublethal immunotoxic risks of contaminated soils to environmental (eg. higher wildlife) and public health. Coelomocytes can be exposed in vivo to complex contaminated parent soils by placing earthworms in situ at hazardous waste sites (HWS) or into soil samples and their dilutions with artificial soil (AS) in the laboratory, or in vitro to soil extracts and their fractionations. Here the authors report on phagocytosis by coelomocytes in earthworms exposed to pentachlorophenol (PCP) contaminated soils from a wood treatment HWS, PCP-spiked AS and PCP treated filter paper (FP). HWS soil was diluted to 25% with AS to a sublethal concentration (ca. 125 mg kg{sup {minus}1}) and earthworms exposed for 14d at 10 C under light conditions. AS was spiked at ca. 125 mg kg{sup {minus}1} PCP and earthworms were similarly exposed. Controls for both consisted of earthworms exposed to 100% AS. Earthworms were exposed to FP treated with a sublethal PCP concentration (15 {micro}g cm{sup {minus}2}) at 10 C under dark conditions for 96H. Controls were similarly exposed without PCP. Phagocytosis by coelomocytes in earthworms exposed to HWS soil, spiked AS and treated FP was suppressed 37, 41 and 29%, respectively. Results are discussed in terms of PCP body burdens and exposure protocols.

  20. Data Mining as a Guide for the Construction of Cross-Linked Nanoparticles with Low Immunotoxicity via Control of Polymer Chemistry and Supramolecular Assembly.

    PubMed

    Elsabahy, Mahmoud; Wooley, Karen L

    2015-06-16

    The potential immunotoxicity of nanoparticles that are currently being approved, in different phases of clinical trials, or undergoing rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger various components of the immune system unintentionally and lead to serious adverse reactions. Cytokines are one of the useful biomarkers for predicting the effect of biotherapeutics on modulation of the immune system and for screening the immunotoxicity of nanoparticles both in vitro and in vivo, and they were recently found to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for the construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse, and experiments are usually conducted using different assays under specific conditions. As a result, making direct comparisons nearly impossible, and thus, tailoring the properties of nanomaterials on the basis of the available data is challenging. In this Account, the effects of chemical structure, cross-linking, degradability, morphology, concentration, and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with a focus on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized uniquely to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple way to compare the immunotoxicities of various nanomaterials, and the values were found to correlate well with published data. On the basis of the polymeric systems investigated in this study, valuable information has been collected that

  1. Data Mining as a Guide for the Construction of Crosslinked Nanoparticles with Low Immunotoxicity via Controlling Polymer Chemistry and Supramolecular Assembly

    PubMed Central

    Elsabahy, Mahmoud; Wooley, Karen L.

    2015-01-01

    CONSPECTUS The potential immunotoxicity of nanoparticles that are currently being approved or in different phases of clinical trials or under rigorous in vitro and in vivo characterizations in several laboratories has recently raised special attention. Products with no apparent in vitro or in vivo toxicity may still trigger the various components of the immune system, unintentionally, and lead to serious adverse reactions. Cytokines are one of the useful biomarkers to predict the effect of biotherapeutics on modulating the immune system and for screening the immunotoxicity of nanoparticles, both in vitro and in vivo, and were found recently to partially predict the in vivo pharmacokinetics and biodistribution of nanomaterials. Control of polymer chemistry and supramolecular assembly provides a great opportunity for construction of biocompatible nanoparticles for biomedical clinical applications. However, the sources of data collected regarding immunotoxicities of nanomaterials are diverse and experiments are usually conducted using different assays and under specific conditions, making direct comparisons nearly impossible and, thus, tailoring properties of nanomaterials based on the available data is challenging. In this account, the effects of chemical structure, crosslinking, degradability, morphology, concentration and surface chemistry on the immunotoxicity of an expansive array of polymeric nanomaterials will be highlighted, with focus being given on assays conducted using the same in vitro and in vivo models and experimental conditions. Furthermore, numerical descriptive values have been utilized, uniquely, to stand for induction of cytokines by nanoparticles. This treatment of available data provides a simple and easy way to compare the immunotoxicity of various nanomaterials, and the values were found to correlate-well with published data. Based on the investigated polymeric systems in this study, valuable information has been collected that aids in the

  2. Immunotoxicity of zearalenone in Balb/c mice in a high subchronic dosing study counteracted by Raphanus sativus extract.

    PubMed

    Salah-Abbès, Jalila Ben; Abbès, Samir; Abdel-Wahhab, Ma; Oueslati, Ridha

    2010-12-01

    Radish (Raphanus sativus) is a cruciferous plant, rich on flavonoids, isothiocyanates, and phenolic acids. They show anti-inflammatory and immunomodulatory activity both in vitro and in vivo. Isothiocyanates and flavonoids have been reported previously to prevent low-sub-chronic dose of zearalenone (ZEN) causing immunotoxicity. The present study focuses on the amelioration of fusarotoxicosis in Balb/c mice by feeding two concentrations of radish extract. The extract at 15 and 30 mg/kg bw, was evaluated to reduce the deleterious effects in immunological parameters of high subchronic doses of 40 and 80 mg of ZEN/kg bw on modulation of lipopolysaccharide (LPS). ZEN consuming mice showed a "dose-related" decrease in weight gain and in the immune relative weights organs. Moreover, Atrophy and lymphoid depletion were seen in the histopathology of spleen. Ingestion of ZEN at either level had a significant effect on total red blood cell numbers and on their relative number of lymphocytes. Likewise, ZEN alters the production of regulatory cytokines and antibody of LPS stimulated mice. By contrast, the additions of radish extract with a low or high dose of ZEN moderately decreased the affected mice and/or the severity of lesions, and all tested parameters were normal or at least near normal levels. In addition, the radish extract alone did not produce any significant changes in all tested parameters compared with the controls. In conclusion, radish extract was effective for the protection of high dose ZEN-immunotoxication in mice and it could contribute to a solution of the ZEN immunotoxicity in humans and in farm animals. PMID:20205508

  3. Biological responses of Raw 264.7 macrophage exposed to two strains of Stachybotrys chartarum spores grown on four different wallboard types.

    PubMed

    Kim, J H; Harvey, L A; Evans, A L; Byfield, G E; Betancourt, D A; Dean, T R

    2016-06-01

    The many benefits of building "green" have motivated the use of sustainable products in the design and execution of the built environment. However, the use of these natural or recycled materials, some of which have been treated with antimicrobials, provides a growth opportunity for microorganisms with the potential to elicit adverse health effects especially in the presence of an antimicrobial. The focus of this research was to determine the effects of Stachybotrys chartarum (strains Houston and 51-11) grown under different conditions on a macrophage cell line (Raw 264.7) using endpoints, including cytotoxicity, and those associated with immunity specifically inflammation and MHC class II expression. The fungi were grown on four different gypsum products, and macrophages were exposed to whole spores of both strains and fragmented spores of strain 51-11. Whole spores of the Houston strain elicited no cytotoxicity with some level of inflammation, while exposure to whole spores of 51-11 caused variable responses depending on the wallboard type supporting the fungal growth. High concentrations of fragmented 51-11 spores primarily resulted in the apoptosis of macrophage with no inflammation. None of the fungal strains caused elevated levels of major histocompatibility complex (MHC) class II expression on the surface of Raw cells. Mycotoxin levels of 51-11 spores from all of the wallboard types measured  >250 ng/μL of T2 equivalent toxin based on activity. Collectively, the data demonstrated that all of the wallboard types supported growth of fungi with the ability to elicit harmful biological responses with the potential to negatively impact human health. PMID:27097835

  4. Effect of Different Selenium Supplementation Levels on Oxidative Stress, Cytokines, and Immunotoxicity in Chicken Thymus.

    PubMed

    Wang, Yachao; Jiang, Li; Li, Yuanfeng; Luo, Xuegang; He, Jian

    2016-08-01

    This study assessed the effects of different selenium (Se) supplementation levels on oxidative stress, cytokines, and immunotoxicity in chicken thymus. A total of 180 laying hens (1 day old; Mianyang, China) were randomly divided into 4 groups (n = 45). The chickens were maintained either on a basic diet (control group) containing 0.2 mg/kg Se, a low-supplemented diet containing 5 mg/kg Se, a medium-supplemented diet containing 10 mg/kg Se, or a high-supplemented diet containing 15 mg/kg Se for 15, 30, and 45 days, respectively. Over the entire experimental period, serum and thymus samples were collected and used for the detection of the experimental index. The results indicated that the antioxidative enzyme activities and messenger RNA (mRNA) levels of antioxidative enzymes, IFN-γ and IL-2 in the thymus, and the content of IFN-γ and IL-2 in the serum of excessive-Se-treated chickens at all time points (except for the 5 mg/kg Se supplement group at 15 days) were significantly decreased (P < 0.05) compared to the corresponding control groups. Interestingly, a significantly increase (P < 0.05) in the content of IFN-γ was observed in the serum and thymus in the 5 mg/kg Se supplement group at 15 and 30 days compared to the corresponding control groups. In histopathological examination, the thymus tissue from excessive-Se-treated chickens revealed different degrees of cortex drop, incrassation of the medulla, and degeneration of the reticular cells. These results suggested that the excessive Se could result in a decrease in immunity, an increase in oxidative damage, and a series of clinical pathology changes, such as cortex drop, incrassation of the medulla, and degeneration of the reticular cells. PMID:26740218

  5. Immunotoxicity of surface waters contaminated by municipal effluents to the snail Lymnaea stagnalis.

    PubMed

    Gust, M; Fortier, M; Garric, J; Fournier, M; Gagné, F

    2013-01-15

    The immunotoxic effects of surface waters contaminated by a municipal effluent dispersion plume were examined in the snail Lymnaea stagnalis. Snails were exposed to surface waters where changes in hemocyte counts, viability, levels of reactive oxygen species (ROS), reduced thiols and phagocytic activity were tracked following exposure periods of 3h and 3 and 7d. Changes in mRNA expression of some genes in the hemocytes were also assessed after 7d of exposure, as follows: genes coding for catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GSR), selenium-dependent glutathione peroxidase (SeGPX), two isoforms of the nitric oxide synthetase (NOS1 and NOS2), molluscan defensive molecule (MDM), toll-like receptor 4 (TLR4), allograft inflammatory factor-1 (AIF), and heat-shock protein 70 (HSP70). At the sites closest to the discharge point, exposure led to impaired hemocyte viability and intracellular thiol levels and also an increase of hemocyte count, ROS levels and phagocytosis. Phagocytosis and ROS levels in hemocytes were correlated with heterotrophic bacterial counts in snails. We found four genes with increased mRNA expression as a response to exposure of municipal wastewaters: TLR4 (6-fold), HSP70 (2-fold), SeGPx (4-fold) and CAT (2-fold). Immunocompetence responses were analyzed by canonical analysis to seek out relationships with mRNA expression of the genes involved in stress, pattern recognition, cellular and humoral responses. The data revealed that genes involved in oxidative stress were strongly involved with immunocompetence and that the resulting immune responses were influenced both by the bacterial and pollutant loadings of the effluent. PMID:23021492

  6. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    NASA Astrophysics Data System (ADS)

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-11-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery.

  7. Immunotoxicity activity of 1,2,4-trimethoxybenzene from the Paulownia coreana Uyeki. against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Moon, Hyung-In

    2011-03-01

    The flower parts of Paulownia coreana were extracted and the major essential oils composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of P. coreana. The P. coreana essential oil (PCEO) yield was 0.175%, and GC/MS analysis revealed that its major constituents were benzyl alcohol (13.72%), phenol, 3,4-dimethoxy-methyl ester (3.64%), phenol, 2-methoxy-3-(2-popenyl)-methyl ester (6.24%), 1,2,4-Trimethoxybenzene (8.32%), tricosane (3.28%), and pentacosane (3.26%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 31.64 ppm and an LC(90) value of 56.43 ppm. 1,2,4-Trimethoxybenzene was the most toxic among the major components with an LC(50) value near 23.1 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20476845

  8. Biological and immunotoxicity evaluation of antimicrobial peptide-loaded coatings using a layer-by-layer process on titanium

    PubMed Central

    Shi, Jue; Liu, Yu; Wang, Ying; Zhang, Jing; Zhao, Shifang; Yang, Guoli

    2015-01-01

    The prevention and control of peri-implantitis is a challenge in dental implant surgery. Dental implants with sustained antimicrobial coating are an ideal way of preventing peri-implantitis. This study reports development of a non- immunotoxicity multilayered coating on a titanium surface that had sustained antimicrobial activity and limited early biofilm formation. In this study, the broad spectrum AMP, Tet213, was linked to collagen IV through sulfo-SMPB and has been renamed as AMPCol. The multilayer AMPCol coatings were assembled on smooth titanium surfaces using a LBL technique. Using XPS, AFM, contact angle analysis, and QCM, layer-by-layer accumulation of coating thickness was measured and increased surface wetting compared to controls was confirmed. Non-cytotoxicity to HaCaT and low erythrocyte hemolysis by the AMPCol coatings was observed. In vivo immunotoxicity assays showed IP administration of AMPCol did not effect serum immunoglobulin levels. This coating with controlled release of AMP decreased the growth of both a Gram-positive aerobe (Staphylococcus aureus) and a Gram-negative anaerobe (Porphyromonas gingivalis) up to one month. Early S. aureus biofilm formation was inhibited by the coating. The excellent long-term sustained antimicrobial activity of this multilayer coating is a potential method for preventing peri-implantitis through coated on the neck of implants before surgery. PMID:26548760

  9. In vitro lymphotoxicity and selective T cell immunotoxicity of high doses of acyclovir and its derivatives in mice.

    PubMed

    Poluektova, L; Krzystyniak, K; Desjardins, R; Flipo, D; Fournier, M

    1996-01-01

    The antiviral drug acyclovir [9-(2-hydroxyethoxymethyl)guanine (ACV)], its 7-isomer (7-ACV) and its two derivatives: N2-acetyl ACV (ac-ACV) and N2,O-diacetyl ACV (diac-ACV) were examined for their potential in vitro lymphotoxicity and in vivo immunotoxicity in mice. In vitro lymphotoxicity of ACV and its acetylated derivatives was low, whereas the 7-ACV isomer enhanced the in vitro cell proliferation in PHA-stimulated cultures. Addition of 2'-deoxyguanosine (dGuo) did not exhibit any inhibitory potential of ACV. However, reduction in the absolute number of CD3+, CD8+, and CD25+ cells, but not Ig+ cells, was noted at high concentrations of ACV and its derivatives, suggesting a selective T cell cytotoxicity. Similarly, the in vivo exposure revealed selective T cell immunotoxicity of ACV and its derivatives since the reduced number of Thy 1.2+ and CD8+ cells was not accompanied with any marked changes in the Ig+ population. The CD4+/CD8+ ratio was affected both in vitro and in vivo by high concentrations of ACV. PMID:9024946

  10. Immunotoxic effects of sodium tungstate dihydrate on female B6C3F1/N mice when administered in drinking water.

    PubMed

    Frawley, Rachel P; Smith, Matthew J; White, Kimber L; Elmore, Susan A; Herbert, Ron; Moore, Rebecca; Staska, Lauren M; Behl, Mamta; Hooth, Michelle J; Kissling, Grace E; Germolec, Dori R

    2016-09-01

    Tungsten is a naturally occurring, high-tensile strength element that has been used in a number of consumer products. Tungsten has been detected in soil, waterways, groundwater, and human tissue and body fluids. Elevated levels of tungsten in urine were reported for populations exposed to tungstate in drinking water in areas where natural tungsten formations were prevalent. Published reports indicated that sodium tungstate may modulate hematopoiesis, immune cell populations, and immune responses in rodent models. The objective of this study was to assess potential immunotoxicity of sodium tungstate dihydrate (STD), a drinking water contaminant. Female B6C3F1/N mice received 0-2000 mg STD/L in their drinking water for 28 d, and were evaluated for effects on immune cell populations in spleen and bone marrow, and humoral-mediated, cell-mediated, and innate immunity. Three different parameters of cell-mediated immunity were similarly affected at 1000 mg STD/L. T-cell proliferative responses against allogeneic leukocytes and anti-CD3 were decreased 32%, and 21%, respectively. Cytotoxic T-lymphocyte activity was decreased at all effector:target cell ratios examined. At 2000 mg STD/L, the absolute numbers of CD3(+) T-cell progenitor cells in bone marrow were increased 86%, but the alterations in B-lymphocyte and other progenitor cells were not significant. There were no effects on bone marrow DNA synthesis or colony forming capabilities. STD-induced effects on humoral-mediated immunity, innate immunity, and splenocyte sub-populations were limited. Enhanced histopathology did not detect treatment-related lesions in any of the immune tissues. These data suggest exposure to STD in drinking water may adversely affect cell-mediated immunity. PMID:27223060

  11. Thymus-directed immunotoxicity of airborne dust particles from Upper Silesia (Poland) under acute extrapulmonary studies in mice

    SciTech Connect

    Kozlowska, E.; Krzystniak, K.; Drela, N.

    1996-12-27

    Industrial air pollutants from Upper Silesia, Poland, contain over 250 polycyclic and heterocyclic aromatic hydrocarbons and heavy metals, including mutagenic and carcinogenic chemicals that have been shown to from DNA adducts. Over 4 million habitants of Silesia are permanently exposed to the industrial pollution by pulmonary and dermal routes and by contaminated food and water. These chemicals, when examined separately in animals models, were proven immunotoxic. We studied the extrapulmonary immunotoxic potential of a typical mixture of Silesian filter-suspended matter from a selected area, over a specific season and time period. Early changes in the immune system were analyzed in BALB/c mice exposed ip to acute doses of 20-330 mg dust mixture/kg body weight (0.06-1.0 LD50). No major changes were noted for weight and the cellularity of spleen, liver and kidneys. However, dramatic decrease in thymus weight index and thymocyte cell count were noted as early as 24-72 h postexposure, which correlated with almost complete depletion of immature, double-positive CD4{sup +}CD8{sup +} thymocytes. Changes in spleen were less profound; however, increased depletion of B cells over T cells was noted at high doses of the suspended matter. Exposure to the airborne dust also decreased cytokine production by spleen cells, such as interferon-{gamma} (IFN-{gamma}) and tumor necrosis factor-{alpha} (TNF-{alpha}). Overall, a single exposure to Silesian dust, even at the relatively low 0.06 LD50 dose, affected lymphokine production, suppressed B-cell proliferative response, and depleted thymuses of immature, double-positive CD4{sup +}CD8{sup +} cells. A chemical synergism is suspected. To our knowledge, none of the known components of Silesian suspended matter, when examined as a single chemical, was shown to exert such a profound biological effect. 32 refs., 5 figs.

  12. In vitro immunotoxicity of untreated and treated urban wastewaters using various treatment processes to rainbow trout leucocytes.

    PubMed

    Gagné, François; Fortier, Marlène; Fournier, Michel; Smyth, Shirley-Anne

    2013-07-01

    Municipal effluents are known to impede the immune system of aquatic organisms. The purpose of this study was to examine the immunotoxicity of urban wastewaters before and after 6 treatment processes from 12 cities toward trout leucocytes. Freshly prepared trout leucocytes were exposed to increasing concentrations of solid phase (C18) extracts of wastewaters for 24 hr at 150C. Immunocompetence was determined by following changes in leucocyte viability and the proportion of cells able to ingest at least one (immunoactivity) and at least three (immunoefficiency) fluorescent beads. The influents were treated by six different treatment strategies consisting of facultative aerated lagoons, activated sludge, biological aerated filter, biological nutrient removal, chemically-assisted physical treatment and trickling filter/solid contact. Water quality parameters of the wastewaters revealed that the plants effectively removed total suspended solids and reduced the chemical oxygen demand. The results revealed that the effluents' immunotoxic properties were generally more influenced by the properties of the untreated wastewaters than by the treatment processes. About half of the incoming influents decreased leucocyte viability while 4 treatment plants were able to reduce toxicity. The influents readily increased phagocytosis activity for 8/12 influents while it was decreased in 4/12 influents. This increase was abolished for 4/12 of the effluents using treatments involving biological and oxidative processes. In conclusion, municipal effluents have the potential to alter the immune system in fish and more research will be needed to improve the treatments of wastewaters to better protect the quality of the aquatic environment. PMID:24218853

  13. In Vivo Immunotoxicity of SiO2@(Y0.5Gd0.45Eu0.05)2O3 as Dual-Modality Nanoprobes

    PubMed Central

    Tian, Xiumei; Li, Ermao; Yang, Fanwen; Peng, Ye; Zhu, Jixiang; He, Fupo; Chen, Xiaoming

    2014-01-01

    We have successfully synthesized SiO2@(Y0.5Gd0.45Eu0.05)2O3 nanocomposites as a potential dual-modality nanoprobe for molecular imaging in vitro. However, their immunotoxicity assessment in vivo remains unknown. In this article, the in vitro biocompatibility of our dual-modality nanoprobes was assayed in terms of cell viability and apoptosis. In vivo immunotoxicity was investigated by monitoring the generation of reactive oxygen species (ROS), cluster of differentiation (CD) markers and cytokines in Balb/c mice. The data show that the in vitro biocompatibility was satisfactory. In addition, the immunotoxicity data revealed there are no significant changes in the expression levels of CD11b and CD71 between the nanoprobe group and the Gd in a diethylenetriaminepentaacetic acid (DTPA) chelator (Gd-DTPA) group 24 h after injection in Balb/c mice (p > 0.05). Importantly, there are significant differences in the expression levels of CD206 and CD25 as well as the secretion of IL-4 and the generation of ROS 24 h after injection (p < 0.05). Transmission electron microscopy (TEM) images showed that few nanoprobes were localized in the phagosomes of liver and lung. In conclusion, the toxic effects of our nanoprobes may mainly result from the aggregation of particles in phagosomes. This accumulation may damage the microstructure of the cells and generate oxidative stress reactions that further stimulate the immune response. Therefore, it is important to evaluate the in vivo immunotoxicity of these rare earth-based biomaterials at the molecular level before molecular imaging in vivo. PMID:25105724

  14. Subchronic toxicity and immunotoxicity of MeO-PEG-poly(D,L-lactic-co-glycolic acid)-PEG-OMe triblock copolymer nanoparticles delivered intravenously into rats

    NASA Astrophysics Data System (ADS)

    Liao, Longfei; Zhang, Mengtian; Liu, Huan; Zhang, Xuanmiao; Xie, Zhaolu; Zhang, Zhirong; Gong, Tao; Sun, Xun

    2014-06-01

    Although monomethoxy(polyethyleneglycol)-poly (D,L-lactic-co-glycolic acid)-monomethoxy (PELGE) nanoparticles have been widely studied as a drug delivery system, little is known about their toxicity in vivo. Here we examined the subchronic toxicity and immunotoxicity of different doses of PELGE nanoparticles with diameters of 50 and 200 nm (PELGE50 and PELGE200) in rats. Neither size of PELGE nanoparticles showed obvious subchronic toxic effects during 28 d of continuous intravenous administration based on clinical observation, body weight, hematology parameters and histopathology analysis. PELGE200 nanoparticles showed no overt signs of immunotoxicity based on organ coefficients, histopathology analysis, immunoglobulin levels, blood lymphocyte subpopulations and splenocyte cytokines. Conversely, PELGE50 nanoparticles were associated with an increased organ coefficient and histopathological changes in the spleen, increased serum IgM and IgG levels, alterations in blood lymphocyte subpopulations and enhanced expression of spleen interferon-γ. Taken together, these results suggest that PELGE nanoparticles show low subchronic toxicity but substantial immunotoxicity, which depends strongly on particle size. These findings will be useful for safe application of PELGE nanoparticles in drug delivery systems.

  15. Role of Metabolism by Intestinal Bacteria in Arbutin-Induced Suppression of Lymphoproliferative Response in vitro.

    PubMed

    Kang, Mi Jeong; Ha, Hyun Woo; Kim, Ghee Hwan; Lee, Sang Kyu; Ahn, Young Tae; Kim, Dong Hyun; Jeong, Hye Gwang; Jeong, Tae Cheon

    2012-03-01

    Role of metabolism by intestinal bacteria in arbutin-induced immunotoxicity was investigated in splenocyte cultures. Following an incubation of arbutin with 5 different intestinal bacteria for 24 hr, its aglycone hydroquinone could be produced and detected in the bacterial culture media with different amounts. Toxic effects of activated arbutin by intestinal bacteria on lymphoproliferative response were tested in splenocyte cultures from normal mice. Lipopolysaccharide and concanavalin A were used as mitogens for B- and T-cells, respectively. When bacteria cultured medium with arbutin was treated into the splenocytes for 3 days, the medium cultured with bacteria producing large amounts of hydroquinone induced suppression of lymphoproliferative responses, indicating that metabolic activation by intestinal bacteria might be required in arbutin-induced toxicity. The results indicated that the present testing system might be applied for determining the possible role of metabolism by intestinal bacteria in certain chemical-induced immunotoxicity in animal cell cultures. PMID:24116295

  16. Interaction of aflatoxin B1 and fumonisin B1 in mice causes immunotoxicity and oxidative stress: Possible protective role using lactic acid bacteria.

    PubMed

    Abbès, Samir; Ben Salah-Abbès, Jalila; Jebali, Rania; Younes, Ridha Ben; Oueslati, Ridha

    2016-01-01

    Aflatoxins (AF) are important foodborne mycotoxins implicated in human health and have immunocytotoxic effects. The aims of this study were to evaluate a new aflatoxin B1 (AFB1) and fumonisin B1 (FB1)-binding/degrading micro-organism for biological detoxification, to examine its ability to degrade AFB1 and FB1 in liquid medium, and to evaluate its potential in vivo protective role against any combined effects from AFB1 and FB1 on host splenocyte caspase-3 activity (reflecting DNA damage/cell death) and mRNA levels of select inflammation-regulating cytokines. Balb/c mice were divided into groups (10/group) and treated daily for 2 weeks by oral gavage with AFB1 (80 µg/kg BW), FB1 (100 µg/kg), AFB1 + FB1, or lactic acid bacteria (Lactobacillus paracasei BEJ01, 2 × 10(9) CFU/L, ∼2 mg/kg) - alone or in combination with the AFB1 and/or FB1. After the exposures, spleens were collected for measures of caspase-3 activity, lipid peroxidation (LP), and glutathione (GSH) content, expression of anti-oxidation protective enzymes (GPx and SOD), and mRNA levels of inflammation-regulating cytokines (e.g. IL-10, IL-4, IFNγ, TNFα). Thymii were also removed for analysis of apoptosis. The results indicated that, in the spleen, exposure to the mycotoxins led to increased caspase-3 activity, LP, and IL-10 and IL-4 mRNA levels, but decreased GSH content and down-regulated expression of GPx and SOD, and of IFNγ and TNFα mRNA. Co-treatment using Lactic Acid Bacteria (LAB) with AFB1 or FB1 suppressed levels of DNA fragmentation, normalized splenic LP and increased GSH levels, up-regulated expression of GPx and SOD, and normalized mRNA levels of the analyzed cytokines. It is concluded that AFB1 and FB1 might have combinational (synergistic moreso than additive) toxic effects in situ. Further, it can be seen that use of LAB induced protective effects against the oxidative stress and (immuno)toxicity of these agents in part through adhesion (and so likely diminished

  17. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal.

    PubMed

    Silkworth, J B; Cutler, D S; Sack, G

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm). The results suggest that the immunosuppression caused by OPL in BALB/cByJ mice was primarily due to TCDD, that the non-TCDD components of OPL diminished the TCDD immunotoxicity in the DBA/2J strain, and that the thymic atrophy and hepatomegaly were caused primarily by the non

  18. Composition and immunotoxicity activity of essential oils from leaves of Zingiber officinale Roscoe against Aedes aegypti L.

    PubMed

    Moon, Hyung-In; Cho, Sang-Buem; Kim, Soo-Ki

    2011-03-01

    The leaves of Zingiber officinale Roscoe were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS) revealed that the essential oils of Z. officinale leaves. The Z. officinale essential oil yield was 0.26%, and GC/MS analysis revealed that its major constituents were Camphene (5.26%), Phellandrene (6.58%), Zingiberene (36.48%), Geranial (4.32%), β-gurjunene (2.74%), and Citronellol β-sesguiphellandrene (12.31%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 46.38 ppm and an LC(90) value of 84.32 ppm. Also, Camphene (≥95.0%), Phellandrene (≥95.0%), Zingiberene (≥95.0%), Geranial (≥95.0%), β-gurjunene (≥97.0%), and Citronellol (≥95.0%) were tested against the F21 laboratory strain of A. aegypti. Zingiberene (≥95.0%) and Citronellol (≥95.0%) have medium activity with an LC(50) value of 99.55 ppm and 141.45 ppm. This indicates that other major compounds may play a more important role in the toxicity of essential oil. PMID:20568951

  19. Short-term exposure of rodents to diesel exhausts: usefulness for studies of genotoxic and immunotoxic effects.

    PubMed

    Nilsen, A; Trønnes, T; Westerholm, R; Rannug, U; Nilsen, O G; Helleberg, H; Kautiainen, A; Hedenskog, M; Törnqvist, M

    1999-03-01

    An exposure facility was tested with regard to the information obtainable from short-term animal experiments for the assessment of health hazards from automotive engine exhausts. Indicators of immunotoxicity and genotoxicity were studied in guinea pigs and mice, respectively, exposed for 2 weeks, 8 h/day, to ten times diluted exhausts from a one-cylinder research diesel engine running at constant load. Regulated and non-regulated pollutants were determined. Besides increased number of lavageable cells in the airways, exposed guinea pigs exhibited, after immunization and challenge to ovalbumin, reduced leukotrienes B4 and C4 in lavage fluid and reduced anti-ovalbumin IgG in serum. Absence of increased CYP1A activity indicated that the exposure was below the threshold for induction of these enzymes. Instead a certain reduction of this activity indicated interaction with active enzyme sites. In vivo doses of some reactive metabolites of low molecular mass were measured by adducts to hemoglobin. Doses from aliphatic epoxides were low, in accordance with low hydrocarbon levels in the exhaust. The levels of hemoglobin adducts from aldehydes showed no clearcut influences of exposure. Genetic effects determined by DNA fingerprint analysis were indicated. It is concluded that repeated dose inhalation exposure of small numbers of animals is a useful mode of exposure for studying parameters that may elucidate toxic effects of air pollutants emitted from automotive engines, with a possibility to evaluate engine and fuel with regard to health hazards. PMID:10227576

  20. Immunotoxic potential of aeration lagoon effluents for the treatment of domestic and hospital wastewaters in the freshwater mussel Elliptio complanata.

    PubMed

    Gagné, Francois; André, Chantale; Fortier, Marlène; Fournier, Michel

    2012-01-01

    Municipal wastewaters are major sources of pollution for the aquatic biota. The purpose of this study was to determine the levels of some pharmaceutical products and the immunotoxic potential of a municipal wastewater aeration lagoon for the treatment of the domestic wastewaters of a small town with wastewater inputs from a 400-bed hospital complex. Endemic mussels were collected, caged and placed in the final aeration lagoon and at sites 1 km upstream and 1 km downstream of the effluent outfall in the receiving river for a period of 14 days. The results showed that the final aeration lagoon contained high levels of total coliforms, conductivity and low dissolved oxygen (2.9 mg/L) as well as detectable amounts of trimethoprim, carbamazepine, gemfibrozil, and norfloxacin at concentrations exceeding 50 ng/L. The lagoon effluent was indeed toxic to the mussel specimens, as evidenced by the appearance of mortality after 14 days (10% mortality), decreased mussel weight-to-shell-length ratio and loss of hemocyte viability. The number of adhering hemocytes, phagocytic activity, total nitrite levels and arachidonic cyclooxygenase activity were significantly higher in mussels placed in the final aeration lagoon. A multivariate analysis also revealed that water pH, conductivity, total coliforms and dissolved oxygen were the endpoints most closely linked with phagocytic activity, the amount of adhering hemocytes and loss of hemocyte viability. In conclusion, exposure of mussels to treated aerated lagoon wastewater is deleterious to freshwater mussels where the immune system is compromised. PMID:22893952

  1. Immunotoxicity and biodistribution analysis of arsenic trioxide in C57Bl/6 mice following a 2-week inhalation exposure

    SciTech Connect

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu Kejian

    2009-12-15

    In these studies the immunotoxicity of arsenic trioxide (ATO, As{sub 2}O{sub 3}) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 h per day) at concentrations of 50 mug/m{sup 3} and 1 mg/m{sup 3}. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 mug/g tissue following the 1 mg/m{sup 3} exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 mug/m{sup 3} and 1 mg/m{sup 3} exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents.

  2. IMMUNOTOXICITY AND BIODISTRIBUTION ANALYSIS OF ARSENIC TRIOXIDE IN C57Bl/6 MICE FOLLOWING A TWO-WEEK INHALATION EXPOSURE

    PubMed Central

    Burchiel, Scott W.; Mitchell, Leah A.; Lauer, Fredine T.; Sun, Xi; McDonald, Jacob D.; Hudson, Laurie G.; Liu, Ke Jian

    2010-01-01

    In these studies the immunotoxicity of arsenic trioxide (ATO, As2O3) was evaluated in mice following 14 days of inhalation exposures (nose only, 3 hrs per day) at concentrations of 50 μg/m3 and 1 mg/m3. A biodistribution analysis performed immediately after inhalation exposures revealed highest levels of arsenic in the kidneys, bladder, liver, and lung. Spleen cell levels were comparable to those found in the blood, with the highest concentration of arsenic detected in the spleen being 150 μg/mg tissue following the 1 mg/m3 exposures. No spleen cell cytotoxicity was observed at either of the two exposure levels. There were no changes in spleen cell surface marker expression for B cells, T cells, macrophages, and natural killer (NK) cells. There were also no changes detected in the B cell (LPS-stimulated) and T cell (Con A-stimulated) proliferative responses of spleen cells, and no changes were found in the NK-mediated lysis of Yac-1 target cells. The primary T-dependent antibody response was, however, found to be highly susceptible to ATO suppression. Both the 50 μg/m3 and 1 mg/m3 exposures produced greater than 70% suppression of the humoral immune response to sheep red blood cells. Thus, the primary finding of this study is that the T-dependent humoral immune response is extremely sensitive to suppression by ATO and assessment of humoral immune responses should be considered in evaluating the health effects of arsenic containing agents. PMID:19800901

  3. Immunotoxicity of skin acid secretion produced by the sea slug Berthellina citrina in mice spleen: Histological and Immunohistochemical study.

    PubMed

    Awaad, Aziz; Moustafa, Alaa Y

    2016-07-01

    Acid secretion containing sulfuric and hydrochloric acids is a fascinating defensive phenomenon within many groups of marine organisms. This study aimed to investigate the mice spleen histology and immunotoxicity using skin acid secretion (SAS) of the sea slug Berthellina citrina after oral administration. The spleen showed atrophy in the white pulp, decrease in the splenocytes density, megakaryocytes cytoplasmic degeneration as well as inflammatory cells infiltrations. The white and red pulp splenocytes number decreased time-dependently in the treated spleens. Additionally, the size of the megakaryocytes increased as compared with the control. The administration with SAS increased the number of the IgA(+) cells aggregation in the splenic red pulp. Furthermore, after 7days of the administration, large number of dispersed IgA(+) cells were distributed in splenic parenchyma. The IgA(+) cells numbers increased time-dependently as compared with those in the control. The aggregation sizes and number of the F4/80(+) cell in the splenic red pulp were increased. Furthermore the F4/80(+) cells numbers increased time-dependently as compared with those in the control. The UEAI(+) cells were found as free cells but not in aggregations in the control splenic red pulp. Contradictory to the number of IgA(+) cells and F4/80(+) cells the number of the UEAI(+) cells decreased time-dependently after administration with SAS. Hematologically, abnormal numbers of WBCs different cells were observed after administration with SAS. This study provides new insight about the toxicity of a marine extract may be used in natural products industry or medical applications. PMID:27378377

  4. IMMUNOTOXICOGENOMICS: THE POTENTIAL OF GENOMICS TECHNOLOGY IN THE IMMUNOTOXICITY RISK ASSESSMENT PROCESS

    EPA Science Inventory

    Evaluation of xenobiotic-induced changes in gene expression as a method to identify and classify potential toxicants is being pursued by industry and regulatory agencies worldwide. A workshop was held at the Research Triangle Park campus of the Environmental Protection Agency to...

  5. In vitro hematological and in vivo immunotoxicity assessment of dextran stabilized iron oxide nanoparticles.

    PubMed

    Easo, Sheeja Liza; Mohanan, P V

    2015-10-01

    Iron oxide nanoparticles have attracted enormous interest as potential therapeutic agents. The purpose of this study was to examine the in vitro hematological toxicity and in vivo immune response toward previously synthesized and characterized dextran stabilized iron oxide nanoparticles (DIONPs) developed for hyperthermia application. Peripheral whole blood from human volunteers was used to investigate hemolysis, platelet aggregation, lymphocyte proliferation and cytokine mRNA expression induced by DIONPs in vitro. In the concentration range of 0.008-1 mg/ml, DIONPs did not induce relevant levels of hemolysis or platelet aggregation. Assessment of lymphocyte function showed significant suppression of the proliferation activity of T-lymphocytes in cultures stimulated with the mitogen phytohemagglutinin (PHA). In addition, inhibition of PHA-induced cytokine mRNA expressions was also seen. However, systemic administration of DIONPs resulted in enhanced proliferation of mitogen-stimulated spleen derived lymphocytes and secretion of IL-1β at day 7 post exposure. In conclusion, our results demonstrate that immune response is influenced variably by nanoparticles and its degradation milieu. Further investigation of the observed immunosuppressive effects of DIONPs in immune stimulated animal models is required to assess the functional impact of such a response. PMID:26183082

  6. Immunotoxicity activity of 2,6,10,15-tetrame-heptadecane from the essential oils of Clerodendron trichotomum Thunb. against Aedes aegypti L.

    PubMed

    Lee, Sung-Jae; Moon, Hyung-In

    2010-12-01

    The leaf parts of Clerodendron trichotomum were extracted and the major essential oils composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography-mass spectroscopy (GC-MS) revealed that the essential oils of C. trichotomum (CTEO). The CTEO yield was 0.071%, and GC/MS analysis revealed that its major constituents were Hexanal (3.31%), 5-Me-3-heptanone (1.71%), 2,6,6-trime-cyclohexanone (2.23%), 2,6,10,15-tetrame-heptadecane (24.21%) and Linalool (31.2%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L with an LC(50) value of 32.78 ppm and an LC(90) value of 93.72 ppm. 2,6,10,15-tetrame-heptadecane was the most toxic among the two major components (2,6,10,15-tetrame-heptadecane and Linalool), with an LC(50) value near 43.9 ppm. The results could be useful in search for newer, safer, and more effective natural immunotoxicity agents against A. aegypti. PMID:20233126

  7. Immunotoxicity of the colour additive caramel colour III; a review on complicated issues in the safety evaluation of a food additive.

    PubMed

    Houben, G F; Penninks, A H

    1994-08-12

    Food additives can be regarded as the safest constituents of our daily food. Nevertheless, complicated issues with respect to their safety evaluation do also occur. In this review paper, some of these issues are illustrated by the description and evaluation of the research on the immunotoxicity of the food additive Caramel Colour III. Caramel Colour III is commonly used as a color additive in many products for human consumption. Toxicity studies conducted in the seventies demonstrated that administration of Caramel Colour III can cause a reduction in total white blood cell counts in rats, due to reduced lymphocyte counts. Studies reviewed in this paper demonstrated several other effects of Caramel Colour III on the immune system of rodents, including disturbed immune functions and changed resistance in infection models. In addition, studies in rats demonstrated that most of the effects occur only when the animals are fed a diet low in vitamin B6. The imidazole derivative 2-acetyl-4(5)-(1,2,3,4-tetrahydroxy-butyl)-imidazole (THI) was found to be responsible for the immunotoxicity. Issues such as the mechanism of action of THI and the role of vitamin B6 are discussed. Finally, the results of a human intervention study and the observed effect levels of THI in rats are discussed in terms of safety of the use of Caramel Colour III in our daily food supply. PMID:8079366

  8. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    NASA Astrophysics Data System (ADS)

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-11-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications.

  9. Surface Charges and Shell Crosslinks Each Play Significant Roles in Mediating Degradation, Biofouling, Cytotoxicity and Immunotoxicity for Polyphosphoester-based Nanoparticles

    PubMed Central

    Elsabahy, Mahmoud; Zhang, Shiyi; Zhang, Fuwu; Deng, Zhou J.; Lim, Young H.; Wang, Hai; Parsamian, Perouza; Hammond, Paula T.; Wooley, Karen L.

    2013-01-01

    The construction of nanostructures from biodegradable precursors and shell/core crosslinking have been pursued as strategies to solve the problems of toxicity and limited stability, respectively. Polyphosphoester (PPE)-based micelles and crosslinked nanoparticles with non-ionic, anionic, cationic, and zwitterionic surface characteristics for potential packaging and delivery of therapeutic and diagnostic agents, were constructed using a quick and efficient synthetic strategy, and importantly, demonstrated remarkable differences in terms of cytotoxicity, immunotoxicity, and biofouling properties, as a function of their surface characteristics and also with dependence on crosslinking throughout the shell layers. For instance, crosslinking of zwitterionic micelles significantly reduced the immunotoxicity, as evidenced from the absence of secretions of any of the 23 measured cytokines from RAW 264.7 mouse macrophages treated with the nanoparticles. The micelles and their crosslinked analogs demonstrated lower cytotoxicity than several commercially-available vehicles, and their degradation products were not cytotoxic to cells at the range of the tested concentrations. PPE-nanoparticles are expected to have broad implications in clinical nanomedicine as alternative vehicles to those involved in several of the currently available medications. PMID:24264796

  10. Fate of silver nanoparticles in wastewater and immunotoxic effects on rainbow trout.

    PubMed

    Bruneau, A; Turcotte, P; Pilote, M; Gagné, F; Gagnon, C

    2016-05-01

    Silver nanoparticles (AgNPs) are currently used in technology, medicine and consumer products, even though the fate and the ecotoxicological risks on aquatic organisms of these new materials are not well known. The purpose of this study was to investigate the fate, bioavailability of AgNPs and their effects on fish in presence of municipal effluents. Juvenile rainbow trout were exposed for 96h to 40μg/L of AgNPs or 4μg/L of dissolved silver (AgNO3) in diluted (10%) municipal wastewater. Silver (Ag) concentrations were measured both on water samples and fish tissues (liver and gills). Toxicity was investigated by following immunological parameters in the pronephros (viability, phagocytosis) and biomarkers in liver and gills (cyclooxygenase activity, lipid peroxidation, glutathione-S-transferase, metallothioneins, DNA strand breaks and labile zinc). Results indicated that AgNPs appeared as small non-charged aggregates in wastewaters (11.7±1.4nm). In gills, the exposure to AgNPs induced morphological modifications without visible nanoparticle bioaccumulation. Dissolved Ag(+) was bioavailable in diluted effluent and induced oxidative stress (lipid peroxidation), labile zinc and a marginal decrease in superoxide dismutase in fish gills. Ag(+) also increased significantly metallothionein levels and inhibited the DNA repair activity in the liver. Finally, the two silver forms were found in liver and induced immunosuppression and inflammation (increase in cyclooxygenase activity). This study demonstrated that both forms of Ag produced harmful effects and AgNPs in wastewater were bioavailable to fish despite of their formation of aggregates. PMID:26921728

  11. Atrazine induces endoplasmic reticulum stress-mediated apoptosis of T lymphocytes via the caspase-8-dependent pathway.

    PubMed

    Lee, Eun-Jin; Jang, Youngsaeng; Kang, Kwonyoon; Song, Da-Hyun; Kim, Rihyun; Chang, Hee-Won; Lee, Dong Eil; Song, Claire Ka-Eun; Choi, Bongkun; Kang, Min-Ji; Chang, Eun-Ju

    2016-08-01

    Atrazine (ATR) is one of the most commonly applied broad-spectrum herbicides. Although ATR is well known to be a biologically hazardous molecule with potential toxicity in the immune system, the molecular mechanisms responsible for ATR-induced immunotoxicity remain unclear. In this study, we found that the immunotoxic properties of ATR were mediated through the induction of apoptotic changes in T lymphocytes. Mice exposed to ATR for 4 weeks exhibited a significant decrease in the number of spleen CD3(+) T lymphocytes, while CD19(+) B lymphocytes and nonlymphoid cells were unaffected. ATR exposure also led to inhibition of cell growth and induction of apoptosis in human Jurkat T-cells. Importantly, ATR triggered the activation of caspase-3 and the cleavage of caspase-8 and PARP, whereas it did not affect the release of cytochrome c from the mitochondria in Jurkat T-cells. In addition, ATR activated the unfolded protein response signaling pathway, as indicated by eIF2α phosphorylation and CHOP induction. Our results demonstrate that ATR elicited an immunotoxic effect by inducing ER stress-induced apoptosis in T-cells, therefore providing evidence for the molecular mechanism by which ATR induces dysregulation of the immune system. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 998-1008, 2016. PMID:25640594

  12. Immunotoxicity in ascidians: antifouling compounds alternative to organotins-IV. The case of zinc pyrithione.

    PubMed

    Cima, Francesca; Ballarin, Loriano

    2015-03-01

    New biocides such as the organometallic compound zinc pyrithione (ZnP) have been massively introduced by many countries in formulations of antifouling paints following the ban on tributyltin (TBT). The effects of sublethal concentrations (LC50=82.5 μM, i.e., 26.2 mg/l) on cultured haemocytes of the ascidian Botryllus schlosseri have been investigated and compared with TBT. The percentage of haemocytes with amoeboid morphology and containing phagocytised yeast cells were significantly (p<0.05) reduced after exposure to 0.1 (31.7 μg/l) and 0.5 μM (158 μg/l), respectively. An antagonistic interaction in inducing cytoskeletal alterations was observed when ZnP and TBT were co-present in the exposure medium. ZnP affected only the actin component. As caused by TBT, ZnP induced apoptosis and inhibited both oxidative phosphorylation and lysosomal activities. In contrast to the case of TBT, a decrement in Ca(2+)-ATPase activity and a decrease in cytosolic Ca(2+) were detected after incubation at the highest concentration (1 μM, i.e., 317.7 μg/l) used. In comparison with other antifouling compounds, ZnP shows as much toxicity as TBT to cultured haemocytes at extremely low concentrations interfering with fundamental cell activities. PMID:25576186

  13. Immunotoxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in a complex environmental mixture from the Love Canal

    SciTech Connect

    Silkworth, J.B.; Cutler, D.S.; Sack, G.

    1989-02-01

    The organic phase of the leachate (OPL) from the Love Canal chemical dump site contains more than 100 organic compounds including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The immunotoxic potential of OPL was determined in two mouse strains which differ in their sensitivity to aromatic hydrocarbon (Ah) receptor-mediated toxicity. OPL was administered in corn oil in a single oral gavage to male BALB/cByJ (Ahb/Ahb) mice (0.5, 0.8, or 1.1 g/kg) and DBA/2J (Ahd/Ahd) mice (0.6, 0.9, or 1.3 g/kg). TCDD was similarly administered at 0.25, 1.0, 4.0, or 16.0 micrograms/kg. Two days later all mice were immunized with sheep erythrocytes (SRBC). The antibody response (PFC) and organ weights were evaluated 4 days later. OPL produced thymic atrophy and hepatomegaly in both strains at all dose levels. The PFC/spleen in BALB/cByJ mice was significantly reduced at the three doses to 34, 13, and 15%, respectively, of the control response. Serum anti-SRBC antibody levels and relative spleen weights were also reduced. The only immune effect in the DBA/2J mice was a decrease of the PFC/spleen to 58% of the control at the highest dose. TCDD decreased the relative thymus and spleen weights only in BALB/cByJ mice. However, TCDD produced hepatomegaly, a decrease in serum antibody, and a decrease in PFC/spleen in both BALB/cByJ and DBA/2J mice to 3 and 15%, respectively, at 16 micrograms/kg. Thus, the TCDD dose required to cause a 50% suppression (ED50) of PFC/spleen for the BALB/cByJ and DBA/2J strains was 1.84 and 3.89 micrograms/kg, respectively. The ED50 for OPL was 0.24 g/kg in BALB/cByJ mice. The TCDD concentration in the OPL was estimated to be 7.6 ppm, which agrees closely with the chemical analysis (3 ppm).

  14. Immunotoxic effects on freshwater mussels of a primary-treated wastewater before and after ozonation: a pilot plant study.

    PubMed

    Gagné, F; André, C; Cejka, P; Hausler, R; Fournier, M; Blaise, C

    2008-03-01

    The immunotoxic potential of a primary-treated municipal effluent following enhanced disinfection by ozonation was studied in the freshwater mussel Elliptio complanata. Mussels were exposed to increasing concentrations (0%, 1%, 3%, 10%, and 20% v/v) of the effluent before and after ozone treatment (approximately 10 mg/L of purged O(3)) in a continuous flow-through laboratory for 7 weeks. Immunocompetence was appraised by measuring phagocytosis, cell viability (fluorescein retention), cell adherence to polystyrene micro-wells, cyclooxygenase (COX) activity and total nitrite levels in peripheral hemocytes from the hemolymphs. The results showed that phagocytosis was significantly inhibited by the primary-treated effluent at a threshold concentration of 1.7% v/v. Cell viability was also significantly reduced three-fold compared to controls at the same effluent threshold concentration, but hemocyte adherence was unchanged. COX activity was increased 1.3-fold at a threshold concentration of 14% v/v. Total nitrite levels were significantly increased 2.2-fold at a threshold concentration of 5.5% v/v. Ozone treatment of the effluent was not successful in removing phagocytic inhibition, but did completely remove cytotoxicity from hemocytes. Ozonation also reduced cell adherence at a threshold concentration of 1.7% v/v. The inflammatory properties of the effluent appeared to be accentuated by the ozone, as evidenced by an increase in COX activity, which reached 2.6-fold activity compared to controls, as compared to the 1.3-fold increase witnessed in the primary-treated effluent. Furthermore, total nitrite levels reached a two-fold induction at a threshold concentration of 1.7% v/v in the ozone-enhanced effluent compared to 5.5% v/v in the primary-treated effluent. In conclusion, ozonation of a primary-treated effluent successfully reduced microbial loading and completely removed cytotoxicity, but increased the inflammatory properties of the effluent. Investigations aimed at

  15. Functionalized porous silica&maghemite core-shell nanoparticles for applications in medicine: design, synthesis, and immunotoxicity

    PubMed Central

    Zasońska, Beata A.; Líšková, Aurélia; Kuricová, Miroslava; Tulinská, Jana; Pop-Georgievski, Ognen; Čiampor, Fedor; Vávra, Ivo; Dušinská, Mária; Ilavská, Silvia; Horváthová, Mira; Horák, Daniel

    2016-01-01

    Aim To determine cytotoxicity and effect of silica-coated magnetic nanoparticles (MNPs) on immune response, in particular lymphocyte proliferative activity, phagocytic activity, and leukocyte respiratory burst and in vitro production of interleukin-6 (IL-6) and 8 (IL-8), interferon-gamma (IFN-γ), tumor necrosis factor-alpha (TNF-α), and granulocyte macrophage colony stimulating factor (GM-CSF). Methods Maghemite was prepared by coprecipitation of iron salts with ammonia, oxidation with NaOCl and modified by tetramethyl orthosilicate and aminosilanes. Particles were characterized by transmission electron microscopy (TEM), dynamic light scattering (DLS), Fourier-transform infrared (FTIR), and X-ray photoelectron spectroscopy (XPS). Cytotoxicity and lymphocyte proliferative activity were assessed using [3H]-thymidine incorporation into DNA of proliferating human peripheral blood cells. Phagocytic activity and leukocyte respiratory burst were measured by flow cytometry; cytokine levels in cell supernatants were determined by ELISA. Results γ-Fe2O3&SiO2-NH2 MNPs were 13 nm in size. According to TEM, they were localized in the cell cytoplasm and extracellular space. Neither cytotoxic effect nor significant differences in T-lymphocyte and T-dependent B-cell proliferative response were found at particle concentrations 0.12-75 μg/cm2 after 24, 48, and 72 h incubation. Significantly increased production of IL-6 and 8, and GM-CSF cytokines was observed in the cells treated with 3, 15, and 75 µg of particles/cm2 for 48 h and stimulated with pokeweed mitogen (PHA). No significant changes in TNF-α and IFN-γ production were observed. MNPs did not affect phagocytic activity of monocytes and granulocytes when added to cells for 24 and 48 h. Phagocytic respiratory burst was significantly enhanced in the cultures exposed to 75 µg MNPs/cm2 for 48 h. Conclusions The cytotoxicity and in vitro immunotoxicity were found to be minimal in the newly developed porous core-shell γ-Fe2

  16. Evaluation of nanoparticle immunotoxicity

    NASA Astrophysics Data System (ADS)

    Dobrovolskaia, Marina A.; Germolec, Dori R.; Weaver, James L.

    2009-07-01

    The pharmaceutical industry is developing increasing numbers of drugs and diagnostics based on nanoparticles, and evaluating the immune response to these diverse formulations has become a challenge for scientists and regulatory agencies alike. An international panel of scientists and representatives from various agencies and companies reviewed the imitations of current tests at a workshop held at the National Cancer Institute in Frederick, Maryland. This article outlines practical strategies for identifying and controlling interferences in common evaluation methods and the implications for regulation.

  17. ANIMAL MODELS FOR IMMUNOTOXICITY

    EPA Science Inventory

    Greater susceptibility to infection is a hallmark of compromised immune function in humans and animals, and is often considered the benchmark against which the predictive value of immune function tests are compared. This focus of this paper is resistance to infection with the pa...

  18. IMMUNOTOXICITY OF AIR POLLUTANTS

    EPA Science Inventory

    The most common ubiquitous air pollutants, as well as some point source (e.g. metals) air pollutants, decrease the function of pulmonary host defense mechanisms against infection. Most of this knowledge is based on animal studies and involves cellular antibacterial defenses such ...

  19. Composition and immunotoxicity activity of major essential oils from stems of Allium victorialis L. var. platyphyllum Makino against Aedes aegypti L.

    PubMed

    Chung, Ill-Min; Song, Hong-Keun; Yeo, Min-A; Moon, Hyung-In

    2011-09-01

    The stems of Allium victorialis L. var. platyphyllum were extracted and the major essential oil composition and immunotoxicity effects were studied. The analyses were conducted by gas chromatography and mass spectroscopy (GC-MS), which revealed the essential oils of A. victorialis L. var. platyphyllum stems. The A. victorialis L. var. platyphyllum essential oil yield was 1.45%, and GC/MS analysis revealed that its major constituents were allyl methyl disulfide (24.36%), dimethyl trisulfide (11.78%), allyl cis-1-propenyl disulfide (9.17%), allyl methyl trisulfide (4.13%), and dipropyl trisulfide (7.22%). The essential oil had a significant toxic effect against early fourth-stage larvae of Aedes aegypti L. with an LC(50) value of 24.12 ppm and an LC(90) value of 34.67 ppm. Also, allyl methyl disulfide (≥95.0%), dimethyl trisulfide (≥95.0%), allyl cis-1-propenyl disulfide (≥95.0%), allyl methyl trisulfide (≥95.0%), and dipropyl trisulfide (≥95.0%) were tested against the F(21) laboratory strain of A. aegypti. Allyl cis-1-propenyl disulfide (≥95.0%) has good activity with an LC(50) value of 15.35 ppm. Also, the above data indicate that other major compounds may play a more important role in the toxicity of essential oils. PMID:21162628

  20. European medicinal and edible plants associated with subacute and chronic toxicity part II: Plants with hepato-, neuro-, nephro- and immunotoxic effects.

    PubMed

    Kristanc, Luka; Kreft, Samo

    2016-06-01

    A tremendous surge of public interest in natural therapies has been reported in the past several decades in both developing and developed countries. Furthermore, edible wild-growing plants whose use had long been associated with poverty and famine have also gained in popularity among people in developed countries. An important fraction of herbal products evade all control measures and are generally perceived as safe. However, this may not always be true. It is important to recognize that some plants are not associated with acute toxicity but rather produce more insidious problems, which develop only with long-term exposure. In this review, we continue a systematic analysis of the subacute and chronic toxicity associated with the use of herbal preparations. The hepato-, neuro-, nephro- and immunotoxicity of plant species that either grow natively or are cultivated in Europe are discussed in some detail. The basic concepts regarding the molecular mechanisms implicated in their nonacute toxicity and their pathophysiological, clinical and epidemiological characteristics are included. Among others, we discuss the hepatotoxicity of pyrrolizidine alkaloids, the nephrotoxicity of aristolochic acid, the lathyrism associated with neurotoxin swainsonine, thiamine depletion and thyroid dysfunction of herbal cause, and finally address also the immunosuppressive effects of cannabinoids. PMID:27012588

  1. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... be removed. Â Top of Page Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  2. Novel biomarkers of mercury-induced autoimmune dysfunction: a cross-sectional study in Amazonian Brazil.

    PubMed

    Motts, Jonathan A; Shirley, Devon L; Silbergeld, Ellen K; Nyland, Jennifer F

    2014-07-01

    Mercury is a ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio=89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population). Mercury

  3. Novel biomarkers of mercury-induced autoimmune dysfunction: a Cross-sectional study in Amazonian Brazil

    PubMed Central

    Motts, Jonathan A.; Shirley, Devon L.; Silbergeld, Ellen K.; Nyland, Jennifer F.

    2014-01-01

    Mercury is an ubiquitous environmental contaminant, causing both neurotoxicity and immunotoxicity. Given its ability to amalgamate gold, mercury is frequently used in small-scale artisanal gold mining. We have previously reported that elevated serum titers of antinuclear autoantibodies (ANA) are associated with mercury exposures of miners in gold mining. The goal of this project was to identify novel serum biomarkers of mercury-induced immunotoxicity and autoimmune dysregulation. We conducted an analysis of serum samples from a cross-sectional epidemiological study on miners working in Amazonian Brazil. In proteomic screening analyses, samples were stratified based on mercury concentrations and ANA titer and a subset of serum samples (N=12) were profiled using Immune Response Biomarker Profiling ProtoArray protein microarray for elevated autoantibodies. Of the up-regulated autoantibodies in the mercury-exposed cohort, potential target autoantibodies were selected based on relevance to pro-inflammatory and macrophage activation pathways. ELISAs were developed to test the entire sample cohort (N=371) for serum titers to the highest of these autoantibodies (anti-glutathione S-transferase alpha, GSTA1) identified in the high mercury/high ANA group. We found positive associations between elevated mercury exposure and up-regulated serum titers of 3760 autoantibodies as identified by ProtoArray. Autoantibodies identified as potential novel biomarkers of mercury-induced immunotoxicity include antibodies to the following proteins: GSTA1, tumor necrosis factor ligand superfamily member 13, linker for activation of T cells, signal peptide peptidase like 2B, stimulated by retinoic acid 13, and interferon induced transmembrane protein. ELISA analyses confirmed that mercury-exposed gold miners had significantly higher serum titers of anti-GSTA1 autoantibody [unadjusted odds ratio = 89.6; 95% confidence interval: 27.2, 294.6] compared to emerald miners (referent population

  4. Meta-analysis of data from human ex vivo placental perfusion studies on genotoxic and immunotoxic agents within the integrated European project NewGeneris.

    PubMed

    Mose, T; Mathiesen, L; Karttunen, V; Nielsen, J K S; Sieppi, E; Kummu, M; Mørck, T A; Myöhänen, K; Partanen, H; Vähäkangas, K; Knudsen, L E; Myllynen, P

    2012-05-01

    In the E.U. integrated project NewGeneris, we studied placental transport of thirteen immunotoxic and genotoxic agents in three ex vivo placental perfusion laboratories. In the present publication, all placental perfusion data have been re-analyzed and normalized to make them directly comparable and rankable. Antipyrine transfer data differed significantly between the studies and laboratories, and therefore normalization of data was necessary. An antipyrine normalization factor was introduced making the variance significantly smaller within and between the studies using the same compound but performed in different laboratories. Non-normalized (regular) and normalized data showed a good correlation. The compounds were ranked according to their transplacental transfer rate using either antipyrine normalized AUC120 or transfer index (TI120(%)). Normalization generated a division of compounds in slow, medium and high transfer rate groups. The transfer rate differed slightly depending on the parameter used. However, compounds with passage similar to antipyrine which goes through the placenta by passive diffusion, and good recovery in media (no accumulation in the tissue or adherence to equipment) were highly ranked no matter which parameter was used. Antipyrine normalization resulted in the following ranking order of compounds according to AUC(120NORM) values: NDMA ≥ EtOH ≥ BPA ≥ IQ ≥AA ≥ GA ≥ PCB180 ≥ PhIP ≥ AFB1 > DON ≥ BP ≥ PCB52 ≥ TCDD. As the variance in all parameters within a study decreased after antipyrine normalization, we conclude that this normalization approach at least partially corrects the bias caused by the small methodological differences between studies. PMID:22374511

  5. Immunotoxic effects of cis-urocanic acid exposure in C57BL/6N and C3H/HeN mice.

    PubMed

    Prater, M Renee; Gogal, Robert M; De Fabo, Edward C; Longstreth, Janice; Holladay, Steven D

    2003-04-01

    Exposure to ultraviolet radiation results in increased levels of intradermal cis-urocanic acid (cUCA) and alters cutaneous immunity by interfering with processing and presentation of antigen by Langerhans cells. Reports on effects of systemic immunotoxicity with 30 day cUCA exposure in laboratory rodents include thymic atrophy, thymic hypocellularity and decreased T-cell-mediated immunity; however, immune effects of single exposure or 5 day cUCA administration, which may better mimic human exposures, are poorly defined. The present study initially evaluated immune effects of single, 5 day, and 4 week cUCA exposure in C57BL/6N mice. Single administration of intradermal cUCA resulted in decreased splenocyte phagocytosis that persisted for 30 days after cUCA exposure. Five day consecutive cUCA exposure decreased numbers of phenotypically mature CD4(+)CD8(-) and CD4(-)CD8(+) (single positive) thymocytes, increased CD4(+)CD8(+) (double positive) immature thymocytes and increased splenocyte proliferation. Prolonged cUCA exposure (4 weeks) caused profound thymic hypocellularity and splenic hypercellularity and increased splenic macrophage chemiluminescence. Because of this apparent sensitivity of C57BL/6N mice to cUCA, thymic hypocellularity was compared between C57BL/6N and C3H/HeN mice dosed with cUCA, and was found to be more pronounced in the C57BL/6N strain. These results are an extension of previous conclusions on immune modulation caused by cUCA in the spleen and thymus. Further, the observed variation in sensitivity between the mouse strains is consistent with known genetic susceptibility of these strains to the immunomodulatory effects of exposure to sunlight. PMID:12733650

  6. Patterns of Immunotoxicity Associated with Chronic as Compared with Acute Exposure to Chemical or Physical Stressors and their Relevance with Regard to the Role of Stress and with Regard to Immunotoxicity Testing

    PubMed Central

    Pruett, Stephen B.; Fan, Ruping; Zheng, Qiang; Schwab, Carlton

    2009-01-01

    Previous studies have demonstrated that the stress response induced by some drugs and chemicals contributes in a predictable way to alteration of particular immunological parameters in mice. It has not been determined if mice can become tolerant or habituated with regard to the stress response and consequent immunological effects. Addressing this issue was the purpose of the present study. Mice were dosed daily for 28 days with atrazine, ethanol, propanil, or subjected to restraint, which are known to induce neuroendocrine stress responses and thereby to alter several immunological parameters. On day 29, a blood sample was taken and the spleen was removed for analysis of cellular phenotypes, differential cell counts (for blood), and natural killer (NK) cell activity. Corticosterone concentration at various times after dosing (or restraint) was also measured. Comparison of these results with results from previous studies with a single acute exposure revealed that the corticosterone response was almost completely absent in mice treated with ethanol, reduced in mice treated with restraint and propanil, and for atrazine the response was the same as noted for acute exposure. In most cases, the changes in immunological parameters were consistent with expectations based on these corticosterone responses. However, in a few cases (e.g., NK cell activity), it was clear that there were effects not mediated by stress. These results indicate that the nature of the stressor determines whether mice become tolerant with regard to the stress response and consequent immunological effects. This finding has practical implications for safety testing in mice. PMID:19357072

  7. In vitro immunotoxic and genotoxic activities of particles emitted from two different small-scale wood combustion appliances

    NASA Astrophysics Data System (ADS)

    Tapanainen, Maija; Jalava, Pasi I.; Mäki-Paakkanen, Jorma; Hakulinen, Pasi; Happo, Mikko S.; Lamberg, Heikki; Ruusunen, Jarno; Tissari, Jarkko; Nuutinen, Kati; Yli-Pirilä, Pasi; Hillamo, Risto; Salonen, Raimo O.; Jokiniemi, Jorma; Hirvonen, Maija-Riitta

    2011-12-01

    Residential wood combustion appliances emit large quantities of fine particles which are suspected to cause a substantial health burden worldwide. Wood combustion particles contain several potential health-damaging metals and carbon compounds such as polycyclic aromatic hydrocarbons (PAH), which may determine the toxic properties of the emitted particles. The aim of the present study was to characterize in vitro immunotoxicological and chemical properties of PM 1 ( Dp ≤ 1 μm) emitted from a pellet boiler and a conventional masonry heater. Mouse RAW264.7 macrophages were exposed for 24 h to different doses of the emission particles. Cytotoxicity, production of the proinflammatory cytokine TNF-α and the chemokine MIP-2, apoptosis and phases of the cell cycle as well as genotoxic activity were measured after the exposure. The type of wood combustion appliance had a significant effect on emissions and chemical composition of the particles. All the studied PM 1 samples induced cytotoxic, genotoxic and inflammatory responses in a dose-dependent manner. The particles emitted from the conventional masonry heater were 3-fold more potent inducers of programmed cell death and DNA damage than those emitted from the pellet boiler. Furthermore, the particulate samples that induced extensive DNA damage contained also large amounts of PAH compounds. Instead, significant differences between the studied appliances were not detected in measurements of inflammatory mediators, although the chemical composition of the combustion particles differed considerably from each other. In conclusion, the present results show that appliances representing different combustion technology have remarkable effects on physicochemical and associated toxicological and properties of wood combustion particles. The present data indicate that the particles emitted from incomplete combustion are toxicologically more potent than those emitted from more complete combustion processes.

  8. GC-TOF/MS-based metabolomics approach to study the cellular immunotoxicity of deoxynivalenol on murine macrophage ANA-1 cells.

    PubMed

    Ji, Jian; Sun, Jiadi; Pi, Fuwei; Zhang, Shuang; Sun, Chao; Wang, Xiumei; Zhang, Yinzhi; Sun, Xiulan

    2016-08-25

    Gas chromatography-time of fly/mass spectrum (GC-TOF/MS) based complete murine macrophage ANA-1 cell metabolome strategy, including the endo-metabolome and the exo-metabolome, ANA-1 cell viability assays and apoptosis induced by diverse concentrations of DON were evaluated for selection of an optimized dose for in-depth metabolomic research. Using the optimized chromatography and mass spectrometry parameters, the metabolites detected by GC-TOF/MS were identified and processed with multivariate statistical analysis, including principal componentanalysis (PCA) and orthogonal projection to latent structures-discriminant analysis (OPLS-DA) analysis. The data sets were screened with a t-test (P) value < 0.05, VIP value > 1, similarity value > 500, leaving 16 exo-metabolite variables and 11 endo-metabolite variables for further pathway analysis. Implementing the integration of key metabolic pathways, the metabolism pathways were categorized into two dominating types, metabolism of amino acid and glycometabolism. Glycine, serine and threonine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis and phenylalanine metabolism were the significant amino acids affected by the metabolic pathways, indicating statistically significant fold changes including pyruvate, serine, glycine, lactate and threonine. Glycolysis or gluconeogenesis, starch and sucrose metabolism, and galactose metabolism, belonging to glycometabolism, were the pathways that were found to be primarily affected, resulting in abnormal metabolites such as glucose-1P, Glucose, gluconic acid, myo-inositol, sorbitol and glycerol. PMID:27350164

  9. Ability of Lactobacillus plantarum MON03 to mitigate aflatoxins (B1 and M1) immunotoxicities in mice.

    PubMed

    Jebali, Rania; Abbès, Samir; Salah-Abbès, Jalila Ben; Younes, Ridha Ben; Haous, Zohra; Oueslati, Ridha

    2015-01-01

    Aflatoxin B1 (AFB1) and M1 (AFM1) are mycotoxins produced by numerous Aspergillus species in pre- or post-harvest cereals and milk. AFB1 and AFM1 display a potent economic loss in livestock and also cause severe immunological problems. The aims of this study were to: evaluate a new AFB1 and AFM1-binding/degrading micro-organism for biological detoxification; examine its ability to degrade AFB1 and AFM1 in liquid medium; and evaluate its potential for in vivo preventative effects against AFB1- and AFM1-induced immunomodulation in mice. Lactobacillus plantarum MON03 (LP) isolated from Tunisian artisanal butter was found to display significant binding ability to AFB1 and AFM1 in PBS (i.e. 82% and 89%, respectively) within 24 h of incubation and able to tolerate gastric acidity, have strongly hydrophilic cells surface properties, and adhere efficacy to Caco-3 cells in vitro. The in vivo study was conducted using Balb/c mice that received by oral gavage vehicle (control), LP only (2 × 10(9) CFU/L, ~2 g/kg BW), AFB1 or AFM1 alone (0.25 and 0.27 mg/kg, respectively), or AFB1 + LP or AFM1 + LP daily for 15 days. Compared to in control mice, treatments with AFB1 and AFM1 led to significantly decreased body weight gains, histopathological changes, and decrements in all hematologic and immune parameters assessed. Co-treatment with LP strongly reduced the adverse effects of each mycotoxin. In fact, the mice receiving AFB1 + LP or AFM1 + LP co-treatment displayed no significant differences in the assayed parameters as compared to the control mice. By itself, the bacteria alone had no adverse effects in the mice. From these data, it is concluded that the tested bacteria could be beneficial in biotechnology detoxification of contaminated food and feed for humans and animals. PMID:25441623

  10. Melatonin Reverses Fas, E2F-1 and Endoplasmic Reticulum Stress Mediated Apoptosis and Dysregulation of Autophagy Induced by the Herbicide Atrazine in Murine Splenocytes

    PubMed Central

    Sharma, Shweta; Sarkar, Jayanta; Haldar, Chandana; Sinha, Sudhir

    2014-01-01

    Exposure to the herbicide Atrazine (ATR) can cause immunotoxicity, apart from other adverse consequences for animal and human health. We aimed at elucidating the apoptotic mechanisms involved in immunotoxicity of ATR and their attenuation by Melatonin (MEL). Young Swiss mice were divided into control, ATR and MEL+ATR groups based on daily (x14) intraperitoneal administration of the vehicle (normal saline), ATR (100 mg/kg body weight) and MEL (20 mg/kg body weight) with ATR. Isolated splenocytes were processed for detection of apoptosis by Annexin V-FITC and TUNEL assays, and endoplasmic reticulum (ER) stress by immunostaining. Key proteins involved in apoptosis, ER stress and autophagy were quantified by immunoblotting. ATR treatment resulted in Fas-mediated activation of caspases 8 and 3 and inactivation of PARP1 which were inhibited significantly by co-treatment with MEL. MEL also attenuated the ATR-induced, p53 independent mitochondrial apoptosis through upregulation of E2F-1 and PUMA and suppression of their downstream target Bax. An excessive ER stress triggered by ATR through overexpression of ATF-6α, spliced XBP-1, CREB-2 and GADD153 signals was reversed by MEL. MEL also reversed the ATR-induced impairment of autophagy which was indicated by a decline in BECN-1, along with significant enhancement in LC3B-II and p62 expressions. Induction of mitochondrial apoptosis, ER stress and autophagy dysregulation provide a new insight into the mechanism of ATR immunotoxicity. The cytoprotective role of MEL, on the other hand, was defined by attenuation of ER stress, Fas-mediated and p53 independent mitochondria-mediated apoptosis as well as autophagy signals. PMID:25259610

  11. Tissue oxidative stress induced by patulin and protective effect of crocin.

    PubMed

    Boussabbeh, Manel; Ben Salem, Intidhar; Belguesmi, Faicel; Bacha, Hassen; Abid-Essefi, Salwa

    2016-03-01

    Patulin (PAT) is a secondary toxic metabolite produced principally by Penicillium expansum. This mycotoxin is known to be teratogenic, mutagenic, immunotoxic and neurotoxic, and it has been shown to cause damage in several organs in laboratory animals. This study focuses on the prevention of experimental murine PAT-induced nephrotoxicity and hepatotoxicity. We investigate the ability of a natural product, crocin (CRO), to counteract the toxic effects of PAT. Pre-treatment of mice with CRO prevented PAT-induced oxidative damage in both liver and kidney. CRO reduced lipid peroxidation, protein oxidation and restored redox status by regulating the endogenous antioxidant enzymatic system. These data corroborate and extend findings in PAT-induced nephrotoxicity and hepatotoxicity, and further suggest that preventive effect of CRO towards other forms of PAT toxicity, including neurotoxicity, may be warranted. PMID:26584762

  12. PARTNERSHIPS TO IMPROVE IMMUNOTOXICITY TESTING

    EPA Science Inventory

    Research in ITB is focused on the effects that chemicals/environmental contaminants have on modulation of the immune system. Immune modulation may result in suppressed immune function, while exposure to certain contaminants may result in hypersensitivity reactions (e.g., asthma ...

  13. DEVELOPMENTAL IMMUNOTOXICITY AND HUMAN DEVELOPMENT

    EPA Science Inventory

    To compile literature information for web-based dissemination. The report will be on our current understanding of the science of development of the immune system, to provide examples of perturbations that can be brought about by environmental agents and that could produce effects...

  14. Workshop report. Children as a special subpopulation: focus on immunotoxicity. Federal Institute for Health Protection of Consumers and Veterinary Medicine (BgVV), 15-16 November 2001, Berlin, Germany.

    PubMed

    Richter-Reichhelm, H B; Althoff, J; Schulte, A; Ewe, S; Gundert-Remy, U

    2002-07-01

    relevant aspects into existing test guidelines for testing developmental immunotoxicity. In this context, it is recommended that animals culled otherwise in one- and two-generation studies be examined for developmental immunotoxicity according to the valid methods and parameters discussed. The majority of participants agreed that a safety factor of 10 is too low in risk assessment and management to protect a sensitive subpopulation of children against man-made environmental pollutants. PMID:12222155

  15. Comparative immunotoxicity of 2,2`-dichlorodiethyl sulfide and cyclophosphamide: Evaluation of L1210 tumor cell resistance, cell-mediated immunity, and humoral immunity. (Reannouncement with new availability information)

    SciTech Connect

    Blank, J.A.; Joiner, R.L.; Houchens, D.P.; Dill, G.S.; Hobson, D.W.

    1991-12-31

    The immunotoxicity of 2,2`-dichlorodiethyl sulfide (sulfur mustard, SM),on humoral and cell-mediated immunity was compared with that of the nitrogen mustard 2-(bis(2-chloroethyl) amino)tetrahydro- 2H-1,3,2-oxazophosphorine 2-oxide (cyclophosphamide, CP). SM and CP had similar effects on thymic and splenic weights, spleen cell number, and the formation of antibody producing cells to sheep red blood cells (sRBC) when examined 5 days after exposure, but differed in their effects on body weights. Although there were no differences in the delayed hypersensitivity response to keyhole limpet hemocyanin, CP and SM had different effects in the L1210 tumor cell allograft rejection assay. CP, but not SM, decreased the 28 day survival rate of allogeneic mice exposed to a sublethal L1210 tumor challenge. The differing effects on survival to the L1210 tumor challenge could not be attributed to a direct cytotoxic effect of SM on the L1210 tumor cells as SM did not increase the survival rate or mediansurvival time of syngeneic mice exposed to a lethal L1210 tumor cell challenge. In summary, SM and CP had immunosuppressive effects in the humoral immune assay. Although neither compound suppressed the delayed hypersensitivity response, CP was found to suppress host resistance to L1210 tumor cells.

  16. Tributyltin induces mitochondrial fission through Mfn1 degradation in human induced pluripotent stem cells.

    PubMed

    Yamada, Shigeru; Asanagi, Miki; Hirata, Naoya; Itagaki, Hiroshi; Sekino, Yuko; Kanda, Yasunari

    2016-08-01

    Organotin compounds, such as tributyltin (TBT), are well-known endocrine disruptors. TBT is also known to cause various forms of cytotoxicity, including neurotoxicity and immunotoxicity. However, TBT toxicity has not been identified in normal stem cells. In the present study, we examined the effects of TBT on cell growth in human induced pluripotent stem cells (iPSCs). We found that exposure to nanomolar concentrations of TBT decreased intracellular ATP levels and inhibited cell viability in iPSCs. Because TBT suppressed energy production, which is a critical function of the mitochondria, we further assessed the effects of TBT on mitochondrial dynamics. Staining with MitoTracker revealed that nanomolar concentrations of TBT induced mitochondrial fragmentation. TBT also reduced the expression of mitochondrial fusion protein mitofusin 1 (Mfn1), and this effect was abolished by knockdown of the E3 ubiquitin ligase membrane-associated RING-CH 5 (MARCH5), suggesting that nanomolar concentrations of TBT could induce mitochondrial dysfunction via MARCH5-mediated Mfn1 degradation in iPSCs. Thus, mitochondrial function in normal stem cells could be used to assess cytotoxicity associated with metal exposure. PMID:27133438

  17. Immunotoxicity of nanoparticles: a computational study suggests that CNTs and C60 fullerenes might be recognized as pathogens by Toll-like receptors

    NASA Astrophysics Data System (ADS)

    Turabekova, M.; Rasulev, B.; Theodore, M.; Jackman, J.; Leszczynska, D.; Leszczynski, J.

    2014-03-01

    Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke substantial inflammation in alveolar and bronchial epithelial cells, epidermal keratinocytes, cultured monocyte-macrophage cells, etc. We suggest a hypothetical model providing the potential mechanistic explanation for immune and inflammatory responses observed upon exposure to carbon nanoparticles. Specifically, we performed a theoretical study to analyze CNT and C60 fullerene interactions with the available X-ray structures of Toll-like receptors (TLRs) homo- and hetero-dimer extracellular domains. This assumption was based on the fact that similar to the known TLR ligands both CNTs and fullerenes induce, in cells, the secretion of certain inflammatory protein mediators, such as interleukins and chemokines. These proteins are observed within inflammation downstream processes resulted from the ligand molecule dependent inhibition or activation of TLR-induced signal transduction. Our computational studies have shown that the internal hydrophobic pockets of some TLRs might be capable of binding small-sized carbon nanostructures (5,5 armchair SWCNTs containing 11 carbon atom layers and C60 fullerene). High binding scores and minor structural alterations induced in TLR ectodomains upon binding C60 and CNTs further supported our hypothesis. Additionally, the proposed hypothesis is strengthened by the indirect experimental findings indicating that CNTs and fullerenes induce an excessive expression of specific cytokines and chemokines (i.e. IL-8 and MCP1).Over the last decade, a great deal of attention has been devoted to study the inflammatory response upon exposure to multi/single-walled carbon nanotubes (CNTs) and different fullerene derivatives. In particular, carbon nanoparticles are reported to provoke

  18. Immunotoxic effects of exposure of rats to xenobiotics via maternal lactation. Part I 2,3,7,8-tetrachlorodibenzo-p-dioxin.

    PubMed Central

    Badesha, J. S.; Maliji, G.; Flaks, B.

    1995-01-01

    Exposure of lactating female Leeds rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) resulted in a reduction in the body, spleen and liver weights of their male offspring at 130 days of age. None of the total administered doses (0.2, 1.0 or 5.0 micrograms/kg b.wt over 18 days) induced thymic atrophy in the offspring of either sex as adults. Most of the growth inhibition occurred during the suckling period and the effect was near maximal following maternal exposure to the lowest dose of TCDD. After this dose, at post-natal day 130 the body weights of the female offspring remained depressed, while those of the males had recovered to untreated control values. Maternal exposure to TCDD affected the immunocompetence of the adult offspring: in vitro T cell dependent and T cell independent responses and mitogen induced in vitro production of interleukin 1 (IL-1) and interleukin 2 (IL-2) were suppressed at post-natal day 130. The total dose of TCDD that has to be administered to dams over an 18-day nursing period in order to reduce the humoral responses of their offspring as adults by 50% of the maximum was estimated to be in the range 0.3-1.0 micrograms/kg b.wt to the antigens SRBC, DNP-Ficoll or TNP-LPS and 3.5-3.9 micrograms/kg b.wt. to the antigen LPS. PMID:8652363

  19. EVALUATION OF ANTIMICROBIAL EFFICACY FOR CONTROL OF STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Biological contaminants in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants, Sick buildings are evidence of extremely problematic indoor air quality (lAO) often resulting from unacceptable concentration...

  20. In Vitro Nephrotoxicity Induced by Propanil

    PubMed Central

    Rankin, Gary O.; Racine, Christopher; Sweeney, Adam; Kraynie, Alyssa; Anestis, Dianne K.; Barnett, John B.

    2015-01-01

    Propanil is a postemergence herbicide used primarily in rice and wheat production in the United States. The reported toxicities for propanil exposure include methemoglobinemia, immunotoxicity, and nephrotoxicity. A major metabolite of propanil, 3,4-dichloroaniline (3,4-DCA), has been shown to be a nephrotoxicant in vivo and in vitro, but the nephrotoxic potential of propanil has not been examined in detail. The purpose of this study was to determine the nephrotoxic potential of propanil using an in vitro kidney model, determine whether in vitro propanil nephrotoxicity is due to metabolites arising from propanil hydrolysis, and examine mechanistic aspects of propanil nephrotoxicity in vitro. Propanil, 3,4-DCA, propionic acid (0.1–5.0 mM), or vehicle was incubated for 15–120 min with isolated renal cortical cells (IRCC; ~4 million cells/mL) obtained from untreated male Fischer 344 rats. Cytotoxicity was determined by measuring lactate dehydrogenase release from IRCC. In 120-min incubations, propanil induced cytotoxicity at concentrations >0.5 mM. At 1.0 mM, propanil induced cytotoxicity following 60- or 120-min exposure. Cytotoxicity was observed with 3,4-DCA (2.0 mM) at 60 and 120 min, while propionic acid (5.0 mM) induced cytotoxicity at 60 min. In IRCC pretreated with an antioxidant, cytochrome P450(CYP) inhibitor, flavin adenine dinucleotide monooxygenase activity modulator, or cyclooxygenase inhibitor before propanil exposure (1.0 mM; 120 min), only piperonyl butoxide (0.1 mM), a CYP inhibitor, pretreatment decreased propanil cytotoxicity. These results demonstrate that propanil is an in vitro nephrotoxicant in IRCC. Propanil nephrotoxicity is not primarily due to metabolites resulting from hydrolysis of propanil, but a metabolite resulting from propanil oxidation may contribute to propanil cytotoxicity. PMID:18214888

  1. External gamma irradiation-induced effects in early-life stages of zebrafish, Danio rerio.

    PubMed

    Gagnaire, B; Cavalié, I; Pereira, S; Floriani, M; Dubourg, N; Camilleri, V; Adam-Guillermin, C

    2015-12-01

    In the general context of validation of tools useful for the characterization of ecological risk linked to ionizing radiation, the effects of an external gamma irradiation were studied in zebrafish larvae irradiated for 96 h with two dose rates: 0.8 mGy/d, which is close to the level recommended to protect ecosystems from adverse effects of ionizing radiation (0.24 mGy/d) and a higher dose rate of 570 mGy/d. Several endpoints were investigated, such as mortality, hatching, and some parameters of embryo-larval development, immunotoxicity, apoptosis, genotoxicity, neurotoxicity and histological alterations. Results showed that an exposure to gamma rays induced an acceleration of hatching for both doses and a decrease of yolk bag diameter for the highest dose, which could indicate an increase of global metabolism. AChE activity decreased with the low dose rate of gamma irradiation and alterations were also shown in muscles of irradiated larvae. These results suggest that gamma irradiation can induce damages on larval neurotransmission, which could have repercussions on locomotion. DNA damages, basal ROS production and apoptosis were also induced by irradiation, while ROS stimulation index and EROD biotransformation activity were decreased and gene expression of acetylcholinesterase, choline acetyltransferase, cytochrome p450 and myeloperoxidase increased. These results showed that ionizing radiation induced an oxidative stress conducting to DNA damages. This study characterized further the modes of action of ionizing radiation in fish. PMID:26517177

  2. Perfluorinated Compounds: Emerging POPs with Potential Immunotoxicity

    EPA Science Inventory

    Perfluorinated compounds (PFCs) have been recognized as an important class of environmental contaminants commonly detected in blood samples of both wildlife and humans. These compounds have been in use for more than 60 years as surface treatment chemicals, polymerization aids, an...

  3. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  4. Selected new developments in asbestos immunotoxicity.

    PubMed Central

    Rosenthal, G J; Corsini, E; Simeonova, P

    1998-01-01

    Research over the past three decades has shown that the mammalian immune system can be altered by the occupational exposure of asbestos. Early clinical studies generally focused on systemic observations of immune alteration such as the number and function of peripheral lymphocytes and monocytes. More recently as the regulatory influence of local immunity in health and disease becomes more defined, immunologic changes occurring in the lung, the primary target organ of asbestos, have been significant areas of investigation. This review will focus on recent studies that examine the influence of asbestos on pulmonary immunity as well as the role of host immune competence in asbestos-related disease. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9539011

  5. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  6. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  7. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  8. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  9. 40 CFR 799.9780 - TSCA immunotoxicity.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 CFR 799.9346. The exposure time for the anti-SRBC test shall be at least 28 days. (6) Observation... levels. (3) Test report. In addition to the reporting requirements as specified under 40 CFR part 792... study shall be conducted in compliance with the 40 CFR Part 792—Good Laboratory Practice. (j)...

  10. Induction of Heat Shock Proteins and Antioxidant Enzymes in 2,3,7,8-TCDD-Induced Hepatotoxicity in Rats

    PubMed Central

    Kim, Hyun-Sook; Park, So-Young; Yoo, Ki-Yeol

    2012-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (2,3,7,8-TCDD) is an environmental toxicant with a polyhalogenated aromatic hydrocarbon structure and is one of the most toxic man-made chemicals. Exposure to 2,3,7,8-TCDD induces reproductive toxicity, immunotoxicity, and hepatotoxicity. In this study, we evaluated how 2,3,7,8-TCDD-induced hepatotoxicity affect the expression of heat shock proteins and antioxidant enzymes using the real-time polymerase chain reaction (PCR) in rat. 2,3,7,8-TCDD increased heat shock protein (Hsp27, α-B-crystallin, Mortalin, Hsp105, and Hsp90s) and antioxidant enzymes (SOD-3, GST and catalase) expression after a 1 day exposure in livers of rats, whereas heat shock protein (α-B-crystallin, Hsp90, and GRP78) and antioxidant enzymes (SOD-1, SOD-3, catalase, GST, and GPXs) expression decreased on day 2 and then slowly recovered back to control levels on day 8. These results suggest that heat shock proteins and antioxidant enzymes were induced as protective mechanisms against 2,3,7,8-TCDD induced hepatotoxicity, and that prolonged exposure depressed their levels, which recovered to control levels due to reduced 2,3,7,8-TCDD induced hepatotoxicity. PMID:23269910