Science.gov

Sample records for chemically modified oligonucleotides

  1. Automated parallel synthesis of 5'-triphosphate oligonucleotides and preparation of chemically modified 5'-triphosphate small interfering RNA.

    PubMed

    Zlatev, Ivan; Lackey, Jeremy G; Zhang, Ligang; Dell, Amy; McRae, Kathy; Shaikh, Sarfraz; Duncan, Richard G; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2013-02-01

    A fully automated chemical method for the parallel and high-throughput solid-phase synthesis of 5'-triphosphate and 5'-diphosphate oligonucleotides is described. The desired full-length oligonucleotides were first constructed using standard automated DNA/RNA solid-phase synthesis procedures. Then, on the same column and instrument, efficient implementation of an uninterrupted sequential cycle afforded the corresponding unmodified or chemically modified 5'-triphosphates and 5'-diphosphates. The method was readily translated into a scalable and high-throughput synthesis protocol compatible with the current DNA/RNA synthesizers yielding a large variety of unique 5'-polyphosphorylated oligonucleotides. Using this approach, we accomplished the synthesis of chemically modified 5'-triphosphate oligonucleotides that were annealed to form small-interfering RNAs (ppp-siRNAs), a potentially interesting class of novel RNAi therapeutic tools. The attachment of the 5'-triphosphate group to the passenger strand of a siRNA construct did not induce a significant improvement in the in vitro RNAi-mediated gene silencing activity nor a strong specific in vitro RIG-I activation. The reported method will enable the screening of many chemically modified ppp-siRNAs, resulting in a novel bi-functional RNAi therapeutic platform. PMID:23260577

  2. Recognition of RNA duplexes by chemically modified triplex-forming oligonucleotides

    PubMed Central

    Zhou, Yuan; Kierzek, Elzbieta; Loo, Zi Ping; Antonio, Meraldo; Yau, Yin Hoe; Chuah, York Wieo; Geifman-Shochat, Susana; Kierzek, Ryszard; Chen, Gang

    2013-01-01

    Triplex is emerging as an important RNA tertiary structure motif, in which consecutive non-canonical base pairs form between a duplex and a third strand. RNA duplex region is also often functionally important site for protein binding. Thus, triplex-forming oligonucleotides (TFOs) may be developed to regulate various biological functions involving RNA, such as viral ribosomal frameshifting and reverse transcription. How chemical modification in TFOs affects RNA triplex stability, however, is not well understood. Here, we incorporated locked nucleic acid, 2-thio U- and 2′-O methyl-modified residues in a series of all pyrimidine RNA TFOs, and we studied the binding to two RNA hairpin structures. The 12-base-triple major-groove pyrimidine–purine–pyrimidine triplex structures form between the duplex regions of RNA/DNA hairpins and the complementary RNA TFOs. Ultraviolet-absorbance-detected thermal melting studies reveal that the locked nucleic acid and 2-thio U modifications in TFOs strongly enhance triplex formation with both parental RNA and DNA duplex regions. In addition, we found that incorporation of 2′-O methyl-modified residues in a TFO destabilizes and stabilizes triplex formation with RNA and DNA duplex regions, respectively. The (de)stabilization of RNA triplex formation may be facilitated through modulation of van der Waals contact, base stacking, hydrogen bonding, backbone pre-organization, geometric compatibility and/or dehydration energy. Better understanding of the molecular determinants of RNA triplex structure stability lays the foundation for designing and discovering novel sequence-specific duplex-binding ligands as diagnostic and therapeutic agents targeting RNA. PMID:23658228

  3. Recognition of RNA duplexes by chemically modified triplex-forming oligonucleotides.

    PubMed

    Zhou, Yuan; Kierzek, Elzbieta; Loo, Zi Ping; Antonio, Meraldo; Yau, Yin Hoe; Chuah, York Wieo; Geifman-Shochat, Susana; Kierzek, Ryszard; Chen, Gang

    2013-07-01

    Triplex is emerging as an important RNA tertiary structure motif, in which consecutive non-canonical base pairs form between a duplex and a third strand. RNA duplex region is also often functionally important site for protein binding. Thus, triplex-forming oligonucleotides (TFOs) may be developed to regulate various biological functions involving RNA, such as viral ribosomal frameshifting and reverse transcription. How chemical modification in TFOs affects RNA triplex stability, however, is not well understood. Here, we incorporated locked nucleic acid, 2-thio U- and 2'-O methyl-modified residues in a series of all pyrimidine RNA TFOs, and we studied the binding to two RNA hairpin structures. The 12-base-triple major-groove pyrimidine-purine-pyrimidine triplex structures form between the duplex regions of RNA/DNA hairpins and the complementary RNA TFOs. Ultraviolet-absorbance-detected thermal melting studies reveal that the locked nucleic acid and 2-thio U modifications in TFOs strongly enhance triplex formation with both parental RNA and DNA duplex regions. In addition, we found that incorporation of 2'-O methyl-modified residues in a TFO destabilizes and stabilizes triplex formation with RNA and DNA duplex regions, respectively. The (de)stabilization of RNA triplex formation may be facilitated through modulation of van der Waals contact, base stacking, hydrogen bonding, backbone pre-organization, geometric compatibility and/or dehydration energy. Better understanding of the molecular determinants of RNA triplex structure stability lays the foundation for designing and discovering novel sequence-specific duplex-binding ligands as diagnostic and therapeutic agents targeting RNA. PMID:23658228

  4. A status update of modified oligonucleotides for chemotherapeutics applications.

    PubMed

    Sanghvi, Yogesh S

    2011-09-01

    This unit presents an update of recent developments and clinical progress in chemically modified oliogonucleotides useful for therapeutic applications. During the last decade, the number of therapeutic oligonucleotides in clinical trials has nearly tripled. This is primarily due to advances in the synthesis protocols, better understanding of the biology, improved delivery, and better formulation technologies. Currently, over 100 clinical trials with oligonucleotide-based drugs are ongoing in the United States for potential treatment of a variety of life-threatening diseases. Among various oligonucleotides, antisense technology has been at the forefront, with one product on the market. Antisense technologies represent about half of the active clinical trials. Similarly, siRNA, aptamers, spiegelmers microRNA, shRNA, IMO, and CpG have been other active classes of oligonucleotides that are also undergoing clinical trials. This review attempts to summarize the current status of synthesis, chemical modifications, purification, and analysis in light of the rapid progress with multitude of oligonucleotides pursued as therapeutic modality. PMID:21901670

  5. Inhibition of dengue virus by novel, modified antisense oligonucleotides.

    PubMed Central

    Raviprakash, K; Liu, K; Matteucci, M; Wagner, R; Riffenburgh, R; Carl, M

    1995-01-01

    Five different target regions along the length of the dengue virus type 2 genome were compared for inhibition of the virus following intracellular injection of the cognate antisense oligonucleotides and their analogs. Unmodified phosphodiester oligonucleotides as well as the corresponding phosphorothioate oligonucleotides were ineffective in bringing about a significant inhibition of the virus. Novel modified phosphorothioate oligonucleotides in which the C-5 atoms of uridines and cytidines were replaced by propynyl groups caused a significant inhibition of the virus. Antisense oligonucleotide directed against the target region near the translation initiation site of dengue virus RNA was the most effective, followed by antisense oligonucleotide directed against a target in the 3' untranslated region of the virus RNA. It is suggested that the inhibitory effect of these novel modified oligonucleotides is due to their increased affinity for the target sequences and that they probably function via an RNase H cleavage of the oligonucleotide:RNA heteroduplex. PMID:7983769

  6. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  7. 2′-Fluoro-modified phosphorothioate oligonucleotide can cause rapid degradation of P54nrb and PSF

    PubMed Central

    Shen, Wen; Liang, Xue-hai; Sun, Hong; Crooke, Stanley T.

    2015-01-01

    Synthetic oligonucleotides are used to regulate gene expression through different mechanisms. Chemical modifications of the backbone of the nucleic acid and/or of the 2′ moiety of the ribose can increase nuclease stability and/or binding affinity of oligonucleotides to target molecules. Here we report that transfection of 2′-F-modified phosphorothioate oligonucleotides into cells can reduce the levels of P54nrb and PSF proteins through proteasome-mediated degradation. Such deleterious effects of 2′-F-modified oligonucleotides were observed in different cell types from different species, and were independent of oligonucleotide sequence, positions of the 2′-F-modified nucleotides in the oligonucleotides, method of delivery or mechanism of action of the oligonucleotides. Four 2′-F-modified nucleotides were sufficient to cause the protein reduction. P54nrb and PSF belong to Drosophila behavior/human splicing (DBHS) family. The third member of the family, PSPC1, was also reduced by the 2′-F-modified oligonucleotides. Preferential association of 2′-F-modified oligonucleotides with P54nrb was observed, which is partially responsible for the protein reduction. Consistent with the role of DBHS proteins in double-strand DNA break (DSB) repair, elevated DSBs were observed in cells treated with 2′-F-modified oligonucleotides, which contributed to severe impairment in cell proliferation. These results suggest that oligonucleotides with 2′-F modifications can cause non-specific loss of cellular protein(s). PMID:25855809

  8. Use of a chemically modified antisense oligonucleotide library to identify and validate Eg5 (kinesin-like 1) as a target for antineoplastic drug development.

    PubMed

    Koller, Erich; Propp, Stephanie; Zhang, Hong; Zhao, Chenguang; Xiao, Xiaokun; Chang, MingYi; Hirsch, Scott A; Shepard, Peter J; Koo, Seongjoon; Murphy, Cain; Glazer, Robert I; Dean, Nicholas M

    2006-02-15

    A library of 2'-methoxyethyl-modified antisense oligonucleotides (2'MOE ASO) targeting 1,510 different genes has been developed, validated, and used to identify cell cycle regulatory genes. The most effective molecular target identified was Eg5 (kinesin-like-1), which when inhibited gave the largest increase in 4N DNA in various tumor cells. The Eg5 ASO reduced Eg5 levels, inhibited proliferation, increased apoptosis, and altered the expression of other cell cycle proteins, including survivin and Aurora-A. To examine the therapeutic utility of the Eg5 ASO, the compound was also evaluated in xenograft models. Treatment with Eg5 ASO produced a statistically significant reduction of tumor growth, reduction in Eg5 expression in the tumors, and changes in histone phosphorylation, consistent with a loss of Eg5 protein expression. These data show, for the first time, the utility of a 2'MOE ASO library for high-throughput cell culture-based functional assays and suggest that an Eg5 ASO also has potential in a therapeutic strategy. PMID:16489005

  9. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  10. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    DOEpatents

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  11. Correlating In Vitro Splice Switching Activity With Systemic In Vivo Delivery Using Novel ZEN-modified Oligonucleotides

    PubMed Central

    Hammond, Suzan M; McClorey, Graham; Nordin, Joel Z; Godfrey, Caroline; Stenler, Sofia; Lennox, Kim A; Smith, CI Edvard; Jacobi, Ashley M; Varela, Miguel A; Lee, Yi; Behlke, Mark A; Wood, Matthew J A; Andaloussi, Samir E L

    2014-01-01

    Splice switching oligonucleotides (SSOs) induce alternative splicing of pre-mRNA and typically employ chemical modifications to increase nuclease resistance and binding affinity to target pre-mRNA. Here we describe a new SSO non-base modifier (a naphthyl-azo group, “ZEN™”) to direct exon exclusion in mutant dystrophin pre-mRNA to generate functional dystrophin protein. The ZEN modifier is placed near the ends of a 2′-O-methyl (2′OMe) oligonucleotide, increasing melting temperature and potency over unmodified 2′OMe oligonucleotides. In cultured H2K cells, a ZEN-modified 2′OMe phosphorothioate (PS) oligonucleotide delivered by lipid transfection greatly enhanced dystrophin exon skipping over the same 2′OMePS SSO lacking ZEN. However, when tested using free gymnotic uptake in vitro and following systemic delivery in vivo in dystrophin deficient mdx mice, the same ZEN-modified SSO failed to enhance potency. Importantly, we show for the first time that in vivo activity of anionic SSOs is modelled in vitro only when using gymnotic delivery. ZEN is thus a novel modifier that enhances activity of SSOs in vitro but will require improved delivery methods before its in vivo clinical potential can be realized. PMID:25423116

  12. 2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

    SciTech Connect

    Prakash, T.P.; Puschl, A.; Lesnik, E.; Mohan, V.; Tereshko, V.; Egli, M.; Manoharan, M.

    2010-03-08

    Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA ({Delta}T{sub m} 3.2 C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 {angstrom} resolution.

  13. Enzymatic synthesis of modified oligonucleotides by PEAR using Phusion and KOD DNA polymerases.

    PubMed

    Wang, Xuxiang; Zhang, Jianye; Li, Yingjia; Chen, Gang; Wang, Xiaolong

    2015-02-01

    Antisense synthetic oligonucleotides have been developed as potential gene-targeted therapeutics. We previously reported polymerase-endonuclease amplification reaction (PEAR) for amplification of natural and 5'-O-(1-thiotriphosphate) (S)-modified oligonucleotides. Here, we extended the PEAR technique for enzymatic preparation of 2'-deoxy-2'-fluoro-(2'-F) and 2'-F/S double-modified oligonucleotides. The result showed that KOD and Phusion DNA polymerase could synthesize oligonucleotides with one or two modified nucleotides, and KOD DNA polymerase is more suitable than Phusion DNA polymerase for PEAR amplification of 2'-F and 2'-F/S double modified oligonucleotides. The composition of PEAR products were analyzed by electrospray ionization liquid chromatography mass spectrometry (ESI/LC/MS) detection and showed that the sequence of the PEAR products are maintained at an extremely high accuracy (>99.9%), and after digestion the area percent of full-length modified oligonucleotides reaches 89.24%. PEAR is suitable for synthesis of modified oligonucleotides efficiently and with high purity. PMID:25517220

  14. A convenient and efficient purification method for chemically labeled oligonucleotides.

    PubMed

    Hwang, Jihee; Kang, Junhee; Kim, Seong Keun; Kim, Younggyu

    2013-05-01

    We developed an efficient, cost-effective, and rapid purification method for chemically-labeled oligonucleotides that requires less time than conventional procedures such as ethanol precipitation or size-exclusion chromatography. Based on the hydrophilic and hydrophobic properties of DNA and amine-reactive fluorophores, we show that n-butanol saturated with distilled water may be used to remove unreacted fluorophores by sequestering them in the organic phase, while labeled DNA remains in the aqueous phase. This phase extraction method is simple, fast, and allows for processing multiple samples simultaneously, a necessity for high-throughput labeling strategies. PMID:23662899

  15. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

  16. Effect of 2'-O-methyl/thiophosphonoacetate-modified antisense oligonucleotides on huntingtin expression in patient-derived cells.

    PubMed

    Matsui, Masayuki; Threlfall, Richard N; Caruthers, Marvin H; Corey, David R

    2014-12-15

    Optimizing oligonucleotides as therapeutics will require exploring how chemistry can be used to enhance their effects inside cells. To achieve this goal it will be necessary to fully explore chemical space around the native DNA/RNA framework to define the potential of diverse chemical modifications. In this report we examine the potential of thiophosphonoacetate (thioPACE)-modified 2'-O-methyl oligoribonucleotides as inhibitors of human huntingtin (HTT) expression. Inhibition occurred, but was less than with analogous locked nucleic acid (LNA)-substituted oligomers lacking the thioPACE modification. These data suggest that thioPACE oligonucleotides have the potential to control gene expression inside cells. However, advantages relative to other modifications were not demonstrated. Additional modifications are likely to be necessary to fully explore any potential advantages of thioPACE substitutions. PMID:26865404

  17. Modified nucleotides in T1 RNase oligonucleotides of 18S ribosomal RNA of the Novikoff hepatoma.

    PubMed

    Choi, Y C; Busch, H

    1978-06-27

    The primary structure of 18S rRNA of the Novikoff hepatoma cells was investigated. Regardless of whether the primary sequence of 18S rRNA is finally determined by RNA sequencing methods or DNA sequencing methods, it is important to identify numbers and types of the modified nucleotides and accordingly the present study was designed to localize the modified regions in T1 RNase derived oligonucleotide. Modified nucleotides found in 66 different oligonucleotide sequences included 2 m62A, 1 m6A, 1 m7G, 1m1cap3psi, 7 Cm, 13 Am, 9 Gm, 11 Um, and 38 psi residues. A number of these modified nucleotides are now placed in defined sequences of T1 RNase oligonucleotides which are now being searched for in larger fragments derived from partial T1 RNase digests of 18S rRNA. Improved homochromatography fingerprinting (Choi et al. (1976) Cancer Res. 36, 4301) of T1 RNase derived oligonucleotides provided a distinctive pattern for 18S rRNA of Novikoff hepatoma ascites cells. The 116 spots obtained by homochromatography contain 176 oligonucleotide sequences. PMID:209819

  18. Inhibition Of Molecular And Biological Processes Using Modified Oligonucleotides

    DOEpatents

    Kozyavkin, Sergei A.; Malykh, Andrei G.; Polouchine, Nikolai N.; Slesarev, Alexei I.

    2003-04-15

    A method of inhibiting at least one molecular process in a sample, comprising administering to the sample an oligonucleotide or polynucleotide containing at least one monomeric unit having formula (I): wherein A is an organic moiety, n is at least 1, and each X is independently selected from the group consisting of --NRCOCONu, --NHCOCR.sub.2 CR.sub.2 CONu, --NHCOCR.dbd.CRCONu, and --NHCOSSCONu, wherein each R independently represents H or a substituted or unsubstituted alkyl group, and Nu represents a nucleophile, or a salt of the compound.

  19. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    SciTech Connect

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  20. Approach to the synthesis of natural and modified oligonucleotides by the phosphotriester method using O-nucleophilic intramolecular catalysis.

    PubMed

    Efimov, Vladimir A; Molchanova, Natalia S; Chakhmakhcheva, Oksana G

    2007-01-01

    An approach to the solid phase synthesis of natural and modified oligonucleotides using phosphotriester technique has been developed. Particularly, this method allows the synthesis of ribo- and deoxyribo-oligonucleotides containing various 2'-modified mononucleotides as well as stereodefined nucleotide phosphorothioate analogues. PMID:18058542

  1. Ribonuclease H1-dependent hepatotoxicity caused by locked nucleic acid-modified gapmer antisense oligonucleotides

    PubMed Central

    Kasuya, Takeshi; Hori, Shin-ichiro; Watanabe, Ayahisa; Nakajima, Mado; Gahara, Yoshinari; Rokushima, Masatomo; Yanagimoto, Toru; Kugimiya, Akira

    2016-01-01

    Gapmer antisense oligonucleotides cleave target RNA effectively in vivo, and is considered as promising therapeutics. Especially, gapmers modified with locked nucleic acid (LNA) shows potent knockdown activity; however, they also cause hepatotoxic side effects. For developing safe and effective gapmer drugs, a deeper understanding of the mechanisms of hepatotoxicity is required. Here, we investigated the cause of hepatotoxicity derived from LNA-modified gapmers. Chemical modification of gapmer’s gap region completely suppressed both knockdown activity and hepatotoxicity, indicating that the root cause of hepatotoxicity is related to intracellular gapmer activity. Gene silencing of hepatic ribonuclease H1 (RNaseH1), which catalyses gapmer-mediated RNA knockdown, strongly supressed hepatotoxic effects. Small interfering RNA (siRNA)-mediated knockdown of a target mRNA did not result in any hepatotoxic effects, while the gapmer targeting the same position on mRNA as does the siRNA showed acute toxicity. Microarray analysis revealed that several pre-mRNAs containing a sequence similar to the gapmer target were also knocked down. These results suggest that hepatotoxicity of LNA gapmer is caused by RNAseH1 activity, presumably because of off-target cleavage of RNAs inside nuclei. PMID:27461380

  2. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye. PMID:26774580

  3. Potent triple helix stabilization by 5',3'-modified triplex-forming oligonucleotides.

    PubMed

    Ben Gaied, Nouha; Zhao, Zhengyun; Gerrard, Simon R; Fox, Keith R; Brown, Tom

    2009-07-20

    Anthraquinone and pyrene analogues attached to the 3' and/or 5' termini of triplex-forming oligonucleotides (TFOs) by various linkers increased the stability of parallel triple helices. The modifications are simple to synthesize and can be introduced during standard solid-phase oligonucleotide synthesis. Potent triplex stability was achieved by using doubly modified TFOs, which in the most favourable cases gave an increase in melting temperature of 30 degrees C over the unmodified counterparts and maintained their selectivity for the correct target duplex. Such TFOs can produce triplexes with melting temperatures of 40 degrees C at pH 7 even though they do not contain any triplex-stabilizing base analogues. These studies have implications for the design of triplex-forming oligonucleotides for use in biology and nanotechnology. PMID:19554592

  4. Terminally L-modified oligonucleotides: pairing, stability and biological properties.

    PubMed

    Tondelli, L; Garbesi, A; Morelli, S; Calastretti, A; Copreni, E; Gong, L; Nicolin, A

    1996-02-01

    An oligodeoxynucleotide (ODN), capable of reducing the growth of human B lymphocytes carrying the t(14;18) chromosome translocation, was prepared in different 'chemical versions': unmodified phosphodiester, phosphorothioate and phosphodiester capped with L-2'-deoxycytidine. Their binding affinity to the complementary synthetic target was studied by the melting point assay. The ODNs, administered to DOHH2 cells, were compared for stability in the culture medium, cellular uptake, time course of the intact sequence concentration within the cell and ability to inhibit cell growth. The 5', 3'-L-capped derivative and the phosphorothioate had comparable potency, superior to that of the unmodified ODN, in agreement with the concentration of undegraded ODNs within the cell. PMID:8740724

  5. N-Branched acyclic nucleoside phosphonates as monomers for the synthesis of modified oligonucleotides.

    PubMed

    Hocková, Dana; Rosenbergová, Šárka; Ménová, Petra; Páv, Ondřej; Pohl, Radek; Novák, Pavel; Rosenberg, Ivan

    2015-04-21

    Protected N-branched nucleoside phosphonates containing adenine and thymine bases were prepared as the monomers for the introduction of aza-acyclic nucleotide units into modified oligonucleotides. The phosphotriester and phosphoramidite methods were used for the incorporation of modified and natural units, respectively. The solid phase synthesis of a series of nonamers containing one central modified unit was successfully performed in both 3'→5' and 5'→3' directions. Hybridization properties of the prepared oligoribonucleotides and oligodeoxyribonucleotides were evaluated. The measurement of thermal characteristics of the complexes of modified nonamers with the complementary strand revealed a considerable destabilizing effect of the introduced units. We also examined the substrate/inhibitory properties of aza-acyclic nucleoside phosphono-diphosphate derivatives (analogues of nucleoside triphosphates) but neither inhibition of human and bacterial DNA polymerases nor polymerase-mediated incorporation of these triphosphate analogues into short DNA was observed. PMID:25766752

  6. Structure Activity Relationships of α-L-LNA Modified Phosphorothioate Gapmer Antisense Oligonucleotides in Animals.

    PubMed

    Seth, Punit P; Jazayeri, Ali; Yu, Jeff; Allerson, Charles R; Bhat, Balkrishen; Swayze, Eric E

    2012-01-01

    We report the structure activity relationships of short 14-mer phosphorothioate gapmer antisense oligonucleotides (ASOs) modified with α-L-locked nucleic acid (LNA) and related modifications targeting phosphatase and tensin homologue (PTEN) messenger RNA in mice. α-L-LNA represents the α-anomer of enantio-LNA and modified oligonucleotides show LNA like binding affinity for complementary RNA. In contrast to sequence matched LNA gapmer ASOs which showed elevations in plasma alanine aminotransferase (ALT) levels indicative of hepatotoxicity, gapmer ASOs modified with α-L-LNA and related analogs in the flanks showed potent downregulation of PTEN messenger RNA in liver tissue without producing elevations in plasma ALT levels. However, the α-L-LNA ASO showed a moderate dose-dependent increase in liver and spleen weights suggesting a higher propensity for immune stimulation. Interestingly, replacing α-L-LNA nucleotides in the 3'- and 5'-flanks with R-5'-Me-α-L-LNA but not R-6'-Me- or 3'-Me-α-L-LNA nucleotides, reversed the drug induced increase in organ weights. Examination of structural models of dinucleotide units suggested that the 5'-Me group increases steric bulk in close proximity to the phosphorothioate backbone or produces subtle changes in the backbone conformation which could interfere with recognition of the ASO by putative immune receptors. Our data suggests that introducing steric bulk at the 5'-position of the sugar-phosphate backbone could be a general strategy to mitigate the immunostimulatory profile of oligonucleotide drugs. In a clinical setting, proinflammatory effects manifest themselves as injection site reactions and flu-like symptoms. Thus, a mitigation of these effects could increase patient comfort and compliance when treated with ASOs.Molecular Therapy - Nucleic Acids (2012) 1, e47; doi:10.1038/mtna.2012.34; published online 18 September 2012. PMID:23344239

  7. Achieving successful delivery of oligonucleotides--From physico-chemical characterization to in vivo evaluation.

    PubMed

    Scomparin, Anna; Polyak, Dina; Krivitsky, Adva; Satchi-Fainaro, Ronit

    2015-11-01

    RNA interference is one of the most promising fields in modern medicine to treat several diseases, ranging from cancer to cardiac diseases, passing through viral infections and metabolic pathologies. Since the discovery of the potential therapeutic properties of non-self oligonucleotides, it was clear that it is important to develop delivery systems that are able to increase plasma stability and bestow membrane-crossing abilities to the oligonucleotides in order to reach their cytoplasmic targets. Polymer therapeutics, among other systems, are widely investigated as delivery systems for therapeutic agents, such as oligonucleotides. Physico-chemical characterization of the supramolecular polyplexes obtained upon charge interaction or covalent conjugation between the polymeric carrier and the oligonucleotides is critical. Appropriate characterization is fundamental in order to predict and understand the in vivo silencing efficacy and to avoid undesired side effects and toxicity profile. Shedding light on the physico-chemical and in vitro requirements of a polyplex leads to an efficient in vivo delivery system for RNAi therapeutics. In this review, we will present the most common techniques for characterization of obtained polymer/oligonucleotide polyplexes and an up-to-date state of the art in vivo preclinical and clinical studies. This is the first review to deal with the difficulties in appropriate characterization of small interfering RNA (siRNA) or microRNA (miRNA) polyplexes and conjugates which limit the clinical translation of this promising technology. PMID:25916823

  8. Targeting DNA with triplex-forming oligonucleotides to modify gene sequence.

    PubMed

    Simon, Philippe; Cannata, Fabio; Concordet, Jean-Paul; Giovannangeli, Carine

    2008-08-01

    Molecules that interact with DNA in a sequence-specific manner are attractive tools for manipulating gene sequence and expression. For example, triplex-forming oligonucleotides (TFOs), which bind to oligopyrimidine.oligopurine sequences via Hoogsteen hydrogen bonds, have been used to inhibit gene expression at the DNA level as well as to induce targeted mutagenesis in model systems. Recent advances in using oligonucleotides and analogs to target DNA in a sequence-specific manner will be discussed. In particular, chemical modification of TFOs has been used to improve binding to chromosomal target sequences in living cells. Various oligonucleotide analogs have also been found to expand the range of sequences amenable to manipulation, including so-called "Zorro" locked nucleic acids (LNAs) and pseudo-complementary peptide nucleic acids (pcPNAs). Finally, we will examine the potential of TFOs for directing targeted gene sequence modification and propose that synthetic nucleases, based on conjugation of sequence-specific DNA ligands to DNA damaging molecules, are a promising alternative to protein-based endonucleases for targeted gene sequence modification. PMID:18460344

  9. Chemically modified polypyrrole

    SciTech Connect

    Inagaki, T.; Skotheim, T.A.; Lee, H.S.; Okamoto, Y.; Samuelson, L.; Tripathy, S.

    1988-01-01

    Polypyrrole (PPy) films have been systematically modified with electroactive groups in the ..beta..-position to design electrode materials with specific electrochemical and surface active properties. Electrochemical copolymerization of pyrrole and 3-(6-ferrocenyl,6-hydroxyhexyl)pyrrole (P-6-Fc) yields a ferrocene functionalized polypyrrole with a controlled amount to ferrocene functionalization. And also, copolymers of pyrrole and 3-(4-(2,5- dimethoxyphenyl)butyl)pyrrole (P-MP) can be made by electrochemical polymerization and converted to the copolymers containing pH dependent electroactive hydroquinone moieties. Derivatized pyrroles have also been incorporated into Langmuir-Blodgett film structures. The surface pressure-area isotherms of 3-(13-ferrocenyl,13-hydroxytridecy)pyrrole (P-13-Fc) and the mixed monolayer of P-13-Fc and 3-n-hexadecylpyrrole (HDP) are shown. 17 refs., 4 figs.

  10. Assembly of hybrid oligonucleotide modified gold (Au) and alloy nanoparticles building blocks.

    PubMed

    Kuo, Yu-Ching; Jen, Chun-Ping; Chen, Yu-Hung; Su, Chia-Hao; Tsai, Shu-Hui; Yeh, Chen-Sheng

    2006-01-01

    The alloy-based hybrid materials with macroscopic network arrays were developed by AuAg/Au and AuAgPd/Au nanoparticle composites through oligonucleotides hybridization. AuAg/Au and AuAgPd/Au exhibited distinct organization. The morphology of AuAg/Au conjugation assembled mainly as compact aggregates while AuAgPd/Au hybrid conjugated into the loosen network assemblies. The dehybridization temperatures were studied as a function of molar ratio of alloy/Au. It was found that higher alloy/gold molar ratio led to stronger hybridization for alloy/gold composite, accompanied with increased melting temperature. These results could be interpreted in terms of more alloy nanoparticles bound to a Au particle when the molar ratio of alloy/gold increased. The thermal analysis also showed that AuAg/Au exhibited higher dehybridization temperature. A modified model describing the dehybridization probability of an intact Au/alloy aggregate was performed to support the dehybridization temperature increased with increasing alloy/Au molar ratio. As to more oligonucleotides carried by AuAg (4.9 +/- 1.9 nm) than by AuAgPd (4.4 +/- 1.5 nm) due to larger size in AuAg, the efficient hybridization could result in higher dehybridization temperature in AuAg/Au. PMID:16573077

  11. Synthesis of chemically modified DNA.

    PubMed

    Shivalingam, Arun; Brown, Tom

    2016-06-15

    Naturally occurring DNA is encoded by the four nucleobases adenine, cytosine, guanine and thymine. Yet minor chemical modifications to these bases, such as methylation, can significantly alter DNA function, and more drastic changes, such as replacement with unnatural base pairs, could expand its function. In order to realize the full potential of DNA in therapeutic and synthetic biology applications, our ability to 'write' long modified DNA in a controlled manner must be improved. This review highlights methods currently used for the synthesis of moderately long chemically modified nucleic acids (up to 1000 bp), their limitations and areas for future expansion. PMID:27284032

  12. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  13. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  14. Aptamer-modified PLGA nanoparticle delivery of triplex forming oligonucleotide for targeted prostate cancer therapy.

    PubMed

    Jiao, J; Zou, Q; Zou, M H; Guo, R M; Zhu, S; Zhang, Y

    2016-01-01

    Presented study aimed to prepare A10 aptamer-modified poly (D,L-lactic-co-glycolic acid) (PLGA) nanoparticles loaded with triplex forming oligonucleotides(TFO) for targeted prostate cancer therapy. We first synthesized a PLGA-PEG-Apt copolymer. The PLGA-PEG-Apt nanoparticles (NP-Apt) were loaded with TFO using double emulsion solvent evaporation method. Carboxy-fluorescein labeled TFO-NP-Apt, TFO-NP and TFO were prepared for cellular uptake experiments. Cell counting kit-8 (CCK-8) test was used to determine the ability of TFO-NP-Apt to inhibit LNCaP cell proliferation. RT-PCR and Western blot was conducted to analyze AR gene expressing. Then, a mouse model of prostate cancer was used to evaluate the anti-cancer effect of TFO-NP-Apt in vivo. We confirmed that the PLGA-PEG-Apt conjugation was successful. The TFO encapsulation efficiency and drug loading percentage were 46.1± 3.6% and 40.8±5.3%, respectively. TFO-NP-Apt showed a more efficient cellular uptake than TFO-NP or TFO in LNCaP cells. TFO-NP-Apt was significantly more cytotoxic than TFO-NP and TFO in the CCK-8 test (p<0.001). TFO-NP-Apt silenced the AR gene better than unconjugated Apt, naked TFO, NP or saline. TFO-NP-Apt were more effective than TFO-NP, naked TFO, NP and saline at inhibiting prostate cancer growth in vivo (p<0.05). Aptamer-modified TFO-loaded PLGA nanoparticles may prove useful in targeted therapy for advanced prostate cancer. PMID:27268920

  15. Monitoring of microenvironmental changes in the major and minor grooves of DNA by dan-modified oligonucleotides.

    PubMed

    Kimura, Takumi; Kawai, Kiyohiko; Majima, Tetsuro

    2005-12-22

    [graph: see text] We describe the synthesis of new environmentally sensitive fluorescence probes to elucidate DNA structures. DNA oligonucleotides containing fluorophore dan (6-(dimethylamino)-2-acylnaphthalene)-modified dC or dG were able to monitor the microenvironmental changes in both the major and minor grooves of DNA with a B- to A-DNA conformational transition and RNA hybridization. PMID:16354077

  16. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples. PMID:15308218

  17. Sensitive detection of glucose in human serum with oligonucleotide modified gold nanoparticles by using dynamic light scattering technique.

    PubMed

    Miao, Xiangmin; Ling, Liansheng; Shuai, Xintao

    2013-03-15

    Dynamic light scattering based sensor for glucose was developed with oligonucleotide functionalized gold nanoparticles (Oligo-AuNPs). Oligonucleotide 5'-SH-(A)(12)-AGACAAGAGAGG-3' (Oligo 1) modified AuNPs and oligonucleotide 5'-CAACAGAGAACG-(A)(12)-HS-3' (Oligo 2) modified AuNPs could hybridize with oligonulceotide 5'-CGTTCTCTGTTGCCTCTCTTGTCT-3' (Oligo 3), which resulted in the aggregation of Oligo-AuNPs probes, and triggered the increase of their average diameter. However, Oligo 3 could be cleaved into DNA fragments by the mixture of glucose, glucose oxidase (GOD) and Fe(2+), and the DNA fragments could not hybridize with Oligo-AuNPs probes. Under the conditions of 3.7 nM Oligo 1-AuNPs, 3.7 nM Oligo 2-AuNPs, 8.0 μg/mL GOD, 100 nM Oligo 3 and 900 nM Fe(2+), the average diameter of Oligo-AuNPs probes decreased linearly with the increasing concentration of glucose over the range from 50 pmol/L to 5.0 nmol/L, with a detection limit of 38 pmol/L (3σ/slope). Moreover, five sugars had no effect on the average diameter of mixture of Oligo-AuNPs probes, GOD and Fe(2+), which demonstrated the good selectivity of the assay. PMID:23084753

  18. Improved Genome Editing Efficiency and Flexibility Using Modified Oligonucleotides with TALEN and CRISPR-Cas9 Nucleases.

    PubMed

    Renaud, Jean-Baptiste; Boix, Charlotte; Charpentier, Marine; De Cian, Anne; Cochennec, Julien; Duvernois-Berthet, Evelyne; Perrouault, Loïc; Tesson, Laurent; Edouard, Joanne; Thinard, Reynald; Cherifi, Yacine; Menoret, Séverine; Fontanière, Sandra; de Crozé, Noémie; Fraichard, Alexandre; Sohm, Frédéric; Anegon, Ignacio; Concordet, Jean-Paul; Giovannangeli, Carine

    2016-03-01

    Genome editing has now been reported in many systems using TALEN and CRISPR-Cas9 nucleases. Precise mutations can be introduced during homology-directed repair with donor DNA carrying the wanted sequence edit, but efficiency is usually lower than for gene knockout and optimal strategies have not been extensively investigated. Here, we show that using phosphorothioate-modified oligonucleotides strongly enhances genome editing efficiency of single-stranded oligonucleotide donors in cultured cells. In addition, it provides better design flexibility, allowing insertions more than 100 bp long. Despite previous reports of phosphorothioate-modified oligonucleotide toxicity, clones of edited cells are readily isolated and targeted sequence insertions are achieved in rats and mice with very high frequency, allowing for homozygous loxP site insertion at the mouse ROSA locus in particular. Finally, when detected, imprecise knockin events exhibit indels that are asymmetrically positioned, consistent with genome editing taking place by two steps of single-strand annealing. PMID:26923600

  19. Simultaneous rapid chemical synthesis of over one hundred oligonucleotides on a microscale

    PubMed Central

    Matthes, Hans W.D.; Zenke, W. Martin; Grundström, Thomas; Staub, Adrien; Wintzerith, Marguerite; Chambon, Pierre

    1984-01-01

    An inexpensive, extremely rapid manual method for simultaneous synthesis of large numbers of oligodeoxyribonucleotides on 50 or 150 nanomole scale is described. The oligonucleotides are assembled in parallel by the phosphotriester method on small cellulose paper disks in a simple gas pressure-controlled continuous-flow system. For each addition of a nucleotide the disks are sorted into four sets which are placed in four columns for addition of A, C, G and T, respectively. During one 2-week period, three rounds of synthesis by this method yielded 254 oligomers (8- to 22-mers), many of which were also purified during this time. Using 50 nanomole scale reactions the yields for 17-mers, for example, were in the range of 0.5 O.D.260 units (˜5 nmol, i.e., ˜10% yield), an amount sufficient for most purposes. The equipment required is relatively inexpensive and for the most part usually already available in molecular biology laboratories. All chemicals are commercially available and the current reagent cost per oligonucleotide (25 μg, average length 17-mer) is ˜3 US dollars. ImagesFig. 1.Fig. 3.Fig. 4.Fig. 5. PMID:16453516

  20. Crystallographic Studies of Chemically Modified Nucleic Acids: A Backward Glance

    PubMed Central

    Egli, Martin; Pallan, Pradeep S.

    2010-01-01

    Chemically modified nucleic acids (CNAs) are widely explored as antisense oligonucleotide or small interfering RNA (siRNA) candidates for therapeutic applications. CNAs are also of interest in diagnostics, high-throughput genomics and target validation, nanotechnology and as model systems in investigations directed at a better understanding of the etiology of nucleic acid structure as well as the physical-chemical and pairing properties of DNA and RNA and for probing protein-nucleic acid interactions. In this article we review research conducted by our laboratory over the past two decades with a focus on crystal structure analyses of CNAs and artificial pairing systems. We highlight key insights into issues ranging from conformational distortions as a consequence of modification to the modulation of pairing strength and RNA affinity by stereoelectronic effects and hydration. Although crystal structures have only been determined for a subset of the large number of modifications that were synthesized and analyzed in the oligonucleotide context to date, they have yielded guiding principles for the design of new analogs with tailormade properties, including pairing specificity, nuclease resistance and cellular uptake. And, perhaps less obviously, crystallographic studies of CNAs and synthetic pairing systems have shed light on fundamental aspects of DNA and RNA structure and function that would not have been disclosed by investigations solely focused on the natural nucleic acids. PMID:20087997

  1. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao

    2007-07-11

    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes. PMID:17559227

  2. 2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

    SciTech Connect

    Prhavc, M.; Prakash, T.P.; Minasov, G.; Egli, M.; Manoharan, M.

    2010-03-08

    Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

  3. Effect of dose and plasma concentration on liver uptake and pharmacologic activity of a 2'-methoxyethyl modified chimeric antisense oligonucleotide targeting PTEN.

    PubMed

    Geary, Richard S; Wancewicz, Ed; Matson, John; Pearce, Megan; Siwkowski, Andrew; Swayze, Eric; Bennett, Frank

    2009-08-01

    The role of dose and plasma concentration on liver tissue uptake and resulting antisense pharmacology using a chemically modified antisense oligonucleotide (ASO) targeting PTEN was assessed in mice. A single bolus s.c. dose of 60 mg/kg in mice showed a time-dependent reduction in liver PTEN mRNA that was maximal at 48-72 h and returned to near control levels by 20 days after administration. These pharmacodynamics are in good agreement with liver concentrations of ASO and are consistent with slow elimination (t(1/2)=8 days) of the PTEN ASO from Balb/C mouse liver. As expected, highest ASO concentrations in liver resulted from the s.c. slow infusion at all doses tested. Unexpectedly, the liver EC(50) for the 24-h s.c. slow infusion was approximately twofold higher than the two bolus routes of administration. Based on plasma concentration analysis it appears that 1-2 microg/mL ASO plasma concentration is a threshold that, if exceeded, results in robust antisense effects and below which there is reduced or complete loss of antisense pharmacology in liver even though bulk uptake in the organ is improved. Co-administration of a nonsense ASO competed for liver uptake, but unexpectedly increased pharmacodynamic response for the active oligonucleotide (ISIS 116847) supporting inhibition of a nonproductive bulk uptake pathway while simultaneously improving productive uptake (pharmacodynamics). This competition effect was similar whether the nonsense oligonucleotide was co-administered with ASO or administered up to 24 h prior to active ASO injection. PMID:19393225

  4. In vitro optimization of 2′-OMe-4′-thioribonucleoside–modified anti-microRNA oligonucleotides and its targeting delivery to mouse liver using a liposomal nanoparticle

    PubMed Central

    Takahashi, Mayumi; Yamada, Naoki; Hatakeyama, Hiroto; Murata, Manami; Sato, Yusuke; Minakawa, Noriaki; Harashima, Hideyoshi; Matsuda, Akira

    2013-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression post-transcriptionally. Previous studies, which characterized miRNA function, revealed their involvement in fundamental biological processes. Importantly, miRNA expression is deregulated in many human diseases. Specific inhibition of miRNAs using chemically modified anti-miRNA oligonucleotides (AMOs) can be a potential therapeutic strategy for diseases in which a specific miRNA is overexpressed. 2′-O-Methyl (2′-OMe)-4′-thioRNA is a hybrid type of chemically modified oligonucleotide, exhibiting high binding affinity to complementary RNAs and high resistance to nuclease degradation. Here, we evaluate 2′-OMe-4′-thioribonucleosides for chemical modification on AMOs. Optimization of the modification pattern using a variety of chemically modified AMOs that are perfectly complementary to mature miR-21 revealed that the uniformly 2′-OMe-4′-thioribonucleoside–modified AMO was most potent. Further investigation showed that phosphorothioate modification contributed to long-term miR-122 inhibition by the 2′-OMe-4′-thioribonucleoside–modified AMO. Moreover, systemically administrated AMOs to mouse using a liposomal delivery system, YSK05-MEND, showed delivery to the liver and efficient inhibition of miR-122 activity at a low dose in vivo. PMID:24030710

  5. Quartz crystal microbalance with dissipation monitoring and spectroscopic ellipsometry measurements of the phospholipid bilayer anchoring stability and kinetics of hydrophobically modified DNA oligonucleotides.

    PubMed

    van der Meulen, Stef A J; Dubacheva, Galina V; Dogterom, Marileen; Richter, Ralf P; Leunissen, Mirjam E

    2014-06-10

    Decorating lipid bilayers with oligonucleotides has great potential for both fundamental studies and applications, taking advantage of the membrane properties and the specific Watson-Crick base pairing. Here, we systematically studied the binding of DNA oligonucleotides with the frequently used hydrophobic anchors cholesterol, stearyl, and distearyl to supported lipid bilayers made of dioleoylphosphatidylcholine (DOPC) by quartz crystal microbalance with dissipation monitoring and spectroscopic ellipsometry (SE). All three anchors were found to incorporate well into DOPC lipid membranes, yet only the distearyl-based anchor remained stable in the bilayer when it was rinsed. The unstable anchoring of the cholesterol- and stearyl-based oligonucleotides can, however, be stabilized by hybridization of the oligonucleotides to complementary DNA modified with a second hydrophobic anchor of the same type. In all cases, the incorporation into the lipid bilayer was found to be limited by mass transport, although micelle formation likely reduced the effective concentration of available oligonucleotides in some samples, leading to substantial differences in binding rates. Using a viscoelastic model to determine the thickness of the DNA layer and elucidating the surface coverage by SE, we found that at equal bulk concentrations double-stranded DNA constructs attached to the lipid bilayer establish a layer that is thicker than that of single-stranded oligonucleotides, whereas the DNA surface densities are similar. Shortening the length of the oligonucleotides, on the other hand, does alter both the thickness and surface density of the DNA layer. This indicates that at the bulk oligonucleotide concentrations employed in our experiments, the packing of the oligonucleotides is not affected by the anchor type, but rather by the length of the DNA. The results are useful for material and biomedical applications that require efficient linking of oligonucleotides to lipid membranes. PMID

  6. Chemical modification of triplex-forming oligonucleotide to promote pyrimidine motif triplex formation at physiological pH.

    PubMed

    Torigoe, Hidetaka; Nakagawa, Osamu; Imanishi, Takeshi; Obika, Satoshi; Sasaki, Kiyomi

    2012-04-01

    Extreme instability of pyrimidine motif triplex DNA at physiological pH severely limits its use in wide variety of potential applications, such as artificial regulation of gene expression, mapping of genomic DNA, and gene-targeted mutagenesis in vivo. Stabilization of pyrimidine motif triplex at physiological pH is, therefore, crucial for improving its potential in various triplex-formation-based strategies in vivo. To this end, we investigated the effect of 3'-amino-2'-O,4'-C-methylene bridged nucleic acid modification of triplex-forming oligonucleotide (TFO), in which 2'-O and 4'-C of the sugar moiety were bridged with the methylene chain and 3'-O was replaced by 3'-NH, on pyrimidine motif triplex formation at physiological pH. The modification not only significantly increased the thermal stability of the triplex but also increased the binding constant of triplex formation about 15-fold. The increased magnitude of the binding constant was not significantly changed when the number and position of the modification in TFO changed. The consideration of the observed thermodynamic parameters suggested that the increased rigidity of the modified TFO in the free state resulting from the bridging of different positions of the sugar moiety with an alkyl chain and the increased hydration of the modified TFO in the free state caused by the introduction of polar nitrogen atoms may significantly increase the binding constant at physiological pH. The study on the TFO viability in human serum showed that the modification significantly increased the resistance of TFO against nuclease degradation. This study presents an effective approach for designing novel chemically modified TFOs with higher binding affinity of triplex formation at physiological pH and higher nuclease resistance under physiological condition, which may eventually lead to progress in various triplex-formation-based strategies in vivo. PMID:22245184

  7. Efficient Targeting of Fatty-Acid Modified Oligonucleotides to Live Cell Membranes through Stepwise Assembly

    PubMed Central

    2014-01-01

    Lipid modifications provide efficient targeting of oligonucleotides to live cell membranes in a range of applications. Targeting efficiency is a function of the rate of lipid DNA insertion into the cell surface and its persistence over time. Here we show that increasing lipid hydrophobicity increases membrane persistence, but decreases the rate of membrane insertion due to the formation of nonproductive aggregates in solution. To ameliorate this effect, we split the net hydrophobicity of the membrane anchor between two complementary oligonucleotides. When prehybridized in solution, doubly anchored molecules also aggregate due to their elevated hydrophobicity. However, when added sequentially to cells, aggregation does not occur so membrane insertion is efficient. Hybridization between the two strands locks the complexes at the cell surface by increasing net hydrophobicity, increasing their total concentration and lifetime, and dramatically improving their utility in a variety of biomedical applications. PMID:25325667

  8. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    PubMed Central

    Sun, Jingjing; Tang, Xinjing

    2015-01-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

  9. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sun, Jingjing; Tang, Xinjing

    2015-05-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure

  10. Chemically modified graphite for electrochemical cells

    DOEpatents

    Greinke, R.A.; Lewis, I.C.

    1998-05-26

    This invention relates to chemically modified graphite particles: (a) that are useful in alkali metal-containing electrode of a electrochemical cell comprising: (1) the electrode, (2) a non-aqueous electrolytic solution comprising an organic aprotic solvent which solvent tends to decompose when the electrochemical cell is in use, and an electrically conductive salt of an alkali metal, and (3) a counter electrode; and (b) that are chemically modified with fluorine, chlorine, iodine or phosphorus to reduce such decomposition. This invention also relates to electrodes comprising such chemically modified graphite and a binder and to electrochemical cells containing such electrodes. 3 figs.

  11. Chemically modified graphite for electrochemical cells

    DOEpatents

    Greinke, Ronald Alfred; Lewis, Irwin Charles

    1998-01-01

    This invention relates to chemically modified graphite particles: (a) that are useful in alkali metal-containing electrode of a electrochemical cell comprising: (i) the electrode, (ii) a non-aqueous electrolytic solution comprising an organic aprotic solvent which solvent tends to decompose when the electrochemical cell is in use, and an electrically conductive salt of an alkali metal, and (iii) a counterelectrode; and (b) that are chemically modified with fluorine, chlorine, iodine or phosphorus to reduce such decomposition. This invention also relates to electrodes comprising such chemically modified graphite and a binder and to electrochemical cells containing such electrodes.

  12. Invader Assisted Enzyme-Linked Immunosorbent Assay for Colorimetric Detection of Disease Biomarkers Using Oligonucleotide Probe-Modified Gold Nanoparticles.

    PubMed

    Song, Qinxin; Qi, Xiemin; Jia, Huning; He, Liang; Kumar, Shalen; Pitman, Janet L; Zou, Bingjie; Zhou, Guohua

    2016-04-01

    We successfully developed an invader assisted ELISA assay (iaELISA) for sensitive detection of disease biomarkers. The method includes three key steps as follows; biotinylated detection antibody was at first used to capture targeted antigen by sandwich ELISA. The biotinylated oligonucleotide was then attached to detection antibody via streptavidin. Finally, the cascade invader reactions were employed to amplify the biotinylated oligonucleotide specific to the antigen so that detection of the antigen was transformed into signal amplification of the antigen-specific DNA. To achieve colorimetric detection, oligonucleotide probe and modified gold nanoparticles (AuNPs) were coupled with the invader assay. Utilization of the hairpin probes in the invader reaction brought about free AuNPs, resulting in the positive read-out (red color). On the other hand, aggregation of the AuNPs occurred when the hairpin probes were not utilized in the reaction. This method was successfully used to detect as low as 2.4 x 10(-11) g/mL of HBsAg by both naked eye and spectrophotometer. This sensitivity was about 100 times higher than that of conventional ELISA method. The method was also used to assay 16 serum specimens from HBV-infected patients and 8 serum specimens from HBV-negative donors and results were in good agreement with those obtained from the conventional ELISA. As the invader assay is sensitive to one base sequence, a good specificity was also obtained by detecting other antigens like hepatitis A virus (HAV) and BSA. The method has therefore much potential for ultrasensitive and cost-effective detection of targeted proteins that have clinical importance. PMID:27301208

  13. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases.

    PubMed

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  14. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  15. Structural Basis of Duplex Thermodynamic Stability and Enhanced Nuclease Resistance of 5'-C-Methyl Pyrimidine-Modified Oligonucleotides.

    PubMed

    Kel'in, Alexander V; Zlatev, Ivan; Harp, Joel; Jayaraman, Muthusamy; Bisbe, Anna; O'Shea, Jonathan; Taneja, Nate; Manoharan, Rajar M; Khan, Saeed; Charisse, Klaus; Maier, Martin A; Egli, Martin; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2016-03-18

    Although judicious use of chemical modifications has contributed to the success of nucleic acid therapeutics, poor systemic stability remains a major hurdle. The introduction of functional groups around the phosphate backbone can enhance the nuclease resistance of oligonucleotides (ONs). Here, we report the synthesis of enantiomerically pure (R)- and (S)-5'-C-methyl (C5'-Me) substituted nucleosides and their incorporation into ONs. These modifications generally resulted in a decrease in thermal stability of oligonucleotide (ON) duplexes in a manner dependent on the stereoconfiguration at C5' with greater destabilization characteristic of (R)-epimers. Enhanced stability against snake venom phosphodiesterase resulted from modification of the 3'-end of an ON with either (R)- or (S)-C5'-Me nucleotides. The (S)-isomers with different 2'-substituents provided greater resistance against 3'-exonucleases than the corresponding (R)-isomers. Crystal structure analyses of RNA octamers with (R)- or (S)-5'-C-methyl-2'-deoxy-2'-fluorouridine [(R)- or (S)-C5'-Me-2'-FU, respectively] revealed that the stereochemical orientation of the C5'-Me and the steric effects that emanate from the alkyl substitution are the dominant determinants of thermal stability and are likely molecular origins of resistance against nucleases. X-ray and NMR structural analyses showed that the (S)-C5'-Me epimers are spatially and structurally more similar to their natural 5' nonmethylated counterparts than the corresponding (R)-epimers. PMID:26940174

  16. Microenvironmental Effect of 2'-O-(1-Pyrenylmethyl)uridine Modified Fluorescent Oligonucleotide Probes on Sensitive and Selective Detection of Target RNA.

    PubMed

    Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing

    2016-04-19

    2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (Up) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes

  17. Synthesis of selenomethylene-locked nucleic acid (SeLNA)-modified oligonucleotides by polymerases.

    PubMed

    Wheeler, Megan; Chardon, Antoine; Goubet, Astrid; Morihiro, Kunihiko; Tsan, Sze Yee; Edwards, Stacey L; Kodama, Tetsuya; Obika, Satoshi; Veedu, Rakesh N

    2012-11-18

    Enzymatic recognition of SeLNA nucleotides was investigated. KOD XL DNA polymerase was found to be an efficient enzyme in primer extension reactions. Polymerase chain reaction (PCR) amplification of SeLNA-modified DNA templates was also efficiently achieved by Phusion and KOD XL DNA polymerases. PMID:23042489

  18. Cross-linking to an interrupted polypurine sequence with a platinum-modified triplex-forming oligonucleotide.

    PubMed

    Campbell, Meghan A; Miller, Paul S

    2009-08-01

    Triplex-forming oligonucleotides (TFOs) can bind specifically to polypurine sequences in double-stranded DNA. A single interruption of this polypurine tract can greatly destabilize triplex formation. The stability of triplexes can be significantly enhanced by covalently linking the TFO to its DNA target with reactive functional groups conjugated to the TFO. Covalently cross-linked TFOs are effective inhibitors of transcription of the target DNA sequence. We have designed a TFO with a platinum-modified base that can interact with and cross-link to a cytosine interruption in the polypurine tract of a target DNA duplex. The TFO contains an N(4)-(aminoalkyl)cytosine derivatized with cis-diamminediaquaplatinum(II) or trans-diamminediaquaplatinum(II). When bound to its target, the tethered platinum of the TFO can reach across the major groove and form an adduct with the guanine N7 of the interrupting C.G base pair. The optimal tether length is five methylene groups, and cross-linking is most efficient when the tether is modified with trans-diamminediaquaplatinum(II). Cross-linking requires that the TFO is bound to its designated DNA target. Addition of cyanide to the cross-linked TFO product reversed the cross-link, behavior that is consistent with the presence of a platinum-guanine adduct. The kinetics of the cross-linking reaction were studied and the half-life of the cross-linking reaction was approximately 3 h. Our results demonstrate that platinum-conjugated TFOs can be designed to cross-link with DNA targets that contain a single pyrimidine interruption. Modifications of this type may prove useful for expanding the DNA sequences that can be targeted by TFOs and increasing the stability of the resulting triplexes. PMID:19350290

  19. Chemically modified electrodes and related solution studies

    SciTech Connect

    Elliott, C.M.

    1990-01-01

    This report briefly discusses work done in the following areas of chemically modified electrodes: Spectroscopic studies of the modes of interactions of pyridine containing ligands with metal surfaces; attempted synthesis of gem-dihalide containing polymers for attachment of Mo{sub 2}S{sub 4} clusters; Synthesis of oxo-ruthenium dimer complexes as catalysts for H{sub 2} oxidation; and, studies of porphyrin based polymers which catalyze the oxidation (oxygenation) of olefins and benzylic carbons. (JDL)

  20. Immobilization of oligonucleotides onto zirconia-modified filter paper and specific molecular recognition.

    PubMed

    Xiao, Wei; Huang, Jianguo

    2011-10-18

    A morphologically complex cellulosic substance (e.g., commercial filter paper) was employed as a substrate for DNA immobilization and successive recognition. A uniform ultrathin zirconia gel film was first deposited on each cellulose nanofiber in bulk filter paper by a facile sol-gel process. Relying on the large surface area of filter paper and the strong affinity of zirconia for the phosphate group, terminal-phosphate probe DNA was abundantly immobilized on the zirconia-modified filter paper so as to convert the composite to a biofunctional material for the sensitive and repetitive recognition of the corresponding complementary target DNA on the nanomolar level. By contrast, in spite of the viability of the immobilization of the probe DNA and the recognition of target DNA on the quartz plate, the amount of captured probe DNA or recognized target DNA on such a flat substrate was much less than that captured or recognized on filter paper, resulting in a relatively insensitive recognition event. Moreover, control experiments on bare filter paper (without a zirconia nanocoating) suggested that the zirconia gel film was essential to probe DNA immobilization and subsequent target DNA recognition. PMID:21905718

  1. Effects of Repeated Complement Activation Associated with Chronic Treatment of Cynomolgus Monkeys with 2'-O-Methoxyethyl Modified Antisense Oligonucleotide.

    PubMed

    Shen, Lijiang; Engelhardt, Jeffrey A; Hung, Gene; Yee, Jenna; Kikkawa, Rie; Matson, John; Tayefeh, Bryan; Machemer, Todd; Giclas, Patricia C; Henry, Scott P

    2016-08-01

    The effects of repeated complement activation in cynomolgus monkeys after chronic antisense oligonucleotide (ASO) treatment were evaluated by using ISIS 104838, a representative 2'-O-methoxyethyl (2'-MOE) modified ASO. The treatment was up to 9 months with a total weekly dose of 30 mg/kg, given either as daily [4.3 mg/kg/day, subcutaneous (s.c.) injection] or once weekly [30 mg/kg, either as s.c. injection or 30-min intravenous (i.v.) infusion]. Acute elevations of complement split products (Bb and C3a) and a transient decrease in C3 occurred after the first dose and were drug plasma concentration dependent. However, with repeated complement activation after chronic ASO treatment, there were progressive increases in basal (predose) levels of Bb and C3a, and a sustained C3 reduction in all treated groups. There was also a progressive increase in C3d-bound circulating immune complex (CIC) that was considered secondary to the C3 depletion. Evidence of vascular inflammation was observed, mostly in the liver, kidney, and heart, and correlated with severe C3 depletion and increases in plasma IgG and IgM. Vascular inflammation was accompanied by increased C3 and IgM immunereactivity in the affected vasculatures and endothelial activation markers in serum. In summary, repeated complement activations in monkeys lead to a sustained decrease in circulating C3 over time. The concomitantly increased inflammatory signals and decreased CIC clearance due to impairment of complement function may lead to vascular inflammation after chronic ASO treatment in monkeys. However, based on the known sensitivity of monkeys to ASO-induced complement activation, these findings have limited relevance to humans. PMID:27140858

  2. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    NASA Astrophysics Data System (ADS)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  3. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore.

    PubMed

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I. PMID:27111839

  4. Functionalization of silicon oxide using supercritical fluid deposition of 3,4-epoxybutyltrimethoxysilane for the immobilization of amino-modified oligonucleotide

    NASA Astrophysics Data System (ADS)

    Rull, Jordi; Nonglaton, Guillaume; Costa, Guillaume; Fontelaye, Caroline; Marchi-Delapierre, Caroline; Ménage, Stéphane; Marchand, Gilles

    2015-11-01

    The functionalization of silicon oxide based substrates using silanes is generally performed through liquid phase methodologies. These processes involve a huge quantity of potentially toxic solvents and present some important disadvantages for the functionalization of microdevices or porous materials, for example the low diffusion. To overcome this drawback, solvent-free methodologies like molecular vapor deposition (MVD) or supercritical fluid deposition (SFD) have been developed. In this paper, the deposition process of 3,4-epoxybutyltrimethoxysilane (EBTMOS) on silicon oxide using supercritical carbon dioxide (scCO2) as a solvent is studied for the first time. The oxirane ring of epoxy silanes readily reacts with amine group and is of particular interest for the grafting of amino-modified oligonucleotides or antibodies for diagnostic application. Then the ability of this specific EBTMOS layer to react with amine functions has been evaluated using the immobilization of amino-modified oligonucleotide probes. The presence of the probes is revealed by fluorescence using hybridization with a fluorescent target oligonucleotide. The performances of SFD of EBTMOS have been optimized and then compared with the dip coating and molecular vapor deposition methods, evidencing a better grafting efficiency and homogeneity, a lower reaction time in addition to the eco-friendly properties of the supercritical carbon dioxide. The epoxysilane layers have been characterized by surface enhanced ellipsometric contrast optical technique, atomic force microscopy, multiple internal reflection infrared spectroscopy and X-ray photoelectron spectroscopy. The shelf life of the 3,4-epoxybutyltrimethoxysilane coating layer has also been studied. Finally, two different strategies of NH2-oligonucleotide grafting on EBTMOS coating layer have been compared, i.e. reductive amination and nucleophilic substitution, SN2. This EBTMOS based coating layer can be used for a wide range of applications

  5. Polycationic ligands of different chemical classes stimulate DNA strand displacement between short oligonucleotides in a protein-free system.

    PubMed

    Volodin, Alexander A; Bocharova, Tatiana N; Smirnova, Elena A

    2016-09-01

    The ability of polycationic ligands to stimulate DNA strand displacement between short oligonucleotides in a protein-free system is demonstrated. We show that two ligands, tetracationic aliphatic amine (spermine) and a dicationic intercalating drug (chloroquine), promote strand displacement in a concentration-dependent manner. At low concentrations both ligands decelerate spontaneous strand displacement because of their impact on the stability of the DNA duplex. At elevated concentrations they accelerate strand displacement via formation of intermediate structures containing three DNA strands. The rate of the last process does not correlate with the thermal dissociation rate of the entire DNA duplex. It indicates that, possibly, the action of these agents cannot be explained by their influence on the stability of the DNA duplex. In general, our results suggest that the ability to stimulate DNA strand displacement appears to be a common feature of polycations of different chemical and structural classes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 633-641, 2016. PMID:27106951

  6. Stability measurements of antisense oligonucleotides by capillary gel electrophoresis.

    PubMed

    Bruin, G J; Börnsen, K O; Hüsken, D; Gassmann, E; Widmer, H M; Paulus, A

    1995-08-11

    The approach of using antisense oligonucleotides as potential drugs is based on hybridization of a short chemically-modified oligonucleotide with complementary cellular DNA or RNA sequences. A critical question is the stability of chemically modified antisense oligonucleotides in cellular environments. In a model system, resistance against various nucleases was evaluated by capillary gel electrophoresis (CGE). For some of the samples, matrix assisted laser desorption and ionization mass spectrometry (MALDI-MS) was used as an additional analytical tool to perform stability measurements. Using CGE, the enzymatic degradation of single nucleotides from the oligomer can be followed after different incubation times. 10% T polyacrylamide gels give baseline resolution for oligonucleotides ranging between 5 and 30 bases in length. The kinetic influence of a specific nuclease concentration and the antisense oligonucleotide structure on the cleavage reaction are discussed. Also, a simple desalting method to improve the injection efficiency and sensitivity of the method are described. Examples of measurements of chemically modified antisense 19-mers are presented. PMID:7581844

  7. Chemically modified carbonic anhydrases useful in carbon capture systems

    SciTech Connect

    Novick, Scott; Alvizo, Oscar

    2013-01-15

    The present disclosure relates to chemically modified carbonic anhydrase polypeptides and soluble compositions, homogenous liquid formulations comprising them. The chemically modified carbonic anhydrase polypeptides have improved properties relative to the same carbonic anhydrase polypeptide that is not chemically modified including the improved properties of increased activity and/or stability in the presence of amine compounds, ammonia, or carbonate ion. The present disclosure also provides methods of preparing the chemically modified polypeptides and methods of using the chemically modified polypeptides for accelerating the absorption of carbon dioxide from a gas stream into a solution as well as for the release of the absorbed carbon dioxide for further treatment and/or sequestering.

  8. Antitumor activity of chemical modified natural compounds.

    PubMed

    de Oliveira, M M

    1991-01-01

    Search of new activity substances starting from chemotherapeutic agents, continuously appears in international literature. Perhaps this search has been done more frequently in the field of antitumor chemotherapy on account of the unsuccess in saving advanced stage patients. The new point in this matter during the last decade was computer aid in planning more rational drugs. In near future "the accessibility of super computers and emergence of computer net systems, will open new avenues to rational drug design" (Portoghese, P. S., J. Med. Chem. 1989, 32, 1). Unknown pharmacological active compounds synthetized by plants can be found even without this electronic devices, as traditional medicine has pointed out in many countries, and give rise to a new drug. These compounds used as found in nature or after chemical modifications have produced successful experimental medicaments as FAA, "flavone acetic acid" with good results as inhibitors of slow growing animal tumors currently in preclinical evaluation for human treatment. In this lecture some international contributions in the field of chemical modified compounds as antineoplastic drugs will be examined, particularly those done by Brazilian researches. PMID:1842015

  9. Fluorescent oligonucleotides can serve as suitable alternatives to radiolabeled oligonucleotides.

    PubMed

    Ballal, Rahul; Cheema, Amrita; Ahmad, Waaqar; Rosen, Eliot M; Saha, Tapas

    2009-09-01

    Prolonged exposure to radiation from radionuclei used in medical research can cause DNA damage and mutation, which lead to several diseases including cancer. Radioactivity-based experiments are expensive and associated with specialized training, dedication of instruments, approvals, and cleanup with potential hazardous waste. The objective of this study was to find an alternative to the use of radioactivity in medical research using nucleic acid chemistry. FITC-labeled oligonucleotides that contain wild-type (wt) and modified base (8-oxo-G) at the same position and their complementary unlabeled strand were synthesized. Purified DNA repair enzyme, OGG1, and nuclear lysates from MCF-7 breast cancer cells were incubated with double-stranded FITC-labeled wt and 8-oxo-G oligonucleotide to demonstrate the OGG1 incision assay. We found that FITC-coupled oligonucleotides do not impose a steric hindrance during duplex formation, and the fluorescence intensity of the oligonucleotide is comparable with the intensity of the radioactive oligonucleotide. Moreover, we have seen that the OGG1 incision assay can be performed using these fluorescence oligonucleotides, replacing conventional use of radiolabeled oligonucleotides in the assay. Although the use of fluorescent-labeled oligonucleotides was described in detail for incision assays, the technique can be applied to replace a broad range of experiments, where radioactive oligonucleotides are used, eliminating the hazardous consequences of radiation. PMID:19721820

  10. Chemically modified flexible strips as electrochemical biosensors.

    PubMed

    Thota, Raju; Ganesh, V

    2014-09-21

    A flexible and disposable strip sensor for non-enzymatic glucose detection is demonstrated in this work. The strips are prepared by using chemical modification processes followed by a simple electroless deposition of copper. Essentially, polyester overhead projector (OHP) transparent films are modified with a monolayer of 3-aminopropyltrimethoxysilane (APTMS) and polyaniline (PANI) conducting polymer. Later, nanostructured copper is deposited onto this modified film. Scanning electron microscope (SEM) and X-ray diffraction (XRD) studies are used for the structural, morphological and crystallinity characterization of the modified films. Electrochemical techniques, namely cyclic voltammetry (CV) and chronoamperometry (CA), are employed for the non-enzymatic detection of glucose. These studies clearly reveal the formation of homogeneous, close-packed spherical Cu particles converged into uniform film that exhibits a good catalytic activity towards the oxidation of glucose. The Cu/PANI/APTMS/OHP sensor displays a remarkable enhancement in the oxidation current density, a very high sensitivity value of 2.8456 mA cm(-2) per mM, and a linear concentration range from 100 μM to 6.5 mM associated with glucose detection. Detection limit is estimated to be 5 μM and the response time of the sensor is determined to be less than 5 s. For comparison, similar studies are performed without PANI, namely Cu/APTMS/OHP films for glucose detection. In this case, a sensitivity value of 2.4457 mA cm(-2) per mM and a linear concentration range of 100 μM-3 mM are estimated. The higher performance characteristics observed in the case of Cu/PANI/APTMS/OHP are attributed to the synergistic effects of the conducting polymer acting as an electron facilitator and the nanostructured Cu films. These disposable, flexible and low-cost strip sensors have also been applied to the detection of glucose in clinical blood serum samples and the results obtained agree very well with the actual glucose

  11. Double-stranded DNA-templated cleavage of oligonucleotides containing a P3'->N5' linkage triggered by triplex formation: the effects of chemical modifications and remarkable enhancement in reactivity.

    PubMed

    Ito, Kosuke Ramon; Kodama, Tetsuya; Tomizu, Masaharu; Negoro, Yoshinori; Orita, Ayako; Osaki, Tomohisa; Hosoki, Noritsugu; Tanaka, Takaya; Imanishi, Takeshi; Obika, Satoshi

    2010-11-01

    We recently reported double-stranded DNA-templated cleavage of oligonucleotides as a sequence-specific DNA-detecting method. In this method, triplex-forming oligonucleotides (TFOs) modified with 5'-amino-2',4'-BNA were used as a DNA-detecting probe. This modification introduced a P3'→N5' linkage (P-N linkage) in the backbone of the TFO, which was quickly cleaved under acidic conditions when it formed a triplex. The prompt fission of the P-N linkage was assumed to be driven by a conformational strain placed on the linkage upon triplex formation. Therefore, chemical modifications around the P-N linkage should change the reactivity by altering the microenvironment. We synthesized 5'-aminomethyl type nucleic acids, and incorporated them into TFOs instead of 5'-amino-2',4'-BNA to investigate the effect of 5'-elongation. In addition, 2',4'-BNA/LNA or 2',5'-linked DNA were introduced at the 3'- and/or 5'-neighboring residues of 5'-amino-2',4'-BNA to reveal neighboring residual effects. We evaluated the triplex stability and reaction properties of these TFOs, and found out that chemical modifications around the P-N linkage greatly affected their reaction properties. Notably, 2',5'-linked DNA at the 3' position flanking 5'-amino-2',4'-BNA brought significantly higher reactivity, and we succeeded in indicating that a TFO with this modification is promising as a DNA analysis tool. PMID:20615902

  12. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  13. Synthesis, improved antisense activity and structural rationale for the divergent RNA affinities of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides.

    PubMed

    Egli, Martin; Pallan, Pradeep S; Allerson, Charles R; Prakash, Thazha P; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E; Seth, Punit P

    2011-10-19

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F···H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py)···H-C(Pu) pseudo hydrogen bonds in nucleic acid structures. PMID:21919455

  14. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    SciTech Connect

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2012-03-16

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

  15. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  16. Chemically Modifying Viruses for Diverse Applications.

    PubMed

    Mohan, Kritika; Weiss, Gregory A

    2016-05-20

    Long fascinating to biologists, viruses offer nanometer-scale benchtops for building molecular-scale devices and materials. Viruses tolerate a wide range of chemical modifications including reaction conditions, pH values, and temperatures. Recent examples of nongenetic manipulation of viral surfaces have extended viruses into applications ranging from biomedical imaging, drug delivery, tissue regeneration, and biosensors to materials for catalysis and energy generation. Chemical reactions on the phage surface include both covalent and noncovalent modifications, including some applied in conjunction with genetic modifications. Here, we survey viruses chemically augmented with capabilities limited only by imagination. PMID:26930417

  17. Chemical and semisynthesis of modified histones.

    PubMed

    Maity, Suman Kumar; Jbara, Muhammad; Brik, Ashraf

    2016-05-01

    Post-translational modifications (PTMs) of histones play critical roles in the epigenetic regulation of eukaryotic genome by directly altering the biophysical properties of chromatin or by recruiting effector proteins. The large number of PTMs and the inherent complexity in their population and signaling processes make it highly challenging to understand epigenetics-related processes. To address these challenges, accesses to homogeneously modified histones are obligatory. Over the last decade, synthetic protein chemists have been devising novel synthetic tools and applying state-of-the-art chemoselective ligation strategies to prepare precious materials useful in answering fundamental questions in this area. In this short review, we cover some of the recent breakthroughs in these directions in particular the synthesis and semi-synthesis of modified histones and their use to unravel the mysteries of epigenetics. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. PMID:26778211

  18. Development of a Method for Profiling Protein Interactions with LNA-Modified Antisense Oligonucleotides Using Protein Microarrays.

    PubMed

    Kakiuchi-Kiyota, Satoko; Whiteley, Lawrence O; Ryan, Anne M; Mathialagan, Nagappan

    2016-04-01

    Development of locked nucleic acid (LNA) gapmers, antisense oligonucleotides used for efficient inhibition of target RNA expression, is limited by nontarget-mediated hepatotoxicity. Increased binding of hepatocellular proteins to toxic LNA gapmers may be one of the mechanisms contributing to LNA gapmer-induced hepatotoxicity in vivo. In the present study, we investigated the protein binding propensity of nontoxic sequence-1 (NTS-1), toxic sequence-2 (TS-2), and severely highly toxic sequence-3 (HTS-3) LNA gapmers using human protein microarrays. We previously demonstrated by the transcription profiling analysis of liver RNA isolated from mice that TS-2 and HTS-3 gapmers modulate different transcriptional pathways in mice leading to hepatotoxicity. Our protein array profiling demonstrated that a greater number of proteins, including ones associated with hepatotoxicity, hepatic system disorder, and cell functions, were bound by TS-2 and HTS-3 compared with NTS-1. However, the profiles of proteins bound by TS-2 and HTS-3 were similar and did not distinguish proteins contributing to severe in vivo toxicity. These results, together with the previous transcription profiling analysis, indicate that the combination of sequence-dependent transcription modulation and increased protein binding of toxic LNA gapmers contributes to hepatotoxicity. PMID:26643897

  19. Cytokines and therapeutic oligonucleotides.

    PubMed

    Hartmann, G; Bidlingmaier, M; Eigler, A; Hacker, U; Endres, S

    1997-12-01

    Therapeutic oligonucleotides - short strands of synthetic nucleic acids - encompass antisense and aptamer oligonucleotides. Antisense oligonucleotides are designed to bind to target RNA by complementary base pairing and to inhibit translation of the target protein. Antisense oligonucleotides enable specific inhibition of cytokine synthesis. In contrast, aptamer oligonucleotides are able to bind directly to specific proteins. This binding depends on the sequence of the oligonucleotide. Aptamer oligonucleotides with CpG motifs can exert strong immunostimulatory effects. Both kinds of therapeutic oligonucleotides - antisense and aptamer oligonucleotides - provide promising tools to modulate immunological functions. Recently, therapeutic oligonucleotides have moved towards clinical application. An antisense oligonucleotide directed against the proinflammatory intercellular adhesion molecule 1 (ICAM-1) is currently being tested in clinical trials for therapy of inflammatory disease. Immunostimulatory aptamer oligonucleotides are in preclinical development for immunotherapy. In the present review we summarize the application of therapeutic oligonucleotides to modulate immunological functions. We include technological aspects as well as current therapeutic concepts and clinical studies. PMID:9740353

  20. Chemically modified primers for improved multiplex PCR

    PubMed Central

    Shum, Jonathan; Paul, Natasha

    2009-01-01

    Multiplexed PCR, the amplification of multiple targets in a single reaction, presents a new set of challenges that further complicate more traditional PCR set-ups. These complications include a greater probability for non-specific amplicon formation and for imbalanced amplification of different targets, each of which can compromise quantification and detection of multiple targets. Despite these difficulties, multiplex PCR is frequently used in such applications as pathogen detection, RNA quantification, mutation analysis and now, next generation DNA sequencing. Herein, we investigate the utility of primers with one or two thermolabile 4-oxo-1-pentyl phosphotriester modifications in improving multiplex PCR performance. Initial endpoint and real-time analyses reveal a decrease in off-target amplification and subsequent increase in amplicon yield. Furthermore, the use of modified primers in multiplex set-ups revealed a greater limit of detection and more uniform amplification of each target as compared to unmodified primers. Overall, the thermolabile modified primers present a novel and exciting avenue in improving multiplex PCR performance. PMID:19258004

  1. Biopolymer synthesis on polypropylene supports. I. Oligonucleotides.

    PubMed

    Matson, R S; Rampal, J B; Coassin, P J

    1994-03-01

    We have modified polypropylene to serve as a new solid-phase support for oligonucleotide synthesis. The plastic is first surface aminated by exposure to an ammonia plasma generated by radiofrequency plasma discharge. The aminated polypropylene has been found to be useful as a support for the in situ synthesis of oligonucleotides from monomers. Furthermore, oligonucleotides synthesized on the surface of the plastic remain attached following deprotection and can be used directly for hybridization. PMID:8203760

  2. Effects of Chemically Modified Messenger RNA on Protein Expression.

    PubMed

    Li, Bin; Luo, Xiao; Dong, Yizhou

    2016-03-16

    Chemically modified nucleotides play significant roles in the effectiveness of mRNA translation. Here, we describe the synthesis of two sets of chemically modified mRNAs [encoding firefly Luciferase (FLuc) and enhanced green fluorescent protein (eGFP), respectively], evaluation of protein expression, and correlation analysis of expression level under various conditions. The results indicate that chemical modifications of mRNAs are able to significantly improve protein expression, which is dependent on cell types and coding sequences. Moreover, eGFP mRNAs with N1-methylpseudouridine (me(1)ψ), 5-methoxyuridine (5moU), and pseudouridine (ψ) modifications ranked top three in cell lines tested. Interestingly, 5moU-modified eGFP mRNA was more stable than other eGFP mRNAs. Consequently, me(1)ψ, 5moU, and ψ are promising nucleotides for chemical modification of mRNAs. PMID:26906521

  3. Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.

    PubMed

    Smith, T H; LaTour, J V; Bochkariov, D; Chaga, G; Nelson, P S

    1999-01-01

    The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored. PMID:10411463

  4. Nature of the chemical reaction for furfural modified asphalt

    SciTech Connect

    Memon, G.M.; Chollar, B.H.

    1994-12-31

    Three of the most serious problems of asphalt pavements today are rutting, cracking, and susceptibility to moisture damage (stripping). Asphalt manufacturers have been mixing asphalts with polymers to produce polymer-modified asphalts with improved rheological properties. However, the costs for these improved polymer-modified asphalts are almost double that of regular asphalts. FHWA researchers have found that asphalt modified by the chemical, furfural (which is prepared by simple elimination reaction of aldopentoses obtained from oat hulls), exhibited better stripping properties and was less temperature susceptible than the virgin asphalt while costing less than polymer-modified asphalts. This paper discusses the possible structure of the furfural-modified asphalt, data for the virgin and furfural-modified asphalts and their Corbett fractions, data from a model reaction between phenol and furfural, and a possible explanation of this structure based on these data.

  5. Identification and characterization of modified antisense oligonucleotides targeting DMPK in mice and nonhuman primates for the treatment of myotonic dystrophy type 1.

    PubMed

    Pandey, Sanjay K; Wheeler, Thurman M; Justice, Samantha L; Kim, Aneeza; Younis, Husam S; Gattis, Danielle; Jauvin, Dominic; Puymirat, Jack; Swayze, Eric E; Freier, Susan M; Bennett, C Frank; Thornton, Charles A; MacLeod, A Robert

    2015-11-01

    Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy in adults. DM1 is caused by an expanded CTG repeat in the 3'-untranslated region of DMPK, the gene encoding dystrophia myotonica protein kinase (DMPK). Antisense oligonucleotides (ASOs) containing 2',4'-constrained ethyl-modified (cEt) residues exhibit a significantly increased RNA binding affinity and in vivo potency relative to those modified with other 2'-chemistries, which we speculated could translate to enhanced activity in extrahepatic tissues, such as muscle. Here, we describe the design and characterization of a cEt gapmer DMPK ASO (ISIS 486178), with potent activity in vitro and in vivo against mouse, monkey, and human DMPK. Systemic delivery of unformulated ISIS 486718 to wild-type mice decreased DMPK mRNA levels by up to 90% in liver and skeletal muscle. Similarly, treatment of either human DMPK transgenic mice or cynomolgus monkeys with ISIS 486178 led to up to 70% inhibition of DMPK in multiple skeletal muscles and ∼50% in cardiac muscle in both species. Importantly, inhibition of DMPK was well tolerated and was not associated with any skeletal muscle or cardiac toxicity. Also interesting was the demonstration that the inhibition of DMPK mRNA levels in muscle was maintained for up to 16 and 13 weeks post-treatment in mice and monkeys, respectively. These results demonstrate that cEt-modified ASOs show potent activity in skeletal muscle, and that this attractive therapeutic approach warrants further clinical investigation to inhibit the gain-of-function toxic RNA underlying the pathogenesis of DM1. PMID:26330536

  6. Double-stranded DNA-templated cleavage of oligonucleotides containing a P3′→N5′ linkage triggered by triplex formation: the effects of chemical modifications and remarkable enhancement in reactivity

    PubMed Central

    Ito, Kosuke Ramon; Kodama, Tetsuya; Tomizu, Masaharu; Negoro, Yoshinori; Orita, Ayako; Osaki, Tomohisa; Hosoki, Noritsugu; Tanaka, Takaya; Imanishi, Takeshi; Obika, Satoshi

    2010-01-01

    We recently reported double-stranded DNA-templated cleavage of oligonucleotides as a sequence-specific DNA-detecting method. In this method, triplex-forming oligonucleotides (TFOs) modified with 5′-amino-2′,4′-BNA were used as a DNA-detecting probe. This modification introduced a P3′→N5′ linkage (P–N linkage) in the backbone of the TFO, which was quickly cleaved under acidic conditions when it formed a triplex. The prompt fission of the P–N linkage was assumed to be driven by a conformational strain placed on the linkage upon triplex formation. Therefore, chemical modifications around the P–N linkage should change the reactivity by altering the microenvironment. We synthesized 5′-aminomethyl type nucleic acids, and incorporated them into TFOs instead of 5′-amino-2′,4′-BNA to investigate the effect of 5′-elongation. In addition, 2′,4′-BNA/LNA or 2′,5′-linked DNA were introduced at the 3′- and/or 5′-neighboring residues of 5′-amino-2′,4′-BNA to reveal neighboring residual effects. We evaluated the triplex stability and reaction properties of these TFOs, and found out that chemical modifications around the P–N linkage greatly affected their reaction properties. Notably, 2′,5′-linked DNA at the 3′ position flanking 5′-amino-2′,4′-BNA brought significantly higher reactivity, and we succeeded in indicating that a TFO with this modification is promising as a DNA analysis tool. PMID:20615902

  7. Stabilin-1 and Stabilin-2 are specific receptors for the cellular internalization of phosphorothioate-modified antisense oligonucleotides (ASOs) in the liver

    PubMed Central

    Miller, Colton M.; Donner, Aaron J.; Blank, Emma E.; Egger, Andrew W.; Kellar, Brianna M.; Østergaard, Michael E.; Seth, Punit P.; Harris, Edward N.

    2016-01-01

    Phosphorothioate (PS)-modified antisense oligonucleotides (ASOs) have been extensively investigated over the past three decades as pharmacological and therapeutic agents. One second generation ASO, Kynamro™, was recently approved by the FDA for the treatment of homozygous familial hypercholesterolemia and over 35 second generation PS ASOs are at various stages of clinical development. In this report, we show that the Stabilin class of scavenger receptors, which were not previously thought to bind DNA, do bind and internalize PS ASOs. With the use of primary cells from mouse and rat livers and recombinant cell lines each expressing Stabilin-1 and each isoform of Stabilin-2 (315-HARE and 190-HARE), we have determined that PS ASOs bind with high affinity and these receptors are responsible for bulk, clathrin-mediated endocytosis within the cell. Binding is primarily dependent on salt-bridge formation and correct folding of the intact protein receptor. Increased internalization rates also enhanced ASO potency for reducing expression of the non-coding RNA Malat-1, in Stabilin-expressing cell lines. A more thorough understanding of mechanisms by which ASOs are internalized in cells and their intracellular trafficking pathways will aid in the design of next generation antisense agents with improved therapeutic properties. PMID:26908652

  8. Molecular Dynamics Investigations of the Local Structural Characteristics of DNA Oligonucleotides: Studies of Helical Axis Deformations, Conformational Sequence Dependence and Modified Nucleoside Perturbations.

    NASA Astrophysics Data System (ADS)

    Louise-May, Shirley

    The present DNA studies investigate the local structure of DNA oligonucleotides in order to characterize helical axis deformations, sequence dependent fine structure and modified nucleoside perturbations of selected oligonucleotide sequences. The molecular dynamics method is used to generate an ensemble of energetically feasible DNA conformations which can then be analyzed for dynamical conformational properties, some of which can be compared to experimentally derived values. A theory and graphical presentation for the analysis of helical deformations of DNA based on the configurational statistics of polymers, called "Persistence Analysis", was designed. The results of the analysis on prototype forms, static crystal structures and two solvated MD simulations of the sequence d(CGCGAATTCGCG) indicate that all of the expected features of bending can be sensitively and systematically identified by this approach. Comparison of the relative performance of three molecular dynamics potential functions commonly used for dynamical modeling of biological macromolecules; CHARMm, AMBER and GROMOS was investigated via in vacuo MD simulations on the dodecamer sequence d(CGCGAATTCGCG)_2 with respect to the conformational properties of each dynamical model and their ability to support A and B families of DNA. Vacuum molecular dynamics simulations using the CHARMm force field carried out on simple homo- and heteropolymers of DNA led to the conclusion that sequence dependent fine structure appears to be well defined for adenine-thymine rich sequences both at the base pair and base step level whereas much of the the fine structure found in cytosine -guanine rich sequences appears to be context dependent. The local conformational properties of the homopolymer poly (dA) -poly (dT) revealed one dynamical model which was found in general agreement with fiber models currently available. Investigation of the relative structural static and dynamical effect of the misincorporation of

  9. Modified H5 real-time reverse transcriptase-PCR oligonucleotides for detection of divergent avian influenza H5N1 viruses in Egypt.

    PubMed

    Abdelwhab, E M; Abdelwhab, El-Sayed M; Arafa, Abdel-Satar; Erfan, Ahmed M; Aly, Mona M; Hafez, Hafez M

    2010-12-01

    The efforts exerted to prevent circulation of highly pathogenic avian influenza (HPAI) H5N1 virus in birds are the best way to prevent the emergence of a new virus subtype with pandemic potential. Despite the blanket vaccination strategy against HPAI H5N1 in Egypt, continuous circulation of the virus in poultry has increased since late 2007 as a result of the presence of genetic and antigenic distinct variant strains that have escaped during the immune response of vaccinated birds. Although the suspected poultry flocks have had signs and lesions commonly seen in HPAI H5N1-infected birds, escape of variant strains from detection by real-time reverse transcriptase-PCR (RRT-PCR) was observed. Sequence analysis of these variants revealed multiple single nucleotide substitutions in the primers and probe target sequences of the H5 gene by real-time RT-PCR. This study describes the results of RRT-PCR, modified from an existing protocol with regard to the detection of the partial H5 gene segment of the Egyptian H5N1 divergent viruses and applied to nationwide surveillance. The modified RRT-PCR assay was more sensitive than the original one in the detection of Egyptian isolates, with 104% amplification efficiency. Sixty-one field samples were found to be positive in our assay, but only 51 samples tested positive by the original protocol and were more sensitive than matrix gene RRT-PCR detection assay. A detection limit of 10 mean embryo infective dose (EID50) with the updated oligonucleotides primers and probe set was found. For the foreseeable future, mutation of H5N1 viruses and the endemic situation in developing countries require continuous improvement of current diagnostics to aid in the containment of the H5N1 virus in poultry sectors and to lower the threat of influenza virus spread. PMID:21313854

  10. Styrene oxide DNA adducts: in vitro reaction and sensitive detection of modified oligonucleotides using capillary zone electrophoresis interfaced to electrospray mass spectrometry.

    PubMed

    Schrader, W; Linscheid, M

    1997-01-01

    Styrene is one of the most important synthetic chemicals in the world and is subject to investigations concerning carcinogenicity and mutagenicity due to the active metabolite, styrene-7,8-oxide. This epoxide shows a tendency to react, among others, with DNA and DNA constituents. The in vitro reaction of styrene oxide with DNA was investigated by cleaving incubated calf thymus DNA with two different enzymes, namely Benzonase and alkaline phosphatase, to obtain oligonucleotides of the type n-nucleotide-(n-1)-phosphate with chain length from 2 to 8 bases. Alkylated and nonalkylated nucleotides were separated in groups according to their chain length using capillary zone electrophoresis and were detected with electrospray mass spectrometry. This improvement in sensitivity made it possible to obtain new information about the reaction of styrene oxide with DNA, especially to detect unknown reaction products. The results indicate that primarily purine bases were alkylated by styrene oxide before pyrimidine bases, which react with higher concentrations of styrene oxide. This means that in addition to the already reported adducts in DNA at the N-7-, O6- and N2-position of guanine also adducts at the nucleophilic sites of adenine can be found using mass spectrometry. We anticipate for the future this procedure will allow us to investigate base sequence specific reactions as well as interactions from xenobiotics and cytostatic drugs, since reaction products would directly be detectable. PMID:9285042

  11. Modified NASA-Lewis chemical equilibrium code for MHD applications

    NASA Technical Reports Server (NTRS)

    Sacks, R. A.; Geyer, H. K.; Grammel, S. J.; Doss, E. D.

    1979-01-01

    A substantially modified version of the NASA-Lewis Chemical Equilibrium Code was recently developed. The modifications were designed to extend the power and convenience of the Code as a tool for performing combustor analysis for MHD systems studies. The effect of the programming details is described from a user point of view.

  12. A new general approach for the simultaneous chemical synthesis of large numbers of oligonucleotides: segmental solid supports.

    PubMed Central

    Frank, R; Heikens, W; Heisterberg-Moutsis, G; Blöcker, H

    1983-01-01

    A new approach is described which will allow the simultaneous synthesis of large numbers of pre-defined oligonucleotide chains. No machine aid is needed. The simultaneous syntheses can be performed by one person and do not require much more time than is currently needed for the synthesis of just one oligonucleotide in existing strategies. The general idea is the following: One uses noninterchangeable polymeric entities from each of which enough OD units can be isolated after completion of the syntheses. Whenever growing chains on different entities have to be elongated with the same building block these entities are gathered in the same reaction vessel. After such a common reaction cycle the entities are separated and now combined according to the next common building blocks etc. The practicability of this approach is demonstrated by the synthesis of d(T-A-A-T-A-T-T-A) and d(T-A-G-T-A-C-T-A) on cellulose filter disks following the phosphotriester approach. Images PMID:6306587

  13. Lubricant base stock potential of chemically modified vegetable oils.

    PubMed

    Erhan, Sevim Z; Sharma, Brajendra K; Liu, Zengshe; Adhvaryu, Atanu

    2008-10-01

    The environment must be protected against pollution caused by lubricants based on petroleum oils. The pollution problem is so severe that approximately 50% of all lubricants sold worldwide end up in the environment via volatility, spills, or total loss applications. This threat to the environment can be avoided by either preventing undesirable losses, reclaiming and recycling mineral oil lubricants, or using environmentally friendly lubricants. Vegetable oils are recognized as rapidly biodegradable and are thus promising candidates as base fluids in environment friendly lubricants. Lubricants based on vegetable oils display excellent tribological properties, high viscosity indices, and flash points. To compete with mineral-oil-based lubricants, some of their inherent disadvantages, such as poor oxidation and low-temperature stability, must be corrected. One way to address these problems is chemical modification of vegetable oils at the sites of unsaturation. After a one-step chemical modification, the chemically modified soybean oil derivatives were studied for thermo-oxidative stability using pressurized differential scanning calorimetry and a thin-film micro-oxidation test, low-temperature fluid properties using pour-point measurements, and friction-wear properties using four-ball and ball-on-disk configurations. The lubricants formulated with chemically modified soybean oil derivatives exhibit superior low-temperature flow properties, improved thermo-oxidative stability, and better friction and wear properties. The chemically modified soybean oil derivatives having diester substitution at the sites of unsaturation have potential in the formulation of industrial lubricants. PMID:18783238

  14. Polymer materials as modified optical fiber cladding for chemical sensors

    NASA Astrophysics Data System (ADS)

    Yuan, Jianming

    An intrinsic fiber optic chemical sensor has been designed and developed by using a polymer material as a modified fiber cladding. The sensor is constructed by replacing a certain portion of the original cladding with a chemically sensitive material, specifically, polyaniline or polypyrrole. Both the light absorption coefficient and the refractive index of the polymers change upon the exposure to different chemical vapors. These changes induce the optical intensity modulation of the fiber optic sensor. Polyaniline or polypyrrole is coated as the modified cladding by either spin-cast or in-situ deposition method for sensing HCl, NH3, H 2O2, and H4N2 vapors. All sensors show rapid and strong response to the chemical vapors. Thus, these sensors demonstrate that polyaniline and polypyrrole are viable candidate materials for the detection of volatile toxic gases. Sensors exhibit better performance when correct parameters, such as modification area, in-situ deposition time, and spin-rate, are used in the cladding modification process. The reversibility of the sensor depends on the reaction between the modified cladding material and the chemical vapors. Polyaniline cladding has better reversibility than polypyrrole. The optimized sensor response and sensitivity can be achieved by selecting an incident light with suitable wavelength, power, and incident angle.

  15. Intercalator conjugates of pyrimidine locked nucleic acid-modified triplex-forming oligonucleotides: improving DNA binding properties and reaching cellular activities

    PubMed Central

    Brunet, Erika; Corgnali, Maddalena; Perrouault, Loïc; Roig, Victoria; Asseline, Ulysse; Sørensen, Mads D.; Babu, B. Ravindra; Wengel, Jesper; Giovannangeli, Carine

    2005-01-01

    Triplex-forming oligonucleotides (TFOs) are powerful tools to interfere sequence-specifically with DNA-associated biological functions. (A/T,G)-containing TFOs are more commonly used in cells than (T,C)-containing TFOs, especially C-rich sequences; indeed the low intracellular stability of the non-covalent pyrimidine triplexes make the latter less active. In this work we studied the possibility to enhance DNA binding of (T,C)-containing TFOs, aiming to reach cellular activities; to this end, we used locked nucleic acid-modified TFOs (TFO/LNAs) in association with 5′-conjugation of an intercalating agent, an acridine derivative. In vitro a stable triplex was formed with the TFO-acridine conjugate: by SPR measurements at 37°C and neutral pH, the dissociation equilibrium constant was found in the nanomolar range and the triplex half-life ∼10 h (50-fold longer compared with the unconjugated TFO/LNA). Moreover to further understand DNA binding of (T,C)-containing TFO/LNAs, hybridization studies were performed at different pH values: triplex stabilization associated with pH decrease was mainly due to a slower dissociation process. Finally, biological activity of pyrimidine TFO/LNAs was evaluated in a cellular context: it occurred at concentrations ∼0.1 μM for acridine-conjugated TFO/LNA (or ∼2 μM for the unconjugated TFO/LNA) whereas the corresponding phosphodiester TFO was inactive, and it was demonstrated to be triplex-mediated. PMID:16049028

  16. Furan-modified oligonucleotides for fast, high-yielding and site-selective DNA inter-strand cross-linking with non-modified complements†

    PubMed Central

    Stevens, Kristof; Madder, Annemieke

    2009-01-01

    Among the various types of DNA damage, inter-strand cross-links (ICL) represent one of the most cytotoxic lesions. Processes such as transcription and replication can be fully blocked by ICLs, as shown by the mechanism of action of some anticancer drugs. However, repair of ICLs can be a possible cause of resistance. To study the mechanisms of cross-link repair stable, site-specifically cross-linked duplexes are needed. We here report on the synthesis of site-specifically cross-linked DNA using an acyclic furan containing nucleoside. Selective in situ oxidation of the incorporated furan moiety generates a highly reactive oxo-enal that instantly reacts with the complementary base in a non-modified strand, yielding one specific stable cross-linked duplex species. Varying sequence context showed that a strong selectivity for cross-linking to either complementary A or complementary C is operating, without formation of cross-links to neighboring or distant bases. Reaction times are very short and high isolated yields are obtained using only one equivalent of modified strand. The formed covalent link is stable and the isolated cross-linked duplexes can be stored for several months without degradation. Structural characterization of the obtained ICL was possible by comparison to the natural mutagenic adducts of cis-2-butene-1,4-dial, a metabolite of furan primarily responsible for furan carcinogenicity. PMID:19151089

  17. Design and Application of an Easy to Use Oligonucleotide Mass Calculation Program

    NASA Astrophysics Data System (ADS)

    Yang, Jiong; Leopold, Peter; Helmy, Roy; Parish, Craig; Arvary, Becky; Mao, Bing; Meng, Fanyu

    2013-08-01

    With the development of new synthesis procedures, an ever increasing number of chemical modifications can now be incorporated into synthetic oligonucleotides, representing new challenges for analytical chemists to efficiently identify and characterize such molecules. While conventional mass spectrometry (MS) has proven to be a powerful tool to study nucleic acids, new and improved methods and software are now needed to address this emerging challenge. In this report, we describe a simple yet powerful program that affords great flexibility in the calculation of theoretical masses for conventional as well as modified oligonucleotide molecules. This easy to use program can accept input oligonucleotide sequences and then calculate the theoretical mass values for full length products, process impurities, potential metabolites, and gas phase fragments. We intentionally designed this software so that modified nucleotide residues can be incorporated into oligonucleotide sequences, and corresponding mass values can be rapidly calculated. To test the utility of this program, two oligonucleotides that contain a large number of chemical modifications were synthesized. We have analyzed these samples using a Q-TOF mass spectrometer and compared the calculated masses to the observed ones. We found that all of the data matched very well with less than 30 ppm mass errors, well within the expectation for our instrument operated in its current mode. These data confirmed the validity of calculations performed with this new software.

  18. In vitro binding of the purified hormone-binding subunit of the estrogen receptor to oligonucleotides containing natural or modified sequences of an estrogen-responsive element.

    PubMed

    Medici, N; Nigro, V; Abbondanza, C; Moncharmont, B; Molinari, A M; Puca, G A

    1991-04-01

    Estrogen receptor (ER) was purified from calf uterus by immunoaffinity chromatography in the absence of the ligand. The purified ER consists of a mixture of monomer and homodimer forms of 67-kDa hormone-binding subunit (no 90-kDa heat shock protein is present). The purified ER was incubated with a 32P-labeled 61-basepair oligonucleotide containing the sequence of the estrogen response element (ERE) of the Xenopus laevis A2 vitellogenin gene. DNA mobility shift assays showed formation of specific complexes of the ERE containing oligonucleotide with ER, formation which did not require and was not affected by estradiol or antiestrogenic molecules. Both the monomer and the dimer were equally able to interact with the ERE-containing oligonucleotide. Sucrose gradient experiments showed that only the ER monomer is able to interact with an oligonucleotide in which a single mutation destroyed the dyad symmetry of ERE. Multiple symmetric mutations which did not alter the dyad symmetry of ERE nevertheless totally destroyed the ability of the oligonucleotide to form complexes with either the monomeric or dimeric form of ER. These results suggest that ER is able to bind to ERE independently of the presence of estradiol or other proteins and, therefore, that estradiol does not act by modulating the ability of ER to bind to ERE on DNA. PMID:1922088

  19. ZnS nanoflakes deposition by modified chemical method

    SciTech Connect

    Desai, Mangesh A. Sartale, S. D.

    2014-04-24

    We report deposition of zinc sulfide nanoflakes on glass substrates by modified chemical method. The modified chemical method involves adsorption of zinc–thiourea complex on the substrate and its dissociation in presence of hydroxide ions to release sulfur ions from thiourea which react with zinc ions present in the complex to form zinc sulfide nanoflakes at room temperature. Influence of zinc salt and thiourea concentrations ratios on the morphology of the films was investigated by scanning electron microscope (SEM). The ratio of zinc and thiourea in the zinc–thiourea complex significantly affect the size of the zinc sulfide nanoflakes, especially width and density of the nanoflakes. The X-ray diffraction analysis exhibits polycrystalline nature of the zinc sulfide nanoflakes with hexagonal phase.

  20. Biocatalytic transformation of petroporphyrins by chemical modified cytochrome C.

    PubMed

    García-Arellano, Humberto; Buenrostro-Gonzalez, Eduardo; Vazquez-Duhalt, Rafael

    2004-03-30

    A semi-synthetic biocatalyst was prepared by a double chemical modification of cytochrome c. Free amino groups were modified with poly(ethylene glycol) while free carboxylic groups were alkylated to form methyl esters. The double chemically modified protein, PEG-Cyt-Met, oxidized synthetic porphyrins in a ternary solvent mixture composed by methylene chloride, methanol, and phosphate buffer. The highest activity was found in the ternary systems with low water content (5%). The use of relatively hydrophobic peroxides, such as tert-butyl and cumene hydroperoxides, extended the operational life of the biocatalyst, which, in turn, resulted in an extended oxidation of the substrates tested. PEG-Cyt-Met is able to transform asphaltenes, a highly recalcitrant petroleum fraction. The huge energetic resource found as asphaltene-rich deposits is the driving force to investigate and to innovate upgrading technologies, including biotechnological strategies. PMID:14991657

  1. Supersensitive fingerprinting of explosives by chemically modified nanosensors arrays

    NASA Astrophysics Data System (ADS)

    Lichtenstein, Amir; Havivi, Ehud; Shacham, Ronen; Hahamy, Ehud; Leibovich, Ronit; Pevzner, Alexander; Krivitsky, Vadim; Davivi, Guy; Presman, Igor; Elnathan, Roey; Engel, Yoni; Flaxer, Eli; Patolsky, Fernando

    2014-06-01

    The capability to detect traces of explosives sensitively, selectively and rapidly could be of great benefit for applications relating to civilian national security and military needs. Here, we show that, when chemically modified in a multiplexed mode, nanoelectrical devices arrays enable the supersensitive discriminative detection of explosive species. The fingerprinting of explosives is achieved by pattern recognizing the inherent kinetics, and thermodynamics, of interaction between the chemically modified nanosensors array and the molecular analytes under test. This platform allows for the rapid detection of explosives, from air collected samples, down to the parts-per-quadrillion concentration range, and represents the first nanotechnology-inspired demonstration on the selective supersensitive detection of explosives, including the nitro- and peroxide-derivatives, on a single electronic platform. Furthermore, the ultrahigh sensitivity displayed by our platform may allow the remote detection of various explosives, a task unachieved by existing detection technologies.

  2. Supersensitive fingerprinting of explosives by chemically modified nanosensors arrays.

    PubMed

    Lichtenstein, Amir; Havivi, Ehud; Shacham, Ronen; Hahamy, Ehud; Leibovich, Ronit; Pevzner, Alexander; Krivitsky, Vadim; Davivi, Guy; Presman, Igor; Elnathan, Roey; Engel, Yoni; Flaxer, Eli; Patolsky, Fernando

    2014-01-01

    The capability to detect traces of explosives sensitively, selectively and rapidly could be of great benefit for applications relating to civilian national security and military needs. Here, we show that, when chemically modified in a multiplexed mode, nanoelectrical devices arrays enable the supersensitive discriminative detection of explosive species. The fingerprinting of explosives is achieved by pattern recognizing the inherent kinetics, and thermodynamics, of interaction between the chemically modified nanosensors array and the molecular analytes under test. This platform allows for the rapid detection of explosives, from air collected samples, down to the parts-per-quadrillion concentration range, and represents the first nanotechnology-inspired demonstration on the selective supersensitive detection of explosives, including the nitro- and peroxide-derivatives, on a single electronic platform. Furthermore, the ultrahigh sensitivity displayed by our platform may allow the remote detection of various explosives, a task unachieved by existing detection technologies. PMID:24960270

  3. Cationic nanoemulsion as a delivery system for oligonucleotides targeting malarial topoisomerase II.

    PubMed

    Bruxel, F; Cojean, S; Bochot, A; Teixeira, H; Bories, C; Loiseau, P-M; Fattal, E

    2011-09-20

    A promising strategy based on the antisense oligonucleotides against the Plasmodium falciparum topoisomerase II has been considered using cationic nanoemulsion as oligonucleotide delivery system. Phosphodiester and chemically modified phosphorothioate oligonucleotides bearing negative charges were adsorbed on positively charged emulsion composed of medium chain triglycerides, egg lecithin, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and water, at different +/- charge ratios (positive charges from cationic lipid/negative charges from oligonucleotide): +0.5/-, +2/-, +4/- and +6/-. The physicochemical properties of the complexes were determined, as well as their stability in culture medium. Their interaction with erythrocytes through hemolysis, binding experiments and confocal microscopy were also evaluated. Finally, the in vitro evaluation of parasite growth and reinfection capacity was performed. The overall results showed that antisense oligonucleotides against P. falciparum topoisomerase II gene can be efficiently adsorbed onto a cationic nanoemulsion forming complexes. Whereas unloaded nanoemulsion displayed an hemolytic effect due to the presence of the cationic lipid, this was not the case of loaded nanoemulsion at low +/- ratios. Oligonucleotide-loaded nanoemulsions were found to be located inside the infected erythrocytes, inhibiting efficiently parasite growth (until 80%) and causing a delay in P. falciparum life cycle. PMID:21291974

  4. Synthesis, thermal stability and reactivity towards 9-aminoellipticine of double-stranded oligonucleotides containing a true abasic site.

    PubMed Central

    Bertrand, J R; Vasseur, J J; Rayner, B; Imbach, J L; Paoletti, J; Paoletti, C; Malvy, C

    1989-01-01

    A 13 mers abasic oligonucleotide was synthetized. It was therefore possible to compare thermal stability and reactivity of duplex oligonucleotides either with an apurinic/apyrimidinic site or without any lesion. An important decrease in the melting temperature appeared for duplexes with an abasic site. The chemical reaction of these modified oligonucleotides with the intercalating agent 9-aminoellipticine was studied by gel electrophoresis and by fluorescence. The formation of a Schiff base between 9-aminoellipticine and abasic sites was rapid and complete with duplexes at 11 degrees C. Schiff base related fluorescence and beta-elimination cleavage were more important with the apyrimidinic sites than with the apurinic ones. When compared to previous results obtained with the model d(TprpT) some unexpected behaviours appeared with longer and duplex oligonucleotides. For instance only partial beta-elimination cleavage was observed. It is likely that stacking parameters in the double helix play a great role in the studied reaction. Images PMID:2602153

  5. Film forming capacity of chemically modified corn starches.

    PubMed

    López, Olivia V; García, María A; Zaritzky, Noemí E

    2008-09-01

    Native starch can be chemically modified to improve its functionality and to expand its uses. Modified starches were characterized and the rheological behavior of filmogenic suspensions was analyzed. The film forming capacity of different chemical modified corn starches was evaluated. Acetylated starch was selected by the characteristics of the resulted films; its optimum concentration was 5% w/w since their films exhibited the lowest water vapor permeability (WVP, 1.26×10(-10)g/msPa). The effect of glycerol as plasticizer on film properties depend on its concentration, being 1.5% w/w those that allows to obtain the lowest WVP value (1.64×10(-11)g/msPa), low film solubility in water and a more compact structure than those of unplasticized films. Mechanical behavior of plasticized acetylated starch films depends on glycerol concentration, being rigid and brittle the unplasticized ones, ductile those containing 1.5% w/w of glycerol and very flexible those with a higher plasticizer content. PMID:26048223

  6. Recovery of palladium using chemically modified cedar wood powder.

    PubMed

    Parajuli, Durga; Hirota, Koichi

    2009-10-15

    Japanese cedar wood powder (CWP) was chemically modified to a tertiary-amine-type adsorbent and studied for the selective recovery of Pd(II) from various industrial waters. Batch adsorption tests performed from 0.1 M to 5 M HCl and HNO3 systems reveal stable performance with better results in HNO3 medium. The maximum loading capacity for Pd(II) was studied in HCl as well as in HNO3. A continuous-flow experiment taking a real industrial solution revealed the feasibility of using modified CWP for the selective uptake and preconcentration of traces of palladium contained in acidic effluents. In addition, stable adsorption performance even on long exposure to gamma-irradiation and selective recovery of palladium from simulated high-level liquid waste (HLW) are important outcomes of the study. PMID:19640546

  7. Chemically modified tetracyclines: The novel host modulating agents

    PubMed Central

    Swamy, Devulapalli Narasimha; Sanivarapu, Sahitya; Moogla, Srinivas; Kapalavai, Vasavi

    2015-01-01

    Periodontal pathogens and destructive host responses are involved in the initiation and progression of periodontitis. The emergence of host response modulation as a treatment concept has resulted from our improved understanding of the pathogenesis of periodontal disease. A variety of drugs have been evaluated as host modulation agents (HMA), including Non Steroidal Anti Inflammatory Drugs (NSAIDS), bisphosphonates, tetracyclines, enamel matrix proteins and bone morphogenetic proteins. Chemically modified tetracyclines (CMTs) are one such group of drugs which have been viewed as potential host modulating agents by their anticollagenolytic property. The CMTs are designed to be more potent inhibitors of pro inflammatory mediators and can increase the levels of anti inflammatory mediators. PMID:26392682

  8. Chemically modified tetracyclines: The novel host modulating agents.

    PubMed

    Swamy, Devulapalli Narasimha; Sanivarapu, Sahitya; Moogla, Srinivas; Kapalavai, Vasavi

    2015-01-01

    Periodontal pathogens and destructive host responses are involved in the initiation and progression of periodontitis. The emergence of host response modulation as a treatment concept has resulted from our improved understanding of the pathogenesis of periodontal disease. A variety of drugs have been evaluated as host modulation agents (HMA), including Non Steroidal Anti Inflammatory Drugs (NSAIDS), bisphosphonates, tetracyclines, enamel matrix proteins and bone morphogenetic proteins. Chemically modified tetracyclines (CMTs) are one such group of drugs which have been viewed as potential host modulating agents by their anticollagenolytic property. The CMTs are designed to be more potent inhibitors of pro inflammatory mediators and can increase the levels of anti inflammatory mediators. PMID:26392682

  9. Reduced chemically modified graphene oxide for supercapacitor electrode

    PubMed Central

    2014-01-01

    An efficient active material for supercapacitor electrodes is prepared by reacting potassium hydroxide (KOH) with graphene oxide followed by chemical reduction with hydrazine. The electrochemical performance of KOH treated graphene oxide reduced for 24 h (reduced chemically modified graphene oxide, RCMGO-24) exhibits a specific capacitance of 253 F g-1 at 0.2 A g-1 in 2 M H2SO4 compared to a value of 141 F g-1 for graphene oxide reduced for 24 h (RGO-24), and good cyclic stability up to 3,000 cycles. Interestingly, RCMGO-24 demonstrated a higher specific capacitance and excellent cycle stability due to its residual oxygen functional groups that accelerate the faradaic reactions and aid in faster wetting. This non-annealed strategy offers the potential for simple and cost-effective preparation of an active material for a supercapacitor electrode. PMID:25298756

  10. One-pot synthesis of chemically modified vegetable oils.

    PubMed

    Sharma, Brajendra K; Liu, Zengshe; Adhvaryu, Atanu; Erhan, Sevim Z

    2008-05-14

    Vegetable oils are promising candidates as substitutes for petroleum base oils in lubricant applications, such as total loss lubrication, military applications, and outdoor activities. Although vegetable oils have some advantages, they also have poor oxidation and low temperature stability. One of the ways to address these issues is chemical modification of fatty acid chain of triglyceride. We report a one-pot synthesis of a novel class of chemically modified vegetable oils from epoxidized triacylglycerols and various anhydrides. In an anhydrous solvent, boron trifluoride etherate is used as catalyst to simultaneously open the oxirane ring and activate the anhydride. The reaction was monitored and products confirmed by NMR, FTIR, GPC, and TGA analysis. Experimental conditions were optimized for research quantity and laboratory scale-up (up to 4 lbs). The resultant acyl derivatives of vegetable oil, having diester substitution at the sites of unsaturation, have potential in formulation of industrial fluids such as hydraulic fluids, lubricants, and metal working fluids. PMID:18399638

  11. Probing Chromatin-modifying Enzymes with Chemical Tools.

    PubMed

    Fischle, Wolfgang; Schwarzer, Dirk

    2016-03-18

    Chromatin is the universal template of genetic information in all eukaryotic organisms. Chemical modifications of the DNA-packaging histone proteins and the DNA bases are crucial signaling events in directing the use and readout of eukaryotic genomes. The enzymes that install and remove these chromatin modifications as well as the proteins that bind these marks govern information that goes beyond the sequence of DNA. Therefore, these so-called epigenetic regulators are intensively studied and represent promising drug targets in modern medicine. We summarize and discuss recent advances in the field of chemical biology that have provided chromatin research with sophisticated tools for investigating the composition, activity, and target sites of chromatin modifying enzymes and reader proteins. PMID:26845102

  12. Novel aerobic tetracycline resistance gene that chemically modifies tetracycline.

    PubMed Central

    Speer, B S; Salyers, A A

    1989-01-01

    A tetracycline resistance gene that was found originally on the Bacteroides plasmid pBF4 confers resistance on Escherichia coli but only when cells are growing aerobically. When E. coli EM24 carrying this aerobic tetracycline resistance (*Tcr) gene is grown in medium containing tetracycline, the resulting spent medium is no longer toxic to tetracycline-sensitive (Tcs) E. coli EM24 (B.S. Speer and A.A. Salyers, J. Bacteriol. 170: 1423-1429, 1988). To determine whether the *Tcr gene product modified tetracycline, we characterized the material resulting from incubation of E. coli (*Tcr) with tetracycline. When [7-3H(N)]tetracycline was added to cultures of E. coli (*Tcr), at least 90% of the label was recovered in the extracellular fluid. Therefore, tetracycline was not being sequestered by the cells. The labeled material behaved similarly to tetracycline with respect to solubility in various organic solvents. However, the UV-visible light spectrum had a single peak at 258 nm, whereas the tetracycline spectrum had a peak at 364 nm. The labeled material also had a faster migration rate than did tetracycline on thin-layer plates in a solvent system of butanol-methanol-10% citric acid (4:1:2, vol/vol/vol) and was separable from tetracycline by reverse-phase high-pressure liquid chromatography, using an acetronitrile-0.1% trifluoroacetic acid solvent system. These results demonstrate that the *Tcr gene product chemically modifies tetracycline. The *Tcr gene is the first example of a chemically modifying tetracycline resistance mechanism. PMID:2644186

  13. Gene Assembly from Chip-Synthesized Oligonucleotides

    PubMed Central

    Eroshenko, Nikolai; Kosuri, Sriram; Marblestone, Adam H; Conway, Nicholas; Church, George M.

    2012-01-01

    De novo synthesis of long double-stranded DNA constructs has a myriad of applications in biology and biological engineering. However, its widespread adoption has been hindered by high costs. Cost can be significantly reduced by using oligonucleotides synthesized on high-density DNA chips. However, most methods for using off-chip DNA for gene synthesis have failed to scale due to the high error rates, low yields, and high chemical complexity of the chip-synthesized oligonucleotides. We have recently demonstrated that some commercial DNA chip manufacturers have improved error rates, and that the issues of chemical complexity and low yields can be solved by using barcoded primers to accurately and efficiently amplify subpools of oligonucleotides. This article includes protocols for computationally designing the DNA chip, amplifying the oligonucleotide subpools, and assembling 500-800 basepair (bp) constructs. PMID:25077042

  14. Maltodextrins from chemically modified starches. Selected physicochemical properties.

    PubMed

    Pycia, Karolina; Juszczak, Lesław; Gałkowska, Dorota; Witczak, Mariusz; Jaworska, Grażyna

    2016-08-01

    The aim of this work was to evaluate the effect of chemical modification of starch (cross-linking and/or stabilisation) on selected rheological and functional properties of maltodextrins of dextrose equivalent of 6, 11 and 16. It was found that values of glass transition temperatures were decreasing with dextrose equivalent of maltodextrin. The highest values of glass transition temperature (TG) were determined for maltodextrin of DE 6-obtained from distarch phosphate and acetylated distarch phosphate. Increase in DE value of maltodextrin was also accompanied by decrease and increase in values of intrinsic viscosity and the critical concentration, respectively; however, there was no significant effect of kind of chemical modification of starch on the values of these parameters. Maltodextrin solutions at concentrations of from 10 to 70 % exhibited Newtonian flow behaviour. In the case of 50% solutions of maltodextrins of DE 6 the highest viscosity was produced by maltodextrin from native potato starch, while the lowest one by maltodextrin from acetylated starch. On the other hand, among the maltodextrin of DE 11 this one produced from acetylated starch showed the highest viscosity. All the maltodextrins exhibited surfactant properties in a water-air system, with the strongest effect observed for maltodextrins produced from double chemically modified starches and from acetylated starch. The surface activity was increasing with increasing of the DE value of maltodextrin. Moreover, values of surface tension were decreasing with increasing in maltodextrin concentration in the system. PMID:27112878

  15. Oxidized SWCNT chemically attached to a modified copper substrate

    NASA Astrophysics Data System (ADS)

    Hernandez, Dionne; Cabrera, Carlos R.; Mendez, Laura; Diaz-Serrano, Madeline; Vega, Omar; Weiner, Brad R.; Rosa, Luis G.

    2015-08-01

    Oxidized single-wall carbon nanotubes were chemically attached to a modified copper substrate by means of a 4-aminothiophenol (4-ATP) self-assembly monolayer (SAM). This bottom up approach offers a low cost route to attach carbon nanotubes by using a condensation reaction. Here, the exposed amine from the 4-ATP SAM reacts with the carboxylic group (COOH) on the CNT. The reaction was followed using ATR-FTIR and the surface was characterized using SEM, XPS, and Raman. The analytical techniques used on this study suggest that the condensation reaction employed using a carbodiimide such as 1-Ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) produced SWCNT attached to the copper substrate.

  16. Modelling Amperometric Biosensors Based on Chemically Modified Electrodes

    PubMed Central

    Baronas, Romas; Kulys, Juozas

    2008-01-01

    The response of an amperometric biosensor based on a chemically modified electrode was modelled numerically. A mathematical model of the biosensor is based on a system of non-linear reaction-diffusion equations. The modelling biosensor comprises two compartments: an enzyme layer and an outer diffusion layer. In order to define the main governing parameters the corresponding dimensionless mathematical model was derived. The digital simulation was carried out using the finite difference technique. The adequacy of the model was evaluated using analytical solutions known for very specific cases of the model parameters. By changing model parameters the output results were numerically analyzed at transition and steady state conditions. The influence of the substrate and mediator concentrations as well as of the thicknesses of the enzyme and diffusion layers on the biosensor response was investigated. Calculations showed complex kinetics of the biosensor response, especially when the biosensor acts under a mixed limitation of the diffusion and the enzyme interaction with the substrate.

  17. Mesoscale assembly of chemically modified graphene into complex cellular networks

    NASA Astrophysics Data System (ADS)

    Barg, Suelen; Perez, Felipe Macul; Ni, Na; Do Vale Pereira, Paula; Maher, Robert C.; Garcia-Tuñon, Esther; Eslava, Salvador; Agnoli, Stefano; Mattevi, Cecilia; Saiz, Eduardo

    2014-07-01

    The widespread technological introduction of graphene beyond electronics rests on our ability to assemble this two-dimensional building block into three-dimensional structures for practical devices. To achieve this goal we need fabrication approaches that are able to provide an accurate control of chemistry and architecture from nano to macroscopic levels. Here, we describe a versatile technique to build ultralight (density ≥1 mg cm-3) cellular networks based on the use of soft templates and the controlled segregation of chemically modified graphene to liquid interfaces. These novel structures can be tuned for excellent conductivity; versatile mechanical response (elastic-brittle to elastomeric, reversible deformation, high energy absorption) and organic absorption capabilities (above 600 g per gram of material). The approach can be used to uncover the basic principles that will guide the design of practical devices that by combining unique mechanical and functional performance will generate new technological opportunities.

  18. Mesoscale assembly of chemically modified graphene into complex cellular networks

    PubMed Central

    Barg, Suelen; Perez, Felipe Macul; Ni, Na; do Vale Pereira, Paula; Maher, Robert C.; Garcia-Tuñon, Esther; Eslava, Salvador; Agnoli, Stefano; Mattevi, Cecilia; Saiz, Eduardo

    2014-01-01

    The widespread technological introduction of graphene beyond electronics rests on our ability to assemble this two-dimensional building block into three-dimensional structures for practical devices. To achieve this goal we need fabrication approaches that are able to provide an accurate control of chemistry and architecture from nano to macroscopic levels. Here, we describe a versatile technique to build ultralight (density ≥1 mg cm−3) cellular networks based on the use of soft templates and the controlled segregation of chemically modified graphene to liquid interfaces. These novel structures can be tuned for excellent conductivity; versatile mechanical response (elastic-brittle to elastomeric, reversible deformation, high energy absorption) and organic absorption capabilities (above 600 g per gram of material). The approach can be used to uncover the basic principles that will guide the design of practical devices that by combining unique mechanical and functional performance will generate new technological opportunities. PMID:24999766

  19. The oral and craniofacial relevance of chemically modified RNA therapeutics.

    PubMed

    Elangovan, Satheesh; Kormann, Michael S D; Khorsand, Behnoush; Salem, Aliasger K

    2016-01-01

    Several tissue engineering strategies in the form of protein therapy, gene therapy, cell therapy, and their combinations are currently being explored for oral and craniofacial regeneration and repair. Though each of these approaches has advantages, they all have common inherent drawbacks of being expensive and raising safety concerns. Using RNA (encoding therapeutic protein) has several advantages that have the potential to overcome these limitations. Chemically modifying the RNA improves its stability and mitigates immunogenicity allowing for the potential of RNA to become an alternative to protein and gene based therapies. This brief review article focuses on the potential of RNA therapeutics in the treatment of disorders in the oral and craniofacial regions. PMID:26896600

  20. Modified chemical route for deposition of molybdenum disulphide thin films

    SciTech Connect

    Vyas, Akshay N. Sartale, S. D.

    2014-04-24

    Molybdenum disulphide (MoS{sub 2}) thin films were deposited on quartz substrates using a modified chemical route. Sodium molybdate and sodium sulphide were used as precursors for molybdenum and sulphur respectively. The route involves formation of tetrathiomolybdate ions (MoS{sub 4}{sup 2−}) and further reduction by sodium borohydride to form MoS{sub 2}. The deposition was performed at room temperature. The deposited films were annealed in argon atmosphere at 1073 K for 1 hour to improve its crystallinity. The deposited films were characterized using scanning electron microscopy (SEM) for morphology, UV-Vis absorption spectroscopy for optical studies and X-ray diffraction (XRD) for structure determination.

  1. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    NASA Astrophysics Data System (ADS)

    Zhou, Liang-Chun; Meng, Xiang-Guang; Fu, Jing-Wei; Yang, Yu-Chong; Yang, Peng; Mi, Chun

    2014-02-01

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer-Emmett-Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m2/g), pore volume (7.29 × 10-3 mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m2/g, 2.00 × 10-3 mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and sbnd OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80-91% adsorption efficiency.

  2. Modifying steam generator corrosion behavior via chemical cleaning

    SciTech Connect

    Sweeney, K.; Neese, K.

    1994-12-31

    A steam generator chemical cleaning program was conducted in Palo Verde nuclear generating station (PVNGS) units 2 and 3 in 1994. This effort represented the first full-bundle chemical cleaning of a recirculating steam generator in the United States. The objectives of the process were: (1) to remove deposits in the upper bundle regions, which were identified by eddy-current analysis and linked to a free-span outside-diameter stress corrosion cracking (ODSCC) condition; (2) to remove tube scale deposits that interfere with heat transfer and may contain undesirable contaminants; (3) to remove deposits from the surface of the tube sheet and the flow distribution plate; and (4) to remove deposits from the drilled hole crevices in the FDP, which may be contributing to low recirculation ratios and upper bundle transition boiling. The Electric Power Research Institute/Steam Generator Owners` Group low-temperature process, modified to include {open_quotes}crevice cleaning{close_quotes} and {open_quotes}passivation{close_quotes} steps, was selected as the best method. Babock & Wilcox Nuclear Technologies was selected as the vendor.

  3. Magnetorheological finishing of chemical-vapor deposited zinc sulfide via chemically and mechanically modified fluids

    DOE PAGESBeta

    Salzman, Sivan; Romanofsky, Henry J.; Giannechini, Lucca J.; Jacobs, Stephen D.; Lambropoulos, John C.

    2016-02-19

    In this study, we describe the anisotropy in the material removal rate (MRR) of the polycrystalline, chemical-vapor deposited zinc sulfide (ZnS).We define the polycrystalline anisotropy via microhardness and chemical erosion tests for four crystallographic orientations of ZnS: (100), (110), (111), and (311). Anisotropy in the MRR was studied under magnetorheological finishing (MRF) conditions. Three chemically and mechanically modified magnetorheological (MR) fluids at pH values of 4, 5, and 6 were used to test the MRR variations among the four single-crystal planes. When polishing the single-crystal planes and the polycrystalline with pH 5 and pH 6MR fluids, variations were found inmore » the MRR among the four single-crystal planes and surface artifacts were observed on the polycrystalline material. When polishing the single-crystal planes and the polycrystalline with the modified MR fluid at pH 4, however, minimal variation was observed in the MRR among the four orientations and a reduction in surface artifacts was achieved on the polycrystalline material.« less

  4. Magnetorheological finishing of chemical-vapor deposited zinc sulfide via chemically and mechanically modified fluids.

    PubMed

    Salzman, Sivan; Romanofsky, Henry J; Giannechini, Lucca J; Jacobs, Stephen D; Lambropoulos, John C

    2016-02-20

    We describe the anisotropy in the material removal rate (MRR) of the polycrystalline, chemical-vapor deposited zinc sulfide (ZnS). We define the polycrystalline anisotropy via microhardness and chemical erosion tests for four crystallographic orientations of ZnS: (100), (110), (111), and (311). Anisotropy in the MRR was studied under magnetorheological finishing (MRF) conditions. Three chemically and mechanically modified magnetorheological (MR) fluids at pH values of 4, 5, and 6 were used to test the MRR variations among the four single-crystal planes. When polishing the single-crystal planes and the polycrystalline with pH 5 and pH 6 MR fluids, variations were found in the MRR among the four single-crystal planes and surface artifacts were observed on the polycrystalline material. When polishing the single-crystal planes and the polycrystalline with the modified MR fluid at pH 4, however, minimal variation was observed in the MRR among the four orientations and a reduction in surface artifacts was achieved on the polycrystalline material. PMID:26906603

  5. Engineering chemically modified viruses for prostate cancer cell recognition.

    PubMed

    Mohan, K; Weiss, G A

    2015-12-01

    Specific detection of circulating tumor cells and characterization of their aggressiveness could improve cancer diagnostics and treatment. Metastasis results from such tumor cells, and causes the majority of cancer deaths. Chemically modified viruses could provide an inexpensive and efficient approach to detect tumor cells and quantitate their cell surface biomarkers. However, non-specific adhesion between the cell surface receptors and the virus surface presents a challenge. This report describes wrapping the virus surface with different PEG architectures, including as fusions to oligolysine, linkers, spacers and scaffolded ligands. The reported PEG wrappers can reduce by >75% the non-specific adhesion of phage to cell surfaces. Dynamic light scattering verified the non-covalent attachment by the reported wrappers as increased sizes of the virus particles. Further modifications resulted in specific detection of prostate cancer cells expressing PSMA, a key prostate cancer biomarker. The approach allowed quantification of PSMA levels on the cell surface, and could distinguish more aggressive forms of the disease. PMID:26463253

  6. Chemically modified nucleic acids as immunodetectable probes in hybridization experiments.

    PubMed Central

    Tchen, P; Fuchs, R P; Sage, E; Leng, M

    1984-01-01

    Guanine residues in nucleic acids can be modified by treatment with N-acetoxy-N-2-acetylaminofluorene and its 7-iodo derivative in an in vitro nonenzymatic reaction. The modified nucleic acids (ribo or deoxyribo, single or double stranded) are recognized by specific antibodies. They can be immunoprecipitated or used as probes in hybridization experiments and detected by immunochemical techniques. Images PMID:6374657

  7. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications. PMID:27521696

  8. Development of Therapeutic Splice-Switching Oligonucleotides

    PubMed Central

    Kryczka, Adrianna; Liu, Yuqi; Badi, Yusef E.; Wong, Jessie J.; Owen, James S.; Khoo, Bernard

    2014-01-01

    Abstract Synthetic splice-switching oligonucleotides (SSOs) target nuclear pre-mRNA molecules to change exon splicing and generate an alternative protein isoform. Clinical trials with two competitive SSO drugs are underway to treat Duchenne muscular dystrophy (DMD). Beyond DMD, many additional therapeutic applications are possible, with some in phase 1 clinical trials or advanced preclinical evaluation. Here, we present an overview of the central factors involved in developing therapeutic SSOs for the treatment of diseases. The selection of susceptible pre-mRNA target sequences, as well as the design and chemical modification of SSOs to increase SSO stability and effectiveness, are key initial considerations. Identification of effective SSO target sequences is still largely empirical and published guidelines are not a universal guarantee for success. Specifically, exon-targeted SSOs, which are successful in modifying dystrophin splicing, can be ineffective for splice-switching in other contexts. Chemical modifications, importantly, are associated with certain characteristic toxicities, which need to be addressed as target diseases require chronic treatment with SSOs. Moreover, SSO delivery in adequate quantities to the nucleus of target cells without toxicity can prove difficult. Last, the means by which these SSOs are administered needs to be acceptable to the patient. Engineering an efficient therapeutic SSO, therefore, necessarily entails a compromise between desirable qualities and effectiveness. Here, we describe how the application of optimal solutions may differ from case to case. PMID:24826963

  9. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    PubMed

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. PMID:27117425

  10. Poly(oligonucleotide)

    PubMed Central

    2015-01-01

    Here we report the preparation of poly(oligonucleotide) brush polymers and amphiphilic brush copolymers from nucleic acid monomers via graft-through polymerization. We describe the polymerization of PNA-norbornyl monomers to yield poly-PNA (poly(peptide nucleic acid)) via ring-opening metathesis polymerization (ROMP) with the initiator, (IMesH2)(C5H5N)2(Cl)2RuCHPh.1 In addition, we present the preparation of poly-PNA nanoparticles from amphiphilic block copolymers and describe their hybridization to a complementary single-stranded DNA (ssDNA) oligonucleotide. PMID:25077676

  11. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  12. Synthesis of DNA oligonucleotides containing C5-ethynylbenzenesulfonamide-modified nucleotides (EBNA) by polymerases towards the construction of base functionalized nucleic acids.

    PubMed

    Goubet, Astrid; Chardon, Antoine; Kumar, Pawan; Sharma, Pawan K; Veedu, Rakesh N

    2013-02-01

    C5-Ethynylbenzenesulfonamide-modified nucleotide (EBNA) was investigated as substrate of various DNA polymerases. The experiments revealed that KOD, Phusion and Klenow DNA polymerases successfully accepted EBNA-T nucleotide as a substrate and yielded the fully extended DNA. KOD DNA polymerase was found to be the most efficient enzyme to furnish EBNA-T containing DNA in good yields. Phusion DNA polymerase efficiently amplified the template containing EBNA-T nucleotides by PCR. PMID:23265899

  13. Safety evaluation of chemically modified beta-lactoglobulin administered intravaginally.

    PubMed

    Guo, Xuetao; Qiu, Lixia; Wang, Yonghong; Wang, Yue; Meng, Yuanguang; Zhu, Yun; Lu, Lu; Jiang, Shibo

    2016-06-01

    Currently, there is no specific antiviral therapy for treatment of HPV infection. Jiang and colleagues previously reported that anhydride-modified proteins have inhibitory activities against multiple viruses including HPV. Here, we evaluated the safety of 3-hydroxyphthalic anhydride-modified bovine beta-lactoglobulin, designated JB01, vaginally applied in women infected by high-risk HPV. After the vaginal application of JB01 in 38 women for 3 months, no serious adverse events were reported, and normalization of the vaginal micro-environment has been observed. It can be concluded that JB01-BD is safe for vaginal use in HPV-infected women, suggesting its potential application for the treatment of HPV infection. J. Med. Virol. 88:1098-1101, 2016. © 2015 Wiley Periodicals, Inc. PMID:26629967

  14. Chemical reactivity of twin-modified copper nanowire surfaces

    SciTech Connect

    Huang, Chun-Lung; Liao, Chien-Neng

    2015-07-13

    Effect of twin boundary (TB) spacing on atomic surface structure and chemical reactivity of nanotwinned Cu nanowires (NWs) is investigated. Post-etching surface structure and wire diameter of Cu NWs were examined by transmission electron microscopy. When TB spacing is less than 10 nm, the Cu NWs remain almost intact after chemical attack and show faceted surface structures with low atomic step density. A mechanism based on surface tension torque acting on TB/surface triple junctions is proposed to explain the faceted structure formation and enhanced corrosion resistance of nanotwinned Cu NWs.

  15. Chemical reactivity of twin-modified copper nanowire surfaces

    NASA Astrophysics Data System (ADS)

    Huang, Chun-Lung; Liao, Chien-Neng

    2015-07-01

    Effect of twin boundary (TB) spacing on atomic surface structure and chemical reactivity of nanotwinned Cu nanowires (NWs) is investigated. Post-etching surface structure and wire diameter of Cu NWs were examined by transmission electron microscopy. When TB spacing is less than 10 nm, the Cu NWs remain almost intact after chemical attack and show faceted surface structures with low atomic step density. A mechanism based on surface tension torque acting on TB/surface triple junctions is proposed to explain the faceted structure formation and enhanced corrosion resistance of nanotwinned Cu NWs.

  16. Synthesis of 5'-Aldehyde Oligonucleotide.

    PubMed

    Lartia, Rémy

    2016-01-01

    Synthesis of oligonucleotide ending with an aldehyde functional group at their 5'-end (5'-AON) is possible for both DNA (5'-AODN) and RNA (5'-AORN) series irrespectively of the nature of the last nucleobase. The 5'-alcohol of on-support ODN is mildly oxidized under Moffat conditions. Transient protection of the resulting aldehyde by N,N'-diphenylethylenediamine derivatives allows cleavage, deprotection, and RP-HPLC purification of the protected 5'-AON. Finally, 5'-AON is deprotected by usual acetic acid treatment. In the aggregates, 5'-AON can be now synthesized and purified as routinely as non-modified ODNs, following procedures similar to the well-known "DMT-On" strategy. PMID:26967469

  17. Poly(dG) spacers lead to increased surface coverage of DNA probes: an XPS study of oligonucleotide binding to zirconium phosphonate modified surfaces.

    PubMed

    Lane, Sarah M; Monot, Julien; Petit, Marc; Tellier, Charles; Bujoli, Bruno; Talham, Daniel R

    2008-07-15

    A spacer is often employed between the surface linking group and the probe sequence to improve the performance of DNA microarrays. Previous work demonstrated that a consecutive stretch of guanines as a spacer increased target capture during hybridization relative to probes with either no spacer or a similar stretch of one of the other nucleotides. Using zirconium phosphonate modified surfaces with 5'-phosphorylated ssDNA probes, the present study compares the surface coverage of ssDNA probes containing either a poly(dG) spacer or a poly(dA) spacer. Surface coverages are quantified by XPS using a modified overlayer model. The results show that after treatment to mimic conditions of the passivation and hybridization steps the probe with the poly(dG) spacer has about twice the surface coverage as the probe with the poly(dA) spacer, indicating that increased target capture is due to higher probe coverage. When monitoring the surface coverage after each rinsing step, it is observed that the probe with the poly(dA) spacer is more susceptible to rinsing, suggesting the interaction with the surface is different for the two probes. It is suggested that the formation of G quadruplexes causes an increased avidity of the probe for the zirconium phosphonate surface. PMID:18547070

  18. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae. PMID:26651586

  19. 40 CFR 372.20 - Process for modifying covered chemicals and facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... chemicals and facilities. 372.20 Section 372.20 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS TOXIC CHEMICAL RELEASE REPORTING: COMMUNITY RIGHT-TO-KNOW Reporting Requirements § 372.20 Process for modifying covered...

  20. PERFORMANCE CHARACTERISTICS OF 65-MER OLIGONUCLEOTIDE MICROARRAYS

    PubMed Central

    Lee, Myoyong; Xiang, Charlie C.; Trent, Jeffrey M.; Bittner, Michael L.

    2009-01-01

    Microarray fabrication using pre-synthesized long oligonucleotide is becoming increasingly important, but a study of large-scale array productions is not published yet. We addressed the issue of fabricating oligonucleotide microarrays by spotting commercial, pre-synthesized 65-mers with 5′ amines representing 7500 murine genes. Amine-modified oligonucleotides were immobilized on glass slides having aldehyde groups via transient Schiff base formation followed by reduction to produce a covalent conjugate. When RNA derived from the same source was used for Cy3 and Cy5 labeling and hybridized to the same array, signal intensities spanning three orders of magnitude were observed, and the coefficient of variation between the two channels for all spots was 8–10%. To ascertain the reproducibility of ratio determination of these arrays, two triplicate hybridizations (with fluorochrome reversal) comparing RNAs from a fibroblast (NIH3T3) and a breast cancer (JC) cell line were carried out. The 95% confidence interval for all spots in the six hybridizations was 0.60 – 1.66. This level of reproducibility allows use of the full range of pattern finding and discriminant analysis typically applied to cDNA microarrays. Further comparative testing was carried out with oligonucleotide microarrays, cDNA microarrays and RT-PCR assays to examine the comparability of results across these different methodologies. PMID:17617369

  1. Iodine derivatives of chemically modified gum Arabic microspheres.

    PubMed

    Ganie, Showkat A; Ali, Akbar; Mazumdar, Nasreen

    2015-09-20

    Acetylated gum Arabic (AGA) derivatives with different degrees of substitution (DS 0.97-2.74) were synthesized using acetyl chloride and a base under varying reaction conditions. The AGA derivatives were obtained in the form of microspheres and thereafter stable iodine products were prepared by doping the microspheres with an iodinating agent, iodine monochloride (ICl). The reaction between electrophilic iodine and polar carbonyl groups was studied by FT-IR, (1)H-NMR, and UV-VIS spectroscopies. The products were also characterized by DSC, TGA and SEM studies. The incorporated iodine was released in aqueous medium as iodide ions (I(-)). A reaction scheme has been proposed for the iodination and de-iodination of the gum derivatives. This work suggests that the iodine derivatives of modified gum Arabic could be used as a source of iodide ions which is the nutritional form of iodine. PMID:26050909

  2. Mthfd1 is a modifier of chemically induced intestinal carcinogenesis

    PubMed Central

    MacFarlane, Amanda J.; Perry, Cheryll A.; McEntee, Michael F.; Lin, David M.; Stover, Patrick J.

    2011-01-01

    The causal metabolic pathways underlying associations between folate and risk for colorectal cancer (CRC) have yet to be established. Folate-mediated one-carbon metabolism is required for the de novo synthesis of purines, thymidylate and methionine. Methionine is converted to S-adenosylmethionine (AdoMet), the major one-carbon donor for cellular methylation reactions. Impairments in folate metabolism can modify DNA synthesis, genomic stability and gene expression, characteristics associated with tumorigenesis. The Mthfd1 gene product, C1-tetrahydrofolate synthase, is a trifunctional enzyme that generates one-carbon substituted tetrahydrofolate cofactors for one-carbon metabolism. In this study, we use Mthfd1gt/+ mice, which demonstrate a 50% reduction in C1-tetrahydrofolate synthase, to determine its influence on tumor development in two mouse models of intestinal cancer, crosses between Mthfd1gt/+ and Apcmin/+ mice and azoxymethane (AOM)-induced colon cancer in Mthfd1gt/+ mice. Mthfd1 hemizygosity did not affect colon tumor incidence, number or load in Apcmin/+ mice. However, Mthfd1 deficiency increased tumor incidence 2.5-fold, tumor number 3.5-fold and tumor load 2-fold in AOM-treated mice. DNA uracil content in the colon was lower in Mthfd1gt/+ mice, indicating that thymidylate biosynthesis capacity does not play a significant role in AOM-induced colon tumorigenesis. Mthfd1 deficiency-modified cellular methylation potential, as indicated by the AdoMet: S-adenosylhomocysteine ratio and gene expression profiles, suggesting that changes in the transcriptome and/or decreased de novo purine biosynthesis and associated mutability cause cellular transformation in the AOM CRC model. This study emphasizes the impact and complexity of gene–nutrient interactions with respect to the relationships among folate metabolism and colon cancer initiation and progression. PMID:21156972

  3. Antisense oligonucleotide induction of progerin in human myogenic cells.

    PubMed

    Luo, Yue-Bei; Mitrpant, Chalermchai; Adams, Abbie M; Johnsen, Russell D; Fletcher, Sue; Mastaglia, Frank L; Wilton, Steve D

    2014-01-01

    We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA) transcript in human myogenic cells. The progerin transcript (LMNA Δ150) lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS). HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model to investigate

  4. Bonding and reactivity of clean and chemically-modified semiconductor surfaces probed with STM

    SciTech Connect

    Hamers, R.J.

    1995-12-01

    Scanning tunneling microscopy has been used to directly study the interrelationships between chemical composition, chemical reactivity, electronic structure, and surface morphology at the atomic level on clean and chemically-modified semiconductor surfaces. Our work has focused recently on understanding the atomic-level interactions of dopants such as phosphorus and boron on the Si(001) surface, and the influence of these atoms on other chemical reactions such as the thermal decomposition of disilane to grow epitaxial silicon. Using STM to study how these atoms modify the surface in combination with tunneling spectroscopy to reveal the occupied and unoccupied molecular orbitals of these structures provides direct insight into the nature of chemical bonding on these surfaces. This talk will discuss the application of STM to understand chemical bonding at silicon surfaces.

  5. Highly Efficient Gene Suppression by Chemically Modified 27 Nucleotide Double-Stranded RNAs

    NASA Astrophysics Data System (ADS)

    Kubo, Takanori; Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki

    2008-02-01

    RNA interference (RNAi) technology, described by Fire and Mello in 1998, is a powerful tool for the suppression of gene expression in mammalian cells. RNAi technology has several advantages over other chemical and genetic drugs. However, several problems in RNAi technology, such as cellular delivery, nuclease stability, and side effects, should be solved before applying it in the clinic. In this study, we focused on the development of novel chemically modified 27 nucleotide (nt) double-stranded RNAs (dsRNAs) with improved biological properties. Our chemically modified 27 nt dsRNAs exhibited an enhanced RNAi activity and a markedly increased stability in cell culture medium (containing 10% serum) in comparison with widely used 21 nt siRNAs and recently reported nonmodified 27 nt dsRNAs. The chemically modified 27 nt dsRNAs also exhibited a strong high long-term gene silencing effect after the 7 d treatment of viable cells. The chemically modified 27 nt dsRNAs in specific positions could be processed to 21 nt siRNAs by a recombinant Dicer enzyme. We suggested that the chemically modified 27 nt dsRNAs could be used for therapeutic applications (as genetic drugs) and bioanalyses.

  6. Interfacial characterization and analytical applications of chemically-modified surfaces

    SciTech Connect

    Wang, J.

    1998-02-23

    The goal of this work is to explore several new strategies and approaches to the surface modification and the microscopic characterization of interfaces in the areas mainly targeting sensor technologies that are of interest to environmental control or monitoring, and scanning probe microscopies techniques that can monitor interfacial chemical reactions in real time. Centered on the main theme, four specific topics are presented as four chapters in this dissertation following the general introduction. Chapter 1 describes the development of two immobilization schemes for covalently immobilizing fluoresceinamine at cellulose acetate and its application as a pH sensing film. Chapter 2 investigates the applicability of SFM to following the base-hydrolysis of a dithio-bis(succinimidylundecanoate) monolayer at gold in situ. Chapter 3 studies the mechanism for the accelerated rate of hydrolysis of the dithio-bis(succinimidylundecanoate) monolayer at Au(111) surface. Chapter 4 focuses on the development of an electrochemical approach to the elimination of chloride interference in Chemical Oxygen Demand (COD) analysis of waste water. The procedures, results and conclusions are described in each chapter. This report contains the introduction, references, and general conclusions. Chapters have been processed separately for inclusion on the data base. 95 refs.

  7. siRNAmod: A database of experimentally validated chemically modified siRNAs.

    PubMed

    Dar, Showkat Ahmad; Thakur, Anamika; Qureshi, Abid; Kumar, Manoj

    2016-01-01

    Small interfering RNA (siRNA) technology has vast potential for functional genomics and development of therapeutics. However, it faces many obstacles predominantly instability of siRNAs due to nuclease digestion and subsequently biologically short half-life. Chemical modifications in siRNAs provide means to overcome these shortcomings and improve their stability and potency. Despite enormous utility bioinformatics resource of these chemically modified siRNAs (cm-siRNAs) is lacking. Therefore, we have developed siRNAmod, a specialized databank for chemically modified siRNAs. Currently, our repository contains a total of 4894 chemically modified-siRNA sequences, comprising 128 unique chemical modifications on different positions with various permutations and combinations. It incorporates important information on siRNA sequence, chemical modification, their number and respective position, structure, simplified molecular input line entry system canonical (SMILES), efficacy of modified siRNA, target gene, cell line, experimental methods, reference etc. It is developed and hosted using Linux Apache MySQL PHP (LAMP) software bundle. Standard user-friendly browse, search facility and analysis tools are also integrated. It would assist in understanding the effect of chemical modifications and further development of stable and efficacious siRNAs for research as well as therapeutics. siRNAmod is freely available at: http://crdd.osdd.net/servers/sirnamod. PMID:26818131

  8. siRNAmod: A database of experimentally validated chemically modified siRNAs

    PubMed Central

    Dar, Showkat Ahmad; Thakur, Anamika; Qureshi, Abid; Kumar, Manoj

    2016-01-01

    Small interfering RNA (siRNA) technology has vast potential for functional genomics and development of therapeutics. However, it faces many obstacles predominantly instability of siRNAs due to nuclease digestion and subsequently biologically short half-life. Chemical modifications in siRNAs provide means to overcome these shortcomings and improve their stability and potency. Despite enormous utility bioinformatics resource of these chemically modified siRNAs (cm-siRNAs) is lacking. Therefore, we have developed siRNAmod, a specialized databank for chemically modified siRNAs. Currently, our repository contains a total of 4894 chemically modified-siRNA sequences, comprising 128 unique chemical modifications on different positions with various permutations and combinations. It incorporates important information on siRNA sequence, chemical modification, their number and respective position, structure, simplified molecular input line entry system canonical (SMILES), efficacy of modified siRNA, target gene, cell line, experimental methods, reference etc. It is developed and hosted using Linux Apache MySQL PHP (LAMP) software bundle. Standard user-friendly browse, search facility and analysis tools are also integrated. It would assist in understanding the effect of chemical modifications and further development of stable and efficacious siRNAs for research as well as therapeutics. siRNAmod is freely available at: http://crdd.osdd.net/servers/sirnamod. PMID:26818131

  9. Gold Binding by Native and Chemically Modified Hops Biomasses

    DOE PAGESBeta

    López, M. Laura; Gardea-Torresdey, J. L.; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.

    2005-01-01

    Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass ( Humulus lupulus ) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage bindingmore » at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively.« less

  10. CO2 adsorption on chemically modified activated carbon.

    PubMed

    Caglayan, Burcu Selen; Aksoylu, A Erhan

    2013-05-15

    CO2 adsorption capacity of a commercial activated carbon was improved by using HNO3 oxidation, air oxidation, alkali impregnation and heat treatment under helium gas atmosphere. The surface functional groups produced were investigated by diffuse reflectance infrared Fourier transform spectrometer (DRIFTS). CO2 adsorption capacities of the samples were determined by gravimetric analyses for 25-200°C temperature range. DRIFTS studies revealed the formation of carboxylic acid groups on the HNO3 oxidized adsorbents. Increased aromatization and uniform distribution of the Na particles were observed on the samples prepared by Na2CO3 impregnation onto HNO3 oxidized AC support. The adsorption capacities of the nonimpregnated samples were increased by high temperature helium treatments or by increasing the adsorption temperature; both leading to decomposition of surface oxygen groups, forming sites that can easily adsorb CO2. The adsorption capacity loss due to cyclic adsorption/desorption procedures was overcome with further surface stabilization of Na2CO3 modified samples with high temperature He treatments. With Na2CO3 impregnation the mass uptakes of the adsorbents at 20 bars and 25 °C were improved by 8 and 7 folds and at 1 bar were increased 15 and 16 folds, on the average, compared to their air oxidized and nitric acid oxidized supports, respectively. PMID:23500788

  11. PET Imaging and biodistribution of chemically modified bacteriophage MS2.

    PubMed

    Farkas, Michelle E; Aanei, Ioana L; Behrens, Christopher R; Tong, Gary J; Murphy, Stephanie T; O'Neil, James P; Francis, Matthew B

    2013-01-01

    The fields of nanotechnology and medicine have merged in the development of new imaging and drug delivery agents based on nanoparticle platforms. As one example, a mutant of bacteriophage MS2 can be differentially modified on the exterior and interior surfaces for the concurrent display of targeting functionalities and payloads, respectively. In order to realize their potential for use in in vivo applications, the biodistribution and circulation properties of this class of agents must first be investigated. A means of modulating and potentially improving the characteristics of nanoparticle agents is the appendage of PEG chains. Both MS2 and MS2-PEG capsids possessing interior DOTA chelators were labeled with (64)Cu and injected intravenously into mice possessing tumor xenografts. Dynamic imaging of the agents was performed using PET-CT on a single animal per sample, and the biodistribution at the terminal time point (24 h) was assessed by gamma counting of the organs ex vivo for 3 animals per agent. Compared to other viral capsids of similar size, the MS2 agents showed longer circulation times. Both MS2 and MS2-PEG bacteriophage behaved similarly, although the latter agent showed significantly less uptake in the spleen. This effect may be attributed to the ability of the PEG chains to mask the capsid charge. Although the tumor uptake of the agents may result from the enhanced permeation and retention (EPR) effect, selective tumor imaging may be achieved in the future by using exterior targeting groups. PMID:23214968

  12. Theory of nanoscale friction on chemically modified graphene

    NASA Astrophysics Data System (ADS)

    Ko, Jae-Hyeon; Kim, Yong-Hyun

    2013-03-01

    Recently, it is known from FFM experiments that friction force on graphene is significantly increased by chemical modification such as hydrogenation, oxidization, and fluorination, whereas adhesion properties are altered marginally. A novel nanotribological theory on two-dimensional materials is proposed on the basis of experimental results and first-principles density-functional theory (DFT) calculations. The proposed theory indicates that the total lateral stiffness that is the proportional constant of friction force is mostly associated with the out-of-plane bending stiffness of two-dimensional materials. This contrasts to the case of three-dimensional materials, in which the shear strength of materials determines nanoscale friction. We will discuss details of DFT calculations and how to generalize the current theory to three dimensional materials.

  13. Equilibrium and thermodynamic studies of Cd (II) biosorption by chemically modified orange peel.

    PubMed

    Kumar, Arbind; Kumar, Vipin

    2016-03-01

    Agricultural wastes have great potential of removing heavy metal ions from aqueous solution. Removal of Cd (II) from aqueous solutions onto chemically modified orange peel was studied at different pH, contact time, initial metal concentrations, adsorbent doses and temperature. Batch experiments were carried out under optimized conditions to evaluate the adsorption capacity of orange peel chemically modified with NaOH. The results showed that maximum adsorption capacity of modified orange peel, approximately 97.0%, was observed 3 mg 1⁻¹ of initial Cd(II) concentration pH 6 for 4 g 1⁻¹ adsorbent dosage, 200 min contact time and 298 K temperature. Adsorption efficiency of modified orange peel decreased with increase in temperature indicated exothermic nature of adsorption. A negative value of ΔG⁰(-8.59 kJ mol⁻¹) confirmed the feasibility of adsorption process and spontaneous nature of adsorption. A negative value of ΔH⁰ (-28.08 kJ mol⁻¹) indicated exothermic nature while a negative ΔS⁰ (-66.86 J K⁻¹ mol⁻¹) value suggested decrease in degree of freedom of the adsorbed species. The results showed that biosorption process of Cd(II) ions by chemically modified orange peel is feasible, spontaneous and exothermic under studied conditions. Chemically by modified orange peel investigated in the present study showed good potential for the removal of cadmium from aqueous solutions. PMID:27097438

  14. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  15. Chitosan and chemically modified chitosan beads for acid dyes sorption.

    PubMed

    Azlan, Kamari; Wan Saime, Wan Ngah; Lai Ken, Liew

    2009-01-01

    The capabilities of chitosan and chitosan-EGDE (ethylene glycol diglycidyl ether) beads for removing Acid Red 37 (AR 37) and Acid Blue 25 (AB 25) from aqueous solution were examined. Chitosan beads were cross-linked with EGDE to enhance its chemical resistance and mechanical strength. Experiments were performed as a function of pH, agitation period and concentration of AR 37 and AB 25. It was shown that the adsorption capacities of chitosan for both acid dyes were comparatively higher than those of chitosan-EGDE. This is mainly because cross-linking using EGDE reduces the major adsorption sites -NH3+ on chitosan. Langmuir isotherm model showed the best conformity compared to Freundlich and BET. The kinetic experimental data agreed very well to the pseudo second-order kinetic model. The desorption study revealed that after three cycles of adsorption and desorption by NaOH and HCl, both adsorbents retained their promising adsorption abilities. FT-IR analysis proved that the adsorption of acid dyes onto chitosan-based adsorbents was a physical adsorption. Results also showed that chitosan and chitosan-EGDE beads were favourable adsorbers and could be employed as low-cost alternatives for the removal of acid dyes in wastewater treatment. PMID:19634439

  16. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  17. Sequence-dependent theory of oligonucleotide hybridization kinetics

    SciTech Connect

    Marimuthu, Karthikeyan; Chakrabarti, Raj E-mail: rajc@andrew.cmu.edu

    2014-05-07

    A theoretical approach to the prediction of the sequence and temperature-dependent rate constants for oligonucleotide hybridization reactions has been developed based on the theory of relaxation kinetics. One-sided and two-sided melting reaction mechanisms for oligonucleotide hybridization reactions have been considered, analyzed, modified, and compared to select a physically consistent as well as robust model for prediction of the relaxation times of DNA hybridization reactions that agrees with the experimental evidence. The temperature- and sequence-dependent parameters of the proposed model have been estimated using available experimental data. The relaxation time model that we developed has been combined with the nearest neighbor model of hybridization thermodynamics to estimate the temperature- and sequence-dependent rate constants of an oligonucleotide hybridization reaction. The model-predicted rate constants are compared to experimentally determined rate constants for the same oligonucleotide hybridization reactions. Finally, we consider a few important applications of kinetically controlled DNA hybridization reactions.

  18. [Preparative isolation of tetra-, penta- and hexapurine oligonucleotides from partial hydrolysates of depyrimidinated herring sperm DNA].

    PubMed

    Schott, H; Schrade, H

    1984-02-01

    Herring sperm DNA is chemically degraded to a complex mixture of purine nucleotides. The oligonucleotides are separated from the partial hydrolysates by column chromatography. The resulting mixture of trimer to hexamer purine oligonucleotides is subsequently fractionated on QAE-Sephadex into different mixtures of sequence-isomeric purine oligonucleotides. In a final separation, which uses reversed-phase (Nucleosil C18) high-performance liquid chromatography, these mixtures are separated under isocratic conditions into 35 pure defined purine oligonucleotides with four to six monomer units, 14 defined mixtures of sequence-isomeric purine oligonucleotides and several unidentified products. Purity and sequence of the isolated oligonucleotides are determined by the "fingerprint" method. The results of the high-performance liquid chromatographic and the "fingerprint" methods of the isolated oligonucleotides are discussed. PMID:6707126

  19. Insights into the electrocatalysis of nitrobenzene using chemically-modified carbon nanotube electrodes

    PubMed Central

    Sang, Yutao; Wang, Baoyan; Wang, Qinchao; Zhao, George; Guo, Peizhi

    2014-01-01

    The electrochemical behavior of nitrobenzene and its derivatives at chemically-functionalized multi-wall carbon nanotubes (MWNTs) modified electrodes was studied. Experimental results showed that hydroxyl-containing MWNTs exhibited the highest electrocatalytic activity among the used MWNTs because of its weak capacitive features and oxygen-containing functional groups. The cycle voltammetrys of nitrobenzene derivatives on the MWNTs modified electrodes can be easily tuned by changing the substituted groups of nitrobenzene. Based on the experimental data, the electrochemical reaction mechanisms of nitrobenzene and its derivatives on the MWNTs modified electrodes have been discussed and analyzed. PMID:25204889

  20. Modified clay minerals efficiency against chemical and biological warfare agents for civil human protection.

    PubMed

    Plachá, Daniela; Rosenbergová, Kateřina; Slabotínský, Jiří; Kutláková, Kateřina Mamulová; Studentová, Soňa; Martynková, Gražyna Simha

    2014-04-30

    Sorption efficiencies of modified montmorillonite and vermiculite of their mono ionic Na and organic HDTMA and HDP forms were studied against chemical and biological warfare agents such as yperite and selected bacterial strains. Yperite interactions with modified clay minerals were observed through its capture in low-density polyethylene foil-modified clay composites by measuring yperite gas permeation with using chemical indication and gas chromatography methods. The antibacterial activities of synthetized organoclays were tested against selected Gram-positive and Gram-negative bacterial species in minimum inhibitory concentration tests. The obtained results showed a positive influence of modified clay minerals on the significant yperite breakthrough-time increase. The most effective material was the polyethylene-Na form montmorillonite, while the polyethylene-Na form vermiculite showed the lowest efficiency. With increasing organic cations loading in the interlayer space the montmorillonite efficiency decreased, and in the case of vermiculite an opposite effect was observed. Generally the modified montmorillonites were more effective than modified vermiculites. The HDP cations seem to be more effective compare to the HDTMA. The antibacterial activity tests confirmed efficiency of all organically modified clay minerals against Gram-positive bacteria. The confirmation of antibacterial activity against Y. pestis, plague bacteria, is the most interesting result of this part of the study. PMID:24603112

  1. Expanding the chemical toolbox for the synthesis of large and uniquely modified proteins

    NASA Astrophysics Data System (ADS)

    Bondalapati, Somasekhar; Jbara, Muhammad; Brik, Ashraf

    2016-05-01

    Methods to prepare proteins that include a specific modification at a desired position are essential for understanding their cellular functions and physical properties in living systems. Chemical protein synthesis, which relies on the chemoselective ligation of unprotected peptides, enables the preparation of modified proteins that are not easily fabricated by other methods. In contrast to recombinant approaches, chemical synthesis can be used to prepare protein analogues such as D-proteins, which are useful in protein structure determination and the discovery of novel therapeutics. Post-translationally modifying proteins is another example where chemical protein synthesis proved itself as a powerful approach for preparing samples with high homogeneity and in workable quantities. In this Review, we discuss the basic principles of the field, focusing on novel chemoselective peptide ligation approaches such as native chemical ligation and the recent advances based on this method with a proven record of success in the synthesis of highly important protein targets.

  2. Chemical and Biological Tools for the Preparation of Modified Histone Proteins

    PubMed Central

    Howard, Cecil J.; Yu, Ruixuan R.; Gardner, Miranda L.; Shimko, John C.; Ottesen, Jennifer J.

    2016-01-01

    Eukaryotic chromatin is a complex and dynamic system in which the DNA double helix is organized and protected by interactions with histone proteins. This system is regulated through, a large network of dynamic post-translational modifications (PTMs) exists to ensure proper gene transcription, DNA repair, and other processes involving DNA. Homogenous protein samples with precisely characterized modification sites are necessary to better understand the functions of modified histone proteins. Here, we discuss sets of chemical and biological tools that have been developed for the preparation of modified histones, with a focus on the appropriate choice of tool for a given target. We start with genetic approaches for the creation of modified histones, including the incorporation of genetic mimics of histone modifications, chemical installation of modification analogs, and the use of the expanded genetic code to incorporate modified amino acids. Additionally, we will cover the chemical ligation techniques that have been invaluable in the generation of complex modified histones that are indistinguishable from the natural counterparts. Finally, we will end with a prospectus on future directions of synthetic chromatin in living systems. PMID:25863817

  3. Stable dye-labelled oligonucleotide-nanoparticle conjugates for nucleic acid detection

    NASA Astrophysics Data System (ADS)

    Barrett, Lee; Dougan, Jennifer A.; Faulds, Karen; Graham, Duncan

    2011-08-01

    Metallic nanoparticles functionalized with oligonucleotides are used for a number of nucleic acid detection strategies. However, oligonucleotide-nanoparticle conjugates suffer from a lack of stability when exposed to certain conditions associated with DNA detection assays. In this study, we report the synthesis of thiol and thioctic acid-modified oligonucleotide gold nanoparticle (OGNs) conjugates functionalized with a dye label and varying spacer groups. The thioctic acid-modified conjugates exhibit increased stability when treated with dithiothreitol (DTT) compared to the more commonly used thiol modification. When the dye labelled oligonucleotide nanoparticle conjugates are exposed to the same conditions there is a pronounced increase in the stability for both thioctic acid and thiol modified sequences. These results open up the possibility of simply using a dye label to enhance the stability of oligonucleotide-nanoparticle conjugates in DNA detection assays where the enhanced stability of the conjugate system can be advantageous in more complex biological environments.

  4. CHARACTERIZATION OF CHEMICALLY MODIFIED HYPERTHERMOPHILIC ENZYMES FOR CHEMICAL SYNTHESES AND BIOREMEDIATION REACTIONS

    EPA Science Inventory

    Research developments in the area of biocatalysis in organic solvents are expected to greatly expand the role of bioprocessing in chemical synthesis, fuel processing, and bioremediation technologies. Many biological transformation reactions of interest to DOE site remediation inv...

  5. Optical characterization of pure and chemically modified chitosan bio-films

    NASA Astrophysics Data System (ADS)

    Nosal, William H.

    The purpose of this work was to apply spectroscopic ellipsometry (SE) to the study of monolayer thick chemically modified surfaces and then study the protein attachment or rejection of these films. Optical properties of spin-cast pure and chemically modified chitosan films have been determined in the infrared (IR), visible (vis), ultraviolet (UV), and vacuum ultraviolet (VUV) regions of the spectrum using spectroscopic ellipsometry (SE). Vis-SE data were used to monitor protein attachment or nonattachment to the surface of the chemically modified chitosan using real-time SE. Optical constants for the UV-Vis-near IR spectra from 130nm to 1700nm were determined on dried samples. Optical constants were modeled using Cauchy dispersion forms combined with Lorentzian oscillator models in the absorptive shorter wavelength regions. Infrared refraction index and extinction coefficients from 750cm -1 to 4000cm-1 were determined using ellipsometric data fits to dispersion models based on harmonic oscillators. This modeling determined that optical anisotropy was present and measurable over all wavelength regions of ellipsometric data. VUV adsorption was accounted for by including Gaussian and Tauc-Lorentz shaped oscillators in the optical model. IR-SE and VUV-SE data were used to confirm that chemical modifications to the surface occurred. IR spectra are well known for identifying resonant chemical bonds. However, VUV-SE simultaneously offers resonances for chemical identifications and high surface sensitivity due to shallow depth of optical penetration. To obtain additional information on the micro-scale and nano-scale surface structure, tapping mode AFM imaging was employed to determine morphology and roughness information of dry modified and pure spin-cast chitosan films.

  6. Modified Nucleoside Triphosphates for In-vitro Selection Techniques

    PubMed Central

    Dellafiore, María A.; Montserrat, Javier M.; Iribarren, Adolfo M.

    2016-01-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed. PMID:27200340

  7. Modified Nucleoside Triphosphates for In-vitro Selection Techniques.

    PubMed

    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M

    2016-01-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed. PMID:27200340

  8. Modified Nucleoside Triphosphates for in-vitro Selection Techniques

    NASA Astrophysics Data System (ADS)

    Iribarren, Adolfo; Dellafiore, María; Montserrat, Javier

    2016-05-01

    The development of SELEX (Selective Enhancement of Ligands by Exponential Enrichment) provides a powerful tool for the search of functional oligonucleotides with the ability to bind ligands with high affinity and selectivity (aptamers) and for the discovery of nucleic acid sequences with diverse enzymatic activities (ribozymes and DNAzymes). This technique has been extensively applied to the selection of natural DNA or RNA molecules but, in order to improve chemical and structural diversity as well as for particular applications where further chemical or biological stability is necessary, the extension of this strategy to modified oligonucleotides is desirable. Taking into account these needs, this review intends to collect the research carried out during the past years, focusing mainly on the use of modified nucleotides in SELEX and the development of mutant enzymes for broadening nucleoside triphosphates acceptance. In addition, comments regarding the synthesis of modified nucleoside triphosphate will be briefly discussed.

  9. Working with Oligonucleotide Arrays.

    PubMed

    Carvalho, Benilton S

    2016-01-01

    Preprocessing microarray data consists of a number of statistical procedures that convert the observed intensities into quantities that represent biological events of interest, like gene expression and allele-specific abundances. Here, we present a summary of the theory behind microarray data preprocessing for expression, whole transcriptome and SNP designs and focus on the computational protocol used to obtain processed data that will be used on downstream analyses. We describe the main features of the oligo Bioconductor package, an application designed to support oligonucleotide microarrays using the R statistical environment and the infrastructure provided by Bioconductor, allowing the researcher to handle probe-level data and interface with advanced statistical tools under a simplified framework. We demonstrate the use of the package by preprocessing data originated from three different designs. PMID:27008013

  10. Process for preparing chemically modified micas for removal of cesium salts from aqueous solution

    SciTech Connect

    Yates, Stephen Frederic; DeFilippi, Irene; Gaita, Romulus; Clearfield, Abraham; Bortun, Lyudmila; Bortun, Anatoly

    2000-09-05

    A chemically modified mica composite formed by heating a trioctahedral mica in an aqueous solution of sodium chloride having a concentration of at least 1 mole/liter at a temperature greater than 180 degrees Centigrade for at least 20 hours, thereby replacing exchangeable ions in the mica with sodium. Formation is accomplished at temperatures and pressures which are easily accessed by industrial equipment. The reagent employed is inexpensive and non-hazardous, and generates a precipitate which is readily separated from the modified mica.

  11. Catalytic conversion of biomass pyrolysis-derived compounds with chemical liquid deposition (CLD) modified ZSM-5.

    PubMed

    Zhang, Huiyan; Luo, Mengmeng; Xiao, Rui; Shao, Shanshan; Jin, Baosheng; Xiao, Guomin; Zhao, Ming; Liang, Junyu

    2014-03-01

    Chemical liquid deposition (CLD) with KH550, TEOS and methyl silicone oil as the modifiers was used to modify ZSM-5 and deposit its external acid sites. The characteristics of modified catalysts were tested by catalytic conversion of biomass pyrolysis-derived compounds. The effects of different modifying conditions (deposited amount, temperature, and time) on the product yields and selectivities were investigated. The results show KH550 modified ZSM-5 (deposited amount of 4%, temperature of 20°C and time of 6h) produced the maximum yields of aromatics (24.5%) and olefins (16.5%), which are much higher than that obtained with original ZSM-5 catalyst (18.8% aromatics and 9.8% olefins). The coke yield decreased from 44.1% with original ZSM-5 to 26.7% with KH550 modified ZSM-5. The selectivities of low-molecule-weight hydrocarbons (ethylene and benzene) decreased, while that of higher molecule-weight hydrocarbons (propylene, butylene, toluene, and naphthalene) increased comparing with original ZSM-5. PMID:24413482

  12. Towards electron transport measurements in chemically modified graphene: effect of a solvent

    NASA Astrophysics Data System (ADS)

    Jacobsen, Arnhild; Koehler, Fabian M.; Stark, Wendelin J.; Ensslin, Klaus

    2010-12-01

    The chemical functionalization of graphene modifies the local electron density of carbon atoms and hence electron transport. Measuring these changes allows for a closer understanding of the chemical interaction and the influence of functionalization on the graphene lattice. However, not only chemistry, in this case diazonium chemistry, has an effect on electron transport. The latter is also influenced by defects and dopants resulting from different processing steps. Here, we show that the solvents used in the chemical reaction process change the transport properties. In more detail, the investigated combination of isopropanol and heating treatment reduces the doping concentration and significantly increases the mobility of graphene. Furthermore, isopropanol treatment alone increases the concentration of dopants and introduces an asymmetry between electron and hole transport, which might be difficult to distinguish from the effect of functionalization. The results shown in this work demand a closer look at the influence of solvents used for chemical modification in order to understand their influence.

  13. In vivo natriuretic peptide reporter assay identifies chemical modifiers of hypertrophic cardiomyopathy signalling

    PubMed Central

    Becker, Jason R.; Robinson, Tamara Y.; Sachidanandan, Chetana; Kelly, Amy E.; Coy, Shannon; Peterson, Randall T.; MacRae, Calum A.

    2012-01-01

    Aims Despite increased understanding of the fundamental biology regulating cardiomyocyte hypertrophy and heart failure, it has been challenging to find novel chemical or genetic modifiers of these pathways. Traditional cell-based methods do not model the complexity of an intact cardiovascular system and mammalian models are not readily adaptable to chemical or genetic screens. Our objective was to create an in vivo model suitable for chemical and genetic screens for hypertrophy and heart failure modifiers Methods and results Using the developing zebrafish, we established that the cardiac natriuretic peptide genes (nppa and nppb), known markers of cardiomyocyte hypertrophy and heart failure, were induced in the embryonic heart by pathological cardiac stimuli. This pathological induction was distinct from the developmental regulation of these genes. We created a luciferase-based transgenic reporter line that accurately modelled the pathological induction patterns of the zebrafish nppb gene. Utilizing this reporter line, we were able to show remarkable conservation of pharmacological responses between the larval zebrafish heart and adult mammalian models. Conclusion By performing a focused screen of chemical agents, we were able to show a distinct response of a genetic model of hypertrophic cardiomyopathy to the histone deacetylase inhibitor, Trichostatin A, and the mitogen-activated protein kinase kinase 1/2 inhibitor, U0126. We believe this in vivo reporter line will offer a unique approach to the identification of novel chemical or genetic regulators of myocardial hypertrophy and heart failure. PMID:22198505

  14. Radiation-grafted, chemically modified membranes part I - Synthesis of a selective aluminum material

    NASA Astrophysics Data System (ADS)

    Bazante-Yamaguishi, Renata; Moura, Eduardo; Manzoli, José E.; Geraldo, Aurea B. C.

    2014-01-01

    Polymeric membranes were styrene grafted by irradiation methods and the obtained material was chemically modified to become aluminum selective. For this purpose, polymeric substrates of PVC (polyvinyl chloride) and PP (polypropylene) were styrene grafted mutually by gamma and electron beam irradiation. The modification process includes three basic reaction paths: Friedel-Crafts acylation, 2-methylanisole coupling and a final oxidation to achieve aluminum selectivity. Although this specific chemical modification in derivatives of polystyrene is not new, the new challenge is to obtain a selective material where original membrane characteristics (physical shape and mechanical resistance) are minimally conserved after such an aggressive treatment.

  15. Research on the chemical mechanism in the polyacrylate latex modified cement system

    SciTech Connect

    Wang, Min; Wang, Rumin; Zheng, Shuirong; Farhan, Shameel; Yao, Hao; Jiang, Hao

    2015-10-15

    In this paper, the chemical mechanism in the polyacrylate latex modified cement system was investigated by Fourier transform infrared spectra (FT-IR), X-ray photoelectron spectroscopy (XPS), gel permeation chromatography (GPC) and compact pH meter. All results have shown that the chemical reactions in the polyacrylate modified system can be divided into three stages. The hydration reactions of cement can produce large amounts of Ca(OH){sub 2} (calcium hydroxide) and lead the whole system to be alkali-rich and exothermic at the first stage. Subsequently, this environment can do great contributions to the hydrolysis of ester groups in the polyacrylate chains, resulting in the formation of carboxyl groups at the second stage. At the third stage, the final crosslinked network structure of the product was obtained by the reaction between the carboxyl groups in the polyacrylate latex chains and Ca(OH){sub 2}.

  16. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides

    PubMed Central

    Wang, Shiyu; Sun, Hong; Tanowitz, Michael; Liang, Xue-hai; Crooke, Stanley T.

    2016-01-01

    Chemically modified antisense oligonucleotides (ASOs) designed to mediate site-specific cleavage of RNA by RNase H1 are used as research tools and as therapeutics. ASOs modified with phosphorothioate (PS) linkages enter cells via endocytotic pathways. The mechanisms by which PS-ASOs are released from membrane-enclosed endocytotic organelles to reach target RNAs remain largely unknown. We recently found that annexin A2 (ANXA2) co-localizes with PS-ASOs in late endosomes (LEs) and enhances ASO activity. Here, we show that co-localization of ANXA2 with PS-ASO is not dependent on their direct interactions or mediated by ANXA2 partner protein S100A10. Instead, ANXA2 accompanies the transport of PS-ASOs to LEs, as ANXA2/PS-ASO co-localization was observed inside LEs. Although ANXA2 appears not to affect levels of PS-ASO internalization, ANXA2 reduction caused significant accumulation of ASOs in early endosomes (EEs) and reduced localization in LEs and decreased PS-ASO activity. Importantly, the kinetics of PS-ASO activity upon free uptake show that target mRNA reduction occurs at least 4 hrs after PS-ASOs exit from EEs and is coincident with release from LEs. Taken together, our results indicate that ANXA2 facilitates PS-ASO trafficking from early to late endosomes where it may also contribute to PS-ASO release. PMID:27378781

  17. Effect of chemical heterogeneity on photoluminescence of graphite oxide treated with S-/N-containing modifiers

    NASA Astrophysics Data System (ADS)

    Ebrahim, Amani M.; Rodríguez-Castellón, Enrique; Montenegro, José María; Bandosz, Teresa J.

    2015-03-01

    Graphite oxide (GO) obtained using Hummers method was modified by hydrothermal treatment either with sulfanilic acid or polystyrene (3-ammonium) sulfonate at 100 °C or 85 °C, respectively. Both modifiers contain sulfur in the oxidized forms and nitrogen in the reduced forms. The materials were characterized using FTIR, XPS, thermal analysis, potentiometric titration and SEM. Their photoluminescent properties and their alteration with an addition of Ag+ were also measured. As a result of these modifications nitrogen was introduced to the graphene layers as amines, imides, amides, and sulfur as sulfones and sulfonic acids. Moreover, the presence of polyaniline was detected. This significantly affected the polarity, acid-base character, and conductivity of the materials. Apparently carboxylic groups of GO were involved in the surface reactions. The modified GOs lost their layered structure and the modifications resulted in the high degree of structural and chemical heterogeneity. Photoluminescence in visible light was recorded and linked to the presence of heteroatoms. For the polystyrene (3-ammonium) sulfonate modified sample addition of Ag+ quenched the photoluminescence at low wavelength showing sensitivity as a possible optical detector. No apparent effect was found for the sulfanilic acid modified sample.

  18. Gene-modified embryonic stem cell test to characterize chemical risks.

    PubMed

    Kitada, Kohei; Kizu, Akane; Teramura, Takeshi; Takehara, Toshiyuki; Hayashi, Masami; Tachibana, Daisuke; Wanibuchi, Hideki; Fukushima, Shoji; Koyama, Masayasu; Yoshida, Kayo; Morita, Takashi

    2015-11-01

    A high-throughput test of cell growth inhibition was performed using mouse embryonic stem (ES) cells to assess chemical toxicities. We herein demonstrated using a 96-well culture plate approach and the MTT assay that this method was suitable for prioritization of chemicals for their cytotoxic properties. In order to categorize chemicals, we used p53 gene-modified mouse ES cells as well as wild-type ES cells. The p53 gene is a well-known tumor suppressor and controls programmed cell death (apoptosis) and cellular senescence that is triggered by DNA-damaging agents such as alkylating agents and radiation. In the present study, p53-deficient ES cells were found to be more resistant to a tumor initiator, diethylnitrosamine (DEN), than wild-type ES cells, suggesting the inhibition of apoptosis or senescence by a dysfunction in p53. Chromosome aberrations were more frequently detected in p53-deficient ES cells than in wild-type cells, indicating genomic instability due to the deletion of p53. Other tumor initiators, methyl methanesulfonate (MMS) and N-methyl-N-nitrosourea (NMU), did not reveal apparent differences in cytotoxicity between wild-type and p53-deficient ES cells. Thus, ES test system using gene-modified ES cells may be used to categorize chemicals by detecting their characteristic effects on apoptosis, genotoxic potentials as well as general cytotoxicity. PMID:26206128

  19. Chemically modified biochar produced from conocarpus waste increases NO3 removal from aqueous solutions.

    PubMed

    Usman, Adel R A; Ahmad, Mahtab; El-Mahrouky, Mohamed; Al-Omran, Abdulrasoul; Ok, Yong Sik; Sallam, Abdelazeem Sh; El-Naggar, Ahmed H; Al-Wabel, Mohammad I

    2016-04-01

    Biochar has emerged as a universal sorbent for the removal of contaminants from water and soil. However, its efficiency is lower than that of commercially available sorbents. Engineering biochar by chemical modification may improve its sorption efficiency. In this study, conocarpus green waste was chemically modified with magnesium and iron oxides and then subjected to thermal pyrolysis to produce biochar. These chemically modified biochars were tested for NO3 removal efficiency from aqueous solutions in batch sorption isothermal and kinetic experiments. The results revealed that MgO-biochar outperformed other biochars with a maximum NO3 sorption capacity of 45.36 mmol kg(-1) predicted by the Langmuir sorption model. The kinetics data were well described by the Type 1 pseudo-second-order model, indicating chemisorption as the dominating mechanism of NO3 sorption onto biochars. Greater efficiency of MgO-biochar was related to its high specific surface area (391.8 m(2) g(-1)) and formation of strong ionic complexes with NO3. At an initial pH of 2, more than 89 % NO3 removal efficiency was observed for all of the biochars. We conclude that chemical modification can alter the surface chemistry of biochar, thereby leading to enhanced sorption capacity compared with simple biochar. PMID:26100325

  20. Transfer of Chemically Modified Graphene with Retention of Functionality for Surface Engineering.

    PubMed

    Whitener, Keith E; Lee, Woo-Kyung; Bassim, Nabil D; Stroud, Rhonda M; Robinson, Jeremy T; Sheehan, Paul E

    2016-02-10

    Single-layer graphene chemically reduced by the Birch process delaminates from a Si/SiOx substrate when exposed to an ethanol/water mixture, enabling transfer of chemically functionalized graphene to arbitrary substrates such as metals, dielectrics, and polymers. Unlike in previous reports, the graphene retains hydrogen, methyl, and aryl functional groups during the transfer process. This enables one to functionalize the receiving substrate with the properties of the chemically modified graphene (CMG). For instance, magnetic force microscopy shows that the previously reported magnetic properties of partially hydrogenated graphene remain after transfer. We also transfer hydrogenated graphene from its copper growth substrate to a Si/SiOx wafer and thermally dehydrogenate it to demonstrate a polymer- and etchant-free graphene transfer for potential use in transmission electron microscopy. Finally, we show that the Birch reduction facilitates delamination of CMG by weakening van der Waals forces between graphene and its substrate. PMID:26784372

  1. Chemically modified Si(111) surfaces simultaneously demonstrating hydrophilicity, resistance against oxidation, and low trap state densities

    NASA Astrophysics Data System (ADS)

    Brown, Elizabeth S.; Hlynchuk, Sofiya; Maldonado, Stephen

    2016-03-01

    Chemically modified Si(111) surfaces have been prepared through a series of wet chemical surface treatments that simultaneously show resistance towards surface oxidation, selective reactivity towards chemical reagents, and areal defect densities comparable to unannealed thermal oxides. Specifically, grazing angle attenuated total reflectance infrared and X-ray photoelectron (XP) spectroscopies were used to characterize allyl-, 3,4-methylenedioxybenzene-, or 4-[bis(trimethylsilyl)amino]phenyl-terminated surfaces and the subsequently hydroxylated surfaces. Hydroxylated surfaces were confirmed through reaction with 4-(trifluoromethyl)benzyl bromide and quantified by XP spectroscopy. Contact angle measurements indicated all surfaces remained hydrophilic, even after secondary backfilling with CH3sbnd groups. Surface recombination velocity measurements by way of microwave photoconductivity transients showed the relative defect-character of as-prepared and aged surfaces. The relative merits for each investigated surface type are discussed.

  2. Prompt activation of telomerase by chemical carcinogens in rats detected with a modified TRAP assay.

    PubMed

    Miura, M; Karasaki, Y; Abe, T; Higashi, K; Ikemura, K; Gotoh, S

    1998-05-01

    The maintenance of telomere length is crucial for survival of cells. Telomerase is an RNA-containing reverse transcriptase, which is responsible for elongation of shortened telomeres. Telomerase reactivation has been suggested to be involved in malignant progressions. To study on the involvement of telomerase activation in in vivo carcinogenesis, we first modified the original TRAP assay by changing the primer designs and the labeling method of PCR products to an end-labeling method. Second, we investigated the activation of telomerase in different organs after treatments of rats with various chemical carcinogens. Very early after the beginning of the treatment, telomerase activity in the liver, kidney, and lung was increased. In most cases, telomerase activation occurred in the primary or favorite target organs. The present results suggest that telomerase activation occurs promptly when animals are exposed to chemical carcinogens, which may contribute to in vivo chemical carcinogenesis. PMID:9600060

  3. Synthesis of chimeric oligonucleotides containing phosphodiester, phosphorothioate, and phosphoramidate linkages.

    PubMed

    Maier, M A; Guzaev, A P; Manoharan, M

    2000-06-29

    [reaction: see text] H-Phosphonate monomers of 2'-O-(2-methoxyethyl) ribonucleosides have been synthesized. Oxidation of oligonucleotide H-phosphonates has been optimized to allow the synthesis of oligonucleotides containing either 2'-deoxy or 2'-O-(2-methoxyethyl) ribonucleoside residues combined with three different phosphate modifications in the backbone, i.e., phosphodiester (PO), phosphorothioate (PS), and phosphoramidate (PN). Phosphodiester linkages were introduced by oxidation with a cocktail of 0.1 M Et(3)N in CCl(4)/Pyr/H(2)O (5:9:1) without affecting phosphorothioate or phosphoramidate linkages. For the synthesis of phosphoramidate-modified oligonucleotides, N(4)-acetyl deoxycytidine-3'-H-phosphonate monomers were used to avoid transamination during the oxidation step. PMID:10891166

  4. Chemically modified nucleic acid aptamers for in vitro selections: evolving evolution.

    PubMed

    Kusser, W

    2000-03-01

    Combinatorial library selections through the systematic evolution of ligands by exponential enrichment (SELEX) technique identify so-called nucleic acid aptamers that bind with high-affinity and specificity to a wide range of selected molecules. However, the modest chemical functionality of nucleic acids poses some limits on their versatility as binders and catalysts, and, furthermore, the sensitivity of pure RNA- and DNA-based aptamers to nucleases restricts their use as therapeutic and diagnostic agents. Here we review synthetic chemistries for modifying nucleotides that have been developed to enhance the affinity of aptamers for targets and to increase their stability in biological fluids. Implementation of in vitro selections with modified nucleotides promises to be an elegant technique for the creation of ligands with novel physical and chemical properties and is anticipated to have a significant impact on biotechnology, diagnostics and drug development. The current molecular designs and applications of modified nucleotides for in vitro selections are reviewed, along with a discussion of future developments expected to further the utility of this approach in both practical and theoretical terms. PMID:10943570

  5. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  6. Silencing of Inducible Immunoproteasome Subunit Expression by Chemically Modified siRNA and shRNA.

    PubMed

    Gvozdeva, Olga V; Prassolov, Vladimir S; Zenkova, Marina A; Vlassov, Valentin V; Chernolovskaya, Elena L

    2016-08-01

    Overexpression of inducible subunits of immunoproteasome is related to pathogenesis of some chronic diseases. Specific inhibition of the immunosubunits may be used for the treatment of these diseases and RNA interference is one of the potent methods used in this area. We designed 2'-O-methyl modified siRNAs with selectively protected nuclease-sensitive sites, which efficiently silence LMP2, LMP7, and MECL-1 genes expression. To provide stable long-lasting inhibition of target genes, short-hairpin RNAs (shRNA) expressed by lentiviral vectors were constructed. Our results demonstrated that chemically modified siRNAs inhibited the expression of target genes with similar efficiency or with efficiency exceeding that of corresponding shRNAs and provide silencing effect for 5 days. PMID:27351110

  7. The Use of Aryl Hydrazide Linkers for the Solid Phase Synthesis of Chemically Modified Peptides

    SciTech Connect

    Woo, Y; Mitchell, A R; Camarero, J A

    2006-11-03

    Since Merrifield introduced the concept of solid phase synthesis in 1963 for the rapid preparation of peptides, a large variety of different supports and resin-linkers have been developed that improve the efficiency of peptide assembly and expand the myriad of synthetically feasible peptides. The aryl hydrazide is one of the most useful resin-linkers for the synthesis of chemically modified peptides. This linker is completely stable during Boc- and Fmoc-based solid phase synthesis and yet it can be cleaved under very mild oxidative conditions. The present article reviews the use of this valuable linker for the rapid and efficient synthesis of C-terminal modified peptides, head-to-tail cyclic peptides and lipidated peptides.

  8. Peeling single-stranded DNA from graphite surface to determine oligonucleotide binding energy by force spectroscopy.

    PubMed

    Manohar, Suresh; Mantz, Amber R; Bancroft, Kevin E; Hui, Chung-Yuen; Jagota, Anand; Vezenov, Dmitri V

    2008-12-01

    We measured the force required to peel single-stranded DNA molecules from single-crystal graphite using chemical force microscopy. Force traces during retraction of a tip chemically modified with oligonucleotides displayed characteristic plateaus with abrupt force jumps, which we interpreted as a steady state peeling process punctuated by complete detachment of one or more molecules. We were able to differentiate between bases in pyrimidine homopolymers; peeling forces were 85.3 - 4.7 pN for polythymine and 60.8 +/- 5.5 pN for polycytosine, substantially independent of salt concentration and the rate of detachment. We developed a model for peeling a freely jointed chain from the graphite surface and estimated the average binding energy per monomer to be 11.5 +/- 0.6 k(B)T and 8.3 +/- 0.7 k(B)T in the cases of thymine and cytosine nucleotides, respectively. The equilibrium free-energy profile simulated using molecular dynamics had a potential well of 18.9 k(B)T for thymidine, showing that nonelectrostatic interactions dominate the binding. The discrepancy between the experiment and theory indicates that not all bases are adsorbed on the surface or that there is a population of conformations in which they adsorb. Force spectroscopy using oligonucleotides covalently linked to AFM tips provides a flexible and unambiguous means to quantify the strength of interactions between DNA and a number of substrates, potentially including nanomaterials such as carbon nanotubes. PMID:19368004

  9. Size-dependent mobility of gold nano-clusters during growth on chemically modified graphene

    SciTech Connect

    Bell, Gavin R. Dawson, Peter M.; Pandey, Priyanka A.; Wilson, Neil R.; Mulheran, Paul A.

    2014-01-01

    Gold nano-clusters were grown on chemically modified graphene by direct sputter deposition. Transmission electron microscopy of the nano-clusters on these electron-transparent substrates reveals an unusual bimodal island size distribution (ISD). A kinetic Monte Carlo model of growth incorporating a size-dependent cluster mobility rule uniquely reproduces the bimodal ISD, providing strong evidence for the mobility of large clusters during surface growth. The cluster mobility exponent of −5/3 is consistent with cluster motion via one-dimensional diffusion of gold atoms around the edges of the nano-clusters.

  10. Adsorption characteristics of metal ions on chitosan chemically modified by D-galactose

    SciTech Connect

    Kondo, Kazuo; Sumi, Hisaharu; Matsumoto, Michiaki

    1996-07-01

    The adsorption characteristics of metal ions on chitosan chemically modified by D-galactose were examined. The pH dependency on the distribution ratio was found to be affected by the valency of the metal ion, and the apparent adsorption equilibrium constants of the metal ions were determined. The order of adsorption of the metal ions is Ga > In > Nd > Eu for the trivalent metal ions and Cu > Ni > Co for the divalent metal ions. It is believed that amino and hydroxyl groups in the chitosan act as a chelating ligand.

  11. An Efficient Protection-Free One-Pot Chemical Synthesis of Modified Nucleoside-5'-Triphosphates.

    PubMed

    Shanmugasundaram, Muthian; Senthilvelan, Annamalai; Xiao, Zejun; Kore, Anilkumar R

    2016-07-01

    A simple, reliable, and an efficient "one-pot, three step" chemical method for the synthesis of modified nucleoside triphosphates such as 5-methylcytidine-5'-triphosphate (5-MeCTP), pseudouridine-5'-triphosphate (pseudoUTP) and N(1)-methylpseudouridine-5'-triphosphate (N(1)-methylpseudoUTP) starting from the corresponding nucleoside is described. The overall reaction involves the monophosphorylation of nucleoside, followed by the reaction with pyrophosphate and subsequent hydrolysis of the cyclic intermediate to furnish the corresponding NTP in moderate yields with high purity (>99.5%). PMID:27159048

  12. Peroxide-modified titanium dioxide: a chemical analog of putative Martian soil oxidants

    NASA Technical Reports Server (NTRS)

    Quinn, R. C.; Zent, A. P.

    1999-01-01

    Hydrogen peroxide chemisorbed on titanium dioxide (peroxide-modified titanium dioxide) is investigated as a chemical analog to the putative soil oxidants responsible for the chemical reactivity seen in the Viking biology experiments. When peroxide-modified titanium dioxide (anatase) was exposed to a solution similar to the Viking labeled release (LR) experiment organic medium, CO2 gas was released into the sample cell headspace. Storage of these samples at 10 degrees C for 48 hr prior to exposure to organics resulted in a positive response while storage for 7 days did not. In the Viking LR experiment, storage of the Martian surface samples for 2 sols (approximately 49 hr) resulted in a positive response while storage for 141 sols essentially eliminated the initial rapid release of CO2. Heating the peroxide-modified titanium dioxide to 50 degrees C prior to exposure to organics resulted in a negative response. This is similar to, but not identical to, the Viking samples where heating to approximately 46 degrees C diminished the response by 54-80% and heating to 51.5 apparently eliminated the response. When exposed to water vapor, the peroxide-modified titanium dioxide samples release O2 in a manner similar to the release seen in the Viking gas exchange experiment (GEx). Reactivity is retained upon heating at 50 degrees C for three hours, distinguishing this active agent from the one responsible for the release of CO2 from aqueous organics. The release of CO2 by the peroxide-modified titanium dioxide is attributed to the decomposition of organics by outer-sphere peroxide complexes associated with surface hydroxyl groups, while the release of O2 upon humidification is attributed to more stable inner-sphere peroxide complexes associated with Ti4+ cations. Heating the peroxide-modified titanium dioxide to 145 degrees C inhibited the release of O2, while in the Viking experiments heating to this temperature diminished but did not eliminated the response. Although the

  13. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  14. A Mechanistic Study of Chemically Modified Inorganic Membranes for Gas and Liquid Separations

    SciTech Connect

    Way, J Douglas

    2011-01-21

    This final report will summarize the progress made during the period August 1, 1993 - October 31, 2010 with support from DOE grant number DE-FG03-93ER14363. The objectives of the research have been to investigate the transport mechanisms in micro- and mesoporous, metal oxide membranes and to examine the relationship between the microstructure of the membrane, the membrane surface chemistry, and the separation performance of the membrane. Examples of the membrane materials under investigation are the microporous silica hollow fiber membrane manufactured by PPG Industries, chemically modified mesoporous oxide membranes, and polymer membranes containing microporous oxides (mixed matrix membranes). Analytical techniques such as NMR, FTIR and Raman spectroscopy, thermal analysis, and gas adsorption were used to investigate membrane microstructure and to probe the chemical interactions occurring at the gas-membrane interface.

  15. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells.

    PubMed

    Hendel, Ayal; Bak, Rasmus O; Clark, Joseph T; Kennedy, Andrew B; Ryan, Daniel E; Roy, Subhadeep; Steinfeld, Israel; Lunstad, Benjamin D; Kaiser, Robert J; Wilkens, Alec B; Bacchetta, Rosa; Tsalenko, Anya; Dellinger, Douglas; Bruhn, Laurakay; Porteus, Matthew H

    2015-09-01

    CRISPR-Cas-mediated genome editing relies on guide RNAs that direct site-specific DNA cleavage facilitated by the Cas endonuclease. Here we report that chemical alterations to synthesized single guide RNAs (sgRNAs) enhance genome editing efficiency in human primary T cells and CD34(+) hematopoietic stem and progenitor cells. Co-delivering chemically modified sgRNAs with Cas9 mRNA or protein is an efficient RNA- or ribonucleoprotein (RNP)-based delivery method for the CRISPR-Cas system, without the toxicity associated with DNA delivery. This approach is a simple and effective way to streamline the development of genome editing with the potential to accelerate a wide array of biotechnological and therapeutic applications of the CRISPR-Cas technology. PMID:26121415

  16. Behaviour of chemical modifiers in the determination of arsenic by electrothermal atomic absorption spectrometry in petroleum products.

    PubMed

    Reboucas, Marcio V; Ferreira, Sergio L C; de Barros Neto, Benicio

    2005-07-15

    Most comparative studies on the efficiency of chemical modifiers have been conducted in aqueous media. In the present work, we proposed a detailed study of the use of different chemical modifiers for direct determination of arsenic in complex organic matrices by electrothermal atomic absorption spectrometry (ETAAS). Palladium, rhodium, tungsten, silver, lanthanum and a mixture of palladium and magnesium were tested. The figures of merit used for evaluation and comparison were acquired in the optimal conditions for each modifier, established by multivariate optimization of the main variables based on Doehlert designs. Singular features were observed for the chemical behaviour of some modifiers in organic matrices compared to aqueous media, such as the worse performance of Pd+Mg modifier and no notice of severe tube corrosion from La application. Lanthanum was chosen as the best chemical modifier for the present application, according to predefined criteria. Lanthanum showed the minimum limit of detection, characteristic concentration and blank signal among all tested species and no effect of the concomitants usually present in petrochemical feedstocks. Using a 200mgL(-1) lanthanum solution as a chemical modifier, the average relative standard deviations of 7 and 16% (at 3-15mugL(-1) level) and characteristic concentrations of 0.47 and 0.77mugL(-1) for naphtha and petroleum condensates, respectively, were observed. PMID:18970155

  17. Supported liquid membrane stability in chiral resolution by chemically and physically modified membranes.

    PubMed

    Molinari, R; Argurio, P

    2001-01-01

    In the present work some stability studies on Supported Liquid Membranes (SLMs) to be used for chiral separations were realized. In particular, primary aim was to determine how a modification of the support surface influences the SLM stability. First, the procedure for support modification was optimised, making a screening of various compounds (sulphuric acid, nitric acid, chromic acid, sodium dodecyl sulphate (SDS), glycerol, oleic alcohol, propylene glycol (PPG), bovine serum albumin (BSA)) and testing their performance by means of contact angle measurements. Next, a second screening was realized by permeation tests in a stirred cell. Finally, to compare the stability of modified with unmodified support in a process of interest for chemical and/or biochemical industries, some permeation tests for resolution of DNB-DL-Leucine were realized in a re-circulation system. Results showed a better surface hydrophilization of chemically modified support and better stability of the sulphonated support. However, in operating conditions a little high stability of the unmodified support was obtained. PMID:11381544

  18. Covering Chemical Diversity of Genetically-Modified Tomatoes Using Metabolomics for Objective Substantial Equivalence Assessment

    PubMed Central

    Hirai, Tadayoshi; Oikawa, Akira; Matsuda, Fumio; Fukushima, Atsushi; Arita, Masanori; Watanabe, Shin; Yano, Megumu; Hiwasa-Tanase, Kyoko; Ezura, Hiroshi; Saito, Kazuki

    2011-01-01

    As metabolomics can provide a biochemical snapshot of an organism's phenotype it is a promising approach for charting the unintended effects of genetic modification. A critical obstacle for this application is the inherently limited metabolomic coverage of any single analytical platform. We propose using multiple analytical platforms for the direct acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an application of our multi-platform approach that assesses the substantial equivalence of tomatoes over-expressing the taste-modifying protein miraculin. In combination, the chosen platforms detected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the LycoCyc database. Following a proof-of-safety approach, we show that % had an acceptable range of variation while simultaneously indicating a reproducible transformation-related metabolic signature. We conclude that multi-platform metabolomics is an approach that is both sensitive and robust and that it constitutes a good starting point for characterizing genetically modified organisms. PMID:21359231

  19. Covering chemical diversity of genetically-modified tomatoes using metabolomics for objective substantial equivalence assessment.

    PubMed

    Kusano, Miyako; Redestig, Henning; Hirai, Tadayoshi; Oikawa, Akira; Matsuda, Fumio; Fukushima, Atsushi; Arita, Masanori; Watanabe, Shin; Yano, Megumu; Hiwasa-Tanase, Kyoko; Ezura, Hiroshi; Saito, Kazuki

    2011-01-01

    As metabolomics can provide a biochemical snapshot of an organism's phenotype it is a promising approach for charting the unintended effects of genetic modification. A critical obstacle for this application is the inherently limited metabolomic coverage of any single analytical platform. We propose using multiple analytical platforms for the direct acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an application of our multi-platform approach that assesses the substantial equivalence of tomatoes over-expressing the taste-modifying protein miraculin. In combination, the chosen platforms detected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the LycoCyc database. Following a proof-of-safety approach, we show that % had an acceptable range of variation while simultaneously indicating a reproducible transformation-related metabolic signature. We conclude that multi-platform metabolomics is an approach that is both sensitive and robust and that it constitutes a good starting point for characterizing genetically modified organisms. PMID:21359231

  20. Chemically modified inulin microparticles serving dual function as a protein antigen delivery vehicle and immunostimulatory adjuvant.

    PubMed

    Gallovic, Matthew D; Montjoy, Douglas G; Collier, Michael A; Do, Clement; Wyslouzil, Barbara E; Bachelder, Eric M; Ainslie, Kristy M

    2016-02-23

    To develop a new subunit vaccine adjuvant, we chemically modified a naturally-occurring, immunostimulatory inulin polysaccharide to produce an acid-sensitive biopolymer (acetalated inulin, Ace-IN). Various hydrophobic Ace-IN polymers were formed into microparticles (MPs) by oil-in-water emulsions followed by solvent evaporation These Ace-IN MPs possessed tunable degradation characteristics that, unlike polyesters used in FDA-approved microparticulate formulations, had only pH-neutral hydrolytic byproducts. Macrophages were passively targeted with cytocompatible Ace-IN MPs. TNF-α production by macrophages treated with Ace-IN MPs could be altered by adjusting the polymers' chemistry. Mice immunized with Ace-IN MPs encapsulating a model ovalbumin (OVA) antigen showed higher production of anti-OVA IgG antibody levels relative to soluble antigen. The antibody titers were also comparable to an alum-based formulation. This proof-of-concept establishes the potential for chemically-modified inulin MPs to simultaneously enable dual functionality as a stimuli-controlled antigen delivery vehicle and immunostimulatory adjuvant. PMID:26753184

  1. Physico-chemical properties of organically modified silicates' sol-gel layers for optical fibre sensors

    NASA Astrophysics Data System (ADS)

    Chodkowska, Eliza; Rayss, Jan

    2006-10-01

    The paper concerns the investigation of modified silica gel materials applied in optical fibre sensors. These materials are products of a sol-gel process in which three kinds of alkoxysilanes undergo hydrolysis and condensation and may play a role of the matrices containing transducer's molecules in the active layer of the sensor. In the experiment presented below three different compositions comprising tetraethoxysilane (TEOS), methyltriethoxysilane (MTES) and phenyltriethoxysilane (PhTES) were used. The alkoxysilanes underwent hydrolysis and condensation and the obtained gels were investigated in order to determine their texture, strucuture, composition and chemical properties as far as the dependence of those characteristics on the hydrolysis time and the molar ratio of the ingredients in the initial sols. The methods employed in the experiment were: Atomic Force Microscopy (AFM) which delivered vital information about the gels' textures, contact angles' and surface charge's measurements serving to estimate chemical properties of the gels' surfaces, Nuclear Magnetic Resonance (NMR) which helped to evaluate the hydrolysis' rate and porosimetric measurements enabling a determination of BET surface area and average diametres of the pores. The results may occur important for improving the construction of optical fibre sensors in which organically modified silicates (ORMOSILs)-TEOS layes are used.

  2. Aqueous dispersions of few-layer-thick chemically modified magnesium diboride nanosheets by ultrasonication assisted exfoliation.

    PubMed

    Das, Saroj Kumar; Bedar, Amita; Kannan, Aadithya; Jasuja, Kabeer

    2015-01-01

    The discovery of graphene has led to a rising interest in seeking quasi two-dimensional allotropes of several elements and inorganic compounds. Boron, carbon's neighbour in the periodic table, presents a curious case in its ability to be structured as graphene. Although it cannot independently constitute a honeycomb planar structure, it forms a graphenic arrangement in association with electron-donor elements. This is exemplified in magnesium diboride (MgB2): an inorganic layered compound comprising boron honeycomb planes alternated by Mg atoms. Till date, MgB2 has been primarily researched for its superconducting properties; it hasn't been explored for the possibility of its exfoliation. Here we show that ultrasonication of MgB2 in water results in its exfoliation to yield few-layer-thick Mg-deficient hydroxyl-functionalized nanosheets. The hydroxyl groups enable an electrostatically stabilized aqueous dispersion and create a heterogeneity leading to an excitation wavelength dependent photoluminescence. These chemically modified MgB2 nanosheets exhibit an extremely small absorption coefficient of 2.9 ml mg(-1) cm(-1) compared to graphene and its analogs. This ability to exfoliate MgB2 to yield nanosheets with a chemically modified lattice and properties distinct from the parent material presents a fundamentally new perspective to the science of MgB2 and forms a first foundational step towards exfoliating metal borides. PMID:26041686

  3. Chemically and biologically synthesized CPP-modified gelonin for enhanced anti-tumor activity.

    PubMed

    Shin, Meong Cheol; Zhang, Jian; David, Allan E; Trommer, Wolfgang E; Kwon, Young Min; Min, Kyoung Ah; Kim, Jin H; Yang, Victor C

    2013-11-28

    The ineffectiveness of small molecule drugs against cancer has generated significant interest in more potent macromolecular agents. Gelonin, a plant-derived toxin that inhibits protein translation, has attracted much attention in this regard. Due to its inability to internalize into cells, however, gelonin exerts only limited tumoricidal effect. To overcome this cell membrane barrier, we modified gelonin, via both chemical conjugation and genetic recombination methods, with low molecular weight protamine (LMWP), a cell-penetrating peptide (CPP) which was shown to efficiently ferry various cargoes into cells. Results confirmed that gelonin-LMWP chemical conjugate (cG-L) and recombinant gelonin-LMWP chimera (rG-L) possessed N-glycosidase activity equivalent to that of unmodified recombinant gelonin (rGel); however, unlike rGel, both gelonin-LMWPs were able to internalize into cells. Cytotoxicity studies further demonstrated that cG-L and rG-L exhibited significantly improved tumoricidal effects, with IC50 values being 120-fold lower than that of rGel. Moreover, when tested against a CT26 s.c. xenograft tumor mouse model, significant inhibition of tumor growth was observed with rG-L doses as low as 2 μg/tumor, while no detectable therapeutic effects were seen with rGel at 10-fold higher doses. Overall, this study demonstrated the potential of utilizing CPP-modified gelonin as a highly potent anticancer drug to overcome limitations of current chemotherapeutic agents. PMID:23973813

  4. Pharmacological profiling of zebrafish behavior using chemical and genetic classification of sleep-wake modifiers

    PubMed Central

    Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Ashikawa, Yoshifumi; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2015-01-01

    Sleep-wake states are impaired in various neurological disorders. Impairment of sleep-wake states can be an early condition that exacerbates these disorders. Therefore, treating sleep-wake dysfunction may prevent or slow the development of these diseases. Although many gene products are likely to be involved in the sleep-wake disturbance, hypnotics and psychostimulants clinically used are limited in terms of their mode of action and are not without side effects. Therefore, there is a growing demand for developing new hypnotics and psychostimulants with high efficacy and few side effects. Toward this end, animal models are indispensable for use in genetic and chemical screens to identify sleep-wake modifiers. As a proof-of-concept study, we performed behavioral profiling of zebrafish treated with chemical and genetic sleep-wake modifiers. We were able to demonstrate that behavioral profiling of zebrafish treated with hypnotics or psychostimulants from 9 to 10 days post-fertilization was sufficient to identify drugs with specific modes of action. We were also able to identify behavioral endpoints distinguishing GABA-A modulators and hypocretin (hcrt) receptor antagonists and between sympathomimetic and non-sympathomimetic psychostimulants. This behavioral profiling can serve to identify genes related to sleep-wake disturbance associated with various neuropsychiatric diseases and novel therapeutic compounds for insomnia and excessive daytime sleep with fewer adverse side effects. PMID:26578964

  5. Aqueous dispersions of few-layer-thick chemically modified magnesium diboride nanosheets by ultrasonication assisted exfoliation

    PubMed Central

    Das, Saroj Kumar; Bedar, Amita; Kannan, Aadithya; Jasuja, Kabeer

    2015-01-01

    The discovery of graphene has led to a rising interest in seeking quasi two-dimensional allotropes of several elements and inorganic compounds. Boron, carbon’s neighbour in the periodic table, presents a curious case in its ability to be structured as graphene. Although it cannot independently constitute a honeycomb planar structure, it forms a graphenic arrangement in association with electron-donor elements. This is exemplified in magnesium diboride (MgB2): an inorganic layered compound comprising boron honeycomb planes alternated by Mg atoms. Till date, MgB2 has been primarily researched for its superconducting properties; it hasn’t been explored for the possibility of its exfoliation. Here we show that ultrasonication of MgB2 in water results in its exfoliation to yield few-layer-thick Mg-deficient hydroxyl-functionalized nanosheets. The hydroxyl groups enable an electrostatically stabilized aqueous dispersion and create a heterogeneity leading to an excitation wavelength dependent photoluminescence. These chemically modified MgB2 nanosheets exhibit an extremely small absorption coefficient of 2.9 ml mg−1 cm−1 compared to graphene and its analogs. This ability to exfoliate MgB2 to yield nanosheets with a chemically modified lattice and properties distinct from the parent material presents a fundamentally new perspective to the science of MgB2 and forms a first foundational step towards exfoliating metal borides. PMID:26041686

  6. Kinetics of cadmium, chromium, and lead sorption onto chemically modified sugarcane bagasse and wheat straw.

    PubMed

    Mahmood-ul-Hassan, M; Suthar, V; Rafique, E; Ahmad, R; Yasin, M

    2015-07-01

    In this study, cadmium (Cd), chromium (Cr), and lead (Pb) adsorption potential of unmodified and modified sugarcane bagasse and ground wheat straw was explored from aqueous solution through batch equilibrium technique. Both the materials were chemically modified by treating with sodium hydroxide (NaOH) alone and in combination with nitric acid (HNO3) and sulfuric acid (H2SO4). Two kinetic models, pseudo-first order and pseudo-second order were used to follow the adsorption process and reaction fallowed the later model. The Pb removal by both the materials was highest and followed by Cr and Cd. The chemical treatment invariably increased the adsorption capacity and NaOH treatment proved more effective than others. Langmuir maximum sorption capacity (q m) of Pb was utmost (12.8-23.3 mg/g of sugarcane bagasse, 14.5-22.4 mg/g of wheat straw) and of Cd was least (1.5-2.2 mg/g of sugarcane bagasse, 2.5-3.8 mg/g of wheat straw). The q m was in the order of Pb > Cr > Cd for all the three adsorbents. Results demonstrate that agricultural waste materials used in this study could be used to remediate the heavy metal-polluted water. PMID:26116198

  7. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  8. Dual-tracer method to estimate coral reef response to a plume of chemically modified seawater

    NASA Astrophysics Data System (ADS)

    Maclaren, J. K.; Caldeira, K.

    2013-12-01

    We present a new method, based on measurement of seawater samples, to estimate the response of a reef ecosystem to a plume of an additive (for example, a nutrient or other chemical). In the natural environment, where there may be natural variability in concentrations, it can be difficult to distinguish between changes in concentrations that would occur naturally and changes in concentrations that result from a chemical addition. Furthermore, in the unconfined natural environment, chemically modified water can mix with waters that have not been modified, making it difficult to distinguish between effects of dilution and effects of chemical fluxes or transformations. We present a dual-tracer method that extracts signals from observations that may be affected by both natural variability and dilution. In this dual-tracer method, a substance (in our example case, alkalinity) is added to the water in known proportion to a passive conservative tracer (in our example case, Rhodamine WT dye). The resulting plume of seawater is allowed to flow over the study site. Two transects are drawn across the plume at the front and back of the study site. If, in our example, alkalinity is plotted as a function of dye concentration for the front transect, the slope of the resulting mixing line is the ratio of alkalinity to dye in the added fluid. If a similar mixing line is measured and calculated for the back transect, the slope of this mixing line will indicate the amount of added alkalinity that remains in the water flowing out of the study site per unit of added dye. The ratio of the front and back slopes indicates the fraction of added alkalinity that was taken up by the reef. The method is demonstrated in an experiment performed on One Tree Reef (Queensland, Australia) aimed at showing that ocean acidification is already affecting coral reef growth. In an effort to chemically reverse some of the changes to seawater chemistry that have occurred over the past 200 years, we added

  9. Fabrication and long-wavelength characterization of neat and chemically modified graphene

    SciTech Connect

    Kalugin, Nikolai G.

    2014-03-31

    Graphene, a single- or several layer-thick carbon, attracts significant research activity because of its exceptional material properties. Graphene is a promising material for optoelectronic applications. Neat graphene demonstrates potential as a material for long wavelength photodetectors working at elevated temperatures. Chemical modification of graphene opens up many new applications of this material in electronics, in new composite materials, and in new catalysts for different chemical processes. Chemical vapor deposition-grown large-area graphene can be successfully modified with the creation of benzyne attachments. The investigation of microwave properties is an important part of graphene research. Two variants of near-field long wavelength microscopy were found efficient with graphene. Measurements with a probe formed by an electrically open end of a 4 GHz half-lambda parallel-strip transmission line resonator allow the implementation of an electrodynamic model of graphene microwave impedance. The results of near-field scanning superconducting quantum interference device (SQUID) RF microscopy of graphite and graphene at 200 MHz shed light on mechanisms of AC graphene response: screening currents induced in graphene by an external RF magnetic field tend to localize near structural defects.

  10. Fabrication and long-wavelength characterization of neat and chemically modified graphene

    NASA Astrophysics Data System (ADS)

    Kalugin, Nikolai G.

    2014-03-01

    Graphene, a single- or several layer-thick carbon, attracts significant research activity because of its exceptional material properties. Graphene is a promising material for optoelectronic applications. Neat graphene demonstrates potential as a material for long wavelength photodetectors working at elevated temperatures. Chemical modification of graphene opens up many new applications of this material in electronics, in new composite materials, and in new catalysts for different chemical processes. Chemical vapor deposition-grown large-area graphene can be successfully modified with the creation of benzyne attachments. The investigation of microwave properties is an important part of graphene research. Two variants of near-field long wavelength microscopy were found efficient with graphene. Measurements with a probe formed by an electrically open end of a 4 GHz half-lambda parallel-strip transmission line resonator allow the implementation of an electrodynamic model of graphene microwave impedance. The results of near-field scanning superconducting quantum interference device (SQUID) RF microscopy of graphite and graphene at 200 MHz shed light on mechanisms of AC graphene response: screening currents induced in graphene by an external RF magnetic field tend to localize near structural defects.

  11. Optical second-harmonic spectroscopy of chemically-modified silicon and silicon-dioxide surfaces

    NASA Astrophysics Data System (ADS)

    Downer, M. C.; Jiang, Y. Y.; Lim, D.

    2002-03-01

    The optical second-harmonic generation (SHG) response of solid interfaces depends sensitively on chemical termination. We present a spectroscopic SHG study of chemically-modified Si and SiO2 surfaces that elucidates at the atomic level how adsorbates alter the electronic structure, and thereby the SHG response, of the surface. SHG spectra were measured on reconstructed Si(001) surfaces in UHV that were exposed to atomic H or to gas-phase precursors of Ge and B, and on the surfaces of 30 angstrom-thick silicon dioxide films on silicon substrates that were chemically functionalized to nucleate silicon nanocrystal formation. Microscopic models show that adsorbate-induced alterations of the surface SHG spectra are correlated with changes in near-surface charge polarization caused by surface dimer buckling, transfer of electrons to boron acceptors in second layer substitutional sites, or transfer of electrons from the silicon substrate, through the tunneling oxide, to the surface nanocrystals [1]. 1. M. C. Downer, B. S. Mendoza and V. I. Gavrilenko, Surf. Interface Anal. 31, 966 (2001).

  12. Allergenic components in modified and unmodified rosin. Chemical characterization and studies of allergenic activity.

    PubMed

    Gäfvert, E

    1994-01-01

    Gäfvert, E. 1994. Allergenic components in modified and unmodified rosin. Chemical characterization and studies of allergenic activity. Acta Dermato-Venereologica. Suppl. 184. 36pp. Uppsala. Unmodified rosin (colophony) is a well-known cause of contact allergy (delayed type hypersensitivity). Rosin is obtained from coniferous trees and consists mainly of diterpenoid resin acids. Most rosin used in technical products is chemically modified. In the common modification of rosin with maleic anhydride, the major product formed is maleopimaric acid (MPA). MPA was identified in experimental sensitization studies as a potent contact allergen. MPA is also formed when rosin is modified with fumaric acid at high temperature and with prolonged heating. The amounts of MPA in technical quality rosins modified with maleic anhydride or fumaric acid might be enough to sensitize individuals handling these rosins. The major product of the modification of rosin with fumaric acid, fumaropimaric acid (FPA), did not elicit any reactions in the animals tested. In another common rosin modification, glycerol esterification, the major product formed was identified as glyceryl triabietate (GTA). In an experimental sensitization study none of the animals reacted to GTA. However, a minor product formed, glyceryl 1-monoabietate (GMA) showed sensitizing capacity. The presence of new contact allergens due to the modification, together with remaining unmodified material, contributes to the risk of developing allergy from contact with these types of rosin. A new main contact allergen in unmodified rosin was identified; 13,14(beta)-epoxyabietic acid. The allergenicity of this epoxide was comparable to that of an earlier identified rosin allergen, 15-hydroperoxyabietic acid (15-HPA). The allergens were detected as their methyl esters. Experimental sensitization and cross-reactivity of oxidation products of resin acids were studied. A pattern of cross-reactivity was observed which indicates that the

  13. New oligonucleotide derivatives as unreactive substrate analogues and potential inhibitors of human apurinic/apyrimidinic endonuclease APE1.

    PubMed

    Kuznetsov, Nikita A; Kupryushkin, Maxim S; Abramova, Tatyana V; Kuznetsova, Alexandra A; Miroshnikova, Anastasia D; Stetsenko, Dmitry A; Pyshnyi, Dmitrii V; Fedorova, Olga S

    2016-01-01

    Human apurinic/apyrimidinic endonuclease APE1 is one of the key enzymes of the base excision DNA repair system. The main biological function of APE1 is the hydrolysis of the phosphodiester bond on the 5'-side of an apurinic/apyrimidinic site (AP-site) to give the 5'-phosphate and 3'-hydroxyl group. It has long been known that AP-sites have mutagenic and cytotoxic effects and their accumulation in DNA is a potential hazard to the cell lifecycle. The structural and biochemical studies of APE1 are complicated by its high catalytic activity towards the AP-site and its cyclic or acyclic analogues. This work has focussed on the design, synthesis and analysis of oligonucleotide derivatives as potentially unreactive APE1 substrates. We have shown that the replacement of oxygen atoms in the phosphate group on the 5'-side from the AP-site analogue tetrahydrofuran (F) considerably decreases the rate of enzymatic hydrolysis of modified oligonucleotides. We have calculated that a N3'-P5' phosphoramidate linkage is hydrolysed about 30 times slower than the native phosphodiester bond while phosphorothioate or primary phosphoramidate linkages are cleaved more than three orders of magnitude slower. The value of IC50 of the oligonucleotide duplex containing a primary phosphoramidate linkage is 2.5 × 10(-7) M, which is in accordance with the APE1 association constant of DNA duplexes containing AP-sites. Thus, it is demonstrated that oligonucleotide duplexes with chemical modifications could be used as unreactive substrates and potential competitive inhibitors of APE1. PMID:26548492

  14. Chemically modified and nanostructured porous silicon as a drug delivery material and device

    NASA Astrophysics Data System (ADS)

    Anglin, Emily Jessica

    This thesis describes the fabrication, chemical modification, drug release, and toxicity studies of nanostructured porous silicon for the purposes of developing a smart drug delivery device. The first chapter is an introductory chapter, presenting the chemical and physical properties of porous silicon, the concepts and issues of current drug delivery devices and materials, and how porous silicon can address the issues regarding localized and controlled drug therapies. The second chapter discusses chemical modifications of nanostructured porous Si for stabilizing the material in biologically relevant media while providing an extended release of a therapeutic in vitro. This chapter also demonstrates the utility of the porous silicon optical signatures for effectively monitoring drug release from the system and its applications for development of a self-reporting drug delivery device. In chapter three, the concept of providing a triggered release of a therapeutic from porous silicon microparticles through initiation by an external stimulus is demonstrated. The microparticles are chemically modified, and the release is enhanced by a short application of ultrasound to the particulate system. The effect of ultrasound on the drug release and particle size is discussed. Chapter four presents a new method for sustaining the release of a monoclonal antibody from the porous matrix of porous SiO2. The therapeutic is incorporated into the films through electrostatic adsorption and a slow release is observed in vitro. A new method of quantifying the extent of drug loading is monitored with interferometry. The last chapter of the thesis provides a basic in vivo toxicity study of various porous Si microparticles for intraocular applications. Three types of porous Si particles are fabricated and studied in a rabbit eye model. The toxicity studies were conducted by collaborators at the Shiley Eye Center, La Jolla, CA. This work, demonstrates the feasibility of developing a self

  15. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics. PMID:25707197

  16. Extensive sugar modification improves triple helix forming oligonucleotide activity in vitro but reduces activity in vivo.

    PubMed

    Alam, Md Rowshon; Majumdar, Alokes; Thazhathveetil, Arun Kalliat; Liu, Su-Ting; Liu, Ji-Lan; Puri, Nitin; Cuenoud, Bernard; Sasaki, Shigeki; Miller, Paul S; Seidman, Michael M

    2007-09-01

    We are developing triple helix forming oligonucleotides (TFOs) for gene targeting. Previously, we synthesized bioactive TFOs containing 2'-O-methylribose (2'-OMe) and 2'-O-aminoethylribose (2'-AE) residues. Active TFOs contained four contiguous 2'-AE residues and formed triplexes with high thermal stability and rapid association kinetics. In an effort to further improve bioactivity, we synthesized three series of TFOs containing the 2'-AE patch and additional ribose modifications distributed throughout the remainder of the oligonucleotide. These were either additional 2'-AE residues, the conformationally locked BNA/LNA ribose with a 2'-O,4'-C-methylene bridge, or the 2'-O,4'-C-ethylene analogue (ENA). The additionally modified TFOs formed triplexes with greater thermal stability than the reference TFO, and some had improved association kinetics. However, the most active TFOs in the biochemical and biophysical assays were the least active in the bioassay. We measured the thermal stability of triplexes formed by the TFOs in each series on duplex targets containing a change in sequence at a single position. The Tm value of the variant sequence triplexes increased as the number of all additional modifications increased. A simple explanation for the failure of the improved TFOs in the bioassay was that the increased affinity for nonspecific targets lowered the effective nuclear concentration. Enhancement of TFO bioactivity will require chemical modifications that improve interaction with the specific targets while retaining selectivity against mismatched sequences. PMID:17691818

  17. Effect of three biological response modifiers on chemical carcinogenesis in mice.

    PubMed

    Bogdanović, Z; Culo, F; Marusić, M

    1993-01-01

    The modulation of chemical carcinogenesis by three biological response modifiers was assessed in a mouse model. CBA mice given 20-methylcholanthrene s.c. were treated with peptidoglycan monomer, azure B and indomethacin for one month, either from day 0 or 75 after methylcholanthrene injection to assess their effects on tumor incidence (on days 150 and 300), time of tumor appearance, time of death, and duration and dynamics of tumor growth. All three agents significantly influenced some of the parameters of tumor growth, except tumor incidence on day 300. Highly significant sex differences in tumor appearance and growth were observed. Tumors with late appearance grew faster in comparison to tumors with early appearance. The data presented indicate that the effectiveness of anti-cancer body defense mechanisms can be best defined by the time of tumor appearance. PMID:8272149

  18. Synchrotron Infrared Confocal Microspectroscopical Detection of Heterogeneity Within Chemically Modified Single Starch Granules

    SciTech Connect

    Wetzel, D.; Shi, Y; Reffner, J

    2010-01-01

    This reports the first detection of chemical heterogeneity in octenyl succinic anhydride modified single starch granules using a Fourier transform infrared (FT-IR) microspectroscopical technique that combines diffraction-limited infrared microspectroscopy with a step size that is less than the mask projected spot size focused on the plane of the sample. The high spatial resolution was achieved with the combination of the application of a synchrotron infrared source and the confocal image plane masking system of the double-pass single-mask Continuum{reg_sign} infrared microscope. Starch from grains such as corn and wheat exists in granules. The size of the granules depends on the plant producing the starch. Granules used in this study typically had a median size of 15 {micro}m. In the production of modified starch, an acid anhydride typically is reacted with OH groups of the starch polymer. The resulting esterification adds the ester carbonyl (1723 cm{sup -1}) organic functional group to the polymer and the hydrocarbon chain of the ester contributes to the CH{sub 2} stretching vibration to enhance the intensity of the 2927 cm{sup -1} band. Detection of the relative modifying population on a single granule was accomplished by ratioing the baseline adjusted peak area of the carbonyl functional group to that of a carbohydrate band. By stepping a confocally defined infrared beam as small as 5 {micro}m x 5 {micro}m across a starch granule 1 {micro}m at a time in both the x and y directions, the heterogeneity is detected with the highest possible spatial resolution.

  19. Nanometric dispersion of a Mg/Al layered double hydroxide into a chemically modified polycaprolactone.

    PubMed

    Mangiacapra, Pasqualina; Raimondo, Marialuigia; Tammaro, Loredana; Vittoria, Vittoria; Malinconico, Mario; Laurienzo, Paola

    2007-03-01

    Polycaprolactone (PCL) was chemically modified by grafting maleic anhydride on it, through a radical reaction induced by benzoyl peroxide as initiator. To improve the grafting degree, a second unsaturated comonomer such as glycidyl methacrylate (GMA) has been added, demonstrating a good reactivity in melt grafting without leading to long grafted chains. The quantitative determination of grafted maleic anhydride, performed by FTIR analysis, revealed a grafting weight percentage of 9.5 +/- 0.9, and the NMR characterization made it possible to propose a structure for the grafted polymer (PCLgMA). The modified polymer was analyzed by DSC and X-ray diffraction, showing a structural organization even better than that of the pristine polymer. An exchange reaction with a layered double hydroxide (LDH), hydrotalcite-like solid in the nitrate form, led to the disappearance of the crystalline basal peak of LDH in the X-ray diffractograms, suggesting a possible exfoliation of the inorganic sample. An oxidative etching on the composite surface followed by atomic force microscopy analysis made it possible to enlighten the lamellar structure in the pristine sample. In the composite sample, the well identifiable narrow fissures homogeneously distributed on the surface demonstrate that nanometer stacks of LDH sheets, embedded in a highly textured PCLgMA matrix, are present in the composite sample. The comparison of X-ray diffractograms and AFM analysis suggests either a partial exfoliation or an intercalation of the polymer in a lamellar texture with a basal spacing higher than 5 nm. In any case, the process of ionic exchange between nitrate LDH and PCLgMA led to the formation of nanocomposites, in which no large hydrotalcite aggregates are present. This is an interesting method to obtain a direct intercalation of the modified polymer into the inorganic solid with a simple ionic exchange reaction. PMID:17319719

  20. Chemical drug stability in lipids, modified lipids, and polyethylene oxide-containing formulations.

    PubMed

    Stella, Valentino J

    2013-12-01

    To critique the stability complications seen in formulating poorly water-soluble, problematic drugs in lipids, modified lipids, and polyethylene oxide solvents and surfactants in hard and soft gelatin capsules as well as some parenterals, a literature search was performed and personal experiences, and those of colleagues, collated. The literature is replete with examples of molecules undergoing rapid oxidative degradation in the presence of polyethylene oxide based solvents and surfactants as well as in the presence of unsaturated lipids. More recently appreciated is instability caused by the reaction of amine and amide drugs, with formaldehyde, formic acid found in many of these solvents as impurities and other degradation byproducts of the solvents themselves. One would expect acylation and transacylation reactions to be more common than reported but the literature has some good examples. An added complexity is occasionally seen with the use of hard and soft gelatin capsules with these solvents. The chemical stability of drugs in liquid and semi-solid formulations in the presence of lipids, modified lipids, and polyoxyethylene oxide-based solvents and surfactants can be complex, further exacerbated by the use of gelatin capsules, and can lead to a plethora of degradation pathways often not seen when the same drugs are formulated in solid dosage forms. PMID:23636838

  1. Chemically Modified Plastic Tube for High Volume Removal and Collection of Circulating Tumor Cells

    PubMed Central

    Gaitas, Angelo; Kim, Gwangseong

    2015-01-01

    In this preliminary effort, we use a commercially available and chemically modified tube to selectively capture circulating tumor cells (CTCs) from the blood stream by immobilizing human anti-EpCAM antibodies on the tube's interior surface. We describe the requisite and critical steps required to modify a tube into a cancer cell-capturing device. Using these simple modifications, we were able to capture or entrap about 85% of cancer cells from suspension and 44% of cancer cells from spiked whole blood. We also found that the percentage of cells captured was dependent on the tube's length and also the number of cancer cells present. It is our strong belief that with the utilization of appropriate tube lengths and procedures, we can ensure capture and removal of nearly the entire CTC population in whole blood. Importantly after a patient’s entire blood volume has circulated through the tube, the tube can then be trypsinized to release the captured live CTCs for further analysis and testing. PMID:26176235

  2. Chemically Modified Plastic Tube for High Volume Removal and Collection of Circulating Tumor Cells.

    PubMed

    Gaitas, Angelo; Kim, Gwangseong

    2015-01-01

    In this preliminary effort, we use a commercially available and chemically modified tube to selectively capture circulating tumor cells (CTCs) from the blood stream by immobilizing human anti-EpCAM antibodies on the tube's interior surface. We describe the requisite and critical steps required to modify a tube into a cancer cell-capturing device. Using these simple modifications, we were able to capture or entrap about 85% of cancer cells from suspension and 44% of cancer cells from spiked whole blood. We also found that the percentage of cells captured was dependent on the tube's length and also the number of cancer cells present. It is our strong belief that with the utilization of appropriate tube lengths and procedures, we can ensure capture and removal of nearly the entire CTC population in whole blood. Importantly after a patient's entire blood volume has circulated through the tube, the tube can then be trypsinized to release the captured live CTCs for further analysis and testing. PMID:26176235

  3. The effects of space radiation on a chemically modified graphite-epoxy composite material

    NASA Technical Reports Server (NTRS)

    Reed, S. M.; Herakovich, C. T.; Sykes, G. F.

    1986-01-01

    The effects of the space environment on the engineering properties and chemistry of a chemically modified T300/934 graphite-epoxy composite system are characterized. The material was subjected to 1.0 x 10 to the 10th power rads of 1.0 MeV electron irradiation under vacuum to simulate 30 years in geosynchronous earth orbit. Monotonic tension tests were performed at room temperature (75 F/24 C) and elevated temperature (250 F/121 C) on 4-ply unidirectional laminates. From these tests, inplane engineering and strength properties (E sub 1, E sub 2, Nu sub 12, G sub 12, X sub T, Y sub T) were determined. Cyclic tests were also performed to characterize energy dissipation changes due to irradiation and elevated temperature. Large diameter graphite fibers were tested to determine the effects of radiation on their stiffness and strength. No significant changes were observed. Dynamic-mechanical analysis demonstrated that the glass transition temperature was reduced by 50 F(28 C) after irradiation. Thermomechanical analysis showed the occurrence of volatile products generated upon heating of the irradiated material. The chemical modification of the epoxy did not aid in producing a material which was more radiation resistant than the standard T300/934 graphite-epoxy system. Irradiation was found to cause crosslinking and chain scission in the polymer. The latter produced low molecular weight products which plasticize the material at elevated temperatures and cause apparent material stiffening at low stresses at room temperature.

  4. Efficiency of modified chemical remediation techniques for soil contaminated by organochlorine pesticides

    NASA Astrophysics Data System (ADS)

    Correa-Torres, S. N.; Kopytko, M.; Avila, S.

    2016-07-01

    This study reports the optimization of innovation chemical techniques in order to improve the remediation of soils contaminated with organochloride pesticides. The techniques used for remediation were dehalogenation and chemical oxidation in soil contaminated by pesticides. These techniques were applied sequentially and combined to evaluate the design optimize the concentration and contact time variables. The soil of this study was collect in cotton crop zone in Agustin Codazzi municipality, Colombia, and its physical properties was measure. The modified dehalogenation technique of EPA was applied on the contaminated soil by adding Sodium Bicarbonate solution at different concentrations and rates during 4, 7 and 14 days, subsequently oxidation technique was implemented by applying a solution of KMnO4 at different concentration and reaction times. Organochlorine were detected by Gas Chromatography analysis coupled Mass Spectrometry and its removals were between 85.4- 90.0% of compounds such as 4, 4’-DDT, 4,4’-DDD, 4,4-DDE, trans-Clordane y Endrin. These results demonstrate that the technique of dehalogenation with oxidation chemistry can be used for remediation soils contaminated by organochloride pesticides.

  5. Chemical composition and resistance-modifying effect of the essential oil of Lantana camara Linn

    PubMed Central

    Sousa, Erlânio O.; Silva, Natálya F.; Rodrigues, Fabiola F. G.; Campos, Adriana R.; Lima, Sidney G.; Costa, José Galberto M.

    2010-01-01

    In this work, the chemical constituents, antibacterial and modulatory activities of the essential oil of Lantana camara Linn were studied. The essential oil was extracted from the leaves of L. camara by hydrodistillation method using Clevenger's apparatus and its chemical constituents were separated and identified by GC-MS, and the relative content of each constituent was determined by area normalization. Among the 25 identified components, bicyclogermacrene (19.42%), isocaryophyllene (16.70%), valecene (12.94%) and germacrene D (12.34%) were the main constituents. The oil was examined to antibacterial and modulatory activities against the multiresistant strains of Escherichia coli and Staphylococcus aureus by microdilution test. The results show an inhibitory activity to E. coli (MIC 512 μg/ml) and S. aureus (MIC 256 μg/ml). The synergism of the essential oil and aminoglycosides was verified too, with significant reduction of MICs (7 ×, 1250-5 μg/ml) against E. coli. It is suggested that the essential oil of Lantana camara Linn could be used as a source of plant-derived natural products with resistance-modifying activity. PMID:20668570

  6. Biodistribution profiling of the chemical modified hyaluronic acid derivatives used for oral delivery system.

    PubMed

    Hsieh, Chien-Ming; Huang, Yu-Wen; Sheu, Ming-Thau; Ho, Hsiu-O

    2014-03-01

    A series of adipic acid dihydrazide (ADH)-modified hyaluronic acid (HA-ADH) compounds were synthesized and conjugated with QDots (QDots-HA conjugates) to assess the effects of the molecular weight (MW) and extent of chemical modification of HA on its biodistribution. Their physicochemical structures were confirmed by complementary application of GPC, (1)H NMR, FTIR, and UV-vis spectroscopic methods. In vivo imaging of QDots-HA conjugates after oral administration was analyzed to investigate their biodistribution in nude mice. Simultaneously, real-time bioimaging was confirmed by an anatomical analysis to investigate the organ-specific accumulation of conjugates. QDot-HA conjugates with a higher MW of HA or high modification presented relatively slow clearance leading to an extension of the retention time for up to 10 days, whereas those with lower MWs of HA or a low modification extent exhibited quick absorption and elimination after oral administration. Taken together, HA derivatives with suitable MWs and chemical modification extents can be used to design new, more-sophisticated, and intelligent HA-based vehicles for oral delivery with diverse characteristics. PMID:24315950

  7. Phosphoramidate Ligation of Oligonucleotides in Nanoscale Structures.

    PubMed

    Kalinowski, Matthäus; Haug, Rüdiger; Said, Hassan; Piasecka, Sylwia; Kramer, Markus; Richert, Clemens

    2016-06-16

    The folding of long DNA strands into designed nanostructures has evolved into an art. Being based on linear chains only, the resulting nanostructures cannot readily be transformed into covalently linked frameworks. Covalently linking strands in the context of folded DNA structures requires a robust method that avoids sterically demanding reagents or enzymes. Here we report chemical ligation of the 3'-amino termini of oligonucleotides and 5'-phosphorylated partner strands in templated reactions that produce phosphoramidate linkages. These reactions produce inter-nucleotide linkages that are isoelectronic and largely isosteric to phosphodiesters. Ligations were performed at three levels of complexity, including the extension of branched DNA hybrids and the ligation of six scaffold strands in a small origami. PMID:27225865

  8. Chemical Sensors Based on IR Spectroscopy and Surface-Modified Waveguides

    NASA Technical Reports Server (NTRS)

    Lopez, Gabriel P.; Niemczyk, Thomas

    1999-01-01

    Sol-gel processing techniques have been used to apply thin porous films to the surfaces of planar infrared (IR) waveguides to produce widely useful chemical sensors. The thin- film coating serves to diminish the concentration of water and increase the concentration of the analyte in the region probed by the evanescent IR wave. These porous films are composed of silica, and therefore, conventional silica surface modification techniques can be used to give the surface a specific functional character. The sol-gel film was surface-modified to make the film highly hydrophobic. These sensors were shown to be capable of detecting non-polar organic analytes, such as benzonitrile, in aqueous solution with detection limits in the ppb range. Further, these porous sol-gel structures allow the analytes to diffuse into and out of the films rapidly, thus reaching equilibrium in less than ten seconds. These sensors are unique because of the fact that their operation is based on the measurement of an IR absorption spectrum. Thus, these sensors are able to identify the analytes as well as measure concentration with high sensitivity. These developments have been documented in previous reports and publications. Recently, we have also targeted detection of the polar organic molecules acetone and isopropanol in aqueous solution. Polar organics are widely used in industrial and chemical processes, hence it is of interest to monitor their presence in effluents or decontamination process flows. Although large improvements in detection limits were expected with non-polar organic molecules in aqueous solutions using very hydrophobic porous sol-gel films on silicon attenuated total reflectance (Si ATR) waveguides, it was not as clear what the detection enhancements might be for polar organic molecules. This report describes the use of modified sol-gel-coated Si ATR sensors for trace detection and quantitation of small polar organic molecules in aqueous solutions. The detection of both acetone

  9. Characterization of chemically modified enzymes for bioremediation-reactions. 1997 annual progress report

    SciTech Connect

    Kaufman, E.N.; Adams, M.W.W.

    1997-09-01

    'Many, if not most, biological transformation reactions of interest to US Department of Energy (DOE) site remediation involve substrates that are only sparingly soluble in aqueous environments. Hence, destruction of these recalcitrant and toxic materials would benefit tremendously if their degradation could be performed in nonaqueous environments. Organic biocatalysis may be motivated by the nature of the substrate itself, augmented mass transport, ease of product recovery, or novel reaction pathways afforded by the organic solvent. For instance, polychlorinated biphenyls (PCBs) are sparingly soluble in water, but may be more effectively processed when solubilized by organic liquids. However, naturally-occurring enzymes are not soluble in organic solvents. Indeed, most spontaneously denature and, depending on the solvent used, typically form inactive and insoluble precipitates. The objective of the current work is to gain a fundamental understanding of the molecular and catalytic properties of enzymes that have been chemically-modified so that they are catalytically-active and chemically-thermally-stable in organic solvents. The premise for this study is that highly stable enzymes which are catalytically active in both water and in a range of organic solvents are optimally suited for bioremediation where substrates of interest are more soluble and may be processed with greater specificity in nonaqueous solvents. The proposed research program will enable the development of nonaqueous bioremediation technologies for the treatment of DOE sites contaminated with aqueous-insoluble organic compounds. Such compounds may include dense nonaqueous phase liquids, trichloroethylene (TCE), trichloroacetic acid, trans-dichloroethylene, diesel fuel, and PCBs. These compounds have been identified as targets for technology development in the ``EM Technology Needs Database,'''' and are contaminants at the following DOE sites: K-25 Site plumes; ORNL WAGS 1, 4, and 5; Paducah plumes

  10. Modified chemical synthesis of porous α-Sm{sub 2}S{sub 3} thin films

    SciTech Connect

    Kumbhar, V.S.; Jagadale, A.D.; Gaikwad, N.S.; Lokhande, C.D.

    2014-08-15

    Highlights: • A novel chemical route to prepare α-Sm{sub 2}S{sub 3} thin films. • A porous honeycomb like morphology of the α-Sm{sub 2}S{sub 3} thin film. • An application of α-Sm{sub 2}S{sub 3} thin film toward its supercapacitive behaviour. - Abstract: The paper reports synthesis of porous α-Sm{sub 2}S{sub 3} thin films using modified chemical synthesis, also known as successive ionic layer adsorption and reaction (SILAR) method. The X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), scanning electron microscopy (SEM), atomic force microscopy (AFM), wettability and ultraviolet–visible spectroscopy (UV–vis) techniques are used for the study of structural, elemental, morphological and optical properties of α-Sm{sub 2}S{sub 3} films. An orthorhombic crystal structure of α-Sm{sub 2}S{sub 3} is resulted from XRD study. The SEM and AFM observations showed highly porous α-Sm{sub 2}S{sub 3} film surface. An optical band gap of 2.50 eV is estimated from optical absorption spectrum. The porous α-Sm{sub 2}S{sub 3} thin film tuned for supercapacitive behaviour using cyclic voltammetry and galvanostatic charge discharge showed a specific capacitance and energy density of 294 Fg{sup –1} and 48.9 kW kg{sup –1}, respectively in 1 M LiClO{sub 4}–propylene carbonate electrolyte.

  11. Oligonucleotide-directed site-specific mutagenesis in Drosophila melanogaster.

    PubMed Central

    Banga, S S; Boyd, J B

    1992-01-01

    An efficient technique has been developed for performing in vivo site-directed mutagenesis in Drosophila melanogaster. This procedure involves directed repair of P-element-induced DNA lesions after injection of a modified DNA sequence into early embryos. An oligonucleotide of 50 base pairs, whose sequence spans the P-element insertion site, mediates base replacement in the endogenous gene. Restriction mapping, DNA sequencing, and polymerase chain reaction analysis demonstrate that base substitutions present in an injected oligonucleotide are incorporated into genomic sequences flanking a P insertion site in the white gene. This analysis suggests that progeny bearing directed mutations are recovered with a frequency of about 0.5 x 10(-3). Because Drosophila remains a premier organism for the analysis of eukaryotic gene regulation, this system should find strong application in that analysis as well as in the analysis of DNA recombination, conversion, repair, and mutagenesis. Images PMID:1311850

  12. A Novel Chemically Modified Curcumin Reduces Severity of Experimental Periodontal Disease in Rats: Initial Observations

    PubMed Central

    Elburki, Muna S.; Rossa, Carlos; Guimaraes, Morgana R.; Goodenough, Mark; Lee, Hsi-Ming; Curylofo, Fabiana A.; Zhang, Yu; Johnson, Francis; Golub, Lorne M.

    2014-01-01

    Tetracycline-based matrix metalloproteinase- (MMP-) inhibitors are currently approved for two inflammatory diseases, periodontitis and rosacea. The current study addresses the therapeutic potential of a novel pleiotropic MMP-inhibitor not based on an antibiotic. To induce experimental periodontitis, endotoxin (LPS) was repeatedly injected into the gingiva of rats on one side of the maxilla; the contralateral (control) side received saline injections. Two groups of rats were treated by daily oral intubation with a chemically modified curcumin, CMC 2.24, for two weeks; the control groups received vehicle alone. After sacrifice, gingiva, blood, and maxilla were collected, the jaws were defleshed, and periodontal (alveolar) bone loss was quantified morphometrically and by μ-CT scan. The gingivae were pooled per experimental group, extracted, and analyzed for MMPs (gelatin zymography; western blot) and for cytokines (e.g., IL-1β; ELISA); serum and plasma samples were analyzed for cytokines and MMP-8. The LPS-induced pathologically excessive bone loss was reduced to normal levels based on either morphometric (P = 0.003) or μ-CT (P = 0.008) analysis. A similar response was seen for MMPs and cytokines in the gingiva and blood. This initial study, on a novel triketonic zinc-binding CMC, indicates potential efficacy on inflammatory mediators and alveolar bone loss in experimental periodontitis and warrants future therapeutic and pharmacokinetic investigations. PMID:25104884

  13. Structural and dynamical properties of water on chemically modified surfaces: The role of the instantaneous surface

    NASA Astrophysics Data System (ADS)

    Bekele, Selemon; Tsige, Mesfin

    Surfaces of polymers such as atactic polystyrene (aPS) represent very good model systems for amorphous material surfaces. Such polymer surfaces are usually modified either chemically or physically for a wide range of applications that include friction, lubrication and adhesion. It is thus quite important to understand the structural and dynamical properties of liquids that come in contact with them to achieve the desired functional properties. Using molecular dynamics (MD) simulations, we investigate the structural and dynamical properties of water molecules in a slab of water in contact with atactic polystyrene surfaces of varying polarity. We find that the density of water molecules and the number distribution of hydrogen bonds as a function of distance relative to an instantaneous surface exhibit a structure indicative of a layering of water molecules near the water/PS interface. For the dynamics, we use time correlation functions of hydrogen bonds and the incoherent structure function for the water molecules. Our results indicate that the polarity of the surface dramatically affects the dynamics of the interfacial water molecules with the dynamics slowing down with increasing polarity. This work was supported by NSF Grant DMR1410290.

  14. A novel chemically modified curcumin reduces severity of experimental periodontal disease in rats: initial observations.

    PubMed

    Elburki, Muna S; Rossa, Carlos; Guimaraes, Morgana R; Goodenough, Mark; Lee, Hsi-Ming; Curylofo, Fabiana A; Zhang, Yu; Johnson, Francis; Golub, Lorne M

    2014-01-01

    Tetracycline-based matrix metalloproteinase- (MMP-) inhibitors are currently approved for two inflammatory diseases, periodontitis and rosacea. The current study addresses the therapeutic potential of a novel pleiotropic MMP-inhibitor not based on an antibiotic. To induce experimental periodontitis, endotoxin (LPS) was repeatedly injected into the gingiva of rats on one side of the maxilla; the contralateral (control) side received saline injections. Two groups of rats were treated by daily oral intubation with a chemically modified curcumin, CMC 2.24, for two weeks; the control groups received vehicle alone. After sacrifice, gingiva, blood, and maxilla were collected, the jaws were defleshed, and periodontal (alveolar) bone loss was quantified morphometrically and by μ-CT scan. The gingivae were pooled per experimental group, extracted, and analyzed for MMPs (gelatin zymography; western blot) and for cytokines (e.g., IL-1β; ELISA); serum and plasma samples were analyzed for cytokines and MMP-8. The LPS-induced pathologically excessive bone loss was reduced to normal levels based on either morphometric (P = 0.003) or μ-CT (P = 0.008) analysis. A similar response was seen for MMPs and cytokines in the gingiva and blood. This initial study, on a novel triketonic zinc-binding CMC, indicates potential efficacy on inflammatory mediators and alveolar bone loss in experimental periodontitis and warrants future therapeutic and pharmacokinetic investigations. PMID:25104884

  15. Structural and dynamics analysis of matrix metalloproteinases MMP-2 complexed with chemically modified tetracyclines (CMTs).

    PubMed

    Marcial, B L; Sousa, S F; Santos, H F Dos; Ramos, M J

    2014-12-01

    Matrix metalloproteinases (MMPs) play a critical role in physiological processes and pathological conditions such tumor invasion and metastasis. In recent years, a number of MMP inhibitors have been proposed, including the chemically modified tetracyclines (CMTs), which have been evaluated in preclinical cancer models showing promising results. This work provides insights into the structure and dynamics of the MMP-2 catalytic domain complexed with seven CMT (CMT-n), based on the analysis of molecular dynamics trajectories in solution. The comparative analysis of various relevant molecular aspects of the different complexes of MMP-2 and CMT-n derivatives was performed aiming to elucidate the effect of ligands on the enzyme structure. These include the radial distribution function of the water molecules around the catalytic zinc, the solvent accessible surface area for the inhibitors and the root-mean-square fluctuation for all amino acid residues. The results help to understand the differences in the binding modes of related compounds and, therefore, add to further design of novel tetracycline-based inhibitors for MMP enzymes. PMID:24125013

  16. The effects of chemically modifying serum apolipoproteins on their ability to activate lipoprotein lipase.

    PubMed Central

    Dodds, P F; Lopez-Johnston, A; Welch, V A; Gurr, M I

    1987-01-01

    Lipoprotein lipase activity was measured in an acetone-dried-powder preparation from rat epididymal adipose tissue using pig serum or pig serum lipoprotein, which had been chemically modified, as activator. Modification of acidic amino acids of lipoproteins with NN-dimethyl-1,3-diamine resulted in a complete loss of ability to activate lipoprotein lipase. Modification of 34% of lipoprotein arginine groups with cyclohexanedione resulted in the loss of 75% of the activation of lipoprotein lipase; approx. 42% of the original activity was recovered after reversal of the modification. This effect was dependent on the cyclohexanedione concentration. Modification of 48% of lipoprotein lysine groups with malonaldehyde decreased the maximum activation by 20%, but three times as much lipoprotein was required to achieve this. Non-enzymic glycosylation of lipoprotein with glucose, under a variety of conditions resulting in up to 28 nmol of glucose/mg of protein, had no effect upon the ability to activate lipoprotein lipase. In contrast non-enzymic sialylation resulted in a time-dependent loss of up to 60% of ability to activate lipoprotein lipase. Reductive methylation and acetoacetylation of serum did not affect the ability to activate lipoprotein lipase. The results are compared to the effects of similar modifications to low density lipoproteins on receptor-mediated endocytosis. PMID:3593262

  17. Changes in the Chemical Composition and Decay Resistance of Thermally-Modified Hevea brasiliensis Wood.

    PubMed

    Severo, Elias Taylor Durgante; Calonego, Fred Willians; Sansígolo, Cláudio Angeli; Bond, Brian

    2016-01-01

    In this study the effect of thermal treatment on the equilibrium moisture content, chemical composition and biological resistance to decay fungi of juvenile and mature Hevea brasiliensis wood (rubber wood) was evaluated. Samples were taken from a 53-year-old rubber wood plantation located in Tabapuã, Sao Paulo, Brazil. The samples were thermally-modified at 180°C, 200°C and 220°C. Results indicate that the thermal modification caused: (1) a significant increase in the extractive content and proportional increase in the lignin content at 220°C; (2) a significant decrease in the equilibrium moisture content, holocelluloses, arabinose, galactose and xylose content, but no change in glucose content; and (3) a significant increase in wood decay resistance against both Pycnoporus sanguineus (L.) Murrill and Gloeophyllum trabeum (Pers.) Murrill decay fungi. The greatest decay resistance was achieved from treatment at 220°C which resulted in a change in wood decay resistance class from moderately resistant to resistant. Finally, this study also demonstrated that the influence of thermal treatment in mature wood was lower than in juvenile wood. PMID:26986200

  18. Changes in the Chemical Composition and Decay Resistance of Thermally-Modified Hevea brasiliensis Wood

    PubMed Central

    2016-01-01

    In this study the effect of thermal treatment on the equilibrium moisture content, chemical composition and biological resistance to decay fungi of juvenile and mature Hevea brasiliensis wood (rubber wood) was evaluated. Samples were taken from a 53-year-old rubber wood plantation located in Tabapuã, Sao Paulo, Brazil. The samples were thermally-modified at 180°C, 200°C and 220°C. Results indicate that the thermal modification caused: (1) a significant increase in the extractive content and proportional increase in the lignin content at 220°C; (2) a significant decrease in the equilibrium moisture content, holocelluloses, arabinose, galactose and xylose content, but no change in glucose content; and (3) a significant increase in wood decay resistance against both Pycnoporus sanguineus (L.) Murrill and Gloeophyllum trabeum (Pers.) Murrill decay fungi. The greatest decay resistance was achieved from treatment at 220°C which resulted in a change in wood decay resistance class from moderately resistant to resistant. Finally, this study also demonstrated that the influence of thermal treatment in mature wood was lower than in juvenile wood. PMID:26986200

  19. Adhesion-dependent negative friction coefficient on chemically modified graphite at the nanoscale

    NASA Astrophysics Data System (ADS)

    Deng, Zhao; Smolyanitsky, Alex; Li, Qunyang; Feng, Xi-Qiao; Cannara, Rachel J.

    2012-12-01

    From the early tribological studies of Leonardo da Vinci to Amontons’ law, friction has been shown to increase with increasing normal load. This trend continues to hold at the nanoscale, where friction can vary nonlinearly with normal load. Here we present nanoscale friction force microscopy (FFM) experiments for a nanoscale probe tip sliding on a chemically modified graphite surface in an atomic force microscope (AFM). Our results demonstrate that, when adhesion between the AFM tip and surface is enhanced relative to the exfoliation energy of graphite, friction can increase as the load decreases under tip retraction. This leads to the emergence of an effectively negative coefficient of friction in the low-load regime. We show that the magnitude of this coefficient depends on the ratio of tip-sample adhesion to the exfoliation energy of graphite. Through both atomistic- and continuum-based simulations, we attribute this unusual phenomenon to a reversible partial delamination of the topmost atomic layers, which then mimic few- to single-layer graphene. Lifting of these layers with the AFM tip leads to greater deformability of the surface with decreasing applied load. This discovery suggests that the lamellar nature of graphite yields nanoscale tribological properties outside the predictive capacity of existing continuum mechanical models.

  20. Adhesion-dependent negative friction coefficient on chemically modified graphite at the nanoscale.

    PubMed

    Deng, Zhao; Smolyanitsky, Alex; Li, Qunyang; Feng, Xi-Qiao; Cannara, Rachel J

    2012-12-01

    From the early tribological studies of Leonardo da Vinci to Amontons' law, friction has been shown to increase with increasing normal load. This trend continues to hold at the nanoscale, where friction can vary nonlinearly with normal load. Here we present nanoscale friction force microscopy (FFM) experiments for a nanoscale probe tip sliding on a chemically modified graphite surface in an atomic force microscope (AFM). Our results demonstrate that, when adhesion between the AFM tip and surface is enhanced relative to the exfoliation energy of graphite, friction can increase as the load decreases under tip retraction. This leads to the emergence of an effectively negative coefficient of friction in the low-load regime. We show that the magnitude of this coefficient depends on the ratio of tip-sample adhesion to the exfoliation energy of graphite. Through both atomistic- and continuum-based simulations, we attribute this unusual phenomenon to a reversible partial delamination of the topmost atomic layers, which then mimic few- to single-layer graphene. Lifting of these layers with the AFM tip leads to greater deformability of the surface with decreasing applied load. This discovery suggests that the lamellar nature of graphite yields nanoscale tribological properties outside the predictive capacity of existing continuum mechanical models. PMID:23064494

  1. Chemically modified graphene films for high-performance optical NO2 sensors.

    PubMed

    Xing, Fei; Zhang, Shan; Yang, Yong; Jiang, Wenshuai; Liu, Zhibo; Zhu, Siwei; Yuan, Xiaocong

    2016-08-01

    Various graphene-based gas sensors that operate based on the electrical properties of graphene have been developed for accurate detection of gas components. However, electronic graphene-based gas sensors are unsafe under explosive atmospheres and sensitive to electromagnetic interference. Here, a novel optical graphene-based gas sensor for NO2 detection is established based on surface chemical modification of high-temperature-reduced graphene oxide (h-rGO) films with sulfo groups. Sulfo group-modified h-rGO (S-h-rGO) films with a thickness of several nanometers exhibit excellent performance in NO2 detection at room temperature and atmospheric pressure based on the polarization absorption effect of graphene. Initial slope analysis of the S-h-rGO sensor indicates that it has a limit of detection of 0.28 ppm and a response time of 300 s for NO2 gas sensing. Furthermore, the S-h-rGO sensor also possesses the advantages of good linearity, reversibility, selectivity, non-contact operation, low cost and safety. This novel optical gas sensor has the potential to serve as a general platform for the selective detection of a variety of gases with high performance. PMID:27265308

  2. Progress in chemical treatment of LEU targets by the modified Cintichem process

    SciTech Connect

    Wu, D.; Landsberger, S.; Vandegrift, G.F.

    1996-12-31

    Presented here are recent experimental results on tests of a modified Cintichem process for producing {sup 99}Mo from low enriched uranium (LEU). Studies were focused in three areas: (1) testing the effects on {sup 99}Mo recovery and purity of dissolving LEU foil in nitric acid alone, rather than in the sulfuric/nitric acid mixture currently used, (2) measuring decontamination factors for radionuclide impurities in each purification step, and (3) testing the effects on processing of adding barrier materials to the LEU metal-foil target. The experimental results show that switching from dissolving the target in the sulfuric/nitric mixture to using nitric acid alone should cause no significant difference in {sup 99}Mo product yield or purity. Further, the results show that overall decontamination factors for gamma emitters in the LEU-target processing are high enough to meet the purity requirements for the {sup 99}Mo product. The results also show that the selected barrier materials, Cu, Fe, and Ni, do not interfere with {sup 99}Mo recovery and can be removed during chemical processing of the LEU target.

  3. Effects of Zn Content on Crystal Structure, Cytocompatibility, Antibacterial Activity, and Chemical Stability in Zn-Modified Calcium Silicate Coatings

    NASA Astrophysics Data System (ADS)

    Li, Kai; Yu, Jiangming; Xie, Youtao; Huang, Liping; Ye, Xiaojian; Zheng, Xuebin

    2013-08-01

    In our previous study, Zn-modified calcium silicate coatings possess not only excellent chemical stability but also well antibacterial activity. Still, effects of zinc content on these properties and cytocompatibility remain unclear. In this paper, two kinds of Zn-modified calcium silicate coatings (ZC0.3, ZC0.5) were fabricated on Ti-6Al-4V substrates via plasma spraying technology. X-ray diffraction results and transmission electron microscopy observations showed that the ZC0.5 coating was composed of pure hardystonite (Ca2ZnSi2O7) phase, while, besides Ca2ZnSi2O7 phase, the amorphous CaSiO3 phase was also detected in the ZC0.3 coating. Chemical stability in Tris-HCl buffer solution and antibacterial activity of the Zn-modified calcium silicate coatings increased with an increase in zinc content. In vitro cytocompatibility evaluation demonstrated that the proliferation and alkaline phosphatase activity and collagen type I (COLI) secretion of osteoblast-like MC3T3-E1 cells on Zn-modified coatings were significantly enhanced compared to the Zn-free coating and Ti-6Al-4V control, and no cytotoxicity appeared on Zn-modified coatings. The better antibacterial activity and the enhanced capability to promote MC3T3-E1 cells differentiation of Zn-modified coatings should be attributed to the slow and constant Zn2+ releasing from the coatings.

  4. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  5. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  6. Surfactants as bubble surface modifiers in the flotation of algae: dissolved air flotation that utilizes a chemically modified bubble surface.

    PubMed

    Henderson, Rita K; Parsons, Simon A; Jefferson, Bruce

    2008-07-01

    In this paper we present an investigation into the use of bubbles modified with surfactants in dissolved air flotation (DAF). Bubble modification was investigated by dosing surfactants of varying character into the saturator of a DAF unit in turn. The cell removal efficiency only improved when using a cationic surfactant where optimum removal of Microcystis aeruginosa cells was obtained when using 0.0022-0.004 mequiv L(-1) surfactant. However, the magnitude of the removal differed according to the hydrophobicity of the surfactant. Typically, the more efficiently the surfactant adsorbed at the bubble interface, the better the removal efficiency. When the dose to saturator ratio was kept constant and the recycle ratio varied, the removal efficiency improved with increasing recycle ratio, reaching a maximum removal efficiency of 87% for M. aeruginosa. This value was comparable with that predicted by a theoretical model. The bubble collection efficiency of a maximum of two cells per bubble was constant irrespective of the influent cell number or recycle ratio. Treatment of additional species in this way revealed a relationship between increasing size and both increasing removal efficiency and decreasing surfactant dose, which is supported by theoretical relationships. PMID:18678021

  7. The Fidelity of Template-Directed Oligonucleotide Ligation and the Inevitability of Polymerase Function

    NASA Astrophysics Data System (ADS)

    James, Kenneth D.; Ellington, Andrew D.

    1999-08-01

    The first living systems may have employed template-directed oligonucleotide ligation for replication. The utility of oligonucleotide ligation as a mechanism for the origin and evolution of life is in part dependent on its fidelity. We have devised a method for evaluating ligation fidelity in which ligation substrates are selected from random sequence libraries. The fidelities of chemical and enzymatic ligation are compared under a variety of conditions. While reaction conditions can be found that promote high fidelity copying, departure from these conditions leads to error-prone copying. In particular, ligation reactions with shorter oligonucleotide substrates are less efficient but more faithful. These results support a model for origins in which there was selective pressure for template-directed oligonucleotide ligation to be gradually supplanted by mononucleotide polymerization.

  8. 40 CFR 372.20 - Process for modifying covered chemicals and facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... facilities that release the toxic chemical or to population centers, the history of releases of such chemical... (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS TOXIC CHEMICAL RELEASE... toxic chemical listed under subsection (c) of section 313 of Title III if the Administrator...

  9. 40 CFR 372.20 - Process for modifying covered chemicals and facilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... facilities that release the toxic chemical or to population centers, the history of releases of such chemical... (CONTINUED) SUPERFUND, EMERGENCY PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS TOXIC CHEMICAL RELEASE... toxic chemical listed under subsection (c) of section 313 of Title III if the Administrator...

  10. Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS

    PubMed Central

    Østergaard, Michael E.; Southwell, Amber L.; Kordasiewicz, Holly; Watt, Andrew T.; Skotte, Niels H.; Doty, Crystal N.; Vaid, Kuljeet; Villanueva, Erika B.; Swayze, Eric E.; Frank Bennett, C.; Hayden, Michael R.; Seth, Punit P.

    2013-01-01

    Autosomal dominant diseases such as Huntington’s disease (HD) are caused by a gain of function mutant protein and/or RNA. An ideal treatment for these diseases is to selectively suppress expression of the mutant allele while preserving expression of the wild-type variant. RNase H active antisense oligonucleotides (ASOs) or small interfering RNAs can achieve allele selective suppression of gene expression by targeting single nucleotide polymorphisms (SNPs) associated with the repeat expansion. ASOs have been previously shown to discriminate single nucleotide changes in targeted RNAs with ∼5-fold selectivity. Based on RNase H enzymology, we enhanced single nucleotide discrimination by positional incorporation of chemical modifications within the oligonucleotide to limit RNase H cleavage of the non-targeted transcript. The resulting oligonucleotides demonstrate >100-fold discrimination for a single nucleotide change at an SNP site in the disease causing huntingtin mRNA, in patient cells and in a completely humanized mouse model of HD. The modified ASOs were also well tolerated after injection into the central nervous system of wild-type animals, suggesting that their tolerability profile is suitable for advancement as potential allele-selective HD therapeutics. Our findings lay the foundation for efficient allele-selective downregulation of gene expression using ASOs—an outcome with broad application to HD and other dominant genetic disorders. PMID:23963702

  11. Redesigned and chemically-modified hammerhead ribozymes with improved activity and serum stability

    PubMed Central

    Hendry, Philip; McCall, Maxine J; Stewart, Tom S; Lockett, Trevor J

    2004-01-01

    Background Hammerhead ribozymes are RNA-based molecules which bind and cleave other RNAs specifically. As such they have potential as laboratory reagents, diagnostics and therapeutics. Despite having been extensively studied for 15 years or so, their wide application is hampered by their instability in biological media, and by the poor translation of cleavage studies on short substrates to long RNA molecules. This work describes a systematic study aimed at addressing these two issues. Results A series of hammerhead ribozyme derivatives, varying in their hybridising arm length and size of helix II, were tested in vitro for cleavage of RNA derived from the carbamoyl phosphate synthetase II gene of Plasmodium falciparum. Against a 550-nt transcript the most efficient (t1/2 = 26 seconds) was a miniribozyme with helix II reduced to a single G-C base pair and with twelve nucleotides in each hybridising arm. Miniribozymes of this general design were targeted to three further sites, and they demonstrated exceptional cleavage activity. A series of chemically modified derivatives was prepared and examined for cleavage activity and stability in human serum. One derivative showed a 103-fold increase in serum stability and a doubling in cleavage efficiency compared to the unmodified miniribozyme. A second was almost 104-fold more stable and only 7-fold less active than the unmodified parent. Conclusion Hammerhead ribozyme derivatives in which helix II is reduced to a single G-C base pair cleave long RNA substrates very efficiently in vitro. Using commonly available phosphoramidites and reagents, two patterns of nucleotide substitution in this derivative were identified which conferred both good cleavage activity against long RNA targets and good stability in human serum. PMID:15588292

  12. Direct determination of cadmium in Orujo spirit samples by electrothermal atomic absorption spectrometry: comparative study of different chemical modifiers.

    PubMed

    Vilar Fariñas, M; Barciela García, J; García Martín, S; Peña Crecente, R; Herrero Latorre, C

    2007-05-22

    In this work, several analytical methods are proposed for cadmium determination in Orujo spirit samples using electrothermal atomic absorption spectrometry (ETAAS). Permanent chemical modifiers thermally coated on the platforms inserted in pyrolytic graphite tubes (such as W, Ir, Ru, W-Ir and W-Ru) were comparatively studied in relation to common chemical modifier mixtures [Pd-Mg(NO3)2 and (NH4)H2PO4-Mg(NO3)2] for cadmium stabilization. Different ETAAS Cd determination methods based on the indicated modifiers have been developed. In each case, pyrolysis and atomization temperatures, atomization shapes, characteristic masses and detection limits as well as other analytical characteristics have been determined. All the assayed modifiers (permanent and conventional) were capable of achieving the appropriate stabilization of the analyte, with the exception of Ru and W-Ru. Moreover, for all developed methods, recoveries (99-102%) and precision (R.S.D. lower than 10%) were acceptable. Taking into account the analytical performance (best detection limit LOD = 0.01 microg L(-1)), the ETAAS method based on the use of W as a permanent modifier was selected for further direct Cd determinations in Orujo samples from Galicia (NW Spain). The chosen method was applied in the determination of the Cd content in 38 representative Galician samples. The cadmium concentrations ranged

  13. Selective release of multiple DNA oligonucleotides from gold nanorods.

    PubMed

    Wijaya, Andy; Schaffer, Stefan B; Pallares, Ivan G; Hamad-Schifferli, Kimberly

    2009-01-27

    Combination therapy, or the use of multiple drugs, has been proven to be effective for complex diseases, but the differences in chemical properties and pharmacokinetics can be challenging in terms of the loading, delivering, and releasing multiple drugs. Here we demonstrate that we can load and selectively release two different DNA oligonucleotides from two different gold nanorods. DNA was loaded on the nanorods via thiol conjugation. Selective releases were induced by selective melting of gold nanorods via ultrafast laser irradiation at the nanorods' longitudinal surface plasmon resonance peaks. Excitation at one wavelength could selectively melt one type of gold nanorods and selectively release one type of DNA strand. Releases were efficient (50-80%) and externally tunable by laser fluence. Released oligonucleotides were still functional. This proof of concept is potentially a powerful method for multiple-drug delivery strategies. PMID:19206252

  14. Adsorptive separation of rhodium(III) using Fe(III)-templated oxine type of chemically modified chitosan

    SciTech Connect

    Alam, M.S.; Inoue, Katsutoshi; Yoshizuka, Kazuharu; Ishibashi, Hideaki

    1998-03-01

    The oxine type of chemically modified chitosan was prepared by the template crosslinking method using Fe(III) as a template ion. Batchwise adsorption of rhodium(III) on this chemically modified chitosan was examined from chloride media in the absence and presence of a large amount of tin(II). It was observed that the Fe(III)-templated oxine type of chemically modified chitosan shows better performance for rhodium adsorption than that of the original chitosan. When Sn(II) is absent from the solution, Rh(III) is hardly adsorbed on the modified chitosan and the order of selectivity of the adsorption of Rh(III), Pt(IV), and Cu(II) was found to be Pt(IV) > Cu(II) {approx} Rh(III). On the other hand, adsorption of rhodium is significantly increased in the presence of Sn(II) and the selectivity order of the adsorption was drastically changed to Rh(III) > Pt(IV) {much_gt} Cu(II), which ensures selective separation of Rh(III) from their mixture. Adsorption of Rh(III) increases with an increase in the concentration of Sn(II) in the aqueous solution, and maximum adsorption is achieved at a molar ratio, [Sn]/[Rh], of >6. The adsorption of Rh(III) decreases at a high concentration of hydrochloric acid. The maximum adsorption capacity was evaluated to be 0.92 mol/kg-dry adsorbent. Stripping tests of rhodium from the loaded chemically modified chitosan were carried out using different kinds of stripping agents containing some oxidizing agent. The maximum stripping of rhodium under these experimental conditions was found to be 72.5% by a single contact with 0.5 M HCl + 8 M HNO{sub 3}.

  15. Electron Transfer Dissociation of Oligonucleotide Cations.

    PubMed

    Smith, Suncerae I; Brodbelt, Jennifer S

    2009-06-01

    Electron transfer dissociation (ETD) of multi-protonated 6 - 20-mer oligonucleotides and 12- and 14-mer duplexes is compared to collision activated dissociation (CAD). ETD causes efficient charge reduction of the multi-protonated oligonucleotides in addition to limited backbone cleavages to yield sequence ions of low abundance. Subsequent CAD of the charge-reduced oligonucleotides formed upon electron transfer, in a net process termed electron transfer collision activated dissociation (ETcaD), results in rich fragmentation in terms of w, a, z, and d products, with a marked decrease in the abundance of base loss ions and internal fragments. Complete sequencing was possible for nearly all oligonucleotides studied. ETcaD of an oligonucleotide duplex resulted in specific backbone cleavages, with conservation of weaker non-covalent bonds. PMID:20161288

  16. Chemically and compositionally modified solid solution disordered multiphase nickel hydroxide positive electrode for alkaline rechargeable electrochemical cells

    DOEpatents

    Ovshinsky, Stanford R.; Corrigan, Dennis; Venkatesan, Srini; Young, Rosa; Fierro, Christian; Fetcenko, Michael A.

    1994-01-01

    A high capacity, long cycle life positive electrode for use in an alkaline rechargeable electrochemical cell comprising: a solid solution nickel hydroxide material having a multiphase structure that comprises at least one polycrystalline .gamma.-phase including a polycrystalline .gamma.-phase unit cell comprising spacedly disposed plates with at least one chemical modifier incorporated around the plates, the plates having a range of stable intersheet distances corresponding to a 2.sup.+ oxidation state and a 3.5.sup.+, or greater, oxidation state; and at least one compositional modifier incorporated into the solid solution nickel hydroxide material to promote the multiphase structure.

  17. Targeting Several CAG Expansion Diseases by a Single Antisense Oligonucleotide

    PubMed Central

    Evers, Melvin M.; Pepers, Barry A.; van Deutekom, Judith C. T.; Mulders, Susan A. M.; den Dunnen, Johan T.; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.; van Roon-Mom, Willeke M. C.

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2′-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)7, also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  18. Targeting several CAG expansion diseases by a single antisense oligonucleotide.

    PubMed

    Evers, Melvin M; Pepers, Barry A; van Deutekom, Judith C T; Mulders, Susan A M; den Dunnen, Johan T; Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B; van Roon-Mom, Willeke M C

    2011-01-01

    To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2'-O-methyl phosphorothioate (CUG)n triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG)(7), also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well. PMID:21909428

  19. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.

    PubMed

    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes

    2016-10-01

    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. PMID:27236069

  20. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  1. Optimizing antisense oligonucleotides using phosphorodiamidate morpholino oligomers.

    PubMed

    Popplewell, Linda J; Malerba, Alberto; Dickson, George

    2012-01-01

    Duchenne muscular dystrophy (DMD) is caused by mutations that disrupt the reading frame of the human DMD gene. Selective removal of exons flanking an out-of-frame DMD mutation can result in an in-frame mRNA transcript that may be translated into an internally deleted Becker muscular dystrophy-like functionally active dystrophin protein with therapeutic activity. Antisense oligonucleotides (AOs) can be designed to bind to complementary sequences in the targeted mRNA and modify pre-mRNA splicing to correct the reading frame of a mutated transcript. AO-induced exon skipping resulting in functional truncated dystrophin has been demonstrated in animal models of DMD both in vitro and in vivo, in DMD patient cells in vitro in culture, and in DMD muscle explants. The recent advances made in this field suggest that it is likely that AO-induced exon skipping will be the first gene therapy for DMD to reach the clinic. However, it should be noted that personalized molecular medicine may be necessary, since the various reading frame-disrupting mutations are spread across the DMD gene. The different deletions that cause DMD would require skipping of different exons, which would require the optimization and clinical trial workup of many specific AOs. This chapter describes the methodologies available for the optimization of AOs, in particular phosphorodiamidate morpholino oligomers, for the targeted skipping of specific exons on the DMD gene. PMID:22454060

  2. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  3. Quantum chemical characterization of zwitterionic structures: Supramolecular complexes for modifying the wettability of oil-water-limestone system.

    PubMed

    Lopez-Chavez, Ernesto; Garcia-Quiroz, Alberto; Gonzalez-Garcia, Gerardo; Orozco-Duran, Gabriela E; Zamudio-Rivera, Luis S; Martinez-Magadan, José M; Buenrostro-Gonzalez, Eduardo; Hernandez-Altamirano, Raul

    2014-06-01

    In this work, we present a quantum chemical study pertaining to some supramolecular complexes acting as wettability modifiers of oil-water-limestone system. The complexes studied are derived from zwitterionic liquids of the types N'-alkyl-bis, N-alquenil, N-cycloalkyl, N-amyl-bis-beta amino acid or salts acting as sparkling agents. We studied two molecules of zwitterionic liquids (ZL10 and ZL13), HOMO and LUMO levels, and the energy gap between them, were calculated, as well as the electron affinity (EA) and ionization potential (IP), chemical potential, chemical hardness, chemical electrophilicity index and selectivity descriptors such Fukui indices. In this work, electrochemical comparison was realized with cocamidopropyl betaine (CPB), which is a structure zwitterionic liquid type, nowadays widely applied in enhanced recovery processes. PMID:24907932

  4. Physico-Chemical Properties of Rice Starch Modified by Hydrothermal Treatments

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice starches of long grain and waxy cultivars were annealed (ANN) in excess water at 50 oC for 4 hours. They were also modified under heat-moisture treatment (MHT) conditions at 110 oC, and various moisture contents (20%, 30%, and 40%) for 8 hours. The modified products were analyzed by Rapid-Vis...

  5. Physico-chemical Properties of Rice Starch Modified by Hydrothermal Treatment.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice starch of long grain and waxy cultivars were annealed (ANN) in excess water at 50C for 4 hours. They were also modified under moisture-heat treatment (MHT) conditions at 110 C, and various moisture contents (20%, 30%, and 40%) for 8 hrs. The modified products were analyzed by Rapid-Visco Anal...

  6. Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing

    PubMed Central

    Rigo, Frank; Hua, Yimin; Chun, Seung J; Prakash, Thazha P; Krainer, Adrian R; Bennett, C Frank

    2016-01-01

    We describe a new technology for recruiting specific proteins to RNA through selective recognition of heteroduplexes formed with chemically modified antisense oligonucleotides (ASOs). Typically, ASOs function by hybridizing to their RNA targets and blocking the binding of single-stranded RNA–binding proteins. Unexpectedly, we found that ASOs with 2′-deoxy-2′-fluoro (2′-F) nucleotides, but not with other 2′ chemical modifications, have an additional property: they form heteroduplexes with RNA that are specifically recognized by the interleukin enhancer-binding factor 2 and 3 complex (ILF2/3). 2′-F ASO–directed recruitment of ILF2/3 to RNA can be harnessed to control gene expression by modulating alternative splicing of target transcripts. ILF2/3 recruitment to precursor mRNA near an exon results in omission of the exon from the mature mRNA, both in cell culture and in mice. We discuss the possibility of using chemically engineered ASOs that recruit specific proteins to modulate gene expression for therapeutic intervention. PMID:22504300

  7. Synthetic oligonucleotides recruit ILF2/3 to RNA transcripts to modulate splicing.

    PubMed

    Rigo, Frank; Hua, Yimin; Chun, Seung J; Prakash, Thazha P; Krainer, Adrian R; Bennett, C Frank

    2012-06-01

    We describe a new technology for recruiting specific proteins to RNA through selective recognition of heteroduplexes formed with chemically modified antisense oligonucleotides (ASOs). Typically, ASOs function by hybridizing to their RNA targets and blocking the binding of single-stranded RNA-binding proteins. Unexpectedly, we found that ASOs with 2'-deoxy-2'-fluoro (2'-F) nucleotides, but not with other 2' chemical modifications, have an additional property: they form heteroduplexes with RNA that are specifically recognized by the interleukin enhancer-binding factor 2 and 3 complex (ILF2/3). 2'-F ASO-directed recruitment of ILF2/3 to RNA can be harnessed to control gene expression by modulating alternative splicing of target transcripts. ILF2/3 recruitment to precursor mRNA near an exon results in omission of the exon from the mature mRNA, both in cell culture and in mice. We discuss the possibility of using chemically engineered ASOs that recruit specific proteins to modulate gene expression for therapeutic intervention. PMID:22504300

  8. Chemically modified polymeric resins for high performance liquid chromatography, solid-phase extraction and organic separation by LC and GC

    SciTech Connect

    Sun, Jeffrey Jiafang.

    1991-08-06

    Polystyrene divinylbenzene resins were chemically modified by introduction of various functional groups, which included polar, non-polar, ionic and metallic groups. These chemically modified polymeric resins were used successfully for high performance liquid chromatography, solid phase extraction and some special applications in liquid and gas chromatography. The introduced functional groups offer an additional selectivity parameter for liquid chromatographic separation. The polar derivatized polymeric resins dramatically increased the recoveries of solid phase extraction, especially for polar compounds. The sulfonated polystyrene resins were used for separation of neutral and basic compounds as well as basic and weaker basic compounds. The sulfonated non-porous resin was used amine abstracter and the polymeric-mercuric resin was used as mercaptan abstracter in capillary gas chromatograph. The researches in this dissertation has shown the very promising applications of polystyrene divinylbenzene resin in chromatographic field. 58 refs., 34 figs., 28 tabs.

  9. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry.

    PubMed

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization. PMID:26454462

  10. Tandem oligonucleotide synthesis using linker phosphoramidites

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan

    2005-01-01

    Multiple oligonucleotides of the same or different sequence, linked end-to-end in tandem can be synthesized in a single automated synthesis. A linker phosphoramidite [R. T. Pon and S. Yu (2004) Nucleic Acids Res., 32, 623–631] is added to the 5′-terminal OH end of a support-bound oligonucleotide to introduce a cleavable linkage (succinic acid plus sulfonyldiethanol) and the 3′-terminal base of the new sequence. Conventional phosphoramidites are then used for the rest of the sequence. After synthesis, treatment with ammonium hydroxide releases the oligonucleotides from the support and cleaves the linkages between each sequence. Mixtures of one oligonucleotide with both 5′- and 3′-terminal OH ends and other oligonucleotides with 5′-phosphorylated and 3′-OH ends are produced, which are deprotected and worked up as a single product. Tandem synthesis can be used to make pairs of PCR primers, sets of cooperative oligonucleotides or multiple copies of the same sequence. When tandem synthesis is used to make two self-complementary sequences, double-stranded structures spontaneously form after deprotection. Tandem synthesis of oligonucleotide chains containing up to six consecutive 20mer (120 bases total), various trinucleotide codons and primer pairs for PCR, or self-complementary strands for in situ formation of double-stranded DNA fragments has been demonstrated. PMID:15814811

  11. Chemically modified, non-anticoagulant heparin derivatives are potent galectin-3 binding inhibitors and inhibit circulating galectin-3-promoted metastasis.

    PubMed

    Duckworth, Carrie A; Guimond, Scott E; Sindrewicz, Paulina; Hughes, Ashley J; French, Neil S; Lian, Lu-Yun; Yates, Edwin A; Pritchard, D Mark; Rhodes, Jonathan M; Turnbull, Jeremy E; Yu, Lu-Gang

    2015-09-15

    Concentrations of circulating galectin-3, a metastasis promoter, are greatly increased in cancer patients. Here we show that 2- or 6-de-O-sulfated, N-acetylated heparin derivatives are galectin-3 binding inhibitors. These chemically modified heparin derivatives inhibited galectin-3-ligand binding and abolished galectin-3-mediated cancer cell-endothelial adhesion and angiogenesis. Unlike standard heparin, these modified heparin derivatives and their ultra-low molecular weight sub-fractions had neither anticoagulant activity nor effects on E-, L- or P-selectin binding to their ligands nor detectable cytotoxicity. Intravenous injection of such heparin derivatives (with cancer cells pre-treated with galectin-3 followed by 3 subcutaneous injections of the derivatives) abolished the circulating galectin-3-mediated increase in lung metastasis of human melanoma and colon cancer cells in nude mice. Structural analysis using nuclear magnetic resonance and synchrotron radiation circular dichroism spectroscopies showed that the modified heparin derivatives bind to the galectin-3 carbohydrate-recognition domain. Thus, these chemically modified, non-anticoagulant, low-sulfated heparin derivatives are potent galectin-3 binding inhibitors with substantial potential as anti-metastasis/cancer drugs. PMID:26160844

  12. Chemically modified, non-anticoagulant heparin derivatives are potent galectin-3 binding inhibitors and inhibit circulating galectin-3-promoted metastasis

    PubMed Central

    Sindrewicz, Paulina; Hughes, Ashley J.; French, Neil S.; Lian, Lu-Yun; Yates, Edwin A.; Pritchard, D. Mark; Rhodes, Jonathan M.; Turnbull, Jeremy E.; Yu, Lu-Gang

    2015-01-01

    Concentrations of circulating galectin-3, a metastasis promoter, are greatly increased in cancer patients. Here we show that 2- or 6-de-O-sulfated, N-acetylated heparin derivatives are galectin-3 binding inhibitors. These chemically modified heparin derivatives inhibited galectin-3-ligand binding and abolished galectin-3-mediated cancer cell-endothelial adhesion and angiogenesis. Unlike standard heparin, these modified heparin derivatives and their ultra-low molecular weight sub-fractions had neither anticoagulant activity nor effects on E-, L- or P-selectin binding to their ligands nor detectable cytotoxicity. Intravenous injection of such heparin derivatives (with cancer cells pre-treated with galectin-3 followed by 3 subcutaneous injections of the derivatives) abolished the circulating galectin-3-mediated increase in lung metastasis of human melanoma and colon cancer cells in nude mice. Structural analysis using nuclear magnetic resonance and synchrotron radiation circular dichroism spectroscopies showed that the modified heparin derivatives bind to the galectin-3 carbohydrate-recognition domain. Thus, these chemically modified, non-anticoagulant, low-sulfated heparin derivatives are potent galectin-3 binding inhibitors with substantial potential as anti-metastasis/cancer drugs. PMID:26160844

  13. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  14. Renewable resources as reinforcement of polymeric matrices: composites based on phenolic thermosets and chemically modified sisal fibers.

    PubMed

    Megiatto, Jackson D; Oliveira, Franciéli B; Rosa, Derval S; Gardrat, Christian; Castellan, Alain; Frollini, Elisabete

    2007-09-11

    Lignocellulosic materials can significantly contribute to the development of composites, since it is possible to chemically and/or physically modify their main components, cellulose, hemicelluloses and lignin. This may result in materials more stable and with more uniform properties. It has previously been shown that chemically modified sisal fibers by ClO(2) oxidation and reaction with FA and PFA presented a thin coating layer of PFA on their surface. FA and PFA were chosen as reagents because these alcohols can be obtained from renewable sources. In the present work, the effects of the polymeric coating layer as coupling agent in phenolic/sisal fibers composites were studied. For a more detailed characterization of the fibers, IGC was used to evaluate the changes that occurred at the sisal fibers surface after the chemical modifications. The dispersive and acid-base properties of untreated and treated sisal fibers surfaces were determined. Biodegradation experiments were also carried out. In a complementary study, another PFA modification was made on sisal fibers, using K2Cr2O(7) as oxidizing agent. In this case the oxidation effects involve mainly the cellulose polymer instead of lignin, as observed when the oxidation was carried out with ClO(2). The SEM images showed that the oxidation of sisal fibers followed by reaction with FA or PFA favored the fiber/phenolic matrix interaction at the interface. However, because the fibers were partially degraded by the chemical treatment, the impact strength of the sisal-reinforced composites decreased. By contrast, the chemical modification of fibers led to an increase of the water diffusion coefficient and to a decrease of the water absorption of the composites reinforced with modified fibers. The latter property is very important for certain applications, such as in the automotive industry. PMID:17676656

  15. Quantitation of phosphorothioate oligonucleotides in human plasma.

    PubMed

    Leeds, J M; Graham, M J; Truong, L; Cummins, L L

    1996-03-01

    Methods are presented for the extraction of phosphorothioate oligonucleotides from human plasma to permit quantitation by capillary gel electrophoresis. Extraction of the phosphorothioate oligonucleotides from plasma was accomplished using two solid-phase extraction columns, a strong anion-exchange column to remove plasma proteins and lipids, followed by a reverse-phase column to remove salts. A second desalting step, achieved by dialysis utilizing a membrane with a molecular weight cutoff of 2500 Da floating on distilled water, was required to remove residual ionic material from the extracted sample. This method should be generally applicable to the analysis and quantitation of phosphorothioate oligonucleotides. PMID:8850544

  16. Rapid bacterial identification using evanescent-waveguide oligonucleotide microarray classification.

    PubMed

    Francois, Patrice; Charbonnier, Yvan; Jacquet, Jean; Utinger, Dominic; Bento, Manuela; Lew, Daniel; Kresbach, Gerhard M; Ehrat, Markus; Schlegel, Werner; Schrenzel, Jacques

    2006-06-01

    Bacterial identification relies primarily on culture-based methodologies and requires 48-72 h to deliver results. We developed and used i) a bioinformatics strategy to select oligonucleotide signature probes, ii) a rapid procedure for RNA labelling and hybridization, iii) an evanescent-waveguide oligoarray with exquisite signal/noise performance, and iv) informatics methods for microarray data analysis. Unique 19-mer signature oligonucleotides were selected in the 5'-end of 16s rDNA genes of human pathogenic bacteria. Oligonucleotides spotted onto a Ta(2)O(5)-coated microarray surface were incubated with chemically labelled total bacterial RNA. Rapid hybridization and stringent washings were performed before scanning and analyzing the slide. In the present paper, the eight most abundant bacterial pathogens representing >54% of positive blood cultures were selected. Hierarchical clustering analysis of hybridization data revealed characteristic patterns, even for closely related species. We then evaluated artificial intelligence-based approaches that outperformed conventional threshold-based identification schemes on cognate probes. At this stage, the complete procedure applied to spiked blood cultures was completed in less than 6 h. In conclusion, when coupled to optimal signal detection strategy, microarrays provide bacterial identification within a few hours post-sampling, allowing targeted antimicrobial prescription. PMID:16216356

  17. In vitro characterization of two novel biodegradable vectors for the delivery of radiolabeled antisense oligonucleotides.

    PubMed

    von Guggenberg, Elisabeth; Shahhosseini, Soraya; Koslowsky, Ingrid; Lavasanifar, Afsaneh; Murray, David; Mercer, John

    2010-12-01

    The development of antisense oligonucleotides suitable for tumor targeting applications is hindered by low stability and bioavailability of oligonucleotides in vivo and by the absence of efficient and safe vectors for oligonucleotide delivery. Stabilization in vivo has been achieved through chemical modification of oligonucleotides by various means, but effective approaches to enhance their intracellular delivery are lacking. This study reports on the characterization in vitro of a fully phosphorothioated 20-mer oligonucleotide, complementary to p21 mRNA, radiolabeled with fluorine-18 using a thiol reactive prosthetic group. The potential of two novel synthetic block copolymers containing grafted polyamines on their hydrophobic blocks for vector-assisted cell delivery was studied in vitro. Extensive cellular uptake studies were performed in human colon carcinoma cell lines with enhanced or deficient p21 expression to evaluate and compare the uptake mechanism of naked and vectorized radiolabeled formulations. Uptake studies with the two novel biodegradable vectors showed a moderate increase in cell uptake of the radiofluorinated antisense oligonucleotide. The two vectors show, however, promising advantages over conventional lipidic vectors regarding their biocompatibility and subcellular distribution. PMID:21204767

  18. OSWG Recommendations for Genotoxicity Testing of Novel Oligonucleotide-Based Therapeutics.

    PubMed

    Berman, Cindy L; Barros, Scott A; Galloway, Sheila M; Kasper, Peter; Oleson, Frederick B; Priestley, Catherine C; Sweder, Kevin S; Schlosser, Michael J; Sobol, Zhanna

    2016-04-01

    The Oligonucleotide Safety Working Group subcommittee on genotoxicity testing considers therapeutic oligonucleotides (ONs) unlikely to be genotoxic based on their properties and on the negative results for ONs tested to date. Nonetheless, the subcommittee believes that genotoxicity testing of new ONs is warranted because modified monomers could be liberated from a metabolized ON and incorporated into DNA and could hypothetically cause chain termination, miscoding, and/or faulty replication or repair. The standard test battery as described in Option 1 of International Conference on Harmonisation S2(R1) is generally adequate to assess such potential. However, for the in vitro assay for gene mutations, mammalian cells are considered more relevant than bacteria for most ONs due to their known responsiveness to nucleosides and their greater potential for ON uptake; on the other hand, bacterial assays may be more appropriate for ONs containing non-ON components. Testing is not recommended for ONs with only naturally occurring chemistries or for ONs with chemistries for which there is documented lack of genotoxicity in systems with demonstrated cellular uptake. Testing is recommended for ONs that contain non-natural chemical modifications and use of the complete drug product (including linkers, conjugates, and liposomes) is suggested to provide the most clinically relevant assessment. Documentation of uptake into cells comparable to those used for genotoxicity testing is proposed because intracellular exposure cannot be assumed for these large molecules. ONs could also hypothetically cause mutations through triple helix formation with genomic DNA and no tests are available for detection of such sequence-specific mutations across the entire genome. However, because the potential for triplex formation by therapeutic ONs is extremely low, this potential can be assessed adequately by sequence analysis. PMID:26978711

  19. Identification and characterization of intracellular proteins that bind oligonucleotides with phosphorothioate linkages

    PubMed Central

    Liang, Xue-hai; Sun, Hong; Shen, Wen; Crooke, Stanley T.

    2015-01-01

    Although the RNase H-dependent mechanism of inhibition of gene expression by chemically modified antisense oligonucleotides (ASOs) has been well characterized, little is known about the interactions between ASOs and intracellular proteins that may alter cellular localization and/or potency of ASOs. Here, we report the identification of 56 intracellular ASO-binding proteins using multi-step affinity selection approaches. Many of the tested proteins had no significant effect on ASO activity; however, some proteins, including La/SSB, NPM1, ANXA2, VARS and PC4, appeared to enhance ASO activities, likely through mechanisms related to subcellular distribution. VARS and ANXA2 co-localized with ASOs in endocytic organelles, and reduction in the level of VARS altered lysosome/ASO localization patterns, implying that these proteins may facilitate ASO release from the endocytic pathway. Depletion of La and NPM1 reduced nuclear ASO levels, suggesting potential roles in ASO nuclear accumulation. On the other hand, Ku70 and Ku80 proteins inhibited ASO activity, most likely by competition with RNase H1 for ASO/RNA duplex binding. Our results demonstrate that phosphorothioate-modified ASOs bind a set of cellular proteins that affect ASO activity via different mechanisms. PMID:25712094

  20. Transformation of yeast with synthetic oligonucleotides.

    PubMed Central

    Moerschell, R P; Tsunasawa, S; Sherman, F

    1988-01-01

    Genomic DNA of the yeast, Saccharomyces cerevisiae, can be conveniently and specifically altered by transforming spheroplasts or lithium acetate-treated cells directly with synthetic oligonucleotides. Altered forms of iso-1-cytochrome c were generated by transforming a cyc1 mutant with oligonucleotides and selecting for at least partially functional revertants; the oligonucleotides contained a sequence that corrected the cyc1 mutation and produced additional alterations at nearby sites. Transformation has been accomplished with oligonucleotides as short as 20 nucleotides and with amounts as low as 100 micrograms. This method of site-directed mutagenesis in vivo has been used to produce alterations in the NH2-terminal region of iso-1-cytochrome c in which the NH2-terminal methionine is excised and the penultimate residue is acetylated. PMID:2829192

  1. Cr(VI) adsorption from electroplating plating wastewater by chemically modified coir pith.

    PubMed

    Suksabye, Parinda; Thiravetyan, Paitip

    2012-07-15

    Coir pith samples were chemically modified by grafting with acrylic acid for the removal of Cr(VI) from electroplating wastewater. The presence of acrylic acid on the coir pith surface was verified by a scanning electron microscope with an electron dispersive x-ray spectrometer (SEM/EDX), Fourier transform infrared spectroscopy (FTIR) and thermogravimetry (TG). The carbonyl groups (C==O) from the carboxylic acids (COOH) increased on the coir pith surface after grafting with acrylic acid. In addition, the thermal stability of the acrylic acid-grafted coir pith also improved. The optimum conditions for grafting the acrylic acid on the coir pith consisted of 2 M acrylic acid and 0.00125 M ceric ammonium nitrate (CAN, as an initiator). The maximum Cr(VI) removal (99.99 ± 0.07%) was obtained with the following conditions: a 1.3% (w/v) dosage of acrylic acid-grafted coir pith, a system pH of 2, a contact time of 22 h, a temperature of 30 °C, a particle size of <150 μm and an initial Cr(VI) of 1,171 mg l(-1). At system pH of 2, Cr(VI) in the HCrO(4)(-) form can be adsorbed with acrylic acid-grafted coir pith via an electrostatic attraction. The adsorption isotherm of 2 M acrylic acid-grafted coir pith exhibited a good fit with the Langmuir isotherm. The maximum Cr(VI) adsorption capacity of the 2 M acrylic acid-grafted coir pith was 196.00 mg Cr(VI) g(-1) adsorbent, whereas for coir pith without grafting, the maximum Cr(VI) removal was 165.00 mg Cr(VI) g(-1) adsorbent. The adsorption capacity of the acrylic acid-grafted coir pith for Cr(VI) was higher compared to the original coir pith. This result was due to the enhancement of the carbonyl groups on the coir pith surface that may have involved the mechanism of chromium adsorption. The X-ray absorption near edged structure (XANES) and desorption studies suggested that most of the Cr(III) that presented on the acrylic acid-grafted coir pith was due to the Cr(VI) being reduced to Cr(III) on the adsorbent surface. FTIR

  2. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  3. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L

    1987-01-01

    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  4. Determination of bismuth in environmental samples by slurry sampling graphite furnace atomic absorption spectrometry using combined chemical modifiers.

    PubMed

    Dobrowolski, Ryszard; Dobrzyńska, Joanna; Gawrońska, Barbara

    2015-01-01

    Slurry sampling graphite furnace atomic absorption spectrometry technique was applied for the determination of Bi in environmental samples. The study focused on the effect of Zr, Ti, Nb and W carbides, as permanent modifiers, on the Bi signal. Because of its highest thermal and chemical stability and ability to substantially increase Bi signal, NbC was chosen as the most effective modifier. The temperature programme applied for Bi determination was optimized based on the pyrolysis and atomization curves obtained for slurries prepared from certified reference materials (CRMs) of the soil and sediments. To overcome interferences caused by sulfur compounds, Ba(NO₃)₂ was used as a chemical modifier. Calibration was performed using the aqueous standard solutions. The analysis of the CRMs confirmed the reliability of the proposed analytical method. The characteristic mass for Bi was determined to be 16 pg with the detection limit of 50 ng/g for the optimized procedure at the 5% (w/v) slurry concentration. PMID:25384374

  5. Cell and tissue distribution of synthetic oligonucleotides in healthy and tumor-bearing nude mice. An autoradiographic, immunohistological, and direct fluorescence microscopy study.

    PubMed Central

    Plenat, F.; Klein-Monhoven, N.; Marie, B.; Vignaud, J. M.; Duprez, A.

    1995-01-01

    Antisense oligonucleotides have the ability to inhibit individual gene expression in the potential treatment of cancer and viral diseases. However, the way parenterally administered oligonucleotides distribute themselves into healthy tissues or tumors is poorly understood. In this study, the cell and tissue distribution of two modified or unmodified phosphodiester pentadeca-beta-oligonucleotides intravenously administered to healthy or tumor-bearing nude mice was assessed by autoradiography as well as by direct fluorescence and immunoenzymatic histological methods. Resistance of oligonucleotides to degradation by nuclease activity was previously studied in vitro. Using these methods we were able to show the following: 1) within minutes, oligonucleotides permeate all cells and tissues with the exceptions of erythrocytes and intervertebral discs; 2) cell and tissue distribution does not depend on the sequence of the given oligonucleotide; 3) concentration of oligonucleotides is higher within the connective tissue cells than in the interstitial matrix; 4) after uptake, oligomers partition throughout all of the cellular compartments, including at the highest intracellular concentrations in the nuclei; 5) oligonucleotides penetrate easily the tumor cell compartments, oligonucleotide diffusion being unimpeded by the extracellular matrix. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:7604874

  6. Electrothermal atomic absorption spectrometric determination of copper in nickel-base alloys with various chemical modifiers*1

    NASA Astrophysics Data System (ADS)

    Tsai, Suh-Jen Jane; Shiue, Chia-Chann; Chang, Shiow-Ing

    1997-07-01

    The analytical characteristics of copper in nickel-base alloys have been investigated with electrothermal atomic absorption spectrometry. Deuterium background correction was employed. The effects of various chemical modifiers on the analysis of copper were investigated. Organic modifiers which included 2-(5-bromo-2-pyridylazo)-5-(diethylamino-phenol) (Br-PADAP), ammonium citrate, 1-(2-pyridylazo)-naphthol, 4-(2-pyridylazo)resorcinol, ethylenediaminetetraacetic acid and Triton X-100 were studied. Inorganic modifiers palladium nitrate, magnesium nitrate, aluminum chloride, ammonium dihydrogen phosphate, hydrogen peroxide and potassium nitrate were also applied in this work. In addition, zirconium hydroxide and ammonium hydroxide precipitation methods have also been studied. Interference effects were effectively reduced with Br-PADAP modifier. Aqueous standards were used to construct the calibration curves. The detection limit was 1.9 pg. Standard reference materials of nickel-base alloys were used to evaluate the accuracy of the proposed method. The copper contents determined with the proposed method agreed closely with the certified values of the reference materials. The recoveries were within the range 90-100% with relative standard deviation of less than 10%. Good precision was obtained.

  7. Rheological monitoring of phase separation induced by chemical reaction in thermoplastic-modified epoxy

    SciTech Connect

    Vinh-Tung, C.; Lachenal, G.; Chabert, B.

    1996-12-31

    The phase separation induced by chemical reaction in blends of tetraglycidyl-diaminodiphenylmethane epoxy resin with an aromatic diamine hardener and a thermoplastic was monitored. Rheological measurements and morphologies are described.

  8. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  9. A ω-mercaptoundecylphosphonic acid chemically modified gold electrode for uranium determination in waters in presence of organic matter.

    PubMed

    Merli, Daniele; Protti, Stefano; Labò, Matteo; Pesavento, Maria; Profumo, Antonella

    2016-05-01

    A chemically modified electrode (CME) on a gold surface assembled with a ω-phosphonic acid terminated thiol was investigated for its capability to complex uranyl ions. The electrode, characterized by electrochemical techniques, demonstrated to be effective for the determination of uranyl at sub-μgL(-1) level by differential pulse adsorptive stripping voltammetry (DPAdSV) in environmental waters, also in presence of humic matter and other potential chelating agents. The accuracy of the measurements was investigated employing as model probes ligands of different complexing capability (humic acids and EDTA). PMID:26946018

  10. Determination of vanadium in mussels by electrothermal atomic absorption spectrometry without chemical modifiers.

    PubMed

    Saavedra, Y; Fernández, P; González, A

    2004-05-01

    A method was developed for the quantitative determination of total vanadium concentration in mussels via electrothermal atomic absorption spectrometry (ETAAS). After the microwave digestion of the samples, a program using temperatures of 1600 degrees C and 2600 degrees C for ashing and atomization respectively, without any matrix modifiers, allowed us to obtain results that were satisfactory since they agreed closely with certified reference material values. The detection limit was 0.03 mg kg(-1) (dry weight), indicating that the method is suitable for the analysis of mussel samples. This determination was compared with matrix modifiers that have been reported previously. The method was applied to various cultivated and wild mussels from the Galician coast, yielding levels below 1 mg kg(-1) (wet weight). PMID:14745471

  11. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries

    PubMed Central

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2016-01-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection–based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization. PMID:26054766

  12. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating.

    PubMed

    Abel, Biebele; Aslan, Kadir

    2012-11-01

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization), where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. PMID:23645933

  13. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.

    PubMed

    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo

    2015-12-01

    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment. PMID:26479411

  14. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomized pool of imidazole modified ssDNA. Sequencing data from the evolved pool shows that conserved 5 and 6 nt motifs were shared amongst many of the isolates, which indicates that these motifs could serve as chelation sites for gold atoms or help stabilize colloidal gold solutions in a base specific manner.

  15. Tolerance and immunological changes of chemically modified allergen vaccine of Parietaria judaica in accelerated schedules.

    PubMed

    Asturias, J A; Ferrer, A; Arilla, M C; Andreu, C; Madariaga, B; Martínez, A

    2007-03-01

    The physicochemical modification of allergen vaccines provides a chance for administering higher doses in a shorter period of time. We sought to assess the safety and immunological changes of using a biologically standardized and modified Parietaria judaica pollen extract in accelerated schedules. Two accelerated schedules were tested in 45 P. judaica-allergic patients: 20 patients reached the maximum dose after two visits using two different concentrations and 25 patients reached the maximum dose after only one visit with two injections of the maximum concentration vial. The tolerance was assessed by recording all side effects related with immunotherapy. Specific antibody levels against native extract and rPar j 2 allergen were evaluated at the beginning and the end of the study. Allergenic potency determined by enzyme allergosorbent test (EAST) inhibition and skin prick test showed that modified P. judaica pollen had a 99.9% less allergenicity than native extract. After 650 doses administered, two clinically irrelevant local reactions (diameter<0 x 5 cm) and no systemic reactions were registered. Significant increases in allergen-specific IgG4 and IgG against P. judaica extract and rPar j 2 and significant decrease of specific IgE against Par j 2 were observed. The modified extract of P. judaica is safe to treat sensitive patients, even at accelerated regimens, and induces significant immunological changes. PMID:17302898

  16. Disulfide-tethered solid supports for synthesis of photoluminescent oligonucleotide conjugates: hydrolytic stability and labeling on the support.

    PubMed

    Salo, H; Guzaev, A; Lönnberg, H

    1998-01-01

    Several new disulfide-tethered solid supports (S1-S5) were synthesized, and their resistance against ammonolysis was tested. Among these supports, only the one bearing an N-[15-[(4, 4'-dimethoxytrityl)oxy]-12,13-dithiapentadecanoyl] linker (S4b) tolerated ammonolysis and exhibited properties compatible with the oligonucleotide synthesis by phosphoramidite strategy. The applicability of this disulfide linker structure in postsynthetic oligonucleotide labeling on the support was demonstrated by introduction of two photoluminescent lanthanide chelates or two dansyl groups to the N4-(6-aminohexyl) amino-modified cytosine residues at the 5' end of the oligonucleotide sequence. Subsequent release of the resulting conjugates as their 3'-phosphates was achieved by reductive cleavage of the disulfide bond and precipitation of the conjugate from the solution with ethanol. The fluorescently tagged oligomer obtained showed hybridization properties similar to those of oligonucleotides labeled in solution. PMID:9576811

  17. Application of pervaporation and vapor permeation processes to separate aqueous ethanol solution through chemically modified Nylon 4 membranes

    SciTech Connect

    Wang, Y.H.; Teng, M.Y.; Lee, K.R.; Wang, D.M.; Lai, J.Y.

    1998-08-01

    The pervaporation performance of a Nylon 4 membrane, chemically grafted by N,N-dimethylaminoethyl methacrylate (DMAEM), DMAEM-g-N4, was studied by measurement of the permeation ratio and the pervaporation separation index. It was found that the water permselectivity and permeation rate for the chemically modified Nylon 4 membrane were higher than those of the unmodified Nylon 4 membrane. Optimum pervaporation results, a separation factor of 28.3, and a permeation rate of 439 g/m{sup 2}{center_dot}h, were obtained when the degree of grafting was 12.7%. It was also found that all the permeation ratios at low temperature were less than unity. In addition, compared with pervaporation, vapor permeation effectively increases the permselectivity of water.

  18. Simple Method To Prepare Oligonucleotide-Conjugated Antibodies and Its Application in Multiplex Protein Detection in Single Cells.

    PubMed

    Gong, Haibiao; Holcomb, Ilona; Ooi, Aik; Wang, Xiaohui; Majonis, Daniel; Unger, Marc A; Ramakrishnan, Ramesh

    2016-01-20

    The diversity of nucleic acid sequences enables genomics studies in a highly multiplexed format. Since multiplex protein detection is still a challenge, it would be useful to use genomics tools for this purpose. This can be accomplished by conjugating specific oligonucleotides to antibodies. Upon binding of the oligonucleotide-conjugated antibodies to their targets, the protein levels can be converted to oligonucleotide levels. In this report we describe a simple method for preparing oligonucleotide-conjugated antibodies and discuss this method's application in oligonucleotide extension reaction (OER) for multiplex protein detection. Conjugation is based on strain-promoted alkyne-azide cycloaddition (the Cu-free click reaction), in which the antibody is activated with a dibenzocyclooctyne (DBCO) moiety and subsequently linked covalently with an azide-modified oligonucleotide. In the functional test, the reaction conditions and purification processes were optimized to achieve maximum yield and best performance. The OER assay employs a pair of antibody binders (two antibodies, each conjugated with its own oligonucleotide) developed for each protein target. The two oligonucleotides contain unique six-base complementary regions at their 3' prime ends to allow annealing and extension by DNA synthesis enzymes to form a DNA template. Following preamplification, the DNA template is detected by qPCR. Distinct oligonucleotide sequences are assigned to different antibody binders to enable multiplex protein detection. When tested using recombinant proteins, some antibody binders, such as those specific to CSTB, MET, EpCAM, and CASP3, had dynamic ranges of 5-6 logs. The antibody binders were also used in a multiplexed format in OER assays, and the binders successfully detected their protein targets in cell lysates, and in single cells in combination with the C1 system. This click reaction-based antibody conjugation procedure is cost-effective, needs minimal hands-on time, and

  19. Preparation of oligonucleotides corresponding to the acceptor stem of yeast tRNAPhe and their interaction with yeast ATP(CTP):tRNA nucleotidyltransferase.

    PubMed Central

    Wang, G H; McLaughlin, L W; Sternbach, H; Cramer, F

    1984-01-01

    Seven oligonucleotides corresponding to the 3' and 5' sequences of the acceptor stem of yeast tRNAPhe have been prepared by chemical synthesis, chemical-enzymatic synthesis or by isolation from tRNA hydrolysates. The oligonucleotides have been examined as substrates for phosphodiester bond synthesis in the presence of ATP as catalysed by yeast ATP (CTP): tRNA nucleotidyltransferase. Oligonucleotides which correspond to the sequence of the 3'-strand of the tRNA acceptor stem and possess no secondary structure exhibit little or no activity with the enzyme. The ability of the enzyme to catalyse the synthesis of a phosphodiester linkage using ATP and an oligonucleotide corresponding to the 3'-strand of the acceptor stem is in general dramatically increased when an oligonucleotide corresponding to the sequence of the 5'-strand of tRNA acceptor stem is present. In cases where significant activity was observed kinetic parameters have been determined. Images PMID:6384932

  20. Oxidation, Low Temperature, and Lubricating Properties of Chemically-modified Methyl Oleates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The inherent problems of vegetable oils, such as poor oxidation and low temperature properties, can be improved by attaching functional groups at the sites of unsaturation through chemical modification. In this study, we have shown how functionalization helps overcome these disadvantages. Five bra...

  1. Chemically modified fatty acid methyl esters: their potential for use as lubrication fluids and surfactants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A review of recent developments in the synthesis and characterization of lubrication fluids and surfactants from methyl oleate. The synthesis of materials made using an epoxidation route is the focus. This versatile method of chemical modification of fatty acid methyl esters improves their oxidati...

  2. Caged oligonucleotides for studying biological systems

    PubMed Central

    Ruble, Brittani K.; Yeldell, Sean B.; Dmochowski, Ivan J.

    2015-01-01

    Light-activated (“caged”) compounds have been widely employed for studying biological processes with high spatial and temporal control. In the past decade, several new approaches for caging the structure and function of DNA and RNA oligonucleotides have been developed. This review focuses on caged oligonucleotides that incorporate site-specifically one or two photocleavable linkers, whose photolysis yields oligonucleotides with dramatic structural and functional changes. This technique has been employed by our laboratory and others to photoregulate gene expression in cells and living organisms, typically using near UV-activated organic chromophores. To improve capabilities for in vivo studies, we harnessed the rich inorganic photochemistry of ruthenium bipyridyl complexes to synthesize Ru-caged morpholino antisense oligonucleotides that remain inactive in zebrafish embryos until uncaged with visible light. Expanding into new caged oligonucleotide applications, our lab has developed Transcriptome In Vivo Analysis (TIVA) technology, which provides the first noninvasive, unbiased method for isolating mRNA from single neurons in brain tissues. TIVA-isolated mRNA can be amplified and then analyzed using next-generation sequencing (RNA-seq). PMID:25865001

  3. Adsorption of hexavalent chromium from synthetic and electroplating effluent on chemically modified Swietenia mahagoni shell in a packed bed column.

    PubMed

    Rangabhashiyam, S; Nandagopal, M S Giri; Nakkeeran, E; Selvaraju, N

    2016-07-01

    Packed bed column studies were carried out to evaluate the performance of chemically modified adsorbents for the sequestration of hexavalent chromium from synthetic and electroplating industrial effluent. The effects of parameters such as bed height (3-9 cm), inlet flow rate (5-15 mL/min), and influent Cr(VI) concentration (50-200 mg/L) on the percentage removal of Cr(VI) and the adsorption capacity of the adsorbents in a packed bed column were investigated. The breakthrough time increased with increasing bed height and decreased with the increase of inlet flow rate and influent Cr(VI) concentration. The adsorption column models such as Thomas, Adams-Bohart, Yoon-Nelson, and bed depth service time (BDST) were successfully correlated with the experimental data. The Yoon-Nelson and BDST model showed good agreement with the experimental data for all the studied parameter conditions. Results of the present study indicated that the chemically modified Swietenia mahagoni shell can be used as an adsorbent for the removal of Cr(VI) from industrial wastewater in a packed bed column. PMID:27312254

  4. Chemically-modified Nafion ®/poly(vinylidene fluoride) blend ionomers for proton exchange membrane fuel cells

    NASA Astrophysics Data System (ADS)

    Song, Min-Kyu; Kim, Young-Taek; Fenton, James M.; Kunz, H. Russell; Rhee, Hee-Woo

    Miscible Nafion ®/poly(vinylidene fluoride) blend membranes are prepared and characterized PVdF = poly(vinylidene fluoride). The membranes have high miscibility above a 60 wt.% Nafion ® fraction when both polymers are dissolved in a solvent mixture of N, N'-dimethylacetamide and 2-propanol. Despite the high miscibility, the extremely hydrophobic PVdF component reduces the water uptake of Nafion ®/PVdF blend, and the proton conductivity is much lower than that of a Nafion ® 115 membrane even with a high weight fraction of Nafion ®. To improve water affinity and proton conductivity, PVdF is chemically-modified by means of a dehydrofluorination reaction and H 2SO 4 doping prior to solution blend. The chemically-modified Nafion ®/PVdF blend membrane shows similar conductance to Nafion ® 115 without any auxiliary fillers. Nafion ®/PVdF blend membranes of ˜35 μm thickness are hot-pressed between catalyzed carbon paper ELAT ® electrodes. A 25 cm 2 single cell delivers a maximum power of about 440 mW cm -2 at 900 mA cm -2 under H 2/O 2, which is comparable to the performance of Nafion ® 115 under the same operating conditions.

  5. Oligonucleotide-based label-free detection with optical microresonators: strategies and challenges.

    PubMed

    Toren, Pelin; Ozgur, Erol; Bayindir, Mehmet

    2016-07-01

    This review targets diversified oligonucleotide-based biodetection techniques, focusing on the use of microresonators of whispering gallery mode (WGM) type as optical biosensors mostly integrated with lab-on-a-chip systems. On-chip and microfluidics combined devices along with optical microresonators provide rapid, robust, reproducible and multiplexed biodetection abilities in considerably small volumes. We present a detailed overview of the studies conducted so far, including biodetection of various oligonucleotide biomarkers as well as deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs) and proteins. We particularly advert to chemical surface modifications for specific and selective biosensing. PMID:27306702

  6. Enhancing adsorption capacity of toxic malachite green dye through chemically modified breadnut peel: equilibrium, thermodynamics, kinetics and regeneration studies.

    PubMed

    Chieng, Hei Ing; Lim, Linda B L; Priyantha, Namal

    2015-01-01

    Breadnut skin, in both its unmodified (KS) and base-modified (BM-KS) forms, was investigated for its potential use as a low-cost adsorbent for the removal of toxic dye, malachite green (MG). Characterization of the adsorbents was carried out using scanning electron microscope, X-ray fluorescence and Fourier transform infra-red spectroscopy. Batch adsorption experiments, carried out under optimized conditions, for the adsorption of MG were fitted using five isotherm models (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Sips) and six error functions to determine the best-fit model. The adsorption capacity was greatly enhanced when breadnut skin was chemically modified with NaOH, leading to an adsorption capacity of 353.0 mg g(-1), that was far superior to most reported adsorbents for the removal of MG. Thermodynamics studies indicated that the adsorption of MG was spontaneous on KS and BM-KS, and the reactions were endothermic and exothermic, respectively. Kinetics studies showed that both followed the pseudo-second order. Regeneration experiments on BM-KS indicated that its adsorption capacity was still maintained at>90% even after five cycles. It can be concluded that NaOH-modified breadfruit skin has great potential to be utilized in real-life application as a low-cost adsorbent for the removal of MG in wastewater treatment. PMID:25409587

  7. Comparison of chemical modifiers for direct determination of Cd, Cu and Zn in food stuffs by solid-sampling-ETAAS.

    PubMed

    Török, Peter; Žemberyová, Mária

    2012-05-01

    In this work, the capability of different chemical modifiers (Pd, Pd/Mg(NO3)2, Pd/NH4NO3, NH4H2PO4, NH4H2PO4/Mg(NO3)2) to eliminate the matrix effects in the direct determination of Cd, Cu and Zn in food-stuffs by solid sampling-electrothermal atomic absorption spectrometry was compared. The alternative analytical lines were used for determination of Cu (327.4nm) and Zn (307.6nm) in order to allow the introduction of reasonably high sample mass into the furnace. Mixed modifiers containing palladium were useful to eliminate the matrix effect in Cd determination. For Cu and Zn determination the application of Pd shows satisfactory analytical performance. In the determinations of Cd and Zn the phosphate containing modifiers shows elimination of matrix effects only when applying them to a partially pyrolysed sample (at 400°C). The achievable limits of detection for Cd, Cu and Zn in solid samples were 0.279ngg(-1); 0.020μgg(-1) and 2.04μgg(-1), respectively. PMID:26434331

  8. Thermogravimetric Analysis of Modified Hematite by Methane (CH{sub 4}) for Chemical-Looping Combustion: A Global Kinetics Mechanism

    SciTech Connect

    Monazam, Esmail R; Breault, Ronald W; Siriwardane, Ranjani; Miller, Duane D

    2013-10-01

    Iron oxide (Fe{sub 2}O{sub 3}) or in its natural form (hematite) is a potential material to capture CO{sub 2} through the chemical-looping combustion (CLC) process. It is known that magnesium (Mg) is an effective methyl cleaving catalyst and as such it has been combined with hematite to assess any possible enhancement to the kinetic rate for the reduction of Fe{sub 2}O{sub 3} with methane. Therefore, in order to evaluate its effectiveness as a hematite additive, the behaviors of Mg-modified hematite samples (hematite –5% Mg(OH){sub 2}) have been analyzed with regard to assessing any enhancement to the kinetic rate process. The Mg-modified hematite was prepared by hydrothermal synthesis. The reactivity experiments were conducted in a thermogravimetric analyzer (TGA) using continuous stream of CH{sub 4} (5, 10, and 20%) at temperatures ranging from 700 to 825 {degrees}C over ten reduction cycles. The mass spectroscopy analysis of product gas indicated the presence of CO{sub 2}, H{sub 2}O, H{sub 2} and CO in the gaseous product. The kinetic data at reduction step obtained by isothermal experiments could be well fitted by two parallel rate equations. The modified hematite samples showed higher reactivity as compared to unmodified hematite samples during reduction at all investigated temperatures.

  9. Physico-chemical properties of corn starch modified with cyclodextrin glycosyltransferase.

    PubMed

    Dura, Angela; Rosell, Cristina M

    2016-06-01

    Cyclodextrin glycosyltransferase (CGTase) has been used to produce cyclodextrins (CDs) from starches, but their ability to modify starches has been barely explored. The effect of CGTase on corn starch at sub-gelatinization temperature (50°C) and at different pH conditions, pH 4.0 and pH 6.0, was evaluated. Biochemical features, thermal and structural analysis, oligosaccharides and CDs content were studied. Microscopic analysis of the granules confirmed the enzymatic modification of the starches obtaining structures with irregular surface and small pinholes. The extent of the starch modification was largely dependent on the pHs, being higher at pH 6.0. This was also confirmed by the low viscosity of the resulting pastes during a heating and cooling cycle. Thermal parameters were not affected due to enzymatic treatment. Modified starches were less susceptible to undergo α-amylase hydrolysis. CDs released were higher for samples treated at pH 4.0. Therefore, CGTase modification of corn starches at sub-gelatinization temperature offers an attractive alternative for obtaining porous starches with different properties depending on the pH conditions. PMID:26970178

  10. Treatment of swine wastewater using chemically modified zeolite and bioflocculant from activated sludge.

    PubMed

    Guo, Junyuan; Yang, Chunping; Zeng, Guangming

    2013-09-01

    Sterilization, alkaline-thermal and acid-thermal treatments were applied to activated sludge and the pre-treated sludge was used as raw material for Rhodococcus R3 to produce polymeric substances. After 60 h of fermentation, bioflocculant of 2.7 and 4.2 g L(-1) were produced in sterilized and alkaline-thermal treated sludge as compared to that of 0.9 g L(-1) in acid-thermal treated sludge. Response surface methodology (RSM) was employed to optimize the treatment process of swine wastewater using the composite of bioflocculant and zeolite modified by calcining with MgO. The optimal flocculating conditions were bioflocculant of 24 mg L(-1), modified zeolite of 12 g L(-1), CaCl2 of 16 mg L(-1), pH of 8.3 and contact time of 55 min, and the corresponding removal rates of COD, ammonium and turbidity were 87.9%, 86.9%, and 94.8%. The use of the composite by RSM provides a feasible way to improve the pollutant removal efficiencies and recycle high-level of ammonium from wastewater. PMID:23810950

  11. Amyloid fibrillation in native and chemically-modified forms of carbonic anhydrase II: role of surface hydrophobicity.

    PubMed

    Es-Haghi, Ali; Shariatizi, Sajad; Ebrahim-Habibi, Azadeh; Nemat-Gorgani, Mohsen

    2012-03-01

    Chemical modification or mutation of proteins may bring about significant changes in the net charge or surface hydrophobicity of a protein structure. Such events may be of major physiological significance and may provide important insights into the genetics of amyloid diseases. In the present study, fibrillation potential of native and chemically-modified forms of bovine carbonic anhydrase II (BCA II) were investigated. Initially, various denaturing conditions including low pH and high temperatures were tested to induce fibrillation. At a low pH of around 2.4, where the protein is totally dissociated, the apo form was found to take up a pre-molten globular (PMG) conformation with the capacity for fibril formation. Upon increasing the pH to around 3.6, a molten globular (MG) form became abundant, forming amorphous aggregates. Charge neutralization and enhancement of hydrophobicity by methylation, acetylation and propionylation of lysine residues appeared very effective in promoting fibrillation of both the apo and holo forms under native conditions, the rates and extents of which were directly proportional to surface hydrophobicity, and influenced by salt concentration and temperature. These modified structures underwent more pronounced fibrillation under native conditions, than the PMG intermediate form, observed under denaturing conditions. The nature of the fibrillation products obtained from intermediate and modified structures were characterized and compared and their possible cytotoxicity determined. Results are discussed in terms of the importance of surface net charge and hydrophobicity in controlling protein aggregation. A discussion on the physiological significance of the observations is also presented. PMID:22251892

  12. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  13. Catalytic activity of platinum on ruthenium electrodes with modified (electro)chemical states.

    PubMed

    Park, Kyung-Won; Sung, Yung-Eun

    2005-07-21

    Using Pt on Ru thin-film electrodes with various (electro)chemical states designed by the sputtering method, the effect of Ru states on the catalytic activity of Pt was investigated. The chemical and electrochemical properties of Pt/Ru thin-film samples were confirmed by X-ray photoelectron spectroscopy (XPS) and cyclic voltammetry. In addition, Pt nanoparticles on Ru metal or oxide for an actual fuel cell system showed an effect of Ru states on the catalytic activity of Pt in methanol electrooxidation. Finally, it was concluded that such an enhancement of methanol electrooxidation on the Pt is responsible for Ru metallic and/or oxidation sites compared to pure Pt without any Ru state. PMID:16852701

  14. Effect of modified atmospheric packaging on chemical and microbial changes in dietetic rabri during storage.

    PubMed

    Ghayal, Gajanan; Jha, Alok; Kumar, Arvind; Gautam, Anuj Kumar; Rasane, Prasad

    2015-03-01

    Rabri is a dairy based sweet popular in the Indian subcontinent. The high sugar and fat content impose restrictions on its consumption due to health reasons. Dietetic rabri was prepared by the replacement of sugar with aspartame. Inulin was added to partially replace the milk fat and to improve the consistency of rabri. The rabri samples were packed in the polyethylene bags filled with different gaseous compositions (Air, 50 % CO2:50 % N2 and 100 % N2) and stored at 10 °C. The shelf life was evaluated on the basis of changes in the chemical quality parameters such as HMF, TBA and FFA and microbial content such as total plate count, yeast and molds and coliform counts. The chemical parameters and microbial spoilage increased in all the samples with the progression of storage period. The samples packed with air showed significantly higher chemical deterioration and microbial spoilage as compared to the other two combinations. The samples packed with 100 % N2 were more shelf stable than with air and 50 % CO2:50 % N2 combinations. PMID:25745264

  15. Synthesis of cyclic oligonucleotides by a modified phosphotriester approach.

    PubMed Central

    de Vroom, E; Broxterman, H J; Sliedregt, L A; van der Marel, G A; van Boom, J H

    1988-01-01

    Evidence will be presented to show that the allyl group is suitable for the protection of a 3'-terminal phosphodiester function. The latter will be demonstrated by the synthesis, via a phosphotriester approach, of two cyclic tetraribonucleotides [r(AAAA) and r(UAMe2UAMe2)], two cyclic hexadeoxyribonucleotides [d(CGCGCG) and d(TAAAAA)] and a cyclic octadeoxyribonucleotide [d(CGTGCGTG)]. PMID:3380690

  16. Nickel release behavior and surface characteristics of porous NiTi shape memory alloy modified by different chemical processes.

    PubMed

    Wu, Shuilin; Liu, Xiangmei; Chan, Y L; Chu, Paul K; Chung, C Y; Chu, Chenglin; Yeung, Kelvin W K; Lu, W W; Cheung, Kenneth M C; Luk, K D K

    2009-05-01

    As a non-line-of-sight surface modification technique, chemical treatment is an effective method to treat porous NiTi with complex surface morphologies and large exposed areas due to its liquidity and low temperature. In the work described here, three different chemical processes are used to treat porous NiTi alloys. Our results show that H(2)O(2) treatment, NaOH treatment, and H(2)O(2) pre-treatment plus subsequent NaOH treatment can mitigate leaching of nickel from the alloy. The porous NiTi samples modified by the two latter processes favor deposition of a layer composed of Ca and P due to the formation of bioactive Na(2)TiO(3) on the surface. Among the three processes, H(2)O(2) pre-treatment plus subsequent NaOH modification is the most effective in suppressing nickel release. Small area X-ray photoelectron spectroscopy reveals that the surfaces treated by different chemical processes have different structures and compositions. The sample modified by the H(2)O(2) treatment is composed of rough TiO(2) on the outer surface and an oxide transition layer underneath whereas the sample treated by NaOH comprises a surface layer of titanium oxide and Na(2)TiO(3) together with a transition layer. The sample processed by the H(2)O(2) and NaOH treatment has a pure Na(2)TiO(3) layer on the surface and a transition layer underneath. These results help to elucidate the different nickel release behavior and bioactivity of porous NiTi alloys processed by different methods. PMID:18431757

  17. Open tubular capillary electrochromatography migration behavior of enkephalins in etched chemically modified fused silica capillaries.

    PubMed

    Pesek, Joseph J; Matyska, Maria T; Velpula, Sunandini

    2006-09-01

    Fused silica capillaries for use in electrophoretic analyses are etched with ammonium bifluoride in the presence of a second inorganic salt (CuCl(2), CrCl(3), NaNO(3), or (NH(4))(2)CO(3)). The effects of the presence of these inorganic components in the surface matrix on the electromigration behavior of enkephalins are evaluated. Resolution, efficiency and peak shape are used to compare the various columns. In some cases the etched surface is then modified by the addition of an octadecyl moiety using a silanization/hydrosilation procedure. The surface properties of the etched capillaries can also be evaluated by electroosmotic flow measurements. RSDs of migration times under identical experimental conditions were <1%. PMID:16720028

  18. [Chemical modification of rabbit immunoglobulin G by dansylaziridine and study of the properties of modified antibodies].

    PubMed

    Pikuleva, I A; Turko, I V; Adamovich, T B; Chashchin, V L

    1990-12-01

    To elucidate the effect of the antigen binding fluorescent thiol reagent, N-dansylaziridine (DAZ) which is sensitive to microenvironmental changes, was used for modification of the rabbit IgG hinge region cystine residue. DAZ binds to the hinge region Cys 226 as could be evidenced from the structural analysis data. Labelling of IgG with DAZ does not alter either its conformation and hydrodynamic behaviour or its antigen binding properties. Upon antigen binding the fluorescence intensity of modified IgG increases up to about 80%. This finding suggests that the interaction of antibodies with the antigen is accompanied by conformational changes in the IgG hinge region. PMID:2096951

  19. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. PMID:24727531

  20. DOTAP/UDCA vesicles: novel approach in oligonucleotide delivery.

    PubMed

    Ruozi, Barbara; Battini, Renata; Montanari, Monica; Mucci, Adele; Tosi, Giovanni; Forni, Flavio; Vandelli, Maria Angela

    2007-03-01

    The relatively hydrophilic bile acid, ursodeoxycholic acid (UDCA), was used as an additive to DOTAP cationic liposomes to evaluate the effect on the cellular uptake of an oligonucleotide. Nuclear magnetic resonance studies were applied to estimate the relative amount of incorporated UDCA into the lipidic bilayers. DOTAP or DOTAP-UDCA vesicles (MixVes; DOTAP/UDCA molar ratios 1:0.25, 1:0.5, 1:1, and 1:2) formed complexes with 5'-fluorescein conjugated 29-mer phosphorothioate oligonucleotides (PS-ODNs) and studied using gel electrophoresis. In addition, the complexes were tested after transfection to assess the cellular uptake and the localization of the oligo in a HaCaT cell line by the use of cytofluorimetric and confocal microscopic analysis. DOTAP lipid formulated in the presence of a defined amount of UDCA forms more stable, flexible, and active MixVes. In particular, the MixVes at 1:0.25 and 1:0.5 molar ratios increase and modify the cellular uptake of PS-ODNs if compared with DOTAP liposomes 3 hours after the transfection studies. Moreover, the in vitro data suggest that these new formulations are not toxic. PMID:17379164

  1. [Bio-based pharmaceutical polymers, possibility of their chemical modification and the applicability of modified polymers].

    PubMed

    Sebe, István; Szabó, Barnabás; Zelkó, Romána

    2012-01-01

    Different types of polymers are widely used in biomedical, pharmaceutical and cosmetic purposes. Their applications are curbed, if the polymers can not break down by the body or if the polymer itself is harmful or decompose to harmful material. Authors provide an overview of different types of pharmaceutical polymers of various sources, of the structural characterization and possibilities of their chemical modification and of the classical and instrumental analytical examination methods. The paper deals with the limitations of the use of biopolymers, as well. PMID:23444721

  2. X-ray photoemission analysis of chemically modified TlBr surfaces for improved radiation detectors

    DOE PAGESBeta

    Nelson, A. J.; Voss, L. F.; Beck, P. R.; Graff, R. T.; Conway, A. M.; Nikolic, R. J.; Payne, S. A.; Lee, J. -S.; Kim, H.; Cirignano, L.; et al

    2013-01-12

    We subjected device-grade TlBr to various chemical treatments used in room temperature radiation detector fabrication to determine the resulting surface composition and electronic structure. As-polished TlBr was treated separately with HCl, SOCl2, Br:MeOH and HF solutions. High-resolution photoemission measurements on the valence band electronic structure and Tl 4f, Br 3d, Cl 2p and S 2p core lines were used to evaluate surface chemistry and shallow heterojunction formation. Surface chemistry and valence band electronic structure were correlated with the goal of optimizing the long-term stability and radiation response.

  3. Wrapping of a single bacterium with Functionalized - Chemically Modified Graphene (FCMG) sheets via highly specific protein-cell wall interaction

    NASA Astrophysics Data System (ADS)

    Mohanty, Nihar; Berry, Vikas

    2009-03-01

    Graphene has recently generated a lot of interest due to its unique structural and electrical properties. It's micro-scale area and sub-nano-scale thickness coupled with ballistic electronic transport at room temperature, low Johnston noise and low charge scattering, have made it a gold mine for novel applications. Since its discovery in 2004, there have been a plethora of studies on characterizing its unique physical, chemical and electrical properties of graphene as well as on integrating it with various physical/chemical systems to utilize these properties. But there have been limited or no studies on the integration of graphene with living microorganisms or mammalian cells. Here we describe the novel wrapping of a single live bacterium (Bacillus cereus) with a chemically modified graphene sheet functionalized with the protein Concanavalin-A (Con-A) via the highly specific Con-A - Teichoic acid interaction. We are investigating the structural and the electrical properties of these novel bacteria-FCMG ensembles. Further, we are also interested in characterizing this wrapping process in detail by studying the kinetics and the mechanism of action of bacterial-wrapping via 3D modelling. This is a first step towards the live-bio-nano-integration of graphene which would open up avenues for applications as diverse as bio-batteries using the Geobacter to recombinant enzyme compartmentalization.

  4. Evaluation of alkyne-modified isoprenoids as chemical reporters of protein prenylation

    PubMed Central

    DeGraw, Amanda J.; Palsuledesai, Charuta; Ochocki, Joshua D.; Dozier, Jonathan K.; Lenevich, Stepan; Rashidian, Mohammad; Distefano, Mark D.

    2010-01-01

    Protein prenyltransferases catalyze the attachment of C15 (farnesyl) and C20 (geranylgeranyl) groups to proteins at specific sequences localized at or near the C-termini of specific proteins. Determination of the specific protein prenyltransferase substrates affected by the inhibition of these enzymes is critical for enhancing knowledge of the mechanism of such potential drugs. Here we investigate the utility of alkyne-containing isoprenoid analogues for chemical proteomics experiments by showing that these compounds readily penetrate mammalian cells in culture and become incorporated into proteins that are normally prenylated. Derivatization via Cu(I) catalyzed Click reaction with a fluorescent azide reagent allows the proteins to be visualized and their relative levels to be analyzed. Simultaneous treatment of cells with these probes and inhibitors of prenylation reveals decreases in the levels of some but not all of the labeled proteins. Two-dimensional electrophoretic separation of these labeled proteins followed by mass spectrometric analysis allowed several labeled proteins to be unambiguously identified. Docking experiments and DFT calculations suggest that the substrate specificity of PFTase may vary depending on whether azide- or alkyne-based isoprenoid analogues are employed. These results demonstrate the utility of alkyne-containing analogues for chemical proteomic applications. PMID:21040496

  5. Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta1

    PubMed Central

    Jordon-Thaden, Ingrid E.; Chanderbali, Andre S.; Gitzendanner, Matthew A.; Soltis, Douglas E.

    2015-01-01

    Premise of the study: Here we present a series of protocols for RNA extraction across a diverse array of plants; we focus on woody, aromatic, aquatic, and other chemically complex taxa. Methods and Results: Ninety-one taxa were subjected to RNA extraction with three methods presented here: (1) TRIzol/TURBO DNA-free kits using the manufacturer’s protocol with the addition of sarkosyl; (2) a combination method using cetyltrimethylammonium bromide (CTAB) and TRIzol/sarkosyl/TURBO DNA-free; and (3) a combination of CTAB and QIAGEN RNeasy Plant Mini Kit. Bench-ready protocols are given. Conclusions: After an iterative process of working with chemically complex taxa, we conclude that the use of TRIzol supplemented with sarkosyl and the TURBO DNA-free kit is an effective, efficient, and robust method for obtaining RNA from 100 mg of leaf tissue of land plant species (Embryophyta) examined. Our protocols can be used to provide RNA of suitable stability, quantity, and quality for transcriptome sequencing. PMID:25995975

  6. Synthesis of 4'-Methoxy 2'-Deoxynucleoside Phosphoramidites for Incorporation into Oligonucleotides.

    PubMed

    Petrová, Magdalena; Rosenberg, Ivan

    2016-01-01

    This unit contains detailed synthetic protocols for the preparation of 4'-methoxy 2'-deoxynucleoside phosphoramidite monomers for A, G, C, T, and U. First, 3'-silyl-protected 2'-deoxynucleosides (dNs) are converted in two steps to 4',5'-enol acetates as the key starting compounds. Next, 4'-methoxy dNs are prepared by a one-pot procedure comprising N-iodosuccinimide-promoted methoxylation, hydrolysis, and reduction of the formed intermediates. Finally, 3'-phosphoramidites of 4'-methoxy dNs are obtained by a routine three-step procedure. Title phosphoramidite monomers are suitable for the synthesis of oligonucleotides on solid phase according to conventional amidite chemistry. 4'-Methoxy substitution represents a simple modification of the sugar part of dNs, where β-D-erythro epimers preferentially adopt N-type (C3'-endo, RNA-like) conformation. Moreover, it imparts superior chemical stability, nuclease resistance, and excellent hybridization properties to modified 4'-methoxyoligodeoxynucleotides. The strong tendency toward RNA-selective hybridization suggests its potential utilization in antisense and/or RNAi technologies. © 2016 by John Wiley & Sons, Inc. PMID:27584701

  7. Evaluation of inhibition of miRNA expression induced by anti-miRNA oligonucleotides.

    PubMed

    Chae, Dong-Kyu; Ban, Eunmi; Yoo, Young Sook; Baik, Ja-Hyun; Song, Eun Joo

    2016-07-01

    MicroRNAs (miRNAs) are short RNA molecules that control the expression of mRNAs associated with various biological processes. Therefore, deregulated miRNAs play an important role in the pathogenesis of diseases. Numerous studies aimed at developing novel miRNA-based drugs or determining miRNA functions have been conducted by inhibiting miRNAs using anti-miRNA oligonucleotides (AMOs), which inhibit the function by hybridizing with miRNA. To increase the binding affinity and specificity to target miRNA, AMOs with various chemical modifications have been developed. Evaluating the potency of these various types of AMOs is an essential step in their development. In this study, we developed a capillary electrophoresis with laser-induced fluorescence (CE-LIF) method to evaluate the potency of AMOs by measuring changes in miRNA levels with fluorescence-labeled ssDNA probes using AMO-miR-23a, which inhibits miR-23a related to lung cancer. In order to eliminate interference by excess AMOs during hybridization of the ssDNA probe with the miR-23a, the concentration of the ssDNA probe was optimized. This newly developed method was used to compare the potency of two different modified AMOs. The data were supported by the results of a luciferase assay. This study demonstrated that CE-LIF analysis could be used to accurately evaluate AMO potency in biological samples. PMID:27178549

  8. Chemically Modified Interleukin-6 Aptamer Inhibits Development of Collagen-Induced Arthritis in Cynomolgus Monkeys

    PubMed Central

    Murakami, Ikuo; Ishikawa, Yuichi; Suzuki, Tomoki; Sumida, Shun-ichiro; Ibaragi, Shigeru; Kasai, Hayato; Horai, Naoto; Drolet, Daniel W.; Gupta, Shashi; Janjic, Nebojsa

    2016-01-01

    Interleukin-6 (IL-6) is a potent mediator of inflammatory and immune responses, and a validated target for therapeutic intervention of inflammatory diseases. Previous studies have shown that SL1026, a slow off-rate modified aptamer (SOMAmer) antagonist of IL-6, neutralizes IL-6 signaling in vitro. In the present study, we show that SL1026 delays the onset and reduces the severity of rheumatoid symptoms in a collagen-induced arthritis model in cynomolgus monkeys. SL1026 (1 and 10 mg/kg), administered q.i.d., delayed the progression of arthritis and the concomitant increase in serum IL-6 levels compared to the untreated control group. Furthermore, SL1026 inhibited IL-6-induced STAT3 phosphorylation ex vivo in T lymphocytes from human blood and IL-6-induced C-reactive protein and serum amyloid A production in human primary hepatocytes. Importantly, SOMAmer treatment did not elicit an immune response, as evidenced by the absence of anti-SOMAmer antibodies in plasma of treated monkeys. These results demonstrate that SOMAmer antagonists of IL-6 may be attractive agents for the treatment of IL-6-mediated diseases, including rheumatoid arthritis. PMID:26579954

  9. Investigation of the biofouling properties of several algae on different textured chemical modified silicone surfaces

    NASA Astrophysics Data System (ADS)

    Xu, Jihai; Zhao, Wenjie; Peng, Shusen; Zeng, Zhixiang; Zhang, Xin; Wu, Xuedong; Xue, Qunji

    2014-08-01

    Engineered pillars, pits and grooves spaced 3, 6, 9 and 12 μm apart were fabricated on siloxane modified acrylic resin films. The effect of feature size, geometry, and wettability on the settlement of different algae was evaluated. These films showed various antifouling performances to Ulothrix, Closterium and Navicula. For Navicula (length: 10-12 μm), the feature size and geometry displayed a substantial correlation with the antifouling properties. The film with pillars spaced 3 μm reduced Navicula settlement by 73% compared to the control surface. For Closterium (length: 45-55 μm), their responses were governed by the same underlying thermodynamic principles as wettability, the largest reduction in Closterium, 81%, was obtained on the surface with grooves spaced 12 μm apart. For Ulothrix (length: 5-8 mm), the surface also showed the best antifouling performance, the reduction ratio of the settlement on the surface with grooves spaced 12 μm apart could even reach 92%. At last, physical fouling deterrent mechanisms for the films with various textures were analyzed in detail. The feature size and geometry display a substantial correlation with the antifouling properties when the size of fouling algae is close to the textures. With the increasing size for algae, antifouling performance was getting better on surface with pillars or grooves because the algae are bridged between two or more features other than stabilizing its entire mass on one single feature or able to settle between features.

  10. Chemical and Nanomechanical Analysis of Rice Husk Modified by ATRP-Grafted Oligomer

    PubMed Central

    Morsi, Samir M.; Pakzad, Anahita; Amin, Amal; Yassar, Reza S.; Heiden, Patricia A.

    2013-01-01

    Rice husk (RH), an abundant agricultural residue, was reacted with 2-bromoisobutyryl bromide, to convert it to a heterogeneous polyfunctional macroinitiator for Atom Transfer Radical Polymerization (ATRP). The number of active sites placed on the RH surface was small, but they were ATRP active. Non-polar methyl methacrylate (MMA) and polar acrylonitrile (AN) were polymerized from the RH, and a sequential monomer addition was used to prepare an amphiphilic PMMA-b-PAN copolymer on RH surface. FTIR qualitatively confirmed the grafting. Gravimetric and XPS analysis of the different RH surface compositions indicated thin layers of oligomeric PMMA, PAN, and PMMA-b-PAN. The modified surfaces were mapped by nanomechanical AFM to measure surface roughness, and adhesion and moduli using the Derjaguin-Muller-Toropov model. RH grafted with MMA possessed a roughness value of 7.92, and a hard and weakly adhering surface (13.1 GPa and 16.7 nN respectively) while RH grafted with AN yielded a roughness value of 29 with hardness and adhesion values of 4.0 GPa and 23.5 nN. The PMMA-b-PAN modification afforded a surface with a roughness value of 51.5 nm, with hardness and adhesion values of 3.0 GPa and .75.3 nN. PMID:21565356

  11. Chemical, Physical, and Mechanical Characterization of Isocyanate Cross-linked Amine-Modified Silica Aerogels

    NASA Technical Reports Server (NTRS)

    Katti, Atul; Shimpi, Nilesh; Roy, Samit; Lu, Hongbing; Fabrizio, Eve F.; Dass, Amala; Capadona, Lynn A.; Leventis, Nicholas

    2006-01-01

    We describe a new mechanically strong lightweight porous composite material obtained by encapsulating the skeletal framework of amine-modified silica aerogels with polyurea. The conformal polymer coating preserves the mesoporous structure of the underlying silica framework and the thermal conductivity remains low at 0.041 plus or minus 0.001 W m(sup -1 K(sup -1). The potential of the new cross-linked silica aerogels for load-carrying applications was determined through characterization of their mechanical behavior under compression, three-point bending, and dynamic mechanical analysis (DMA). A primary glass transition temperature of 130 C was identified through DMA. At room temperature, results indicate a hyperfoam behavior where in compression cross-linked aerogels are linearly elastic under small strains (less than 4%) and then exhibit yield behavior (until 40% strain), followed by densification and inelastic hardening. At room temperature the compressive Young's modulus and the Poisson's ratio were determined to be 129 plus or minus 8 MPa and 0.18, respectively, while the strain at ultimate failure is 77% and the average specific compressive stress at ultimate failure is 3.89 x 10(exp 5) N m kg(sup -1). The specific flexural strength is 2.16 x 10(exp 4) N m kg(sup -1). Effects on the compressive behavior of strain rate and low temperature were also evaluated.

  12. Directed assembly of nanodiamond nitrogen-vacancy centers on a chemically modified patterned surface.

    PubMed

    Rao, Saleem G; Karim, Altaf; Schwartz, Julian; Antler, Natania; Schenkel, Thomas; Siddiqi, Irfan

    2014-08-13

    Nitrogen-vacancy (NV) centers in nanodiamond (ND) particles are an attractive material for photonic, quantum information, and biological sensing technologies due to their optical properties-bright single photon emission and long spin coherence time. To harness these features in practical devices, it is essential to realize efficient methods to assemble and pattern NDs at the micro-/nanoscale. In this work, we report the large scale patterned assembly of NDs on a Au surface by creating hydrophobic and hydrophilic regions using self-assembled monolayer (SAM). Hydrophobic regions are created using a methyl (-CH3) terminated SAM of octadecanethiol molecules. Evaporating a water droplet suspension of NDs on the SAM patterned surface assembles the NDs in the bare Au, hydrophilic regions. Using this procedure, we successfully produced a ND structures in the shape of dots, lines, and rectangles. Subsequent photoluminescence imaging of the patterned NDs confirmed the presence of optically active NV centers. Experimental evidence in conjunction with computational analysis indicates that the surface wettability of the SAM modified Au surface plays a dominant role in the assembly of NDs as compared to van der Waals and other substrate-ND interactions. PMID:25029262

  13. Protein Adsorption on Chemically Modified Block Copolymer Nanodomains: Influence of Charge and Flow.

    PubMed

    Silverstein, Joshua S; Casey, Brendan J; Kofinas, Peter; Dair, Benita J

    2016-02-01

    Understanding the interactions of biomacromolecules with nanoengineered surfaces is vital for assessing material biocompatibility. This study focuses on the dynamics of protein adsorption on nanopatterned block copolymers (BCPs). Poly(styrene)-block-poly(1,2-butadiene) BCPs functionalized with an acid, amine, amide, or captopril moieties were processed to produce nanopatterned films. These films were characterized using water contact angle measurements and atomic force microscopy in air and liquid to determine how the modification process affected. wettability and swelling. Protein adsorption experiments were conducted under static and dynamic conditions via a quartz crystal microbalance with dissipation. Proteins of various size, charge, and stability were investigated to determine whether their physical characteristics affected adsorption. Significantly decreased contact angles were caused by selective swelling of modified BCP domains. The results indicate that nanopatterned chemistry and experimental conditions strongly impact adsorption dynamics. Depending on the structural stability of the protein, polyelectrolyte surfaces significantly increased adsorption over controls. Further analysis suggested that protein stability may correlate with dissipation versus frequency plots. PMID:27433605

  14. NOx Direct Decomposition: Potentially Enhanced Thermodynamics and Kinetics on Chemically Modified Ferroelectric Surfaces

    NASA Astrophysics Data System (ADS)

    Kakekhani, Arvin; Ismail-Beigi, Sohrab

    2014-03-01

    NOx are regulated pollutants produced during automotive combustion. As part of an effort to design catalysts for NOx decomposition that operate in oxygen rich environment and permit greater fuel efficiency, we study chemistry of NOx on (001) ferroelectric surfaces. Changing the polarization at such surfaces modifies electronic properties and leads to switchable surface chemistry. Using first principles theory, our previous work has shown that addition of catalytic RuO2 monolayer on ferroelectric PbTiO3 surface makes direct decomposition of NO thermodynamically favorable for one polarization. Furthermore, the usual problem of blockage of catalytic sites by strong oxygen binding is overcome by flipping polarization that helps desorb the oxygen. We describe a thermodynamic cycle for direct NO decomposition followed by desorption of N2 and O2. We provide energy barriers and transition states for key steps of the cycle as well as describing their dependence on polarization direction. We end by pointing out how a switchable order parameter of substrate,in this case ferroelectric polarization, allows us to break away from some standard compromises for catalyst design(e.g. the Sabatier principle). This enlarges the set of potentially catalytic metals. Primary support from Toyota Motor Engineering and Manufacturing, North America, Inc.

  15. Chemical modification of metallic implant surfaces with biofunctional proteins (Part 2). Corrosion resistance of a chemically modified NiTi alloy.

    PubMed

    Endo, K

    1995-12-01

    The corrosion resistance of a NiTi alloy, chemically modified with a human plasma fibronectin (pFN) using an aminosilane and a glutaraldehyde, was examined by electrochemical techniques in a 0.9% NaCl solution and a cell culture medium containing serum. The role of serum proteins in influencing the passive behavior of the alloy was extensively studied by anodic polarization and X-ray photoelectron spectroscopy (XPS). The passive current density increased in the presence of serum proteins. The enhanced dissolution of the passive film appears to be a consequence of quick adsorption of the serum proteins and the subsequent formation of metal ion-protein complexes on the film surface. With the chemical modification, the corrosion rate was reduced by approximately 50% in both solutions due to a highly cross-linked siloxane network formed on the alloy surface. This network layer limited the diffusion of dissolved oxygen, metal ions, and biological molecules involved in the corrosion reactions. PMID:8940558

  16. Improved actuation strain of PDMS-based DEA materials chemically modified with softening agents

    NASA Astrophysics Data System (ADS)

    Biedermann, Miriam; Blümke, Martin; Wegener, Michael; Krüger, Hartmut

    2015-04-01

    Dielectric elastomer actuators (DEAs) are smart materials that gained much in interest particularly in recent years. One active field of research is the improvement of their properties by modification of their structural framework. The object of this work is to improve the actuation properties of polydimethylsiloxane (PDMS)-based DEAs by covalent incorporation of mono-vinyl-terminated low-molecular PDMS chains into the PDMS network. These low-molecular units act as a kind of softener within the PDMS network. The loose chain ends interfere with the network formation and lower the network's density. PDMS films with up to 50wt% of low-molecular PDMS additives were manufactured and the chemical, mechanical, electrical, and electromechanical properties of these novel materials were investigated.

  17. Graphene oxide papers modified by divalent ions-enhancing mechanical properties via chemical cross-linking.

    PubMed

    Park, Sungjin; Lee, Kyoung-Seok; Bozoklu, Gulay; Cai, Weiwei; Nguyen, Sonbinh T; Ruoff, Rodney S

    2008-03-01

    Significant enhancement in mechanical stiffness (10-200%) and fracture strength (approximately 50%) of graphene oxide paper, a novel paperlike material made from individual graphene oxide sheets, can be achieved upon modification with a small amount (less than 1 wt %) of Mg(2+) and Ca(2+). These results can be readily rationalized in terms of the chemical interactions between the functional groups of the graphene oxide sheets and the divalent metals ions. While oxygen functional groups on the basal planes of the sheets and the carboxylate groups on the edges can both bond to Mg(2+) and Ca(2+), the main contribution to mechanical enhancement of the paper comes from the latter. PMID:19206584

  18. Facile synthesis of graphene oxide-modified lithium hydroxide for low-temperature chemical heat storage

    NASA Astrophysics Data System (ADS)

    Yang, Xixian; Huang, Hongyu; Wang, Zhihui; Kubota, Mitsuhiro; He, Zhaohong; Kobayashi, Noriyuki

    2016-01-01

    LiOH·H2O nanoparticles supported on graphene oxide (GO) were facilely synthesized by a hydrothermal process. The mean diameter of nanoparticles on the integrated graphene sheet was about 5-10 nm showed by SEM and TEM results. XRD results suggested that the nanoparticles are in good agreement with the data of LiOH·H2O. The as-prepared sample showed a greatly enhanced thermal energy storage density and exhibit higher rate of heat release than pure lithium hydroxide, and thermal conductivity of composites increased due to the introduction of nano carbon. LiOH·H2O/GO nanocomposites are novel chemical heat storage materials for potential highly efficient energy system.

  19. A facile and sensitive electrochemiluminescence biosensor for Hg2+ analysis based on a dual-function oligonucleotide probe.

    PubMed

    Huang, Rong-Fu; Liu, Hui-Xin; Gai, Qi-Qi; Liu, Gai-Juan; Wei, Zheng

    2015-09-15

    In this study, a sensitive electrochemiluminescent (ECL) biosensor for the detection of Hg(2+) was easily prepared by self-assembling mercury-specific oligonucleotide on the surface of gold nanoparticles (AuNPs) modified indium tin oxide (ITO) electrode. A conformation change of the oligonucleotide from linear chain to hairpin occurs upon the binding of Hg(2+) through thymine-Hg(2+)-thymine coordination. The dual-function oligonucleotide serves as the probe to Hg(2+) but also a carrier of signal-generating molecules, [Ru(bpy)2(dppz)](BF4)2. It was estimated that one oligonucleotide was able to load with eight ECL signal molecules; a ratio of four or five oligonucleotides per gold nanoparticle was obtained basing on the calculation with surface density. Without tedious multiple-labeling procedures and special modification of oligonucleotide probe for signal transduction/amplification, a detection limit of 5.1 pM Hg(2+) was outstanding from the interference of other ten metal ions. Results of spiked water samples were in good agreement with that obtained by atomic fluorescent spectrometry. PMID:25909339

  20. Applicability of vacuum impregnation to modify physico-chemical, sensory and nutritive characteristics of plant origin products--a review.

    PubMed

    Radziejewska-Kubzdela, Elżbieta; Biegańska-Marecik, Róża; Kidoń, Marcin

    2014-01-01

    Vacuum impregnation is a non-destructive method of introducing a solution with a specific composition to the porous matrices of fruit and vegetables. Mass transfer in this process is a result of mechanically induced differences in pressure. Vacuum impregnation makes it possible to fill large volumes of intercellular spaces in tissues of fruit and vegetables, thus modifying physico-chemical properties and sensory attributes of products. This method may be used, e.g., to reduce pH and water activity of the product, change its thermal properties, improve texture, color, taste and aroma. Additionally, bioactive compounds may be introduced together with impregnating solutions, thus improving health-promoting properties of the product or facilitating production of functional food. PMID:25244012

  1. Interaction of plasma-generated water cluster ions with chemically-modified Si surfaces investigated by infrared absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Hirano-Iwata, Ayumi; Matsumura, Ryosuke; Ma, Teng; Kimura, Yasuo; Niwano, Michio; Nishikawa, Kazuo

    2016-03-01

    We have investigated the interaction of water cluster ions generated by discharge plasma, with chemically modified Si surfaces using infrared absorption spectroscopy in the multiple internal reflection geometry. We observe that water cluster ions readily adsorb on SiO2-covered Si surfaces to form water droplets. We demonstrate that positively- and negatively-charged cluster ions adsorb on the SiO2-covered Si surface in different manners, indicating ionic interaction of the water droplets with the negatively-charged SiO2 surface. Water droplets formed on the protein-coated surface rupture the amide bond of the proteins, suggesting the function of protein decomposition of water cluster ions.

  2. A modified method for the determination of chemical oxygen demand (COD) for samples with high salinity and low organics.

    PubMed

    Vyrides, I; Stuckey, D C

    2009-01-01

    This study proposes a modification to the standard method for the determination of the chemical oxygen demand of samples with a salinity up to 40 g NaCl/L and low organic concentrations (20-230 mg COD/L). The masking of chloride by the use of a HgSO(4):Cl ratio of 20:1 prior to digestion, and the use of 3g K(2)Cr(2)O(7)/L in the digestion solution resulted in an error of less than 10% and 12% for samples containing 40 g NaCl/L at 20-190 mg COD/L and 230 mg COD/L, respectively. Comparison of the standard method with the new proposed method using a synthetic sewage highlights the large errors (50-85%) of the standard method in contrast to an error of less than 10% for the proposed modified method. PMID:18693009

  3. Applicability of Vacuum Impregnation to Modify Physico-Chemical, Sensory and Nutritive Characteristics of Plant Origin Products—A Review

    PubMed Central

    Radziejewska-Kubzdela, Elżbieta; Biegańska-Marecik, Róża; Kidoń, Marcin

    2014-01-01

    Vacuum impregnation is a non-destructive method of introducing a solution with a specific composition to the porous matrices of fruit and vegetables. Mass transfer in this process is a result of mechanically induced differences in pressure. Vacuum impregnation makes it possible to fill large volumes of intercellular spaces in tissues of fruit and vegetables, thus modifying physico-chemical properties and sensory attributes of products. This method may be used, e.g., to reduce pH and water activity of the product, change its thermal properties, improve texture, color, taste and aroma. Additionally, bioactive compounds may be introduced together with impregnating solutions, thus improving health-promoting properties of the product or facilitating production of functional food. PMID:25244012

  4. The photosensitivity and ultraviolet absorption change of Sn-doped silica film fabricated by modified chemical vapor deposition

    SciTech Connect

    Chen Guanghui; Li Yigang; Liu Liying; He Yaoji; Xu Lei; Wang Wencheng

    2004-12-01

    10.5 {mu}m thick Sn-doped silica films were prepared by the modified chemical vapor deposition followed by the solution-doping method. The films were exposed to 248 and 266 nm laser light, respectively. Positive refractive index change up to 2x10{sup -4} at 1550 nm was observed by measuring the reflectivity based on Fresnel formulas. The data of UV absorption spectra suggest that the photosensitivity of the Sn-doped silica film under high energy density laser irradiation should be mainly due to the bond breaking of oxygen deficient defects, while under relatively low energy density laser irradiation, the refractive index change probably originates from photoconversion of optically active defects.

  5. Surface charge, electroosmotic flow and DNA extension in chemically modified thermoplastic nanoslits and nanochannels.

    PubMed

    Uba, Franklin I; Pullagurla, Swathi R; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoon-Kyoung; Shin, Heungjoo; Soper, Steven A

    2015-01-01

    Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels. PMID:25369728

  6. Surface Charge, Electroosmotic Flow and DNA Extension in Chemically Modified Thermoplastic Nanoslits and Nanochannels

    PubMed Central

    Uba, Franklin I.; Pullagurla, Swathi R.; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoonkyoung; Shin, Heungjoo; Soper, Steven A.

    2014-01-01

    Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels. PMID:25369728

  7. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  8. Characterization of Heme-DNA Complexes Composed of Some Chemically Modified Hemes and Parallel G-Quadruplex DNAs.

    PubMed

    Yamamoto, Yasuhiko; Kinoshita, Masashi; Katahira, Yuya; Shimizu, Haruna; Di, Yue; Shibata, Tomokazu; Tai, Hulin; Suzuki, Akihiro; Neya, Saburo

    2015-12-15

    Heme {Fe(II)- or Fe(III)-protoporphyrin IX complex [heme(Fe(2+)) or heme(Fe(3+)), respectively]} binds selectively to the 3'-terminal G-quartet of a parallel G-quadruplex DNA formed from a single repeat sequence of the human telomere, d(TTAGGG), through a π-π stacking interaction between the porphyrin moiety of the heme and the G-quartet. The binding affinities of some chemically modified hemes(Fe(3+)) for DNA and the structures of complexes between the modified hemes(Fe(2+)) and DNA, with carbon monoxide (CO) coordinated to the heme Fe atom on the side of the heme opposite the G6 G-quartet, have been characterized to elucidate the interaction between the heme and G-quartet in the complexes through analysis of the effects of the heme modification on the structural properties of the complex. The study revealed that the binding affinities and structures of the complexes were barely affected by the heme modification performed in the study. Such plasticity in the binding of heme to the G-quartet is useful for the versatile design of the complex through heme chemical modification and DNA sequence alteration. Furthermore, exchangeable proton signals exhibiting two-proton intensity were observed at approximately -3.5 ppm in the (1)H nuclear magnetic resonance (NMR) spectra of the CO adducts of the complexes. Through analysis of the NMR results, together with theoretical consideration, we concluded that the heme(Fe(2+)) axial ligand trans to CO in the complex is a water molecule (H2O). Identification of the Fe-bound H2O accommodated between the heme and G-quartet planes in the complex provides new insights into the structure-function relationship of the complex. PMID:26595799

  9. Inhibition of certain strains of HIV-1 by cell surface polyanions in the form of cholesterol-labeled oligonucleotides

    SciTech Connect

    Ahn, Kwang-Soo; Ou, Wu; Silver, Jonathan . E-mail: jsilver@nih.gov

    2004-12-05

    Cholesterol-labeled oligonucleotides were found several years ago to inhibit HIV-1 in tissue culture at nanomolar concentrations. We present evidence that this is mainly due to an electrostatic interaction between polyanionic oligonucleotide concentrated at the cell surface and a positively charged region in the V3 loop of the HIV-1 envelope protein. When added to tissue culture, cholesterol-labeled oligonucleotides became concentrated at the plasma membrane and potently inhibited virus entry and cell fusion mediated by the envelope protein of some X4 strains of HIV-1, but had little effect on fusion mediated by R5 strains of HIV-1, amphotropic MLV envelope protein, or VSV-G protein. Noncholesterol-labeled oligonucleotides did not bind to the cell surface or inhibit fusion. The pattern of susceptibility to cholesterol-labeled oligonucleotides among HIV-1 strains was the same as reported for nonmembrane-associating polyanions such as dextran sulfate, but the cholesterol-labeled oligonucleotides were effective at lower concentrations. Substitution of a basic 33 amino acid V3 loop sequence from the envelope protein of a resistant strain into a susceptible strain made the envelope protein resistant to inhibition. Inhibition by cholesterol-labeled oligonucleotides was abrogated by the polycation DEAE-dextran. Cholesterol-labeled oligonucleotides bound to nonraft regions of the plasma membrane and did not inhibit HIV virus binding to cells. Many infectious agents first associate with target cells via relatively nonspecific charge interactions; our data suggest that molecules that combine a membrane-targeting motif with multiple negative charges might be useful to modify these interactions.

  10. Cobalt as chemical modifier to improve chromium sensitivity and minimize matrix effects in tungsten coil atomic emission spectrometry.

    PubMed

    Silva, Sidnei G; Donati, George L; Santos, Luana N; Jones, Bradley T; Nóbrega, Joaquim A

    2013-05-30

    Cobalt is used as chemical modifier to improve sensitivity and minimize matrix effects in Cr determinations by tungsten coil atomic emission spectrometry (WCAES). The atomizer is a tungsten filament extracted from microscope light bulbs. A solid-state power supply and a handheld CCD-based spectrometer are also used in the instrumental setup. In the presence of 1000 mg L(-1) Co, WCAES limit of detection for Cr (λ=425.4 nm) is calculated as 0.070 mg L(-1); a 10-fold improvement compared to determinations without Co modifier. The mechanism involved in such signal enhancement is similar to the one observed in ICP OES and ICP-MS determinations of As and Se in the presence of C. Cobalt increases the population of Cr(+) by charge transfer reactions. In a second step, Cr(+)/e(-) recombination takes place, which results in a larger population of excited-state Cr atoms. This alternative excitation route is energetically more efficient than heat transfer from atomizer and gas phase to analyte atoms. A linear dynamic range of 0.25-10 mg L(-1) and repeatability of 3.8% (RSD, n=10) for a 2.0 mg L(-1) Cr solution are obtained with this strategy. The modifier high concentration also contributes to improving accuracy due to a matrix-matching effect. The method was applied to a certified reference material of Dogfish Muscle (DORM-2) and no statistically significant difference was observed between determined and certified Cr values at a 95% confidence level. Spike experiments with bottled water samples resulted in recoveries between 93% and 112%. PMID:23680545

  11. Development of Green Solvent Modified Zeolite (GSMZ) for the Removal of Chemical Contaminants and Pathogens from Water

    NASA Astrophysics Data System (ADS)

    Li, Z.; Stapleton, E. R.; Xu, S.

    2012-12-01

    Sorption represents an important strategy in the remediation of groundwater contamination. As a naturally-occurring mineral with large cation exchange capacity, zeolite is negatively charged and has been widely used as an inexpensive and effective sorbent for the removal of positively charged contaminants such as heavy metals from water. The negative charges of zeolite, however, make it generally ineffective in the sorption of anionic contaminants such as chromate and arsenate as well as many pathogens. In this research, we used the imidazolium group of chemicals, which are considered as "green solvents" and differ from the surfactants used in previous studies, to modify zeolite. Both batch and column experiments were performed to evaluate the effectiveness of GSMZ in the removal of representative anionic pollutant (i.e., Cr) and bacterium (i.e., Eschericha coli) under various water chemistry conditions. Our experimental results showed that the adsorption of Cr on GSMZ was fast (equilibrium was reached within ~5 min) and the capacity of GSMZ to remove chromate (>1000 mg/kg) was ~100% higher than surfactant modified zeolite (SMZ). GSMZ was also found to be very effective in the removal of E. coli. As pH was found to have minimal effects on the adsorption of chromium on GSMZ, higher ionic strength could lower the adsorption capacity of chromium by GSMZ.

  12. A reagentless enzymatic fluorescent biosensor for glucose based on upconverting glasses, as excitation source, and chemically modified glucose oxidase.

    PubMed

    Del Barrio, Melisa; Cases, Rafael; Cebolla, Vicente; Hirsch, Thomas; de Marcos, Susana; Wilhelm, Stefan; Galbán, Javier

    2016-11-01

    Upon near-infrared excitation Tm(3+)+Yb(3+) doped fluorohafnate glasses present upconversion properties and emit visible light. This property permits to use these glasses (UCG) as excitation sources for fluorescent optical biosensors. Taking this into account, in this work a fluorescent biosensor for glucose determination is designed and evaluated. The biosensor combines the UCG and the fluorescence of the enzyme glucose oxidase chemically modified with a fluorescein derivative (GOx-FS), whose intensity is modified during the enzymatic reaction with glucose. Optical parameters have been optimized and a mathematical model describing the behavior of the analytical signal is suggested. Working in FIA mode, the biosensor responds to glucose concentrations up to, at least, 15mM with a limit of detection of 1.9mM. The biosensor has a minimum lifetime of 9 days and has been applied to glucose determination in drinks. The applicability of the sensor was tested by glucose determination in two fruit juices. PMID:27591654

  13. Hsp90 protein interacts with phosphorothioate oligonucleotides containing hydrophobic 2'-modifications and enhances antisense activity.

    PubMed

    Liang, Xue-Hai; Shen, Wen; Sun, Hong; Kinberger, Garth A; Prakash, Thazha P; Nichols, Joshua G; Crooke, Stanley T

    2016-05-01

    RNase H1-dependent antisense oligonucleotides (ASOs) are chemically modified to enhance pharmacological properties. Major modifications include phosphorothioate (PS) backbone and different 2'-modifications in 2-5 nucleotides at each end (wing) of an ASO. Chemical modifications can affect protein binding and understanding ASO-protein interactions is important for better drug design. Recently we identified many intracellular ASO-binding proteins and found that protein binding could affect ASO potency. Here, we analyzed the structure-activity-relationships of ASO-protein interactions and found 2'-modifications significantly affected protein binding, including La, P54nrb and NPM. PS-ASOs containing more hydrophobic 2'-modifications exhibit higher affinity for proteins in general, although certain proteins, e.g. Ku70/Ku80 and TCP1, are less affected by 2'-modifications. We found that Hsp90 protein binds PS-ASOs containing locked-nucleic-acid (LNA) or constrained-ethyl-bicyclic-nucleic-acid ((S)-cEt) modifications much more avidly than 2'-O-methoxyethyl (MOE). ASOs bind the mid-domain of Hsp90 protein. Hsp90 interacts with more hydrophobic 2' modifications, e.g. (S)-cEt or LNA, in the 5'-wing of the ASO. Reduction of Hsp90 protein decreased activity of PS-ASOs with 5'-LNA or 5'-cEt wings, but not with 5'-MOE wing. Together, our results indicate Hsp90 protein enhances the activity of PS/LNA or PS/(S)-cEt ASOs, and imply that altering protein binding of ASOs using different chemical modifications can improve therapeutic performance of PS-ASOs. PMID:26945041

  14. Wetting Properties of Chemically Modified Surfaces: The role of hydrogen bonding

    NASA Astrophysics Data System (ADS)

    Bekele, Selemon; Tsige, Mesfin

    2015-03-01

    Many industrial processing operations involve the spreading of a liquid on a solid material. Controlling the wetting of one material by another is of crucial importance in such applications as adhesion, coating and oil recovery. A strategy often employed to control the wettability of solid surfaces is a combination of surface patterning and chemical surface modification. In order to understand the effect of surface chemistry on the wetting process, we have carried out all-atom molecular dynamics (MD) simulations of a water droplet spreading on pure and oxidized polystyrene surfaces. Our previous results show that the contact angle generally decreases with increasing oxygen concentration and there is a correlation between the spreading and hydrogen bonding. In this talk, we will present results on the structure and dynamics of the hydrogen bonds in the interfacial region between water and the polystyrene substrate. We will discuss our findings on hydrogen bond lifetimes, time correlations functions and number of hydrogen bonds per water molecule for the hydrogen bonds around the water/polystyrene interface which are found to play a role in the spreading process. This work was supported by NSF Grant DMR0847580.

  15. Chemical structures and physical properties of vanadium oxide films modified by single-walled carbon nanotubes.

    PubMed

    He, Qiong; Xu, Xiangdong; Wang, Meng; Sun, Minghui; Jiang, Yadong; Yao, Jie; Ao, Tianhong

    2016-01-21

    A series of vanadium oxide (VOx)-single-walled carbon nanotube (SWCNT) composite films with different SWCNT concentrations were prepared and systematically investigated. The results reveal that after SWCNT addition, the optical absorption and electrical conductivity of VOx are enhanced, but the crystallinity and temperature coefficient of resistance (TCR) are weakened. Consequently, either too low or too high CNT loading will lead to the degradation of the comprehensive properties. In contrast, the VOx-SWCNT composite film containing 4 wt% SWCNTs exhibits the optimal comprehensive properties such as high film uniformity, large optical absorption, and desirable sheet resistance (141 kΩ) and TCR (-1.73% K(-1)), favorable for applications in uncooled infrared detectors. Saturated interactions between SWCNTs and VOx are observed at 6 wt% SWCNTs, after which (≤10 wt% SWCNTs) the structures and properties are changed slightly. This work reveals the modification of the chemical structures and physical properties of VOx films by SWCNTs, whose results will be helpful not only for a better understanding of VOx, SWCNTs, and their composites, but also for seeking new versatile functional materials for device applications. PMID:26456497

  16. Epithelial cell morphology and adhesion on diamond films deposited and chemically modified by plasma processes.

    PubMed

    Rezek, Bohuslav; Ukraintsev, Egor; Krátká, Marie; Taylor, Andrew; Fendrych, Frantisek; Mandys, Vaclav

    2014-09-01

    The authors show that nanocrystalline diamond (NCD) thin films prepared by microwave plasma enhanced chemical vapor deposition apparatus with a linear antenna delivery system are well compatible with epithelial cells (5637 human bladder carcinoma) and significantly improve the cell adhesion compared to reference glass substrates. This is attributed to better adhesion of adsorbed layers to diamond as observed by atomic force microscopy (AFM) beneath the cells. Moreover, the cell morphology can be adjusted by appropriate surface treatment of diamond by using hydrogen and oxygen plasma. Cell bodies, cytoplasmic rims, and filopodia were characterized by Peakforce AFM. Oxidized NCD films perform better than other substrates under all conditions (96% of cells adhered well). A thin adsorbed layer formed from culture medium and supplemented with fetal bovine serum (FBS) covered the diamond surface and played an important role in the cell adhesion. Nevertheless, 50-100 nm large aggregates formed from the RPMI medium without FBS facilitated cell adhesion also on hydrophobic hydrogenated NCD (increase from 23% to 61%). The authors discuss applicability for biomedical uses. PMID:25280853

  17. Biomimetic Deposition of Apatite on Surface Chemically Modified Porous NiTi Shapememory Alloy

    NASA Astrophysics Data System (ADS)

    Wu, S. L.; Liu, X. M.; Chung, C. Y.; Chu, Paul K.; Chan, Y. L.; Yeung, K. W. K.; Chu, C. L.

    Porous NiTi shape memory alloy (SMA) with 48% porosity and an average pore size of 50-800 μm was synthesized by capsule-free hot isostatic pressing (CF-HIP). To enhance the surface bioactivity, the porous NiTi SMA was subjected to H2O2 and subsequent NaOH treatment. Scanning electron microscopy, X-ray diffraction, and X-ray photoelectron spectroscopy analyses revealed that a porous sodium titanate (Na2TiO3) film had formed on the surface of the porous NiTi SMA. An apatite layer was deposited on this film after immersion in simulated body fluid at 37°C, while no apatite could be found on the surface of the untreated porous NiTi SMA. The formation of the apatite layer infers that the bioactivity of the porous NiTi SMA may be enhanced by surface chemical treatment, which is favorable for its application as bone implants.

  18. Amino resin modified xanthan polymer foamed with a chemical blowing agent

    SciTech Connect

    Hazlett, R.D.; Shu, P.

    1989-05-16

    A method is described for reducing the permeability in an area of a subterranean formation which consists of mixing a gellable composition containing: water, about 0.2 to about 5.0 wt.% of a cross linkable polysaccharide biopolymer having at least one functional group charide biopolymer having at least one functional group selected from a member of the group consisting of an amine, an amide, a hydroxyl, or a thiol group, and about 0.02 to about 5.0 wt.% of an aminoplast resin which reinforces the biopolymer thereby causing the polymer to become more thermally stable. Also included are sufficient transitional metal ions to form a gel of a size and strength sufficient to reduce permeability in a more permeable zone in the formation. A chemical surfactant, and an alkali metal salt of azodicarboxylic acid, are then introduced produce a gas sufficient to foam the composition described above. The composition is then injected into the desired area of the formation where the azodicarboxylic acid decomposes thereby generating nitrogen and carbon dioxide gas in an amount sufficient to form a foam which subsequently hardens and reduces the permeability in the desired area.

  19. The chemical synthesis of α-conotoxins and structurally modified analogs with enhanced biological stability.

    PubMed

    Banerjee, Jayati; Gyanda, Reena; Chang, Yi-Pin; Armishaw, Christopher J

    2013-01-01

    α-Conotoxins are peptide neurotoxins isolated from the venom ducts of carnivorous marine cone snails that exhibit exquisite pharmacological potency and selectivity for various nicotinic acetylcholine receptor subtypes. As such, they are important research tools and drug leads for treating various diseases of the central nervous system, including pain and tobacco addiction. Despite their therapeutic potential, the chemical synthesis of α-conotoxins for use in structure-activity relationship studies is complicated by the possibility of three disulfide bond isomers, where inefficient folding methods can lead to a poor recovery of the pharmacologically active isomer. In order to achieve higher yields of the native isomer, especially in high-throughput syntheses it is necessary to select appropriate oxidative folding conditions. Moreover, the poor biochemical stability exhibited by α-conotoxins limits their general therapeutic applicability in vivo. Numerous strategies to enhance their stability including the substitution of disulfide bond with diselenide bond and N-to-C cyclization via an oligopeptide spacer have successfully overcome these limitations. This chapter describes methods for performing both selective and nonselective disulfide bond oxidation strategies for controlling the yields and formation of α-conotoxin disulfide bond isomers, as well as methods for the production of highly stable diselenide-containing and N-to-C cyclized conotoxin analogs. PMID:24014431

  20. Physisorption of DNA molecules on chemically modified single-walled carbon nanotubes with and without sonication.

    PubMed

    Umemura, Kazuo; Ishibashi, Yu; Oura, Shusuke

    2016-09-01

    We investigated the physisorption phenomenon of single-stranded DNA (ssDNA) molecules onto two types of commercially available chemically functionalized single-walled carbon nanotubes (SWNTs) by atomic force microscopy (AFM) and agarose gel electrophoresis. We found that DNA molecules can adsorb on the water-soluble SWNT surfaces without sonication, although sonication treatment has been used for hybridization of DNA and SWNTs in many previous studies. Using our method, damage of DNA molecules by sonication can be avoided. On the other hand, the amount of DNA molecules adsorbed on SWNT surfaces increased when the samples were sonicated. This fact suggests that the sonication is effective not only at debundling of SWNTs, but also at assisting DNA adsorption. Furthermore, DNA adsorption was affected by the types of functionalized SWNTs. In the case of SWNTs functionalized with polyethylene glycol (PEG-SWNT), physisorption of ssDNA molecules was confirmed only by agarose-gel electrophoresis. In contrast, amino-terminated SWNTs (NH2-SWNTs) showed a change in the height distribution profile based on AFM observations. These results suggest that DNA molecules tended to adsorb to NH2-SWNT surfaces, although DNA molecules can also adsorb on PEG-SWNT surfaces. Our results revealed fundamental information for developing nanobiodevices using hybrids of DNA and SWNTs. PMID:26846296

  1. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-09-11

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. PMID:8414968

  2. L-DNAs as potential antimessenger oligonucleotides: a reassessment.

    PubMed Central

    Garbesi, A; Capobianco, M L; Colonna, F P; Tondelli, L; Arcamone, F; Manzini, G; Hilbers, C W; Aelen, J M; Blommers, M J

    1993-01-01

    Unnatural L-2'-deoxyribonucleosides L-T, L-dC, L-dA and L-dG were prepared from L-arabinose and assembled, by solution or solid phase synthesis, to give L-oligonucleotides (L-DNAs), which contain all four natural bases. The affinity of these modified oligomers for complementary D-ribo- and D-deoxyribo-oligomers was studied with NMR, UV and CD spectroscopies and mobility shift assay on native PAGE. All experimental results indicate that L-DNAs do not, in general, recognize single-stranded, natural DNA and RNA. Hence, contrary to previous suggestions, it is not possible to envisage their use as wide scope antimessenger agents in the selective control of gene expression. Images PMID:8414968

  3. Synthesis of oligonucleotides on cellulose by a phosphotriester method.

    PubMed Central

    Crea, R; Horn, T

    1980-01-01

    The synthesis of oligothymidilic acids, (dT)m (where m = 4, 7, 10, 13, 16, 19, 22, and 25), was carried out using a solid phase approach in combination with the modified phosphotriester methodology developed in solution. Cellulose was used as the solid support after its functionalization with a specially featured dinucleoside diphosphate, 5'-0-p-chlorophenylphospho-2'(3')-0-acetyluridilyl-[2'(3')-3']-5'-0-dimethoxytritylthymidine p-chlorophenylester. The fully protected trideoxynucleoside triphosphate containing only thymidine was repeatedly used to elongate the oligonucleotide chain in the 3'-5' direction. Individual coupling yields ranged from 45% to 75%. The total time needed to prepare (dT)25 was four days. Similarly, the tridecanucleotide d(AGAAGGTACTTTT) was synthesized in good yield. The results show that this approach can be used for a fast and economic way to synthesize oligodeoxynucleotides. Images PMID:7433092

  4. Chemically modified carbon nanostructures for electrospun thin film polymer-nanocomposites

    NASA Astrophysics Data System (ADS)

    Behler, Kristopher

    Various nano-structured carbon materials, most notably carbon nanotubes (CNTs) and nanodiamonds (NDs), are used in preparing polymer-nanocomposites. Surface-modified NDs, multi-walled (MWCNT), double-walled (DWCNT) and triple-walled (TWCNT) have been incorporated into polymer matrix systems. Treatments include vacuum annealing, thermal oxidation in air and acid treatments (nitric and sulfuric acids for the CNTs and hydrochloric acid for NDs). Acid treatments have led to carboxylic group formation on the surface of CNTs and NDs, promoting improved dispersion. As-received, thermal and acid treated MWCNTs have been incorporated into polyvinylidene fluoride and polyamide-11 and -12 electrospun nanofibers with little improvements in the electrical conductivity. To improve the electrical properties of CNT-polyamide composites, negatively charged CNTs were self-assembled on the nanofiber's surface. At a 2 wt% loading, the electrical resistance of the nanofibers decreased two orders of magnitude (to 154 O/sq) by increasing the number of MWCNT self-assembly depositions and then another three orders of magnitude by using DWCNTs (700 O/sq). Further heat treatments were used to fuse (110°C) and completely remove the nanofibers (450°C) to produce ˜150 nm coatings with improved transparency, ˜96% transmission, in the visible spectrum. HCl-purified NDs have also been successfully incorporated in polyamide 11 and polyacrylonitrile nanofibers leading to improvements in the mechanical properties of the fibers. Extremely high loadings of up to 90 wt% ND in the polymer have also been achieved. The Young's modulus of the ND-polyamide-11 composites increased by a factor of four, the hardness doubled and the scratch resistance was improved such that a load three times larger than used on the pure polymer was required to generate a scratch of the identical depth in the composite material. The ND-polymer films have shown about a 50% decrease in transmission in the UV-range, making

  5. Field Deployable Chemical Redox Probe for Quantitative Characterization of Carboxymethylcellulose Modified Nano Zerovalent Iron.

    PubMed

    Fan, Dimin; Chen, Shengwen; Johnson, Richard L; Tratnyek, Paul G

    2015-09-01

    Nano zerovalent iron synthesized with carboxymethylcelluose (CMC-nZVI) is among the leading formulations of nZVI currently used for in situ groundwater remediation. The main advantage of CMC-nZVI is that it forms stable suspensions, which are relatively mobile in porous media. Rapid contaminant reduction by CMC-nZVI is well documented, but the fate of the CMC-nZVI (including "aging" and "reductant demand") is not well characterized. Improved understanding of CMC-nZVI fate requires methods with greater specificity for Fe(0), less vulnerability to sampling/recovery artifacts, and more practical application in the field. These criteria can be met with a simple and specific colorimetric approach using indigo-5,5'-disulfonate (I2S) as a chemical redox probe (CRP). The measured stoichiometric ratio for reaction between I2S and nZVI is 1.45 ± 0.03, suggesting complete oxidation of nZVI to Fe(III) species. However, near pH 7, reduction of I2S is diagnostic for Fe(0), because aqueous Fe(II) reduces I2S much more slowly than Fe(0). At that pH, adding Fe(II) increased I2S reduction rates by Fe(0), consistent with depassivation of nZVI, but did not affect the stoichiometry. Using the I2S assay to quantify changes in the Fe(0) content of CMC-nZVI, the rate of Fe(0) oxidation by water was found to be orders of magnitude faster than previously reported values for other types of nZVI. PMID:26218836

  6. Enhanced compatibility of chemically modified titanium surface with periodontal ligament cells

    NASA Astrophysics Data System (ADS)

    Kado, T.; Hidaka, T.; Aita, H.; Endo, K.; Furuichi, Y.

    2012-12-01

    A simple chemical modification method was developed to immobilize cell-adhesive molecules on a titanium surface to improve its compatibility with human periodontal ligament cells (HPDLCs).The polished titanium disk was immersed in 1% (v/v) p-vinylbenzoic acid solution for 2 h to introduce carboxyl groups onto the surface. After rinsing with distilled deionized water, the titanium disk was dipped into 1.47% 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide solution containing 0.1 mg/ml Gly-Arg-Gly-Asp-Ser (GRGDS), human plasma fibronectin (pFN), or type I collagen from calf skin (Col) to covalently immobilize the cell-adhesive molecules on the titanium surface via formation of peptide bonds. X-ray photoelectron spectroscopy analyses revealed that cell-adhesive molecules were successfully immobilized on the titanium surfaces. The Col-immobilized titanium surface revealed higher values regarding nano rough characteristics than the as-polished titanium surface under scanning probe microscopy. The number of HPDLCs attached to both the pFN- and Col-immobilized titanium surfaces was twice that attached to the as-polished titanium surfaces. The cells were larger with the cellular processes that stretched to a greater extent on the pFN- and Col-immobilized titanium surfaces than on the as-polished titanium surface (p < 0.05). HPDLCs on the Col-immobilized titanium surfaces showed more extensive expression of vinculin at the tips of cell projections and more contiguously along the cell outline than on the as-polished, GRGDS-immobilized and pFN-immobilized titanium surfaces. It was concluded that cell-adhesive molecules successfully immobilized on the titanium surface and improved the compatibility of the surface with HPDLCs. The Col-immobilized titanium surface could be used for forming ligament-like tissues around titanium dental implants.

  7. Induction of primary mixed leukocyte reactions with ultraviolet B or chemically modified stimulator cells

    SciTech Connect

    Mincheff, M.S.; Meryman, H.T. )

    1989-12-01

    Treatment of stimulator cells with paraformaldehyde for 60 sec or ultraviolet-B (UV-B) irradiation eliminates their ability to elicit T cell proliferation in a primary mixed leukocyte reaction. However, a T cell response equal to 20-40% of control value could be elicited by paraformaldehyde fixed or UV-B irradiated cells providing the latter are incubated at 37 degrees C for 18 hr prior to treatment. The incubation also induces a one-log increase in the density of fluorescence when the cells are stained with monoclonal antibodies against class II molecules DR and DP as well as the intercellular adhesion molecule -1. We interpret this as an increase in the membrane expression of these structures following incubation. Chloroquine and cerulenin, known to inhibit protein degradation and antigen processing and presentation do not influence the upregulation in membrane expression of these class II and adhesion molecules, but do prevent incubation from overriding the effect of paraformaldehyde treatment. Colchicine, which reduces the traffic through tubular lysosomes, also has no effect on the upregulation but enhances allopresentation. We propose that incubation of stimulator cells in the presence of chloroquine and cerulenin results in the membrane expression of class II molecules without associated peptides. The inability of stimulator cells expressing such nude MHC molecules to elicit T cell proliferation after chemical modification could be due to easier crosslinking of the allodeterminants by paraformaldehyde when the binding site is empty but could also mean that nude MHC molecules are not per se immunogenic and become so only after acquisition of a peptide. It is also possible that chloroquine, NH4Cl, and cerulenin block the expression of signals other than the class II and cell adhesion molecules that are essential for induction of T cell proliferation.

  8. Generation and screening of an oligonucleotide-encoded synthetic peptide library.

    PubMed Central

    Needels, M C; Jones, D G; Tate, E H; Heinkel, G L; Kochersperger, L M; Dower, W J; Barrett, R W; Gallop, M A

    1993-01-01

    We have prepared a library of approximately 10(6) different peptide sequences on small, spherical (10-microns diameter) beads by the combinatorial chemical coupling of both L- and D-amino acid building blocks. To each bead is covalently attached many copies of a single peptide sequence and, additionally, copies of a unique single-stranded oligonucleotide that codes for that peptide sequence. The oligonucleotide tags are synthesized through a parallel combinatorial procedure that effectively records the process by which the encoded peptide sequence is assembled. The collection of beads was screened for binding to a fluorescently labeled anti-peptide antibody using a fluorescence-activated cell sorting instrument. Those beads to which the antibody bound tightly were isolated by fluorescence-activated sorting, and the oligonucleotide identifiers attached to individual sorted beads were amplified by the PCR. Sequences of the amplified DNAs were determined to reveal the identity of peptide sequences that bound to the antibody with high affinity. By combining the capacity for information storage in an oligonucleotide code with the tremendous level of amplification possible through the PCR, we have devised a means for specifying the identity of each member of a vast library of molecules synthesized from both natural and unnatural chemical building blocks. In addition, we have shown that the use of flow cytometry instrumentation permits facile isolation of individual beads that bear high-affinity ligands for biological receptors. Images Fig. 2 PMID:7504279

  9. A chemically modified [alpha]-amylase with a molten-globule state has entropically driven enhanced thermal stability

    SciTech Connect

    Siddiqui, Khawar Sohail; Poljak, Anne; De Francisci, Davide; Guerriero, Gea; Pilak, Oliver; Burg, Dominic; Raftery, Mark J.; Parkin, Don M.; Trewhella, Jill; Cavicchioli, Ricardo

    2010-11-15

    The thermostability properties of TAA were investigated by chemically modifying carboxyl groups on the surface of the enzyme with AMEs. The TAA{sub MOD} exhibited a 200% improvement in starch-hydrolyzing productivity at 60 C. By studying the kinetic, thermodynamic and biophysical properties, we found that TAA{sub MOD} had formed a thermostable, MG state, in which the unfolding of the tertiary structure preceded that of the secondary structure by at least 20 C. The X-ray crystal structure of TAA{sub MOD} revealed no new permanent interactions (electrostatic or other) resulting from the modification. By deriving thermodynamic activation parameters of TAA{sub MOD}, we rationalised that thermostabilisation have been caused by a decrease in the entropy of the transition state, rather than being enthalpically driven. Far-UV CD shows that the origin of decreased entropy may have arisen from a higher helical content of TAA{sub MOD}. This study provides new insight into the intriguing properties of an MG state resulting from the chemical modification of TAA.

  10. A genotype of modified vaccinia Ankara (MVA) that facilitates replication in suspension cultures in chemically defined medium.

    PubMed

    Jordan, Ingo; Horn, Deborah; John, Katrin; Sandig, Volker

    2013-01-01

    While vectored vaccines, based on hyperattenuated viruses, may lead to new treatment options against infectious diseases and certain cancers, they are also complex products and sometimes difficult to provide in sufficient amount and purity. To facilitate vaccine programs utilizing host-restricted poxviruses, we established avian suspension cell lines (CR and CR.pIX) and developed a robust, chemically defined, culturing process for production of this class of vectors. For one prominent member, modified vaccinia Ankara (MVA), we now describe a new strain that appears to replicate to greater yields of infectious units, especially in the cell-free supernatant of cultures in chemically defined media. The new strain was obtained by repeated passaging in CR suspension cultures and, consistent with reports on the exceptional genetic stability of MVA, sequencing of 135 kb of the viral genomic DNA revealed that only three structural proteins (A3L, A9L and A34R) each carry a single amino acid exchange (H639Y, K75E and D86Y, respectively). Host restriction in a plaque-purified isolate of the new genotype appears to be maintained in cell culture. Processing towards an injectable vaccine preparation may be simplified with this strain as a complete lysate, containing the main burden of host cell contaminants, may not be required anymore to obtain adequate yields. PMID:23337383

  11. Development of pH Sensitive Nanoparticles for Intestinal Drug Delivery Using Chemically Modified Guar Gum Co-Polymer.

    PubMed

    Varma, Vegesna Naga Sravan Kumar; Shivakumar, Hosakote Gurumalappa; Balamuralidhara, Veerna; Navya, Manne; Hani, Umme

    2016-01-01

    The aim of the research work was to chemically modify guargum (GG) as a pH sensitive co-polymer and formulating intestinal targeting ESO nanoparticles (NPs) using the synthesized co-polymer. Poly acrylamide-grafted-guar gum (PAAm-g-GG) co-polymer was synthesized by free radical polymerization. Chemical modification of PAAm-g-GG by alkaline hydrolysis results in formation of a pH-sensitive co-polymer. The effect of GG and acryl amide (AAm) on grafting was studied. Esomeprazole magnesium (ESO) loaded pH sensitive NPs were prepared by nano-emulsification polymer crosslinking method and characterized. Sixteen formulations were prepared and the concentration of process variables wasvaried to obtain nanoparticles of 200-600 nm. The NPs were found to be homogenous in size distribution. The encapsulation efficiency and drug loading ranged from 33.2% to 50.1% and 12.2% to 17.2% respectively. Particle size, encapsulation efficiency and drug loading increasedalong with co-polymer concentration. In-vitro release studies at pH 1.2 for 2 h, followed by pH 6.8 showed that environment pH significantly affected the drug release. SEM has shown that NPsare spherical with smooth surface. The pH sensitive PAAm-g-GGNPs resisted the initial release of the drug from the drug loaded NPs in acidic pH and delayed the release process to a longer period in alkaline environment. PMID:27610149

  12. Phase Stability of Ce-Modified La2Zr2O7 Coatings and Chemical Compatibility with YSZ

    NASA Astrophysics Data System (ADS)

    Wu, Qiong; Ji, Xiaojuan; Peng, Haoran; Ren, Xianjing; Yu, Yueguang

    2016-04-01

    Ce-modified La2Zr2O7 powders, i.e., La2Zr2O7 (LZ), La2(Zr0.7Ce0.3)2O7 (LZ7C3), and La2(Zr0.3Ce0.7)2O7 (LZ3C7), were used to produce thermal barrier coatings by atmospheric plasma spray process. The chemical compatibility of the CeO2-doped La2Zr2O7 with the traditional YSZ was investigated in LZ-YSZ powder mixtures and LZ-YSZ bilayer coatings by x-ray diffraction and scanning electron microscope. The powder mixtures and coatings were aged at 1200 and 1300 °C for 100 h. The results showed that LZ and LZ7C3 presented single pyrochlore structure after the heat treatments at both 1200 and 1300 °C. For LZ3C7, however, fluorite structure was observed at 1300 °C, indicating a poor phase stability of LZ3C7 at the elevated temperature. The results further showed that La2(Zr0.3Ce0.7)2O7 reacted with YSZ in the bilayer ceramic coatings due to the diffusion of cerium, zirconium, and yttrium. While for La2Zr2O7(LZ) and La2(Zr0.7Ce0.3)2O7, a better chemical compatibility with YSZ was shown.

  13. Chemically modified nanoparticles surface for sensing bacterial loading--experimental study based on fluorescence stimulation by iron ions.

    PubMed

    Poiata, Antoniea; Creanga, Dorina E; Nadejde, Claudia; Fifere, Nicușor; Airinei, Anton

    2013-10-01

    The influence of iron ions supplied from magnetite nanoparticles with chemically modified surface on Pseudomonas aeruginosa germ was aimed--with experimental and theoretical approach of the intensity of the fluorescent signal emitted by the pyoverdine like siderophores. As the coated magnetic nanoparticles could function as probes, the possibility of designing a chemical device was considered based on the sensing of iron reduction from Fe(3+) into the more soluble Fe(2+), for detecting various levels of contamination (10 ÷ 10(8) cell/ml) of biological specimens and environmental samples. The proposed mathematical model estimated the fluorescence intensity due to siderophore synthesized by Pseudomonas, considering that the parameter describing the ion-bacteria interaction depends differently on the cell density for different magnetite nanoparticle coatings: linear dependence was found in the case of sodium oleate coating while power function was revealed for tetramethyl ammonium coating of magnetite nanocores, in both cases magnetite suspension being supplied in the same concentration (0.1 μl/ml). The calculated values of fluorescence intensity fitted the experimental data corresponding to magnetite supplied bacteria with graph slopes close to the unit and correlation coefficients of 0.999 and 0.996, while for the control samples, where that parameter was zeroed, correlation coefficient was found of 0.999. PMID:23186558

  14. Development of pH Sensitive Nanoparticles for Intestinal Drug Delivery Using Chemically Modified Guar Gum Co-Polymer

    PubMed Central

    Varma, Vegesna Naga Sravan Kumar; Shivakumar, Hosakote Gurumalappa; Balamuralidhara, Veerna; Navya, Manne; Hani, Umme

    2016-01-01

    The aim of the research work was to chemically modify guargum (GG) as a pH sensitive co-polymer and formulating intestinal targeting ESO nanoparticles (NPs) using the synthesized co-polymer. Poly acrylamide-grafted-guar gum (PAAm-g-GG) co-polymer was synthesized by free radical polymerization. Chemical modification of PAAm-g-GG by alkaline hydrolysis results in formation of a pH-sensitive co-polymer. The effect of GG and acryl amide (AAm) on grafting was studied. Esomeprazole magnesium (ESO) loaded pH sensitive NPs were prepared by nano-emulsification polymer crosslinking method and characterized. Sixteen formulations were prepared and the concentration of process variables wasvaried to obtain nanoparticles of 200-600 nm. The NPs were found to be homogenous in size distribution. The encapsulation efficiency and drug loading ranged from 33.2% to 50.1% and 12.2% to 17.2% respectively. Particle size, encapsulation efficiency and drug loading increasedalong with co-polymer concentration. In-vitro release studies at pH 1.2 for 2 h, followed by pH 6.8 showed that environment pH significantly affected the drug release. SEM has shown that NPsare spherical with smooth surface. The pH sensitive PAAm-g-GGNPs resisted the initial release of the drug from the drug loaded NPs in acidic pH and delayed the release process to a longer period in alkaline environment. PMID:27610149

  15. Biolubricant basestocks from chemically modified plant oils: ricinoleic acid based-tetraesters

    PubMed Central

    2013-01-01

    Background Plant oils have been investigated as a potential source of environmentally favorable biolubricants because of their biodegradability, renewability and excellent lubrication performance. Low oxidation and thermal stability, poor low-temperature properties and a narrow range of available viscosities, however, limit their potential application as industrial lubricants. The inherent problems of plant oils can be improved by attaching functional groups at the sites of unsaturation through chemical modifications. In this article, we will demonstrate how functionalization helps overcome these disadvantages. Results In this work, mono-, tri- and tetra-esters have been synthesized, including 10,12-dihydroxy-9-(stearoyloxy)octadecanoic acid 3; 9,10,12-tris(stearoyloxy)octadecanoic acid 4; and 18-(4-ethylhexyloxy)-18-oxooctadecane-7,9,10-triyl tristearate 5. Pour-point and cloud-point measurements have shown that these derivatives have improved low-temperature properties as compared to the precursor. The tetra ester compound, 18-(4-ethylhexyloxy)-18-oxooctadecane-7,9,10-triyl tristearate 5, had the lowest pour point (PP) (−44.37°C) and the lowest cloud point (CP) (−41.25°C). This derivatization also improved the compound’s thermo-oxidative stability, measured using pressurized differential scanning calorimetry (PDSC) and thin-film micro-oxidation (TFMO) testing. 18-(4-Ethylhexyloxy)-18-oxooctadecane-7,9,10-triyl tristearate 5 also had the highest onset temperature (OT) (282.10°C) and the lowest volatile loss and insoluble deposit (37.39% and 50.87%, respectively). Furthermore, the compounds’ tribological behaviors were evaluated using the four-ball method. 18-(4-Ethylhexyloxy)-18-oxooctadecane-7,9,10-triyl tristearate 5 also had the lowest coefficient of friction (μ) (0.44). Conclusions The results showed that, in general, these derivatives have good anti-wear and friction-reducing properties at relatively low concentrations under all of the test loads

  16. Electron Transfer Reactivity Patterns at Chemically Modified Electrodes: Fundamentals and Application to the Optimization of Redox Recycling Amplification Systems

    SciTech Connect

    Adam Johan Bergren

    2006-05-01

    Electroanalytical chemistry is often utilized in chemical analysis and Fundamental studies. Important advances have been made in these areas since the advent of chemically modified electrodes: the coating of an electrode with a chemical film in order to impart desirable, and ideally, predictable properties. These procedures enable the exploitation of unique reactivity patterns. This dissertation presents studies that investigate novel reaction mechanisms at self-assembled monolayers on gold. In particular, a unique electrochemical current amplification scheme is detailed that relies on a selective electrode to enable a reactivity pattern that results in regeneration of the analyte (redox recycling). This regenerating reaction can occur up to 250 times for each analyte molecule, leading to a notable enhancement in the observed current. The requirements of electrode selectivity and the resulting amplification and detection limit improvements are described with respect to the heterogeneous and homogeneous electron transfer rates that characterize the system. These studies revealed that the heterogeneous electrolysis of the analyte should ideally be electrochemically reversible, while that for the regenerating agent should be held to a low level. Moreover, the homogeneous reaction that recycles the analyte should occur at a rapid rate. The physical selectivity mechanism is also detailed with respect to the properties of the electrode and redox probes utilized. It is shown that partitioning of the analyte into/onto the adlayer leads to the extraordinary selectivity of the alkanethiolate monolayer modified electrode. Collectively, these studies enable a thorough understanding of the complex electrode mechanism required for successful redox recycling amplification systems, Finally, in a separate (but related) study, the effect of the akyl chain length on the heterogeneous electron transfer behavior of solution-based redox probes is reported, where an odd-even oscillation

  17. Generation of a C-3'-thymidinyl radical in single-stranded oligonucleotides under anaerobic conditions.

    PubMed

    Bryant-Friedrich, Amanda C

    2004-07-01

    [reaction: see text] A C-3'-thymidinyl radical has been photochemically generated site-specifically in DNA oligonucleotides. A nucleoside H-phosphonate bearing a C-3' acetyl group was incorporated into DNA oligomers using a hand-coupling technique. When nucleotides containing the modified monomer were photolyzed (> or =320 nm) in the presence of a hydrogen atom donor, reduction products were detected by RP-HPLC and MALDI-ToF MS analysis. PMID:15228271

  18. Fragmentation and reactivity in collisions of protonated diglycine with chemically modified perfluorinated alkylthiolate-self-assembled monolayer surfaces

    SciTech Connect

    Barnes, George L.; Yang Li; Hase, William L.; Young, Kelsey

    2011-03-07

    Direct dynamics simulations are reported for quantum mechanical (QM)/molecular mechanical (MM) trajectories of N-protonated diglycine (gly{sub 2}-H{sup +}) colliding with chemically modified perfluorinated octanethiolate self-assembled monolayer (SAM) surfaces. The RM1 semiempirical theory is used for the QM component of the trajectories. RM1 activation and reaction energies were compared with those determined from higher-level ab initio theories. Two chemical modifications are considered in which a head group (-COCl or -CHO) is substituted on the terminal carbon of a single chain of the SAM. These surfaces are designated as the COCl-SAM and CHO-SAM, respectively. Fragmentation, peptide reaction with the SAM, and covalent linkage of the peptide or its fragments with the SAM surface are observed. Peptide fragmentation via concerted CH{sub 2}-CO bond breakage is the dominant pathway for both surfaces. HCl formation is the dominant species produced by reaction with the COCl-SAM, while for the CHO-SAM a concerted H-atom transfer from the CHO-SAM to the peptide combined with either a H-atom or radical transfer from the peptide to the surface to form singlet reaction products is the dominant pathway. A strong collision energy dependence is found for the probability of peptide fragmentation, its reactivity, and linkage with the SAM. Surface deposition, i.e., covalent linkage between the surface and the peptide, is compared to recent experimental observations of such bonding by Laskin and co-workers [Phys. Chem. Chem. Phys. 10, 1512 (2008)]. Qualitative differences in reactivity are seen between the COCl-SAM and CHO-SAM showing that chemical identity is important for surface reactivity. The probability of reactive surface deposition, which is most closely analogous to experimental observables, peaks at a value of around 20% for a collision energy of 50 eV.

  19. Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

    PubMed Central

    Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

    2012-01-01

    In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

  20. Understanding oligonucleotide-mediated inhibition of gene expression in Xenopus laevis oocytes

    PubMed Central

    Bailey, Cheryl; Weeks, Daniel L.

    2000-01-01

    Triplex-forming oligonucleotides (TFOs) modified with N,N-diethylethylenediamine can inhibit the expression of a reporter plasmid in Xenopus oocytes if the triplex is preformed prior to injection while unmodified oligonucleotides cannot. Here we show that merely forming a triplex in a reporter plasmid does not disrupt transcription, but when TFOs are targeted to sites within the transcribed region of a reporter gene then gene activity is inhibited. TFO-based inhibition did not lead to large scale degradation or mutation of the reporter plasmid, but dramatically lowered mRNA levels. Finally, we investigated the accessibility of a triplex target site on a reporter plasmid after injection into nuclei. We found that the site used for our previous studies was inaccessible to restriction endonuclease after injection into nuclei. This observation may explain why inhibition was dependent on forming the triplex before injection into oocytes. Based on the assumption that oligonucleotide association, like restriction enzyme access, was excluded by nucleosome formation, additional target sites were inserted so that all sites could not simultaneously be associated with the octamer core of a nucleosome. With multiple target sites prior association of the plasmid with nuclear proteins does not prevent oligonucleotide-mediated inhibition of gene activity. PMID:10666457

  1. Circulation of oligonucleotides by disulfide bridge formation.

    PubMed Central

    Gao, H; Yang, M; Patel, R; Cook, A F

    1995-01-01

    An effective, convenient method for the circularization of oligonucleotides has been developed. This procedure involved preparation of an oligonucleotide with backbone-linked 5'- and 3'-terminal hexamethylenethiol groups, followed by oxidation of the thiol groups with air of oxygen to produce the corresponding circular sequence bridged via a bis(hexamethylene)-disulfide moiety. The method has been applied to the circularization of oligodeoxynucleotide sequences of varying lengths (5, 10, 15, 20, 30 and 40 bases), and the circularization process was highly efficient as shown by HPLC or gel electrophoresis of the crude reaction mixtures. Competing reactions such as dimerization were not significant except for the longer sequences (30 and 40 bases). The circularization of an eight base RNA sequence was also accomplished, as well as hexa-ethylene glycol bridged poly-T sequences capable of triplex formation. PMID:7596832

  2. DNA analysis and diagnostics on oligonucleotide microchips.

    PubMed Central

    Yershov, G; Barsky, V; Belgovskiy, A; Kirillov, E; Kreindlin, E; Ivanov, I; Parinov, S; Guschin, D; Drobishev, A; Dubiley, S; Mirzabekov, A

    1996-01-01

    We present a further development in the technology of sequencing by hybridization to oligonucleotide microchips (SHOM) and its application to diagnostics for genetic diseases. A robot has been constructed to manufacture sequencing "microchips." The microchip is an array of oligonucleotides immobilized into gel elements fixed on a glass plate. Hybridization of the microchip with fluorescently labeled DNA was monitored in real time simultaneously for all microchip elements with a two-wavelength fluorescent microscope equipped with a charge-coupled device camera. SHOM has been used to detect beta-thalassemia mutations in patients by hybridizing PCR-amplified DNA with the microchips. A contiguous stacking hybridization technique has been applied for the detection of mutations; it can simplify medical diagnostics and enhance its reliability. The use of multicolor monitoring of contiguous stacking hybridization is suggested for large-scale diagnostics and gene polymorphism studies. Other applications of the SHOM technology are discussed. Images Fig. 2 Fig. 3 Fig. 4 PMID:8643503

  3. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  4. Effect of chemical sanitizer combined with modified atmosphere packaging on inhibiting Escherichia coli O157:H7 in commercial spinach.

    PubMed

    Lee, Sun-Young; Baek, Seung-Youb

    2008-06-01

    Escherichia coli O157:H7 contaminated spinach has recently caused several outbreaks of human illness in the USA and Canada. However, to date, there has been no study demonstrating an effective way to eliminate E. coli O157:H7 in spinach. Therefore, this study was conducted to investigate the effect of chemical sanitizers alone or in combination with packaging methods such as vacuum and modified atmosphere packaging (MAP) on inactivating E. coli O157:H7 in spinach during storage time. Spinach inoculated with E. coli O157:H7 was packaged in four different methods (air, vacuum, N(2) gas, and CO(2) gas packaging) following treatment with water, 100 ppm chlorine dioxide, or 100 ppm sodium hypochlorite for 5 min at room temperature and stored at 7+/-2 degrees C. Treatment with water did not significantly reduce levels of E. coli O157:H7 in spinach. However, treatment with chlorine dioxide and sodium hypochlorite significantly decreased levels of E. coli O157:H7 by 2.6 and 1.1 log(10)CFU/g, respectively. Levels of E. coli O157:H7 in samples packaged in air following treatments grew during storage time, whereas levels were maintained in samples packaged in other packaging methods (vacuum, N(2) gas, and CO(2) gas packaging). Therefore there were significant differences (about 3-4 log) of E. coli O157:H7 populations between samples packed in air and other packaging methods following treatment with chemical sanitizers after 7 days storage. These results suggest that the combination of treatment with chlorine dioxide and packaging methods such as vacuum and MAP may be useful for improving the microbial safety of spinach against E. coli O157:H7 during storage. PMID:18456113

  5. The effect of different annealing temperatures on tin and cadmium telluride phases obtained by a modified chemical route

    SciTech Connect

    Mesquita, Anderson Fuzer; Porto, Arilza de Oliveira; Magela de Lima, Geraldo; Paniago, Roberto; Ardisson, José Domingos

    2012-11-15

    Graphical abstract: Display Omitted Highlights: ► Synthesis of cadmium and tin telluride. ► Chemical route to obtain pure crystalline cadmium and tin telluride. ► Effect of the annealing temperature on the crystalline phases. ► Removal of tin oxide as side product through thermal treatment. -- Abstract: In this work tin and cadmium telluride were prepared by a modification of a chemical route reported in the literature to obtain metallacycles formed by oxidative addition of tin-tellurium bonds to platinum (II). Through this procedure it was possible to obtain tin and cadmium telluride. X-ray diffraction and X-ray photoelectron spectroscopy were used to identify the crystalline phases obtained as well as the presence of side products. In the case of tin telluride it was identified potassium chloride, metallic tellurium and tin oxide as contaminants. The tin oxidation states were also monitored by {sup 119}Sn Mössbauer spectroscopy. The annealing in hydrogen atmosphere was chosen as a strategy to reduce the tin oxide and promote its reaction with the excess of tellurium present in the medium. The evolution of this tin oxide phase was studied through the annealing of the sample at different temperatures. Cadmium telluride was obtained with high degree of purity (98.5% relative weight fraction) according to the Rietveld refinement of X-ray diffraction data. The modified procedure showed to be very effective to obtain amorphous tin and cadmium telluride and the annealing at 450 °C has proven to be useful to reduce the amount of oxide produced as side product.

  6. Hybridization specificity, enzymatic activity and biological (Ha-ras) activity of oligonucleotides containing 2,4-dideoxy-beta-D-erythro-hexopyranosyl nucleosides.

    PubMed Central

    Augustyns, K; Godard, G; Hendrix, C; Van Aerschot, A; Rozenski, J; Saison-Behmoaras, T; Herdewijn, P

    1993-01-01

    Antisense oligonucleotides with a 2,4-dideoxyhexopyranosyl nucleoside incorporated at the 3'-end and at a mutation site of the Ha-ras oncogene mRNA were synthesized. Melting temperature studies revealed that an A*-G mismatch is more stable than an A*-T mismatch with these hexopyranosyl nucleosides incorporated at the mutation site. The oligonucleotides are stable against enzymatic degradation. RNase H mediated cleavage studies revealed selective cleavage of mutated Ha-ras mRNA. The oligonucleotide containing two pyranose nucleosides at the penultimate position activates RNase H more strongly than natural oligonucleotides. No correlation, however, was found between DNA - DNA or RNA - DNA melting temperatures and RNase H mediated cleavage capacity. Although the A*-G mismatch gives more stable hybridization than the A*-T base pairing, only the oligonucleotides containing an A*-T base pair are recognized by RNase H. This modification is situated 3 base pairs upstream to the cleavage site. Finally, the double pyranose modified oligonucleotide was able to reduce the growth of T24 cells (bladder carcinoma) while the unmodified antisense oligonucleotide was not. Images PMID:7694231

  7. The use of chemically modified and unmodified cassava waste for the removal of Cd, Cu and Zn ions from aqueous solution.

    PubMed

    Abia, A A; Horsfall, M; Didi, O

    2003-12-01

    The use of different chemically modified cassava waste biomass for the enhancement of the adsorption of three metal ions Cd, Cu and Zn from aqueous solution is reported in this paper. Treating with different concentrations of thioglycollic acid modified the cassava waste biomass. The sorption rates of the three metals were 0.2303 min(-1) (Cd(2+)), 0.0051 min(-1) (Cu(2+)), 0.0040 min(-1) (Zn(2+)) and 0.109 min(-1) (Cd(2+)), 0.0069 min(-1) (Cu(2+)), 0.0367 min(-1) (Zn(2+)) for 0.5 and 1.00 M chemically modified levels, respectively. The adsorption rates were quite rapid and within 20-30 min of mixing, about 60-80% of these ions were removed from the solutions by the biomass and that chemically modifying the binding groups in the biomass enhanced its adsorption capacity towards the three metals. The results further showed that increased concentration of modifying reagent led to increased incorporation, or availability of more binding groups, in the biomass matrix, resulting in improved adsorptivity of the cassava waste biomass. The binding capacity study showed that the cassava waste, which is a serious environmental nuisance, due to foul odour released during decomposition, has the ability to adsorb trace metals from solutions. PMID:14575960

  8. Taq DNA Polymerase Mutants and 2'-Modified Sugar Recognition.

    PubMed

    Schultz, Hayley J; Gochi, Andrea M; Chia, Hannah E; Ogonowsky, Alexie L; Chiang, Sharon; Filipovic, Nedim; Weiden, Aurora G; Hadley, Emma E; Gabriel, Sara E; Leconte, Aaron M

    2015-09-29

    Chemical modifications to DNA, such as 2' modifications, are expected to increase the biotechnological utility of DNA; however, these modified forms of DNA are limited by their inability to be effectively synthesized by DNA polymerase enzymes. Previous efforts have identified mutant Thermus aquaticus DNA polymerase I (Taq) enzymes capable of recognizing 2'-modified DNA nucleotides. While these mutant enzymes recognize these modified nucleotides, they are not capable of synthesizing full length modified DNA; thus, further engineering is required for these enzymes. Here, we describe comparative biochemical studies that identify useful, but previously uncharacterized, properties of these enzymes; one enzyme, SFM19, is able to recognize a range of 2'-modified nucleotides much wider than that previously examined, including fluoro, azido, and amino modifications. To understand the molecular origins of these differences, we also identify specific amino acids and combinations of amino acids that contribute most to the previously evolved unnatural activity. Our data suggest that a negatively charged amino acid at 614 and mutation of the steric gate residue, E615, to glycine make up the optimal combination for modified oligonucleotide synthesis. These studies yield an improved understanding of the mutational origins of 2'-modified substrate recognition as well as identify SFM19 as the best candidate for further engineering, whether via rational design or directed evolution. PMID:26334839

  9. Distribution of phosphorus and hydroxypropyl groups within granules of modified sweet potato starches as determined after chemical peeling.

    PubMed

    Zhao, Jianwei; Schols, Henk A; Chen, Zhenghong; Jin, Zhengyu; Buwalda, Piet; Gruppen, Harry

    2015-11-01

    The distributions of phosphorus and hydroxypropyl groups within granules of cross-linked and hydroxypropylated sweet potato starches were investigated. Chemical surface peeling of starch granules was performed after sieving of native and modified starches into large-size (diameter ≥ 20 μm) and small-size (diameter < 20 μm) fractions. Starch granules were surface gelatinized in a 4M calcium chloride solution at different levels. After the peeling step, the remaining starch granules were analysed for the content of phosphorus and hydroxypropyl groups. The phosphorus level of the parental starch gradually decreased from periphery to core of the granules. The increase in phosphorus content after cross-linking in periphery was higher than that in core. The subsequent hydroxypropylation reaction resulted in lower phosphate levels. Hydroxypropylation resulted in a gradient of hydroxypropyl group concentration from periphery to core. Cross-linking prior to the hydroxypropylation resulted in lower levels of hydroxypropyl groups and less pronounced differences between periphery and core. PMID:26256390

  10. Large-Area Chemically Modified Graphene Films: Electrophoretic Deposition and Characterization by Soft X-ray Absorption Spectroscopy

    SciTech Connect

    Lee, V.; Whittaker, L; Jaye, C; Baroudi, K; Fischer, D; Banerjee, S

    2009-01-01

    A facile, rapid, and scalable electrophoretic deposition approach is developed for the fabrication of large-area chemically derived graphene films on conductive substrates based on the electrophoretic deposition of graphene oxide and reduced graphene oxide components. Two distinctive approaches for fabricating conformal graphene films are developed. In the first approach, graphene oxide sheets are electrophoretically deposited from an aqueous solution after the oxidation of graphite to graphite oxide and the subsequent exfoliation of graphite oxide to graphene oxide. Next, the graphene oxide films are reduced via dip-coating in an aqueous solution of hydrazine. In the second approach, graphene oxide is reduced to graphene nanosheets in a strongly alkaline solution and the reduced graphene sheets are directly electrophoretically deposited onto conductive substrates. The film thickness can be modified by the deposition time and the obtained films span several square millimeters in area. Near-edge X-ray absorption fine structure (NEXAFS) spectroscopy is used to study the surface chemistry, electronic band structure, and degree of alignment of the electrophoretically deposited films. Polarized NEXAFS measurements verify the presence of epoxide surface functionalities on the graphene basal planes and indicate significant recovery of extended p-bonded networks upon defunctionalization by hydrazine treatment. These measurements further indicate significantly improved alignment of the graphene sheet components of the films parallel to the substrate surface when defunctionalization is performed prior to electrophoretic deposition.

  11. Control of growth and squamous differentiation in normal human bronchial epithelial cells by chemical and biological modifiers and transferred genes

    SciTech Connect

    Pfeifer, A.M.; Lechner, J.F.; Masui, T.; Reddel, R.R.; Mark, G.E.; Harris, C.C.

    1989-03-01

    The majority of human lung cancers arise from bronchial epithelial cells. The normal pseudostratified bronchial epithelium is composed of basal, mucous, and ciliated cells. This multi-differentiated epithelium usually responds to xenobiotics and physical injury by undergoing basal cell hyperplasia, mucous cell hyperplasia, and squamous metaplasia. One step of the multistage process of carcinogenesis is thought to involve aberrations in control of the squamous metaplastic processes. Decreased responsiveness to regulators of terminal squamous differentiation may confer a selective clonal expansion advantage to an initiated cell. We studied the effects of endogenous (e.g., transforming growth factor beta 1 (TGF-beta 1) and serum) and exogenous (e.g., 12-O-tetradecanoyl-13-phorbol-acetate (TPA), tobacco smoke condensate, and aldehydes) modifiers of normal human bronchial epithelial (NHBE) cell in a serum-free culture system. NHBE cells are growth inhibited by all of these compounds and induced to undergo squamous differentiation by TGF-beta 1 or TPA. In contrast, lung carcinoma cell lines are relatively resistant to inducers of terminal squamous differentiation which may provide them with a selective growth advantage. Chemical agents and activated protooncogenes (ras,raf,myc) altered the response to endogenous and exogenous inducers of squamous differentiation and caused extended cellular lifespan, aneuploidy, and/or tumorigenicity. The data suggest a close relationship between dysregulation of terminal differentiation pathways and neoplastic transformation of human bronchial epithelial cells.

  12. Chemical composition and selected mechanical properties of Al-Zn alloy modified in plasma conditions by RF CVD

    NASA Astrophysics Data System (ADS)

    Kyzioł, Karol; Kluska, Stanisława; Januś, Marta; Środa, Marcin; Jastrzębski, Witold; Kaczmarek, Łukasz

    2014-08-01

    The paper reports results of the study of surface composition and selected functional properties of 7075 (Al-Zn) alloys modified in Ar, N2, SiH4 and CH4 atmosphere at reduced pressure. RF CVD (Radio Frequency Chemical Vapour Deposition) technique was used in the study. The type or weight percentage of carbon in each modification varied in the resultant SiN:H and SiCN:H coatings. Alloy samples were treated with Ar+ plasma etching and N+ ion implantation at reduced pressure. The tests proved the values of selected mechanical properties (hardness ca. 10.5 GPa, Young modulus ca. 95 GPa) and adhesion (delamination force ca. 11.5 mN) to be higher in the case of SiCN:H anti-wear coating (deposited in SiH4:CH4:N2 = 1:1:2 gas mixture) than the values of the respective parameters obtained in the remaining modifications. Further, carbon doped coatings (SiCN:H) exhibited significantly improved hardness (by about 50 to 70%) and nearly threefold increase in delamination force in comparison with SiCN:H coatings.

  13. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  14. PepFect15, a novel endosomolytic cell-penetrating peptide for oligonucleotide delivery via scavenger receptors.

    PubMed

    Lindberg, Staffan; Muñoz-Alarcón, Andrés; Helmfors, Henrik; Mosqueira, Diogo; Gyllborg, Daniel; Tudoran, Oana; Langel, Ulo

    2013-01-30

    Gene-regulatory biomolecules such as splice-correcting oligonucleotides and anti-microRNA oligonucleotides are important tools in the struggle to understand and treat genetic disorders caused by defective gene expression or aberrant splicing. However, oligonucleotides generally suffer from low bioavailability, hence requiring efficient and non-toxic delivery vectors to reach their targets. Cell-penetrating peptides constitute a promising category of carrier molecules for intracellular delivery of bioactive cargo. In this study we present a novel cell-penetrating peptide, PepFect15, comprising the previously reported PepFect14 peptide modified with endosomolytic trifluoromethylquinoline moieties to facilitate endosomal escape. Pepfect15 efficiently delivers both splice-correcting oligonucleotides and anti-microRNA oligonucleotides into cells through a non-covalent complexation strategy. To our knowledge this is the first work that describes peptide-mediated anti-microRNA delivery. The peptide and its cargo form stable, negatively charged nanoparticles that are taken up by cells largely through scavenger receptor type A mediated endocytosis. PMID:23200958

  15. In situ Synthesis of Oligonucleotide Arrays on Surfaces Coated with Crosslinked Polymer Multilayers.

    PubMed

    Broderick, Adam H; Lockett, Matthew R; Buck, Maren E; Yuan, Yuan; Smith, Lloyd M; Lynn, David M

    2012-03-13

    We report an approach to the in situ synthesis of oligonucleotide arrays on surfaces coated with crosslinked polymer multilayers. Our approach makes use of methods for the 'reactive' layer-by-layer assembly of thin, amine-reactive multilayers using branched polyethyleneimine (PEI) and the azlactone-functionalized polymer poly(2-vinyl-4,4'-dimethylazlactone) (PVDMA). Post-fabrication treatment of film-coated glass substrates with d-glucamine or 4-amino-1-butanol yielded hydroxyl-functionalized films suitable for the Maskless Array Synthesis (MAS) of oligonucleotide arrays. Glucamine-functionalized films yielded arrays of oligonucleotides with fluorescence intensities and signal-to-noise ratios (after hybridization with fluorescently labeled complementary strands) comparable to those of arrays fabricated on conventional silanized glass substrates. These arrays could be exposed to multiple hybridization-dehybridization cycles with only moderate loss of hybridization density. The versatility of the layer-by-layer approach also permitted synthesis directly on thin sheets of film-coated poly(ethylene terephthalate) (PET) to yield flexible oligonucleotide arrays that could be readily manipulated (e.g., bent) and cut into smaller arrays. To our knowledge, this work presents the first use of polymer multilayers as a substrate for the multi-step synthesis of complex molecules. Our results demonstrate that these films are robust and able to withstand the ~450 individual chemical processing steps associated with MAS (as well as manipulations required to hybridize, image, and dehybridize the arrays) without large-scale cracking, peeling, or delamination of the thin films. The combination of layer-by-layer assembly and MAS provides a means of fabricating functional oligonucleotide arrays on a range of different materials and substrates. This approach may also prove useful for the fabrication of supports for the solid-phase synthesis and screening of other macromolecular or small

  16. Generating a synthetic genome by whole genome assembly: φX174 bacteriophage from synthetic oligonucleotides

    PubMed Central

    Smith, Hamilton O.; Hutchison, Clyde A.; Pfannkoch, Cynthia; Venter, J. Craig

    2003-01-01

    We have improved upon the methodology and dramatically shortened the time required for accurate assembly of 5- to 6-kb segments of DNA from synthetic oligonucleotides. As a test of this methodology, we have established conditions for the rapid (14-day) assembly of the complete infectious genome of bacteriophage φX174 (5,386 bp) from a single pool of chemically synthesized oligonucleotides. The procedure involves three key steps: (i) gel purification of pooled oligonucleotides to reduce contamination with molecules of incorrect chain length, (ii) ligation of the oligonucleotides under stringent annealing conditions (55°C) to select against annealing of molecules with incorrect sequences, and (iii) assembly of ligation products into full-length genomes by polymerase cycling assembly, a nonexponential reaction in which each terminal oligonucleotide can be extended only once to produce a full-length molecule. We observed a discrete band of full-length assemblies upon gel analysis of the polymerase cycling assembly product, without any PCR amplification. PCR amplification was then used to obtain larger amounts of pure full-length genomes for circularization and infectivity measurements. The synthetic DNA had a lower infectivity than natural DNA, indicating approximately one lethal error per 500 bp. However, fully infectious φX174 virions were recovered after electroporation into Escherichia coli. Sequence analysis of several infectious isolates verified the accuracy of these synthetic genomes. One such isolate had exactly the intended sequence. We propose to assemble larger genomes by joining separately assembled 5- to 6-kb segments; ≈60 such segments would be required for a minimal cellular genome. PMID:14657399

  17. Impact of chemically-modified tetracycline 3 on intertwined physiological, biochemical, and inflammatory networks in porcine sepsis/ARDS

    PubMed Central

    Sadowsky, David; Nieman, Gary; Barclay, Derek; Mi, Qi; Zamora, Ruben; Constantine, Gregory; Golub, Lorne; Lee, Hsi-Ming; Roy, Shreyas; Gatto, Louis A; Vodovotz, Yoram

    2015-01-01

    Sepsis can lead to multiple organ dysfunction, including the Acute Respiratory Distress Syndrome (ARDS), due to intertwined, dynamic changes in inflammation and organ physiology. We have demonstrated the efficacy of Chemically-Modified Tetracycline 3 (CMT-3) at reducing inflammation and ameliorating pathophysiology in the setting of a clinically realistic porcine model of ARDS. Here, we sought to gain insights into the derangements that characterize sepsis/ARDS and the possible impact of CMT-3 thereon, by combined experimental and computational studies. Two groups of anesthetized, ventilated pigs were subjected to experimental sepsis via placement of a peritoneal fecal clot and intestinal ischemia/reperfusion by clamping the superior mesenteric artery for 30 min. The treatment group (n = 3) received CMT-3 at 1 hour after injury (T1), while the control group (n = 3) received a placebo. Multiple inflammatory mediators, along with clinically relevant physiologic and blood chemistry variables, were measured serially until death of the animal or T48. Principal Component Analysis (PCA) and Dynamic Bayesian Network (DBN) inference were used to relate these variables. PCA revealed a separation of cardiac and pulmonary physiologic variables by principal component, and a decreased rank of oxygen index and arterial PO2/FiO2 ratio in the treatment group compared to control. DBN suggested a conserved network structure in both control and CMT-3 animals: a response driven by positive feedback between interleukin-6 and lung dysfunction. Resulting networks further suggested that in control animals, acute kidney injury, acidosis, and respiratory failure play an increased role in the response to insult compared to CMT-3 animals. These combined in vivo and in silico studies in a high fidelity, clinically applicable animal model suggest a dynamic interplay between inflammatory, physiologic, and blood chemistry variables in the setting of sepsis and ARDS that may be dramatically altered

  18. Chemically modified RNA induces osteogenesis of stem cells and human tissue explants as well as accelerates bone healing in rats.

    PubMed

    Balmayor, Elizabeth R; Geiger, Johannes P; Aneja, Manish K; Berezhanskyy, Taras; Utzinger, Maximilian; Mykhaylyk, Olga; Rudolph, Carsten; Plank, Christian

    2016-05-01

    Limitations associated to the use of growth factors represent a major hurdle to musculoskeletal regeneration. On the one hand, they are needed to induce neo-tissue formation for the substitution of a necrotic or missing tissue. On the other hand, these factors are used in supraphysiological concentrations, are short lived and expensive and result in many side effects. Here we develop a gene transfer strategy based on the use of chemically modified mRNA (cmRNA) coding for human bone morphogenetic protein 2 (hBMP-2) that is non-immunogenic and highly stable when compared to unmodified mRNA. Transfected stem cells secrete hBMP-2, show elevated alkaline phosphatase levels and upregulated expression of RunX2, ALP, Osterix, Osteocalcin, Osteopontin and Collagen Type I genes. Mineralization was induced as seen by positive Alizarin red staining. hBMP-2 cmRNA transfected human fat tissue also yielded an osteogenic response in vitro as indicated by expression of hBMP-2, RunX2, ALP and Collagen Type I. Delivering hBMP-2 cmRNA to a femur defect in a rat model results in new bone tissue formation as early as 2 weeks after application of very low doses. Overall, our studies demonstrate the feasibility and therapeutic potential of a new cmRNA-based gene therapy strategy that is safe and efficient. When applied clinically, this approach could overcome BMP-2 growth factor associated limitations in bone regeneration. PMID:26923361

  19. A Standardized Chemically Modified Curcuma longa Extract Modulates IRAK-MAPK Signaling in Inflammation and Potentiates Cytotoxicity.

    PubMed

    Rana, Minakshi; Maurya, Preeti; Reddy, Sukka S; Singh, Vishal; Ahmad, Hafsa; Dwivedi, Anil K; Dikshit, Madhu; Barthwal, Manoj K

    2016-01-01

    The TLR/IL-1R pathway is a critical signaling module that is misregulated in pathologies like inflammation and cancer. Extracts from turmeric (Curcuma longa L.) enriched in curcumin and carbonyls like turmerones have been shown to exert potent anti-inflammatory effects. The present study evaluated the anti-inflammatory activity, cytotoxic effect and the underlying mechanism of a novel chemically modified, non-carbonyl compound enriched Curcuma longa L. (C. longa) extract (CMCE). CMCE (1 or 10 μg/mL; 14 h) significantly decreased LPS (50-100 ng/mL) induced TNF-α and IL-1β production in THP-1 cells, human, and mouse whole blood as measured by ELISA. LPS-induced IRAK1, MAPK activation, TLR4 expression, TLR4-MyD88 interaction, and IκBα degradation were significantly reduced in CMCE pre-treated THP-1 cells as assessed by Western blotting. CMCE (30, 100, and 300 mg/kg; 10 days p.o.) pre-treated and LPS (10 mg/kg) challenged Swiss mice exhibited attenuated plasma TNF-α, IL-1β, nitrite, aortic iNOS expression, and vascular dysfunction. In a PI permeability assay, cell lines derived from acute myeloid leukemia were most sensitive to the cytotoxic effects of CMCE. Analysis of Sub-G1 phase, Annexin V-PI positivity, loss of mitochondrial membrane potential, increased caspase-3, and PARP-1 activation confirmed CMCE induced apoptosis in HL-60 cells. IRAK inhibition also sensitized HL-60 cells to CMCE induced cytotoxicity. The present study defines the mechanism underlying the action of CMCE and suggests a therapeutic potential for its use in sepsis and leukemia. PMID:27504095

  20. Cytotoxic activity and inhibition of tumor cell invasion by derivatives of a chemically modified tetracycline CMT-3 (COL-3).

    PubMed

    Lokeshwar, B L; Escatel, E; Zhu, B

    2001-02-01

    Tetracyclines such as chlortetracycline and doxycycline with antimicrobial activity were reported to possess cytostatic and cytotoxic activity against mammalian tumor cells, often at high doses. Non-antimicrobial chemically modified tetracyclines (CMTs), with limited systemic toxicity but with significant tumor cell toxicity and antimetastatic activity, are attractive for long term treatment for cancer. We recently reported one such CMT, 6-deoxy,6-demethyl 4-dedimethylamino tetracycline (CMT-3) is a potent anti-tumor and anti-metastatic drug. Here we report on the anti-cell proliferation and anti-invasive activity of five nitro derivatives of CMT-3 (CMT-3N). All the five CMT-3Ns (CMT-302, CMT-303, CMT-306, CMT-308 and CMT-316) inhibited in vitro cell proliferation of prostate cancer cells. The 50% growth inhibition concentration (IC(50)) of CMT-3Ns was similar to that of CMT-3. Although CMT-3 was by far the most potent anti-cell proliferation drug, all CMT-3Ns except CMT-303 and CMT-308 had similar anti-cell proliferation activity (IC(50): 2.5 -5.7 microg/ml). IC(50)s for CMT-303 and CMT-308 were approximately 8.1 and -12.4 microg/ml, respectively. Activity against tumor cell invasion was tested in vitro using the Matrigel invasion assay. All CMT-3Ns had similar anti- invasive activity. While cytotoxic activity of CMT-3 was strongly associated with cell death-effector caspase activation, mitochondrial permeablization and apoptosis, the CMT-3Ns weakly induced apoptosis and did not activate Caspase-3. However, the CMT-3Ns were able to induce mitochondrial permeabilization. This dichotomous mechanism of cytotoxic activity of CMTs may have significance in their selection for clinical application. PMID:11172682

  1. A Standardized Chemically Modified Curcuma longa Extract Modulates IRAK-MAPK Signaling in Inflammation and Potentiates Cytotoxicity

    PubMed Central

    Rana, Minakshi; Maurya, Preeti; Reddy, Sukka S.; Singh, Vishal; Ahmad, Hafsa; Dwivedi, Anil K.; Dikshit, Madhu; Barthwal, Manoj K.

    2016-01-01

    The TLR/IL-1R pathway is a critical signaling module that is misregulated in pathologies like inflammation and cancer. Extracts from turmeric (Curcuma longa L.) enriched in curcumin and carbonyls like turmerones have been shown to exert potent anti-inflammatory effects. The present study evaluated the anti-inflammatory activity, cytotoxic effect and the underlying mechanism of a novel chemically modified, non-carbonyl compound enriched Curcuma longa L. (C. longa) extract (CMCE). CMCE (1 or 10 μg/mL; 14 h) significantly decreased LPS (50-100 ng/mL) induced TNF-α and IL-1β production in THP-1 cells, human, and mouse whole blood as measured by ELISA. LPS-induced IRAK1, MAPK activation, TLR4 expression, TLR4-MyD88 interaction, and IκBα degradation were significantly reduced in CMCE pre-treated THP-1 cells as assessed by Western blotting. CMCE (30, 100, and 300 mg/kg; 10 days p.o.) pre-treated and LPS (10 mg/kg) challenged Swiss mice exhibited attenuated plasma TNF-α, IL-1β, nitrite, aortic iNOS expression, and vascular dysfunction. In a PI permeability assay, cell lines derived from acute myeloid leukemia were most sensitive to the cytotoxic effects of CMCE. Analysis of Sub-G1 phase, Annexin V-PI positivity, loss of mitochondrial membrane potential, increased caspase-3, and PARP-1 activation confirmed CMCE induced apoptosis in HL-60 cells. IRAK inhibition also sensitized HL-60 cells to CMCE induced cytotoxicity. The present study defines the mechanism underlying the action of CMCE and suggests a therapeutic potential for its use in sepsis and leukemia. PMID:27504095

  2. Optically Triggered Immune Response through Photocaged Oligonucleotides

    PubMed Central

    Govan, Jeane M.; Young, Douglas D.; Lively, Mark O.

    2015-01-01

    Bacterial and viral CpG oligonculeotides are unmethylated cytosine-phosphate-guanosine dinucleotide sequences and trigger an innate immune response through activation of the toll-like receptor 9 (TLR9). We have developed synthetic photocaged CpGs via site-specific incorporation of nitropiperonyloxymethyl (NPOM)-caged thymidine residues. These oligonucleotides enable the optical control of TLR9 function and thereby provide light-activation of an immune response. We provide a proof-of-concept model by applying a reporter assay in live cells and by quantification of endogenous production of interleukin 6. PMID:26034339

  3. Terahertz spectroscopy of oligonucleotides in aqueous solutions.

    PubMed

    Tang, Mingjie; Huang, Qing; Wei, Dongshan; Zhao, Guozhong; Chang, Tianying; Kou, Kuan; Wang, Min; Du, Chunlei; Fu, Wei-ling; Cui, Hong-Liang

    2015-01-01

    A terahertz (THz) spectroscopic study is carried out to analyze DNA mutations in a label-free manner. Three newly designed liquid sample cells are considered and the best is selected as the sample carrier for THz transmission spectroscopic analyses. Discrimination based on spectral signatures of single-base mutations on single-stranded 20 nt oligonucleotides has been shown possible experimentally. The results clearly attest the ability of this promising approach for label-free analyses of single-base mutations of DNA molecules. This study has demonstrated that the THz spectroscopic technology can be considered as a potential diagnostic tool for investigating molecular reactions, such as DNA mutations. PMID:26385423

  4. Empirical Calculations of {sup 29}Si NMR Chemical Shielding Tensors: A Partial Charge Model Investigation of Hydrolysis in Organically Modified Alkoxy Silanes

    SciTech Connect

    Alam, Todd M.; Henry, Marc

    1999-08-05

    Organically modified alkoxy silanes play an important role in tailoring different properties of silica produced by the sol-gel method. Changes in the size and functionality of the organic group allows control of both physical and chemical properties of the resulting gel, with the kinetics of the polymerization process playing an important role in the design of new siloxane materials. High resolution {sup 29}Si NMR has proven to be valuable tool for monitoring the polymerization reaction, and has been used to investigate a variety of organically modified alkoxy silane systems.

  5. Activation of the ERK1/2 Signaling Pathway during the Osteogenic Differentiation of Mesenchymal Stem Cells Cultured on Substrates Modified with Various Chemical Groups

    PubMed Central

    He, Jin; Li, Yan-Shu; Wang, Xiu-Mei; Ai, Hong-Jun; Cui, Fu-Zhai

    2013-01-01

    The current study examined the influence of culture substrates modified with the functional groups –OH, –COOH, –NH2, and –CH3 using SAMs technology, in conjunction with TAAB control, on the osteogenic differentiation of rabbit BMSCs. The CCK-8 assay revealed that BMSCs exhibited substrate-dependent cell viability. The cells plated on –NH2- and –OH-modified substrates were well spread and homogeneous, but those on the –COOH- and –CH3-modified substrates showed more rounded phenotype. The mRNA expression of BMSCs revealed that –NH2-modified substrate promoted the mRNA expression and osteogenic differentiation of the BMSCs. The contribution of ERK1/2 signaling pathway to the osteogenic differentiation of BMSCs cultured on the –NH2-modified substrate was investigated in vitro. The –NH2-modified substrate promoted the expression of integrins; the activation of FAK and ERK1/2. Inhibition of ERK1/2 activation by PD98059, a specific inhibitor of the ERK signaling pathway, blocked ERK1/2 activation in a dose-dependent manner, as revealed for expression of Cbfα-1 and ALP. Blockade of ERK1/2 phosphorylation in BMSCs by PD98059 suppressed osteogenic differentiation on chemical surfaces. These findings indicate a potential role for ERK in the osteogenic differentiation of BMSCs on surfaces modified by specific chemical functional groups, indicating that the microenvironment affects the differentiation of BMSCs. This observation has important implications for bone tissue engineering. PMID:24069599

  6. Self-Assembly into Nanoparticles Is Essential for Receptor Mediated Uptake of Therapeutic Antisense Oligonucleotides.

    PubMed

    Ezzat, Kariem; Aoki, Yoshitsugu; Koo, Taeyoung; McClorey, Graham; Benner, Leif; Coenen-Stass, Anna; O'Donovan, Liz; Lehto, Taavi; Garcia-Guerra, Antonio; Nordin, Joel; Saleh, Amer F; Behlke, Mark; Morris, John; Goyenvalle, Aurelie; Dugovic, Branislav; Leumann, Christian; Gordon, Siamon; Gait, Michael J; El-Andaloussi, Samir; Wood, Matthew J A

    2015-07-01

    Antisense oligonucleotides (ASOs) have the potential to revolutionize medicine due to their ability to manipulate gene function for therapeutic purposes. ASOs are chemically modified and/or incorporated within nanoparticles to enhance their stability and cellular uptake, however, a major challenge is the poor understanding of their uptake mechanisms, which would facilitate improved ASO designs with enhanced activity and reduced toxicity. Here, we study the uptake mechanism of three therapeutically relevant ASOs (peptide-conjugated phosphorodiamidate morpholino (PPMO), 2'Omethyl phosphorothioate (2'OMe), and phosphorothioated tricyclo DNA (tcDNA) that have been optimized to induce exon skipping in models of Duchenne muscular dystrophy (DMD). We show that PPMO and tcDNA have high propensity to spontaneously self-assemble into nanoparticles. PPMO forms micelles of defined size and their net charge (zeta potential) is dependent on the medium and concentration. In biomimetic conditions and at low concentrations, PPMO obtains net negative charge and its uptake is mediated by class A scavenger receptor subtypes (SCARAs) as shown by competitive inhibition and RNAi silencing experiments in vitro. In vivo, the activity of PPMO was significantly decreased in SCARA1 knockout mice compared to wild-type animals. Additionally, we show that SCARA1 is involved in the uptake of tcDNA and 2'OMe as shown by competitive inhibition and colocalization experiments. Surface plasmon resonance binding analysis to SCARA1 demonstrated that PPMO and tcDNA have higher binding profiles to the receptor compared to 2'OMe. These results demonstrate receptor-mediated uptake for a range of therapeutic ASO chemistries, a mechanism that is dependent on their self-assembly into nanoparticles. PMID:26042553

  7. Efficient oligonucleotide-mediated degradation of nuclear noncoding RNAs in mammalian cultured cells

    PubMed Central

    Ideue, Takashi; Hino, Kimihiro; Kitao, Saori; Yokoi, Takahide; Hirose, Tetsuro

    2009-01-01

    Recent large-scale transcriptome analyses have revealed that large numbers of noncoding RNAs (ncRNAs) are transcribed from mammalian genomes. They include small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), and longer ncRNAs, many of which are localized to the nucleus, but which have remained functionally elusive. Since ncRNAs are only known to exist in mammalian species, established experimental systems, including the Xenopus oocyte system and yeast genetics, are not available for functional analysis. RNA interference (RNAi), commonly used for analysis of protein-coding genes, is effective in eliminating cytoplasmic mRNAs, but not nuclear RNAs. To circumvent this problem, we have refined the system for knockdown of nuclear ncRNAs with chemically modified chimeric antisense oligonucleotides (ASO) that were efficiently introduced into the nucleus by nucleofection. Under optimized conditions, our system appeared to degrade at least 20 different nuclear ncRNA species in multiple mammalian cell lines with high efficiency and specificity. We also confirmed that our method had greatly improved knockdown efficiency compared with that of the previously reported method in which ASOs are introduced with transfection reagents. Furthermore, we have confirmed the expected phenotypic alterations following knockdown of HBII295 snoRNA and U7 snRNA, which resulted in a loss of site-specific methylation of the artificial RNA and the appearance of abnormal polyadenylated histone mRNA species with a concomitant delay of the cell cycle S phase, respectively. In summary, we believe that our system is a powerful tool to explore the biological functions of the large number of nuclear ncRNAs with unknown function. PMID:19535462

  8. Structure of UvrA nucleotide excision repair protein in complex with modified DNA

    PubMed Central

    Jaciuk, Marcin; Nowak, Elżbieta; Skowronek, Krzysztof; Tańska, Anna; Nowotny, Marcin

    2012-01-01

    One of the primary pathways for removal of DNA damage is nucleotide excision repair (NER). In bacteria, the UvrA protein is the component of NER that locates the lesion. A notable feature of NER is its ability to act on many DNA modifications that vary in chemical structure. So far, the mechanism underlying this broad specificity has been unclear. Here, we report the first crystal structure of a UvrA protein in complex with a chemically modified oligonucleotide. The structure shows that the UvrA dimer does not contact the site of lesion directly, but rather binds the DNA regions on both sides of the modification. The DNA region harboring the modification is deformed, with the double helix bent and unwound. UvrA uses damage-induced deformations of the DNA and a less rigid structure of the modified double helix for indirect readout of the lesion. PMID:21240268

  9. Biological effects of hexitol and altritol-modified siRNAs targeting B-Raf

    PubMed Central

    Fisher, Michael; Abramov, Mikhail; Van Aerschot, Arthur; Rozenski, Jef; Dixit, Vidula; Juliano, Rudy L.; Herdewijn, Piet

    2009-01-01

    Increasing the effectiveness of siRNAs through chemical modification is an important task. Here we describe altritol and hexitol modified oligonucleotides targeting the B-Raf oncogene that is critical for the growth and survival of melanoma cells. Using assays for apoptosis, DNA synthesis, colony formation and B-Raf protein and message levels, we demonstrate that certain hexitol modifications can improve the effectiveness of B-Raf siRNAs and also increase duration of action. Altritol modified siRNAs were similar to or slightly less effective than unmodified B-Raf siRNA. Modifications at the 3′ or 5′ end of the sense strand, at the 3′ end of the antisense strand, or within either strand were well tolerated. The basis for the increased effectiveness of the hexitol-modified siRNAs is not fully understood but may be partly due to increased stability to nucleases. PMID:19374843

  10. Bioconjugation of oligonucleotides for treating liver fibrosis.

    PubMed

    Ye, Zhaoyang; Houssein, Houssam S Hajj; Mahato, Ram I

    2007-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is urgently needed to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remain the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of alpha1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in-depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  11. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  12. An imputation approach for oligonucleotide microarrays.

    PubMed

    Li, Ming; Wen, Yalu; Lu, Qing; Fu, Wenjiang J

    2013-01-01

    Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request. PMID:23505547

  13. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  14. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  15. Uptake and antifungal activity of oligonucleotides in Candida albicans

    PubMed Central

    Disney, Matthew D.; Haidaris, Constantine G.; Turner, Douglas H.

    2003-01-01

    Candida albicans is a significant cause of disease in immunocompromised humans. Because the number of people infected by fungal pathogens is increasing, strategies are being developed to target RNAs in fungi. This work shows that oligonucleotides can serve as therapeutics against C. albicans. In particular, oligonucleotides are taken up from cell culture medium in an energy-dependent process. After uptake, oligonucleotides, including RNA, remain mostly intact after 12 h in culture. For culture conditions designed for mammalian cells, intracellular concentrations of oligonucleotides in C. albicans exceed those in COS-7 mammalian cells, suggesting that uptake can provide selective targeting of fungi over human cells. A 19-mer 2′OMe (oligonucleotide with a 2′-O-methyl backbone) hairpin is described that inhibits growth of a C. albicans strain at pH < 4.0. This pH is easily tolerated in some parts of the body subject to C. albicans infections. In vivo dimethyl sulfate modification of ribosomal RNA and the decreased rate of protein synthesis suggest that this hairpin's activity may be due to targeting the ribosome in a way that does not depend on base pairing. Addition of anti-C. albicans oligonucleotides to COS-7 mammalian cells has no effect on cell growth. Evidently, oligonucleotides can selectively serve as therapeutics toward C. albicans and, presumably, other pathogens. Information from genome sequencing and functional genomics studies on C. albicans and other pathogens should allow rapid design and testing of other approaches for oligonucleotide therapies. PMID:12552085

  16. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  17. Science and norms in policies for sustainable development: assessing and managing risks of chemical substances and genetically modified organisms in the European Union.

    PubMed

    Karlsson, Mikael

    2006-02-01

    Use of chemical substances and genetically modified organisms cause complex problems characterised by scientific uncertainty and controversies. Aiming at sustainable development, policies for assessment, and management of risks in the two areas are under development in the European Union. The article points out that both science and norms play a central role in risk assessment as well as risk management and suggests that the precautionary principle, the principle of public participation, and the polluter pays principle, all adopted in the European Union, offer a way to operationalise the concept of sustainable development. It is shown, however, that a number of steps ought to be taken to better implement the principles through different policy measures. In doing so, and by recognising the role of both science and norms, the decision-making on risks related to the use of chemicals or genetically modified organisms can be improved to better promote sustainable development. PMID:16213076

  18. Influence of citric acid as chemical modifier for lead determination in dietary calcium supplement samples by graphite furnace atomic absorption spectrometry

    NASA Astrophysics Data System (ADS)

    Cezar Paz de Mattos, Julio; Medeiros Nunes, Adriane; Figueiredo Martins, Ayrton; Luiz Dressler, Valderi; Marlon de Moraes Flores, Érico

    2005-06-01

    Citric acid was used as a chemical modifier for Pb determination by graphite furnace atomic absorption spectrometry in dietary supplement samples (calcium carbonate, dolomite and oyster shell samples) and its efficiency was compared to the use of palladium. Pyrolysis and atomization curves were established without use of chemical modifier, with the addition of 20, 100 and 200 μg of citric acid, and with 3 μg of palladium. The citric acid modifier made possible the interference-free Pb determination in the presence of high concentrations of Ca and Mg nitrates. Acid sample digestion involving closed vessels (microwave-assisted and conventional heating) and acid attack using polypropylene vessels at room temperature were compared. All digestion procedures presented similar results for calcium carbonate and dolomite samples. However, for oyster shell samples accurate results were obtained only with the use of closed vessel systems. Analyte addition and matrix-matched standards were used for calibration. The characteristic mass for Pb using citric acid and palladium were 16 and 25 pg, respectively. The relative standard deviation (RSD) was always less than 5% when citric acid was used. The relative and absolute limits of detection were 0.02 μg g - 1 and 8 pg with citric acid and 0.1 μg g - 1 and 44 pg with the Pd modifier, respectively ( n = 10, 3σ). The recovery of Pb in spiked calcium supplement samples (10 μg l - 1 ) was between 98% and 105%. With the use of 100 μg of citric acid as chemical modifier, problems such as high background absorption and high RSD values were minimized in comparison to the addition of 3 μg of palladium.

  19. Preparation of Intrastrand {G}O(6) -Alkylene-O(6) {G} Cross-Linked Oligonucleotides.

    PubMed

    O'Flaherty, Derek K; Wilds, Christopher J

    2016-01-01

    This unit describes the preparation O(6) -2'-deoxyguanosine-butylene-O(6) -2'-deoxyguanosine dimer phosphoramidites and precursors for incorporation of site-specific intrastrand cross-links (IaCL) into DNA oligonucleotides. Protected 2'-deoxyguanosine dimers are produced using the Mitsunobu reaction. IaCL DNA containing the intradimer phosphodiester are first chemically phosphorylated, followed by a ring-closing reaction using the condensing reagent 1-(2-mesitylenesulfonyl)-3-nitro-1H-1,2,4-triazole. Phosphoramidites are incorporated into oligonucleotides by solid-phase synthesis and standard deprotection and cleavage protocols are employed. This approach allows for the preparation of IaCL DNA substrates in amounts and purity amenable for biophysical characterization, and biochemical studies as substrates to investigate DNA repair and bypass pathways. © 2016 by John Wiley & Sons, Inc. PMID:27584704

  20. Review of long-term adverse effects associated with the use of chemically-modified animal and nonanimal source hyaluronic acid dermal fillers

    PubMed Central

    Edwards, Paul C; Fantasia, John E

    2007-01-01

    Although only recently introduced, chemically-modified hyaluronic acid dermal fillers have gained widespread acceptance as “redefining” dermal fillers in the fields of dermatology and cosmetic facial surgery. Although hyaluronic acid-based dermal fillers have a low overall incidence of long term side effects, occasional adverse outcomes, ranging from chronic lymphoplasmacytic inflammatory reactions to classic foreign body-type granulomatous reactions have been documented. These long-term adverse events are reviewed. PMID:18225451

  1. Effect of chemically modified Vulcan XC-72R on the performance of air-breathing cathode in a single-chamber microbial fuel cell.

    PubMed

    Duteanu, N; Erable, B; Senthil Kumar, S M; Ghangrekar, M M; Scott, K

    2010-07-01

    The catalytic activity of modified carbon powder (Vulcan XC-72R) for oxygen reduction reaction (ORR) in an air-breathing cathode of a microbial fuel cell (MFC) has been investigated. Chemical modification was carried out by using various chemicals, namely 5% nitric acid, 0.2N phosphoric acid, 0.2N potassium hydroxide and 10% hydrogen peroxide. Electrochemical study was performed for ORR of these modified carbon materials in the buffer solution pH range of 6-7.5 in the anodic compartment. Although, these treatments influenced the surface properties of the carbon material, as evident from the SEM-EDX analysis, treatment with H(2)PO(4), KOH, and H(2)O(2) did not show significant activity during the electrochemical test. The HNO(3) treated Vulcan demonstrated significant ORR activity and when used in the single-chamber MFC cathode, current densities (1115mA/m(2), at 5.6mV) greater than those for a Pt-supported un-treated carbon cathode were achieved. However, the power density for the latter was higher. Such chemically modified carbon material can be a cheaper alternative for expensive platinum catalyst used in MFC cathode construction. PMID:20171090

  2. Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

    PubMed Central

    2015-01-01

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  3. Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

    PubMed

    Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

    2014-04-18

    We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

  4. Enzymatic assay for deoxyribonucleoside triphosphates using synthetic oligonucleotides as template primers

    SciTech Connect

    Sherman, P.A.; Fyfe, J.A. )

    1989-08-01

    The enzymatic assay for deoxyribonucleoside triphosphates has been improved by using synthetic oligonucleotides of a carefully defined sequence as template primers for DNA polymerase. High backgrounds, which limit the sensitivity of the assay when calf thymus DNA or alternating copolymers are used as template primers, were eliminated with these oligonucleotide template primers. Sensitivity was further increased by designing the template primer to incorporate multiple labeled deoxyribonucleotides per limiting unlabeled deoxyribonucleotide. Each of several DNA polymerases exhibited unique reaction characteristics with the oligonucleotide template primers, which was attributed to the differing exonuclease activities associated with these various enzymes. Assay optimization therefore included matching the polymerase with the template primer to obtain the lowest background reaction and highest sensitivity. This modified assay is particularly well suited for keeping cell sample size to a minimum in experimental protocols which generate large numbers of data points or require careful timing of sampling. With this technique, we measured the levels of all four deoxyribonucleoside triphosphates in extracts from as few as 2 x 10(4) cultured cells.

  5. Oligonucleotides labeled with single fluorophores as sensors for deoxynucleotide triphosphate binding by DNA polymerases.

    PubMed

    Nikiforov, Theo T

    2014-01-01

    Oligonucleotides labeled with a single fluorophore (fluorescein or tetramethylrhodamine) have been used previously as fluorogenic substrates for a number of DNA modifying enzymes. Here, it is shown that such molecules can be used as fluorogenic probes to detect the template-dependent binding of deoxynucleotide triphosphates by DNA polymerases. Two polymerases were used in this work: the Klenow fragment of the Escherichia coli DNA polymerase I and the Bacillus stearothermophilus polymerase, Bst. When complexes of these polymerases with dye-labeled hairpin-type oligonucleotides were mixed with various deoxynucleotide triphosphates in the presence of Sr²⁺ as the divalent metal cation, the formation of ternary DNA-polymerase-dNTP complexes was detected by concentration-dependent changes in the fluorescence intensities of the dyes. Fluorescein- and tetramethylrhodamine-labeled probes of identical sequences responded differently to the two polymerases. With Bst polymerase, the fluorescence intensities of all probes increased with the next correct dNTP; with Klenow polymerase, tetramethylrhodamine-labeled probes increased their fluorescence, but the intensity of fluorescein-labeled probes decreased on formation of ternary complexes with the correct incoming nucleotides. The use of Sr²⁺ as the divalent metal ion allowed the formation of catalytically inactive ternary complexes and obviated the need for using 2',3'-dideoxy-terminated oligonucleotides as would have been needed in the case of Mg²⁺ as the metal ion. PMID:24096197

  6. Detection of Glucose with Atomic Absorption Spectroscopy by Using Oligonucleotide Functionalized Gold Nanoparticle.

    PubMed

    Zhang, Hong; Yan, Honglian; Ling, Liansheng

    2016-06-01

    A novel method for the detection of glucose was established with atomic absorption spectroscopy by using the label of gold nanoparticle (AuNP). Silver-coated glass assembled with oligonucleotide 5'-SH-T12-AGA CAA GAG AGG-3' (Oligo 1) was acted as separation probe, oligonucleotide 5'-CAA CAG AGA ACG-T12-SH-3' modified gold nanoparticle (AuNP-Oligo 2) was acted as signal-reporting probe. Oligonucleotide 5'-CGT TCT CTG TTG CCT CTC TTG TCT-3' (Oligo 3) could hybridize with Oligo 1 on the surface of silver-coated glass and AuNP-Oligo 2, and free AuNP-Oligo 2 could be removed by rinsing with buffer. Hence the concentration of Oligo 3 was transformed into the concentration of gold element. In addition, Oligo 3 could be cleaved into DNA fragments by glucose, glucose oxidase and Fe(2+)-EDTA through Fenton reaction. Thereby the concentration of glucose could be transformed to the absorbance of gold element. Under the optimum conditions, the integrated absorbance decreased proportionally to the concentration of glucose over the range from 50.0 μM to 1.0 mM with a detection limit of 40.0 μM. Moreover, satisfactory result was obtained when the assay was used to determinate glucose in human serum. PMID:27427698

  7. Minimizing DNA microarrays to a single molecule per spot: using zero-mode waveguide technology to obtain kinetic data for a large number of short oligonucleotide hybridization reactions

    NASA Astrophysics Data System (ADS)

    Sobek, Jens; Rehrauer, Hubert; Kuhn, Gerrit; Schlapbach, Ralph

    2016-03-01

    We have shown recently that the hybridization of short oligonucleotides can be studied in a zero-mode waveguide nanostructure (ZMW) chip using a modified DNA sequencer.[1] Here we present an extension of this method enabling the parallel measurement of kinetic constants of a large number of hybridization reactions on a single chip. This can be achieved by immobilization of a mixture of oligonucleotides, which leads to a statistical and random distribution of single molecules in the 150'000 ZMWs of a SMRT™ cell. This setup is comparable to a classical microarray with ZMWs in place of spots but unknown allocation of probes. The probe surface density is reduced by a factor of ~1010 allowing the study of hybridization in the absence of interactions with neighboring probes. Hybridization with a dye labelled oligonucleotide results in trains of fluorescence pulses from which interpulse durations (IPDs) and pulse widths (PWs) can be extracted. Since the identity of a probe in a ZMW is unknown, the immobilized oligonucleotide is sequenced in a subsequent step. After mapping the fluorescence traces to the sequence, the association and dissociation rate constant for each oligonucleotide can be calculated. By selecting suitable probes, the method can be used to determine rate constants of hybridization for a large number of mismatch oligonucleotides in a single measurement and at single-molecule level.

  8. Antineoplastic Effect of Decoy Oligonucleotide Derived from MGMT Enhancer

    PubMed Central

    Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris

    2014-01-01

    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy. PMID:25460932

  9. Splice-switching antisense oligonucleotides as therapeutic drugs.

    PubMed

    Havens, Mallory A; Hastings, Michelle L

    2016-08-19

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA-RNA base-pairing or protein-RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipulate protein production from a gene. Splicing modulation is particularly valuable in cases of disease caused by mutations that lead to disruption of normal splicing or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs offer an effective and specific way to target and alter splicing in a therapeutic manner. Here, we discuss the different approaches used to target and alter pre-mRNA splicing with SSOs. We detail the modifications to the nucleic acids that make them promising therapeutics and discuss the challenges to creating effective SSO drugs. We highlight the development of SSOs designed to treat Duchenne muscular dystrophy and spinal muscular atrophy, which are currently being tested in clinical trials. PMID:27288447

  10. Sequence Verification of Oligonucleotides Containing Multiple Arylamine Modifications by Enzymatic Digestion and Liquid Chromatography Mass Spectrometry (LC/MS)

    PubMed Central

    Gao, Lan; Zhang, Li; Cho, Bongsup P.; Chiarelli, M. Paul

    2010-01-01

    An analytical method for the structure differentiation of arylamine modified oligonucleotides (ODNs) using on-line LC/MS analysis of raw exonuclease digests is described. Six different dodeca ODNs derived from the reaction of N-acetoxy-N-(trifluoroacetyl)-2-aminofluorene with the dodeca oligonucleotide 5′-CTCGGCGCCATC-3′ are isolated and sequenced with this LC/MS method using 3′- and 5′-exonucleases. When the three products modified by a single aminofluorene (AF) are subjected to 3′-exonuclease digestion, the exonuclease will cleave a modified nucleotide but when di-AF modified ODNs are analyzed the 3′-exonuclease ceases to cleave nucleotides when the first modification is exposed at the 3′-terminus. Small abundances of ODN fragments formed by the cleavage of an AF-modified nucleotide were observed when two of the three di-AF modified ODNs were subjected to 5′-exonuclease digestion. The results of the 5′-exonuclease studies of the three di-AF modified ODNs suggest that as the number of unmodified bases between two modifications in an ODN sequence increases, the easier it becomes to sequence beyond the modification closest to the 5′-terminus. The results of this study indicate that the LC/MS method described here would be useful in sequencing ODNs modified by multiple arylamines to be used as templates for site-specific mutagenesis studies. PMID:18524623

  11. Hsp90 protein interacts with phosphorothioate oligonucleotides containing hydrophobic 2′-modifications and enhances antisense activity

    PubMed Central

    Liang, Xue-Hai; Shen, Wen; Sun, Hong; Kinberger, Garth A.; Prakash, Thazha P.; Nichols, Joshua G.; Crooke, Stanley T.

    2016-01-01

    RNase H1-dependent antisense oligonucleotides (ASOs) are chemically modified to enhance pharmacological properties. Major modifications include phosphorothioate (PS) backbone and different 2′-modifications in 2–5 nucleotides at each end (wing) of an ASO. Chemical modifications can affect protein binding and understanding ASO-protein interactions is important for better drug design. Recently we identified many intracellular ASO-binding proteins and found that protein binding could affect ASO potency. Here, we analyzed the structure-activity-relationships of ASO-protein interactions and found 2′-modifications significantly affected protein binding, including La, P54nrb and NPM. PS-ASOs containing more hydrophobic 2′-modifications exhibit higher affinity for proteins in general, although certain proteins, e.g. Ku70/Ku80 and TCP1, are less affected by 2′-modifications. We found that Hsp90 protein binds PS-ASOs containing locked-nucleic-acid (LNA) or constrained-ethyl-bicyclic-nucleic-acid ((S)-cEt) modifications much more avidly than 2′-O-methoxyethyl (MOE). ASOs bind the mid-domain of Hsp90 protein. Hsp90 interacts with more hydrophobic 2′ modifications, e.g. (S)-cEt or LNA, in the 5′-wing of the ASO. Reduction of Hsp90 protein decreased activity of PS-ASOs with 5′-LNA or 5′-cEt wings, but not with 5′-MOE wing. Together, our results indicate Hsp90 protein enhances the activity of PS/LNA or PS/(S)-cEt ASOs, and imply that altering protein binding of ASOs using different chemical modifications can improve therapeutic performance of PS-ASOs. PMID:26945041

  12. Long synthetic oligonucleotides for microarray expression measurement

    NASA Astrophysics Data System (ADS)

    Li, Jiong; Wang, Hong; Liu, Heping; Zhang, M.; Zhang, Chunxiu; Lu, Zu-Hong; Gao, Xiang; Kong, Dong

    2001-09-01

    There are generally two kinds of DNA microarray used for genomic-scale gene expression profiling of mRNA: cDNA and DNA chip, but both of them suffer from some drawbacks. To meet more requirements, another oligonucleotide microarray with long was produced. This type of microarray had the advantages of low cost, minimal Cross-hybridization, flexible and easy to make, which is most fit for small laboratories with special purposes. In this paper, we devised different probes with different probe lengths, GC contents and gene positions to optimization the probe design. Experiments showed 70 mer probes are suitable for both sufficient sensitivity and reasonable costs. Higher G-C content produces stronger signal intensity thus better sensitivity and probes designed at 3 untranslated region of gene within the range of 300 pb should be best for both sensitivity and specificity.

  13. MALDI analysis of oligonucleotides directly from montmorillonite.

    PubMed

    Zagorevskii, Dmitri V; Aldersley, Michael F; Ferris, James P

    2006-09-01

    Oligonucleotides synthesized on a montmorillonite catalyst were analyzed directly. By mixing the catalyst with a matrix (2,4,6-trihydroxyacetophenone or 6-aza-2-thiothymine) and dibasic ammonium citrate, higher molecular weight products were detected compared with "classical" methods such as gel electrophoresis and HPLC with UV as a detector. The oligomers (30-mers and higher) were detected by mass spectrometry even though their concentration was less than 10(-4)% of the total content of the RNA. This method is different from the (MALDI) analysis of the eluates from montmorillonite, which otherwise requires desalting. Placing reaction mixtures with a high concentration of buffers on homoionic, preferably Li-containing, montmorillonite does not require desalting. PMID:16809045

  14. Use of nanoparticles to deliver immunomodulatory oligonucleotides.

    PubMed

    Klinman, Dennis M; Sato, Takashi; Shimosato, Takeshi

    2016-07-01

    Synthetic oligonucleotides (ODNs) containing unmethylated 'CpG motifs' stimulate the innate immune system to produce cytokines, chemokines, and polyreactive antibodies. CpG ODNs have shown promise as vaccine adjuvants and for the treatment of infectious diseases and cancer. The immunostimulatory activity of CpG ODNs is inhibited by DNA-containing 'suppressive' motifs. ODNs expressing suppressive motifs (Sup ODNs) reduce ongoing immune reactions and show promise in the treatment of autoimmune and inflammatory diseases. This work reviews recent progress in the use of nanoparticles as carriers of CpG and Sup ODNs to target their delivery to the GI tract and lungs. WIREs Nanomed Nanobiotechnol 2016, 8:631-637. doi: 10.1002/wnan.1382 For further resources related to this article, please visit the WIREs website. PMID:26663867

  15. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity. PMID:24557899

  16. The Identification and Role of Non-Chemical Stressors as Modifiers of Chemical Exposures that Lead to Changes in Health and Well-Being in Children

    EPA Science Inventory

    Describe the Sustainable and Health Communities (SHC) Research Program at the U.S. EPA Discuss non-chemical stressors found in the social environment, What are they? Why are they important? Summarize current and planned work

  17. Information Limited Oligonucleotide Amplification Assay for Affinity-Based, Parallel Detection Studies

    PubMed Central

    Bokkasam, Harish; Ott, Albrecht

    2016-01-01

    Molecular communication systems encounter similar constraints as telecommunications. In either case, channel crosstalk at the receiver end will result in information loss that statistical analysis cannot compensate. This is because in any communication channel there is a physical limit to the amount of information that can be transmitted. We present a novel and simple modified end amplification (MEA) technique to generate reduced and defined amounts of specific information in form of short fragments from an oligonucleotide source that also contains unrelated and redundant information. Our method can be a valuable tool to investigate information overflow and channel capacity in biomolecular recognition systems. PMID:26978653

  18. DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.

    PubMed

    Camden, Alison J; Walsh, Shannon M; Suk, Sarah H; Silverman, Scott K

    2016-05-10

    T4 polynucleotide kinase is widely used for 5'-phosphorylation of DNA and RNA oligonucleotide termini, but no natural protein enzyme is capable of 3'-phosphorylation. Here, we report the in vitro selection of deoxyribozymes (DNA enzymes) capable of DNA oligonucleotide 3'-phosphorylation, using a 5'-triphosphorylated RNA transcript (pppRNA) as the phosphoryl donor. The basis of selection was the capture, during each selection round, of the 3'-phosphorylated DNA substrate terminus by 2-methylimidazole activation of the 3'-phosphate (forming 3'-MeImp) and subsequent splint ligation with a 5'-amino DNA oligonucleotide. Competing and precedented DNA-catalyzed reactions were DNA phosphodiester hydrolysis or deglycosylation, each also leading to a 3'-phosphate but at a different nucleotide position within the DNA substrate. One oligonucleotide 3'-kinase deoxyribozyme, obtained from an N40 random pool and named 3'Kin1, can 3'-phosphorylate nearly any DNA oligonucleotide substrate for which the 3'-terminus has the sequence motif 5'-NKR-3', where N denotes any oligonucleotide sequence, K = T or G, and R = A or G. These results establish the viabilty of in vitro selection for identifying DNA enzymes that 3'-phosphorylate DNA oligonucleotides. PMID:27063020

  19. The frequency of oligonucleotides in mammalian genic regions.

    PubMed

    Volinia, S; Gambari, R; Bernardi, F; Barrai, I

    1989-02-01

    The large body of nucleic acid sequence data now available offers a unique opportunity for the characterization of individual oligonucleotides which may be specific to sequence functional domains. We have prepared algorithms for the study of the frequency distribution of all oligonucleotides of length 2-6 in DNA sequences. We have implemented them in the study of 634 mammalian DNA sequences spanning 1.782 Mb, and have obtained the distribution of the ratio between the observed frequency of oligonucleotides and their expected frequency based on independent nucleotide probabilities. We then studied the distribution of oligonucleotides (or k-tuples) of each length in a subset of 129 complete mammalian genes spanning 0.607 Mb. Eight distinct genomic regions, namely 5'-non-transcribed, first exon, first intron, intermediate exons, intermediate introns, last intron, last exon and 3'-non-transcribed, were considered. We observed that some oligonucleotides show a statistical behaviour and a regional distribution similar to that of known signal sequences. Moreover the frequency distribution of oligonucleotides of length 5 and 6 tends to become bimodal, indicating the existence of a population of very frequent oligonucleotides. PMID:2924169

  20. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides.

    PubMed

    Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-10-30

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca(2+) enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ~100 nm in size are found in Ca(2+)-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  1. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

    PubMed Central

    Hori, Shin-ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-01-01

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca2+ enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ∼100 nm in size are found in Ca2+-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  2. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  3. Hybridization of binary monolayers of single stranded oligonucleotides and short blocking molecules

    NASA Astrophysics Data System (ADS)

    Vikholm-Lundin, Inger; Auer, Sanna; Munter, Tony; Fiegl, Heidi; Apostolidou, Sophia

    2009-02-01

    We have studied the immobilization of single stranded (ss) DNA oligonucleotides of 16-27 base pairs on gold. The oligonucleotides were thiol-modified (SH-ssDNA) or disulfide-modified via a dimethoxytrityl-group (DMT-S-S-ssDNA). Immobilization was performed by adsorption of the probes on the gold surface for 10-15 min, a time within which saturation coverage was obtained for both thiol- and disulfide-modified probes. Hereafter the layer was post-treated with hydroxyalkyl substituted lipoamides also for a time of 10-15 min. The surface density of layers with shorter probes (16-18 mer) was twice (2.4 ± 0.2 × 10 13 probes/cm 2) that of the longer probes (25-27 mer) as studied with surface plasmon resonance. Hybridization of single stranded polymerase chain reaction (PCR) amplified products with a length above 300 base pairs gave a very low hybridization response. For amplicons with about 100 base pairs the response was high. The surface coverage was comparable to that of complementary ssDNA binding (3.0 × 10 12 strands/cm 2). Surfaces made from SH-ssDNA showed a 30% higher hybridization response than surfaces made from DMT-S-S-ssDNA. The PCR amplified products used are of relevance in breast cancer diagnosis. The results clearly demonstrate that the single stranded PCR products might be used in label-free cancer diagnostics.

  4. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    SciTech Connect

    Schinazi, Raymond F.

    2004-12-01

    -methyl)phosphonate (CBMP) internucleotide group. Unmodified phosphodiester linkages were formed using a standard {beta}-cyanoethyl cycle and automated DNA synthesizer. Modified CBMP internucleotide linkage was produced using the phosphotriester method and 5'-O-monomethoxytritylthymidine 3'-O-[(o-carboran-1-yl-methyl)phosphonate] monomer. Several dodecathymidylic acids bearing modification at 3'- or 5'-end, or in the middle of oligonucleotide chain were synthesized. The resulting oligomers are being characterized by reverse phase high-pressure liquid chromatography (RP-HPLC), electrospray ionization mass spectrometry (ESIMS), ultraviolet spectroscopy (UV), and circular dichroism (CD). In collaboration with Cornell University, we employed a secondary ion mass spectrometry (SIMS) based subcellular isotopic imaging technique of ion microscopy for evaluating 4 carboranyl nucleosides. Nucleosides synthesized by our group, including CDU, HMCDU, CTU, and CFAU were tested for their boron delivery to the nuclear and cytoplasmic compartments of U251 human and F98 rat glioma cells. Quantitative SIMS analysis of boron was performed in cryogenically prepared cells. For all drugs, the cell cytoplasm revealed significantly higher boron than the nucleus. However, the boron partitioning between the cell nucleus and the nutrient medium indicated 6.4-10.6 times higher boron in the nucleus. The results suggested that these novel carboranyl nucleosides should provide efficient BNCT agents that accumulate in malignant cells and the need for further evaluations in vitro and in animal models.

  5. Investigation of chemical modifiers for sulfur determination in diesel fuel samples by high-resolution continuum source graphite furnace molecular absorption spectrometry using direct analysis

    NASA Astrophysics Data System (ADS)

    Huber, Charles S.; Vale, Maria Goreti R.; Welz, Bernhard; Andrade, Jailson B.; Dessuy, Morgana B.

    2015-06-01

    High-resolution continuum source graphite furnace molecular absorption spectrometry has been applied for sulfur determination in diesel fuel. The sharp rotational lines of the carbon monosulfide molecule (formed during the vaporization step) were used to measure the absorbance. The analytical line at 258.056 nm was monitored using the sum of three pixels. Different chemical modifiers were investigated and the mixture of palladium and magnesium was used as chemical modifier in combination with iridium as permanent modifier. L-Cysteine was chosen as sulfur standard and the calibration was done against aqueous standard solutions. The proposed method was applied for the analyses of four diesel samples: two S10 samples and two S500 samples. The trueness of the method was checked with a certified reference material (CRM) of sulfur in diesel fuel (NIST 2724b). Accurate results, for samples and CRM, were achieved after a dilution with propan-1-ol. The following figures of merit were obtained: characteristic mass of 17 ± 3 ng, limit of detection and limit of quantification of 1.4 mg kg- 1 and 4.7 mg kg- 1, respectively.

  6. Simultaneous determination of antioxidants at a chemically modified electrode with vitamin B12 by capillary zone electrophoresis coupled with amperometric detection.

    PubMed

    Dong, Shuqing; Chi, Langzhu; He, Pingang; Wang, Qingjiang; Fang, Yuzhi

    2009-12-15

    In the paper, a new kind of vitamin B(12) (acquo-cobalamine) chemically modified electrode was fabricated and applied in capillary zone electrophoresis coupled with amperometric detection (CZE-AD) for simultaneous determination of six antioxidants in fruits and vegetables. The catalytic electrochemical properties of the chemically modified electrode could obviously enhance oxidation peak heights responses by about five times to glutathione, ascorbic acid, vanillic acid, chlorogenic acid, salicylic acid, and caffeic acid compared with common carbon disk electrode. Furthermore, the effects of working electrode potential, pH and concentration of running buffer, separation voltage and injection time on CZE-AD were investigated. Under the optimum conditions, the six analytes could be completely separated and detected in a borate-phosphate buffer (pH 8.4) within 15 min. Their linear ranges were from 2.5x10(-7) to 1.0x10(-4) mol L(-1) and the detection limits were as low as 10(-8) mol L(-1) magnitude (S/N=3). The proposed method has been successfully employed to monitor the six analytes in practical samples with recoveries in the range 96.0-106.0% and RSDs less than 5.0%. Above results demonstrate that capillary zone electrophoresis coupled with electrochemical detection using vitamin B(12) modified electrode as detector is of convenient preparation, high sensitivity, good repeatability, and could be used in the rapid determination of practical samples. PMID:19836556

  7. Cationic liposomes modified with non-ionic surfactants as effective non-viral carrier for gene transfer.

    PubMed

    Huang, Yong-Zhuo; Gao, Jian-Qing; Chen, Jin-Liang; Liang, Wen-Quan

    2006-05-01

    A defined change in formulation components affects the physical and chemical characteristics of cationic liposomes (CLs) carriers in many ways. Therefore, a great degree of control can be exercised over the structure by modifying the CLs with various materials, leading to new innovations for carrier improvement. In the present study, surface modifications of cationic liposomes with non-ionic surfactants--sorbitan monoesters serials (Span 85, 80, 40 and 20) were carried out for developing a new gene transfer carrier. Span modified cationic liposomes (Sp-CLs) were prepared by reverse phase evaporation method (RPV) and self-assemble complexes of antisense oligonucleotides/surfactant modifying cationic liposomes were prepared by auto-coacervation through electrostatic effect. Characterization of Sp-CLs and the self-assembled complex was performed by electron microscope, particle size, zeta potential, turbidity and agarose electrophoresis. Furthermore, in vitro cellular uptake experiment showed that Span plays a role in enhancing the cellular uptake of encapsulated oligonucleotides mediated by Sp-CLs by the endocytosis-dependent route. CLs modified with Span 40 significantly facilitated the cellular uptake by COS-7 cells and HeLa cells; also showed some positive effect on gene expression. That suggests it is a potential non-viral carrier for efficient gene transfer. PMID:16626948

  8. Determination of cadmium, chromium, copper and lead in sediments and soil samples by electrothermal atomic absorption spectrometry using zirconium containing chemical modifiers.

    PubMed

    Acar, Orhan

    2006-05-01

    A method for direct determination of cadmium, chromium, copper and lead in sediments and soil samples by electrothermal atomic absorption spectrometry using Zr, Ir, etylenediamine acetic acid (EDTA), Zr + EDTA, Ir + EDTA, Zr + Ir and Zr + Ir + EDTA as chemical modifiers in 0.5% (v/v) Triton X-100 plus 0.2% (v/v) nitric acid mixture used as diluent was developed. The effects of mass and mass ratio of modifiers on analytes in sample solutions were studied. The optimum masses and mass ratios of modifiers: 20 microg of Zr, 4 microg of Ir, 100 microg of EDTA and 20 microg of Zr + 4 microg of Ir + 100 microg of EDTA, were used to enhance the analyte signals. Pyrolysis and atomization temperatures, atomization and background absorption profiles, characteristic masses, and detection limits of analytes in samples were compared in the presence or absence of a modifier. The detection limits and characteristic masses of analytes in a 0.5% (m/v) dissolved sample (dilution factor of 200 ml g(-1)) obtained with Zr + Ir + EDTA are 8.0 ng g(-1) and 1.2 pg for Cd, 61 ng g(-1) and 4.3 pg for Cr, 32 ng g(-1) and 23 pg for Cu, and 3.4 ng g(-1) and 19 pg for Pb, respectively. The Zr + Ir + EDTA modifier mixture was found to be preferable for the determination of analytes in sediment and soil-certified and standard reference materials. Depending on the sample type, the percent recoveries of analytes were increased from 81 to 103% by using the proposed modifier mixture; the results obtained are in good agreement with the certified values. PMID:16770053

  9. Triplex formation on DNA targets: how to choose the oligonucleotide.

    PubMed

    Vekhoff, Pierre; Ceccaldi, Alexandre; Polverari, David; Pylouster, Jean; Pisano, Claudio; Arimondo, Paola B

    2008-11-25

    Triplex-forming oligonucleotides (TFOs) are sequence-specific DNA binders. TFOs provide a tool for controlling gene expression or, when attached to an appropriate chemical reagent, for directing DNA damage. Here, we report a set of rules for predicting the best out of five different triple-helical binding motifs (TM, UM, GA, GT, and GU, where M is 5-methyldeoxycytidine and U is deoxyuridine) by taking into consideration the sequence composition of the underlying duplex target. We tested 11 different triplex targets present in genes having an oncogenic role. The rules have predictive power and are very useful in the design of TFOs for antigene applications. Briefly, we retained motifs GU and TM, and when they do form a triplex, TFOs containing G and U are preferred over those containing T and M. In the case of the G-rich TFOs, triplex formation is principally dependent on the percentage of G and the length of the TFO. In the case of the pyrimidine motif, replacement of T with U is destabilizing; triplex formation is dependent on the percentage of T and destabilized by the presence of several contiguous M residues. An equation to choose between a GU and TM motif is given. PMID:18954091

  10. Mechanism for radical cation transport in duplex DNA oligonucleotides.

    PubMed

    Liu, Chu-Sheng; Hernandez, Rigoberto; Schuster, Gary B

    2004-03-10

    We investigated the photoinduced one-electron oxidation of a series of DNA oligomers having a covalently linked anthraquinone group (AQ) and containing [(A)(n)GG](m) or [(T)(n)GG](m) segments. These oligomers have m GG steps, where m = 4 or 6, separated by (A)(n) or (T)(n) segments, where n = 1-7 for the (A)(n) set and 1-5 for the (T)(n) set. Irradiation with UV light that is absorbed by the AQ causes injection of a radical cation into the DNA. The radical cation migrates through the DNA, causing chemical reaction, primarily at GG steps, that leads to strand cleavage after piperidine treatment. The uniform, systematic structure of the DNA oligonucleotides investigated permits the numerical solution of a kinetic scheme that models these reactions. This analysis yields two rate constants, k(hop), for hopping of the radical cation from one site to adjacent sites, and k(trap), for irreversible reaction of the radical cation with H(2)O or O(2). Analysis of these findings indicates that radical cation hopping in these duplex DNA oligomers is a process that occurs on a microsecond time scale. The value of k(hop) depends on the number of base pairs in the (A)(n) and (T)(n) segments in a systematic way. We interpret these results in terms of a thermally activated adiabatic mechanism for radical cation hopping that we identify as phonon-assisted polaron hopping. PMID:14995205

  11. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  12. Chemically modified polymeric resins for separation of cations, organic acids, and small polar moleculea by high performance liquid chromatography

    SciTech Connect

    Morris, J.B.

    1993-07-01

    This thesis is divided into 4 parts: a review, ion chromatography of metal cations on carboxylic resins, separation of hydrophilic organic acids and small polar compounds on macroporous resin columns, and use of eluent modifiers for liquid chromatographic separation of carboxylic acids using conductivity detection.

  13. Enzymatically hydrolysed, acetylated and dually modified corn starch: physico-chemical, rheological and nutritional properties and effects on cake quality.

    PubMed

    Sahnoun, Mouna; Ismail, Nouha; Kammoun, Radhouane

    2016-01-01

    Corn starch was treated by enzymatic hydrolysis with Aspergillus oryzae S2 α-amylase, acetylation with vinyl acetate, and dual modification. The dual modified starch displayed a higher substitution degree than the acetylated starch and lower reducing sugar content than the hydrolysed starch. The results revealed that the cooling viscosity and amylose content of those products decrease (P < 0.05). An increase in moisture, water, and oil absorption capacity was observed for the acetylated starch and, which was less pronounced for the enzymatically hydrolysed starch but more pronounced for the enzymatically hydrolysed acetylated product. The latter product underwent an increase in resistant starch content, which is induced by a rise in hydrolysis time to attain about 67 % after 1 h of reaction. The modified starch samples were added to cake formulations at 5 and 10 % concentrations on a wheat flour basis and compared to native starch. The results revealed that when applied at 5 % concentrations, the modified starches reduced the hardness, cohesion, adhesion and chewiness of baked cakes and enhanced their elasticity, volume, height, crust color, and appearance as compared to native starch. These effects were more pronounced for the cake incorporating the dually modified starch. PMID:26787967

  14. Comparison of Fe-Al-modified natural materials by an electrochemical method and chemical precipitation for the adsorption of F- and As(V).

    PubMed

    Vázquez Mejía, G; Martínez-Miranda, V; Fall, C; Linares-Hernández, I; Solache-Ríos, M

    2016-01-01

    The adsorption of fluoride and arsenic ions by modified natural materials may have an impact on the removal of F- and As(V) from waters. In this work, a zeolitic material and pozzolan (commonly known as pumicite) were modified with aluminium an iron by an electrochemical method and chemical precipitation, respectively. The adsorbents were characterized by X-ray diffraction, scanning electron microscopy with energy X-ray disperse spectroscopy analysis and the point of zero charge (pHzpc). F- and As(V) adsorption properties of both materials were investigated. Adsorption kinetic data were best fitted to pseudo-second-order model and equilibrium data to the Langmuir isotherm model. The highest F- and As(V) sorption capacities were obtained for modified zeolitic (0.866 mg/g) and pozzolan (3.35 mg/g) materials, respectively, with initial F- or As(V) concentrations of 10 mg/L. It was found that the unmodified materials did not show either adsorption of F- ions or As(V), which indicated that Al and Fe in the adsorbents are responsible for the adsorption of these ions. In general, both modified materials show similar capacities for the adsorption of F- and As(V). PMID:26362939

  15. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge

    2016-01-01

    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355

  16. PRACTICAL STRATEGIES FOR PROCESSING AND ANALYZING SPOTTED OLIGONUCLEOTIDE MICROARRAY DATA

    EPA Science Inventory

    Thoughtful data analysis is as important as experimental design, biological sample quality, and appropriate experimental procedures for making microarrays a useful supplement to traditional toxicology. In the present study, spotted oligonucleotide microarrays were used to profile...

  17. Micro- and nano-structure based oligonucleotide sensors.

    PubMed

    Ferrier, David C; Shaver, Michael P; Hands, Philip J W

    2015-06-15

    This paper presents a review of micro- and nano-structure based oligonucleotide detection and quantification techniques. The characteristics of such devices make them very attractive for Point-of-Care or On-Site-Testing biosensing applications. Their small scale means that they can be robust and portable, their compatibility with modern CMOS electronics means that they can easily be incorporated into hand-held devices and their suitability for mass production means that, out of the different approaches to oligonucleotide detection, they are the most suitable for commercialisation. This review discusses the advantages of micro- and nano-structure based sensors and covers the various oligonucleotide detection techniques that have been developed to date. These include: Bulk Acoustic Wave and Surface Acoustic Wave devices, micro- and nano-cantilever sensors, gene Field Effect Transistors, and nanowire and nanopore based sensors. Oligonucleotide immobilisation techniques are also discussed. PMID:25655465

  18. Highly parallel oligonucleotide purification and functionalization using reversible chemistry

    PubMed Central

    York, Kerri T.; Smith, Ryan C.; Yang, Rob; Melnyk, Peter C.; Wiley, Melissa M.; Turk, Casey M.; Ronaghi, Mostafa; Gunderson, Kevin L.; Steemers, Frank J.

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5′-labeled oligonucleotides. The approach is based on 5′-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5′-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90–99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  19. Highly parallel oligonucleotide purification and functionalization using reversible chemistry.

    PubMed

    York, Kerri T; Smith, Ryan C; Yang, Rob; Melnyk, Peter C; Wiley, Melissa M; Turk, Casey M; Ronaghi, Mostafa; Gunderson, Kevin L; Steemers, Frank J

    2012-01-01

    We have developed a cost-effective, highly parallel method for purification and functionalization of 5'-labeled oligonucleotides. The approach is based on 5'-hexa-His phase tag purification, followed by exchange of the hexa-His tag for a functional group using reversible reaction chemistry. These methods are suitable for large-scale (micromole to millimole) production of oligonucleotides and are amenable to highly parallel processing of many oligonucleotides individually or in high complexity pools. Examples of the preparation of 5'-biotin, 95-mer, oligonucleotide pools of >40K complexity at micromole scale are shown. These pools are prepared in up to ~16% yield and 90-99% purity. Approaches for using this method in other applications are also discussed. PMID:22039155

  20. Oligonucleotide-based theranostic nanoparticles in cancer therapy.

    PubMed

    Shahbazi, Reza; Ozpolat, Bulent; Ulubayram, Kezban

    2016-05-01

    Theranostic approaches, combining the functionality of both therapy and imaging, have shown potential in cancer nanomedicine. Oligonucleotides such as small interfering RNA and microRNA, which are powerful therapeutic agents, have been effectively employed in theranostic systems against various cancers. Nanoparticles are used to deliver oligonucleotides into tumors by passive or active targeting while protecting the oligonucleotides from nucleases in the extracellular environment. The use of quantum dots, iron oxide nanoparticles and gold nanoparticles and tagging with contrast agents, like fluorescent dyes, optical or magnetic agents and various radioisotopes, has facilitated early detection of tumors and evaluation of therapeutic efficacy. In this article, we review the advantages of theranostic applications in cancer therapy and imaging, with special attention to oligonucleotide-based therapeutics. PMID:27102380

  1. Investigation of chemical modifiers for the determination of lead in fertilizers and limestone using graphite furnace atomic absorption spectrometry with Zeeman-effect background correction and slurry sampling

    NASA Astrophysics Data System (ADS)

    Borges, Aline R.; Becker, Emilene M.; Dessuy, Morgana B.; Vale, Maria Goreti R.; Welz, Bernhard

    2014-02-01

    In this work, chemical modifiers in solution (Pd/Mg, NH4H2PO4 and NH4NO3/Pd) were compared with permanent modifiers (Ir and Ru) for the determination of lead in fertilizer and limestone samples using slurry sampling and graphite furnace atomic absorption spectrometry with Zeeman-effect background correction. The analytical line at 283.3 nm was used due to some spectral interference observed at 217.0 nm. The NH4H2PO4 was abandoned due to severe spectral interference even at the 283.3-nm line. For Pd/Mg and NH4NO3/Pd the optimum pyrolysis and atomization temperatures were 900 °C and 1900 °C, respectively. For Ru and Ir, the integrated absorbance signal was stable up to pyrolysis temperatures of 700 °C and 900 °C, respectively, and up to atomization temperature of 1700 °C. The limit of detection (LOD) was 17 ng g- 1 using Pd/Mg and 29 ng g- 1 using NH4NO3/Pd. Among the permanent modifiers investigated, the LOD was 22 ng g- 1 Pb for Ir and 10 ng g- 1 Pb for Ru. The accuracy of the method was evaluated using the certified reference material NIST SRM 695. Although Ru provided lower LOD, which can be attributed to a lower blank signal, only the modifiers in solution showed concordant values of Pb concentration for the NIST SRM 695 and the most of analyzed samples. Moreover, the Pd/Mg modifier provided the highest sensitivity and for this reason it is more suitable for the determination of Pb in fertilizers samples in slurry; besides this it presented a better signal-to-noise ratio than NH4NO3/Pd.

  2. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays.

    PubMed

    O'Sullivan, Paul J; Burke, Martina; Soini, Aleksi E; Papkovsky, Dmitri B

    2002-11-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3'- or 5'-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5'-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY 7 dye (dark quencher) showed strong (approximately 20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  3. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    PubMed Central

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.

    2002-01-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  4. Oligonucleotide Therapies: The Past and the Present

    PubMed Central

    Lundin, Karin E.; Gissberg, Olof; Smith, C.I. Edvard

    2015-01-01

    In this review we address the development of oligonucleotide (ON) medicines from a historical perspective by listing the landmark discoveries in this field. The various biological processes that have been targeted and the corresponding ON interventions found in the literature are discussed together with brief updates on some of the more recent developments. Most ON therapies act through antisense mechanisms and are directed against various RNA species, as exemplified by gapmers, steric block ONs, antagomirs, small interfering RNAs (siRNAs), micro-RNA mimics, and splice switching ONs. However, ONs binding to Toll-like receptors and those forming aptamers have completely different modes of action. Similar to other novel medicines, the path to success has been lined with numerous failures, where different therapeutic ONs did not stand the test of time. Since the first ON drug was approved for clinical use in 1998, the therapeutic landscape has changed considerably, but many challenges remain until the expectations for this new form of medicine are met. However, there is room for cautious optimism. PMID:26160334

  5. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  6. Antisense Oligonucleotide Therapy for Inherited Retinal Dystrophies.

    PubMed

    Gerard, Xavier; Garanto, Alejandro; Rozet, Jean-Michel; Collin, Rob W J

    2016-01-01

    Inherited retinal dystrophies (IRDs) are an extremely heterogeneous group of genetic diseases for which currently no effective treatment strategies exist. Over the last decade, significant progress has been made utilizing gene augmentation therapy for a few genetic subtypes of IRD, although several technical challenges so far prevent a broad clinical application of this approach for other forms of IRD. Many of the mutations leading to these retinal diseases affect pre-mRNA splicing of the mutated genes . Antisense oligonucleotide (AON)-mediated splice modulation appears to be a powerful approach to correct the consequences of such mutations at the pre-mRNA level , as demonstrated by promising results in clinical trials for several inherited disorders like Duchenne muscular dystrophy, hypercholesterolemia and various types of cancer. In this mini-review, we summarize ongoing pre-clinical research on AON-based therapy for a few genetic subtypes of IRD , speculate on other potential therapeutic targets, and discuss the opportunities and challenges that lie ahead to translate splice modulation therapy for retinal disorders to the clinic. PMID:26427454

  7. Photophysical deactivation pathways in adenine oligonucleotides.

    PubMed

    Spata, Vincent A; Matsika, Spiridoula

    2015-12-14

    In this work we study deactivation processes in adenine oligomers after absorption of UV radiation using Quantum Mechanics combined with Molecular Mechanics (QM/MM). Correlated electronic structure methods appropriate for describing the excited states are used to describe a π-stacked dimer of adenine bases incorporated into (dA)20(dT)20. The results of these calculations reveal three different types of excited state minima which play a role in deactivation processes. Within this set of minima there are minima where the excited state is localized on one adenine (monomer-like) as well as minima where the excited state is delocalized on two adenines, forming different types of excimers and bonded excimers of varying but inter-related character. The proximity of their energies reveals that the minima can decay into one another along a flat potential energy surface dependent on the interbase separation. Additionally, analysis of the emissive energies and other physical properties, including theoretical anisotropy calculations, and comparison with fluorescence experiments, provides evidence that excimers play an important role in long-lived signals in adenine oligonucleotides while the subpicosecond decay is attributed to monomer-like minima. The necessity for a close approach of the nucleobases reveals that the deactivation mechanism is tied to macro-molecular motion. PMID:26536353

  8. Use of phthaloyl protecting group for the automated synthesis of 3'-[(hydroxypropyl)amino] and 3'-[(hydroxypropyl)triglycyl] oligonucleotide conjugates.

    PubMed

    Vu, H; Joyce, N; Rieger, M; Walker, D; Goldknopf, I; Hill, T S; Jayaraman, K; Mulvey, D

    1995-01-01

    The chemical stability of oligonucleotides (ODNs) containing 3'-propanolamine was investigated. Invariably, all the ODNs synthesized from Fmoc-protected 3-aminopropane-1,2-diol-CPG support gave a mixture of three compounds at the end of automated synthesis as analyzed by denaturing PAGE and HPLC. On the basis of analytical procedures, these compounds were identified to be 3'-[N-acetyl-N-(hydroxypropyl)amino],3'-[(hydroxypropyl)amino], and 3'-hydroxyl ODNs. The instability of the amino protecting group under the synthesis conditions was responsible for this observed heterogeneity. In order to evaluate the stability, a comparative study on the chemical stability of the ODN containing amino-protecting groups such as [(9-fluorenylmethyl)oxy]carbonyl (Fmoc), trifluoroacetyl (TFA), and phthaloyl was undertaken. The results indicate that the phthaloyl group provided the best stability for the synthesis of 3' amine-modified ODNs, and the protecting group is cleaved and deprotected in concentrated ammonium hydroxide:40% aqueous methylamine, 1:1, for 5-10 min, at 56 degrees C. The 3'-hydroxypropyl)triglycyl] ODN conjugates were also synthesized from Fmoc- and phthaloyl-protected (hydroxypropyl)triglycine-CPG supports. PMID:8974460

  9. Immobilization of oligonucleotide probes on silicon surfaces using biotin-streptavidin system examined with microscopic and spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Awsiuk, K.; Rysz, J.; Petrou, P.; Budkowski, A.; Bernasik, A.; Kakabakos, S.; Marzec, M. M.; Raptis, I.

    2014-01-01

    To immobilize effectively oligonucleotide probes on SiO2 modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin-biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin-b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin-b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m2) and second (1.31(±0.22) mg/m2) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m2) and fourth (0.41(±0.11) mg/m2) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.

  10. A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides

    PubMed Central

    Dominov, Janice A; Uyan, Özgün; Sapp, Peter C; McKenna-Yasek, Diane; Nallamilli, Babi R R; Hegde, Madhuri; Brown, Robert H

    2014-01-01

    Objective Mutations in dysferlin (DYSF), a Ca2+-sensitive ferlin family protein important for membrane repair, vesicle trafficking, and T-tubule function, cause Miyoshi myopathy, limb-girdle muscular dystrophy type 2B, and distal myopathy. More than 330 pathogenic DYSF mutations have been identified within exons or near exon–intron junctions. In ~17% of patients who lack normal DYSF, only a single disease-causing mutation has been identified. We studied one family with one known mutant allele to identify both the second underlying genetic defect and potential therapeutic approaches. Methods We sequenced the full DYSF cDNA and investigated antisense oligonucleotides (AONs) as a tool to modify splicing of the mRNA transcripts in order to process out mutant sequences. Results We identified a novel pseudoexon between exons 44 and 45, (pseudoexon 44.1, PE44.1), which inserts an additional 177 nucleotides into the mRNA and 59 amino acids within the conserved C2F domain of the DYSF protein. Two unrelated dysferlinopathy patients were also found to carry this mutation. Using AONs targeting PE44.1, we blocked the abnormal splicing event, yielding normal, full-length DYSF mRNA, and increased DYSF protein expression. Interpretation This is the first report of a deep intronic mutation in DYSF that alters mRNA splicing to include a mutant peptide fragment within a key DYSF domain. We report that AON-mediated exon-skipping restores production of normal, full-length DYSF in patients’ cells in vitro, offering hope that this approach will be therapeutic in this genetic context, and providing a foundation for AON therapeutics targeting other pathogenic DYSF alleles. PMID:25493284

  11. Use of inorganic salts during the etching process in the fabrication of chemically modified capillaries for open tubular electrochromatography.

    PubMed

    Pesek, Joseph J; Matyska, Maria T; Velpula, Sunandini

    2005-05-01

    Capillaries for use in electrophoretic analyses are etched with ammonium bifluoride and in some cases a second inorganic salt is included in the process. The effects of the presence of these inorganic components in the surface matrix on the electromigration of heterocyclic aromatic amines and enkephalins are evaluated. Resolution, efficiency, and peak shape are used to compare the various columns. In one instance, the etched surface is then modified by the addition of an octadecyl moiety using a silanization/hydrosilation procedure. The surface properties of the various etched capillaries are also compared by electroosmotic flow measurements. PMID:15938182

  12. Adsorption/desorption of Cd(II), Cu(II) and Pb(II) using chemically modified orange peel: Equilibrium and kinetic studies

    NASA Astrophysics Data System (ADS)

    Lasheen, Mohamed R.; Ammar, Nabila S.; Ibrahim, Hanan S.

    2012-02-01

    Waste materials from industries such as food processing may act as cost effective and efficient biosorbents to remove toxic contaminants from wastewater. This study aimed to establish an optimized condition and closed loop application of processed orange peel for metals removal. A comparative study of the adsorption capacity of the chemically modified orange peel was performed against environmentally problematic metal ions, namely, Cd 2+, Cu 2+ and Pb 2+, from aqueous solutions. Chemically modified orange peel (MOP) showed a significantly higher metal uptake capacity compared to original orange peel (OP). Fourier Transform Infrared (FTIR) Spectra of peel showed that the carboxylic group peak shifted from 1637 to 1644 cm -1 after Pb (II) ions binding, indicated the involvement of carboxyl groups in Pb(II) ions binding. The metals uptake by MOP was rapid and the equilibrium time was 30 min at constant temperature and pH. Sorption kinetics followed a second-order model. The mechanism of metal sorption by MOP gave good fits for Freundlich and Langmuir models. Desorption of metals and regeneration of the biosorbent was attained simultaneously by acid elution. Even after four cycles of adsorption-elution, the adsorption capacity was regained completely and adsorption efficiency of metal was maintained at around 90%.

  13. Microwave-assisted catalytic fast pyrolysis of biomass for bio-oil production using chemical vapor deposition modified HZSM-5 catalyst.

    PubMed

    Zhang, Bo; Zhong, Zhaoping; Chen, Paul; Ruan, Roger

    2015-12-01

    Chemical vapor deposition with tetra-ethyl-orthosilicate as the modifier was applied to deposit the external acid sites of HZSM-5, and the modified HZSM-5 samples were used for the microwave-assisted catalytic fast pyrolysis (MACFP) of biomass for bio-oil production. The experimental results showed that the external acid sites of HZSM-5 decreased significantly when SiO2 deposited amount increased from 0% to 5.9%. For product distribution, the coke yield decreased, the oil fraction yield decreased at first and then increased, and the yields of water and gas first increased and then decreased over the range of SiO2 deposited amount studied. For chemical compositions in oil fraction, the relative contents of aliphatic hydrocarbons, aromatic hydrocarbons and oxygen-containing aromatic compounds first increased to maximum values and then decreased, while the relative content of oxygen-containing aliphatic compounds first decreased and then increased with increasing SiO2 deposited amount. PMID:26318925

  14. Study of the roles of chemical modifiers in determining boron using graphite furnace atomic absorption spectrometry and optimization of the temperature profile during atomization.

    PubMed

    Yamamoto, Yuhei; Shirasaki, Toshihiro; Yonetani, Akira; Imai, Shoji

    2015-01-01

    The measurement conditions for determining boron using graphite furnace-atomic absorption spectrometry (GF-AAS) were investigated. Differences in the boron absorbance profiles were found using three different commercially available GF-AAS instruments when the graphite atomizers in them were not tuned. The boron absorbances found with and without adjusting the graphite atomizers suggested that achieving an adequate absorbance for the determination of boron requires a sharp temperature profile that overshoots the target temperature during the atomization process. Chemical modifiers that could improve the boron absorbance without the need for using coating agents were tested. Calcium carbonate improved the boron absorbance but did not suppress variability in the peak height. Improvement of boron absorbance was comparatively less using iron nitrate or copper nitrate than using calcium carbonate, but variability in the peak height was clearly suppressed using iron nitrate or copper nitrate. The limit of detection was 0.0026 mg L(-1) when iron nitrate was used. It appears that iron nitrate is a useful new chemical modifier for the quick and simple determination of boron using GF-AAS. PMID:25958863

  15. Remarkable enhancement in the Kapitza resistance and electron potential barrier of chemically modified In2O3(ZnO)9 natural superlattice interfaces.

    PubMed

    Liang, Xin

    2015-11-28

    Superlattice interfaces can efficiently scatter phonons and filter low-energy electrons, thereby reducing the thermal conductivity to the "alloy limit" of crystalline solids and increasing the Seebeck coefficient substantially. In this paper, we report a two-fold reduction in the thermal conductivity and an improvement of about 170% in the Seebeck coefficient of an existing In2O3(ZnO)9 superlattice by chemically modifying the interface with small additions of aluminum. Using a classical model for the interface transport, we attribute such significant changes to the increase in both the Kapitza (thermal) resistance and the electron potential barrier height of the InO2(-) superlattice interfaces that are modified by Al(3+). The present work opens a new avenue of research showing that the superlattice interfaces can be chemically tuned for specific properties, which can be investigated in both experimental and computational ways, and also suggests a new route for material design for applications in areas like thermoelectrics. PMID:26477746

  16. Deposition of gold nano-particles and nano-layers on polyethylene modified by plasma discharge and chemical treatment

    NASA Astrophysics Data System (ADS)

    Švorčík, V.; Chaloupka, A.; Záruba, K.; Král, V.; Bláhová, O.; Macková, A.; Hnatowicz, V.

    2009-08-01

    Polyethylene (PE) was treated in Ar plasma discharge and then grafted from methanol solution of 1,2-ethanedithiol to enhance adhesion of gold nano-particles or sputtered gold layers. The modified PE samples were either immersed into freshly prepared colloid solution of Au nano-particles or covered by sputtered, 50 nm thick gold nano-layer. Properties of the plasma modified, dithiol grafted and gold coated PE were studied using XPS, UV-VIS, AFM, EPR, RBS methods and nanoindentation. It was shown that the plasma treatment results in degradation of polymer chain, creation of excessive free radicals and conjugated double bonds. After grafting with 1,2-ethanedithiol the concentration of free radicals declined but the concentration of double bonds remained unchanged. Plasma treatment changes PE surface morphology and increases surface roughness too. Another significant change in the surface morphology and roughness was observed after deposition of Au nano-particles. The presence of Au on the sample surface after the coating with Au nano-particles was proved by XPS and RBS methods. Nanoindentation measurements shown that the grafting of plasma activated PE surface with dithiol increases significantly adhesion of sputtered Au nano-layer.

  17. Affinity selection of chemically modified proteins: role of lysyl residues in the binding of calmodulin to calcineurin

    SciTech Connect

    Manalan, A.S.; Klee, C.B.

    1987-03-10

    In affinity selection, calcineurin selects from a population of randomly modified calmodulins those species with which it prefers to interact. The method shows that acetylation of lysines affects calmodulin so as to interfere with its ability to interact with calcineurin. Monoacetylation of any lysine of calmodulin reduces its affinity for calcineurin by 5-10-fold. Multiple acetylations amplify the loss of affinity; none of the modifications are incompatible with activity. The lack of selective of calcineurin against any particular modified lysine indicates that the loss of affinity reflects changes induced by the removal of the charged groups and suggests an important role for electrostatic interactions in the cooperative structural transitions which calmodulin undergoes upon binding its target proteins or calcium. In the presence of calcineurin, a large and specific decrease in the rate of acetylation of Lys-75 and -148 of calmodulin is observed. The reactivity of the same residues is greatly increased in the presence of calcium alone. Their reactivity changes in opposite directions in response to calcium-induced or calcineurin-induced structural changes. The reactivity of other residues such as Lys-21, decreased in the presence of calcineurin but not calcium, is also affected by a conformational change which is induced specifically by calcineurin. Radiolabelled calmodulin was purified by HPLC.

  18. Chemical modification of poly(ethylene terephthalate) and immobilization of the selected enzymes on the modified film

    NASA Astrophysics Data System (ADS)

    Irena, Gancarz; Jolanta, Bryjak; Karolina, Zynek

    2009-07-01

    Poly(ethylene terephthalate) (PET) film was modified by reaction with hydrazine (HD), ethylenediamine (EDA), 1,2-diaminopropane (1,2-DAP) and 1,3-diaminopropane (1,3-DAP). The maximal amount of amine functionalities introduced in the chosen conditions on the surface was found as 0.07, 3.35, 0.76 and 1.99 nmol cm -2 for HD, EDA, 1,2-DAP and 1,3-DAP respectively. During the modification process etching of the sample and an increase of stiffness takes place. FTIR-ATR spectra prove that the surface chemistry after modification in amine solution is very complex. The lack of clear correlation between the surface tension and surface concentration of amine functionalities seems to confirm that. For immobilization purpose invertase, laccase and tyrosinase were used. The amount of covalently attached proteins at first increases with the increase of surface concentration of amine groups but after reaching a certain level of amine groups, decrease of the immobilization level was observed. All enzymes tested showed highest activity for a moderate level of aminolysis and this activity had the highest values for EDA-modified PET.

  19. Tailoring the physical properties of Ni-based single-phase equiatomic alloys by modifying the chemical complexity

    NASA Astrophysics Data System (ADS)

    Jin, K.; Sales, B. C.; Stocks, G. M.; Samolyuk, G. D.; Daene, M.; Weber, W. J.; Zhang, Y.; Bei, H.

    2016-02-01

    Equiatomic alloys (e.g. high entropy alloys) have recently attracted considerable interest due to their exceptional properties, which might be closely related to their extreme disorder induced by the chemical complexity. In order to understand the effects of chemical complexity on their fundamental physical properties, a family of (eight) Ni-based, face-center-cubic (FCC), equiatomic alloys, extending from elemental Ni to quinary high entropy alloys, has been synthesized, and their electrical, thermal, and magnetic properties are systematically investigated in the range of 4-300 K by combining experiments with ab initio Korring-Kohn-Rostoker coherent-potential-approximation (KKR-CPA) calculations. The scattering of electrons is significantly increased due to the chemical (especially magnetic) disorder. It has weak correlation with the number of elements but strongly depends on the type of elements. Thermal conductivities of the alloys are largely lower than pure metals, primarily because the high electrical resistivity suppresses the electronic thermal conductivity. The temperature dependence of the electrical and thermal transport properties is further discussed, and the magnetization of five alloys containing three or more elements is measured in magnetic fields up to 4 T.

  20. Tailoring the physical properties of Ni-based single-phase equiatomic alloys by modifying the chemical complexity

    DOE PAGESBeta

    Jin, Ke; Sales, Brian C.; Stocks, George Malcolm; Samolyuk, German D.; Daene, Markus; Weber, William J.; Zhang, Yanwen; Bei, Hongbin

    2016-02-01

    We discovered that equiatomic alloys (e.g. high entropy alloys) have recently attracted considerable interest due to their exceptional properties, which might be closely related to their extreme disorder induced by the chemical complexity. To understand the effects of chemical complexity on their fundamental physical properties, a family of (eight) Ni-based, face-center-cubic (FCC), equiatomic alloys, extending from elemental Ni to quinary high entropy alloys, has been synthesized, and their electrical, thermal, and magnetic properties are systematically investigated in the range of 4–300 K by combining experiments with ab initio Korring-Kohn-Rostoker coherent-potential-approximation (KKR-CPA) calculations. The scattering of electrons is significantly increased duemore » to the chemical (especially magnetic) disorder. It has weak correlation with the number of elements but strongly depends on the type of elements. Thermal conductivities of the alloys are largely lower than pure metals, primarily because the high electrical resistivity suppresses the electronic thermal conductivity. Moreover, the temperature dependence of the electrical and thermal transport properties is further discussed, and the magnetization of five alloys containing three or more elements is measured in magnetic fields up to 4 T.« less

  1. Tailoring the physical properties of Ni-based single-phase equiatomic alloys by modifying the chemical complexity

    PubMed Central

    Jin, K.; Sales, B. C.; Stocks, G. M.; Samolyuk, G. D.; Daene, M.; Weber, W. J.; Zhang, Y.; Bei, H.

    2016-01-01

    Equiatomic alloys (e.g. high entropy alloys) have recently attracted considerable interest due to their exceptional properties, which might be closely related to their extreme disorder induced by the chemical complexity. In order to understand the effects of chemical complexity on their fundamental physical properties, a family of (eight) Ni-based, face-center-cubic (FCC), equiatomic alloys, extending from elemental Ni to quinary high entropy alloys, has been synthesized, and their electrical, thermal, and magnetic properties are systematically investigated in the range of 4–300 K by combining experiments with ab initio Korring-Kohn-Rostoker coherent-potential-approximation (KKR-CPA) calculations. The scattering of electrons is significantly increased due to the chemical (especially magnetic) disorder. It has weak correlation with the number of elements but strongly depends on the type of elements. Thermal conductivities of the alloys are largely lower than pure metals, primarily because the high electrical resistivity suppresses the electronic thermal conductivity. The temperature dependence of the electrical and thermal transport properties is further discussed, and the magnetization of five alloys containing three or more elements is measured in magnetic fields up to 4 T. PMID:26832223

  2. Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases.

    PubMed

    Krylov, Alexander A; Kolontaevsky, Egor E; Mashko, Sergey V

    2014-10-01

    Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotide-mediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4±0.3)×10(3) and (6.7±1.3)×10(3) streptomycin-resistant colonies per 10(8) viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5' ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. PMID:25087479

  3. Injection site reactions after subcutaneous oligonucleotide therapy.

    PubMed

    van Meer, Leonie; Moerland, Matthijs; Gallagher, Jolie; van Doorn, Martijn B A; Prens, Errol P; Cohen, Adam F; Rissmann, Robert; Burggraaf, Jacobus

    2016-08-01

    Oligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including more severe manifestations such as ulceration or necrosis. These injection site reactions (ISRs) are common, but rather poorly described in the literature. With this review, we aim to provide an overview on the extent of the problem of ISRs, based on reported incidence. A structured literature search was performed to identify reported incidence and clinical features of ISRs which yielded 70 manuscripts that contained information regarding ISRs. The data from literature was combined with data on file available at our institution. All sc administered ONs described in the literature lead to the occurrence of ISRs. The percentage of trial subjects that developed ISRs ranged from 22 to 100% depending on ON. The majority of ONs caused ISRs in more than 70% of the trial subjects. The severity of the observed reactions varied between different ONs. Occurrence rate as well as severity of ISRs increases with higher doses. For chemistry and target of the compounds, no clear association regarding ISR incidence or severity was identified. All ONs developed to date are associated with ISRs. Overcoming the problem of ISRs might add greatly to the potential success of sc-administered ONs. Knowledge of these skin reactions and their specific immunostimulatory properties should be increased in order to obtain ONs that are more suitable for long-term use and clinically applicable in a broader patient population. PMID:27061947

  4. Mechanism of oligonucleotide release from cationic liposomes.

    PubMed Central

    Zelphati, O; Szoka, F C

    1996-01-01

    We propose a mechanism for oligonucleotide (ODN) release from cationic lipid complexes in cells that accounts for various observations on cationic lipid-nucleic acid-cell interactions. Fluorescent confocal microscopy of cells treated with rhodamine-labeled cationic liposome/ fluorescein-labeled ODN (F-ODN) complexes show the F-ODN separates from the lipid after internalization and enters the nucleus leaving the fluorescent lipid in cytoplasmic structures. ODN displacement from the complex was studied by fluorescent resonance energy transfer. Anionic liposome compositions (e.g., phosphatidylserine) that mimic the cytoplasmic facing monolayer of the cell membrane released ODN from the complex at about a 1:1 (-/+) charge ratio. Release was independent of ionic strength and pH. Physical separation of the F-ODN from monovalent and multivalent cationic lipids was confirmed by gel electrophoresis. Fluid but not solid phase anionic liposomes are required, whereas the physical state of the cationic lipids does not effect the release. Water soluble molecules with a high negative linear charge density, dextran sulfate, or heparin also release ODN. However, ATP, spermidine, spermine, tRNA, DNA, polyglutamic acid, polylysine, bovine serum albumin, or histone did not release ODN, even at 100-fold charge excess (-/+). Based upon these results, we propose that the complex, after internalization by endocytosis, induces flip-flop of anionic lipids from the cytoplasmic facing monolayer. Anionic lipids laterally diffuse into the complex and form a charged neutralized ion-pair with the cationic lipids. This leads to displacement of the ODN from the cationic lipid and its release into the cytoplasm. Images Fig. 1 Fig. 3 PMID:8876163

  5. Piezoelectric Sensor for Determination of Genetically Modified Soybean Roundup Ready® in Samples not Amplified by PCR

    PubMed Central

    Stobiecka, Magdalena; Cieśla, Jarosław M.; Janowska, Beata; Tudek, Barbara; Radecka, Hanna

    2007-01-01

    The chemically modified piezoelectrodes were utilized to develop relatively cheap and easy to use biosensor for determination of genetically modified Roundup Ready soybean (RR soybean). The biosensor relies on the immobilization onto gold piezoelectrodes of the 21-mer single stranded oligonucleotide (probes) related to 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, which is an active component of an insert integrated into RR soybean genome. The hybridization reaction between the probe and the target complementary sequence in solution was monitored. The system was optimized using synthetic oligonucleotides, which were applied for EPSPS gene detection in DNA samples extracted from animal feed containing 30% RR soybean amplified by the PCR and nonamplified by PCR. The detection limit for genomic DNA was in the range of 4.7·105 numbers of genom copies contained EPSPS gene in the QCM cell. The properties such as sensitivity and selectivity of piezoelectric senor presented here indicated that it could be applied for the direct determination of genetically modified RR soybean in the samples non-amplified by PCR.

  6. Chemically modified polymeric resins for solid-phase extraction and group separation prior to analysis by liquid or gas chromatography

    SciTech Connect

    Schmidt, L.W.

    1993-07-01

    Polystyrene divinylbenzene was modified by acetyl, sulfonic acid, and quaternary ammonium groups. A resin functionalized with an acetyl group was impregnated in a PTFE membrane and used to extract and concentrate phenolic compounds from aqueous samples. The acetyl group created a surface easily wetted, making it an efficient adsorbent for polar compounds in water. The membrane stabilized the resin bed. Partially sulfonated high surface area resins are used to extract and group separate an aqueous mixture of neutral and basic organics; the bases are adsorbed electrostatically to the sulfonic acid groups, while the neutraons are adsorbed hydrophobically. A two-step elution is then used to separate the two fractions. A partially functionalized anion exchange resin is used to separate organic acids and phenols from neutrals in a similar way. Carboxylic acids are analyzed by HPLC and phenols by GC.

  7. Solid-phase synthesis of chelate-labelled oligonucleotides: application in triple-color ligase-mediated gene analysis.

    PubMed Central

    Kwiatkowski, M; Samiotaki, M; Lamminmäki, U; Mukkala, V M; Landegren, U

    1994-01-01

    Oligonucleotides labelled with detectable groups are essential tools in gene detection. We describe here the synthesis of pyrimidine deoxynucleotide-building blocks, modified at their C-5 position with a protected form of a strongly chelating agent. These reagents can be used to introduce multiple metal ions into oligodeoxynucleotides during standard oligonucleotide synthesis. The chelating functions form strongly fluorescent complexes with europium ions, characterized by a wide separation between the excitation and emission spectra. Moreover, the long decay time of the fluorescence permits sensitive time-resolved fluorescence measurements. The chelates also have the stability required to function in triple-color assays involving europium, samarium, and terbium ions. We demonstrate the application of these reagents for ligase-based gene analysis reactions. PMID:8041624

  8. Chemical derivatization of compact disc polycarbonate surfaces for SNPs detection.

    PubMed

    Bañuls, María-José; García-Piñón, Francisco; Puchades, Rosa; Maquieira, Angel

    2008-03-01

    Compact discs have been proposed as an efficient analytical platform, with potential to develop high-throughput affinity assays for genomics, proteomics, clinics, and health monitoring. Chemical derivatization of CD surfaces is one of the keys to developing highly efficient microarraying-based assays on discs. Approaches for mild chemical modification of polycarbonate (PC) disc surface based on nitration, reduction, and chloromethylation reactions have been developed. Derivatized surfaces as amino and thiol are obtained for PC, maintaining unchanged the mechanical and optical properties of the discs. Studies of covalent attachment of oligonucleotide probes (5' Cy5-labeled, 3' NH 2-ended) on the modified surfaces have been performed to develop microarraying assays based on hybridization of cDNA strands and single nucleotide polymorphism discrimination (SNPs). A demonstration of the applicability to the compact disc audio/video technology for its use as analytical system is performed, including the employment of a commercial CD player to read the results on disc. PMID:18254580

  9. Analysis of carbon forms in chemically-modified peat humic acids by partial least squares regression analysis of solid-state nuclear magnetic resonance spectra

    NASA Astrophysics Data System (ADS)

    Almendros, G.; Hernández, Z.; González-Vila, F. J.; Sanz, J.; De la Rosa, J. M.; Knicker, H.

    2012-04-01

    Classical structural studies on soil organic matter often show that the natural variability in C- and N forms in soil humic acids (HAs) is in many cases not enough to distinguish significant differences amongst HAs from different origin. In the present research contrasting C-distribution patterns are obtained when the HAs are modified in the laboratory through chemical treatments (derivatization reactions or methods focused to incorporation or removal of specific structural constituents). For instance, oxygen functionality can be modified by introducing or blocking the major functional groups (methylation, acetylation, oximation, nitration, sulphonation, etc). Other treatments lead to selective hydrolysis or drastic peroxydation of the HA carbon backbone. Apart from this, N-groups can be introduced in the HA structure by e.g., nitration, oximation, amidation or ammonification. A series of chemically-modified HA preparations were obtained from a sapric peat (Vivero peat, Northern Spain) and their 13C nuclear magnetic resonance spectra (13C NMR) were obtained, showing the success of the above treatments which lead to contrasted NMR profiles. This set of 12 HA preparations was considered suitable material to assess the extent to which 13C NMR spectroscopy reflect the induced structural modifications, as well as to help the assignation of signals in conflicting chemical shift ranges. In order to improve the interpretation of the 13C NMR spectra, partial least squares regression (PLS) was used as a multivariate chemometric tool based on covariance. This is a convenient method in cases where the number of variables (spectral points in the 200-(-25) ppm spectral range with 1-ppm resolution) is high as regards the number of individuals (modified HAs), mainly when there is large redundancy in data sets of variables mutually correlated. The spectroscopic information in the spectral matrix is processed by successively examining independent variables from an external matrix of

  10. Strand-Specificity in the Transformation of Yeast with Synthetic Oligonucleotides

    PubMed Central

    Yamamoto, T.; Moerschell, R. P.; Wakem, L. P.; Komar-Panicucci, S.; Sherman, F.

    1992-01-01

    Cyc1 mutants of the yeast Saccharomyces cerevisiae were directly transformed with both sense and antisense oligonucleotides to examine the involvement of the two genomic DNA strands in transformation. Sense oligonucleotides yielded approximately 20-fold more transformants than antisense oligonucleotides. This differential effect was observed with oligonucleotides designed to make alterations at six different sites along the gene and was independent of the oligonucleotide sequence and length, number of mismatches and the host strain. Competition studies showed that antisense oligonucleotides did not inhibit transformation. Although the mechanism for this strand specificity is unknown, this difference was maintained even when CYC1 transcription was diminished to approximately 2% of the normal level. PMID:1325385

  11. The preparation of site-specifically modified riboswitch domains as an example for enzymatic ligation of chemically synthesized RNA fragments.

    PubMed

    Lang, Kathrin; Micura, Ronald

    2008-01-01

    This protocol describes an efficient method for the preparation of riboswitch domains comprising up to approximately 200 nt containing site-specific nucleoside modifications. The strategy is based on enzymatic ligation of chemically synthesized RNA fragments. The design of ligation sites strictly follows the criterion that all fragments comprise less than approximately 50 nt. This allows the researcher to rely on custom synthesis services and to utilize the large pool of commercially available, functionalized nucleoside phosphoramidites for solid-phase RNA synthesis. Importantly, this design renders utmost flexibility to position a chemical modification (e.g., a fluorescence label) within the RNA. Selection of the appropriate ligation type (using T4 RNA or T4 DNA ligase) is subordinate to the criteria above and is detailed in the protocol. The whole concept is demonstrated for 2-aminopurine containing thiamine pyrophosphate responsive riboswitch domains that are applied in fluorescence spectroscopic folding studies. Labeled samples in 5-35 nmol quantities are obtained within 3-4 d, not including the time for fragment synthesis. PMID:18772873

  12. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  13. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B

    1989-01-01

    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  14. Reversal of phenotypes in MECP2 duplication mice using genetic rescue or antisense oligonucleotides.

    PubMed

    Sztainberg, Yehezkel; Chen, Hong-mei; Swann, John W; Hao, Shuang; Tang, Bin; Wu, Zhenyu; Tang, Jianrong; Wan, Ying-Wooi; Liu, Zhandong; Rigo, Frank; Zoghbi, Huda Y

    2015-12-01

    Copy number variations have been frequently associated with developmental delay, intellectual disability and autism spectrum disorders. MECP2 duplication syndrome is one of the most common genomic rearrangements in males and is characterized by autism, intellectual disability, motor dysfunction, anxiety, epilepsy, recurrent respiratory tract infections and early death. The broad range of deficits caused by methyl-CpG-binding protein 2 (MeCP2) overexpression poses a daunting challenge to traditional biochemical-pathway-based therapeutic approaches. Accordingly, we sought strategies that directly target MeCP2 and are amenable to translation into clinical therapy. The first question that we addressed was whether the neurological dysfunction is reversible after symptoms set in. Reversal of phenotypes in adult symptomatic mice has been demonstrated in some models of monogenic loss-of-function neurological disorders, including loss of MeCP2 in Rett syndrome, indicating that, at least in some cases, the neuroanatomy may remain sufficiently intact so that correction of the molecular dysfunction underlying these disorders can restore healthy physiology. Given the absence of neurodegeneration in MECP2 duplication syndrome, we propose that restoration of normal MeCP2 levels in MECP2 duplication adult mice would rescue their phenotype. By generating and characterizing a conditional Mecp2-overexpressing mouse model, here we show that correction of MeCP2 levels largely reverses the behavioural, molecular and electrophysiological deficits. We also reduced MeCP2 using an antisense oligonucleotide strategy, which has greater translational potential. Antisense oligonucleotides are small, modified nucleic acids that can selectively hybridize with messenger RNA transcribed from a target gene and silence it, and have been successfully used to correct deficits in different mouse models. We find that antisense oligonucleotide treatment induces a broad phenotypic rescue in adult

  15. Nonconventional chemical inhibitors of microRNA: therapeutic scope.

    PubMed

    Jayaraj, Gopal Gunanathan; Nahar, Smita; Maiti, Souvik

    2015-01-18

    MicroRNAs (miRNAs) are a class of genomically encoded small RNA molecules (∼22nts in length), which regulate gene expression post transcriptionally. The term microRNA or miRNA was coined in 2001, and research in the past decade has shed light on their widespread occurrence, evolutionary conservation and tissue specific functions. It is estimated that they modulate the gene expression of approximately 60% of the mammalian genes by regulating the levels of target mRNAs to which they can bind on the basis of sequence complementarities. miRNAs are produced in a well coordinated series of steps from being transcribed in the nucleus to exerting their function in the cytoplasm. miRNAs are now implicated in diverse biological phenomena ranging from development to stress response which makes miRNAs one of the central regulatory molecules which modulate information flow along the central dogma of gene expression. More importantly, like any regulatory molecule, deregulation of miRNAs is causally associated with several diseases (mainly cancer) and is directly involved in a variety of pathophysiologies owing to their aberrant expression. Thus, modulation of miRNA levels is of prime therapeutic importance. Conventional methods of miRNA knockdown using chemically modified antisense-oligonucleotides have been explored extensively but face the challenges of modes of delivery, biostability and biodistribution. This calls for the development of more alternative and non-conventional methods to target miRNA. Small molecules targeting RNA chemical and structural space provide one such timely opportunity. In this article we first provide a brief overview of miRNA biogenesis and its disease associations. We then summarize the major developments in conventional oligonucleotide based approaches to miRNA knockdown and its status. We then focus on the more non-conventional methods like oligonucleotide enzymes and small molecules and provide an outlook on the future of such methods. PMID

  16. Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease Resistance, and Crystal Structure of Ten 2'-O-Ribonucleic Acid Modifications

    SciTech Connect

    Egli, Martin; Minasov, George; Tereshko, Valentina; Pallan, Pradeep S.; Teplova, Marianna; Inamati, Gopal B.; Lesnik, Elena A.; Owens, Steve R.; Ross, Bruce S.; Prakash, Thazha P.; Manoharan, Muthiah

    2010-03-05

    The syntheses of 10 new RNA 2'-O-modifications, their incorporation into oligonucleotides, and an evaluation of their properties such as RNA affinity and nuclease resistance relevant to antisense activity are presented. All modifications combined with the natural phosphate backbone lead to significant gains in terms of the stability of hybridization to RNA relative to the first-generation DNA phosphorothioates (PS-DNA). The nuclease resistance afforded in particular by the 2'-O-modifications carrying a positive charge surpasses that of PS-DNA. However, small electronegative 2'-O-substituents, while enhancing the RNA affinity, do not sufficiently protect against degradation by nucleases. Similarly, oligonucleotides containing 3'-terminal residues modified with the relatively large 2'-O-[2-(benzyloxy)ethyl] substituent are rapidly degraded by exonucleases, proving wrong the assumption that steric bulk will generally improve protection against nuclease digestion. To analyze the factors that contribute to the enhanced RNA affinity and nuclease resistance we determined crystal structures of self-complementary A-form DNA decamer duplexes containing single 2'-O-modified thymidines per strand. Conformational preorganization of substituents, favorable electrostatic interactions between substituent and sugar-phosphate backbone, and a stable water structure in the vicinity of the 2'-O-modification all appear to contribute to the improved RNA affinity. Close association of positively charged substituents and phosphate groups was observed in the structures with modifications that protect most effectively against nucleases. The promising properties exhibited by some of the analyzed 2'-O-modifications may warrant a more detailed evaluation of their potential for in vivo antisense applications. Chemical modification of RNA can also be expected to significantly improve the efficacy of small interfering RNAs (siRNA). Therefore, the 2'-O-modifications introduced here may benefit the

  17. The Role of Genotypes That Modify the Toxicity of Chemical Mutagens in the Risk for Myeloproliferative Neoplasms

    PubMed Central

    Gross-Davis, Carol Ann; Heavner, Karyn; Frank, Arthur L.; Newschaffer, Craig; Klotz, Judith; Santella, Regina M.; Burstyn, Igor

    2015-01-01

    Background: The etiology of myeloproliferative neoplasms (MPN) (polycythemia vera; essential thrombocythemia; primary myelofibrosis) is unknown, however they are associated with a somatic mutation—JAK2 V617F—suggesting a potential role for environmental mutagens. Methods: We conducted a population-based case-control study in three rural Pennsylvania counties of persons born 1921–1968 and residing in the area between 2000–2008. Twenty seven MPN cases and 292 controls were recruited through random digit dialing. Subjects were genotyped and odds ratios estimated for a select set of polymorphisms in environmentally sensitive genes that might implicate specific environmental mutagens if found to be associated with a disease. Results: The presence of NAT2 slow acetylator genotype, and CYP1A2, GSTA1, and GSTM3 variants were associated with an average 3–5 fold increased risk. Conclusions: Exposures, such as to aromatic compounds, whose toxicity is modified by genotypes associated with outcome in our analysis may play a role in the environmental etiology of MPNs. PMID:25719551

  18. Non-radioactive detection of oligonucleotide probes by photochemical amplification of dioxetanes.

    PubMed Central

    Schubert, F; Knaf, A; Möller, U; Cech, D

    1995-01-01

    We describe a new method of non-radioactive labelling and detection of oligonucleotide probes. The approach is based on a simple chemical principle. Oligonucleotides labelled with methylene blue (a photosensitizer) are hybridized on a membrane to immobilized DNA target sequences. After hybridization and stringency washing 2(-)[3-(hydroxyphenyl)methoxymethylene] adamantane is added to the membrane and the membrane is irradiated with a tungsten lamp light source through a cut-off filter. Thermally stable dioxetanes are amplified during irradiation at the positions of the labelled probe. These amplified dioxetanes are detected using chemically triggered chemiluminescent decay. Signals are recorded on commercial X-ray film. Detection is possible immediately after the last washing step and a hard copy of the blot is obtained within 1 h. Dependent on the level of the target sequences, the sensitivity of the method allows detection of 0.3 pg single-stranded M13mp18(+) plasmid DNA in dot blots and 75 pg in Southern blots. Additional immunological reaction steps and washing steps with blocking reagents and buffers are avoided. Furthermore, expensive reagents and equipment for physical detection are not necessary. The method might be particularly useful for fast routine analysis in forensic and medical applications. The synthesis of the olefin, conditions of hybridization and the protocol of detection are described in detail. Images PMID:8524657

  19. OMA and OPA—Software-Supported Mass Spectra Analysis of Native and Modified Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Nyakas, Adrien; Blum, Lorenz C.; Stucki, Silvan R.; Reymond, Jean-Louis; Schürch, Stefan

    2013-02-01

    The platform-independent software package consisting of the oligonucleotide mass assembler (OMA) and the oligonucleotide peak analyzer (OPA) was created to support the analysis of oligonucleotide mass spectra. It calculates all theoretically possible fragments of a given input sequence and annotates it to an experimental spectrum, thus, saving a large amount of manual processing time. The software performs analysis of precursor and product ion spectra of oligonucleotides and their analogues comprising user-defined modifications of the backbone, the nucleobases, or the sugar moiety, as well as adducts with metal ions or drugs. The ability to expand the library of building blocks and to implement individual structural variations makes it extremely useful for supporting the analysis of therapeutically active compounds. The functionality of the software tool is demonstrated on the examples of a platinated double-stranded oligonucleotide and a modified RNA sequence. Experiments also reveal the unique dissociation behavior of platinated higher-order DNA structures.

  20. Synthesis and characterization of a photosensitive interface for hydrogen generation: Chemically modified p-type semiconducting silicon photocathodes

    PubMed Central

    Bookbinder, Dana C.; Bruce, James A.; Dominey, Raymond N.; Lewis, Nathan S.; Wrighton, Mark S.

    1980-01-01

    p-Si photocathodes functionalized first with an N,N′-dialkyl-4,4′-bipyridinium redox reagent, (PQ2+/+-)surf, and then with a Pt precursor, PtCl62-, give significant efficiency (up to 5%) for photoelectrochemical H2 generation with 632.8-nm light. Naked p-Si photocathodes give nearly zero efficiency, owing to poor H2 evolution kinetics that are improved by the (PQ2+/+-)surf/Pt modification. The mechanism of H2 evolution from p-Si/(PQ2+/+-)surf/Pt is first photoexcitation of electrons to the conduction band of Si followed by (PQ2+)surf → (PQ+-)surf reduction. The dispersion of Pt then catalyzes H2O reduction to give H2 and regeneration of (PQ2+)surf. The overall energy conversion efficiency rivals the best direct optical to chemical conversion systems reported to date. PMID:16592907