Science.gov

Sample records for children immunization monitoring

  1. Immunization Schedules for Infants and Children

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Infants and Children Recommend on Facebook ... any questions. View or Print a Schedule Recommended Immunizations for Children (Birth through 6 years) Schedule for ...

  2. Immunization in children with chronic renal failure.

    PubMed

    Laube, Guido F; Berger, Christoph; Goetschel, Philippe; Leumann, Ernst; Neuhaus, Thomas J

    2002-08-01

    Infections jeopardize children on immunosuppression after organ transplantation. Immunization is protective in healthy children. The aims of this study were to analyze the rate and efficacy of immunization in 62 children undergoing dialysis and renal transplantation (RTPL) between 1987 and 2000. The analysis was based on clinical findings, vaccination certificates, and measurement of specific serum antibodies. A member of the renal unit administered vaccinations. All 62 patients were immunized against diphtheria, tetanus, pertussis, poliomyelitis, measles, mumps, rubella, and hepatitis B. Since introduction in 1991 and 1995, 44 and 42 children were also vaccinated against influenza and Hemophilus influenzae type b, respectively. Of 16 patients with a negative history, 14 were given varicella vaccine; 16 children on peritoneal dialysis (PD) or with nephrotic syndrome were immunized against Streptococcus pneumoniae. All vaccinated patients had detectable serum antibodies against measles, mumps, rubella, varicella, hepatitis B, H. influenzae, and S. pneumoniae. There were 3 infections despite vaccination; 1 patient developed varicella after RTPL and 1 patient on PD had 2 episodes of peritonitis caused by H. influenzae and S. pneumoniae. In conclusion, monitoring and administration of the vaccines by the renal team enabled a high immunization rate. Whether vaccines, as documented by antibody titers, or by the low prevalence in the general population promoted the low prevalence of infections remains open, as there were at least a few vaccination failures. PMID:12185473

  3. Children's Rights: Monitoring Issues.

    ERIC Educational Resources Information Center

    Verhellen, Eugeen, Ed.; Spiesschaert, Frans, Ed.

    A number of research seminars were organized to clarify the fundamental principles underlying local, regional, and international efforts to establish a structure for monitoring and promoting children's rights. This book contains papers presented at these seminars by experts on child advocacy, promotion of children's interests by children, and…

  4. Monitoring asthma in children.

    PubMed

    Pijnenburg, Mariëlle W; Baraldi, Eugenio; Brand, Paul L P; Carlsen, Kai-Håkon; Eber, Ernst; Frischer, Thomas; Hedlin, Gunilla; Kulkarni, Neeta; Lex, Christiane; Mäkelä, Mika J; Mantzouranis, Eva; Moeller, Alexander; Pavord, Ian; Piacentini, Giorgio; Price, David; Rottier, Bart L; Saglani, Sejal; Sly, Peter D; Szefler, Stanley J; Tonia, Thomy; Turner, Steve; Wooler, Edwina; Lødrup Carlsen, Karin C

    2015-04-01

    The goal of asthma treatment is to obtain clinical control and reduce future risks to the patient. To reach this goal in children with asthma, ongoing monitoring is essential. While all components of asthma, such as symptoms, lung function, bronchial hyperresponsiveness and inflammation, may exist in various combinations in different individuals, to date there is limited evidence on how to integrate these for optimal monitoring of children with asthma. The aims of this ERS Task Force were to describe the current practise and give an overview of the best available evidence on how to monitor children with asthma. 22 clinical and research experts reviewed the literature. A modified Delphi method and four Task Force meetings were used to reach a consensus. This statement summarises the literature on monitoring children with asthma. Available tools for monitoring children with asthma, such as clinical tools, lung function, bronchial responsiveness and inflammatory markers, are described as are the ways in which they may be used in children with asthma. Management-related issues, comorbidities and environmental factors are summarised. Despite considerable interest in monitoring asthma in children, for many aspects of monitoring asthma in children there is a substantial lack of evidence. PMID:25745042

  5. Monitoring immune responses in the tumor microenvironment.

    PubMed

    Wargo, Jennifer A; Reddy, Sangeetha M; Reuben, Alexandre; Sharma, Padmanee

    2016-08-01

    Immune monitoring in the tumor microenvironment allows for important insights into immune mechanisms of response and resistance to various cancer treatments; however clinical challenges exist using current strategies. Significant questions remain regarding monitoring of archival versus fresh tissue, assessment of static versus dynamic markers, evaluation of limited tissue samples, and the translation of insights gained from immunologically 'hot' tumors such as melanoma to other 'cold' tumor microenvironments prevalent in other cancer types. Current and emerging immune monitoring strategies will be examined herein, and genomic-based assays complementing these techniques will also be discussed. Finally, host genomic and external environmental factors influencing anti-tumor immune responses will be considered, including the role of the gut microbiome. Though optimal immune monitoring techniques are in evolution, great promise exists in recent advances that will help guide patient selection as far as type, sequence, and combination of therapeutic regimens to enhance anti-tumor immunity and clinical responses. PMID:27240055

  6. Editorial: Immune monitoring in solid organ transplantation.

    PubMed

    Shipkova, Maria; Wieland, Eberhard

    2016-03-01

    Solid organ transplantation is inevitably associated with the activation of the immune system of the graft recipient. An advanced knowledge of the immunological mechanisms leading to acute and chronic rejection, the advent of powerful immunosuppressive drugs, and refined surgical techniques have made solid organ transplantation a standard therapy to replace irretrievable loss of vital functions. The immune system is a complex network involving immune cells, cytokines, chemokines, antibodies, and the complement system. Monitoring and ideally influencing the allo-response of the organ recipient against the donor antigens may help to personalize the immunosuppressive therapy including the disclosure of those patients who are suitable for weaning or even discontinuation of immunosuppression. Immune monitoring comprises as plethora of candidate biomarkers capable of reflecting the donor specific and non-donor specific net activation state of the immune system in transplant recipients both before and after initiation of the immunosuppressive therapy. This special issue of Clinical Biochemistry on Immune Monitoring addresses the basic effects of immune activation in solid organ transplantation and critically reviews candidate biomarkers for immune monitoring and their analytical as well as clinical performance. PMID:26794634

  7. Improving Immunizations in Children: A Clinical Break-even Analysis

    PubMed Central

    Jones, Kyle Bradford; Spain, Chad; Wright, Hannah; Gren, Lisa H.

    2015-01-01

    Introduction Immunizing the population is a vital public health priority. This article describes a resident-led continuous quality improvement project to improve the immunization rates of children under 3 years of age at two urban family medicine residency clinics in Salt Lake City, Utah, as well as a break-even cost analysis to the clinics for the intervention. Methods Immunization records were distributed to provider-medical assistant teamlets daily for each pediatric patient scheduled in clinic to decrease missed opportunities. An outreach intervention by letter, followed by telephone call reminders, was conducted to reach children under 3 years of age who were behind on recommended immunizations for age (total n=457; those behind on immunizations n=101). Immunization rates were monitored at 3 months following start of intervention. A break-even analysis to the clinics for the outreach intervention was performed. Results Immunizations were improved from a baseline of 75.1% (n=133) and 79.6% (n=223) at the two clinics to 92.1% (n=163) and 89.6% (n=251), respectively, at 3 months following the start of intervention (P<0.01). The average revenue per immunization given was $81.57. The financial break-even point required 36 immunizations to be administered. Conclusion Significant improvement in the immunization rate of patients under 3 years of age at two family medicine residency training clinics was achieved through decreasing missed opportunities for immunization in clinic, and with outreach through letters and follow-up phone calls. The intervention showed positive revenue to both clinics. PMID:25380614

  8. Systems immune monitoring in cancer therapy.

    PubMed

    Greenplate, Allison R; Johnson, Douglas B; Ferrell, P Brent; Irish, Jonathan M

    2016-07-01

    Treatments that successfully modulate anti-cancer immunity have significantly improved outcomes for advanced stage malignancies and sparked intense study of the cellular mechanisms governing therapy response and resistance. These responses are governed by an evolving milieu of cancer and immune cell subpopulations that can be a rich source of biomarkers and biological insight, but it is only recently that research tools have developed to comprehensively characterize this level of cellular complexity. Mass cytometry is particularly well suited to tracking cells in complex tissues because >35 measurements can be made on each of hundreds of thousands of cells per sample, allowing all cells detected in a sample to be characterized for cell type, signalling activity, and functional outcome. This review focuses on mass cytometry as an example of systems level characterization of cancer and immune cells in human tissues, including blood, bone marrow, lymph nodes, and primary tumours. This review also discusses the state of the art in single cell tumour immunology, including tissue collection, technical and biological quality controls, computational analysis, and integration of different experimental and clinical data types. Ex vivo analysis of human tumour cells complements both in vivo monitoring, which generally measures far fewer features or lacks single cell resolution, and laboratory models, which incur cell type losses, signalling alterations, and genomic changes during establishment. Mass cytometry is on the leading edge of a new generation of cytomic tools that work with small tissue samples, such as a fine needle aspirates or blood draws, to monitor changes in rare or unexpected cell subsets during cancer therapy. This approach holds great promise for dissecting cellular microenvironments, monitoring how treatments affect tissues, revealing cellular biomarkers and effector mechanisms, and creating new treatments that productively engage the immune system to

  9. Immunization for children traveling abroad.

    PubMed

    Sood, S K

    2000-04-01

    More children are travelling these days, often to underdeveloped countries with high prevalence of vaccine-preventable vector-borne, food-borne, zoonotic, and other infections. The pretravel office visit involves consideration of routine and travel vaccines. Epidemiology of typhoid fever, rabies, yellow fever, Japanese encephalitis, vaccines against them, and their recommended use are reviewed. PMID:10761513

  10. Improving the monitoring of immunization services in Kyrgyzstan.

    PubMed

    Weeks, R M; Svetlana, F; Noorgoul, S; Valentina, G

    2000-09-01

    Following the disbanding of the Soviet Union in 1991, the government of Kyrgyzstan was unable to maintain the previous level of health services. To revitalize the health services, the Ministry of Health (MOH) first focused on improving their immunization services, including the immunization component of the Health Management Information System (HMIS). Secondly, to increase immunization coverage, the MOH set as a priority the elimination of prescribing false contraindications to immunization. To accomplish both goals, the MOH updated the national immunization policies and established a more effective structure for managing immunization services. To support the MOH, the US Agency for International Development (USAID) Resources for Child Health (REACH) and Basic Support for Institutionalizing Child Survival (BASICS) projects provided technical assistance through a resident coordinator and consultants, and by organizing an international seminar. The improvements extended beyond systems and forms, but, instead, emphasized monitoring by the frontline health worker and supervising the quality of health information. To accomplish their objectives, the MOH appointed a Working Group to define the problems, revise record-keeping procedures, and develop monitoring tools. This group, representing both national and local levels, was composed of MOH epidemiologists, paediatricians and a management information specialist. To reduce the burden of excessive record-keeping and reporting requirements, the Working Group identified four key indicators for the service delivery level: (1) DPT3 immunization coverage rates for children less than 1 year of age; (2) contraindication rates for DPT; (3) usage of DPT vaccine; and (4) daily refrigerator temperatures. Additional indicators were included at district and provincial levels. After a successful 1-year trial, the MOH implemented the revised HMIS nationally. Not only did the quality of the information system improve, but the new approach

  11. Monitoring Regulatory Immune Responses in Tumor Immunotherapy Clinical Trials

    PubMed Central

    Olson, Brian M.; McNeel, Douglas G.

    2013-01-01

    While immune monitoring of tumor immunotherapy often focuses on the generation of productive Th1-type inflammatory immune responses, the importance of regulatory immune responses is often overlooked, despite the well-documented effects of regulatory immune responses in suppressing anti-tumor immunity. In a variety of malignancies, the frequency of regulatory cell populations has been shown to correlate with disease progression and a poor prognosis, further emphasizing the importance of characterizing the effects of immunotherapy on these populations. This review focuses on the role of suppressive immune populations (regulatory T cells, myeloid-derived suppressor cells, and tumor-associated macrophages) in inhibiting anti-tumor immunity, how these populations have been used in the immune monitoring of clinical trials, the prognostic value of these responses, and how the monitoring of these regulatory responses can be improved in the future. PMID:23653893

  12. Immunization

    MedlinePlus

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against things like measles, ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  13. Immunization

    MedlinePlus

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  14. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.

    PubMed

    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas

    2016-05-18

    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field. PMID:27115249

  15. Immune reconstitution and vaccination outcome in HIV-1 infected children

    PubMed Central

    Cagigi, Alberto; Cotugno, Nicola; Giaquinto, Carlo; Nicolosi, Luciana; Bernardi, Stefania; Rossi, Paolo; Douagi, Iyadh; Palma, Paolo

    2012-01-01

    Current evidence on routine immunization of HIV-1 infected children point out the need for a special vaccine schedule in this population. However, optimal strategies for identifying individuals susceptible to infections, and then offering them sustained protection through appropriate immunization schedule, both in terms of timing and number of vaccine doses, still remain to be elucidated. Understanding the degree of immune recovery after HAART initiation is important in guiding administration of routine vaccination in HIV-1 infected children. Although quantitative measures (e.g., CD4+ T-cell counts and immunoglobulin levels) are frequently performed to evaluate immune parameters, these measures do not fully mirror functional immune recovery. Here, we will review the status of single mandatory and recommended vaccines for HIV-1 infected children in relation to immune recovery after HAART initiation with the aim of identifying new means to help design personalized vaccine schedules for this population. PMID:22906931

  16. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence

    2007-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  17. [The protective role of postvaccinal immunity in mumps in children].

    PubMed

    Zheleznikova, G F; Ivanova, V V; Bekhtereva, M K; Gnilevskaia, Z U; Monakhova, N E; Novozhilova, E V; Goleva, O V; Sizemov, A N

    2000-01-01

    The immunological study of children with infectious parotitis (IP) without complications and with such complications as pancreatitis, meningitis or orchitis in the glandular form was carried out. In accordance with the previously proposed principle, 4 types of immune response (IR) were established on the basis of differences in initial resistance and the IR profile: cell-mediated immunity (types I and III) and humoral immunity (types II and IV). The patients included nonvaccinated children, as well as children vaccinated on epidemic indications, 3-6, 7-9, 10 and more years before infection. The comparative analysis of the number of IP cases with and without complications in the groups of children, divided according to their immunization history and the type of IR, revealed that postvaccinal immunity in children vaccinated on epidemic indications (less than a month ago) or 3-6 years before infection had protective potential, sufficient for the prevention of complicated forms of IP. Immunity obtained 7-9 years ago was effective for the protection from IP complications only in cell-mediated, but not humoral IR. Postvaccinal immunity obtained more than 10 years ago did not ensure the decrease in the occurrence of complicated forms of IP (in comparison with that in nonvaccinated patients) in children with any type of IR. PMID:10925873

  18. Immunization status of internationally adopted children in Italy.

    PubMed

    Viviano, Enza; Cataldo, Francesco; Accomando, Salvatore; Firenze, Alberto; Valenti, Rosalia Maria; Romano, Nino

    2006-05-01

    An increasing number of internationally adopted children is coming to Italy, and their immunization status is unknown. We evaluated the immunization status of such children in Palermo, Italy. We searched for the presence of a BCG scar in 88 children, 49 boys and 39 girls (mean age 76+/-32 months), most of whom (98%) came from Eastern Europe. Presence of BCG scar was observed in 59 (67.1%) of them, included five children without any pre-adoptive medical records. Twenty-three out of 29 children without any evidence of BCG scar were tested by Mantoux. Seven (30.4%) of 23 were tuberculin positive and diagnosed as having latent tuberculosis infection. We also examined immunization status against poliovirus 1-3, tetanus, diphtheria, pertussis, measles, mumps, rubella and hepatitis B of 70 internationally adopted children and we compared it with the pre-adoptive immunization records of their birth country. Protective titers (>1:8) against poliovirus 1-3, were found respectively in 67.1%, 91.4%, 42.8% of 70 immunized children, and only 38.5% of them had at the same time full protection against all three types of poliovirus. Protective titers against tetanus and diphtheria were found in 91.4% and 95.7% of 70 vaccinated children. Presence of antibodies against pertussis, measles, mumps and rubella was observed respectively in 16 (32.6%) of 49, 40 (62.5%) of 64, 28 (56%) of 50 and 24 (85.7%) of 28 children who had received the vaccine. As regards hepatitis B, only 20 of 29 vaccinated children had detectable hepatitis B surface antibodies, while four of 29 vaccinated and two of 41 not vaccinated children were positive for both hepatitis B surface antibodies and hepatitis B core antibodies. Finally three of 41 not vaccinated children were both hepatitis B surface antigen and hepatitis B core antibodies positive. No relation was found between health status and immunization and between age and antibody positiveness of vaccinated children except for hepatitis B, therefore the

  19. Monitoring of the Immune Dysfunction in Cancer Patients.

    PubMed

    Santegoets, Saskia J A M; Welters, Marij J P; van der Burg, Sjoerd H

    2016-01-01

    Immunotherapy shows promising clinical results in patients with different types of cancer, but its full potential is not reached due to immune dysfunction as a result of several suppressive mechanisms that play a role in cancer development and progression. Monitoring of immune dysfunction is a prerequisite for the development of strategies aiming to alleviate cancer-induced immune suppression. At this point, the level at which immune dysfunction occurs has to be established, the underlying mechanism(s) need to be known, as well as the techniques to assess this. While it is relatively easy to measure general signs of immune suppression, it turns out that accurate monitoring of the frequency and function of immune-suppressive cells is still difficult. A lack of truly specific markers, the phenotypic complexity among suppressive cells of the same lineage, but potentially with different functions and functional assays that may not cover every mechanistic aspect of immune suppression are among the reasons complicating proper assessments. Technical innovations in flow and mass cytometry will allow for more complete sets of markers to precisely determine phenotype and associated function. There is, however, a clear need for functional assays that recapitulate more of the mechanisms employed to suppress the immune system. PMID:27598210

  20. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2008-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) from prolonged immune dysregulation during exploration-class space flight has not yet been determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight status of immunity as it resolves over prolonged flight. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess immunity, latent viral reactivation and physiological stress during both short and long duration flights. Upon completion, it is expected that any clinical risks resulting from the adverse effects of space flight on the human immune system will have been determined. In addition, a flight-compatible immune monitoring strategy will have been developed with which countermeasures validation could be performed. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers' immune systems. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter R+0 assessments. The overall status of the immune system during flight

  1. The impact of sociodemographic variables on immunization coverage of children.

    PubMed

    Waldhoer, T; Haidinger, G; Vutuc, C; Haschke, F; Plank, R

    1997-02-01

    The dependence of immunization coverage of children in the municipalities of Vienna and Klagenfurt on the sociodemographic variables of their parents is investigated. According to the Austrian vaccination program, the following vaccinations are recommended: diphtheria/tetanus (DT), measles/mumps (MM), poliomyelitis (oPV), tickborne encephalitis (TBE), tuberculosis (BCG) and whooping cough (P). The aim of the study is to identify risk groups, as are children that are not well covered. A cross-sectional study using vaccination certificates of second grade schoolchildren in Vienna and Klagenfurt was performed. A multivariate logistic regression model is used. In Vienna a representative sample of second grade schoolchildren (n = 585) was investigated, in Klagenfurt all second grade schoolchildren (n = 824). The investigation took place during the 1993/1994 schoolyear. In Vienna 34.8% of the children have all the vaccinations recommended, in Klagenfurt 59.6%. Children of Austrian mothers have the best immunization coverage, followed by children whose mothers are from 'other countries', 'not stated', and 'former Yugoslavia'. The immunization rate increases with the mother's increasing age. It is lower if the father is unemployed. The effects of the variables age and unemployment are not dependent on nationality. Children from Klagenfurt are more often completely immunized than children from Vienna. The mother's education does not have a significant influence. The Austrian immunization program is not sufficient to provide a high level of herd immunity. The immunization program recommends vaccinations but does not include a system for finding and recording riskgroups (non-immunized). To improve the situation eight steps needed for a setup of surveillance and containment system are recommended. PMID:9084996

  2. Lasting monitoring of immune state in patients with coronary atherosclerosis

    NASA Astrophysics Data System (ADS)

    Malinova, Lidia I.; Denisova, Tatyana P.; Tuchin, Valery V.

    2007-02-01

    Immune state monitoring is an expensive, invasive and sometimes difficult necessity in patients with different disorders. Immune reaction dynamics study in patients with coronary atherosclerosis provides one of the leading components to complication development, clinical course prognosis and treatment and rehabilitation tactics. We've chosen intravenous glucose injection as metabolic irritant in the following four groups of patients: men with proved coronary atherosclerosis (CA), non insulin dependent diabetes mellitus (NIDDM), men hereditary burden by CA and NIDDM and practically healthy persons with longlivers in generation. Immune state parameters such as quantity of leukocytes and lymphocytes, circulating immune complexes levels, serum immunoglobulin levels, HLA antigen markers were studied at 0, 30 and 60 minutes during glucose loading. To obtain continues time function of studied parameters received data were approximated by polynomials of high degree with after going first derivatives. Time functions analyze elucidate principally different dynamics studied parameters in all chosen groups of patients, which couldn't be obtained from discontinuous data compare. Leukocyte and lymphocyte levels dynamics correlated HLA antigen markers in all studied groups. Analytical estimation of immune state in patients with coronary atherosclerosis shows the functional "margin of safety" of immune system state under glucose disturbance. Proposed method of analytical estimation also can be used in immune system monitoring in other groups of patients.

  3. The immunization data quality audit: verifying the quality and consistency of immunization monitoring systems.

    PubMed Central

    Ronveaux, O.; Rickert, D.; Hadler, S.; Groom, H.; Lloyd, J.; Bchir, A.; Birmingham, M.

    2005-01-01

    OBJECTIVE: To evaluate the consistency and quality of immunization monitoring systems in 27 countries during 2002-03 using standardized data quality audits (DQAs) that had been launched within the framework of the Global Alliance for Vaccines and Immunization. METHODS: The consistency of reporting systems was estimated by determining the proportion of third doses of diphtheria-tetanuspertussis (DTP-3) vaccine reported as being administered that could be verified by written documentation at health facilities and districts. The quality of monitoring systems was measured using quality indices for different components of the monitoring systems. These indices were applied to each level of the health service (health unit, district and national). FINDINGS: The proportion of verified DTP-3 doses was lower than 85% in 16 countries. Difficulties in verifying the doses administered often arose at the peripheral level of the health service, usually as the result of discrepancies in information between health units and their corresponding districts or because completed recording forms were not available from health units. All countries had weaknesses in their monitoring systems; these included the inconsistent use of monitoring charts; inadequate monitoring of vaccine stocks, injection supplies and adverse events; unsafe computer practices; and poor monitoring of completeness and timeliness of reporting. CONCLUSION: Inconsistencies in immunization data occur in many countries, hampering their ability to manage their immunization programmes. Countries should use these findings to strengthen monitoring systems so that data can reliably guide programme activities. The DQA is an innovative tool that provides a way to independently assess the quality of immunization monitoring systems at all levels of a health service and serves as a point of entry to make improvements. It provides a useful example for other global health initiatives. PMID:16175824

  4. Cell-mediated immune responses after immunization of healthy seronegative children with varicella vaccine: kinetics and specificity.

    PubMed

    Watson, B; Keller, P M; Ellis, R W; Starr, S E

    1990-10-01

    Humoral and cell-mediated immune responses were determined in seronegative children immunized with live attenuated Oka strain varicella vaccine. At 2 weeks after immunization, 80% of children had detectable lymphocyte proliferation to varicella-zoster virus (VZV) antigens, while only 40% had antibodies to VZV as detected by ELISA. By 6 weeks after immunization, 97% of children seroconverted, and 95% of these responded to VZV antigens in the proliferation assay. A high proportion of immunized children also responded in the proliferation assay to purified glycoproteins I, II, and III of VZV. These results indicate that most children develop a broad cell-mediated immune response to VZV antigens within weeks after immunization with varicella vaccine. PMID:2169495

  5. Validation of Procedures for Monitoring Crewmember Immune Function - Short Duration Biological Investigation

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Crucian, Brian; Stowe, Raymond; Pierson, Duane; Mehta, Satish; Morukov, Boris; Uchakin, Peter; Nehlsen-Cannarella, Sandra

    2008-01-01

    Validation of Procedures for Monitoring Crew Member Immune Function - Short Duration Biological Investigation (Integrated Immune-SDBI) will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flightcompatible immune monitoring strategy. Immune system changes will be monitored by collecting and analyzing blood, urine and saliva samples from crewmembers before, during and after space flight.

  6. Sports Participation in Children and Adolescents with Immune Thrombocytopenia (ITP).

    PubMed

    Kumar, Manjusha; Lambert, Michele P; Breakey, Vicky; Buchanan, George R; Neier, Michelle; Neufeld, Ellis J; Kempert, Pamela; Neunert, Cindy E; Nottage, Kerri; Klaassen, Robert J

    2015-12-01

    We surveyed 278 pediatric hematologists/oncologists regarding how children with immune thrombocytopenia (ITP) are counseled for participation in sports. Results show substantial variation in physician perception of contact risk for different sports, and the advice offered about restriction of sport activities of affected children. Many physicians recommend restriction of sports when platelet counts are under 50 × 10(9) /L. Such restriction may affect the child's quality of life despite their having an overall benign disease. PMID:26174203

  7. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Pierson, Duane; Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Sams, Clarence

    2010-01-01

    The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles, viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. To date, 18 short duration (now completed) and 8 long-duration crewmembers have completed the study. The long-duration phase of this study is ongoing. For this presentation, the final data set for the short duration subjects will be discussed.

  8. Maternal Education and Immunization Status Among Children in Kenya.

    PubMed

    Onsomu, Elijah O; Abuya, Benta A; Okech, Irene N; Moore, DaKysha; Collins-McNeil, Janice

    2015-08-01

    Child morbidity and mortality due to infectious diseases continues to be a major threat and public health concern worldwide. Although global vaccination coverage reached 90 % for diphtheria, tetanus and pertussis (DTP3) across 129 countries, Kenya and other sub-Saharan countries continue to experience under-vaccination. The purpose of this study was to examine the association between maternal education and child immunization (12-23 months) in Kenya. This study used retrospective cross-sectional data from the 2008-2009 Kenya Demographic and Health Survey for women aged 15-49, who had children aged 12-23 months, and who answered questions about vaccination in the survey (n = 1,707). The majority of the children had received vaccinations, with 77 % for poliomyelitis, 74 % for measles, 94 % for tuberculosis, and 91 % for diphtheria, whooping cough (pertussis), and tetanus. After adjusting for other covariates, women with primary, secondary, and college/university education were between 2.21 (p < 0.01) and 9.10 (p < 0.001) times more likely to immunize their children than those who had less than a primary education. Maternal education is clearly crucial in ensuring good health outcomes among children, and integrating immunization knowledge with maternal and child health services is imperative. More research is needed to identify factors influencing immunization decisions among less-educated women in Kenya. PMID:25636652

  9. Can we immunize children against violence?

    PubMed

    McGuinness, Teena M

    2007-02-01

    Psychiatric nurses should support best practices to prevent youth violence. The magnitude and significance of youth violence gives us both social and moral mandates to proceed. Health care professionals have made giant strides in sparing our children from the ravages of childhood diseases. Let us try to do the same by preventing the development of violent behaviors. PMID:17334199

  10. Reasons Parents Exempt Children from Receiving Immunizations

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Beckstrand, Renea L.; Callister, Lynn C.; Cahoon, Spencer

    2012-01-01

    School nurses are on the front lines of educational efforts to promote childhood vaccinations. However, some parents still choose to exempt their children from receiving vaccinations for personal reasons. Studying the beliefs of parents who exempt vaccinations allows health care workers, including school nurses, to better understand parental…

  11. Cellular Immune Responses to Neisseria meningitidis in Children

    PubMed Central

    Pollard, Andrew J.; Galassini, Rachel; Rouppe van der Voort, Eileene M.; Hibberd, Martin; Booy, Robert; Langford, Paul; Nadel, Simon; Ison, Catherine; Kroll, J. Simon; Poolman, Jan; Levin, Michael

    1999-01-01

    There is an urgent need for effective vaccines against serogroup B Neisseria meningitidis. Current experimental vaccines based on the outer membrane proteins (OMPs) of this organism provide a measure of protection in older children but have been ineffective in infants. We postulated that the inability of OMP vaccines to protect infants might be due to age-dependent defects in cellular immunity. We measured proliferation and in vitro production of gamma interferon (IFN-γ), tumor necrosis factor alpha, and interleukin-10 (IL-10) in response to meningococcal antigens by peripheral blood mononuclear cells (PBMCs) from children convalescing from meningococcal disease and from controls. After meningococcal infection, the balance of cytokine production by PBMCs from the youngest children was skewed towards a TH1 response (low IL-10/IFN-γ ratio), while older children produced more TH2 cytokine (higher IL-10/IFN-γ ratio). There was a trend to higher proliferative responses by PBMCs from older children. These responses were not influenced by the presence or subtype of class 1 (PorA) OMP or by the presence of class 2/3 (PorB) or class 4 OMP. Even young infants might be expected to develop adequate cellular immune responses to serogroup B N. meningitidis vaccines if a vaccine preparation can be formulated to mimic the immune stimulus of invasive disease, which may include stimulation of TH2 cytokine production. PMID:10225908

  12. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  13. Immune thrombocytopenia following successful treatment of cancer in children.

    PubMed

    Price, Victoria; Barnes, Chris; Canning, Patricia; Blanchette, Victor; Greenberg, Mark

    2006-03-01

    A predisposition to developing immune thrombocytopenia (ITP) has not been reported in survivors of childhood cancer. We report a case series of childhood cancer survivors who developed an isolated thrombocytopenia in the presence of a normocellular bone marrow. Five children, two with endodermal sinus tumors and three with acute lymphoblastic leukemia, developed ITP at a median of 4 years (range: 0.2-8 years) after completion of therapy. We suggest the association of ITP in survivors of childhood malignancy may not be co-incidental as chemotherapy may cause persistent immune dysfunction. PMID:15700256

  14. Immune Monitoring Using mRNA-Transfected Dendritic Cells.

    PubMed

    Borch, Troels Holz; Svane, Inge Marie; Met, Özcan

    2016-01-01

    Dendritic cells are known to be the most potent antigen presenting cell in the immune system and are used as cellular adjuvants in therapeutic anticancer vaccines using various tumor-associated antigens or their derivatives. One way of loading antigen into the dendritic cells is by mRNA electroporation, ensuring presentation of antigen through major histocompatibility complex I and potentially activating T cells, enabling them to kill the tumor cells. Despite extensive research in the field, only one dendritic cell-based vaccine has been approved. There is therefore a great need to elucidate and understand the immunological impact of dendritic cell vaccination in order to improve clinical benefit. In this chapter, we describe a method for performing immune monitoring using peripheral blood mononuclear cells and autologous dendritic cells transfected with tumor-associated antigen-encoding mRNA. PMID:27236804

  15. Immunization status of children admitted to a tertiary-care hospital of north India: reasons for partial immunization or non-immunization.

    PubMed

    Kumar, Devendra; Aggarwal, Anju; Gomber, Sunil

    2010-06-01

    Reasons for the low coverage of immunization vary from logistic ones to those dependent on human behaviour. The study was planned to find out: (a) the immunization status of children admitted to a paediatric ward of tertiary-care hospital in Delhi, India and (b) reasons for partial immunization and non-immunization. Parents of 325 consecutively-admitted children aged 12-60 months were interviewed using a semi-structured questionnaire. A child who had missed any of the vaccines given under the national immunization programme till one year of age was classified as partially-immunized while those who had not received any vaccine up to 12 months of age or received only pulse polio vaccine were classified as non-immunized. Reasons for partial/non-immunization were recorded using open-ended questions. Of the 325 children (148 males, 177 females), 58 (17.84%) were completely immunized, 156 (48%) were partially immunized, and 111 (34.15%) were non-immunized. Mothers were the primary respondents in 84% of the cases. The immunization card was available with 31.3% of the patients. All 214 partially- or completely-immunized children received BCG, 207 received OPV/DPT1, 182 received OPV/DPT2, 180 received OPV/DPT3, and 115 received measles vaccines. Most (96%) received pulse polio immunization, including 98 of the 111 non-immunized children. The immunization status varied significantly (p<0.05) with sex, education of parents, urban/rural background, route and place of delivery. On logistic regression, place of delivery [odds ratio (OR): 2.3, 95% confidence interval (CI) 1.3-4.1], maternal education (OR=6.94, 95% CI 3.1-15.1), and religion (OR=1.75, 95% CI 1.2-3.1) were significant (p<0.05). The most common reasons for partial or non-immunization were: inadequate knowledge about immunization or subsequent dose (n=140, 52.4%); belief that vaccine has side-effects (n=77, 28.8%); lack of faith in immunization (n=58, 21.7%); or oral polio vaccine is the only vaccine required (n=56

  16. Failure to immunize children under 5 years: a literature review.

    PubMed

    Lochhead, Y J

    1991-02-01

    This paper aims to provide a critical review of the current literature related to immunization default in children under 5 years of age. The author has used a health belief model as the framework for analysis, examining each area in detail. The principle recommendations for practice are addressed and critically evaluated with a concluding summary of the main points raised and the author's recommendation for practice. PMID:2013653

  17. "Immunization mobile" brings protection to children in southeastern Idaho.

    PubMed Central

    Stanger, L

    1987-01-01

    The problem that needs to be addressed is the 58 percent immunity level among 2-year-olds in southeastern Idaho, a level created by the indifference or fear of parents. Southeastern Idaho has the highest birth rate of any region in the State, and this situation has created a large group of children susceptible to vaccine-preventable diseases. The mobile unit, which consists of a specially equipped motor home, allows easy access to immunizations for groups of children and their parents. A search of the computerized record system installed in the mobile unit can provide data on past immunizations for each registered child. The target audience for the mobile unit's visits is church groups because of the particular cultural demographics of this region. In 1987, the District Seven Health Department, a State- and county-funded agency, expects to increase the number of doses of vaccine given by 3,000 over the 19,953 given in 1986. The "Shots for Tots" program is unique in the State of Idaho. Its expansion may be anticipated as the unit becomes better known in the region. The alternative to using aggressive, innovative techniques to motivate people to become immunized is disease. Images p545-a PMID:3116586

  18. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others

    1986-01-01

    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  19. Clinical presentation of pertussis in fully immunized children in Lithuania

    PubMed Central

    Narkeviciute, Irena; Kavaliunaite, Ema; Bernatoniene, Genovaite; Eidukevicius, Rimantas

    2005-01-01

    Background In Lithuania, the vaccination coverage against pertussis is high. Nevertheless, there is a significant increase in pertussis cases in fully immunized children. The aim of our study was to determine the frequency of classical symptoms of laboratory confirmed pertussis and describe its epidemiology in children fully vaccinated against pertussis. Methods From May to December 2001, 70 children aged 1 month to 15 years, suffering from prolonged cough were investigated in the Centre of Paediatrics, Vilnius University Children's Hospital. The collected information included personal data, vaccination history, clinical symptoms of the current illness, and treatment before hospitalization. At the admission to the hospital blood samples were taken from all studied children for Bordetella pertussis IgM and IgA. Results A total of 53 (75.7%) of the 70 recruited patients with prolonged cough showed laboratory evidence of pertussis. 32 of them were fully vaccinated with whole cell pertussis vaccine (DTP). The age of fully vaccinated patients varied from 4 to 15 years (average 10.9 ± 3.1; median 11). The time period between the last vaccination dose (fourth) and the clinical manifestation of pertussis was 2.6–13 years (average 8.9 ± 3.0; median 9). More than half of the children before the beginning of pertussis were in contact with persons suffering from long lasting cough illness in the family, school or day-care center. The mean duration from onset of pertussis symptoms until hospitalization was 61.4 ± 68.3 days (range, 7 to 270 days; median 30). For 11 patients who had had two episodes (waves) of coughing, the median duration of cough was 90 days, and for 21 with one episode 30 days (p < 0.0002). Most of the children (84.4%) had paroxysmal cough, 31.3% had post-tussive vomiting, 28.1% typical whoop, and 3.1% apnea. Only 15.6% children had atypical symptoms of pertussis. Conclusion Fully vaccinated children fell ill with pertussis at the median of 11 years old

  20. Premature aging and immune senescence in HIV-infected children

    PubMed Central

    Gianesin, Ketty; Noguera-Julian, Antoni; Zanchetta, Marisa; Del Bianco, Paola; Petrara, Maria Raffaella; Freguja, Riccardo; Rampon, Osvalda; Fortuny, Clàudia; Camós, Mireia; Mozzo, Elena; Giaquinto, Carlo; De Rossi, Anita

    2016-01-01

    Objective: Several pieces of evidence indicate that HIV-infected adults undergo premature aging. The effect of HIV and antiretroviral therapy (ART) exposure on the aging process of HIV-infected children may be more deleterious since their immune system coevolves from birth with HIV. Design: Seventy-one HIV-infected (HIV+), 65 HIV-exposed-uninfected (HEU), and 56 HIV-unexposed-uninfected (HUU) children, all aged 0–5 years, were studied for biological aging and immune senescence. Methods: Telomere length and T-cell receptor rearrangement excision circle levels were quantified in peripheral blood cells by real-time PCR. CD4+ and CD8+ cells were analysed for differentiation, senescence, and activation/exhaustion markers by flow cytometry. Results: Telomere lengths were significantly shorter in HIV+ than in HEU and HUU children (overall, P < 0.001 adjusted for age); HIV+ ART-naive (42%) children had shorter telomere length compared with children on ART (P = 0.003 adjusted for age). T-cell receptor rearrangement excision circle levels and CD8+ recent thymic emigrant cells (CD45RA+CD31+) were significantly lower in the HIV+ than in control groups (overall, P = 0.025 and P = 0.005, respectively). Percentages of senescent (CD28−CD57+), activated (CD38+HLA-DR+), and exhausted (PD1+) CD8+ cells were significantly higher in HIV+ than in HEU and HUU children (P = 0.004, P < 0.001, and P < 0.001, respectively). Within the CD4+ cell subset, the percentage of senescent cells did not differ between HIV+ and controls, but programmed cell death receptor-1 expression was upregulated in the former. Conclusions: HIV-infected children exhibit premature biological aging with accelerated immune senescence, which particularly affects the CD8+ cell subset. HIV infection per se seems to influence the aging process, rather than exposure to ART for prophylaxis or treatment. PMID:26990630

  1. Primary immune response to blood group antigens in burned children.

    PubMed

    Bacon, N; Patten, E; Vincent, J

    1991-01-01

    Delayed hemolytic transfusion reactions (DHTRs) are generally attributed to an anamnestic immune response. Case reports of DHTRs due to a primary immune response are rare. Transfusion reactions occurring in patients on the pediatric burn unit from 1981 to September 1988 were reviewed, and additional information was obtained for patients for whom a DHTR was documented. Of 62 transfusion reactions, 11 were classified as a primary immune response (DHTR), with either a positive antibody screen, a positive direct antiglobulin test (DAT), or both. None of the 11 patients included in the study had been previously tranfused or pregnant. The average number of units transfused prior to antibody identification was 19. The average time elapsed between the first transfusion and antibody identification was 3.6 weeks. Anti-K and anti-E were the most frequently identified. Three patients had a decrease in hemoglobin (average 1.5 g/dL) and hematocrit at the time that a positive DAT was detected. Such changes could not be demonstrated for the remaining eight patients. The conclusion was that a DHTR may he caused by a primary immune response in burned children more often than expected, but DHTR signs and symptoms are often not apparent due to the complications of burn trauma. PMID:15946011

  2. [Mucosal immunity in children with HIV infection and the possibility of correcting this immunity].

    PubMed

    Kostinov, M P; Suloeva, S V; Tarasova, A A; Lukushkina, E F

    2006-01-01

    The influence of bacterial lysate [see text]PC-19 on the mucosal immunity of children with HIV infection was evaluated. The action of this topical immunomodulator was found to increase the synthesis of sIgA, which was indirectly reflected in a rise of the local immunity of the upper respiratory ways, preventing the aggravation of the chronic focal infection and the main disease. It should be pointed out that in a group of HIV-infected children and adolescents with an initially high level of salivary IgG the prescription of preparation [see text]PC-19 led to its considerable decrease. A decrease in the level of IgG and a rise in the content of sIgA in saliva under the action of the preparation correlated with a decrease in inflammatory changes in the nasopharyngeal mucosa. On the basis of results obtained in this study additions to the algorithm of the prophylactic medical observation of children and adolescents with HIV infection have been developed. PMID:16758905

  3. Brief Report: Dysregulated Immune System in Children with Autism: Beneficial Effects of Intravenous Immune Globulin on Autistic Characteristics.

    ERIC Educational Resources Information Center

    Gupta, Sudhir; And Others

    1996-01-01

    Children (ages 3-12) with autism (n=25) were given intravenous immune globulin (IVIG) treatments at 4-week intervals for at least 6 months. Marked abnormality of immune parameters was observed in subjects, compared to age-matched controls. IVIG treatment resulted in improved eye contact, speech, behavior, echolalia, and other autistic features.…

  4. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  5. Compliance with immunization against H1N1 influenza virus among children with cancer.

    PubMed

    Doganis, Dimitrios; Tsolia, Maria; Dana, Helen; Bouhoutsou, Despina; Pourtsidis, Apostolos; Baka, Margarita; Varvoutsi, Maria; Servitzoglou, Marina; Kosmidis, Helen

    2013-03-01

    In this report, we describe the experience with immunization against pandemic influenza A H1N1 in children with cancer treated at a pediatric oncology department during the pandemic season (2009). According to the guidelines, vaccination of all children with cancer receiving chemotherapy as well as those who had completed treatment was scheduled. Among the 140 children who were eligible for immunization, 122 were immunized, achieving a compliance rate of 87% despite negative publicity and low vaccine uptake in the general population. The vaccine was tolerated and none of the vaccinated children developed influenza. It is concluded that high immunization rates can be achieved among pediatric oncology patients. PMID:23301621

  6. Immunization status in children with inflammatory bowel disease.

    PubMed

    Longuet, Romain; Willot, Stephanie; Giniès, Jean-Louis; Pélatan, Cecile; Breton, Estelle; Segura, Jean-François; Bridoux, Laure; Le Henaff, Gaelle; Cagnard, Benoit; Jobert, Agathe; Cardonna, Joël; Grimal, Isabelle; Balençon, Martine; Darviot, Estelle; Delaperrière, Nadège; Caldari, Dominique; Piloquet, Hugues; Dabadie, Alain

    2014-05-01

    Inflammatory bowel diseases have an increased risk of infections due to immunosuppressive therapies. To report the immunization status according to previous recommendations and the reasons explaining a delay, a questionnaire was filled in by the pediatric gastroenterologist, concerning outpatients, in six tertiary centers and five local hospitals, in a study, from May to November 2011. One hundred and sixty-five questionnaires were collected, of which 106 Crohn's diseases, 41 ulcerative colitis, and 17 indeterminate colitis. Sex ratio was 87:78 M/F. Median age was 14.4 years old (4.2-20.0). One hundred and nine patients (66 %) were receiving or had received an immunosuppressive therapy (azathioprine, infliximab, methotrexate, or prednisone). Vaccines were up to date according to the vaccine schedule of French recommendations in 24 % of cases and according to the recommendations for inflammatory bowel disease in 4 % of cases. Coverage by vaccine was the following: diphtheria-tetanus-poliomyelitis 87 %, hepatitis B 38 %, pneumococcus 32 %, and influenza 22 %. Immunization delay causes were as follows: absence of proposal 58 %, patient refusal 41 %, fear of side effects 33 %, and fear of disease activation 5 %. Therefore, immunization coverage is insufficient in children with inflammatory bowel disease, due to simple omission or to refusal. A collaboration with the attending physicians and a targeted information are necessary. PMID:24305728

  7. Immune Reconstitution after Allogeneic Hematopoietic Cell Transplantation in Children.

    PubMed

    de Koning, Coco; Plantinga, Maud; Besseling, Paul; Boelens, Jaap Jan; Nierkens, Stefan

    2016-02-01

    Allogeneic (allo) hematopoietic cell transplantation (HCT) has evolved into a potent curative treatment option for a variety of malignant and nonmalignant diseases. The occurrence of complications and mortality after allo-HCT is, however, still high and is strongly associated with immune reconstitution (IR). Therefore, detailed information on IR through immunomonitoring is crucial to improve survival chances after HCT. To date, information about the reconstituting immune system after allo-HCT in pediatric patients is mostly derived from routine standard-of-care measurements. More profound knowledge on IR may provide tools to better predict and modulate adverse reactions and, subsequently, improve survival chances. Here, we provide an overview of IR (eg, immune cell subsets and circulating chemokines/cytokines) after allo-HCT in children, taking into account different cell sources and serotherapy, and discuss strategies to enhance immunomonitoring. We conclude that available IR data after allo-HCT contain limited information on immune cell families (mostly only generic T, B, and NK cells), which would improve with more detailed information on reconstituting cell subsets or effector cell functionality at earlier time points (<1 month). In addition, secretome data (eg, multiplex cytokine/chemokine profiles) could add to the understanding of IR mechanisms and cell functionality and may even provide (early) biomarkers for individual disease outcome, such as viral reactivity, graft-versus-host disease, or graft-versus-leukemia. The present data and suggestions for more detailed, standardized, and harmonized immunomonitoring in future (pediatric) allo-HCT studies will pave the path to "precision transplantation:" an individualized HCT approach (including conditioning), based on detailed information on IR and biomarkers, aiming to reduce transplantation related mortality and relapse, and subsequently improve survival chances. PMID:26341398

  8. Helicobacter pylori immunization and atopic dermatitis in South Italian children

    PubMed Central

    Pedullà, Marcella; Fierro, Vincenzo; Del Tufo, Ester; Triassi, Maria; Perrone, Laura

    2014-01-01

    Background The epidemiological decrease of Helicobacter pylori (Hp) infection has been recently associated to the increase of several extra-intestinal allergic disorders. Objective We investigated the role of specific Hp IgG production in the development of IgE or not IgE mediated food allergy (FA) in children affected by atopic dermatitis (AD). Methods From January 2010 to July 2013, 290 South Italian children, aged between 26 and 142 months, were consecutively referred to the Pediatric Clinic of the Pediatric Department at Second University of Naples and were diagnosed as affected by AD. The patients were classified in two groups on the basis of diagnosis of food allergy (88 FA affected and 202 not FA affected) and further divided on the basis of the diagnosis of atopy (63 IgE mediated and 23 not IgE mediated). Hp serum IgG was detected using an enzyme linked immunosorbent assay (ELISA) kit (Wampole® Helicobactor pylori IgG ELISA II, Wampole Laboratories, Cranbury, NJ) and Hp stool antigens using enzyme immunoassay (Premier Platinum HpSa plus, Cincinnati OH). Results We found a statistically significant higher prevalence of Hp serology positivity in not FA vs. FA AD-affected children (p = 0.032) and a significant inverse association between FA and Hp immunization (1/OR 0.32 95% CI 0.11–0.95). Further, we identified an absolute prevalence Hp serology positivity in not-IgE-mediated rather than in IgE-mediated FA AD-affected patients (p = 0.0006). Conclusion We hypothesize that specific Hp IgG production could protect against the development of both FA and atopy in AD-affected children. PMID:25083283

  9. Innate Immune Responses in Children and Adults with Shigellosis

    PubMed Central

    Raqib, Rubhana; Mia, S. M. Shahjahan; Qadri, Firdausi; Alam, Tanfis I.; Alam, Nur H.; Chowdhury, Ashish K.; Mathan, Minnie M.; Andersson, Jan

    2000-01-01

    An array of pro- and anti-inflammatory mediators of the innate immune system was analyzed in stool, urine, and rectal mucosa samples from adults and children with shigellosis to better understand their role in recovery from and in the immunopathogenesis of the disease. Increased concentrations of lactoferrin (Lf), myeloperoxidase (MPO), prostaglandin E2, and leukotriene B4 (LTB4) in stool during acute shigellosis in both children and adults indicated that activated cells of the innate defense system at the mucosal site were secreting the mediators. Increased concentration of MPO and 8-iso-prostaglandin F2α and lower levels of superoxide dismutase (SOD) activity in stool during acute Shigella infection suggested increased formation of reactive oxygen species, free radical-catalyzed peroxidation of membrane lipids, and decreased scavenging of the reactive oxygen radicals. In children, lower expression of SOD in tissue with severe inflammation and lower levels of SOD activity in stool for longer periods compared to adults may further worsen the tissue damage and predispose the children to a lowered defense. Both adult and pediatric patients had significantly higher expression of inducible nitric oxide synthase (iNOS) in the rectum with severe inflammation, compared to that seen with mild inflammation, accompanied by persistently up-regulated iNOS mRNA, reflecting increased production of nitric oxide at the local site. However, in contrast to adults, reduced urinary nitrate levels in pediatric patients during acute shigellosis suggested lower production of nitric oxide in the renal compartment. Persistent production of Lf in pediatric patients may contribute to chronic inflammation in the rectum. In addition, increased production of proinflammatory mediators in the rectum of patients with severe histology suggested contribution of these molecules to the immunopathogenesis of severe colitis caused by shigellae. PMID:10816520

  10. Immunization Services for Adolescents within Comprehensive School Health Programs.

    ERIC Educational Resources Information Center

    Vernon, Mary E.; Bryan, Gloria; Hunt, Pete; Allensworth, Diane; Bradley, Beverly

    1997-01-01

    Discusses school health services, adolescent immunization, current school immunization practices, and support for school-based immunization programs. Children and adolescents can receive preventive health services, including immunizations and monitoring of immunization levels. Expanding school health services could improve the immunization levels…

  11. Managing Multi-center Flow Cytometry Data for Immune Monitoring.

    PubMed

    White, Scott; Laske, Karoline; Welters, Marij Jp; Bidmon, Nicole; van der Burg, Sjoerd H; Britten, Cedrik M; Enzor, Jennifer; Staats, Janet; Weinhold, Kent J; Gouttefangeas, Cécile; Chan, Cliburn

    2014-01-01

    With the recent results of promising cancer vaccines and immunotherapy1-5, immune monitoring has become increasingly relevant for measuring treatment-induced effects on T cells, and an essential tool for shedding light on the mechanisms responsible for a successful treatment. Flow cytometry is the canonical multi-parameter assay for the fine characterization of single cells in solution, and is ubiquitously used in pre-clinical tumor immunology and in cancer immunotherapy trials. Current state-of-the-art polychromatic flow cytometry involves multi-step, multi-reagent assays followed by sample acquisition on sophisticated instruments capable of capturing up to 20 parameters per cell at a rate of tens of thousands of cells per second. Given the complexity of flow cytometry assays, reproducibility is a major concern, especially for multi-center studies. A promising approach for improving reproducibility is the use of automated analysis borrowing from statistics, machine learning and information visualization21-23, as these methods directly address the subjectivity, operator-dependence, labor-intensive and low fidelity of manual analysis. However, it is quite time-consuming to investigate and test new automated analysis techniques on large data sets without some centralized information management system. For large-scale automated analysis to be practical, the presence of consistent and high-quality data linked to the raw FCS files is indispensable. In particular, the use of machine-readable standard vocabularies to characterize channel metadata is essential when constructing analytic pipelines to avoid errors in processing, analysis and interpretation of results. For automation, this high-quality metadata needs to be programmatically accessible, implying the need for a consistent Application Programming Interface (API). In this manuscript, we propose that upfront time spent normalizing flow cytometry data to conform to carefully designed data models enables automated

  12. Managing Multi-center Flow Cytometry Data for Immune Monitoring

    PubMed Central

    White, Scott; Laske, Karoline; Welters, Marij JP; Bidmon, Nicole; van der Burg, Sjoerd H; Britten, Cedrik M; Enzor, Jennifer; Staats, Janet; Weinhold, Kent J; Gouttefangeas, Cécile; Chan, Cliburn

    2014-01-01

    With the recent results of promising cancer vaccines and immunotherapy1–5, immune monitoring has become increasingly relevant for measuring treatment-induced effects on T cells, and an essential tool for shedding light on the mechanisms responsible for a successful treatment. Flow cytometry is the canonical multi-parameter assay for the fine characterization of single cells in solution, and is ubiquitously used in pre-clinical tumor immunology and in cancer immunotherapy trials. Current state-of-the-art polychromatic flow cytometry involves multi-step, multi-reagent assays followed by sample acquisition on sophisticated instruments capable of capturing up to 20 parameters per cell at a rate of tens of thousands of cells per second. Given the complexity of flow cytometry assays, reproducibility is a major concern, especially for multi-center studies. A promising approach for improving reproducibility is the use of automated analysis borrowing from statistics, machine learning and information visualization21–23, as these methods directly address the subjectivity, operator-dependence, labor-intensive and low fidelity of manual analysis. However, it is quite time-consuming to investigate and test new automated analysis techniques on large data sets without some centralized information management system. For large-scale automated analysis to be practical, the presence of consistent and high-quality data linked to the raw FCS files is indispensable. In particular, the use of machine-readable standard vocabularies to characterize channel metadata is essential when constructing analytic pipelines to avoid errors in processing, analysis and interpretation of results. For automation, this high-quality metadata needs to be programmatically accessible, implying the need for a consistent Application Programming Interface (API). In this manuscript, we propose that upfront time spent normalizing flow cytometry data to conform to carefully designed data models enables

  13. Developmental Profiles of Mucosal Immunity in Pre-school Children

    PubMed Central

    Ewing, Patricia; Otczyk, Diana C.; Occhipinti, Stefano; Kyd, Jennelle M.; Gleeson, Maree; Cripps, Allan W.

    2010-01-01

    This study investigated the effect of attending pre-school on mucosal immunity. Children 3.5 to 5 years of age who attended pre-school were observed for a 10 month period. Demographic information was collected on previous childcare experiences, the home environment and clinical information relating to the child and the family. A daily illness log was kept for each child. A multivariate longitudinal analysis of the relation between immunoglobulins in saliva and age, gender, childcare experience, pre-school exposure, number of siblings, environmental tobacco smoke (ETS), atopy and hospitalisation was conducted. There was a positive association of higher IgA levels with the winter season and with children being older than 4 years (P < .001), having attended childcare prior to commencing pre-school (P < .05), and having been exposed to ETS at home (P < .05). Lower IgA levels were associated with being atopic (P < .05). Higher IgG levels were associated with exposure to ETS (P < .001), while lower levels were associated to having atopy. Higher IgM levels were associated with previous childcare experience (P < .01) whilst having been hospitalised was associated with having low salivary IgM levels (P < .01). Lagged analyses demonstrated that immunological parameters were affected by the number of respiratory infections in the preceding 2 months. PMID:21234378

  14. Nutrition and Immune System in Children with Simple Obesity.

    PubMed

    Czerwonogrodzka-Senczyna, Aneta; Janusz, Malgorzata; Jeznach-Steinhagen, Anna; Demkow, Urszula; Pyrzak, Beata

    2016-01-01

    The purpose of this study was to evaluate dietary factors in nutrition influencing the immune system of children and teenagers suffering from simple obesity. The study involved 100 children and teenagers aged 7-18 with simple obesity. Nutritional data were obtained from 3-day food records. The consumed nutrients, including immunomodulators and immunostimulants, were estimated based on the nutrition interview. The results were compared with the nutritional norms. On average, the proportion of n-6:n-3 fatty acids equalled 10:1. Among the amino acids, the highest intake values in the diet were observed for glutamine (13,694.6 mg/day). The study demonstrates inadequate intake levels of iron (73% of recommended dietary allowance, RDA), vitamin C (65% of RDA), and vitamin D (11% of RDA) taking into account the median values for the entire study group. The median daily intake of other nutrients exceeded the RDA values. The diets of the participants in this study were not properly balanced with respect to immunomodulators, which may contribute to the occurrence of immunological disorders and immunodeficiency in this group of patients. PMID:26269024

  15. The effect of nutritional status on immune capacity and immune responses in preschool children in a rural community in India*

    PubMed Central

    Kielmann, A. A.; Uberoi, I. S.; Chandra, R. K.; Mehra, V. L.

    1976-01-01

    Cell-mediated immune response (CMI) and several aspects of humoral immune status and response were measured and related to nutritional status in preschool children in north India. CMI was measured by means of postvaccinal (BCG) tuberculin sensitivity and leucocytic blast cell transformation. Humoral immune response was measured by means of tetanus antibody production following vaccination with diphtheria—pertussis—tetanus vaccine. Immunoglobulins A, G, and M and complement (C3) were also determined. CMI, serum IgA, and C3 were found to be directly correlated with weight-for-age status. PMID:1088398

  16. A Conceptual Framework for Monitoring Children's Services. Discussion Draft.

    ERIC Educational Resources Information Center

    Fiene, Richard

    This discussion draft of a conceptual framework for monitoring children's services was prepared by Peat, Marwick and Co. for the Children's Services Monitoring Transfer Consortium (CFMCS), an organization spanning five states: California, Michigan, Pennsylvania, Texas, and West Virginia. The primary purpose of this conceptual framework was to…

  17. Barriers to immunization among children of HIV-infected mothers in Kolkata, India: a qualitative study.

    PubMed

    Sensarma, Pinaki; Bhandari, Subhasis; Kutty, V Raman

    2015-03-01

    More than one fourth of children of HIV-infected mothers living in Kolkata city are not completely immunized by 12 months of age. This qualitative study aims to explore the barriers to immunization of these children as perceived by their caregivers and the local health care service providers. In-depth interviews were conducted after obtaining written informed consent. Audio recording and hand-recorded notes were used with permission. The transcripts were coded and analyzed using grounded theory. Deteriorating socioeconomic status, tightening of time schedule of caregivers due to illness in the family, stigma, discrimination, and lack of awareness about immunization prove to be major barriers for immunization of the HIV-exposed children. Interplay of these factors coupled with harassment and negative attitudes of service providers toward HIV-affected/HIV-infected people also impede immunization. The intervention efforts need to address these social barriers and adverse life events to improve immunization coverage. PMID:23666833

  18. Influenza immunization of chronically ill children in pediatric tertiary care hospitals.

    PubMed

    Dubé, Eve; Gagnon, Dominique; Huot, Caroline; Paré, Renée; Jacques, Solange; Kossowski, Alexandra; Quach, Caroline; Landry, Monique

    2014-01-01

    Despite a publicly funded immunization program and continuous promotional efforts, vaccine uptake for seasonal influenza in Quebec (Canada) remains under its goal of 80%. Missed opportunities can explain the low influenza vaccine rates among chronically ill children. To address that, demonstration projects using the live attenuated influenza vaccine (LAIV) were implemented in 3 pediatric tertiary care hospitals to evaluate the feasibility and acceptability of implementing influenza immunization of chronically ill children in hospitals' outpatient clinics. A diary was used to document barriers and enabling factors regarding the implementation, and a questionnaire was distributed to healthcare professionals involved in the project in each hospital. Parent's knowledge, attitudes and behaviors (KAB) about influenza immunization and acceptability of immunization in outpatient clinics were also measured with a questionnaire. As part of the project, 2,478 children were immunized. Enabling factors included the financial support received from Quebec ministry of Health, the nasal mode of administration of the LAIV and the presence of a leader specifically dedicated to influenza immunization. Barriers to influenza immunization in outpatient clinics included difficulties of hiring extra staff to work in immunization clinics and additional tasks added to regular activities of the clinics. Results from both questionnaires illustrated a high level of acceptability of seasonal influenza immunization in hospitals' outpatient clinics by parents and healthcare professionals. Influenza immunization in pediatric tertiary care hospital is an effective way to reach chronically ill children and does not involve major feasibility or acceptability issues. PMID:25483460

  19. [Immune function alteration in children after tonsillectomy and(or) adenoidectomy].

    PubMed

    Hu, Lanye; Yang, Jun

    2016-03-01

    Tonsillectomy and(or) adenoidectomy are effective procedures for children with chronic tonsillitis, diseases associated with the tonsil and other adenotonsillar diseases, and obstructive sleep apnea-hypopnea syndrome. Since the tonsil and adenoid gland play a dual role in fluid and cell immunity, whether adenotonsillectomy results in the abnormal immune function in children after the surgery has always been the focus of attention. This review focuses on the alterations and impacts on immunity in children after tonsillectomy and/or adenoidectomy. Recent studies confirmed that in short term the immune index may be slightly reduced after the tonsil and adenoid resection in children, however, the decline has no clinical significance because the remaining mucosa-associated lymphoid tissue can compensate for removal of the tonsils and adenoids. Over time, the immune index tends to be normal. The children's postoperative short-term decline in the immune index will gradually recover to the preoperative level or there is no significant difference compared with that in normal children. Therefore, long-term immune function did not decline after tonsil and adenoid resection in children. PMID:27382697

  20. Performance Monitoring in Children following Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Ornstein, Tisha J.; Levin, Harvey S.; Chen, Shirley; Hanten, Gerri; Ewing-Cobbs, Linda; Dennis, Maureen; Barnes, Marcia; Max, Jeffrey E.; Logan, Gordon D.; Schachar, Russell

    2009-01-01

    Background: Executive control deficits are common sequelae of childhood traumatic brain injury (TBI). The goal of the current study was to assess a specific executive control function, performance monitoring, in children following TBI. Methods: Thirty-one children with mild-moderate TBI, 18 with severe TBI, and 37 control children without TBI, of…

  1. Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model.

    PubMed

    Weir, Chris J; Hudson, Amanda L; Peters, Lyndsay; Howell, Viive M

    2015-01-01

    The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 µl whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment. PMID:26485154

  2. Role of platelet function and platelet membrane glycoproteins in children with primary immune thrombocytopenia

    PubMed Central

    Liu, Wen-Jun; Bai, Jing; Guo, Qu-Lian; Huang, Zhe; Yang, Hong; Bai, Yong-Qi

    2016-01-01

    The aim of the present study was to examine and understand changes in platelet functions prior to and after the treatment of primary immune thrombocytopenia (ITP) in children. An automatic hematology analyzer and whole blood flow cytometry were used to detect immature platelet fraction (IPF), IPC and membrane glycoproteins (CD62p, PAC-1 and CD42b) in ITP children (ITP group), children with complete response after ITP treatment (ITP-CR group) and children with elective surgery (normal control group). The results showed that, levels of platelet count (PLT) and plateletcrit in the ITP group were lower alhtough the levels of mean platelet volume, platelet distribution width and platelet-large cell ratio (P-LCR) were higher than those in the normal control and ITP-CR groups. PLT in the ITP-CR group was lower than that in the normal controls. Additionally, IPF% was higher in the normal control and ITP-CR groups, IPC was lower in the ITP group compared to the normal control and ITP-CR groups. Furthermore, prior to ADP activation, the expression levels of CD62p, PAC-1 and CD42b in the ITP group were lower in ITP group than those in the normal control and ITP-CR groups. The expression level of PAC-1 was lower in the ITP-CR and normal control groups. No differences were identified in CD62p and CD42b expression levels. Following ATP activation, CD62p, PAC-1 and CD42b expression in the ITP group was lower than that in the normal control and ITP-CR groups. PAC-1 expression was lower while CD62p expression was higher in the ITP-CR group compared to the normal control group. In conclusion, the activation of platelets in ITP children was low. Decreased platelet function, platelet parameters and platelet glycoproteins may be used as markers for monitoring the treatment efficacy in ITP children. PMID:27431926

  3. Evaluation of a Social Marketing Campaign to Increase Awareness of Immunizations for Urban Low-Income Children

    PubMed Central

    Ngui, Emmanuel M.; Hamilton, Chelsea; Nugent, Melodee; Simpson, Pippa; Willis, Earnestine

    2015-01-01

    Objective To assess community awareness of childhood immunizations and intent to immunize children after a social marketing immunization campaign. Methods We used 2 interviewer-assisted street-intercept surveys to evaluate awareness of childhood immunizations and intent to immunize low-income children. The “Take Control! Immunize” social marketing campaign was developed using a community-based participatory research approach and used billboards, flyers, and various “walking billboard” (eg, backpacks, pens) to deliver immunization messages in the community settings. Results Over 85% of community members recalled the “Take Control! Immunize” message. Almost half of those who saw the immunization message indicated that the message motivated them to act, including getting their children immunized or calling their physician to inquire about their children's immunizations status. All respondents indicated that immunizations were important for children and that they were likely or very likely to immunize their children. Respondents who reported that “Take Control!” messages motivated them to act in the first intercept survey were significantly more likely than those in the second intercept to report being likely or very likely to immunize their children. Conclusion Culturally appropriate social marketing immunization messages in targeted urban settings can increase parental awareness and behavioral intention to immunize children. PMID:25845130

  4. Lack of serologic immunity against vaccine-preventable diseases in children after thoracic transplantation.

    PubMed

    Urschel, Simon; Cremer, Sabine; Birnbaum, Julia; Dallapozza, Robert; Fuchs, Alexandra; Jäger, Gundula; Schmitz, Christoph; Belohradsky, Bernd H; Netz, Heinrich

    2010-06-01

    We investigated whether children after heart- (HTx) or heart-lung transplantation (HLTx) show protective antibody levels against recommended vaccinations, whether vaccination schedules are completed and which factors influence serologic immunity. We performed a cross sectional ELISA - quantification of specific antibodies in 46 patients after pediatric thoracic Tx. Findings were correlated to vaccination history, age at Tx, clinical course and immunosuppressive regimen. We found protective antibody levels against diphtheria in 74% of patients, against tetanus in 22%, against Haemophilus influenzae type b in 30% and against Streptococcus pneumoniae in 59%. Antibody concentrations against live attenuated vaccines were significantly lower in children transplanted in the first 2 years of life. Antibodies were absent for measles in 55% of late - and 81% of early transplanted children, for mumps in 66%/94%, for rubella in 30%/56% and for Varicella in 34%/63%. We found significant correlation of low antibody concentrations and age at Tx. Patients without protective antibody concentrations had significantly longer use of steroids. Vaccination schedules were incomplete or delayed in the majority of patients associated with more days in hospital pre-Tx. Our study shows that closer adherence to pretransplantation vaccination schedules and also post-transplantation monitoring of antibody levels are required in transplant patients. PMID:20028497

  5. Assessing Immunization Interventions in the Women, Infants, and Children (WIC) Program

    PubMed Central

    Thomas, Tracy N.; Kolasa, Maureen S.; Zhang, Fan; Shefer, Abigail M.

    2016-01-01

    Background Vaccination promotion strategies are recommended in Women, Infants, and Children (WIC) settings for eligible children at risk for under-immunization due to their low-income status. Purpose To determine coverage levels of WIC and non-WIC participants and assess effectiveness of immunization intervention strategies. Methods The 2007–2011 National Immunization Surveys were used to analyze vaccination histories and WIC participation among children aged 24–35 months. Grantee data on immunization activities in WIC settings were collected from the 2010 WIC Linkage Annual Report Survey. Coverage by WIC eligibility and participation status and grantee-specific coverage by intervention strategy were determined at 24 months for select antigens. Data were collected 2007–2011 and analyzed in 2013. Results Of 13,183 age-eligible children, 5,699 (61%, weighted) had participated in WIC, of which 3,404 (62%, weighted) were current participants. In 2011, differences in four or more doses of the diphtheria, tetanus toxoid, and acellular pertussis (DTaP) vaccine by WIC participation status were observed: 86% (ineligible); 84% (current); 77% (previous); and 69% (never-eligible). Children in WIC exposed to an immunization intervention strategy had higher coverage levels than WIC-eligible children who never participated, with differences as great as 15% (DTaP). Conclusions Children who never participated in WIC, but were eligible, had the lowest vaccination coverage. Current WIC participants had vaccination coverage comparable to more affluent children, and higher coverage than previous WIC participants. PMID:25217817

  6. [The dispanserization monitoring of children and adolescents with stomatologic diseases].

    PubMed

    Kulikova, N T; Overchenko, A B

    2010-01-01

    The article deals with actual issues of primary prevention of orthodontic complications and dental maxillary malformations in children and adolescents aged up to 10-14 years. The results of dispanserization monitoring of children and adolescents with dental maxillary malformations and stomatologic pathology are discussed. The analysis of the results of dispanserization monitoring a pregnant women is made. The assessment of the role of primary prevention of stomatologic diseases in preventing the development of dental maxillary malformations in children is proposed. The research data related to the dispanserization activities among children and adolescents in organized and non-organized communities and pregnant women is presented. PMID:20731151

  7. Evaluation of an Intervention Program to Increase Immunization Compliance among School Children

    ERIC Educational Resources Information Center

    Luthy, Karlen E.; Thorpe, Aubrey; Dymock, Leah Clark; Connely, Samantha

    2011-01-01

    State immunization laws necessitate compliance for students enrolling in a public or private school system. In support of state laws, school nurses expend hours to achieve immunization compliance with school-age children. For the purpose of creating a more efficient system, researchers implemented an educational and incentive program in local…

  8. Immunization Uptake in Younger Siblings of Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Kuwaik, Ghassan Abu; Roberts, Wendy; Zwaigenbaum, Lonnie; Bryson, Susan; Smith, Isabel M.; Szatmari, Peter; Modi, Bonnie M.; Tanel, Nadia; Brian, Jessica

    2014-01-01

    Background: Parental concerns persist that immunization increases the risk of autism spectrum disorder, resulting in the potential for reduced uptake by parents of younger siblings of children with autism spectrum disorder ("younger sibs"). Objective: To compare immunization uptake by parents for their younger child relative to their…

  9. Problems encountered by parents and guardians of elementary school-age children in obtaining immunizations.

    PubMed

    Schmalz, K; Larwa, L

    1997-02-01

    This study surveyed 265 parents of children in kindergarten through third grade in an urban New Jersey public school to determine problems encountered in obtaining regular immunizations. The most frequent reasons parents failed to obtain immunizations were cost, lesser use of WIC and AFDC, and lower perceived susceptibility of child to consequences of disease. PMID:9146212

  10. High physical activity in young children suggests positive effects by altering autoantigen-induced immune activity.

    PubMed

    Carlsson, E; Ludvigsson, J; Huus, K; Faresjö, M

    2016-04-01

    Physical activity in children is associated with several positive health outcomes such as decreased cardiovascular risk factors, improved lung function, enhanced motor skill development, healthier body composition, and also improved defense against inflammatory diseases. We examined how high physical activity vs a sedentary lifestyle in young children influences the immune response with focus on autoimmunity. Peripheral blood mononuclear cells, collected from 55 5-year-old children with either high physical activity (n = 14), average physical activity (n = 27), or low physical activity (n = 14), from the All Babies In Southeast Sweden (ABIS) cohort, were stimulated with antigens (tetanus toxoid and beta-lactoglobulin) and autoantigens (GAD65 , insulin, HSP60, and IA-2). Immune markers (cytokines and chemokines), C-peptide and proinsulin were analyzed. Children with high physical activity showed decreased immune activity toward the autoantigens GAD65 (IL-5, P < 0.05), HSP60 and IA-2 (IL-10, P < 0.05) and also low spontaneous pro-inflammatory immune activity (IL-6, IL-13, IFN-γ, TNF-α, and CCL2 (P < 0.05)) compared with children with an average or low physical activity. High physical activity in young children seems to have positive effects on the immune system by altering autoantigen-induced immune activity. PMID:25892449

  11. Importance of immunopharmacogenomics in cancer treatment: Patient selection and monitoring for immune checkpoint antibodies.

    PubMed

    Choudhury, Noura; Nakamura, Yusuke

    2016-02-01

    In the last 5 years, immune checkpoint antibodies have become established as anticancer agents for various types of cancer. These antibody drugs, namely cytotoxic T-lymphocyte-associated antigen, programmed death-1, and programmed death ligand-1 antibodies, have revealed relatively high response rates, the ability to induce durable responses, and clinical efficacy in malignancies not previously thought to be susceptible to immune-based strategies. However, because of its unique mechanisms of activating the host immune system against cancer as well as expensive cost, immune checkpoint blockade faces novel challenges in selecting appropriate patient populations, monitoring clinical responses, and predicting immune adverse events. The development of objective criteria for selecting patient populations that are likely to have benefit from these therapies has been vigorously investigated but still remains unclear. In this review, we describe immune checkpoint inhibition-specific challenges with patient selection and monitoring, and focus on approaches to remedy these challenges. We also discuss applications of the emerging field of immunopharmacogenomics for guiding selection and monitoring for anti-immune checkpoint treatment. PMID:26678880

  12. Source monitoring reduces the suggestibility of preschool children.

    PubMed

    Giles, Jessica W; Gopnik, Alison; Heyman, Gail D

    2002-05-01

    The relation between source monitoring and suggestibility was examined among preschool children. Thirty-two 3- to 5-year-olds were simultaneously presented with a brief story in two different modalities, as a silent video vignette and a spoken narrative. Each modality presented unique information about the story, but the information in the two versions was mutually compatible. The children were then asked a series of questions, including questions about the source (modality) of story details, and leading questions about story details (to assess suggestibility). Performance on the source-monitoring questions was highly correlated with the ability to resist suggestion. In addition, children who were asked source-monitoring questions prior to leading questioning were less susceptible to suggestion than were those who were asked the leading questions first. This study provides evidence that source monitoring can play a causal role in reducing the suggestibility of preschool children. PMID:12009053

  13. Summer Food Service Program for Children. Monitor's Handbook.

    ERIC Educational Resources Information Center

    Food and Nutrition Service (USDA), Washington, DC.

    In this handbook, monitors of food service programs for children are given instructions concerning their general responsibilities, training session requirements, meal requirements, daily record keeping, and specific responsibilities. Site review forms for vended programs are included. (WI)

  14. Heart Rate Monitors Promote Physical Education for Children

    ERIC Educational Resources Information Center

    Tipton, Jan; Sander, Allan N.

    2004-01-01

    National health and fitness data suggests that a significant percentage of children are not on a pathway to leading healthy, physically active lifestyles. Many children are leading sedentary lifestyles due to a lack of opportunity, success, or self-motivation in physical activity. Programs that highlight the use of heart rate monitors offer a…

  15. Immunization of children at risk of infection with human immunodeficiency virus.

    PubMed Central

    Moss, William J.; Clements, C. John; Halsey, Neal A.

    2003-01-01

    This paper reviews the English language literature on the safety, immunogenicity and effectiveness in children infected with the human immunodeficiency virus (HIV) of vaccines currently recommended by WHO for use in national immunization programmes. Immunization is generally safe and beneficial for children infected with HIV, although HIV-induced immune suppression reduces the benefit compared with that obtained in HIV-uninfected children. However, serious complications can occur following immunization of severely immunocompromised children with bacillus Calmette-Gu rin (BCG) vaccine. The risk of serious complications attributable to yellow fever vaccine in HIV-infected persons has not been determined. WHO guidelines for immunizing children with HIV infection and infants born to HIV-infected women differ only slightly from the general guidelines. BCG and yellow fever vaccines should be withheld from symptomatic HIV-infected children. Only one serious complication (fatal pneumonia) has been attributed to measles vaccine administered to a severely immunocompromised adult. Although two HIV-infected infants have developed vaccine-associated paralytic poliomyelitis, several million infected children have been vaccinated and the evidence does not suggest that there is an increased risk. The benefits of measles and poliovirus vaccines far outweigh the potential risks in HIV-infected children. The policy of administering routine vaccines to all children, regardless of possible HIV exposure, has been very effective in obtaining high immunization coverage and control of preventable diseases. Any changes in this policy would have to be carefully examined for a potential negative impact on disease control programmes in many countries. PMID:12640478

  16. Validation of Assays to Monitor Immune Responses in the Syrian Golden Hamster (Mesocricetus auratus)

    PubMed Central

    Zivcec, Marko; Safronetz, David; Haddock, Elaine; Feldmann, Heinz; Ebihara, Hideki

    2011-01-01

    The Syrian Golden hamster (Mesocricetus auratus) is a valuable but under-utilized animal model for studies of human viral pathogens such as bunyaviruses, arenaviruses, flaviviruses, henipaviruses, and SARS-coronavirus. A lack of suitable reagents and specific assays for monitoring host responses has limited the use of this animal model to clinical observations, pathology and humoral immune responses. The objective of this study was to establish and validate assays to monitor host immune responses in the hamster including important pro-inflammatory, anti-inflammatory and innate immune responses, as well as markers of apoptosis, cell proliferation, cell junction integrity and coagulation. Commercially available mouse and rat ELISA and luminex panels were screened for potential cross-reactivity, but were found to be of limited value for studying host responses in hamsters. Subsequently, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) assays for the detection of 51 immune-related and four internal reference genes were developed. To validate the immune-related assays, hamsters were infected with vesicular stomatitis virus (VSV), Indiana species, or treated with lipopolysaccharide (LPS) and host immune responses were monitored in selected organs. Ribosomal protein L18 was identified as the most stable internal reference gene. In conclusion, these new assays will greatly improve the use of the hamster as an important small animal model in infectious disease research. PMID:21334343

  17. How Focus at Encoding Affects Children's Source Monitoring

    ERIC Educational Resources Information Center

    Crawley, Stacie L.; Newcombe, Nora S.; Bingman, Hannah

    2010-01-01

    Retention of source information is enhanced by focus on speakers' feelings about statements even though recognition is reduced for both adults and children. However, does any focus on another person lead to enhanced source monitoring, or is a particular kind of focus required? Does other-focus enhance source monitoring, or does self-focus detract…

  18. Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.

    PubMed

    Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

    2015-01-01

    This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage. PMID:25760670

  19. Development of Mucosal Immunity in Children: A Rationale for Sublingual Immunotherapy?

    PubMed Central

    Szczawinska-Poplonyk, Aleksandra

    2012-01-01

    The mucosal immune system has bidirectional tasks to mount an effective defense against invading harmful pathogens and to suppress the immune response to alimentary antigens and commensal bacterial flora. Oral tolerance is a suppression of the mucosal immune pathway related to a specific immunophenotype of the dendritic cells and an induction of the regulatory T cells as well as with the silencing of the effector T cell response by anergy and deletion. The physiological dynamic process of the anatomical and functional maturation of the immune system occurring in children during pre- and postnatal periods is a significant factor, having an impact on the fine balance between the activation and the suppression of the immune response. In this paper, mechanisms of mucosal immunity and tolerance induction in terms of maturational issues are discussed with a special emphasis on the implications for a novel therapeutic intervention in allergic diseases via the sublingual route. PMID:22121386

  20. Role of platelet function and platelet membrane glycoproteins in children with primary immune thrombocytopenia.

    PubMed

    Liu, Wen-Jun; Bai, Jing; Guo, Qu-Lian; Huang, Zhe; Yang, Hong; Bai, Yong-Qi

    2016-09-01

    The aim of the present study was to examine and understand changes in platelet functions prior to and after the treatment of primary immune thrombocytopenia (ITP) in children. An automatic hematology analyzer and whole blood flow cytometry were used to detect immature platelet fraction (IPF), IPC and membrane glycoproteins (CD62p, PAC-1 and CD42b) in ITP children (ITP group), children with complete response after ITP treatment (ITP-CR group) and children with elective surgery (normal control group). The results showed that, levels of platelet count (PLT) and plateletcrit in the ITP group were lower alhtough the levels of mean platelet volume, platelet distribution width and platelet-large cell ratio (P-LCR) were higher than those in the normal control and ITP-CR groups. PLT in the ITP-CR group was lower than that in the normal controls. Additionally, IPF% was higher in the normal control and ITP-CR groups, IPC was lower in the ITP group compared to the normal control and ITP-CR groups. Furthermore, prior to ADP activation, the expression levels of CD62p, PAC-1 and CD42b in the ITP group were lower in ITP group than those in the normal control and ITP-CR groups. The expression level of PAC-1 was lower in the ITP-CR and normal control groups. No differences were identified in CD62p and CD42b expression levels. Following ATP activation, CD62p, PAC-1 and CD42b expression in the ITP group was lower than that in the normal control and ITP-CR groups. PAC-1 expression was lower while CD62p expression was higher in the ITP-CR group compared to the normal control group. In conclusion, the activation of platelets in ITP children was low. Decreased platelet function, platelet parameters and platelet glycoproteins may be used as markers for monitoring the treatment efficacy in ITP children. PMID:27431926

  1. Early clearance of Chikungunya virus in children is associated with a strong innate immune response.

    PubMed

    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H; Ng, Lisa F P

    2016-01-01

    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children. PMID:27180811

  2. Impaired Antigen-Specific Immune Response to Vaccines in Children with Antibody Production Defects.

    PubMed

    Szczawinska-Poplonyk, Aleksandra; Breborowicz, Anna; Samara, Husam; Ossowska, Lidia; Dworacki, Grzegorz

    2015-08-01

    The impaired synthesis of antigen-specific antibodies, which is indispensable for an adaptive immune response to infections, is a fundamental pathomechanism that leads to clinical manifestations in children with antibody production defects. The aim of this study was to evaluate the synthesis of antigen-specific antibodies following immunization in relation to peripheral blood B cell subsets in young children with hypogammaglobulinemia. Twenty-two children, aged from 8 to 61 months, with a deficiency in one or more major immunoglobulin classes participated in the study. Postvaccination antibodies against tetanus and diphtheria toxoids, the surface antigen of the hepatitis B virus, and the capsular Haemophilus influenzae type b polysaccharide antigen were assessed along with an immunophenotypic evaluation of peripheral blood B lymph cell maturation. A deficiency of antibodies against the tetanus toxoid was assessed in 73% of cases and that against the diphtheria toxoid was assessed in 68% of cases, whereas a deficiency of antibodies against the surface antigen of the hepatitis B virus was revealed in 59% of the children included in the study. A defective response to immunization with a conjugate vaccine with the Haemophilus influenzae type b polysaccharide antigen was demonstrated in 55% of hypogammaglobulinemic patients. Increased proportions of transitional B lymph cells and an accumulation of plasmablasts accompanied antibody deficiencies. The defective response to vaccine protein and polysaccharide antigens is a predominating disorder of humoral immunity in children with hypogammaglobulinemia and may result from a dysfunctional state of the cellular elements of the immune system. PMID:26018535

  3. Early clearance of Chikungunya virus in children is associated with a strong innate immune response

    PubMed Central

    Simarmata, Diane; Ng, David Chun Ern; Kam, Yiu-Wing; Lee, Bernett; Sum, Magdline Sia Henry; Her, Zhisheng; Chow, Angela; Leo, Yee-Sin; Cardosa, Jane; Perera, David; Ooi, Mong H.; Ng, Lisa F. P.

    2016-01-01

    Chikungunya fever (CHIKF) is a global infectious disease which can affect a wide range of age groups. The pathological and immunological response upon Chikungunya virus (CHIKV) infection have been reported over the last few years. However, the clinical profile and immune response upon CHIKV infection in children remain largely unknown. In this study, we analyzed the clinical and immunological response, focusing on the cytokine/chemokine profile in a CHIKV-infected pediatric cohort from Sarawak, Malaysia. Unique immune mediators triggered upon CHIKV infection were identified through meta-analysis of the immune signatures between this pediatric group and cohorts from previous outbreaks. The data generated from this study revealed that a broad spectrum of cytokines/chemokines is up-regulated in a sub-group of virus-infected children stratified according to their viremic status during hospitalization. Furthermore, different immune mediator profiles (the levels of pro-inflammatory cytokines, chemokines and growth and other factors) were observed between children and adults. This study gives an important insight to understand the immune response of CHIKV infection in children and would aid in the development of better prognostics and clinical management for children. PMID:27180811

  4. Immunizations

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Immunizations KidsHealth > For Teens > Immunizations Print A A A ... That Shot? en español Las vacunas Why Are Vaccinations Important? Measles, mumps, and whooping cough may seem ...

  5. Systemic Immune Activation Profiles of HIV-1 Subtype C-Infected Children and Their Mothers

    PubMed Central

    Makhubele, Tinyiko G.; Steel, Helen C.; Anderson, Ronald; van Dyk, Gisela; Theron, Annette J.; Rossouw, Theresa M.

    2016-01-01

    Little is known about immune activation profiles of children infected with HIV-1 subtype C. The current study compared levels of selected circulating biomarkers of immune activation in HIV-1 subtype C-infected untreated mothers and their children with those of healthy controls. Multiplex bead array, ELISA, and immunonephelometric procedures were used to measure soluble CD14 (sCD14), beta-2 microglobulin (β2M), CRP, MIG, IP-10, and transforming growth factor beta 1 (TGF-β1). Levels of all 6 biomarkers were significantly elevated in the HIV-infected mothers and, with the exception of MIG, in their children (P < 0.01–P < 0.0001). The effects of antiretroviral therapy (ART) and maternal smoking on these biomarkers were also assessed. With the exception of TGF-β1, which was unchanged in the children 12 months after therapy, initiation of ART was accompanied by decreases in the other biomarkers. Regression analysis revealed that although most biomarkers were apparently unaffected by smoking, exposure of children to maternal smoking was associated with a significant increase in IP-10. These findings demonstrate that biomarkers of immune activation are elevated in HIV-infected children pre-ART and decline, with the exception of TGF-β1, after therapy. Although preliminary, elevation of IP-10 in smoke-exposed infants is consistent with a higher level of immune activation in this group. PMID:27019552

  6. Cell-Mediated Immune Responses in Four-Year-Old Children after Primary Immunization with Acellular Pertussis Vaccines

    PubMed Central

    Ausiello, Clara M.; Lande, Roberto; Urbani, Francesca; la Sala, Andrea; Stefanelli, Paola; Salmaso, Stefania; Mastrantonio, Paola; Cassone, Antonio

    1999-01-01

    Cell-mediated immune (CMI) responses to Bordetella pertussis antigens (pertussis toxin [PT], pertactin [PRN], and filamentous hemagglutinin [FHA]) were assessed in 48-month-old recipients of acellular pertussis [aP] vaccines (either from Chiron-Biocine [aP-CB] or from SmithKline Beecham [aP-SB]) and compared to CMI responses to the same antigens at 7 months of age, i.e., 1 month after completion of the primary immunization cycle. None of the children enrolled in this study received any booster of pertussis vaccines or was affected by pertussis during the whole follow-up period. Overall, around 75% of 4-year-old children showed a CMI-positive response to at least one B. pertussis antigen, independently of the type of aP vaccine received, and the proportion of CMI responders were at least equal at 48 and 7 months of age. However, longitudinal examination of individual responses showed that from 20 (against PT) to 37% (against FHA) of CMI responders after primary immunization became negative at 48 months of age. This loss was more than compensated for by conversion to positive CMI responses, ranging from 36% against FHA to 69% against PRN, in other children who were CMI negative at 7 months of age. In 60 to 80% of these CMI converters, a lack of decline or even marked elevation of antibody (Ab) titers against B. pertussis antigens also occurred between 20 and 48 months of age. In particular, the frequency of seropositivity to PRN and FHA (but not to PT) was roughly three times higher in CMI converters than in nonconverters. The acquisition of CMI response to B. pertussis antigens in 48-month-old children was not associated with a greater frequency of coughing episodes lasting ≥7 days and was characterized by a prevalent type 1 cytokine profile, with high gamma interferon and low or no production of interleukin-5, reminiscent of cytokine patterns following immunization with whole-cell pertussis vaccine or natural infection. Our data imply that vaccination

  7. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-01-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles–mumps–rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3–5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  8. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  9. The Vaccine Safety Datalink: a model for monitoring immunization safety.

    PubMed

    Baggs, James; Gee, Julianne; Lewis, Edwin; Fowler, Gabrielle; Benson, Patti; Lieu, Tracy; Naleway, Allison; Klein, Nicola P; Baxter, Roger; Belongia, Edward; Glanz, Jason; Hambidge, Simon J; Jacobsen, Steven J; Jackson, Lisa; Nordin, Jim; Weintraub, Eric

    2011-05-01

    The Vaccine Safety Datalink (VSD) project is a collaborative project between the Centers for Disease Control and Prevention and 8 managed care organizations (MCOs) in the United States. Established in 1990 to conduct postmarketing evaluations of vaccine safety, the project has created an infrastructure that allows for high-quality research and surveillance. The 8 participating MCOs comprise a large population of 8.8 million members annually (3% of the US population), which enables researchers to conduct studies that assess adverse events after immunization. Each MCO prepares computerized data files by using a standardized data dictionary containing demographic and medical information on its members, such as age and gender, health plan enrollment, vaccinations, hospitalizations, outpatient clinic visits, emergency department visits, urgent care visits, and mortality data, as well as additional birth information (eg, birth weight) when available. Other information sources, such as medical chart review, member surveys, and pharmacy, laboratory, and radiology data, are often used in VSD studies to validate outcomes and vaccination data. Since 2000, the VSD has undergone significant changes including an increase in the number of participating MCOs and enrolled population, changes in data-collection procedures, the creation of near real-time data files, and the development of near real-time postmarketing surveillance for newly licensed vaccines or changes in vaccine recommendations. Recognized as an important resource in vaccine safety, the VSD is working toward increasing transparency through data-sharing and external input. With its recent enhancements, the VSD provides scientific expertise, continues to develop innovative approaches for vaccine-safety research, and may serve as a model for other patient safety collaborative research projects. PMID:21502240

  10. Newly diagnosed immune thrombocytopenia in children and adults: a comparative prospective observational registry of the Intercontinental Cooperative Immune Thrombocytopenia Study Group

    PubMed Central

    Kühne, Thomas; Berchtold, Willi; Michaels, Lisa A.; Wu, Runhui; Donato, Hugo; Espina, Bibiana; Tamary, Hannah; Rodeghiero, Francesco; Chitlur, Meera; Rischewski, Johannes; Imbach, Paul

    2011-01-01

    Background Primary immune thrombocytopenia is a bleeding diathesis with an unknown etiology in predisposed individuals with immune disturbances. Although it is claimed that children and adults differ in clinical and laboratory aspects, few data exist to corroborate this observation. Our objective was to assess comparative data from children and adults with newly diagnosed immune thrombocytopenia. Design and Methods Clinical and laboratory data of 1,784 children and 340 adults were extracted from the Pediatric and Adult Registry on Chronic Immune Thrombocytopenia. The registry represents a prospective cohort of children and adults with newly diagnosed immune thrombocytopenia. Participating investigators registered their patients immediately after the diagnosis using a web based data transfer. Children aged under 16 years were compared with adults aged 16 years and over with descriptive statistical analyses. Results The presenting mean platelet count of children and adults was 18.1 and 25.4×109/L. Signs of bleeding were reported in 24% of children and in 23% of adults, and intracranial hemorrhage in 10 of 1,784 children and in 6 of 340 adults. Co-morbidity was observed in 3.9% of children and in 30% of adults. Bone marrow aspiration and laboratory tests (antinuclear antibodies, human immunodeficiency and hepatitis C virus) were performed more frequently in adults. Children and adults were followed with a ‘watch and wait’ strategy in 20% and in 29%, respectively. Immunoglobulins were used more frequently in children and corticosteroids in adults. Conclusions Comparative data of children and adults with newly diagnosed immune thrombocytopenia revealed similarities in presenting platelet counts and in bleeding, whereas differences occurred in co-morbidity, diagnostic procedures and therapy. PMID:21880634

  11. Immune responses in children infected with the pinworm Enterobius vermicularis in central Greece.

    PubMed

    Patsantara, G G; Piperaki, E-T; Tzoumaka-Bakoula, C; Kanariou, M G

    2016-05-01

    Previous studies have suggested an immunomodulatory and even protective role for Enterobius vermicularis, the least pathogenic human intestinal helminth. Here, in a study using haematological and serological parameters, we tested a total of 215 children from central Greece, with a mean age of 8.39, of whom 105 (48.84%) were infected with E. vermicularis and 110 (51.16%) were matched healthy controls. In particular, we analysed eosinophil counts (EO), serum eosinophil cationic protein (ECP), total and specific serum immunoglobulin E (IgE) and the ECP/EO ratio. The atopic status and the potential occurrence of clinically expressed allergic diseases were both taken into account. Eosinophils, ECP and IgE were found to be higher in infected than in uninfected children, indicating a type-2 immune response activation during infection. Atopic infected children exhibited higher IgE levels compared to non-atopic ones. EO and ECP were found to be lower in atopic children who had a history of allergic disease than in those with no such history. The type-2 oriented immune response elicited against E. vermicularis could contribute to a balanced activation of the immune system in the examined children. Interestingly, although the atopic children showed a stronger activation, they did not exhibit any symptoms and, moreover, there seemed to be some indication of immunosuppression in those children with a positive history of allergic disease. PMID:25989836

  12. Immunity of PCB transplacental Yu-Cheng children in Taiwan

    SciTech Connect

    Lan, Shou Jen; Yen, Yea Yin; Chen, Eng Rin; Ko, Ying Chin ); Lan, Joung Liang )

    1990-02-01

    Up to now, there has been no studies about the immune status of PCB transplacental Yu-Cheng babies. In an earlier study, Yu-Cheng babies were reported to have a high infant mortality rate. It was reported that these babies would easily catch cold, experience diarrhea and abdominal pains. Recently, it was found that the bronchitis rate of Yu-Cheng babies is higher than in control babies. Because of high risk of infection, it is presumed that these babies might suffer immunosuppression to a certain extent. According to these findings, investigations into the immune functions of PCB transplacental Yu-Cheng babies are needed.

  13. Family Adversity and Autonomic Reactivity Association With Immune Changes in HIV-Affected School Children

    PubMed Central

    Thomas, Melanie; Wara, Diane; Saxton, Katherine; Truskier, Mary; Chesney, Margaret; Boyce, W. Thomas

    2013-01-01

    Objective To explore whether primary school entry is associated with changes in immune system parameters in HIV-affected children. HIV-affected children are vulnerable to psychosocial stressors, regardless of their own HIV serological status. Methods Data from 38 HIV+ and 29 HIV− children born to seropositive women were obtained before and after school entry. Measures included family adversity questionnaires, autonomic nervous system (ANS) reactivity (based on mean arterial responses to challenge tasks), and enumerative and functional changes in peripheral blood immune parameters. Results In comparison to children who were HIV−, children who were HIV+ at baseline had fewer CD4+ T lymphocytes (M = 916 vs. 1206 cells/mm3 × 103; F = 7.8, p = .007), more CD8+ cells (M = 1046 vs. 720 cells/mm3 ×103; F = 7.98, p = .006), and diminished NK cell cytotoxicity (M =−.29 vs. .41; F = 8.87, p = .004). School entry was associated with changes in immune parameters, but HIV status was not associated with the magnitude of changes. Changes in immune parameters following school entry were associated with family stress and pre school entry ANS reactivity. Highly ANS reactive children had either the greatest increase in CD8+ cells following school entry or the greatest decrease, depending upon reported levels of family adversity (B = 215.35; t = 3.74, p < .001). Changes in functional immune assays were significantly associated with the interactions between HIV status and ANS reactivity. Conclusions These results suggest that autonomic reactivity is associated with increased immunological sensitivity to adverse or challenging social contexts among children affected by HIV. PMID:23766380

  14. Monitoring Services to Children: Title XX

    ERIC Educational Resources Information Center

    Black Child Development Institute

    1977-01-01

    The proliferation of State offices of child development and the advent of Social Security Title XX funds have been accompanied by confusion at every level of government and in the black community. The impact of these developments on availability of good day care for children is examined and recommendations are made. (Author/AM)

  15. Varicella zoster immune status in children treated for acute leukemia.

    PubMed

    Patel, Soonie R; Bate, Jessica; Maple, Peter A C; Brown, Kevin; Breuer, Judith; Heath, Paul T

    2014-11-01

    Children treated for acute leukemia are at increased risk of severe infection with varicella zoster virus (VZV). We studied the VZV sero-status of children with acute leukemia prior to starting chemotherapy and after completion of chemotherapy. VZV sero-status was assessed using time resolved fluorescence immunoassay (TRFIA) before starting treatment and 6 months after completion of treatment. Prior to starting treatment for acute leukemia, a significant proportion of children (35%) are VZV seronegative. On completion of treatment most patients maintained protective VZV antibody levels; however, 35% had reduced/loss VZV antibody to a level considered non-protective and susceptible to VZV infection. PMID:24789692

  16. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    PubMed Central

    Urbani, Francesca; Proietti, Enrico

    2013-01-01

    The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs) and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM-) based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT) combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma. PMID:24195078

  17. Acute psychosis in children: do not miss immune-mediated causes.

    PubMed

    AlHakeem, Afnan S; Mekki, Mohamed S; AlShahwan, Saad M; Tabarki, Brahim M

    2016-07-01

    New-onset psychosis in children represents a complex presenting symptom. Psychosis can be attributable to a combination of factors and etiologies, and all possible causes must be systematically examined. There is growing evidence that a proportion of psychosis/ psychiatric manifestations in children may be immunemediated, and physicians should consider this etiology in each presentation of first-episode psychosis. Immunemediated encephalopathies/encephalitis are increasingly being recognized in children with antibodies to N-methyl-D-aspartate receptor, Leucine-rich gliomainactivated 1 or other central nervous system antigens such as Contactin-associated protein-like 2, glutamic acid decarboxylase, alpha-amino-3-hydroxy-5-methyl-4isoxazolepropionic acid or Gamma-aminobutyric acid B. In this study, we describe 3 cases of immune-mediated encephalopathy/encephalitis with prominent psychiatric symptoms at presentation, and suggest a practical diagnostic and treatment approach for children with acute psychosis of an immune-mediated cause. PMID:27356658

  18. Immune monitoring of human gene therapy trials: potential application to leukemia and lymphoma.

    PubMed

    Whiteside, Theresa L; Gooding, William

    2003-01-01

    Therapeutic genetically modified vaccines administered to patients with cancer are expected to induce and sustain tumor-specific immune responses. To measure these responses, monitoring strategies including a range of antibody-based and cellular assays have been developed. Single-cell cellular assays capable of detecting fewer than 1/10,000 of antigen-specific T lymphocytes in the tested population are currently in demand. ELISPOT assay, cytokine flow cytometry, and tetramer binding were recently compared by us in the context of monitoring of a dendritic cell-based multi-peptide vaccination trial in patients with metastatic melanoma. These single-cell assays were not found to be concordant in measurements of the frequency of peptide-specific T cells or in detecting pre- to post-vaccine changes in the frequency of these T cells. Implications of the results for monitoring of genetically modified vaccines are discussed, and the plan for a rational approach to monitoring and for selection of monitoring assays is proposed. Monitoring of human gene therapy or vaccination trials in patients with advanced cancers, who are often immunocompromised and thus poorly responsive, is a challenge. This challenge is best met by utilizing experienced reference laboratories for immune monitoring of clinical trials. PMID:12850486

  19. Determinants of Hepatitis A Vaccine Immunity in a Cohort of Human Immunodeficiency Virus-Infected Children Living in Switzerland

    PubMed Central

    Crisinel, Pierre Alex; Posfay-Barbe, Klara Maria; Aebi, Christoph; Cheseaux, Jean-Jacques; Kahlert, Christian; Rudin, Christoph; Nadal, David

    2012-01-01

    Vaccination in HIV-infected children is often less effective than in healthy children. The goal of this study was to assess vaccine responses to hepatitis A virus (HAV) in HIV-infected children. Children of the Swiss Mother and Child HIV Cohort Study (MoCHiV) were enrolled prospectively. Recommendations for initial, catch-up, and additional HAV immunizations were based upon baseline antibody concentrations and vaccine history. HAV IgG was assessed by enzyme-linked immunosorbent assay (ELISA) with a protective cutoff value defined as ≥10 mIU/ml. Eighty-seven patients were included (median age, 11 years; range, 3.4 to 21.2 years). Forty-two patients were seropositive (48.3%) for HAV. Among 45 (51.7%) seronegative patients, 36 had not received any HAV vaccine dose and were considered naïve. Vaccine responses were assessed after the first dose in 29/35 naïve patients and after the second dose in 33/39 children (25 initially naïve patients, 4 seronegative patients, and 4 seropositive patients that had already received 1 dose of vaccine). Seroconversion was 86% after 1 dose and 97% after 2 doses, with a geometric mean concentration of 962 mIU/ml after the second dose. A baseline CD4+ T cell count below 750 cells/μl significantly reduced the post-2nd-dose response (P = 0.005). Despite a high rate of seroconversion, patients with CD4+ T cell counts of <750/μl had lower anti-HAV antibody concentrations. This may translate into a shorter protection time. Hence, monitoring humoral immunity may be necessary to provide supplementary doses as needed. PMID:22933400

  20. The Immune System in Children with Malnutrition—A Systematic Review

    PubMed Central

    Rytter, Maren Johanne Heilskov; Kolte, Lilian; Briend, André; Friis, Henrik; Christensen, Vibeke Brix

    2014-01-01

    Background Malnourished children have increased risk of dying, with most deaths caused by infectious diseases. One mechanism behind this may be impaired immune function. However, this immune deficiency of malnutrition has not previously been systematically reviewed. Objectives To review the scientific literature about immune function in children with malnutrition. Methods A systematic literature search was done in PubMed, and additional articles identified in reference lists and by correspondence with experts in the field. The inclusion criteria were studies investigating immune parameters in children aged 1–60 months, in relation to malnutrition, defined as wasting, underweight, stunting, or oedematous malnutrition. Results The literature search yielded 3402 articles, of which 245 met the inclusion criteria. Most were published between 1970 and 1990, and only 33 after 2003. Malnutrition is associated with impaired gut-barrier function, reduced exocrine secretion of protective substances, and low levels of plasma complement. Lymphatic tissue, particularly the thymus, undergoes atrophy, and delayed-type hypersensitivity responses are reduced. Levels of antibodies produced after vaccination are reduced in severely malnourished children, but intact in moderate malnutrition. Cytokine patterns are skewed towards a Th2-response. Other immune parameters seem intact or elevated: leukocyte and lymphocyte counts are unaffected, and levels of immunoglobulins, particularly immunoglobulin A, are high. The acute phase response appears intact, and sometimes present in the absence of clinical infection. Limitations to the studies include their observational and often cross-sectional design and frequent confounding by infections in the children studied. Conclusion The immunological alterations associated with malnutrition in children may contribute to increased mortality. However, the underlying mechanisms are still inadequately understood, as well as why different types of

  1. Caregivers Who Refuse Preventive Care for Their Children: The Relationship Between Immunization and Topical Fluoride Refusal

    PubMed Central

    2014-01-01

    Objectives. The aim of this study was to examine caregivers’ refusal of preventive medical and dental care for children. Methods. Prevalence rates of topical fluoride refusal based on dental records and caregiver self-reports were estimated for children treated in 3 dental clinics in Washington State. A 60-item survey was administered to 1024 caregivers to evaluate the association between immunization and topical fluoride refusal. Modified Poisson regression models were used to estimate prevalence rate ratios (PRRs). Results. The prevalence of topical fluoride refusal was 4.9% according to dental records and 12.7% according to caregiver self-reports. The rate of immunization refusal was 27.4%. In the regression models, immunization refusal was significantly associated with topical fluoride refusal (dental record PRR = 1.61; 95% confidence interval [CI] = 1.32, 1.96; P < .001; caregiver self-report PRR = 6.20; 95% CI = 3.21, 11.98; P < .001). Caregivers younger than 35 years were significantly more likely than older caregivers to refuse both immunizations and topical fluoride (P < .05). Conclusions. Caregiver refusal of immunizations is associated with topical fluoride refusal. Future research should identify the behavioral and social factors related to caregiver refusal of preventive care with the goal of developing multidisciplinary strategies to help caregivers make optimal preventive care decisions for children. PMID:24832428

  2. Challenges in the harmonization of immune monitoring studies and trial design for cell-based therapies in the context of hematopoietic cell transplantation for pediatric cancer patients.

    PubMed

    Nierkens, Stefan; Lankester, Arjan C; Egeler, R Maarten; Bader, Peter; Locatelli, Franco; Pulsipher, Michael A; Bollard, Catherine M; Boelens, Jaap-Jan

    2015-12-01

    Clinical trials aimed at improving results of hematopoietic cell transplantation (HCT) by adjuvant cell-based interventions in children have been limited by small numbers and pediatric-specific features. The need for a larger number of pediatric HCT centers to participate in trials has resulted in a demand for harmonization of disease-specific clinical trials and immune-monitoring. Thus far, most phase I/II trials select different end points evaluated at disparate time points, making inter-study comparisons difficult and, sometimes, impossible. In this review, we discuss the various aspects that are important to consider for harmonizing clinical trial design as well as the critical elements for standardized (immune)-monitoring protocols in cell-based intervention trials in the context of HCT. Comparison data from trials applying harmonized trial design will lead to optimized immunotherapeutic treatment protocols to maximize clinical efficacy while minimizing toxicity. PMID:26589751

  3. Time Monitoring and Executive Functioning in Children and Adults

    ERIC Educational Resources Information Center

    Mantyla, Timo; Carelli, Maria Grazia; Forman, Helen

    2007-01-01

    This study examined time-based prospective memory performance in relation to individual and developmental differences in executive functioning. School-age children and young adults completed six experimental tasks that tapped three basic components of executive functioning: inhibition, updating, and mental shifting. Monitoring performance was…

  4. Audiovisual Vowel Monitoring and the Word Superiority Effect in Children

    ERIC Educational Resources Information Center

    Fort, Mathilde; Spinelli, Elsa; Savariaux, Christophe; Kandel, Sonia

    2012-01-01

    The goal of this study was to explore whether viewing the speaker's articulatory gestures contributes to lexical access in children (ages 5-10) and in adults. We conducted a vowel monitoring task with words and pseudo-words in audio-only (AO) and audiovisual (AV) contexts with white noise masking the acoustic signal. The results indicated that…

  5. Maternal determinants of complete child immunization among children aged 12-23 months in a southern district of Nigeria.

    PubMed

    Fatiregun, Akinola Ayoola; Okoro, Anselm O

    2012-01-17

    This study was conducted to identify determinants of complete immunization status among children aged 12-23 months in a southern district of Nigeria. The World Health Organization cluster survey was used to evaluate immunization coverage of infants. Mothers of 525 children selected by the two-stage sampling method and interviewed using an adapted questionnaire responded. Completion of the immunization schedule was verified by an immunization card or by reported history indicating that the child had received full doses of four of the antigens included in the Nigeria routine immunization schedule. Multivariate logistic regression was used to identify factors associated with completion of immunization. Only 32.4% of children had completed the immunization schedule. Determinants of complete immunization status included a maternal age less than 30 years (AOR=2.26, 95% CI:1.27-4.03), availability of an immunization card at first contact (AOR=7.72, 95% CI:4.43-13.44), fewer than three children (AOR=2.22, 95% CI:11.1-4.42), completion of post secondary education (AOR=2.34, 95% CI:1.12-4.47) and maternal unemployment (AOR=1.71, 95% CI:1.01-2.89). Identifying mothers whose children are at risk of not completing the immunization schedule and educating them is an important strategy to improve antigen coverage and prevent early childhood deaths from diseases like tuberculosis, poliomyelitis, tetanus, diphtheria, pertussis and measles. PMID:22137878

  6. Safe immunization of allergic children against measles, mumps, and rubella.

    PubMed

    Juntunen-Backman, K; Peltola, H; Backman, A; Salo, O P

    1987-10-01

    A series of 135 subjects (134 children and one adult) with documented or suspected systemic allergy were prick-tested before a measles, mumps, and rubella (MMR) vaccination. Atopic eczema was documented in 68, asthma in 47, and cow's-milk allergy in 11 examinees; eight children were evaluated because of severe systemic reactions following diphtheria-pertussis-tetanus, measles, or inactivated polio (Salk) vaccinations. In one child, there was only a suspicion of general allergy. The undiluted MMR prick test gave negative reactions in 126 cases (93%). The highest rate of nonreactivity was observed in those with atopic eczema (96%) and in children with asthma (91%) or cow's-milk allergy (82%). All examinees with systemic reactions after other vaccinations also had negative prick-test reactions. A total of 122 (95%) of the 129 examinees were eventually vaccinated with MMR. No untoward reactions developed, except mild generalized urticaria or fever in two vaccinees. We conclude that at least 95% of children with common forms of systemic allergy can be vaccinated safely with MMR and, in general, that allergic diseases should not interfere with execution of the vaccination programs. PMID:3630996

  7. [Mucosal immune response to Helicobacter pylori in children with gastroduodenal diseases and allergy].

    PubMed

    Mazurina, S A; Ilintseva, N V; Gervazieva, V B

    2014-01-01

    In children with chronic gastritis/gastroduodenitis, erosions and ulcer of stomach and duodenum and associated allergic diseases (asthma, allergic rhinitis, atopic dermatitis) CagA, sIgA and IgE antibodies to the H. pylori were determined by ELISA in the supernatants of feces. H. pylori infection was determined according to "Maastricht IV". The frequency and contents of CagA did not differ among the groups we studied. However, in children with positive urease test the contents of CagA was significantly higher (p = 0.03) compared with other children. The highest levels of sIgA were found in the feces supernatants from non-allergic children with CG/CGD and were associated with H. pylori infection. The immune response in children with erosions and ulcer of stomach and duodenum and in children with allergy was presented the sIgE to H. pylori. Also, the negative correlation between the level sIgE to H. pylori and content sIgA was found in children with allergy. Thus, increased IgE indicates not only allergy, but also acts as a protective role in the development of anti-infective immunity. PMID:25916130

  8. Immunization of Children Receiving Immunosuppressive Therapy for Cancer or Hematopoietic Stem Cell Transplantation

    PubMed Central

    Shetty, Avinash K.; Winter, Mary A.

    2012-01-01

    In the past 3 decades, the number of immunocompromised children has increased steadily because of dramatic improvement in survival rates in certain malignancies as a result of intensive curative treatment regimens and an increase in the number of children undergoing life-saving hematopoietic stem cell transplantation (HSCT). Children receiving immunosuppressive therapy for cancer, as well as HSCT recipients, will benefit from vaccination but warrant close evaluation for a variety of reasons, such as the risk of developing severe infections, serious adverse events following certain vaccines, and decreased vaccine efficacy caused by poor immune response to vaccination. Various professional organizations have published vaccination guidelines for immunocompromised patients. Given their heterogeneity, recommendations for the immunization of immunocompromised patients may not be universally applicable. The safety of many commonly used vaccines has not been established in immunocompromised children. In addition, no large-scale vaccine studies have evaluated the clinical outcome of disease prevention in this population. All killed vaccines are generally safe, while live vaccines may be administered to immunocompromised children in select circumstances, depending on the degree of altered immunocompetence and the underlying primary condition. Healthcare providers should be knowledgeable about the indications, contraindications, and precautions for vaccine administration in immunocompromised patients. To protect immunocompromised patients, all family, household contacts, and healthcare workers should also be immunized with all routinely recommended vaccines. Pediatricians play a crucial role in identifying and effectively communicating the risks and benefits of vaccines to immunocompromised patients and their parents. PMID:23049460

  9. [Functional state of specific immunity in children and teenagers vaccinated against mumps].

    PubMed

    Otrashevskaia, E V; Bukin, E K; Krasil'nikov, I V; Ignat'ev, G M

    2010-01-01

    The functional state of immunity was evaluated from the avidity index (AI) of specific antibodies (IgG) and the level and spectrum of their neutralizing activity. The study recruited 200 subjects immunized with Russian vaccine against mumps according to the mandatory scheme. A group of vaccinees with a low AI of specific IgG was identified mainly among old children and teenagers. The vaccinees with a low AI had a significantly lower protective immunity (as shown from the level and spectrum of serum neutralizing activity) than those with a high AI. The vacinees with no humoral, incomplete, or complete postvaccination immunity, but with a low AI of specific IgG, can constitute a population stratum that preserves sensitivity to wild-type mumps viruses and serves as a favorable medium for their circulation. PMID:20886708

  10. Response to immunization in children born to renal transplant recipients using immunosuppressive drugs during gestation.

    PubMed

    Dinelli, Maria Isabel Saraiva; Ono, Erika; Viana, Patrícia Oliveira; Spina, Fernanda Garcia; Weckx, Lily Yin; dos Santos, Amélia Miyashiro Nunes; de Moraes-Pinto, Maria Isabel

    2016-01-20

    The use of immunosuppressive drugs can impair vaccination responses. When used during pregnancy, they may interfere with the development of the fetus's immune system. However, little is known regarding their influence on infant's response to vaccinations. Twenty-seven children born to renal transplant mothers (Tx) taking immunosuppressive drugs and 31 healthy children had the humoral immune response and reactogenicity to tetanus, Haemophilus influenzae type b (Hib) and 7 pneumococcal serotypes evaluated. The evolution of BCG vaccine scar was also registered. Antibodies were measured by ELISA. Lymphocyte immunophenotyping was performed on cord blood and at 7-8 months of age. Among Tx neonates, 82.4% had low B lymphocyte numbers at birth, and 29.4% had also low numbers of other lymphocyte subpopulations. Nevertheless, all children developed protective antibodies with similar antibody concentrations to the control group. Vaccine reactogenicity was similar in both groups and BCG healing was uneventful. PMID:26707214

  11. Immunization Practices of Pediatricians for Children Younger Than Five Years in Coastal South India

    PubMed Central

    Mithra P, Prasanna; Unnikrishnan, B.; Rekha T; Kumar, Nithin; Chatterjee, Pratik Kumar; Holla, Ramesh

    2016-01-01

    Context Immunization helps in controlling infectious diseases. Child immunization is an important component of child survival programs in India, which mainly follows the National Immunization Schedule. Also, many of the injection practices followed are not safe. Aims To study the practices of pediatricians toward the immunization of children younger than 5 years and injection-related waste management. Settings and Design Cross-sectional study carried out in the city of Mangalore, a rapidly developing city in southern India. Methods and Material All the practicing pediatricians were included in the study and an interview was done on prior appointment using pretested interview schedule in March 2012, after obtaining clearance from the institutional ethics committee. Data were analyzed using the Statistical Package for Social Sciences version 11.5. Results Among the 54 practicing pediatricians in Mangalore, 42 were included in this study after exclusion criteria were applied. Among them, 71.4% were following the National Immunization Schedule, 5% did not prefer to give combination vaccines, 17% reported vaccine failure at least once in their practice, and 85.7% motivated the parents for future doses. Distance to the clinic and affordability were the major reasons for loss of follow-up. Only 38.1% used auto-disabled syringes, 11.9% did not observe the children following the immunization, and 45.2% did not use color coding for disposal of injection-related wastes. Mechanical hub cutters were preferred by 41% of the respondents. Conclusion The study showed the diversity in immunization practices. The National Immunization Schedule is the most commonly followed schedule. However, the safety of the injection practices was limited. PMID:25318472

  12. Immune responses to tetanus vaccination in Italian healthy subjects and children with recurrent infections.

    PubMed

    Graziani, S; Romiti, M L; Capponi, C; Di Cesare, S; Corrente, S; Monteferrario, E; Di Paolo, A; De Marchis, C; Chini, L; Moschese, V

    2013-01-01

    The ability of vaccine antigen to generate protection is a challenge that cannot be restricted to the antibody response; however, the contribution of T cell-mediated mechanisms has not been extensively analyzed. Age and administration to specific categories of patients, i.e. children with recurrent infections (RI), are some of the factors that might affect the vaccine immune response. We investigated the humoral and cellular response to tetanus toxoid (TT) vaccine in 104 healthy children (HC), 11 newborns and 22 healthy adults to characterize the status of immunity according to age and compared it to 118 RI children. Humoral and cellular responses varied in both groups according to age and doses of TT administered. The prevalence of antibody and cellular response was similar in both cohorts (HC 88 percent and 82 percent versus RI 86 percent and 85 percent), however, TT antibody values were significantly higher in 12-18 months old RI children compared to HC (median: 5 IU/ml vs 1.10 IU/ml) (p = 0.02). The lack of an efficient immune response was observed in 12-15 percent of children from both cohorts. Our data showed that specific antibodies were responsible for early protection, whereas cell-mediated mechanisms may contribute to the generation of long-term immunity after an appropriate vaccine recall. The occurrence of higher TT antibody values in 12-18 months old RI children deserves additional research to determine whether they are caused by different infectious agents and/or by other environmental factors. Clarification of this issue is important for categorizing patients into an optimal vaccine policy. PMID:23489690

  13. Humoral and cellular immune responses to influenza vaccination in children with cancer receiving chemotherapy

    PubMed Central

    WONG-CHEW, ROSA MARÍA; FRÍAS, MARGARITA NAVA; GARCÍA-LEÓN, MIGUEL LEONARDO; ARRIAGA-PIZANO, LOURDES; SANSON, AURORA MEDINA; LOPEZ-MACÍAS, CONSTANTINO; ISIBASI, ARMANDO; SANTOS-PRECIADO, JOSÉ IGNACIO

    2012-01-01

    The immune response to influenza vaccination in children with cancer is controversial. The objective of this study was to characterize the cellular and humoral immune responses to an influenza vaccine in children with cancer who were receiving chemotherapy. In this study, children with cancer, who were not previously immunized, received an influenza vaccine via intramuscular injection. Blood samples were obtained prior to and at 4 weeks after immunization. Antibodies were measured using a hemagglutination inhibition (HI) assay. Cell-mediated immunity was measured by specific lymphoproliferation with 3H-thymidine incorporation and by measuring cell frequencies following staining with monoclonal antibodies (CD8, CD4, CD19, CD45RA and CD27) using flow cytometry following incubation with the influenza antigen for 5 days. Geometric mean titers (GMT), mean counts per minute (cpm), cell frequencies prior to and following vaccination and percentage patient responses were compared using the Mann-Whitney non-parametric U and Chi-square tests; where p<0.05 was considered to indicate a statistically significant result. A total of 56 children were included. Their mean age was 6.64±3.61 years. Acute lymphoblastic leukemia (ALL) was diagnosed in 75, solid tumors in 23 and lymphoma in 2% of the children. Subjects with titers ≥40 hemagglutination units (HU) increased from 43% prior to vaccination to 73% following vaccination (p=0.01), whereas the GMT increased from 31.35 [95% confidence interval (CI), 29–111] to 143.45 HU (95% CI, 284–640) following vaccination (p<0.001). An increase in CD45RA expression in CD8+ T cells was observed following vaccination (p=0.01). An increase in CD27 expression was observed in the CD4/8-negative cell population stimulated with the influenza antigen following vaccination (p<0.05). No serious adverse effects were observed. An increase in the seropositivity rate and GMT values following influenza vaccination were also observed. Influenza

  14. Program on immunization and cold chain monitoring: the status in eight health districts in Cameroon

    PubMed Central

    2013-01-01

    Background Cold chain monitoring is a precondition to ensure immunization quality, efficacy and safety. In Cameroon, the Expanded Program on Immunization (EPI) has National Standard Operating Procedure (SOP) that describes the vaccines, the cold chain system and equipment, its use and recommended procedures to control and monitor the temperatures and the cold chain. This study was conducted to assess the status of cold chain in eight health districts in Cameroon. Findings The study was carried out in eight health districts out of fifty with poor immunization coverage rate. Data were collected using a validated form by observation and consultation of related documents. District Health Services (DHS) and four Integrated. Health Centers (IHC) randomly selected were targeted per health district. Forty health facilities were included. Twenty eight (70.0%) had at least one functional refrigerator for EPI activities. The power supply was reported to be permanent in 7 (20.6%) out of 34. (85.0%) health facilities with access to power supply. The temperature monitoring chart was pasted on 27 (96.4%) of the cold chain equipment. On 16 (59.3%) of these charts, the temperature was recorded twice daily as recommended. Seven (25.9%) of 27 refrigerators assessed had temperature out of the recommended range of 2 to 8°C. Almost 23.30% of health centers did not received any supervision on cold chain monitoring during a vaccination campaign. Conclusion This study documents failure of the cold chain maintenance and questions the efficacy and safety of vaccines administered during EPI activities in Cameroun. These findings indicate that appropriate actions are needed to ensure monitoring of EPI cold chain in the country. PMID:23497720

  15. Modulation of the immune response by infection with Cryptosporidium spp. in children with allergic diseases.

    PubMed

    Guangorena-Gómez, J O; Maravilla-Domínguez, A; García-Arenas, G; Cervantes-Flores, M; Meza-Velázquez, R; Rivera-Guillén, M; Acosta-Saavedra, L C; Goytia-Acevedo, R C

    2016-08-01

    It has been demonstrated that the allergic response can be ameliorated by the administration of pathogen derivatives that activate Toll-like receptors and induce a Th1-type immune response (IR). Cryptosporidium is a parasite that promotes an IR via Toll-like receptors and elicits the production of Th1-type cytokines, which limit cryptosporidiosis. The aim of this study was to investigate allergy-related immune markers in children naturally infected with Cryptosporidium. In a cross-sectional study, 49 children with or without clinical diagnosis of allergies, oocysts of Cryptosporidium spp. in the faeces were screened microscopically. We microscopically screened for leucocytes, examined T and B cells for allergy-related activation markers using flow cytometry and evaluated serum for total IgE using chemiluminescence. Children with allergies and Cryptosporidium in the faeces had significantly lower levels of total IgE, B cells, CD19(+) CD23(+) and CD19(+) CD124(+) cells as well as a greater percentage of interferon-gamma (IFN-γ(+) ) and IL-4(+) CD4(+) cells than children with allergies without Cryptosporidium. This is the first description of the modulation of the IR in children with allergic diseases in the setting of natural Cryptosporidium infection. Our findings suggest the involvement of CD4(+) cells producing IL-4 and IFN-γ in the IR to Cryptosporidium in naturally infected children. PMID:27150641

  16. Effect of season of inoculation on immune response to rubella vaccine in children.

    PubMed

    Linder, Nehama; Abudi, Yair; Abdalla, Wafa; Badir, Mursi; Amitai, Yona; Samuels, Justin; Mendelson, Ella; Levy, Itzhak

    2011-08-01

    The yearly seasons are marked by changes in the amount of sunlight. Ultraviolet radiation (UVR) is known to adversely affect the course of viral infections, immunologic memory and cellular and humoral immune responses. Our objectives were to investigate potential differences in the immune response of the rubella vaccine after 3-4 years by season of inoculation. Children aged 4-5 years attending four kindergartens in villages in northern Israel, all of whom had been vaccinated at 1 year of age, were enrolled in the study. Participants were divided into three groups by season of the year in which the inoculation was performed: summer (N = 63), winter (N = 36) and intermediate (N = 104). Main outcome measures were mean geometrical titer of rubella antibodies and complete, partial or no immunity to rubella by season of inoculation. Of the 203 children tested, 186 (91.6%) had adequate antibody levels, 7 (3.4%) had equivocal levels and 10 (4.9%) had inadequate levels. Significantly higher mean geometrical titers were found in the winter-inoculated compared with the summer-inoculated group (73.0 ± 2.6 vs 47.6 ± 2.8; p < 0.05). The same tendency was noted in the percent of infants properly immunized. This preliminary study shows a strong correlation between the immune response to rubella vaccine and the season of vaccination. Immunogenicity may be improved by inoculating children during seasons of less sunlight or by reducing the children's exposure to sunlight following inoculation. This practice is especially important in areas with extreme seasonal variability in solar radiation and tropical areas. Further studies are needed to corroborate and expand these findings. PMID:19889749

  17. Effects of malnutrition on children's immunity to bacterial antigens in Northern Senegal.

    PubMed

    Gaayeb, Lobna; Sarr, Jean B; Cames, Cecile; Pinçon, Claire; Hanon, Jean-Baptiste; Ndiath, Mamadou O; Seck, Modou; Herbert, Fabien; Sagna, Andre B; Schacht, Anne-Marie; Remoue, Franck; Riveau, Gilles; Hermann, Emmanuel

    2014-03-01

    To evaluate immunity to vaccine-preventable diseases according to nutritional status, a longitudinal study was conducted in Senegalese children ages 1-9 years old. A linear regression analysis predicted that weight for age was positively associated with immunoglobulin G (IgG) response to tetanus toxoid in children born during the rainy season or at the beginning of the dry season. A relationship between village, time of visits, and levels of antibodies to tetanus showed that environmental factors played a role in modulating humoral immunity to tetanus vaccine over time. Moreover, a whole-blood stimulation assay highlighted that the production of interferon-γ (IFN-γ) in response to tetanus toxoid was compromised in stunted children. However, the absence of cytokine modulation in response to Mycobacterium tuberculosis-purified protein derivatives and phytohemagglutinin suggests that the overall ability to produce IFN-γ was preserved in stunted children. Therefore, these results show that nutritional status can specifically alter the efficacy of long-lasting immunity to tetanus. PMID:24445198

  18. Effects of Malnutrition on Children's Immunity to Bacterial Antigens in Northern Senegal

    PubMed Central

    Gaayeb, Lobna; Sarr, Jean B.; Cames, Cecile; Pinçon, Claire; Hanon, Jean-Baptiste; Ndiath, Mamadou O.; Seck, Modou; Herbert, Fabien; Sagna, Andre B.; Schacht, Anne-Marie; Remoue, Franck; Riveau, Gilles; Hermann, Emmanuel

    2014-01-01

    To evaluate immunity to vaccine-preventable diseases according to nutritional status, a longitudinal study was conducted in Senegalese children ages 1–9 years old. A linear regression analysis predicted that weight for age was positively associated with immunoglobulin G (IgG) response to tetanus toxoid in children born during the rainy season or at the beginning of the dry season. A relationship between village, time of visits, and levels of antibodies to tetanus showed that environmental factors played a role in modulating humoral immunity to tetanus vaccine over time. Moreover, a whole-blood stimulation assay highlighted that the production of interferon-γ (IFN-γ) in response to tetanus toxoid was compromised in stunted children. However, the absence of cytokine modulation in response to Mycobacterium tuberculosis-purified protein derivatives and phytohemagglutinin suggests that the overall ability to produce IFN-γ was preserved in stunted children. Therefore, these results show that nutritional status can specifically alter the efficacy of long-lasting immunity to tetanus. PMID:24445198

  19. Immunizations.

    PubMed

    Sanford, Christopher A; Jong, Elaine C

    2016-03-01

    Vaccinations are a cornerstone of the pretravel consultation. The pretravel provider should assess a traveler's past medical history, planned itinerary, activities, mode of travel, and duration of stay and make appropriate vaccine recommendations. Given that domestic vaccine-preventable illnesses are more common in international travelers than are exotic or low-income nation-associated vaccine-preventable illnesses, clinicians should first ensure that travelers are current regarding routine immunizations. Additional immunizations may be indicated in some travelers. Familiarity with geographic distribution and seasonality of infectious diseases is essential. Clinicians should be cognizant of which vaccines are live, as there exist contraindications for live vaccines. PMID:26900111

  20. Correlates of Immunity to Influenza as Determined by Challenge of Children with Live, Attenuated Influenza Vaccine

    PubMed Central

    Wright, Peter F.; Hoen, Anne G.; Ilyushina, Natalia A.; Brown, Eric P.; Ackerman, Margaret E.; Wieland-Alter, Wendy; Connor, Ruth I.; Jegaskanda, Sinthujan; Rosenberg-Hasson, Yael; Haynes, Brenda C.; Luke, Catherine J.; Subbarao, Kanta; Treanor, John J.

    2016-01-01

    Background. The efficacy of live, attenuated live attenuated influenza vaccine(LAIV) and inactivated influenza vaccine(IIV) is poorly explained by either single or composite immune responses to vaccination. Protective biomarkers were therefore studied in response to LAIV or IIV followed by LAIV challenge in children. Methods. Serum and mucosal responses to LAIV or IIV were analyzed using immunologic assays to assess both quantitative and functional responses. Cytokines and chemokines were measured in nasal washes collected before vaccination, on days 2, 4, and 7 after initial LAIV, and again after LAIV challenge using a 63-multiplex Luminex panel. Results. Patterns of immunity induced by LAIV and IIV were significantly different. Serum responses induced by IIV, including hemagglutination inhibition, did not correlate with detection or quantitation of LAIV on subsequent challenge. Modalities that induced sterilizing immunity seen after LAIV challenge could not be defined by any measurements of mucosal or serum antibodies induced by the initial LAIV immunization. No single cytokine or chemokine was predictive of protection. Conclusions. The mechanism of protective immunity observed after LAIV could not be defined, and traditional measurements of immunity to IIV did not correlate with protection against an LAIV challenge. PMID:27419180

  1. Correlates of Immunity to Influenza as Determined by Challenge of Children with Live, Attenuated Influenza Vaccine.

    PubMed

    Wright, Peter F; Hoen, Anne G; Ilyushina, Natalia A; Brown, Eric P; Ackerman, Margaret E; Wieland-Alter, Wendy; Connor, Ruth I; Jegaskanda, Sinthujan; Rosenberg-Hasson, Yael; Haynes, Brenda C; Luke, Catherine J; Subbarao, Kanta; Treanor, John J

    2016-04-01

    Background.  The efficacy of live, attenuated live attenuated influenza vaccine(LAIV) and inactivated influenza vaccine(IIV) is poorly explained by either single or composite immune responses to vaccination. Protective biomarkers were therefore studied in response to LAIV or IIV followed by LAIV challenge in children. Methods.  Serum and mucosal responses to LAIV or IIV were analyzed using immunologic assays to assess both quantitative and functional responses. Cytokines and chemokines were measured in nasal washes collected before vaccination, on days 2, 4, and 7 after initial LAIV, and again after LAIV challenge using a 63-multiplex Luminex panel. Results.  Patterns of immunity induced by LAIV and IIV were significantly different. Serum responses induced by IIV, including hemagglutination inhibition, did not correlate with detection or quantitation of LAIV on subsequent challenge. Modalities that induced sterilizing immunity seen after LAIV challenge could not be defined by any measurements of mucosal or serum antibodies induced by the initial LAIV immunization. No single cytokine or chemokine was predictive of protection. Conclusions.  The mechanism of protective immunity observed after LAIV could not be defined, and traditional measurements of immunity to IIV did not correlate with protection against an LAIV challenge. PMID:27419180

  2. Immune Monitoring of Trans-endothelial Transport by Kidney-Resident Macrophages.

    PubMed

    Stamatiades, Efstathios G; Tremblay, Marie-Eve; Bohm, Mathieu; Crozet, Lucile; Bisht, Kanchan; Kao, Daniela; Coelho, Carolina; Fan, Xiying; Yewdell, William T; Davidson, Anne; Heeger, Peter S; Diebold, Sandra; Nimmerjahn, Falk; Geissmann, Frederic

    2016-08-11

    Small immune complexes cause type III hypersensitivity reactions that frequently result in tissue injury. The responsible mechanisms, however, remain unclear and differ depending on target organs. Here, we identify a kidney-specific anatomical and functional unit, formed by resident macrophages and peritubular capillary endothelial cells, which monitors the transport of proteins and particles ranging from 20 to 700 kDa or 10 to 200 nm into the kidney interstitium. Kidney-resident macrophages detect and scavenge circulating immune complexes "pumped" into the interstitium via trans-endothelial transport and trigger a FcγRIV-dependent inflammatory response and the recruitment of monocytes and neutrophils. In addition, FcγRIV and TLR pathways synergistically "super-activate" kidney macrophages when immune complexes contain a nucleic acid. These data identify a physiological function of tissue-resident kidney macrophages and a basic mechanism by which they initiate the inflammatory response to small immune complexes in the kidney. PMID:27477514

  3. Health maintenance in school-aged children: Part I. History, physical examination, screening, and immunizations.

    PubMed

    Riley, Margaret; Locke, Amy B; Skye, Eric P

    2011-03-15

    The goals of the well-child examination in school-aged children (kindergarten through early adolescence) are promoting health, detecting disease, and counseling to prevent injury and future health problems. A complete history should address any concerns from the patient and family and screen for lifestyle habits, including diet, physical activity, daily screen time (e.g., television, computer, video games), hours of sleep per night, dental care, and safety habits. School performance can be used for developmental surveillance. A full physical examination should be performed; however, the U.S. Preventive Services Task Force recommends against routine scoliosis screening and testicular examination. Children should be screened for obesity, which is defined as a body mass index at or above the 95th percentile for age and sex, and resources for comprehensive, intensive behavioral interventions should be provided to children with obesity. Although the evidence is mixed regarding screening for hypertension before 18 years of age, many experts recommend checking blood pressure annually beginning at three years of age. The American Academy of Pediatrics recommends vision and hearing screening annually or every two years in school-aged children. There is insufficient evidence to recommend screening for dyslipidemia in children of any age, or screening for depression before 12 years of age. All children should receive at least 400 IU of vitamin D daily, with higher doses indicated in children with vitamin D deficiency. Children who live in areas with inadequate fluoride in the water (less than 0.6 ppm) should receive a daily fluoride supplement. Age-appropriate immunizations should be given, as well as any missed immunizations. PMID:21404978

  4. Evaluation of the Universal Immunization Program and Challenges in Coverage of Migrant Children in Haridwar, Uttarakhand, India

    PubMed Central

    Nath, Latika; Kaur, Prabhdeep; Tripathi, Saurabh

    2015-01-01

    Background: Studies show that immunization among migrant children is poor. India has a dropout rate of 17.7% between Bacillus Calmette-Guιrin (BCG) and measles (District Level Household Survey (DLHS)-3). Haridwar district had the highest dropout rate of 27.4% from BCG to diphtheria, pertussis, and tetanus (DPT) 3 (DLHS-3) in Uttarakhand. We evaluated the Universal Immunization Programme (UIP) among migrants in Haridwar in two blocks. Materials and Methods: We developed input, process, and output indicators on infrastructure, human resources, and service delivery. A facility, session site and cross-sectional survey of 180 children were done and proportions for various indicators were estimated. We determined factors associated with not taking vaccination using multivariate analysis. Results: We surveyed 11 cold chain centers, 25 subcenters, 14 sessions, and interviewed 180 mothers. Dropouts were supposed to be tracked using vaccination card counterfoils and tracking registers. The dropout rate from BCG to DPT3 was 30%. Lack of knowledge (adjusted odds ratio (AOR) 6.6,95% confidence interval (CI) 2.6–16.7), mother not being decision maker (AOR 4.0,95%CI 1.7–9.2), lack of contact by Accredited Social Health Activist (ASHA; AOR 3.0,95%CI 1.1–7.7), not being given four post-vaccination messages (AOR 7.7, 95% CI 2.9–20.2), and longer duration of stay in Haridwar (AOR 3.0 95% 1.9–7.6) were risk factors for nonimmunization. The reasons stated by mothers included lack of awareness of session site location (67%) and belief that child should only be vaccinated in their resident district (43%). Conclusions: There was low immunization coverage among migrants within adequate supervision, poor cold chain maintenance, and improper tracking of dropouts. Mobile immunization teams, prelisting of migrant children, and change in incentives of ASHAs for child tracking were needed. A monitoring plan for sessions and cold chain needed enforcement. PMID:26435596

  5. Shared decision making in the management of children with newly diagnosed immune thrombocytopenia.

    PubMed

    Beck, Carolyn E; Boydell, Katherine M; Stasiulis, Elaine; Blanchette, Victor S; Llewellyn-Thomas, Hilary; Birken, Catherine S; Breakey, Vicky R; Parkin, Patricia C

    2014-10-01

    This study aimed to examine the treatment decision-making process for children hospitalized with newly diagnosed immune thrombocytopenia (ITP). Using focus groups, we studied children with ITP, parents of children with ITP, and health care professionals, inquiring about participants' experience with decision support and decision making in newly diagnosed ITP. Data were examined using thematic analysis. Themes that emerged from children were feelings of "anxiety, fear, and confusion"; the need to "understand information"; and "treatment choice," the experience of which was age dependent. For parents, "anxiety, fear, and confusion" was a dominant theme; "treatment choice" revealed that participants felt directed toward intravenous immune globulin (IVIG) for initial treatment. For health care professionals, "comfort level" highlighted factors contributing to professionals' comfort with offering options; "assumptions" were made about parental desire for participation in shared decision making (SDM) and parental acceptance of treatment options; "providing information" was informative regarding modes of facilitating SDM; and "treatment choice" revealed a discrepancy between current practice (directed toward IVIG) and the ideal of SDM. At our center, families of children with newly diagnosed ITP are not experiencing SDM. Our findings support the implementation of SDM to facilitate patient-centered care for the management of pediatric ITP. PMID:24577546

  6. Local Immune Responses in Children and Adults with Allergic and Nonallergic Rhinitis

    PubMed Central

    Choi, Hana; Jang, Man-Young; Kim, Kyung Rae; Choi, Jae-Hoon; Cho, Seok Hyun

    2016-01-01

    Background Allergic rhinitis (AR) is the most common allergic disease but little is known about the difference of local immune responses in children and adults with AR. Objective To compare local immune responses between children and adults with AR and nonallergic rhinitis (NAR), and to investigate whether the association of local and systemic immune responses is different between the two age groups. Methods Fifty-one patients with chronic rhinitis were enrolled and grouped into children (N = 27, mean age 7.2 years) and adults (N = 24, mean age 29.9 years). Diagnosis of AR was based on symptoms, skin prick tests and serum specific IgEs. Nasal lavage (NAL) fluids were collected from all subjects and used to measure the levels of total IgE, specific IgEs to house dust mites (Dp and Df), and cytokines (TNF-α, IL-4, IL-10, IL-17A and IFN-γ). Flow cytometry was used to measure inflammatory cell types in NAL fluids. Results AR had significantly increased local levels of total IgE and specific IgEs to Dp and Df compared with NAR in both age groups (P < 0.05). Nasal eosinophils % (P = 0.01) was significantly increased only in children with AR. Local-systemic correlations of total IgE (r = 0.662, P = 0.000) and eosinophil % (r = 0.461, P = 0.015) between the peripheral blood and NAL fluids were found only in children. Moreover, children had correlations between total IgE and eosinophil % in the peripheral blood (r = 0.629, P = 0.001) and in NAL fluids (r = 0.373, P = 0.061). Conclusion Elevated local IgE is a common feature of AR in children and adults. Local measures in NAR showed naïve state of immune response which disagree with the hypothesis of local allergic rhinitis. Children showed intense local inflammation and close local-systemic interactions compared to adults supporting pediatric AR as a distinct feature. PMID:27281182

  7. Modification of immune function through exposure to dietary aflatoxin in Gambian children.

    PubMed Central

    Turner, Paul C; Moore, Sophie E; Hall, Andrew J; Prentice, Andrew M; Wild, Christopher P

    2003-01-01

    Aflatoxins are immunotoxins that frequently contaminate staple foods in The Gambia and other parts of sub-Saharan Africa, resulting in high exposure throughout life. Impaired infant immune system development may be a key predictor of mortality from infectious disease. In this study we aimed to determine the effect of dietary aflatoxin exposure on a number of immune parameters in Gambian children. A cohort of 472 Gambian children 6-9 years of age was recruited. Serum aflatoxin-albumin (AF-alb) adducts were analyzed to provide a measure of exposure. Immune parameters included secretory IgA (sIgA) in saliva, cell-mediated immunity (CMI), determined using the CMI multitest where test antigens are applied to the skin, and antibody responses to both rabies and pneumococcal polysaccharide vaccines. Birth weight, current anthropometry, and micronutrient status were also recorded. AF-alb adducts were detected in 93% of the children (geometric mean level 22.3 pg/mg; range 5-456 pg/mg). AF-alb level was strongly influenced by month of sampling. In a multivariable analysis, sIgA was markedly lower in children with detectable AF-alb compared with those with nondetectable levels [50.4 micro g/mg protein (95% confidence interval [CI] 48.0-52.8) and 70.2 micro g/mg protein (95% CI 61.1-79.2), respectively; p < 0.0001]. Antibody response to one of four pneumococcal serotypes, but not rabies vaccine, was weakly associated with higher levels of AF-alb. There was no association between CMI responses to test antigens and AF-alb. These data confirm that children in rural Gambia are frequently exposed to high levels of aflatoxin. The study provides evidence that sIgA in saliva may be reduced because of dietary levels of aflatoxin exposure. Given the high burden of infection-related mortality in West Africa, further investigation of the immune effects of aflatoxin exposure in children is merited. PMID:12573908

  8. Immunization Coverage in Migrant School Children Along the Thailand-Myanmar Border.

    PubMed

    Kaji, Aiko; Parker, Daniel M; Chu, Cindy S; Thayatkawin, Wipa; Suelaor, Jiraporn; Charatrueangrongkun, Rachai; Salathibuppha, Kloloi; Nosten, Francois H; McGready, Rose

    2016-10-01

    The objective of this project was to document and increase vaccine coverage in migrant school children on the Thailand-Myanmar border. Migrant school children (n = 12,277) were enrolled in a school-based immunization program in four Thai border districts. The children were evaluated for vaccination completion and timing, for six different vaccines: Bacille Calmette-Guerin (BCG); Oral Polio vaccine (OPV); Hepatitis B vaccine (HepB); Diphtheria, Pertussis and Tetanus vaccine (DTP); Measles Containing Vaccine or Measles, Mumps and Rubella vaccine (MMR); Tetanus and Diphtheria containing vaccine (Td). Vaccine coverage proportions for BCG, OPV3, DTP3, HepB3 and measles containing vaccine were 92.3, 85.3, 63.8, 72.2, and 90.9 % respectively. Most children were able to receive vaccines in a time appropriate manner. School-based immunization programs offer a suitable vaccine delivery mechanism for hard-to-reach populations. However, these data suggest overall low vaccine coverage in migrant populations. Further efforts toward improving appropriate vaccine coverage and methods of retaining documentation of vaccination in mobile migrant populations are necessary for improved health. PMID:26483180

  9. Monitoring vaccine safety using the Vaccine Safety Datalink: utilizing immunization registries for pandemic influenza.

    PubMed

    McCarthy, Natalie L; Gee, Julianne; Weintraub, Eric; Donahue, James G; Nordin, James D; Daley, Matthew F; Naleway, Allison; Henninger, Michelle; Baxter, Roger; Crane, Bradley; Aukes, Laurie; Wagner, Nicole; Fisher, Sarah; Jacobsen, Steven J; Sy, Lina; Baggs, James

    2011-07-12

    Mass vaccination campaigns during which new vaccines may be administered to many millions of people in a short period of time call for timely and accurate post-licensure surveillance to monitor vaccine safety. To address the need for timely H1N1 influenza vaccine safety information during the 2009-2010 H1N1 influenza pandemic, the Vaccine Safety Datalink (VSD) project assessed the feasibility and potential mechanisms for utilizing data from state and local immunization registries to capture vaccinations that would not otherwise be captured by the data systems of the participating VSD managed care organizations (MCOs). Three of the eight VSD sites were able to capture H1N1 immunization data electronically from the state and local registries, and one site was able to capture the immunizations through a paper-based system; however, the remaining four sites encountered various obstacles that prevented capture of such data. Additional work will be required at these sites to overcome the barriers, which included privacy and confidentiality laws, time constraints brought on by the pandemic, as well as data quality concerns. PMID:21596088

  10. Earlier infantile immune maturation is related to higher DTP vaccine responses in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-01-01

    There are large inter-individual variations in vaccine-specific antibody responses in children. We sought to investigate whether early-life environmental factors and/or adaptive immune maturation were related to diphtheria–tetanus–pertussis (DTP) vaccine-specific antibody levels at 18 months of age. In the prospective FARMFLORA birth-cohort, including both farming and non-farming families, children were immunized with DTP vaccine at 3, 5 and 12 months of age. DTP vaccine-induced antibody levels were measured in plasma at 18 months of age. Infants' blood samples obtained at birth, 3–5 days, 4, 18 and 36 months and at 8 years of age were analyzed for total CD4+ T- and B-cell counts, proportions of naïve and memory T and B cells, and fractions of putative regulatory T cells by flow cytometry. Multivariate factor analysis was used to examine associations between immune variables and vaccine responses. The most apparent multivariate pattern was that higher anti-DTP antibody titers at 18 months of age were associated with lower infantile total counts of T and B cells in the blood. Furthermore, lower infantile total T- and B-cell blood counts were associated with higher proportions of circulating CD45RO+ memory T cells and to lower proportions of α4β7+ naïve T cells later in childhood. The multivariate findings were corroborated in univariate correlation analyses. Sex, delivery mode and dairy farm exposure were unrelated to the magnitude of DTP-specific antibody responses. Our results thus suggest that children with a more mature/activated infantile adaptive immunity respond with higher vaccine-induced anti-DTP antibody levels at 18 months of age. PMID:27217956

  11. Impact of fatty acid status on immune function of children in low-income countries.

    PubMed

    Prentice, Andrew M; van der Merwe, Liandré

    2011-04-01

    In vitro and animal studies point to numerous mechanisms by which fatty acids, especially long-chain polyunsaturated fatty acids (LCPUFA), can modulate the innate and adaptive arms of the immune system. These data strongly suggest that improving the fatty acid supply of young children in low-income countries might have immune benefits. Unfortunately, there have been virtually no studies of fatty acid/immune interactions in such settings. Clinical trial registers list over 150 randomized controlled trials (RCTs) involving PUFAs, only one in a low-income setting (the Gambia). We summarize those results here. There was evidence for improved growth and nutritional status, but the primary end point of chronic environmental enteropathy showed no benefit, possibly because the infants were still substantially breastfed. In high-income settings, there have been RCTs with fatty acids (usually LCPUFAs) in relation to 18 disease end points, for some of which there have been numerous trials (asthma, inflammatory bowel disease and rheumatoid arthritis). For these diseases, the evidence is judged reasonable for risk reduction for childhood asthma (but not in adults), as yielding possible benefit in Crohn's disease (insufficient evidence in ulcerative colitis) and for convincing evidence for rheumatoid arthritis at sufficient dose levels, though formal meta-analyses are not yet available. This analysis suggests that fatty acid interventions could yield immune benefits in children in poor settings, especially in non-breastfed children and in relation to inflammatory conditions such as persistent enteropathy. Benefits might include improved responses to enteric vaccines, which frequently perform poorly in low-income settings, and these questions merit randomized trials. PMID:21366869

  12. Immune response to 1 and 2 dose regimens of Measles vaccine in Pakistani children

    PubMed Central

    Hussain, Hamidah; Akram, Dure Samin; Chandir, Subhash; Khan, Aamir J; Memon, Ashraf; Halsey, Neal A

    2013-01-01

    Measles is a significant problem in Pakistan despite vaccine coverage rates reported at 80%. The purpose of this study was to determine the serologic response in children after one dose of measles vaccine at 9 mo versus two doses at 9 and 15 mo of age. From March through December 2006, children were enrolled from immunization clinics and squatter settlements in Karachi. Blood samples were taken from children in Group A at 9–10 mo of age prior to measles vaccine and 8 to 11 weeks later; from children in Group B at 16–17 mo of age after receiving 2 doses of measles vaccine; and from children in Group C who had received at least one dose of measles vaccine by 5 y of age. After the first dose of measles vaccine, 107/147 (73%) of children in Group A were seropositive, 157/180 (87%) of children in Group B were seropositive after two doses and 126/200 (63%) of children in Group C were seropositive at 5 y of age. The post-vaccination geometric mean antibody concentrations were higher in females than males in groups A (irrespective of pre-vaccination antibody levels) and B. The serologic response to one and two doses of measles vaccine was lower in children in Karachi than has been reported in many other countries. Two doses of vaccine were significantly better than one dose. An in-depth investigation is needed to determine the reason for the lower-than-expected protection rates. Differences in immunogenicity between genders need to be further studied. Recent introduction of supplemental measles vaccine doses should help control measles in Pakistan. PMID:23928952

  13. Regulatory T cells and chronic immune activation in human immunodeficiency virus 1 (HIV-1)-infected children

    PubMed Central

    Freguja, R; Gianesin, K; Mosconi, I; Zanchetta, M; Carmona, F; Rampon, O; Giaquinto, C; De Rossi, A

    2011-01-01

    The function of CD4+ T cells with regulatory activity (Tregs) is the down-regulation of immune responses. This suppressive activity may limit the magnitude of effector responses, resulting in failure to control human immunodeficiency virus 1 (HIV-1) infection, but may also suppress chronic immune activation, a characteristic feature of HIV-1 disease. We evaluated the correlation between viral load, immune activation and Tregs in HIV-1-infected children. Eighty-nine HIV-1-infected children (aged 6–14 years) were included in the study and analysed for HIV-1 plasmaviraemia, HIV-1 DNA load, CD4 and CD8 cell subsets. Treg cells [CD4+ CD25highCD127lowforkhead box P3 (FoxP3high)] and CD8-activated T cells (CD8+CD38+) were determined by flow cytometry. Results showed that the number of activated CD8+CD38+ T cells increased in relation to HIV-1 RNA plasmaviraemia (r = 0·403, P < 0·0001). The proportion of Tregs also correlated positively with HIV-1 plasmaviraemia (r = 0·323, P = 0·002), but correlated inversely with CD4+ cells (r = −0·312, P = 0·004), thus suggesting a selective expansion along with increased viraemia and CD4+ depletion. Interestingly, a positive correlation was found between the levels of Tregs and CD8+CD38+ T cells (r = 0·305, P = 0·005), and the percentage of Tregs tended to correlate with HIV-1 DNA load (r = 0·224, P = 0·062). Overall, these findings suggest that immune activation contributes to the expansion of Treg cells. In turn, the suppressive activity of Tregs may impair effector responses against HIV-1, but appears to be ineffective in limiting immune activation. PMID:21438872

  14. Systemic Comorbidity in Children with Cataracts in Nigeria: Advocacy for Rubella Immunization.

    PubMed

    Duke, Roseline; Oparah, Sidney; Adio, Adedayo; Eyo, Okon; Odey, Friday

    2015-01-01

    Background. Congenital and developmental cataracts are leading causes of childhood blindness and severe visual impairment. They may be associated with systemic diseases including congenital heart diseases which are among the major causes of morbidity and mortality in childhood. The pattern of systemic comorbidities seen in children diagnosed with cataract in Calabar, Nigeria, was studied. Methods. A retrospective review was conducted on the children who had cataract surgery between 2011 and 2012. Diagnosis of the systemic condition was documented. Results. A total of 66 children were recruited for the study. Cardiac disease was seen in 26 children (39.9%), followed by delayed milestone in 16 (24.2%), intellectual disability in 14 (21.2%), deafness in 11 (16.7%), epilepsy in 4 (6.1%), and physical handicap in 3 (4.5%) of them. Clinically confirmed Congenital Rubella Syndrome was seen in 30 (45%) of the children. The pattern of CHD seen was as follows: patent ductus arteriosus in 16 (24.2%) followed by ventricular-septal defect in 5 (7.6%), atrial-septal defect in 3 (4.5%), and pulmonary stenosis in 2 (3%). Conclusion. Systemic comorbidities, especially cardiac anomalies, are common among children with cataract in Nigeria. Congenital Rubella Syndrome may be a prominent cause of childhood cataract in our environment. Routine immunization of school girls against rubella is advocated as a measure to mitigate this trend. PMID:26351577

  15. Monitoring immune responses in a mouse model of fracture fixation with and without Staphylococcus aureus osteomyelitis.

    PubMed

    Rochford, Edward T J; Sabaté Brescó, Marina; Zeiter, Stephan; Kluge, Katharina; Poulsson, Alexandra; Ziegler, Mario; Richards, R Geoff; O'Mahony, Liam; Moriarty, T Fintan

    2016-02-01

    Post-traumatic bone fractures are commonly fixed with implanted devices to restore the anatomical position of bone fragments and aid in the healing process. Bacterial infection in this situation is a challenge for clinicians due to the need for aggressive antibiotic therapy, debridement of infected tissues, and the need to maintain fracture stability. The aim of this study was to monitor immune responses that occur during healing and during Staphylococcus aureus infection, in a clinically relevant murine model of fracture fixation. Skeletally mature C57bl/6 mice received a transverse osteotomy of the femur, which was treated with commercially available titanium fracture fixation plates and screws. In the absence of infection, healing of the fracture was complete within 35days and was characterized by elevated Interleukin (IL)-4 and Interferon-gamma secretion from bone-derived cells and expression of these same genes. In contrast, mice inoculated with S. aureus could not heal the fracture within the observation period and were found to develop typical signs of implant-associated bone infection, including biofilm formation on the implant and osteolysis of surrounding bone. The immune response to infection was characterized by a TH17-led bone response, and a pro-inflammatory cytokine-led Tumor necrosis factor (TNF)-α, Interleukin (IL)-1β) soft tissue response, both of which were ineffectual in clearing implant related bone and soft tissue infections respectively. In this murine model, we characterize the kinetics of pro-inflammatory responses to infection, secondary to bone trauma and surgery. A divergent local immune polarization is evident in the infected versus non-infected animals, with the immune response ultimately unable to clear the S. aureus infection. PMID:26525592

  16. Adaptive maternal immune deviations as a ground for autism spectrum disorders development in children.

    PubMed

    Poletaev, Alexander B; Poletaeva, Alina A; Pukhalenko, Alexander I; Zamaleeva, Roza S; Cherepanova, Natalia A; Frizin, Dmitry V

    2014-01-01

    Autism is a vexed problem today. Overall, there is a high frequency of birth children (1:80 - 1:150) with late diagnosed autism spectrum disorders (ASD) and this trend is getting progressively stronger. The causes for the currently increased frequency of ASD and the pathogenesis of ASD are not fully understood yet. One of the most likely mechanisms inducing ASD may be a maternal immune imprinting. This phenomenon is based on transplacental translocation of maternal antibodies of IgG class and, as a consequence, on the epigenetic "tuning" of immune system of the fetus and child. This mechanism provides development of child's anti-infection resistance before meeting with microorganisms, but it can be also a cause of inborn pathology including the ASD appearance. The quantitative changes in maternal blood serum autoantibodies depend on a specific microbial population, or are induced by environmental chemical pollutants in association with some individual features of the maternal metabolism. These immune changes are adaptive in most cases for the maternal organism, but can be pathogenic for the fetus in some cases. We discuss in the present paper the possibilities to predict the risk from abnormal development of nervous system in fetus and early diagnosis of ASD in high-risk group of children. PMID:25181843

  17. Long-term immunity to measles, mumps and rubella after MMR vaccination among children with bone marrow transplants.

    PubMed

    Spoulou, V; Giannaki, M; Vounatsou, M; Bakoula, C; Grafakos, S

    2004-06-01

    Measles, mumps and rubella (MMR) vaccine-induced long-term immunity was studied in 30 children with bone marrow transplants (BMT). Immunity at baseline for MMR was 13.3, 33.3 and 66.6%, respectively. MMR vaccination failed to induce adequate and persistent responses to measles and mumps; seropositivity at 1 and 12 months for measles was 26.6 and 23.3% and for mumps 46.6 and 36.6%, respectively. In contrast, 27 of 30 children with a BMT were immune to rubella 1 month after immunization and retained protective antibody levels at 12 months. The MMR-induced anamnestic responses to rubella among all responders were associated with the production of high avidity antibodies. We conclude that a single dose of MMR given at 2 years after BMT induces suboptimal and short-lived immune responses to measles and mumps; a second dose should be recommended for paediatric BMT recipients. PMID:15077129

  18. Vaccine-induced immunity in children after orthotopic liver transplantation: a 12-yr review of the Swiss national reference center.

    PubMed

    Diana, Alessandro; Posfay-Barbe, Klara M; Belli, Dominique C; Siegrist, Claire-Anne

    2007-02-01

    Infections represent a significant threat in solid-organ recipients. However, a certain number of infections can be prevented by immunizing patients before their transplantation. The aim of this study is to determine the level of immunity of children undergoing liver transplantation and to assess their capacity to maintain protective levels after surgery. Charts of 44 children transplanted with deceased donation livers between 1990 and 2002 at the Children's Hospital of Geneva were reviewed. Vaccine antibody responses were established pre- and post-transplantation. Only 43% of patients were up to date for diphtheria, tetanus, acellular pertussis, and polio vaccines at the pretransplantation visit, while 44% of children older than 12 months had received their required measles-mumps-rubella vaccines. Six of 44 children had received at least one dose of hepatitis B vaccine, while only two patients had received at least one dose of hepatitis A vaccine. After immunization, and one yr after transplantation, only 14 of 44 patients had detectable anti-HBs antibodies and seven of 18 had anti-HAV antibodies. Varicella antibodies were undetectable in 15 of 19 patients immunized prior to transplantation. This study highlights the need to enforce vaccination before transplantation, follow-up on vaccine- induced immunity, and adapt vaccination schedules after liver transplantation in children, especially for non-live vaccines, which are universally recommended in this population. PMID:17239121

  19. Monitoring food and non-alcoholic beverage promotions to children.

    PubMed

    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. PMID:24074211

  20. Low internal radiation alters innate immune status in children with clinical symptom of irritable bowel syndrome.

    PubMed

    Sheikh Sajjadieh, Mohammad Reza; Kuznetsova, L V; Bojenko, V B

    2010-09-01

    Adverse health effect of low radiation is clear. The aim of this study was to determine effect of internal low radiation on innate immune status in Ukrainian children with spastic colitis as a result of Chernobyl disaster. The test population consisted of 95 participants: 75 rural participants with clinical symptom of irritable bowel syndrome, aged 4 to 18, who lived in a contaminated area exposed to radio nucleotide due to the disaster in reactor in Chernobyl nuclear power plant (categorized in three groups) and 20 healthy urban participants from Kiev, aged 5 to 15, as the control group. Internal radiation activity has been measured by gamma-ray spectrometry. Peripheral blood leukocytes were analyzed for CD16(+) subset, serum concentration of circulation immune complex was measured by the polyethylene glycol method. Phagocytic activity function was assessed by using latex article and phagocytic index were calculated. p < 0.05 was considered significant. Percent of CD16(+) cell in groups II and III increased significantly in comparison to control group (p < 0.05). Concentration of circulating immune complexes increased significantly in all study groups compared to control group (p < 0.001). Phagocytes activity and phagocyte index decreased significantly in all study groups in comparison to control group (p < 0.001). The innate immune status of study groups has changed. Our data have demonstrated that this change may be related to radioactivity from technogenic pollution due to the disaster in reactor in Chernobyl nuclear power plant. PMID:20538707

  1. Childhood Immunization

    MedlinePlus

    ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ... child provide protection for many years, adults need immunizations too. Centers for Disease Control and Prevention

  2. Genetic Background of Immune Complications after Allogeneic Hematopoietic Stem Cell Transplantation in Children.

    PubMed

    Skoczen, Szymon; Bik-Multanowski, Miroslaw; Pietrzyk, Jacek J; Grabowska, Agnieszka; Fijorek, Kamil; Strojny, Wojciech; Klus-Kwiecinska, Kinga; Balwierz, Walentyna; Siedlar, Maciej

    2016-01-01

    Immune reactions are among the most serious complications observed after hematopoietic stem cell transplantation (HSCT) in children. Microarray technique allows for simultaneous assessment of expression of nearly all human genes. The objective of the study was to compare the whole genome expression in children before and after HSCT. A total of 33 children referred for HSCT were enrolled in the study. In 70% of the patients HSCT was performed for the treatment of neoplasms. Blood samples were obtained before HSCT and six months after the procedure. Subsequently, the whole genome expression was assessed in leukocytes using GeneChip Human Gene 1.0 ST microarray. The analysis of genomic profiles before and after HSCT revealed altered expression of 124 genes. Pathway enrichment analysis revealed upregulation of five pathways after HSCT: allograft rejection, graft-versus-host disease, type I diabetes mellitus, autoimmune thyroid disease, and viral myocarditis. The activation of those pathways seems to be related to immune reactions commonly observed after HSCT. Our results contribute to better understanding of the genomic background of the immunologic complications of HSCT. PMID:26880945

  3. Effects of surgical stress on early nonspecific immune response in children.

    PubMed

    Prabhu, P Santosh; Sridharan, S; Ramesh, S

    2014-02-01

    Surgery alters the body's homeostatic balance and defense mechanisms. In adults transient postoperative cellular and humoral immunosuppression after different degrees of operative stress has been reported. In children the immunologic consequences of operations are not elaborated. This study investigates the effect of minor and major surgery on early nonspecific immune response in terms of neutrophil counts and function. Forty-three children undergoing minor and major elective procedures were studied. Blood samples were collected before, immediately after, and 72 h after surgery. Total white cell count, differential neutrophil count, and neutrophil phagocytic function were studied using nitroblue tetrazolium test. Children were divided into two groups-group 1 underwent minor surgery and group 2 major surgery. In group 1 there was a significant drop in total counts after surgery, but in group 2 total counts were not affected. In both groups, the percentage of neutrophils increased immediately after surgery but fell to near or less than preoperative levels 72 h after surgery. However, the assessment of neutrophil functions by nitroblue tetrazolium test in both unstimulated and stimulated forms revealed it to be unchanged in group 1. In group 2 the unstimulated neutrophil function was elevated 72 h after surgery, whereas stimulated function was elevated immediately after surgery. Minor surgery does not alter the early nonspecific immune response. However, major surgery seems to induce a transient increase in neutrophil phagocytic activity. PMID:24799783

  4. Improving Immunization Rates Through Community-Based Participatory Research: Community Health Improvement for Milwaukee’s Children Program

    PubMed Central

    Willis, Earnestine; Sabnis, Svapna; Hamilton, Chelsea; Xiong, Fue; Coleman, Keli; Dellinger, Matt; Watts, Michelle; Cox, Richard; Harrell, Janice; Smith, Dorothy; Nugent, Melodee; Simpson, Pippa

    2016-01-01

    Background Nationally, immunization coverage for the DTaP/3HPV/1MMR/3HepB/3Hib/1VZV antigen series in children ages 19–35 months are near or above the Healthy People 2020 target (80%). However, children in lower socioeconomic families experience lower coverage rates. Objective Using a community-based participatory research (CBPR) approach, Community Health Improvement for Milwaukee Children (CHIMC) intervened to reduce disparities in childhood immunizations. Methods The CHIMC adopted a self-assessment to examine the effectiveness of adhering to CBPR principles. Using behavior change models, CHIMC implemented education, social marketing campaign, and theory of planned behavior interventions. Community residents and organizational representatives vetted all processes, messages, and data collection tools. Results Adherence to the principles of CBPR was consistently positive over the 8-year period. CHIMC enrolled 565 parents/caregivers with 1,533 children into educational and planned behavior change (PBC) interventions, and enrolled another 406 surveyed for the social marketing campaign. Retention rate was high (80%) with participants being predominately Black females (90%) and the unemployed (64%); children’s median age was 6.2 years. Increased knowledge about immunizations was consistently observed among parents/caregivers. Social marketing data revealed high recognition (85%) of the community-developed message (“Take Control: Protect Your Child with Immunizations”). Barriers and facilitators to immunize children revealed protective factors positively correlated with up-to-date (UTD) status (p < 0.007). Ultimately, children between the ages of 19 and 35 months whose parents/caregivers completed education sessions and benefitted from a community-wide social marketing message increased their immunization status from 45% baseline to 82% over 4 years. Conclusions Using multilayered interventions, CHIMC contributed to the elimination of immunization disparities in

  5. Outcomes 5 years after response to rituximab therapy in children and adults with immune thrombocytopenia

    PubMed Central

    Mahévas, Matthieu; Lee, Soo Y.; Stasi, Roberto; Cunningham-Rundles, Susanna; Godeau, Bertrand; Kanter, Julie; Neufeld, Ellis; Taube, Tillmann; Ramenghi, Ugo; Shenoy, Shalini; Ward, Mary J.; Mihatov, Nino; Patel, Vinay L.; Bierling, Philippe; Lesser, Martin; Cooper, Nichola; Bussel, James B.

    2012-01-01

    Treatments for immune thrombocytopenic purpura (ITP) providing durable platelet responses without continued dosing are limited. Whereas complete responses (CRs) to B-cell depletion in ITP usually last for 1 year in adults, partial responses (PRs) are less durable. Comparable data do not exist for children and 5-year outcomes are unavailable. Patients with ITP treated with rituximab who achieved CRs and PRs (platelets > 150 × 109/L or 50-150 × 109/L, respectively) were selected to be assessed for duration of their response; 72 adults whose response lasted at least 1 year and 66 children with response of any duration were included. Patients had baseline platelet counts < 30 × 109/L; 95% had ITP of > 6 months in duration. Adults and children each had initial overall response rates of 57% and similar 5-year estimates of persisting response (21% and 26%, respectively). Children did not relapse after 2 years from initial treatment whereas adults did. Initial CR and prolonged B-cell depletion predicted sustained responses whereas prior splenectomy, age, sex, and duration of ITP did not. No novel or substantial long-term clinical toxicity was observed. In summary, 21% to 26% of adults and children with chronic ITP treated with standard-dose rituximab maintained a treatment-free response for at least 5 years without major toxicity. These results can inform clinical decision-making. PMID:22566601

  6. [Influence of helminthic infections and nutritional status on immune response in Venezuelan children].

    PubMed

    Ortiz, D; Afonso, C; Hagel, I; Rodriguez, O; Ortiz, C; Palenque, M; Lynch, N R

    2000-09-01

    We investigated the influence of nutritional status, as determined from anthropometric measurement, and of helminthic infections on the immune response of children of low socioeconomic status in two rural communities in Venezuela: El Cardón in the state of Nueva Esparta and San Daniel in the state of Miranda. A total of 125 boys and girls between 2 and 15 years old participated in the study. Their socioeconomic stratum was determined by a modified Graffar method. A physical examination was performed, as was also an anthropometric evaluation that took into account three indicators--weight-for-height, weight-for-age, and height-for-age--according to parameters established by the World Health Organization. Other examinations included feces, secretory IgA in saliva, total serum IgE, and anti-Ascaris-specific immunoglobulins. The children in both of the communities were in strata IV and V of the of Graffar scale, with a significantly greater number of stratum V inhabitants in San Daniel (P < 0.001). The results suggest that exposure level and individual susceptibility to the parasites are determining factors in parasitic infection and immune system behavior. The intensity of the parasitic burden plays an important role in stimulating polyclonal IgE, which diminishes the effectiveness of the specific response to those infections. On the other hand, nutritional deficiencies could change the immune mechanisms of the mucous membranes, negatively influence the synthesis of secretory IgA, and stimulate the production of polyclonal IgE. Poor sanitary and socioeconomic conditions promote more exposure to gastrointestinal parasites and a deficient nutritional status, which modulates the immune response and affects serum IgE and secretory IgA production mechanisms. PMID:11036425

  7. Monitoring temperature in children undergoing anaesthesia: a comparison of methods.

    PubMed

    Drake-Brockman, T F E; Hegarty, M; Chambers, N A; von Ungern-Sternberg, B S

    2014-05-01

    Children undergoing anaesthesia are prone to hypothermia. Perioperative monitoring of patient temperature is, therefore, standard practice. Postoperative temperature is regarded as a key anaesthetic performance indicator in Australian hospitals. Many different methods and sites of temperature measurement are used perioperatively. It is unclear to what degree these methods might be interchangeable. The aim of this study was to determine the relationships between temperatures measured at different sites in anaesthetised children. Two hundred children, 0 to 17 years, undergoing general anaesthesia for elective non-cardiac surgery, were prospectively recruited. Temperature measurements were taken in the operating theatre concurrently at the nasopharynx, tympanic membranes, temporal artery, axilla and skin (chest). Patient age and weight were documented. Temperatures varied according to site of measurement. The mean difference from nasopharyngeal temperature to temperatures at left and right tympanic, temporal, axillary and cutaneous sites were +0.24°C, +0.24°C, +0.35°C, -0.38°C and -1.70°C, respectively. Levels of agreement to nasopharyngeal temperature were similar at tympanic, temporal and axillary sites. Tympanic and temporal temperatures were superior to axillary temperatures for detection of mild hypothermia (<36°C). Skin temperature showed a large variation from nasopharyngeal measurements. Our findings indicate that measured temperatures vary between sites. Understanding these variations is important for interpreting temperature readings. PMID:24794470

  8. Excess body mass is associated with T cell differentiation indicative of immune ageing in children.

    PubMed

    Spielmann, G; Johnston, C A; O'Connor, D P; Foreyt, J P; Simpson, R J

    2014-05-01

    Obesity has been associated with accelerated biological ageing and immunosenescence. As the prevalence of childhood obesity is increasing, we wanted to determine if associations between obesity and immunosenescence would manifest in children. We studied 123 Mexican American adolescents aged 10-14 (mean 12·3 ± 0·7) years, with body weights ranging from 30·1 to 115·2 kg (mean 52·5 ± 14·5 kg). Blood samples were obtained to determine proportions of naive, central memory (CM), effector memory (EM), senescent and early, intermediate and highly differentiated subsets of CD4(+) and CD8(+) T cells. Overweight and obese children had significantly lowered proportions of early CD8(+) T cells (B = -11·55 and -5·51%, respectively) compared to healthy weight. Overweight children also had more EM (B = +7·53%), late (B = +8·90%) and senescent (B = +4·86%) CD8(+) T cells than healthy weight children, while obese children had more intermediate CD8(+) (B = +4·59%), EM CD8(+) (B = +5·49%), late CD4(+) (B = +2·01%) and senescent CD4(+) (B = +0·98%) T cells compared to healthy weight children. These findings withstood adjustment for potentially confounding variables, including age, gender and latent cytomegalovirus and Epstein-Barr virus infections. We conclude that excess body mass, even in adolescence, may accelerate immunosenescence and predispose children to increased risks of incurring immune-related health problems in adulthood. PMID:24401077

  9. Intrinsic defect of the immune system in children with Down syndrome: a review

    PubMed Central

    Kusters, M A A; Verstegen, R H J; Gemen, E F A; de Vries, E

    2009-01-01

    Down syndrome (DS) is the most frequent cause of mental retardation in man. Immunological changes in DS have been observed since the 1970s. The neurological system appears to be ageing precociously, with early occurrence of Alzheimer disease; until now, the observed immunological differences have been interpreted in the same context. Looking back at past and present results of immunological studies in DS children in relation to the clinical consequences they suffer, we conclude that it is more likely that the DS immune system is intrinsically deficient from the very beginning. PMID:19250275

  10. Platelet count recovery after intravenous immunoglobulin predicts a favorable outcome in children with immune thrombocytopenia

    PubMed Central

    Ji, Mi Hong; Kim, Sung Jin; Ahn, Hyo Seop

    2016-01-01

    Background Childhood immune thrombocytopenic purpura (ITP) is a common acquired bleeding disorder. Even though most children recover, either spontaneously or with therapy, 10-20% of newly diagnosed ITP cases have a chronic course beyond 12 months. This study evaluated whether clinical and laboratory findings can predict the response to intravenous immunoglobulin (IVIG) and progression to persistent or chronic ITP in children. Methods During the period between March 2003 and June 2015, we retrospectively analyzed 72 children, newly diagnosed with ITP, who received IVIG treatment. Peripheral blood counts were obtained at diagnosis and at 1, 3, 6, and 12 months after IVIG treatment. Results After 6 months of IVIG treatment, 14 of 72 patients (19.4%) had persistent ITP, and after 12 months, 7 of 40 patients (17.5%) had chronic ITP. Age at diagnosis, gender, history of viral infection, or vaccination before disease onset were not statistically correlated with platelet recovery at 6 and 12 months. However, a platelet count recovery of ≥100×103/µL at 1 and 3 months was significantly correlated with platelet recovery at 6 (P<0.001 and P<0.001, respectively) and 12 (P=0.007 and P=0.004, respectively) months. Conclusion This study demonstrated that early platelet count recovery, at 1 and 3 months after IVIG treatment, predicts a short disease duration and a favorable outcome in children with newly diagnosed ITP. Further investigation in a larger group of patients is warranted to validate these findings. PMID:27382553

  11. Childhood Immunization

    MedlinePlus

    Today, children in the United States routinely get vaccines that protect them from more than a dozen ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ...

  12. Immune Dysfunction in Children with CHARGE Syndrome: A Cross-Sectional Study

    PubMed Central

    van der Burg, Mirjam; la Bastide-van Gemert, Sacha; Hogendorf, Lianne A.; van Ravenswaaij-Arts, Conny M. A.; Schölvinck, Elisabeth H.

    2015-01-01

    CHARGE syndrome is a variable, multiple congenital malformation syndrome. Patients with CHARGE syndrome have frequent infections that are presumed to be due to anatomical anomalies of the craniofacial region and upper airway, and cranial nerve problems resulting in swallowing difficulties and aspiration. The possible contribution of immunological abnormalities to these infections has not been systematically studied even though immune deficiencies have been described in patients with 22q11.2 deletion syndrome, a condition which shares remarkable clinical overlap with CHARGE syndrome. We assessed the frequency and nature of immune dysfunction in 24 children with genetically proven CHARGE syndrome. All patients, or their parents, completed a questionnaire on infectious history. Their immune system was extensively assessed through full blood counts, immunoglobulin levels, lymphocyte subpopulations, peripheral B- and T-cell differentiation, T-receptor excision circle (TREC) analysis, T-cell function, and vaccination responses. All CHARGE patients had a history of infections (often frequent), mainly otitis media and pneumonia, leading to frequent use of antibiotics and to hospital admissions. Decreased T-cell numbers were found in 12 (50%) patients, presumably caused by insufficient thymic output since TREC amounts were also diminished in CHARGE patients. Despite normal peripheral B-cell differentiation and immunoglobulin production in all patients, 83% of patients had insufficient antibody titers to one or more early childhood vaccinations. Based on our results, we recommend immunological evaluation of CHARGE patients with recurrent infections. PMID:26544072

  13. Typhoid Fever in Young Children in Bangladesh: Clinical Findings, Antibiotic Susceptibility Pattern and Immune Responses

    PubMed Central

    Khanam, Farhana; Sayeed, Md. Abu; Choudhury, Feroza Kaneez; Sheikh, Alaullah; Ahmed, Dilruba; Goswami, Doli; Hossain, Md. Lokman; Brooks, Abdullah; Calderwood, Stephen B.; Charles, Richelle C.; Cravioto, Alejandro; Ryan, Edward T.; Qadri, Firdausi

    2015-01-01

    Background Children bear a large burden of typhoid fever caused by Salmonella enterica serotype Typhi (S. Typhi) in endemic areas. However, immune responses and clinical findings in children are not well defined. Here, we describe clinical and immunological characteristics of young children with S. Typhi bacteremia, and antimicrobial susceptibility patterns of isolated strains. Methods As a marker of recent infection, we have previously characterized antibody-in-lymphocyte secretion (TPTest) during acute typhoid fever in adults. We similarly assessed membrane preparation (MP) IgA responses in young children at clinical presentation, and then 7-10 days and 21-28 days later. We also assessed plasma IgA, IgG and IgM responses and T cell proliferation responses to MP at these time points. We compared responses in young children (1-5 years) with those seen in older children (6-17 years), adults (18-59 years), and age-matched healthy controls. Principal Findings We found that, compared to age-matched controls patients in all age cohorts had significantly more MP-IgA responses in lymphocyte secretion at clinical presentation, and the values fell in all groups by late convalescence. Similarly, plasma IgA responses in patients were elevated at presentation compared to controls, with acute and convalescent IgA and IgG responses being highest in adults. T cell proliferative responses increased in all age cohorts by late convalescence. Clinical characteristics were similar in all age cohorts, although younger children were more likely to present with loss of appetite, less likely to complain of headache compared to older cohorts, and adults were more likely to have ingested antibiotics. Multi-drug resistant strains were present in approximately 15% of each age cohort, and 97% strains had resistance to nalidixic acid. Conclusions This study demonstrates that S. Typhi bacteremia is associated with comparable clinical courses, immunologic responses in various age cohorts

  14. Three Types of Source Monitoring by Children with and without Autism: The Role of Executive Function

    ERIC Educational Resources Information Center

    Hala, Suzanne; Rasmussen, Carmen; Henderson, Annette M. E.

    2005-01-01

    Earlier investigations have found mixed evidence of source monitoring impairment in autism. The present study examined three types of source monitoring ability in children with autism and typically developing children. In three different conditions, participants were presented with word lists after which they were required to recall the source of…

  15. Children Become "Real Scientists" as They Help to Monitor the Health of Their Local Estuary

    ERIC Educational Resources Information Center

    Beaumont, Brent

    2014-01-01

    The author explains how the children at his primary school in New Zealand are inspired by their involvement in environmental monitoring. Shellfish surveys are conducted annually in New Zealand in order to establish the health of their estuaries. By involving the children in this national monitoring programme, prepared by the Hauraki Gulf Forum (an…

  16. Timely immunization completion among children in Vietnam from 2000 to 2011: a multilevel analysis of individual and contextual factors

    PubMed Central

    Minh An, Dao Thi; Lee, Jong-Koo; Van Minh, Hoang; Trang, Nguyen Thi Huyen; Thu Huong, Nguyen Thi; Nam, You-Seon; Van Dung, Do

    2016-01-01

    Background Since the beginning of 2014, there have been nearly 6,000 confirmed measles cases in northern Vietnam. Of these, more than 86% had neither been immunized nor was their vaccination status confirmed. Objective To establish the likelihood that children under five in Vietnam had ‘timely immunization completion’ (2000–2011) and identify factors that account for variations in timely immunization completion. Design Secondary data from the Multiple Indicator Cluster Survey (MICS), which sampled women aged 15–49 from the 1999 Vietnamese Population and Housing Census frame, were analyzed. Multilevel analysis using Poisson regression was undertaken. Results Proportions of children under five who had timely immunization completion were low, especially for HBV dose 2 and HBV dose 3, which decreased between 2000 and 2011. Among seven vaccines used in the National Expanded Program of Immunization (EPI) in 2000, 2006, and 2011, measles dose 1 had the highest timely immunization completion at 65.3%, 66.7%, and 73.6%, respectively, and hepatitis B dose 1 had the lowest at 17.5%, 19.3%, and 45.5%, respectively. Timely immunization completion was less common among children whose mothers had relatively less household wealth, were from ethnic minorities, lived in rural areas, and had less education. At the community level, the child's region of residence was the main predictor of timely immunization completion, and the availability of hospital delivery and community prenatal care in the local community were also determinants. Conclusion The EPI should include ‘timely immunization completion’ as a quality indicator. There should also be greater focus and targeting in rural areas, and among women who have relatively low education, belong to minority groups, and have less household wealth. Further research on this topic using multilevel analysis is needed to better understand how these factors interact. PMID:26950555

  17. FOXP3+Helios+ Regulatory T Cells, Immune Activation, and Advancing Disease in HIV-Infected Children.

    PubMed

    Khaitan, Alka; Kravietz, Adam; Mwamzuka, Mussa; Marshed, Fatma; Ilmet, Tiina; Said, Swalehe; Ahmed, Aabid; Borkowsky, William; Unutmaz, Derya

    2016-08-15

    Regulatory T cells (Tregs) are functionally suppressive CD4 T cells, critical for establishing peripheral tolerance and controlling inflammatory responses. Previous reports of Tregs during chronic HIV disease have conflicting results with higher or lower levels compared with controls. Identifying true Tregs with suppressive activity proves challenging during HIV infection, as traditional Treg markers, CD25 and FOXP3, may transiently upregulate expression as a result of immune activation (IA). Helios is an Ikaros family transcription factor that marks natural Tregs with suppressive activity and does not upregulate expression after activation. Coexpression of FOXP3 and Helios has been suggested as a highly specific marker of "bona fide" Tregs. We evaluated Treg subsets by FOXP3 coexpressed with either CD25 or Helios and their association with HIV disease progression in perinatally infected HIV-positive children. Identifying Tregs by FOXP3 coexpression with Helios rather than CD25 revealed markedly higher Treg frequencies, particularly in HIV+ children. Regardless of antiretroviral therapy, HIV-infected children had a selective expansion of memory FOXP3+Helios+ Tregs. The rise in memory Tregs correlated with declining HIV clinical status, indicated by falling CD4 percentages and CD4:CD8 ratios and increasing HIV plasma viremia and IA. In addition, untreated HIV+ children exhibited an imbalance between the levels of Tregs and activated T cells. Finally, memory Tregs expressed IA markers CD38 and Ki67 and exhaustion marker, PD-1, that tightly correlated with a similar phenotype in memory CD4 T cells. Overall, HIV-infected children had significant disruptions of memory Tregs that associated with advancing HIV disease. PMID:27003495

  18. Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece

    2010-01-01

    This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  19. Schistosomiasis Coinfection in Children Influences Acquired Immune Response against Plasmodium falciparum Malaria Antigens

    PubMed Central

    Gaayeb, Lobna; Schacht, Anne-Marie; Charrier, Nicole; De Clerck, Dick; Dompnier, Jean-Pierre; Pillet, Sophie; Garraud, Olivier; N'Diaye, Abdoulaye A.; Riveau, Gilles

    2010-01-01

    Background Malaria and schistosomiasis coinfection frequently occurs in tropical countries. This study evaluates the influence of Schistosoma haematobium infection on specific antibody responses and cytokine production to recombinant merozoite surface protein-1-19 (MSP1-19) and schizont extract of Plasmodium falciparum in malaria-infected children. Methodology Specific IgG1 to MSP1-19, as well as IgG1 and IgG3 to schizont extract were significantly increased in coinfected children compared to P. falciparum mono-infected children. Stimulation with MSP1-19 lead to a specific production of both interleukin-10 (IL-10) and interferon-γ (IFN-γ), whereas the stimulation with schizont extract produced an IL-10 response only in the coinfected group. Conclusions Our study suggests that schistosomiasis coinfection favours anti-malarial protective antibody responses, which could be associated with the regulation of IL-10 and IFN-γ production and seems to be antigen-dependent. This study demonstrates the importance of infectious status of the population in the evaluation of acquired immunity against malaria and highlights the consequences of a multiple infection environment during clinical trials of anti-malaria vaccine candidates. PMID:20856680

  20. Duration of the immune response to MMR vaccine in children of two age-different groups.

    PubMed

    Li Volti, S; Giammanco-Bilancia, G; Grassi, M; Garozzo, R; Gluck, R; Giammanco, G

    1993-05-01

    A combined vaccine against measles, mumps and rubella (MMR) was administered to both a group of children aged 10-12 months simultaneously with booster doses of compulsory diphtheria-tetanus toxoids and oral poliovirus vaccine and a group of children aged 15-24 months who had previously received booster doses of the compulsory vaccines. Apart from one subject belonging to the second group who was non responder and one from the same group who did not seroconvert against the mumps virus alone, 5 to 6 weeks after MMR vaccine administration we found protective levels of antibodies against measles, mumps and rubella viruses in all children. The follow up of both groups at 3 years did not reveal difference between the two groups. Protective levels of serum antibodies against measles and mumps were found in the two groups, although a significant decline of rubella antibodies was shown (p < 0.05). Since the immunogenicity of the vaccines in the two groups did not differ, we recommend that the scientific community reconsider the vaccination schedule until now recommended. In our opinion the MMR vaccine should be administered simultaneously with booster doses of diphtheria-tetanus toxoids and oral poliovirus vaccine at 10-12 months of age because this policy improves parents' compliance, markedly reduces community costs and simplifies routine immunization schedule. PMID:8405317

  1. High Remission Rate of Chronic Immune Thrombocytopenia in Children: Result of 20-Year Follow-Up

    PubMed Central

    Kim, Chae Young; Lee, Eun Hye

    2016-01-01

    Purpose This study examined the outcomes of children with chronic immune thrombocytopenia (ITP). Materials and Methods We retrospectively analyzed the medical records of all patients diagnosed with ITP from January 1992 to December 2011 at our institution. Results A total of 128 patients (64%) satisfied the criteria for newly diagnosed ITP, 31 (15%) for persistent ITP, and 41 (21%) for chronic ITP. The median age at diagnosis was 4.5 years (range, 1 month to 18 years). The median platelet count at diagnosis was 32×109/L. A comparison of the initial treatment data from 2001 to 2011 with those from 1992 to 2000 showed that the number of bone marrow examinations decreased, whereas observation increased. Chronic ITP presented at an older age than newly diagnosed and persistent ITP (6.6 years vs. 3.8 years vs. 4.1 years, respectively); however, the difference did not reach statistical significance (p=0.17). The probability of complete remission of chronic ITP was 50% and 76% at 2 and 5 years after diagnosis, respectively. Patients aged <1 year at diagnosis had a significantly better prognosis than did older patients (hazard ratio, 3.86; p=0.02). Conclusion Children with chronic ITP showed a high remission rate after long-term follow-up. This study suggests that invasive treatments such as splenectomy in children with chronic ITP can be delayed for 4 to 5 years if thrombocytopenia and therapeutic medication do not affect the quality of life. PMID:26632392

  2. Altered immune parameters correlate with infection-related hospitalizations in children with Down syndrome.

    PubMed

    Martínez, Elizabeth; Castañeda, Diana; Jaramillo, Sonia; Iregui, Alejandro; Quiñonez, Tatiana; Rodríguez, Jairo A; Herrera, Eddy; Gómez, Ana Milena; Rondón, Martin A; Prieto, Juan Carlos; Angel, Juana; Franco, Manuel A; Mesa, Martha C

    2016-07-01

    In addition to previously studied immunological variables, the relative expression of IFNGR2, IFNAR1, CD18, and CD275 (all encoded in chromosome 21) on circulating leucocytes and multifunctional T cells (evaluated by an intracellular cytokine/proliferation assay) were compared between children with Down syndrome (DS) and healthy controls (HC). As previously reported, numbers of lymphocytes, CD4(+) T cells, Treg cells, B cells, and levels of serum IgM were decreased, and levels of IgG and IgA were increased in children with DS. Moreover, the relative expression of CD18 on T and B cells (previously and not previously reported, respectively) were elevated in DS children (p⩽0.01). Age and numbers of B and Treg cells moderately correlated with retrospectively identified infection related hospitalizations (rho: 0.300-0.460, p⩽0.003). Age and the numbers of Treg cells also correlated with prospectively identified infection related hospitalizations. Future studies are necessary to clarify the role of these parameters in the immunity of DS patients. PMID:27166175

  3. Immunizing the World's Children by 1990. Hearing before the International Task Force of the Select Committee on Hunger. House of Representatives, Ninety-Ninth Congress, First Session.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC.

    A hearing was held to update information on progress toward immunizing the world's children against diphtheria, whooping cough, tetanus, polio, measles, and tuberculosis. Immunization programs are regarded as essential in the effort to break the infection-malnutrition cycle in children in developing nations. Witnesses at the hearing included…

  4. Individual monitoring of immune responses in rainbow trout after cohabitation and intraperitoneal injection challenge with Yersinia ruckeri.

    PubMed

    M Monte, Milena; Urquhart, Katy; Secombes, Christopher J; Collet, Bertrand

    2016-08-01

    Yersinia ruckeri, the causative agent of enteric red mouth disease (ERM), is a widely studied pathogen in disease models using rainbow trout. This infection model, mostly based on intraperitoneally injection or bath immersion challenges, has an impact on both components (innate and adaptive) of the fish immune system. Although there has been much attention in studying its host-pathogen interactions, there is still a lack of knowledge regarding the impact of a cohabitation challenge. To tackle this we used a newly established non-lethal sampling method (by withdrawing a small amount of blood) in rainbow trout which allowed the individual immune monitoring before (non-infected) and after infection with Yersinia ruckeri either by intraperitoneal (i.p.) injection or by cohabitation (cohab). A range of key immune genes were monitored during the infection by real-time PCR, and results were compared between the two infection routes. Results indicated that inflammatory (IL-1β1 and IL-8) cytokines and certain antimicrobial peptides (cathelicidins) revealed a different pattern of expression between the two infected groups (i.p. vs cohab), in comparison to adaptive immune cytokines (IL-22, IFN-γ and IL-4/13A) and β-defensins. This suggests a different involvement of distinct immune markers according to the infection model, and the importance of using a cohabitation challenge as a more natural disease model that likely simulates what would occur in the environment. PMID:27245868

  5. Minimal residual disease monitoring and immune profiling in multiple myeloma in elderly patients.

    PubMed

    Paiva, Bruno; Cedena, Maria-Teresa; Puig, Noemi; Arana, Paula; Vidriales, Maria-Belen; Cordon, Lourdes; Flores-Montero, Juan; Gutierrez, Norma C; Martín-Ramos, María-Luisa; Martinez-Lopez, Joaquin; Ocio, Enrique M; Hernandez, Miguel T; Teruel, Ana-Isabel; Rosiñol, Laura; Echeveste, María-Asunción; Martinez, Rafael; Gironella, Mercedes; Oriol, Albert; Cabrera, Carmen; Martin, Jesus; Bargay, Joan; Encinas, Cristina; Gonzalez, Yolanda; Van Dongen, Jacques J M; Orfao, Alberto; Bladé, Joan; Mateos, Maria-Victoria; Lahuerta, Juan José; San Miguel, Jesús F

    2016-06-23

    The value of minimal residual disease (MRD) in multiple myeloma (MM) has been more frequently investigated in transplant-eligible patients than in elderly patients. Because an optimal balance between treatment efficacy and toxicity is of utmost importance in patients with elderly MM, sensitive MRD monitoring might be particularly valuable in this patient population. Here, we used second-generation 8-color multiparameter-flow cytometry (MFC) to monitor MRD in 162 transplant-ineligible MM patients enrolled in the PETHEMA/GEM2010MAS65 study. The transition from first- to second-generation MFC resulted in increased sensitivity and allowed us to identify 3 patient groups according to MRD levels: MRD negative (<10(-5); n = 54, 34%), MRD positive (between <10(-4) and ≥10(-5); n = 20, 12%), and MRD positive (≥10(-4); n = 88, 54%). MRD status was an independent prognostic factor for time to progression (TTP) (hazard ratio [HR], 2.7; P = .007) and overall survival (OS) (HR, 3.1; P = .04), with significant benefit for MRD-negative patients (median TTP not reached, 70% OS at 3 years), and similar poorer outcomes for cases with MRD levels between <10(-4) and ≥10(-5) vs ≥10(-4) (both with a median TTP of 15 months; 63% and 55% OS at 3 years, respectively). Furthermore, MRD negativity significantly improved TTP of patients >75 years (HR, 4.8; P < .001), as well as those with high-risk cytogenetics (HR, 12.6; P = .01). Using second-generation MFC, immune profiling concomitant to MRD monitoring also contributed to identify patients with poor, intermediate, and favorable outcomes (25%, 61%, and 100% OS at 3 years, respectively; P = .01), the later patients being characterized by an increased compartment of mature B cells. Our results show that similarly to transplant candidates, MRD monitoring is one of the most relevant prognostic factors in elderly MM patients, irrespectively of age or cytogenetic risk. This trial was registered at www.clinicaltrials.gov as #NCT01237249

  6. Immunization coverage and its determinants among children born in 2008-2009 by questionnaire survey in Zhejiang, China.

    PubMed

    Hu, Yu; Chen, Enfu; Li, Qian; Chen, Yaping; Qi, Xiaohua

    2015-03-01

    The study aimed to assess the determinants of immunization coverage in children born in 2008-2009, living in Zhejiang Province. The World Health Organization's cluster sampling technique was applied. Immunization coverage of 5 vaccines was assessed: BCG vaccine, diphtheria and tetanus toxoids and pertussis vaccine, poliomyelitis vaccine, hepatitis B vaccine, and measles-containing vaccine. Determinants for age-appropriate immunization coverage rates were explored using logistic regression models. Immunization coverage of 5 vaccines were all greater than 90%, but the age-appropriate immunization coverage rates for 3 months and for first dose of measles-containing vaccine was 41.3% and 64.5%, respectively. Siblings in household, mother's education level, household registration, socioeconomic level of resident areas, satisfaction with clinical immunization service, and convenient access to local immunization clinic were associated with age-appropriate coverage rates. Age-appropriate immunization coverage rates should be given more attention and should be considered as a benchmark to strive for in the future intervention. PMID:22186397

  7. MONITORING TRAINING LOADS, STRESS, IMMUNE-ENDOCRINE RESPONSES AND PERFORMANCE IN TENNIS PLAYERS

    PubMed Central

    Moreira, A.; Lodo, L.; Nosaka, K.; Coutts, A.J.; Aoki, M.S.

    2013-01-01

    The study aim was to investigate the effect of a periodised pre-season training plan on internal training load and subsequent stress tolerance, immune-endocrine responses and physical performance in tennis players. Well-trained young tennis players (n = 10) were monitored across the pre-season period, which was divided into 4 weeks of progressive overloading training and a 1-week tapering period. Weekly measures of internal training load, training monotony and stress tolerance (sources and symptoms of stress) were taken, along with salivary testosterone, cortisol and immunoglobulin A. One repetition maximum strength, running endurance, jump height and agility were assessed before and after training. The periodised training plan led to significant weekly changes in training loads (i.e. increasing in weeks 3 and 4, decreasing in week 5) and post-training improvements in strength, endurance and agility (P < 0.05). Cortisol concentration and the symptoms of stress also increased in weeks 3 and/or 4, before returning to baseline in week 5 (P < 0.05). Conversely, the testosterone to cortisol ratio decreased in weeks 3 and 4, before returning to baseline in week 5 (P < 0.05). In conclusion, the training plan evoked adaptive changes in stress tolerance and hormonal responses, which may have mediated the improvements in physical performance. PMID:24744485

  8. A survey of children affected by ectomermal dysplasia syndromes shows an increased prevalence of atopic disorders and immune deficiency

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ectodermal dysplasia (ED) syndromes are rare genetic disorders that affect the development of tissues derived from the embryonic ectoderm. Studies and anecdotal experience have indicated that atopic disorders (AD) and immune deficiencies (ID) may be associated with ED in children. Some ED genotypes ...

  9. Intramuscular anti-D in chronic immune thrombocytopenia children with severe thrombocytopenia.

    PubMed

    Sirachainan, Nongnuch; Anurathapan, Usanarat; Chuansumrit, Ampaiwan; Songdej, Duantida; Wongwerawattanakoon, Pakawan; Hutspardol, Sakara; Kitpoka, Pimpun

    2013-12-01

    Nine patients with chronic immune thrombocytopenia and platelet counts <20 × 10(9) /L, with a median age of 7.8 (3.8-15.5) years, received three phases of 10 mcg/kg/dose of intramuscular anti-D. Phase 1 was anti-D daily for 5 days, followed by phase 2, anti-D weekly for 12 weeks and withheld when platelet counts ≥ 20 × 10(9) /L, and then phase 3 was anti-D once every 2 weeks for 24 weeks. According to the International Working Group criteria, in phase 1, 66.7% of patients responded to the treatment. In phases 2 and 3, 11.1% (0-41.7%) and 7.7% (0-33.3%) of total episodes of follow up, respectively, responded to the treatment. Therefore, intramuscular anti-D given at a dose of 10 mcg/kg for 5 days is an alternative method to raise platelet counts in chronic immune thrombocytopenia children with severe thrombocytopenia where the intravenous form of anti-D is not available. PMID:24330299

  10. Parental concern about vaccine safety in Canadian children partially immunized at age 2: A multivariable model including system level factors

    PubMed Central

    MacDonald, Shannon E; Schopflocher, Donald P; Vaudry, Wendy

    2014-01-01

    Children who begin but do not fully complete the recommended series of childhood vaccines by 2 y of age are a much larger group than those who receive no vaccines. While parents who refuse all vaccines typically express concern about vaccine safety, it is critical to determine what influences parents of ‘partially’ immunized children. This case-control study examined whether parental concern about vaccine safety was responsible for partial immunization, and whether other personal or system-level factors played an important role. A random sample of parents of partially and completely immunized 2 y old children were selected from a Canadian regional immunization registry and completed a postal survey assessing various personal and system-level factors. Unadjusted odds ratios (OR) and adjusted ORs (aOR) were calculated with logistic regression. While vaccine safety concern was associated with partial immunization (OR 7.338, 95% CI 4.138– 13.012), other variables were more strongly associated and reduced the strength of the relationship between concern and partial immunization in multivariable analysis (aOR 2.829, 95% CI 1.151 – 6.957). Other important factors included perceived disease susceptibility and severity (aOR 4.629, 95% CI 2.017 – 10.625), residential mobility (aOR 3.908, 95% CI 2.075 – 7.358), daycare use (aOR 0.310, 95% CI 0.144 - 0.671), number of needles administered at each visit (aOR 7.734, 95% CI 2.598 – 23.025) and access to a regular physician (aOR 0.219, 95% CI 0.057 – 0.846). While concern about vaccine safety may be addressed through educational strategies, this study suggests that additional program and policy-level strategies may positively impact immunization uptake. PMID:25483477

  11. Cytomegalovirus Infection May Contribute to the Reduced Immune Function, Growth, Development, and Health of HIV-Exposed, Uninfected African Children

    PubMed Central

    Filteau, Suzanne; Rowland-Jones, Sarah

    2016-01-01

    With increasing access to antiretroviral therapy (ART) in Africa, most children born to HIV-infected mothers are not themselves HIV-infected. These HIV-exposed, uninfected (HEU) children are at increased risk of mortality and have immune, growth, development, and health deficits compared to HIV-unexposed children. HEU children are known to be at higher risk than HIV-unexposed children of acquiring cytomegalovirus (CMV) infection in early life. This risk is largely unaffected by ART and is increased by breastfeeding, which itself is critically important for child health and survival. Early CMV infection, namely in utero or during early infancy, may contribute to reduced growth, altered or impaired immune functions, and sensory and cognitive deficits. We review the evidence that CMV may be responsible for the health impairments of HEU children. There are currently no ideal safe and effective interventions to reduce postnatal CMV infection. If a clinical trial showed proof of the principle that decreasing early CMV infection improved health and development of HEU children, this could provide the impetus needed for the development of better interventions to improve the health of this vulnerable population. PMID:27446087

  12. Impact of HIV Infection and Anti-Retroviral Therapy on the Immune Profile of and Microbial Translocation in HIV-Infected Children in Vietnam.

    PubMed

    Bi, Xiuqiong; Ishizaki, Azumi; Nguyen, Lam Van; Matsuda, Kazunori; Pham, Hung Viet; Phan, Chung Thi Thu; Ogata, Kiyohito; Giang, Thuy Thi Thanh; Phung, Thuy Thi Bich; Nguyen, Tuyen Thi; Tokoro, Masaharu; Pham, An Nhat; Khu, Dung Thi Khanh; Ichimura, Hiroshi

    2016-01-01

    CD4⁺ T-lymphocyte destruction, microbial translocation, and systemic immune activation are the main mechanisms of the pathogenesis of human immunodeficiency virus type 1 (HIV) infection. To investigate the impact of HIV infection and antiretroviral therapy (ART) on the immune profile of and microbial translocation in HIV-infected children, 60 HIV vertically infected children (31 without ART: HIV(+) and 29 with ART: ART(+)) and 20 HIV-uninfected children (HIV(-)) aged 2-12 years were recruited in Vietnam, and their blood samples were immunologically and bacteriologically analyzed. Among the HIV(+) children, the total CD4⁺-cell and their subset (type 1 helper T-cell (Th1)/Th2/Th17) counts were inversely correlated with age (all p < 0.05), whereas regulatory T-cell (Treg) counts and CD4/CD8 ratios had become lower, and the CD38⁺HLA (human leukocyte antigen)-DR⁺CD8⁺- (activated CD8⁺) cell percentage and plasma soluble CD14 (sCD14, a monocyte activation marker) levels had become higher than those of HIV(-) children by the age of 2 years; the CD4/CD8 ratio was inversely correlated with the plasma HIV RNA load and CD8⁺-cell activation status. Among the ART(+) children, the total CD4⁺-cell and Th2/Th17/Treg-subset counts and the CD4/CD8 ratio gradually increased, with estimated ART periods of normalization being 4.8-8.3 years, whereas Th1 counts and the CD8⁺-cell activation status normalized within 1 year of ART initiation. sCD14 levels remained high even after ART initiation. The detection frequency of bacterial 16S/23S ribosomal DNA/RNA in blood did not differ between HIV-infected and -uninfected children. Thus, in children, HIV infection caused a rapid decrease in Treg counts and the early activation of CD8⁺ cells and monocytes, and ART induced rapid Th1 recovery and early CD8⁺-cell activation normalization but had little effect on monocyte activation. The CD4/CD8 ratio could therefore be an additional marker for ART monitoring. PMID:27490536

  13. Impact of HIV Infection and Anti-Retroviral Therapy on the Immune Profile of and Microbial Translocation in HIV-Infected Children in Vietnam

    PubMed Central

    Bi, Xiuqiong; Ishizaki, Azumi; Nguyen, Lam Van; Matsuda, Kazunori; Pham, Hung Viet; Phan, Chung Thi Thu; Ogata, Kiyohito; Giang, Thuy Thi Thanh; Phung, Thuy Thi Bich; Nguyen, Tuyen Thi; Tokoro, Masaharu; Pham, An Nhat; Khu, Dung Thi Khanh; Ichimura, Hiroshi

    2016-01-01

    CD4+ T-lymphocyte destruction, microbial translocation, and systemic immune activation are the main mechanisms of the pathogenesis of human immunodeficiency virus type 1 (HIV) infection. To investigate the impact of HIV infection and antiretroviral therapy (ART) on the immune profile of and microbial translocation in HIV-infected children, 60 HIV vertically infected children (31 without ART: HIV(+) and 29 with ART: ART(+)) and 20 HIV-uninfected children (HIV(−)) aged 2–12 years were recruited in Vietnam, and their blood samples were immunologically and bacteriologically analyzed. Among the HIV(+) children, the total CD4+-cell and their subset (type 1 helper T-cell (Th1)/Th2/Th17) counts were inversely correlated with age (all p < 0.05), whereas regulatory T-cell (Treg) counts and CD4/CD8 ratios had become lower, and the CD38+HLA (human leukocyte antigen)-DR+CD8+- (activated CD8+) cell percentage and plasma soluble CD14 (sCD14, a monocyte activation marker) levels had become higher than those of HIV(−) children by the age of 2 years; the CD4/CD8 ratio was inversely correlated with the plasma HIV RNA load and CD8+-cell activation status. Among the ART(+) children, the total CD4+-cell and Th2/Th17/Treg-subset counts and the CD4/CD8 ratio gradually increased, with estimated ART periods of normalization being 4.8–8.3 years, whereas Th1 counts and the CD8+-cell activation status normalized within 1 year of ART initiation. sCD14 levels remained high even after ART initiation. The detection frequency of bacterial 16S/23S ribosomal DNA/RNA in blood did not differ between HIV-infected and -uninfected children. Thus, in children, HIV infection caused a rapid decrease in Treg counts and the early activation of CD8+ cells and monocytes, and ART induced rapid Th1 recovery and early CD8+-cell activation normalization but had little effect on monocyte activation. The CD4/CD8 ratio could therefore be an additional marker for ART monitoring. PMID:27490536

  14. Vaccine administration and the development of immune thrombocytopenic purpura in children.

    PubMed

    Cecinati, Valerio; Principi, Nicola; Brescia, Letizia; Giordano, Paola; Esposito, Susanna

    2013-05-01

    The most important reasons cited by the opponents of vaccines are concerns about vaccine safety. Unlike issues such as autism for which no indisputable documentation of direct relationship with vaccine use is available, immune thrombocytopenic purpura (ITP) is an adverse event that can really follow vaccine administration, and may limit vaccine use because little is known about which vaccines it may follow, its real incidence and severity, the risk of chronic disease, or the possibility of recurrences after new doses of the same vaccine. The main aim of this review is to clarify the real importance of thrombocytopenia as an adverse event and discuss how it may interfere with recommended vaccination schedules. The available data clearly indicate that ITP is very rare and the only vaccine for which there is a demonstrated cause-effect relationship is the measles, mumps and rubella (MMR) vaccine that can occur in 1 to 3 children every 100,000 vaccine doses. However, also in this case, the incidence of ITP is significantly lower than that observed during the natural diseases that the vaccine prevents. Consequently, ITP cannot be considered a problem limiting vaccine use except in the case of children suffering from chronic ITP who have to receive MMR vaccine. In these subjects, the risk-benefit ratio of the vaccine should be weighed against the risk of measles in the community. PMID:23324619

  15. Immune reconstitution during maintenance therapy in children with acute lymphoblastic leukemia, relation to co-existing infection.

    PubMed

    El-Chennawi, Farha A; Al-Tonbary, Youssef A; Mossad, Youssef M; Ahmed, Mona A

    2008-08-01

    Immunosuppression is a major side effect of cancer chemotherapy. The process of immune reconstitution can be dissimilar according to the nature of the disease, type and doses of drugs, and age of the patients. Recently, several studies have examined immune reconstitution in children and young adults after intensive chemotherapy for solid tumours or stem cell transplantation. The aim of the present study is to evaluate immune reconstitution (cellular and humoral) in children with acute lymphoblastic leukemia during the maintenance phase of therapy and to correlate between the complicating infections and the abnormalities in immune system during reconstitution. To achieve this goal, 36 children with acute lymphoblastic leukemia (24 females and 12 males) in the maintenance phase of therapy with 12 healthy children of matched age and sex served as a control group were recruited in this study. The patients were taken consecutively from the Hematology/Oncology Outpatient Clinic of Mansoura University Children's Hospital (MUCH). They were subjected to thorough history taking, clinical examination and laboratory investigations in the form of: complete blood count, serum creatinine, liver function tests and evaluation of the immune system by estimation of CD3, CD4, CD8, CD19 and CD56 (cellular immunity) by flow cytometry and immunoglobulins A, M and G (humoral immunity) at the first and the third month of maintenance therapy. The results of the study documented presence and persistence of leucopenia and lymphopenia during maintenance therapy with decreased medians of CD3, CD4 and CD8 from the first to the third month of therapy and in comparison to the control group. The other markers CD19, CD56, IgA, IgM, IgG and CD4/CD8 ratio showed increasing median from the first to the third month of therapy. Also we detect a significant correlation between infection and CD19 and serum IgM at the first month and between infection and CD19, IgM and CD4/CD8 ratio at the third month of

  16. A Cell-Based Systems Biology Assessment of Human Blood to Monitor Immune Responses after Influenza Vaccination

    PubMed Central

    Hoek, Kristen L.; Samir, Parimal; Howard, Leigh M.; Niu, Xinnan; Prasad, Nripesh; Galassie, Allison; Liu, Qi; Allos, Tara M.; Floyd, Kyle A.; Guo, Yan; Shyr, Yu; Levy, Shawn E.; Joyce, Sebastian; Edwards, Kathryn M.; Link, Andrew J.

    2015-01-01

    Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses. PMID:25706537

  17. Children's understanding of the immune system: Integrating the cognitive-developmental and intuitive theories' perspectives

    NASA Astrophysics Data System (ADS)

    Landry-Boozer, Kristine L.

    Traditional cognitive-developmental researchers have provided a large body of evidence supporting the stage-like progression of children's cognitive development. Further, from this body of research comes evidence that children's understanding of HIV/AIDS develops in much the same way as their understanding of other illness-related concepts. Researchers from a newer perspective assert that biological concepts develop from intuitive theories. In general, as children are exposed to relevant content and have opportunities to organize this information, their theories become more accurate and differentiated. According to this perspective, there are no broad structural constraints on developing concepts, as asserted by cognitive developmental theorists. The purpose of the current study was two-fold: to provide support for both theoretical perspectives, while at the same time to explore children's conceptualizations of the immune system, which has not been done previously in the cognitive-developmental literature. One hundred ninety children ranging in age from 4 years old through 11 years old, and a group of adults, participated. Each participant was interviewed regarding health concepts and the body's function in maintaining health. Participants were also asked to report if they had certain experiences that would have led to relevant content exposure. Qualitative analyses were utilized to code the interviews with rubrics based on both theoretical perspectives. Quantitative analyses consisted of a series of univariate ANOVAs (and post hoc tests when appropriate) examining all three coding variables (accuracy, differentiation, and developmental level) across various age-group combinations and exposure groups. Results of these analyses provided support for both theoretical perspectives. When the data were analyzed for developmental level by all ages, a stage-like progression consistent with Piagetian stages emerged. When accuracy and differentiation were examined (intuitive

  18. Developing immune function assays to monitor fish health in field studies

    SciTech Connect

    Rice, C.D.; Kergosien, D.H.; Adams, S.M. |

    1995-12-31

    The East Fork Poplar Creek system, a 24km long stream in TN that receives point source discharges of contaminants near its headwaters, was chosen to evaluate a field approach to fish immunotoxicology. Previous studies in this stream have shown that cytochrome P4501A activity, liver somatic indices, macrophage aggregates, and parasitic liver lesions are significantly elevated in sunfish with the degree of impact decreasing with distance from the contaminant source. Red-breasted sunfish were collected between May 23 and June 3 of 1994. Captured fish were anesthetized in MS-222 and processed by two different methods. One group was sacrificed at each sampling station, weights and lengths recorded, and the spleen and anterior kidney tissues removed and placed in buffer on ice. The other group was kept in MS-222 for 2 hr and transported to the laboratory. The spleen and anterior kidney from each fish were then prepared as a single cell suspension and shipped overnight to Mississippi State University. Cells were then washed by centrifugation and resuspended in appropriate media to evaluate PMA-stimulated phagocyte oxidative burst and non-specific cytotoxic cell (NCC) activity against K562 tumor targets. Oxidative burst responses were dramatically suppressed in both groups at stations near the headwaters but returned to reference levels further downstream. There were no differences between treatment groups at each station. NCC activities did not follow gradient-response patterns observed with phagocyte oxidative burst data and there were inconsistent differences between treatment groups at each station. These data show that simple immune function assays, such as phagocyte oxidative burst responses, can be used as an ancillary biomarker in fish health monitoring.

  19. Metacognitive monitoring and control processes in children with autism spectrum disorder: Diminished judgement of confidence accuracy.

    PubMed

    Grainger, Catherine; Williams, David M; Lind, Sophie E

    2016-05-01

    Metacognition consists of monitoring processes (the ability to accurately represent one's own mental states) and control processes (the ability to control one's cognitive processes effectively). Both processes play vital roles in self-regulated learning. However, currently it is unclear whether these processes are impaired in individuals with autism spectrum disorders (ASDs). This study aimed to assess metacognition in thirty-two children with ASD, and 30 IQ-/age-matched neurotypical children, using a judgment of confidence task. It was found that children with ASD showed diminished accuracy in their judgments of confidence, indicating metacognitive monitoring impairments in ASD. Children with ASD also used monitoring to influence control processes significantly less than neurotypical children, despite little evidence of impairments in overall control ability. PMID:26985883

  20. Neurodevelopmental delay among children under the age of three years at immunization clinics in Lagos State, Nigeria – Preliminary report

    PubMed Central

    Bakare, Muideen O.; Bello-Mojeed, Mashudat A.; Munir, Kerim M.; Ogun, Oluwayemi C.; Eaton, Julian

    2016-01-01

    Late diagnosis and interventions characterize childhood neurodevelopmental disorders in Sub-Saharan Africa. This has negatively impacted on the prognosis of the children with neurodevelopmental disorders. This study examined the prevalence and pattern of neurodevelopmental delays among children under the age of 3 years attending immunization clinics in Lagos State, Nigeria and also affords opportunity of early follow-up and interventions, which had been documented to improve prognosis. The study involved two stage assessments; which consisted of first phase screening of the children for neurodevelopmental delays in immunization clinics at primary healthcare centers Lagos State, Nigeria and second phase which consists of definitive clinical evaluation and follow-up interventions for children screened positive for neurodevelopmental delays. Twenty seven (0.9%) of a total of 3,011 children under the age of 3 years were screened positive for neurodevelopmental delays and subsequently undergoing clinical evaluation and follow-up interventions. Preliminary working diagnoses among these children include cerebral palsy, autism spectrum disorder trait, nutritional deficiency, Down syndrome and Non-specific neurodevelopmental delay with co-morbid seizure disorder accounting for 33.3%, 14.8%, 18.5%, 7.4% and 25.9% respectively. This is a preliminary report that would be followed up with information on medium and long term intervention phase. PMID:27125631

  1. Neurodevelopmental delay among children under the age of three years at immunization clinics in Lagos State, Nigeria - Preliminary report.

    PubMed

    Bakare, Muideen O; Bello-Mojeed, Mashudat A; Munir, Kerim M; Ogun, Oluwayemi C; Eaton, Julian

    2016-01-01

    Late diagnosis and interventions characterize childhood neurodevelopmental disorders in Sub-Saharan Africa. This has negatively impacted on the prognosis of the children with neurodevelopmental disorders. This study examined the prevalence and pattern of neurodevelopmental delays among children under the age of 3 years attending immunization clinics in Lagos State, Nigeria and also affords opportunity of early follow-up and interventions, which had been documented to improve prognosis. The study involved two stage assessments; which consisted of first phase screening of the children for neurodevelopmental delays in immunization clinics at primary healthcare centers Lagos State, Nigeria and second phase which consists of definitive clinical evaluation and follow-up interventions for children screened positive for neurodevelopmental delays. Twenty seven (0.9%) of a total of 3,011 children under the age of 3 years were screened positive for neurodevelopmental delays and subsequently undergoing clinical evaluation and follow-up interventions. Preliminary working diagnoses among these children include cerebral palsy, autism spectrum disorder trait, nutritional deficiency, Down syndrome and Non-specific neurodevelopmental delay with co-morbid seizure disorder accounting for 33.3%, 14.8%, 18.5%, 7.4% and 25.9% respectively. This is a preliminary report that would be followed up with information on medium and long term intervention phase. PMID:27125631

  2. Plasmodium falciparum Clearance Is Rapid and Pitting Independent in Immune Malian Children Treated With Artesunate for Malaria

    PubMed Central

    Ndour, Papa Alioune; Lopera-Mesa, Tatiana M.; Diakité, Seidina A. S.; Chiang, Serena; Mouri, Oussama; Roussel, Camille; Jauréguiberry, Stéphane; Biligui, Sylvestre; Kendjo, Eric; Claessens, Antoine; Ciceron, Liliane; Mazier, Dominique; Thellier, Marc; Diakité, Mahamadou; Fairhurst, Rick M.; Buffet, Pierre A.

    2015-01-01

    Background In Plasmodium falciparum–infected patients treated with artemisinins, parasitemia declines through so-called pitting, an innate splenic process that transforms infected red blood cells (iRBCs) into once-infected RBCs (O-iRBCs). Methods We measured pitting in 83 French travelers and 42 Malian children treated for malaria with artesunate. Results In travelers, O-iRBCs peaked at 107.7% initial parasitemia. In Malian children aged 1.5–4 years, O-iRBCs peaked at higher concentrations than in children aged 9–13 years (91.60% vs 31.95%; P = .0097). The parasite clearance time in older children was shorter than in younger children (P = .0001), and the decline in parasitemia in children aged 1.5–4 years often started 6 hours after treatment initiation, a lag phase generally absent in infants and older children. A 6-hour lag phase in artificial pitting of artesunate-exposed iRBCs was also observed in vitro. The proportion of iRBCs recognized by autologous immunoglobulin G (IgG) correlated with the parasite clearance time (r = −0.501; P = .0006) and peak O-iRBC concentration (r = −0.420; P = .0033). Conclusions Antimalarial immunity correlates with fast artemisinin-induced parasite clearance and low pitting rates. In nonimmune populations, artemisinin-induced P. falciparum clearance is related to pitting and starts after a 6-hour lag phase. In immune populations, passively and naturally acquired immune mechanisms operating faster than pitting may exist. This mechanism may mitigate the emergence of artemisinin-resistant P. falciparum in Africa. PMID:25183768

  3. A Study on Longevity of Immune Response after Vaccination with Salmonella Typhi Vi Conjugate Vaccine (Pedatyph™) in Children

    PubMed Central

    Sadasivam, Kanimozhi; Vivekanandhan, Aravindhan; Arunachalam, Prema; Pasupathy, Sekar

    2015-01-01

    Background and Objectives Owing to the limitations of the conventional polysaccharide vaccines, global efforts have been made to develop conjugated polysaccharide vaccines for typhoid. Duration of immune response induced by these vaccines is critical to define the efficacy and frequency of required booster dose. This study was done to determine the duration of immune response following vaccination with Salmonella Typhi Vi conjugate vaccine (Pedatyph™) in children and to assess the booster effect of second dose of conjugate typhoid vaccine. Materials and Methods Forty children were recalled from a cohort of 400 children, who received one dose or two doses of PedaTyph™, 30 months after vaccination. Ten non-vaccinated children were also recalled. Their serum samples were assessed by ELISA for anti Vi antibody. Results Significantly high titers of anti-Vi polysaccharide IgG antibodies were present in vaccinated children even after 30 months of vaccination as compared to non-vaccinated children. Geometric mean titers (GMT) with 95% confidence intervals were 14 (4.8-29.8), 17 (7.4-33) and 6.4 (0.8-12) μg/ml for single dose, two doses and control group respectively. The children in two doses group had higher antibody titers as compared to single dose group. However, the difference was not significant. Interpretation and Conclusion PedaTyph™ was found to induce long term immune response as evidenced by presence of significant anti-Vi polysaccharide antibodies after 30 months of vaccination. No significant advantage of two doses regimen over one dose was found. Hence one dose vaccination with PedaTyph™ is suggested. PMID:26155525

  4. Childhood Immunization Schedule

    MedlinePlus

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  5. Early Additional Immune-Modulators for Mycoplasma pneumoniae Pneumonia in Children: An Observation Study

    PubMed Central

    Lee, Sung-Churl; Rhim, Jung-Woo; Shin, Myung-Seok; Kang, Jin-Han

    2014-01-01

    Background Mycoplasma pneumoniae (MP) pneumonia is a self-limiting disease, but some patients complain of progressive pneumonia, despite of appropriate antibiotic treatment. We aimed to introduce the role of immune-modulators (corticosteroid and/or intravenous immunoglobulin, IVIG) treatment for childhood MP pneumonia based on previous our experiences. Materials and Methods A retrospective case series analysis for 183 children with MP pneumonia was performed. MP pneumonia patients were diagnosed by two Immunoglobulin M (IgM) tests: the micro-particle agglutination method (≥1:40) and the cold agglutination test (≥1:4), and were examined twice at the initial admission and at discharge. Among 183 MP pneumonia patients, 90 patients with persistent fever for over 48 hours after admission or those with severe respiratory symptoms and signs received additional prednisolone (82 patients, 1 mg/kg/day) or intravenous methylprednisolone (8 patients, 5-10 mg/kg/day) with antibiotics. Four patients with aggravated clinical symptoms and chest radiographic findings after corticosteroid treatment received IVIG (1 g/kg/day, 1-2 doses). Results Mean age of 183 patients was 5.5 ± 3.2 years (6 months-15 years), and the male: female ratio was 1.1:1 (96:87). Fifty-seven patients (31%) were seroconverters and 126 seropositive patients showed increased diagnostic IgM antibody titres during admission (over 4 folds). The majority of the patients who received corticosteroids (86/90 cases) showed rapid defervescence within 48 hours with improved clinical symptoms, regardless of the used antibiotics. Also, 4 patients who received additional IVIG improved both clinically and radiographically within 2 days without adverse reaction. Conclusions In the era of macrolide-resistant MP strains, early additional immune-modulator therapy with antibiotics might prevent from the disease progression and reduce the disease morbidity without adverse reaction. PMID:25566403

  6. The Detection and Monitoring of Comprehension Errors by Preschool Children with and without Language Impairment

    ERIC Educational Resources Information Center

    Skarakis-Doyle, Elizabeth; Dempsey, Lynn

    2008-01-01

    Purpose: In this study, the authors examined emerging comprehension monitoring, including error detection, evaluation, and correction within the context of story understanding in preschool children with and without language impairment. Method: Thirty-seven children between the ages of 30 and 61 months completed an online comprehension monitoring…

  7. Exposure to Violence, Parental Monitoring, and Television Viewing as Contributors to Children's Psychological Trauma

    ERIC Educational Resources Information Center

    Singer, Mark I.; Flannery, Daniel J.; Guo, Shenyang; Miller, David; Leibbrandt, Sylvia

    2004-01-01

    This study examined the relative contributions of exposure to violence, parental monitoring, and television viewing habits to children's self-reported symptoms of psychological trauma. Children in grades 3-8 in 11 public schools completed an anonymous self-report questionnaire administered during usual school hours. The final sample was comprised…

  8. Physical and Emotional States as Memory-relevant Factors: Cognitive Monitoring by Young Children.

    ERIC Educational Resources Information Center

    Hayes, Donald S.; And Others

    1987-01-01

    The Flavell (l981) model of cognitive monitoring and metamnemonic development was tested by four experiments conducted to determine whether preschool children (1) recognize that mood, fatigue, and fear are variables that influence learning; and (2) self-monitor their internal states and adjust their study behavior when they are sad or tired. (NH)

  9. Monitoring the Rights of Children. Innocenti Global Seminar (Florence, Italy, May 23-June 1, 1994). Summary Report.

    ERIC Educational Resources Information Center

    Black, Maggie

    In spring 1994, a seminar involving children's rights activists and researchers was held to examine how the monitoring of children's rights, within the context of the United Nations Convention on the Rights of the Child, supports the monitoring of the goals agreed to at the World Summit for Children. The seminar also reviewed the state of the art…

  10. Adaptive and Innate Immune Responsiveness to Borrelia burgdorferi sensu lato in Exposed Asymptomatic Children and Children with Previous Clinical Lyme Borreliosis

    PubMed Central

    Skogman, Barbro H.; Hellberg, Sandra; Ekerfelt, Christina; Jenmalm, Maria C.; Forsberg, Pia; Ludvigsson, Johnny; Bergström, Sven; Ernerudh, Jan

    2012-01-01

    Why some individuals develop clinical manifestations in Lyme borreliosis (LB) while others remain asymptomatic is largely unknown. Therefore, we wanted to investigate adaptive and innate immune responsiveness to Borrelia burgdorferi sensu lato in exposed Borrelia-antibody-positive asymptomatic children (n = 20), children with previous clinical LB (n = 24), and controls (n = 20). Blood samples were analyzed for Borrelia-specific interferon (IFN)-γ, interleukin (IL)-4, and IL-17 secretion by ELISPOT and Borrelia-induced IL-1β, IL-6, IL-10, IL-12(p70), and tumor necrosis factor (TNF) secretion by Luminex. We found no significant differences in cytokine secretion between groups, but a tendency towards an increased spontaneous secretion of IL-6 was found among children with previous clinical LB. In conclusion, the adaptive or innate immune responsiveness to Borrelia burgdorferi sensu lato was similar in Borrelia-exposed asymptomatic children and children with previous clinical LB. Thus, the immunological mechanisms of importance for eradicating the spirochete effectively without developing clinical manifestations of LB remain unknown. PMID:22190976

  11. Workshop to identify critical windows of exposure for children's health: immune and respiratory systems work group summary.

    PubMed Central

    Dietert, R R; Etzel, R A; Chen, D; Halonen, M; Holladay, S D; Jarabek, A M; Landreth, K; Peden, D B; Pinkerton, K; Smialowicz, R J; Zoetis, T

    2000-01-01

    Fetuses, infants, and juveniles (preadults) should not be considered simply "small adults" when it comes to toxicological risk. We present specific examples of developmental toxicants that are more toxic to children than to adults, focusing on effects on the immune and respiratory systems. We describe differences in both the pharmacokinetics of the developing immune and respiratory systems as well as changes in target organ sensitivities to toxicants. Differential windows of vulnerability during development are identified in the context of available animal models. We provide specific approaches to directly investigate differential windows of vulnerability. These approaches are based on fundamental developmental biology and the existence of discrete developmental processes within the immune and respiratory systems. The processes are likely to influence differential developmental susceptibility to toxicants, resulting in lifelong toxicological changes. We also provide a template for comparative research. Finally, we discuss the application of these data to risk assessment. PMID:10852848

  12. Polymorphisms of Immunity Genes and Susceptibility to Otitis Media in Children

    PubMed Central

    Nokso-Koivisto, Johanna; Chonmaitree, Tasnee; Jennings, Kristofer; Matalon, Reuben; Block, Stan; Patel, Janak A.

    2014-01-01

    Background Acute otitis media (OM) is a common disease which often develops through complex interactions between the host, the pathogen and environmental factors. We studied single nucleotide polymorphisms (SNPs) of genes involved in innate and adaptive immunity, and other host and environmental factors for their role in OM. Methods Using Sequenom Massarray platform, 21 SNPs were studied in 653 children from prospective (n = 202) and retrospective (n = 451) cohorts. Data were analyzed for the relationship between SNPs and upper respiratory infection (URI) frequency, risk of acute OM during URI episodes, and proneness to recurrent OM. Results Increased risk for OM proneness was associated with CX3CR1 (Thr280Met) SNP and with a jointly interactive group of IL-10 (−1082) SNP, IL-1β (−511) wild type genotype and white race. Family history of OM proneness independently increased the risk for frequent URIs, OM occurrence during URI, and OM proneness. Additionally, IL-1β (−31) SNP was associated with increased risk for frequent URIs, but IL-10 (−592), IL-1β (−511), IL-5 (−746) and IL-8 (−251) SNPs were associated with decreased risk of URI. Conclusion IL-1β (−31), CX3CR1 (Thr280Met), IL-10 (−1082) and IL-1β (−511) SNPs were associated with increased risk for frequent URIs or OM proneness. PMID:24718616

  13. Immunologic effects of anti-D (WinRho-SD) in children with immune thrombocytopenic purpura.

    PubMed

    Zimmerman, S A; Malinoski, F J; Ware, R E

    1998-02-01

    Intravenous immunoglobulin (IVIG) is an effective treatment for immune thrombocytopenic purpura (ITP) that induces transient blockade of the reticuloendothelial system (RES) with additional effects including alteration of T lymphocyte subsets and suppression of in vitro T lymphocyte proliferation. As anti-D also is an effective treatment for ITP, we investigated its in vitro and in vivo immunologic effects. The in vitro effects of various agents used in ITP therapy were compared using T lymphocyte proliferation assays. Anti-D caused significantly less inhibition than IVIG or dexamethasone, but non-specific protein was as suppressive as IVIG. Six children with chronic ITP were studied following anti-D administration. Patients received a single dose of anti-D (WinRho-SD, 50 microg/kg i.v. over 5 min) and were studied on day 0, day 7, and 1 month later. Anti-D did not affect T lymphocyte subsets including the T cell receptor variable beta repertoire, in vitro T lymphocyte proliferation to mitogens, recall antigens, or interleukin-2, in vitro IgG synthesis induced by pokeweed mitogen, or T lymphocyte cytokine mRNA levels. We conclude that anti-D has no demonstrable in vitro or in vivo effects on lymphocyte enumeration or function, and therefore likely is effective in the treatment of ITP primarily through RES blockade. PMID:9462545

  14. Accurate and High-Coverage Immune Repertoire Sequencing Reveals Characteristics of Antibody Repertoire Diversification in Young Children with Malaria

    NASA Astrophysics Data System (ADS)

    Jiang, Ning

    Accurately measuring the immune repertoire sequence composition, diversity, and abundance is important in studying repertoire response in infections, vaccinations, and cancer immunology. Using molecular identifiers (MIDs) to tag mRNA molecules is an effective method in improving the accuracy of immune repertoire sequencing (IR-seq). However, it is still difficult to use IR-seq on small amount of clinical samples to achieve a high coverage of the repertoire diversities. This is especially challenging in studying infections and vaccinations where B cell subpopulations with fewer cells, such as memory B cells or plasmablasts, are often of great interest to study somatic mutation patterns and diversity changes. Here, we describe an approach of IR-seq based on the use of MIDs in combination with a clustering method that can reveal more than 80% of the antibody diversity in a sample and can be applied to as few as 1,000 B cells. We applied this to study the antibody repertoires of young children before and during an acute malaria infection. We discovered unexpectedly high levels of somatic hypermutation (SHM) in infants and revealed characteristics of antibody repertoire development in young children that would have a profound impact on immunization in children.

  15. Clinical Features and Treatment Outcomes of Primary Immune Thrombocytopenic Purpura in Hospitalized Children Under 2-Years Old

    PubMed Central

    Farhangi, H; Ghasemi, A; Banihashem, A; Badiei, Z; Jarahi, L; Eslami, G; Langaee, T

    2016-01-01

    Background Immune thrombocytopenic purpura (ITP) is the most prevalent cause of thrombocytopenia in children. Despite the importance of ITP in children under 2-years old, only a few publications are available in the literature.ITP usually presents itself as isolated thrombocytopenia and mucocutaneous bleeding. Materials and Methods This study was conducted on 187 under 2-year-old children diagnosed with ITP and treated at Dr. Sheikh Hospital from 2004 to 2011.In this retrospective study, clinical symptoms, laboratory findings, history of viral infections, vaccination history, and treatment efficacy in children under 2-years old with ITP were investigated.Patients were followed for one year after being discharged from the hospital. Results The risk of the disease developing into chronic form was higher in older children (0.001). ITP in children under 3-months old was significantly associated with vaccination (p=0.007). There was no significant differences between male and female patients in regards to newly diagnosed ITP, persistent, and chronic disease status (p = 0.21). No significant difference in bleeding symptoms was observed between patients under 3-months old and 3 to 24-months old (p=0.18). Conclusion Infantile ITP respond favorably to treatment. The risk of the disease developing into chronic form is higher in 3-to-24-month-old children compared to under-three-month olds. PMID:27222699

  16. The role of executive function in children's source monitoring with varying retrieval strategies

    PubMed Central

    Earhart, Becky; Roberts, Kim P.

    2014-01-01

    Previous research on the relationship between executive function and source monitoring in young children has been inconclusive, with studies finding conflicting results about whether working memory and inhibitory control are related to source-monitoring ability. In this study, the role of working memory and inhibitory control in recognition memory and source monitoring with two different retrieval strategies were examined. Children (N = 263) aged 4–8 participated in science activities with two sources. They were later given a recognition and source-monitoring test, and completed measures of working memory and inhibitory control. During the source-monitoring test, half of the participants were asked about sources serially (one after the other) whereas the other half of the children were asked about sources in parallel (considering both sources simultaneously). Results demonstrated that working memory was a predictor of source-monitoring accuracy in both conditions, but inhibitory control was only related to source accuracy in the parallel condition. When age was controlled these relationships were no longer significant, suggesting that a more general cognitive development factor is a stronger predictor of source monitoring than executive function alone. Interestingly, the children aged 4–6 years made more accurate source decisions in the parallel condition than in the serial condition. The older children (aged 7–8) were overall more accurate than the younger children, and their accuracy did not differ as a function of interview condition. Suggestions are provided to guide further research in this area that will clarify the diverse results of previous studies examining whether executive function is a cognitive prerequisite for effective source monitoring. PMID:24847302

  17. EXPOSURE MONITORING COMPONENT FOR DETROIT CHILDREN'S HEALTH STUDY ( DCHS )

    EPA Science Inventory

    Conventional, regulatory-based air monitoring is expensive and, thus, conducted at one or few locations in a city. This provides limited info on intra-urban variability and spatial distribution of air pollution. Research-oriented urban network monitoring has progressed with inc...

  18. Comparison of recruitment, retention, and compliance results for three children's exposure monitoring studies.

    PubMed

    Sexton, Ken

    2005-07-01

    The School Health Initiative: Environment, Learning, Disease (SHIELD) study, the Minnesota Children's Pesticide Exposure Study (MNCPES), and the National Cooperative Inner-City Asthma Study (NCICAS) are three of the most intensive and invasive exposure-monitoring projects ever undertaken in children. An intrinsic facet of each study was the need to recruit children and their families, retain them for the duration of the project, and ensure that they completed monitoring protocols successfully. All of the studies used fiscal incentives to encourage participation, retention, and compliance. Recruitment rates varied from 40% in MNCPES, to 57% in SHIELD, to 64% in NCICAS, while retention rates varied from 85% in SHIELD, to 94% in MNCPES, to 95% in NCICAS. Rates of compliance with exposure sampling procedures were typically >80% for each study. For example, > or =85% of the enrolled children provided all requested urine samples (1 for NCICAS, 2 for SHIELD, 3 for MNCPES), and 82% of the children in SHIELD provided two out of two blood samples (optional in MNCPES and NCICAS). However, compliance rates were substantially lower (34% SHIELD, 40% NCICAS, not applicable to MNCPES) for the more complex and time-consuming protocol used to collect peak flow data. Overall, results demonstrate that it is practical and affordable to conduct demanding exposure-monitoring studies in children, including children from poor minority communities. PMID:15523509

  19. Immunodynamics: a cancer immunotherapy trials network review of immune monitoring in immuno-oncology clinical trials.

    PubMed

    Kohrt, Holbrook E; Tumeh, Paul C; Benson, Don; Bhardwaj, Nina; Brody, Joshua; Formenti, Silvia; Fox, Bernard A; Galon, Jerome; June, Carl H; Kalos, Michael; Kirsch, Ilan; Kleen, Thomas; Kroemer, Guido; Lanier, Lewis; Levy, Ron; Lyerly, H Kim; Maecker, Holden; Marabelle, Aurelien; Melenhorst, Jos; Miller, Jeffrey; Melero, Ignacio; Odunsi, Kunle; Palucka, Karolina; Peoples, George; Ribas, Antoni; Robins, Harlan; Robinson, William; Serafini, Tito; Sondel, Paul; Vivier, Eric; Weber, Jeff; Wolchok, Jedd; Zitvogel, Laurence; Disis, Mary L; Cheever, Martin A

    2016-01-01

    The efficacy of PD-1/PD-L1 targeted therapies in addition to anti-CTLA-4 solidifies immunotherapy as a modality to add to the anticancer arsenal. Despite raising the bar of clinical efficacy, immunologically targeted agents raise new challenges to conventional drug development paradigms by highlighting the limited relevance of assessing standard pharmacokinetics (PK) and pharmacodynamics (PD). Specifically, systemic and intratumoral immune effects have not consistently correlated with standard relationships between systemic dose, toxicity, and efficacy for cytotoxic therapies. Hence, PK and PD paradigms remain inadequate to guide the selection of doses and schedules, both starting and recommended Phase 2 for immunotherapies. The promise of harnessing the immune response against cancer must also be considered in light of unique and potentially serious toxicities. Refining immune endpoints to better inform clinical trial design represents a high priority challenge. The Cancer Immunotherapy Trials Network investigators review the immunodynamic effects of specific classes of immunotherapeutic agents to focus immune assessment modalities and sites, both systemic and importantly intratumoral, which are critical to the success of the rapidly growing field of immuno-oncology. PMID:26981245

  20. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish K.; Crucian, Brian; Pierson, Duane L.; Sams, Clarence; Stowe, Raymond P.

    2007-01-01

    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 degrees head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity (AG) as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system, and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of Epstein barr virus (EBV), Cytomegalovirus (CMV), and Varicella zoster virus (VZV) was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 106 PBMCs. Overall, these data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  1. Monitoring Immune System Function and Reactivation of Latent Viruses in the Artificial Gravity Pilot Study

    NASA Technical Reports Server (NTRS)

    Mehta, Satish; Crusian, Brian; Pierson, Duane; Sams, Clarence; Stowe, Raymond

    2007-01-01

    Numerous studies have indicated that dysregulation of the immune system occurs during or after spaceflight. Using 21 day -6 deg. head-down tilt bed rest as a spaceflight analog, this study describes the effects of artificial gravity as a daily countermeasure on immunity, stress and reactivation of clinically important latent herpes viruses. The specific aims were to evaluate psychological and physiological stress, to determine the status of the immune system and to quantify reactivation of latent herpes viruses. Blood, saliva, and urine samples were collected from each participating subject at different times throughout the study. An immune assessment was performed on all treatment and control subjects that consisted of a comprehensive peripheral immunophenotype analysis, intracellular cytokine profiles and a measurement of T cell function. The treatment group displayed no differences throughout the course of the study with regards to peripheral leukocyte distribution, cytokine production or T cell function. Shedding of EBV and CMV was quantified by real time PCR in saliva and urine samples, respectively. There was no significant difference in CMV DNA in the treatment group as compared to the control group. EBV and VZV on the other hand showed a mild reactivation during the study. There were no significant differences in plasma cortisol between the control and treatment groups. In addition, no significant differences between antiviral antibody titers (EBV-VCA, -EA, -EBNA, CMV) or tetramer-positive (EBV, CMV) were found between the two groups. EBV DNA copies in blood were typically undetectable but never exceeded 1,500 copies per 10(exp 6) PBMCs. These data indicate that the artificial gravity countermeasure and the 21 day head-down tilt bed rest regimen had no observable adverse effect on immune function.

  2. [Therapy monitoring and management of adverse events in PD-1/PD-L1 immune checkpoint inhibition].

    PubMed

    Oppel-Heuchel, H; Grimm, M-O

    2016-05-01

    Nivolumab was recently approved as the first inhibitor of the programmed death 1 (PD-1) receptor and its ligand (PD-L1) for the treatment of urological cancer, namely metastasized renal cell carcinoma after prior therapy. The use of this new immunotherapy requires special therapy monitoring and management of side effects. An increase of immune cells around the tumor can initially mimic progression (so-called pseudoprogression). Treatment-associated side effects of higher grade according to the common terminology criteria for adverse events (CTCAE grades 3 or 4) are relatively rare; however, new immune-mediated side effects can occur and affect the skin, liver (hepatitis), kidneys (nephritis), gastrointestinal tract (diarrhea and colitis), lungs (pneumonitis) and endocrine organs (hyperthyroidism, hypothyroidism and hypophysitis). Treatment has to be delayed or discontinued depending on the kind and degree of side effects; furthermore, corticosteroids can be administered as immunosuppressants. When recognized in time and with correct management, immune-mediated side effects are basically reversible. PMID:27146870

  3. Growth monitoring still has a place in selected populations of children.

    PubMed

    Hussain, M; John, C M; Mohamed, K; Zbaeda, M; Ng, S M; Chanderasekaran, S; Didi, M; Blair, J C

    2011-01-01

    In 1998, a multiprofessional group developed a consensus on growth monitoring in the UK. While routine serial measurements were not recommended in healthy children, it is clear that there is a subset of children at increased risk of growth-modifying disease who may benefit from growth monitoring. This subset includes children with genetic disorders at increased risk of thyroid dysfunction. Symptoms and signs of thyroid dysfunction are non-specific in the early stages of disease and are easily mistaken for features of an underlying genetic disorder. In this article, we report the case of a 2.8-year-old girl with 18q deletion syndrome who was profoundly weak, hypotonic and poorly responsive at diagnosis of Grave's disease. She was tall and her bone age was 2 years advanced, indicating long-standing disease. Growth monitoring of this patient should have enabled earlier diagnosis and avoided a serious and potentially fatal episode. PMID:22700067

  4. New Approaches to Assessment and Monitoring of Concussion in Children

    ERIC Educational Resources Information Center

    Gioia, Gerard A.; Isquith, Peter K.; Schneider, Jillian C.; Vaughan, Christopher G.

    2009-01-01

    A mild traumatic brain injury (TBI) constitutes the overwhelming majority of brain injury cases in children and adolescents. This article focuses on cerebral concussion, which can be viewed as a subset of mild TBI, which, until recently, has received limited attention in the pediatric assessment literature. Few extant measures appropriate to this…

  5. Monitoring Variability and Change in Children's Spelling Strategies

    ERIC Educational Resources Information Center

    Farrington-Flint, Lee; Stash, Amanda; Stiller, James

    2008-01-01

    This study examined the role of variability and change in children's strategy performance within the context of spelling. The spelling ability of 34 eight- to nine-year-olds was examined using an experimental spelling task comprising 45 items, which varied with regard to rime unit frequency. The spelling task incorporated a series of consistent,…

  6. Reaching the Children: Universal Child Immunization by 1990. Development Education Kit.

    ERIC Educational Resources Information Center

    United Nations Children's Fund, New York, NY. United States Committee.

    The goal of the Universal Child Immunization Program, adopted by the World Health Organization in 1977, is to inoculate by 1990, every child in the world against measles, tetanus, whooping cough, diphtheria, tuberculosis, and polio. By 1987, nearly 80 countries had undertaken or were planning immunization programs. These diseases, combined with…

  7. Biological monitoring of organophosphorus pesticide exposure among children of agricultural workers in central Washington State.

    PubMed Central

    Loewenherz, C; Fenske, R A; Simcox, N J; Bellamy, G; Kalman, D

    1997-01-01

    Children up to 6 years of age who lived with pesticide applicators were monitored for increased risk of pesticide exposure: 48 pesticide applicator and 14 reference families were recruited from an agricultural region of Washington State in June 1995. A total of 160 spot urine samples were collected from 88 children, including repeated measures 3-7 days apart. Samples were assayed by gas chromatography flame photometric detector for dimethylphosphate metabolites. Dimethylthiophosphate (DMTP) was the dominant metabolite. DMTP levels were significantly higher in applicator children than in reference children (p = 0.015), with median concentrations of 0.021 and 0.005 microg/ml, respectively; maximum concentrations were 0.44 and 0.10 microg/ml, respectively. Percentages of detectable samples were 47% for applicator children and 27% for reference children. A marginally significant trend of increasing concentration was observed with decreasing age among applicator children (p = 0.060), and younger children within these families had significantly higher concentrations when compared to their older siblings (p = 0.040). Applicator children living less than 200 feet from an orchard were associated with higher frequency of detectable DMTP levels than nonproximal applicator children (p =0.036). These results indicate that applicator children experienced higher organophosphorus pesticide exposures than did reference children in the same community and that proximity to spraying is an important contributor to such exposures. Trends related to age suggest that child activity is an important variable for exposure. It is unlikely that any of the observed exposures posed a hazard of acute intoxication. This study points to the need for a more detailed understanding of pesticide exposure pathways for children of agricultural workers. Images Figure 1. Figure 2. Figure 3. PMID:9405329

  8. Efficacy of combined intravenous immunoglobulins and steroids in children with primary immune thrombocytopenia and persistent bleeding symptoms

    PubMed Central

    Parodi, Emilia; Giordano, Paola; Rivetti, Elisa; Giraudo, Maria Teresa; Ansaldi, Giulia; Davitto, Mirella; Mondino, Anna; Farruggia, Piero; Amendola, Giovanni; Matarese, Sofia M.R.; Rossi, Francesca; Russo, Giovanna; Ramenghi, Ugo

    2014-01-01

    Background The aim of this study was to investigate the effect of the combined administration of intravenous immunoglobulins and steroids as a second-line therapy in 34 children with primary immune thrombocytopenia and persistent, symptomatic bleeding. Materials and methods Combined therapy (intravenous immunoglobulins 0.4 g/kg daily on days 1 and 2, and methylprednisolone 20 mg/kg daily on days 1–3) was administered to 12 patients with newly diagnosed ITP who did not respond to the administration of a single therapy (either intravenous immunoglobulins or steroids) and to 22 children with persistent and chronic disease who required frequent administrations (i.e. more frequently than every 30 days) of either immunoglobulins or steroids (at the same standard dosages) in order to control active bleeding. Results A response (i.e. platelet count >50×109/L and remission of active bleeding) was observed in 8/12 (67%) patients with newly diagnosed ITP. The clinical presentation of responders and non-responders did not differ apparently. Patients in the chronic/persistent phase of disease had a significantly longer median period of remission from symptoms compared with the previous longest period of remission (p=0.016). The treatment was well tolerated. Discussion Our data suggest that the combined approach described is a well-tolerated therapeutic option for children with primary immune thrombocytopenia and persistent bleeding symptoms that can be used in both emergency and/or maintenance settings. PMID:24887226

  9. Potential Use of Salivary Markers for Longitudinal Monitoring of Inflammatory Immune Responses to Vaccination

    PubMed Central

    Garssen, Johan; Sandalova, Elena

    2016-01-01

    Vaccination, designed to trigger a protective immune response against infection, is a trigger for mild inflammatory responses. Vaccination studies can address the question of inflammation initiation, levels, and resolution as well as its regulation for respective studied pathogens. Such studies largely based on analyzing the blood components including specific antibodies and cytokines were usually constrained by number of participants and volume of collected blood sample. Hence, blood-based studies may not be able to cover the full dynamic range of inflammation responses induced by vaccination. In this review, the potential of using saliva in addition to blood for studying the kinetics of inflammatory response studies was assessed. Saliva sampling is noninvasive and has a great potential to be used for studies aimed at analysing the magnitude, time course, and variance in immune responses, including inflammation after vaccination. Based on a literature survey of inflammatory biomarkers that can be determined in saliva and an analysis of how these biomarkers could help to understand the mechanisms and dynamics of immune reactivity and inflammation, we propose that the saliva-based approach might have potential to add substantial value to clinical studies, particularly in vulnerable populations such as infants, toddlers, and ill individuals. PMID:27022211

  10. Recognizing and monitoring adverse events of second-generation antipsychotics in children and adolescents.

    PubMed

    Correll, Christoph U; Penzner, Julie B; Parikh, Umesh H; Mughal, Tahir; Javed, Tariq; Carbon, Maren; Malhotra, Anil K

    2006-01-01

    Although second-generation antipsychotics (SGAs) are used increasingly in children and adolescents, data on the effectiveness and safety in pediatric populations are still sparse. Much of the safety information is derived from studies conducted in adults. This derivation is problematic because children and adolescents are exposed to SGAs during a phase of unparalleled physical and psychologic development that can affect pharmacokinetic and pharmacodynamic drug actions, efficacy, and side-effect patterns. This article presents an overview of SGA-related side effects in children and adolescents and strategies to monitor health outcomes effectively in youngsters receiving SGAs. PMID:16321730

  11. Self-Monitoring of Listening Abilities in Normal-Hearing Children, Normal-Hearing Adults, and Children with Cochlear Implants

    PubMed Central

    Rothpletz, Ann M.; Wightman, Frederic L.; Kistler, Doris J.

    2012-01-01

    Background Self-monitoring has been shown to be an essential skill for various aspects of our lives, including our health, education, and interpersonal relationships. Likewise, the ability to monitor one’s speech reception in noisy environments may be a fundamental skill for communication, particularly for those who are often confronted with challenging listening environments, such as students and children with hearing loss. Purpose The purpose of this project was to determine if normal-hearing children, normal-hearing adults, and children with cochlear implants can monitor their listening ability in noise and recognize when they are not able to perceive spoken messages. Research Design Participants were administered an Objective-Subjective listening task in which their subjective judgments of their ability to understand sentences from the Coordinate Response Measure corpus presented in speech spectrum noise were compared to their objective performance on the same task. Study Sample Participants included 41 normal-hearing children, 35 normal-hearing adults, and 10 children with cochlear implants. Data Collection and Analysis On the Objective-Subjective listening task, the level of the masker noise remained constant at 63 dB SPL, while the level of the target sentences varied over a 12 dB range in a block of trials. Psychometric functions, relating proportion correct (Objective condition) and proportion perceived as intelligible (Subjective condition) to target/masker ratio (T/M), were estimated for each participant. Thresholds were defined as the T/M required to produce 51% correct (Objective condition) and 51% perceived as intelligible (Subjective condition). Discrepancy scores between listeners’ threshold estimates in the Objective and Subjective conditions served as an index of self-monitoring ability. In addition, the normal-hearing children were administered tests of cognitive skills and academic achievement, and results from these measures were compared

  12. Use of continuous glucose monitoring in young children with type 1 diabetes: Implications for behavioral research

    PubMed Central

    Patton, Susana R.; Williams, Laura B.; Eder, Sally J.; Crawford, Megan J.; Dolan, Lawrence; Powers, Scott W.

    2012-01-01

    Objective This study presents data on the use of continuous glucose monitoring (CGM) in young children with type 1 diabetes mellitus (T1DM). CGM provides moment-to-moment tracking of glucose concentrations and measures of intra- and interday variability which are particularly salient measures in young children with T1DM. Methods Thirty-one children (M age = 5.0 years) with T1DM wore the Medtronic Minimed CGM for a mean of 66.8 hours. The CGM was inserted in diabetes clinics and parents were provided brief training. Results Few difficulties were experienced and families cited the acceptability of CGM. Participants' CGM data are compared to self-monitoring blood glucose (SMBG) data as well as data from older children with T1DM to illustrate differences in methodology and variability present in this population. CGM data is used to calculate glucose variabilty, which is found to be related to diabetes variables such as history of hypoglycemic seizures. Conclusions CGM is an acceptable research tool for obtaining glucose data in young children with T1DM and has been used previously in older children and adults. CGM may be particularly useful in young children who often experience more glucose variability. Data obtained via CGM is richer and more detailed than traditional SMBG data and allows for analyses to link blood glucose with behavior. PMID:20337971

  13. Continuous non-invasive finger blood pressure monitoring in children.

    PubMed

    Tanaka, H; Thulesius, O; Yamaguchi, H; Mino, M; Konishi, K

    1994-06-01

    We evaluated the performance of continuous non-invasive finger arterial pressure measurement using the volume-clamp technique (Finapres). This study was designed to compare finger arterial pressure with brachial blood pressure estimated by the auscultatory method in 217 children (90 boys and 127 girls) aged 4-16 years and in 38 adults (aged 18-45 years). Finger and brachial artery pressure readings were obtained consecutively from the ipsilateral side in the supine position. Finger arterial pressure waveforms were recorded in all children except 4 with small and thin fingers. There was good agreement for systolic pressure with only a slight underestimation of 1.9 mmHg and 5.1 mmHg lower for diastolic pressure. This difference most probably reflects inaccuracy of the auscultatory cuff method rather than an error in the Finapres. There was large inter-individual variability in Finapres recordings which might be due to differences in vasomotor tone, as demonstrated by systolic amplification in 5 patients with anorexia. However, Finapres showed a small within-subject variability (3.8 mmHg for systolic and 4.1 mmHg for diastolic pressure) determined in 5 patients during phenylephrine infusion, and as good reproducibility as the auscultatory method. These results suggest that finger arterial pressure measurement in children older than 6 years of age has similar accuracy as that in adults, and that this method is useful for clinical applications in children, especially for the non-invasive evaluation of autonomic control and cardiovascular reflexes involving transient and rapid blood pressure changes. PMID:7919764

  14. Children's Comprehension Monitoring of Multiple Situational Dimensions of a Narrative

    ERIC Educational Resources Information Center

    Wassenburg, Stephanie I.; Beker, Katinka; van den Broek, Paul; van der Schoot, Menno

    2015-01-01

    Narratives typically consist of information on multiple aspects of a situation. In order to successfully create a coherent representation of the described situation, readers are required to monitor all these situational dimensions during reading. However, little is known about whether these dimensions differ in the ease with which they can be…

  15. Dietary self-monitoring and its impact on weight loss in overweight children

    PubMed Central

    Mockus, Danyte S.; Macera, Caroline A.; Wingard, Deborah L.; Peddecord, Michael; Thomas, Ronald G.; Wilfley, Denise E.

    2013-01-01

    Objective To examine whether dietary self-monitoring is related to weight loss in overweight children and whether perceived social support or dietary self-efficacy affects this relation. Design Longitudinal, behavioral intervention study. Subjects The study population included 153 children, aged 7–12 years, with daily food records from a 20-week weight loss program in San Diego, California, USA, conducted between 1999 and 2002. Methods Self-monitoring was assessed using two methods: a weekly index as a measure of competency (possible range −7 to +35) and recording sufficiency for total compliance (percentage of days). Results Significantly greater decreases in percentage overweight were found for children with recording competency at or above the median (mean change: −13.4% vs. −8.6%; p < 0.001) or who were compliant in recording ≥50% of the days (mean change: −13.0% vs. −8.4%; p < 0.001). Using hierarchical linear regression, children who had a higher average weekly monitoring index or recorded sufficiently on more days had significantly greater decreases in percent overweight, after adjusting for age, sex, SES, race/ethnicity and baseline percent overweight (p < 0.001). Perceived social support at baseline and dietary self-efficacy were not related to self-monitoring or change in percent overweight in this sample. Conclusion As has been demonstrated with adults and adolescents, self-monitoring in children was associated with greater decreases in percent overweight. However, dietary self-efficacy and perceived social support were not related to how frequently or thoroughly they monitored dietary intake. PMID:21722068

  16. Prevalence of Plasmodium falciparum transmission reducing immunity among primary school children in a malaria moderate transmission region in Zimbabwe.

    PubMed

    Paul, Noah H; Vengesai, Arthur; Mduluza, Takafira; Chipeta, James; Midzi, Nicholas; Bansal, Geetha P; Kumar, Nirbhay

    2016-11-01

    Malaria continues to cause alarming morbidity and mortality in more than 100 countries worldwide. Antigens in the various life cycle stages of malaria parasites are presented to the immune system during natural infection and it is widely recognized that after repeated malaria exposure, adults develop partially protective immunity. Specific antigens of natural immunity represent among the most important targets for the development of malaria vaccines. Immunity against the transmission stages of the malaria parasite represents an important approach to reduce malaria transmission and is believed to become an important tool for gradual elimination of malaria. Development of immunity against Plasmodium falciparum sexual stages was evaluated in primary school children aged 6-16 years in Makoni district of Zimbabwe, an area of low to modest malaria transmission. Malaria infection was screened by microscopy, rapid diagnostic tests and finally using nested PCR. Plasma samples were tested for antibodies against recombinant Pfs48/45 and Pfs47 by ELISA. Corresponding serum samples were used to test for P. falciparum transmission reducing activity in Anopheles stephensi and An. gambiae mosquitoes using the membrane feeding assay. The prevalence of malaria diagnosed by rapid diagnostic test kit (Paracheck)™ was 1.7%. However, of the randomly tested blood samples, 66% were positive by nested PCR. ELISA revealed prevalence (64% positivity at 1:500 dilution, in randomly selected 66 plasma samples) of antibodies against recombinant Pfs48/45 (mean A 405nm=0.53, CI=0.46-0.60) and Pfs47 (mean A405nm=0.91, CI=0.80-1.02); antigens specific to the sexual stages. The mosquito membrane feeding assay demonstrated measurable transmission reducing ability of the samples that were positive for Pfs48/45 antibodies by ELISA. Interestingly, 3 plasma samples revealed enhancement of infectivity of P. falciparum in An. stephensi mosquitoes. These studies revealed the presence of antibodies with

  17. Use of Text Messaging for Monitoring Sugar-Sweetened Beverages, Physical Activity, and Screen Time in Children: A Pilot Study

    ERIC Educational Resources Information Center

    Shapiro, Jennifer R.; Bauer, Stephanie; Hamer, Robert M.; Kordy, Hans; Ward, Dianne; Bulik, Cynthia M.

    2008-01-01

    Objective: To examine acceptability, attrition, adherence, and preliminary efficacy of mobile phone short message service (SMS; text messaging) for monitoring healthful behaviors in children. Design: All randomized children received a brief psychoeducational intervention. They then either monitored target behaviors via SMS with feedback or via…

  18. From Space to the Patient: A New Cytokine Release Assay to Monitor the Immune Status of HIV Infected Patients and Sepsis Patients

    NASA Technical Reports Server (NTRS)

    Kaufmann, I.; Draenert, R.; Gruber, M.; Feuerecker, M.; Crucian, B. E.; Mehta, S. L.; Roider, J.; Pierson, D. L.; Briegel, J. M.; Schelling, G.; Sams, C. F.; Chouker, A.

    2013-01-01

    Monitoring of humans either in the healthy men under extreme environmental stress like space flight, in human immunodeficiency virus (HIV) infected patients or in sepsis is of critical importance with regard to the timing of adequate therapeutic (counter-)measures. The in vivo skin delayed-type hypersensitivity test (DTH) served for many years as a tool to evaluate cell mediated immunity. However, this standardised in vivo test was removed from the market in 2002 due to the risk of antigen stabilization. To the best of our knowledge an alternative test as monitoring tool to determine cell mediated immunity is not available so far. For this purpose we tested a new alternative assay using elements of the skin DTH which is based on an ex vivo cytokine release from whole blood and asked if it is suitable and applicable to monitor immune changes in HIV infected patients and in patients with septic shock.

  19. Monitoring of immune cell response to B cell depletion therapy and nerve root injury using SPIO enhanced MRI

    NASA Astrophysics Data System (ADS)

    Thorek, Daniel L.

    2009-12-01

    Magnetic resonance (MR) is a robust platform for non-invasive, high-resolution anatomical imaging. However, MR imaging lacks the requisite sensitivity and contrast for imaging at the cellular level. This represents a clinical impediment to greater diagnostic accuracy. Recent advances have allowed for the in vivo visualization of populations and even of individual cells using superparamagnetic iron oxide (SPIO) MR contrast agents. These nanoparticles, commonly manifested as a core of a single iron oxide crystal or cluster of crystals coated in a biocompatible shell, function to shorten proton relaxation times. In MR imaging these constructs locally dephase protons, resulting in a decrease in signal (hypointensity) localized to the region of accumulation of SPIO. In the context of immune cell imaging, SPIO can provide insight into the cellular migration patterns, trafficking, temporal dynamics and progression of diseases and their related pathological states. Furthermore, by visualizing the presence and activity of immune cells, SPIO-enabled cellular imaging can help evaluate the efficacy of therapy in immune disorders. This thesis examines the production, modification and application of SPIO in a range of in vitro and in vivo immune-response-relevant cellular systems. The role of different nanoparticle characteristics including diameter, surface charge and concentration are investigated in the labeling of T cells in culture. Following optimization of SPIO loading conditions for lymphocytes, the effect these particles have on the activation of primary B cells are elucidated. B cells are tracked using a variety of modalities, with and without the application of B cell depleting therapy. This is to evaluate the efficacy of SPIO as in vivo marker for B cell distribution. Unmodified SPIO were applied to monitor macrophage infiltration in a transient nerve root compression model, with implications for neck pain diagnosis and treatment. Nanoparticle accumulation and MR

  20. Early Systemic Cellular Immune Response in Children and Young Adults Receiving Decellularized Fresh Allografts for Pulmonary Valve Replacement

    PubMed Central

    Neumann, Anneke; Breymann, Thomas; Cebotari, Serghei; Boethig, Dietmar; Horke, Alexander; Beerbaum, Philipp; Westhoff-Bleck, Mechthild; Bertram, Harald; Ono, Masamichi; Tudorache, Igor; Haverich, Axel; Beutel, Gernot

    2014-01-01

    Objectives: The longevity of homografts is determined by the activation of the recipients' immune system resulting from allogenic antigen exposition. Fresh decellularized pulmonary homografts (DPH) have shown promising early results in pulmonary valve replacement in children and young adults and could potentially avoid significant activation of the immune system, as more than 99% of the donor DNA is removed during the decellularization process. While the humoral immune response to decellularized allografts has been studied, detailed information on the more significant cellular immune response is currently lacking. Methods and Results: Peripheral blood samples were obtained from patients undergoing pulmonary valve replacement with DPH before, after, and for approximately 3 years after implantation. Absolute counts and percentages of mature T- (CD3+), B- (CD19+), and natural killer- (CD16+/CD56+) cells, as well as T helper- (CD4+) and cytotoxic T-cell- (CD8+) subsets, were determined by fluorescence-activated cell sorting (FACS). Between May 2009 and September 2013, 199 blood samples taken from 47 patients with a mean age at DPH implantation of 16.6±10.8 years were analyzed. The hemodynamic performance of DPH was excellent in all but one patient, and no valve-related deaths or conduit explantations were observed. The short-term follow up revealed a significant postoperative decrease in cell counts of most subtypes with reconstitution after 3 months. Continued assessment did not show any significant deviations in cell counts from their baseline values. Conclusion: The absence of cellular immune response in patients receiving DPH supports the concept that decellularization can provide a basis for autologous regeneration. PMID:24138470

  1. Similar protective immunity induced by an inactivated enterovirus 71 (EV71) vaccine in neonatal rhesus macaques and children.

    PubMed

    Zhang, Ying; Wang, Lichun; Liao, Yun; Liu, Longding; Ma, Kaili; Yang, Erxia; Wang, Jingjing; Che, Yanchun; Jiang, Li; Pu, Jing; Guo, Lei; Feng, Min; Liang, Yan; Cui, Wei; Yang, Huai; Li, Qihan

    2015-11-17

    During the development of enterovirus 71 (EV71) inactivated vaccine for preventing human hand, foot and mouth diseases (HFMD) by EV71 infection, an effective animal model is presumed to be significant and necessary. Our previous study demonstrated that the vesicles in oral regions and limbs potentially associated with viremia, which are the typical manifestations of HFMD, and remarkable pathologic changes were identified in various tissues of neonatal rhesus macaque during EV71 infection. Although an immune response in terms of neutralizing antibody and T cell memory was observed in animals infected by the virus or stimulated by viral antigen, whether such a response could be considered as an indicator to justify the immune response in individuals vaccinated or infected in a pandemic needs to be investigated. Here, a comparative analysis of the neutralizing antibody response and IFN-γ-specific T cell response in vaccinated neonatal rhesus macaques and a human clinical trial with an EV71 inactivated vaccine was performed, and the results showed the identical tendency and increased level of neutralizing antibody and the IFN-γ-specific T cell response stimulated by the EV71 antigen peptide. Importantly, the clinical protective efficacy against virus infection by the elicited immune response in the immunized population compared with the placebo control and the up-modulated gene profile associated with immune activation were similar to those in infected macaques. Further safety verification of this vaccine in neonatal rhesus macaques and children confirmed the potential use of the macaque as a reliable model for the evaluation of an EV71 candidate vaccine. PMID:26419198

  2. Children with High Functioning Autism show increased prefrontal and temporal cortex activity during error monitoring

    PubMed Central

    Goldberg, Melissa C.; Spinelli, Simona; Joel, Suresh; Pekar, James J.; Denckla, Martha B.; Mostofsky, Stewart H.

    2010-01-01

    Evidence exists for deficits in error monitoring in autism. These deficits may be particularly important because they may contribute to excessive perseveration and repetitive behavior in autism. We examined the neural correlates of error monitoring using fMRI in 8–12-year-old children with high-functioning autism (HFA, n=11) and typically developing children (TD, n=15) during performance of a Go/No-Go task by comparing the neural correlates of commission errors versus correct response inhibition trials. Compared to TD children, children with HFA showed increased BOLD fMRI signal in the anterior medial prefrontal cortex (amPFC) and the left superior temporal gyrus (STempG) during commission error (versus correct inhibition) trials. A follow-up region-of-interest analysis also showed increased BOLD signal in the right insula in HFA compared to TD controls. Our findings of increased amPFC and STempG activity in HFA, together with the increased activity in the insula, suggest a greater attention towards the internally-driven emotional state associated with making an error in children with HFA. Since error monitoring occurs across different cognitive tasks throughout daily life, an increased emotional reaction to errors may have important consequences for early learning processes. PMID:21151713

  3. Using Parents and Teachers to Monitor Progress among Children with ASD: A Review of Intervention Research

    ERIC Educational Resources Information Center

    Witmer, Sara E.; Nasamran, Amy; Parikh, Purvi J.; Schmitt, Heather A.; Clinton, Marianne C.

    2015-01-01

    Despite growing knowledge of the effectiveness of various interventions for children with autism spectrum disorders (ASD), it is never clear whether a particular intervention will be effective for a specific child with ASD. Careful monitoring of an individual child's progress is necessary to know whether an intervention is effective. In this…

  4. Self-Initiated Speech Repairs: A Reflection of Communicative Monitoring in Young Children.

    ERIC Educational Resources Information Center

    Evans, Mary Ann

    1985-01-01

    Demonstrates frequent occurrence of self-initiated repairs in speech of kindergarten and second grade children. Speech during "Show and Tell" sessions was scored for spontaneous occurrence of repetitions; corrections of word choice reference and syntax; postponements; and abandonments. Findings indicate most frequent communicative monitoring in…

  5. Oropharyngeal 24-Hour pH Monitoring in Children With Airway-Related Problems

    PubMed Central

    Mesallam, Tamer A.

    2016-01-01

    Objectives Diagnosis and clinical presentation of pediatric laryngopharyngeal reflux (LPR) is still controversial. The aims of this work were to study the possibility of performing 24-hour oropharyngeal pH monitoring for children in the outpatient clinic setup and to explore the results of this test in correlation to airway-related problems. Methods In this descriptive qualitative study, 26 children suffering from airway-related problems were included. Oropharyngeal 24-hour pH monitoring was performed for all subjects in the outpatient clinic setting. The distribution of airway diagnoses among the study group was studied versus the results of the pH monitoring. Results There were 16 males and 10 females participated in the study with a mean age of 6.88 (SD, ±5.77) years. Thirty-five percent of the patients were under the age of 3 years (range, 11 months to 3 years). Eight-five percent of the patients tolerated the pH probe insertion and completed 24-hour of pH recording. Laryngomalacia and subglottic stenosis (SGS) were more frequently reported in the positive LPR patients (77%). Conclusion Oropharyngeal 24-hour pH monitoring can be conducted for children in the outpatient setup even in young age children below 3 years old. Among the positive LPR group, SGS and laryngomalacia were the most commonly reported airway findings. PMID:27090271

  6. Age Differences in the Effects of Social Influence on Children's Eyewitness Performance and Their Metacognitive Monitoring

    ERIC Educational Resources Information Center

    Schwarz, Stefanie; Roebers, Claudia M.

    2006-01-01

    The current work investigated the effects of social influence on children's recall accuracy and metacognitive monitoring. Two studies were conducted in which 8-and 10-year-olds were confronted with postevent information in an interview situation. An interviewer (Study 1) or a confederate (Study 2) provided postevent information with two levels of…

  7. Watching Children: Describing the Use of Baby Monitors on Epinions.com

    ERIC Educational Resources Information Center

    Nelson, Margaret K.

    2008-01-01

    Popular culture today characterizes middle-class parents as being consumed with anxiety about their children. Drawing on more than 100 consumer reviews of baby monitors published on Epinions.com, the author examines how parents respond to that anxiety. Although Epinions.com reviewers are not representative of the population at large, they do…

  8. Using Heart Rate Monitors in Research on Fitness Levels of Children in Physical Education.

    ERIC Educational Resources Information Center

    Strand, Brad; Reeder, Steve

    1993-01-01

    Demonstrates the use of heart rate monitors (HRMs) in fitness research and examines heart rate intensity levels of middle school students while they participated in a variety of physical education activities throughout a school year. Research shows the HRM has considerable potential in assessing fitness achievements in school-age children. (GLR)

  9. Differential Efficacy of Home Monitoring and Cognitive-Behavioral Treatment for Decreasing Children's Maladaptive Nighttime Fears

    ERIC Educational Resources Information Center

    Pincus, Donna B.; Weiner, Courtney L.; Friedman, Alice G.

    2012-01-01

    A number of studies have demonstrated the efficacy of brief cognitive-behavioral interventions for treating childhood nighttime fears. The purpose of the present study is to determine whether behavior changes could be initiated and maintained with home monitoring and reinforcement alone. Sixteen children, ages 6 to 11, with severe, disruptive…

  10. ERPs Associated with Monitoring and Evaluation of Monetary Reward and Punishment in Children with ADHD

    ERIC Educational Resources Information Center

    van Meel, Catharina S.; Heslenfeld, Dirk J.; Oosterlaan, Jaap; Luman, Marjolein; Sergeant, Joseph A.

    2011-01-01

    Background: Several models of attention-deficit hyperactivity disorder (ADHD) propose abnormalities in the response to behavioural contingencies. Using event-related potentials (ERPs), the present study investigated the monitoring and subsequent evaluation of performance feedback resulting in either reward or punishment in children with ADHD (N =…

  11. The role of continuous glucose monitoring in the care of children with type 1 diabetes

    PubMed Central

    2013-01-01

    Continuous glucose monitoring (CGM), while a relatively new technology, has the potential to transform care for children with type 1 diabetes. Some, but not all studies, have shown that CGM can significantly improve hemoglobin A1c levels and reduce time spent in the hypoglycemic range in children, particularly when used as part of sensor-augmented pump (SAP) therapy. Despite the publication of recent clinical practice guidelines suggesting CGM be offered to all children 8 years of age or older who are likely to benefit, and studies showing that younger children can also benefit, this technology is not yet commonly used by children with type 1 diabetes. Effects of CGM are enhanced when used on a near-daily basis (a use-dependent effect) and with insulin pump therapy. Therefore, coordinated strategies are needed to help children and their families initiate and continue to use this resource for diabetes care. This review introduces CGM to pediatric endocrinologists who are not yet familiar with the finer details of this technology, summarizes current data showing the benefits and limitations of CGM use in children, reviews specific case examples demonstrating when CGM can be helpful, and shows the value of both retrospective and real-time CGM. It is hoped that this information leads to discussion of this technology in pediatric endocrinology clinics as an important next step in improving the care of children with type 1 diabetes. PMID:23531400

  12. The role of continuous glucose monitoring in the care of children with type 1 diabetes.

    PubMed

    Larson, Noelle S; Pinsker, Jordan E

    2013-01-01

    Continuous glucose monitoring (CGM), while a relatively new technology, has the potential to transform care for children with type 1 diabetes. Some, but not all studies, have shown that CGM can significantly improve hemoglobin A1c levels and reduce time spent in the hypoglycemic range in children, particularly when used as part of sensor-augmented pump (SAP) therapy. Despite the publication of recent clinical practice guidelines suggesting CGM be offered to all children 8 years of age or older who are likely to benefit, and studies showing that younger children can also benefit, this technology is not yet commonly used by children with type 1 diabetes. Effects of CGM are enhanced when used on a near-daily basis (a use-dependent effect) and with insulin pump therapy. Therefore, coordinated strategies are needed to help children and their families initiate and continue to use this resource for diabetes care. This review introduces CGM to pediatric endocrinologists who are not yet familiar with the finer details of this technology, summarizes current data showing the benefits and limitations of CGM use in children, reviews specific case examples demonstrating when CGM can be helpful, and shows the value of both retrospective and real-time CGM. It is hoped that this information leads to discussion of this technology in pediatric endocrinology clinics as an important next step in improving the care of children with type 1 diabetes. PMID:23531400

  13. [Determining asthma treatment in children by monitoring fractional exhaled nitric oxide, sputum eosinophils and leukotriene B₄].

    PubMed

    Vizmanos-Lamotte, G; Cruz, M J; Gómez-Ollés, S; Muñoz, X; de Mir Messa, I; Moreno-Galdó, A

    2015-01-01

    Sputum eosinophils and exhaled fractional nitric oxide (FENO) are markers of airway inflammation in asthma. Cytokines, cysteinyl-leukotrienes and leukotriene B4 (LTB4) are responsible for this inflammation. The aim of this study is to determine the usefulness of these markers in monitoring asthma treatment in children. FENO, sputum eosinophils, and LTB4 in induced sputum were performed in 10 children (9-15 years old). These determinations were repeated four months later, after the beginning or an increase in the treatment. FENO values tended to decrease (P=.15), pulmonary function tended to improve (P=.10), and sputum eosinophils decreased (P=.003) compared to the first determination. There were no differences in LTB4 concentrations (P=.88). Sputum eosinophils seem to be more precise than FENO in the monitoring of inflammation in asthmatic children. PMID:24857428

  14. Realtime adherence monitoring of antiretroviral therapy among HIV-infected adults and children in rural Uganda.

    PubMed

    Haberer, Jessica E; Kiwanuka, Julius; Nansera, Denis; Muzoora, Conrad; Hunt, Peter W; So, Jacquelyn; O'Donnell, Michael; Siedner, Mark; Martin, Jeffrey N; Bangsberg, David R

    2013-08-24

    A real-time wireless electronic adherence monitor (EAM) and weekly self-report of missed doses via interactive voice response (IVR) and short message service (SMS) queries were used to measure antiretroviral therapy adherence in 49 adults and 46 children in rural Uganda. Median adherence was 89.5% among adults and 92.8% among children by EAM, and 99-100% for both adults and children by IVR/SMS self-report. Loss of viral suppression was significantly associated with adherence by EAM (odds ratio 0.58 for each 10% increase), but not IVR/SMS. Wireless EAM creates an exciting opportunity to monitor and potentially intervene with adherence challenges as they are happening. PMID:23751260

  15. Our Immune System

    MedlinePlus

    Our Immune System A story for children with primary immunodeficiency diseases Written by Sara LeBien IMMUNE DEFICIENCY FOUNDATION A note ... who are immune deficient to better understand their immune system. What is a “ B-cell, ” a “ T-cell, ” ...

  16. Immunization for Women

    MedlinePlus

    ... nfid.org/#sthash.eZ72dCSP.dpuf Diseases & Vaccines Overview Immunization Schedules Talk to you doctor about your immunization ... years Immunization Schedule for Children, 7-18 years Immunization News July 8, 2016 HPV-related cancers on ...

  17. Naturally Acquired and Conjugate Vaccine-Induced Antibody to Haemophilus influenzae Type b (Hib) Polysaccharide in Malian Children: Serological Assessment of the Hib Immunization Program in Mali

    PubMed Central

    Hutter, Julia; Pasetti, Marcela F.; Sanogo, Doh; Tapia, Milagritos D.; Sow, Samba O.; Levine, Myron M.

    2012-01-01

    Haemophilus influenzae type b (Hib) conjugate vaccine for infants (6, 10, and 14 weeks of age) was introduced into the Malian Expanded Program on Immunization in July 2005, to diminish invasive Hib disease in young children. Antibodies to Hib capsular polysaccharide (PRP) were measured in infants and toddlers from an area already served by the Hib immunization program (Bamako) and in unimmunized children of the same age in a district (Kangaba) where Hib immunization had not yet begun. Among vaccinated Bamako children 6–23 months of age, 77–93% exhibited PRP titers ≥ 1.0 μg/mL, indicating long-term protection, versus only 10–23% of Kangaba children of that age. High PRP antibody titers in immunized children persisted through 2 years of age. Moreover, ∼50% of Bamako children exhibited anti-PRP titers ≥ 5.0 μg/mL; a level that impedes Hib upper respiratory carriage, and may thereby diminish the Hib transmission to the unimmunized susceptible population (i.e., providing indirect protection). PMID:22665612

  18. Modulating the natural history of type 1 diabetes in children at high genetic risk by mucosal insulin immunization.

    PubMed

    Achenbach, Peter; Barker, Jennifer; Bonifacio, Ezio

    2008-04-01

    Mucosal administration of insulin represents an attractive antigen-specific therapeutic approach to preventing type 1 diabetes. It can prevent autoimmune diabetes in animal models, but although it has been shown to be safe, it has not yet been proven effective in human studies. Efficacy may depend on the dose and route at which insulin is administered, the stage in type 1 diabetes pathogenesis at which treatment is initiated, and the study cohort that is treated. We have proposed Pre-POINT (Primary Oral/intranasal INsulin Trial), a dose-finding safety and immune efficacy pilot study for primary mucosal insulin therapy in islet autoantibody-negative children at high genetic risk for type 1 diabetes who naturally first develop autoimmunity to insulin. Pre-POINT aims to identify an optimal insulin dose and route of application (orally or intranasally) that is well tolerated and can induce an immune response to insulin for additional use in a phase II/III primary prevention trial in children at risk. PMID:18445349

  19. Routine surveillance of adverse events following immunization as an important tool to monitor vaccine safety.

    PubMed

    Alicino, Cristiano; Merlano, Caterina; Zappettini, Simona; Schiaffino, Sergio; Della Luna, Giovanni; Accardo, Cristina; Gasparini, Roberto; Durando, Paolo; Icardi, Giancarlo

    2015-01-01

    Post licensure surveillance of adverse events following immunization (AEFI) is a fundamental activity to improve safety and maintain public confidence in vaccines.   Since 2011, the Liguria Region has been involved in the inter-regional project of post-marketing surveillance of AEFI, coordinated by the Italian Medicine Agency and the Veneto region. The main objectives of the project are: (1) to coordinate the surveillance activities in the 8 Italian Regions included in the project; (2) to encourage the signal of AEFI by healthcare workers and patients; (3) to organize education activities addressed to health care workers, and, finally; (4) to establish vaccination counseling services in each Region. In particular, the Ligurian multidisciplinary team, composed by physicians expert in the field of vaccination and pharmacists, is involved in the causality assessment between vaccines and all adverse events signaled within the Liguria Region and in the analysis of all adverse events signaled in Italy as possibly related to influenza vaccines. During 2013, the team has organized 4 courses, addressed to healthcare personnel of vaccination outpatient clinics, focused on European and Italian legislation on pharmaco-vigilance and vaccine-vigilance and aimed at promoting signal of AEFI. Since October 2013, the Liguria Region has been participating to the inter-regional project of active surveillance of adverse events aimed at promoting the signal of AEFI by parents of vaccinated infants. After two years of implementation of the project both the number of reported AEFI and the reporting rate per 100 000 administered doses of vaccine increased. The activities need to be consolidated in the next years in order to guarantee high standard of vaccine safety, maintain the confidence in current immunization programs and reach optimal vaccination coverage rate. PMID:25483520

  20. Incidence of seizures on continuous EEG monitoring following traumatic brain injury in children.

    PubMed

    O'Neill, Brent R; Handler, Michael H; Tong, Suhong; Chapman, Kevin E

    2015-08-01

    OBJECT Seizures may cause diagnostic confusion and be a source of metabolic stress after traumatic brain injury (TBI) in children. The incidence of electroencephalography (EEG)-confirmed seizures and of subclinical seizures in the pediatric population with TBI is not well known. METHODS A routine protocol for continuous EEG (cEEG) monitoring was initiated for all patients with moderate or severe TBI at a Level 1 pediatric trauma center. Over a 3.5-year period, all patients with TBI who underwent cEEG monitoring, both according to protocol and those with mild head injuries who underwent cEEG monitoring at the discretion of the treating team, were identified prospectively. Clinical data were collected and analyzed. RESULTS Over the study period, 594 children were admitted with TBI, and 144 of these children underwent cEEG monitoring. One hundred two (71%) of these 144 children had moderate or severe TBI. Abusive head trauma (AHT) was the most common mechanism of injury (65 patients, 45%) in children with cEEG monitoring. Seizures were identified on cEEG in 43 patients (30%). Forty (93%) of these 43 patients had subclinical seizures, including 17 (40%) with only subclinical seizures and 23 (53%) with both clinical and subclinical seizures. Fifty-three percent of patients with seizures experienced status epilepticus. Age less than 2.4 years and AHT mechanism were strongly correlated with presence of seizures (odds ratios 8.7 and 6.0, respectively). Those patients with only subclinical seizures had the same risk factors as the other groups. The presence of seizures did not correlate with discharge disposition but was correlated with longer hospital stay and intensive care unit stay. CONCLUSIONS Continuous EEG monitoring identifies a significant number of subclinical seizures acutely after TBI. Children younger than 2.4 years of age and victims of AHT are particularly vulnerable to subclinical seizures, and seizures in general. Continuous EEG monitoring allows for

  1. Salivary cortisol monitoring: determination of reference values in healthy children and application in asthmatic children.

    PubMed

    Nagakura, Toshikazu; Tanaka, Toshiaki; Arita, Masahiko; Nishikawa, Kiyoshi; Shigeta, Makoto; Wada, Noriyuki; Matsumoto, Tsutomu; Hiraba, Kazumi; Fukuda, Norimasa

    2012-01-01

    Venipuncture testing of adrenocortical function in asthmatic infants and young children receiving inhaled corticosteroids can raise cortisol levels and mask physiological responses. This study aimed to establish reference ranges for salivary cortisol levels and evaluate the safety and effects of jet-nebulized budesonide inhalation suspension (BIS) on salivary cortisol levels and patient outcomes in infants and young children with mild or persistent asthma. Reference salivary cortisol levels were determined in healthy children aged 6 months to 4 years old. A 12-week multicenter, randomized, parallel-group, open-label study was performed involving 53 age-matched asthmatic children who received either 0.5 mg/day of BIS or 40-60 mg/day of cromolyn sodium inhalation suspension (CIS) via compressor nebulizer. The effective measuring range of salivary cortisol concentration in asthmatic children was 0.12-3.00 micrograms/dL. The upper and lower limits of the reference range were 0.827 and 0.076 micrograms/dL, respectively. No significant difference was seen from baseline through week 12 in the CIS and BIS groups. BIS was safe in these patients, with no inhibitory effects on adrenocortical function. Salivary cortisol measurement offers a useful and accurate tool for testing adrenocortical function in infants and young children. Longer-term studies that incorporate testing of the hypothalamic-pituitary-adrenal axis are warranted to confirm our findings. PMID:22856637

  2. Immune Responses to "Helicobacter pylori" Infection in Children with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Douraghi, Masoumeh; Goudarzi, Hossein; Rostami, Mahmoud Nateghi; Nikmanesh, Bahram

    2012-01-01

    Infection with "Helicobacter pylori" was assessed through serum "H. pylori" IgG antibody in children with intellectual disabilities (ID). The sero-status of cytotoxin-associated gene A (CagA) was determined as a risk determinant for severe "H. pylori"-associated diseases. In total, 210 children with ID were included who were permanent resident of…

  3. Telephone advice nursing: parents' experiences of monitoring calls in children with gastroenteritis.

    PubMed

    Eriksson, Elisabeth Kvilén; Sandelius, Susanna; Wahlberg, Anna Carin

    2015-06-01

    A common reason for calling a telephone advice nurse is gastroenteritis symptoms in children. A monitoring call is a follow-up call from the telephone nurse to the care seeker in order to follow up on given advice and make a new assessment. The aim of the study was to describe the parents' experiences of monitoring calls in telephone advice nursing in children with gastroenteritis. A qualitative interview method was chosen and data were analysed inductively with a qualitative latent content analysis. Ten parents, nine mothers and one father were interviewed. Four main categories and 13 subcategories were identified and described as useful, and the main categories were convenience - parents found it convenient to get access to self-care advice at home, confirmation - the interaction between the telephone nurse and the parent seemed to become deeper and closer as a result of the monitoring call, support - in a vulnerable situation receiving further information and an opportunity to let the telephone nurse monitor the sick child and guidance - to be guided through the most acute phase in the child's gastroenteritis symptoms. Monitoring calls seemed to be experienced as a security enhancing, positive opportunity and a robust complement to seeking care at a healthcare facility. The results of the study indicate how inhabitants can receive expert advice, support and guidance for care and provide a useful basis for Swedish Healthcare Direct (SHD) to develop the modalities for monitoring calls. PMID:25236581

  4. A Feasibility Study of Wearable Activity Monitors for Pre-Adolescent School-Age Children

    PubMed Central

    Van Loan, Marta; German, J. Bruce

    2014-01-01

    Introduction Understanding physical activity is key in the fight against childhood obesity. The objective of this study was to examine the feasibility of using certain wearable devices to measure physical activity among children. Methods A qualitative study was conducted with 25 children aged 7 to 10 years to assess acceptability and compliance of wearable activity devices in this age group. During March through August 2012, children participated in a 4-week study of 3 accelerometer models and a heart rate monitor. Children were asked to use a different device each week for 7 consecutive days. Children and their parents completed structured interviews after using each device; they also completed a final exit interview. Results The wrist-worn Polar Active was the device most preferred by children and was associated with the highest level of compliance. Devices that are comfortable to wear, fit properly, have engaging features, and are waterproof increase feasibility and are associated with higher levels of compliance. Conclusion The wrist-worn device was the most feasible for measuring physical activity among children aged 7 to 10 years. These findings will inform researchers in selecting tools for measuring children’s physical activity. PMID:24854236

  5. Accuracy of the SpaceLabs 90207 ambulatory blood pressure monitor in children and adolescents.

    PubMed

    Belsha; Wells; Bowe Rice H; Neaville; Berry

    1996-04-01

    OBJECTIVE: To determine the accuracy of the SpaceLabs 90207 ambulatory blood pressure monitor for measurement of systolic and Korotkoff phases IV and V diastolic blood pressures in children aged 6-18 years. DESIGN: Monitor evaluation was performed using the 1990 British Hypertension Society (BHS) protocol, adapted for use in children. METHODS: Three SpaceLabs 90207 monitors were evaluated according to the five phases of the 1990 BHS protocol: observer training and assessment; before-use interdevice variability assessment; in-use (field) assessment; after-use interdevice variability assessment; and device validation. Outcome was classified according to the criteria from the BHS (1990) and Association for the Advancement of Medical Instrumentation (AAMI) protocols. RESULTS: During in-use assessment, the monitor failed to achieve the required 70% valid readings on four of 25 recording days. On three of four failed days, kinked tubing errors were noted, possibly caused by excess tubing length. After adjustment of tubing length to body size, criteria were satisfied on 24 additional recording days. During validation, the monitor achieved BHS grade C for systolic blood pressure and satisfied AAMI criteria with a mean difference of 5.0+/- 6.4 mmHg. The monitor received grade D for Korotkoff phase IV and V diastolic blood pressure and failed to satisfy AAMI criteria with a mean difference of -7.2+/- 11.0 mmHg for Korotkoff phase IV and 0.8+/-11.1 mmHg for Korotkoff phase V. CONCLUSION: The SpaceLabs 90207 monitor satisfied the minimum accuracy criteria for measurement of systolic, but not diastolic, blood pressure in children aged 6-18 years. PMID:10226214

  6. [Immunization monitoring of students starting school: a regional contribution from the Bavaria district].

    PubMed

    Stich, H L; Beblo, F

    2000-06-01

    The aim of these sectional studies was to find out current mass immunisation rates of school beginners. The study was carried out in the administrative district of Dingolfing-Landau in 1999, also to examine to what extent the recommendations to the STIKO (Established Immunisation Committee at the Robert Koch-Institute) for the corresponding age-group had been complied with. To this end, the vaccination documents submitted at the medical examination were inspected, the given data recorded in a standardised way and subsequently rendered anonymous. According to the available results the mass immunisation rates for diptheria, tetanus and polio met the infection epidemiology requirements by over 90%. The HiB, MMR and whooping cough vaccinations were in on the average 80% for mass immunisation, which no longer meets the epidemiological requirements. BCG inoculation was only given to every tenth child in the relevant age group. A positive aspect was the comparatively high immunisation rate of almost 50% on hepatitis B immunisation. Only one child in twenty in the relevant age group had the full immunisation protection recommended by STIKO. Due to the great acceptance and willingness to co-operate on the part of the parents/legal guardians the review of the immunisation status through the Childrens and Young People's Public Health Authority (KJGD) made it possible to establish the current mass immunisation rate for children of one birth year. In this way, it will be possible by means of relevant immunisation recommendations and immunisation strategies to close the immunisation gaps and raise the mass immunisation rates. PMID:10920568

  7. The use of growth charts for assessing and monitoring growth in Canadian infants and children.

    PubMed

    2004-01-01

    Recent changes to commonly used growth charts, including the addition of charts for body mass index, have raised questions on which growth charts to use for Canadian children and how to apply body mass index in the paediatric population. This statement, developed collaboratively by key organizations in paediatric health care, is intended for use as a practice guideline for medical practitioners and clinical and community health (public health, home health) professionals. The desired outcome is the provision of recommendations that will promote consistent practices in monitoring growth and assessing atypical patterns of linear growth and weight gain in infants, children and adolescents. PMID:15005863

  8. A Murine Model in Which Protection Correlates with Pertussis Vaccine Efficacy in Children Reveals Complementary Roles for Humoral and Cell-Mediated Immunity in Protection against Bordetella pertussis

    PubMed Central

    Mills, Kingston H. G.; Ryan, Mark; Ryan, Elizabeth; Mahon, Bernard P.

    1998-01-01

    The results of phase 3 efficacy trials have shown that acellular and whole-cell pertussis vaccines can confer protection against whooping cough. However, despite the advances in vaccine development, clinical trials have not provided significant new information on the mechanism of protective immunity against Bordetella pertussis. Classical approaches based on measurement of antibody responses to individual antigens failed to define an immunological correlate of protection. A reliable animal model, predictive of acellular and whole-cell pertussis vaccine potency in children, would facilitate an elucidation of the mechanism of immune protection against B. pertussis and would assist in the regulatory control and future development of pertussis vaccines. In this study, we have shown that the rate of B. pertussis clearance following respiratory challenge of immunized mice correlated with vaccine efficacy in children. Using this model together with mice with targeted disruptions of the gamma interferon (IFN-γ) receptor, interleukin-4 or immunoglobulin heavy-chain genes, we have demonstrated an absolute requirement for B cells or their products in bacterial clearance and a role for IFN-γ in immunity generated by previous infection or immunization with the whole-cell pertussis vaccine. The results of passive immunization experiments suggested that protection early after immunization with acellular pertussis vaccines is mediated by antibody against multiple protective antigens. In contrast, more complete protection conferred by previous infection or immunization with whole-cell pertussis vaccines reflected the induction of Th1 cells. Our findings suggest that the mechanism of immunity against B. pertussis involves humoral and cellular immune responses which are not directed against a single protective antigen and thus provide an explanation for previous failures to define an immunological correlate of protection. PMID:9453614

  9. An m-Health monitoring system for children with suspected arrhythmias.

    PubMed

    Kyriacou, E; Pattichis, C; Pattichis, M; Jossif, A; Paraskeva, L; Konstantinides, A; Vogiatzis, D

    2007-01-01

    Advances in wireless communications and networking technologies as well as computer and medical technologies, enable the development of small size, power efficient and more reliable medical multi-parameter recording systems, which can be used for continuous monitoring of patients. Through this paper we present the basic architecture and initial development steps of an m-Health monitoring system that will be used in order to monitor children with suspected cardiac arrhythmias. The proposed system will be based on sensor networks, in order to monitor a subject while being in a predefined area like his/her house; while a module based on PDAs and wearable ECG recorders will be used in order to extent the coverage outside the patient's house. The system will be based on a variable sampling rate to conserve power for the possible arrhythmia episode. The system design has been completed, the hardware specifications have been decided and currently the system is going through the development phase. PMID:18002326

  10. Tumor necrosis factor-α -308G/A gene polymorphism in Egyptian children with immune thrombocytopenic purpura.

    PubMed

    El Sissy, Maha H; El Sissy, A H; Elanwary, Sherif

    2014-07-01

    Immune thrombocytopenic purpura (ITP) is an autoimmune disease characterized by increased platelet destruction. Although the cause of ITP remains unclear, it is accepted that both environmental and genetic factors play an important role in the development of the disease. Children with ITP have a T-helper 1-type cytokine pattern with elevated levels of tumor necrosis factor-alpha (TNF-α) as in most autoimmune diseases. Researchers have shown that polymorphism in the TNF-α gene at position -308 affects gene transcriptions with increased TNF-α production. The current case-control study aimed at detecting the frequency of TNF-α -308G/A gene polymorphism as genetic markers in Egyptian children with ITP, and to clear out their possible role in choosing the treatment protocols of therapy, using PCR restriction fragment length polymorphism assay. Ninety-two ITP patients and 100 age and sex-matched healthy controls were recruited in the study. The results obtained revealed that the frequency of TNF-α -308A/A homotype in ITP patients was significantly higher than that of the controls, and conferred almost six-fold increased risk of ITP acquisition. The polymorphic A allele frequency was significantly higher in ITP patients than in the controls, conferring almost two-fold increased ITP risk. In conclusion, our study suggests the possibility that TNF-α -308 gene polymorphism may contribute to the susceptibility of childhood ITP in Egyptian children. PMID:24509339

  11. Incomplete Immune Reconstitution Despite Virologic Suppression in HIV-1 Infected Children and Adolescents

    PubMed Central

    Krogstad, Paul; Patel, Kunjal; Karalius, Brad; Hazra, Rohan; Abzug, Mark J.; Oleske, James; Seage, George R.; Williams, Paige; Borkowsky, William; Wiznia, Andrew; Pinto, Jorge; Van Dyke, Russell B.

    2015-01-01

    Objectives Some perinatally infected children do not regain normal CD4 T cell counts despite suppression of HIV-1 plasma viremia by antiretroviral therapy (ART), The frequency, severity, and significance of these discordant treatment responses remain unclear. Design We examined the persistence of CD4 lymphocytopenia despite virologic suppression (VS) in 933 children (>5 years of age) in the US, Latin America, and the Caribbean. Methods CD4 T-cell trajectories were examined and Kaplan Meier methods used to estimate median time to CD4 T cell count ≥ 500 cells/μL. Results After 1 year of VS, most (99%) children achieved a CD4 T cell count of ≥200 cells/μl, but CD4 T cell counts remained below 500 cells/μL after 1 and 2 years of VS in 14% and 8%. Median times to first CD4 T cell count ≥ 500 cells/μl were 1.29, 0.78, and 0.46 years for children with <200, 200–349, and 350–499 cells/μL at the start of VS. New AIDS-defining events occurred in 9 children, including 4 in the first 6 months of VS. Other infectious and HIV-related diagnoses occurred more frequently and across a wide range of CD4 counts. Conclusions ART improved CD4 counts in most children, but the time to CD4 count of ≥ 500 cells was highly dependent upon baseline immunological status. Some children did not reach a CD4 T cell count of 500 cells/μl despite 2 years of VS. AIDS defining events occurred in 1% of the population, including children in whom VS and improved CD4 T cell counts were achieved. PMID:25849832

  12. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV)

    PubMed Central

    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J.; Hall, Malcolm

    2015-01-01

    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. “In-tank” anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed. PMID:26397117

  13. Individual Monitoring of Immune Response in Atlantic Salmon Salmo salar following Experimental Infection with Infectious Salmon Anaemia Virus (ISAV).

    PubMed

    Collet, Bertrand; Urquhart, Katy; Monte, Milena; Collins, Catherine; Garcia Perez, Sandro; Secombes, Chris J; Hall, Malcolm

    2015-01-01

    Monitoring the immune response in fish over the progression of a disease is traditionally carried out by experimental infection whereby animals are killed at regular intervals and samples taken. We describe here a novel approach to infectiology for salmonid fish where blood samples are collected repeatedly in a small group of PIT-tagged animals. This approach contributes to the reduction of animals used in research and to improved data quality. Two groups of 12 PIT-tagged Atlantic salmon (Salmo salar) were i.p infected with Infectious Salmon Anaemia Virus (ISAV) or culture medium and placed in 1 m3 tanks. Blood samples were collected at 0, 4, 8, 12, 16, 21 and 25 days post infection. The viral load, immune and stress response were determined in individual fish by real-time quantitative PCR (QPCR) on the blood cells, as well as the haematocrit used as an indicator of haemolysis, a clinical consequence of ISAV infection. "In-tank" anaesthesia was used in order to reduce the stress related to chase and netting prior to sampling. The data were analysed using a statistical approach which is novel with respect to its use in fish immunology. The repeated blood collection procedure did not induce stress response as measured by HSP70 and HSP90 gene expression in the un-infected animals. A strong increase in viraemia as well as a significant induction of Mx and γIP gene expression were observed in the infected group. Interleukin 10 was found induced at the later stage of the infection whereas no induction of CD8 or γ IFN could be detected. These results and the advantages of this approach are discussed. PMID:26397117

  14. Estimating the Number of Measles-Susceptible Children and Adolescents in the United States Using Data From the National Immunization Survey-Teen (NIS-Teen).

    PubMed

    Bednarczyk, Robert A; Orenstein, Walter A; Omer, Saad B

    2016-07-15

    Despite high measles vaccination rates in the United States, imported measles cases have led to outbreaks in the United States. These outbreaks have not led to sustained measles transmission; however, with each birth cohort of children not fully vaccinated against measles, measles-susceptible individuals accumulate in the population. The total number of measles-susceptible children and adolescents in the United States is unknown. We used age-specific measles vaccination data from the National Immunization Survey-Teen (2008-2013) to estimate the number of measles-susceptible children aged 17 years or younger, accounting for vaccine effectiveness, infant protection from maternal antibodies, and loss of immunity following childhood cancer treatment. Approximately 12.5% of US children and adolescents are susceptible to measles, with the highest levels of susceptibility being observed in children aged 3 years or younger (24.7% are susceptible to measles). In sensitivity analyses, we found that a sustained decrease in measles vaccination coverage from 91.9% (2013 level) to 90.0% (2009 level) would add nearly 1.2 million susceptible children and adolescents (thus making 14.2% of those aged 17 years or younger susceptible to measles). This reemphasizes the need for high measles vaccination coverage to support population-level immunity and prevent reestablishment of indigenous measles transmission in the United States. PMID:27338281

  15. Behavioral measures and EEG monitoring using the Brain Symmetry Index during the Wada test in children.

    PubMed

    Peters, Jurriaan M; Tomas-Fernandez, Meritxell; van Putten, Michel J A M; Loddenkemper, Tobias

    2012-03-01

    EEG monitoring is used routinely during the Wada test in children. We quantified EEG asymmetry using the Brain Symmetry Index (BSI) to reduce subjectivity of EEG interpretation. Clinical and procedural variables were obtained and EEG data were retrieved from 46 patients with a total of 89 injections. The BSI, the absolute value of the relative difference of the average spectral density of the right and left hemisphere, was calculated over time for all EEGs. Lateralized slowing was correctly identified in all procedures. Asymmetry was minimal at baseline (BSI 0.16) and increased with injection of amobarbital (BSI 0.49). Various patterns of the BSI were seen in distinct clinical and procedural scenarios. In this retrospective analysis, the BSI could not predict an unsuccessful Wada procedure. Our results suggest application of the BSI during the Wada test in children is feasible. Real-time calculation of the BSI during EEG monitoring in the angiography suite is warranted for further validation. PMID:22341967

  16. Parental Monitoring of Children’s Media Consumption: The Long-term Influences on Body Mass Index in Children

    PubMed Central

    Tiberio, Stacey S.; Kerr, David C. R.; Capaldi, Deborah M.; Pears, Katherine C.; Kim, Hyoun K.; Nowicka, Paulina

    2014-01-01

    Importance Although children's media consumption has been one of the most robust risk factors for childhood obesity, effects of specific parenting influences, such as parental media monitoring, have not been effectively investigated. Objectives This study examined the potential influences of maternal and paternal monitoring of child media exposure and children's general activities on children's BMI in middle childhood. Design A longitudinal study, taken from a subsample of the Three Generational Study, with assessments at children's ages of 5, 7, and/or 9 years collected from 1998-2012. Setting The Three Generational Study, a predominantly Caucasian, Pacific-Northwest U.S. community sample (overall participation rate 90%). Participants Analyses included 112 mothers, 103 fathers and their 213 children (55% girls) at ages 5, 7, and/or 9 years. Participation rates ranged from 67% to 72% of all eligible Three Generational Study children across the three assessments. Main Exposures Parents reported on their general monitoring of their children (whereabouts and activities), specific monitoring of child media exposure, children's participation in sports and recreational activities, children's media time (hours/week), annual income, and education level. Parental BMI was recorded. Main Outcome Measure Predictions to level and change in child BMI z scores were tested. Results Linear mixed-effects modeling indicated that more maternal, but not paternal, monitoring of child media exposure predicted lower child BMI z scores at age 7 years (95% CI, −.39 – −.07) and less steeply increasing child BMI z scores from ages 5-9 years (95% CI, −.11 – −.01). These effects held when controlling for more general parental monitoring, and parent BMI, income and education. Results supported that the significant negative effect of maternal media monitoring on children's BMI z scores at age 7 years was marginally accounted for by the effect of child media time. The maternal media

  17. Viruses, anti-viral therapy, and viral vaccines in children with immune thrombocytopenia.

    PubMed

    Elalfy, Mohsen S; Nugent, Diane

    2016-04-01

    Immune thrombocytopenia (ITP) might be preceded by silent or overt viral infections. Similarly, anti-viral drugs and viral vaccines could also trigger ITP and might play a central role in its pathogenesis. The seasonal nature of childhood ITP suggests that viral infections might initiate immune responses that increase the predisposition and occurrence of ITP. Active cytomegalovirus or Epstein-Barr virus should be considered in differential diagnosis when thrombocytopenia is associated with lymphadenopathy, especially with splenomegaly. This review will focus on the specific association of ITP in association with viral disease and vaccinations, and will discuss the effectiveness of current therapies in light of our current understanding of viral-associated ITP. PMID:27312173

  18. Reduced error monitoring in children with autism spectrum disorder: an ERP study.

    PubMed

    Vlamings, Petra H J M; Jonkman, Lisa M; Hoeksma, Marco R; van Engeland, Herman; Kemner, Chantal

    2008-07-01

    This study investigated self-monitoring in children with autism spectrum disorder (ASD) with event-related potentials looking at both the error-related negativity (ERN) and error-related positivity (Pe). The ERN is related to early error/conflict detection, and the Pe has been associated with conscious error evaluation or attention allocation. In addition, post-error slowing in reaction times (RTs) was measured. Children with ASD and age- and IQ- matched controls were administered an easy and a hard version of an auditory decision task. Results showed that the ERN was smaller in children with ASD but localized in the anterior cingulate cortex (ACC) in both groups. In addition we found a negativity on correct trials (CRN) that did not differ between the groups. Furthermore, a reduced Pe and a lack of post-error slowing in RTs were found in children with ASD. The reduced ERN in children with ASD, in the presence of an intact CRN, might suggest a specific insensitivity to detect situations in which the chance of making errors is enhanced. This might in turn lead to reduced error awareness/attention allocation to the erroneous event (reduced Pe) and eventually in a failure in change of strategy to deal with a situation, as becomes evident from the lack of post-error slowing in the ASD group. This relates well to the perseverative behaviour that is seen in children with ASD. We discuss these results in terms of a general deficit in self-monitoring, underlying social disturbance in ASD and the involvement of the ACC. PMID:18702711

  19. Effect of biosynthetic methionyl growth hormone (GH) therapy on the immune function in GH-deficient children.

    PubMed

    Bozzola, M; Cisternino, M; Valtorta, A; Moretta, A; Biscaldi, I; Maghnie, M; De Amici, M; Schimpff, R M

    1989-01-01

    The ability of growth hormone (GH) to influence certain immune functions has been studied in 21 GH-deficient children aged 1.8-17.7 years, before and during therapy with biosynthetic methionyl-hGH (12 IU/m2) injected intramuscularly 3 times weekly. Blood was collected prior to GH treatment, then after 1 week, again at 3-6 months, and finally at 9-12 months of therapy. We studied (1) the distribution of the T lymphocyte subpopulations: T total (CD3), helper/inducer (CD4) and suppressor/cytotoxic (CD8) cells, using monoclonal antibodies (OKT3, OKT4, OKT8) and (2) the in vitro IgM production stimulated by pokeweed mitogen. Pretreatment CD3, CD4, CD8 values were within the normal range. They did not change after 1 week of GH therapy. Following 3-6 months of GH treatment, CD3 significantly increased (p less than 0.001), CD4 decreased (p less than 0.01), CD8 increased (p less than 0.001) and the CD4/CD8 ratio decreased (p less than 0.001). At 9-12 months of therapy, the percentages of the different groups of T cells was not significantly different from the pretreatment values. In vitro IgM production before and following 3-6 months of GH treatment was significantly lower (p less than 0.005) than that of 15 age-matched controls. At 9-12 months, GH therapy restored the in vitro IgM production. No variations in the levels of serum immunoglobulins were observed throughout the treatment period. These data suggest that GH plays a role in the development of the immune function in children. PMID:2571554

  20. Immunity Against Tetanus Infection, Risk Factors for Non-Protection, and Validation of a Rapid Immunotest Kit among Hospitalized Children in Nigeria

    PubMed Central

    Orimadegun, Adebola Emmanuel; Orimadegun, Bose Etaniamhe; Adepoju, Akinlolu Adedayo

    2013-01-01

    Seroepidemiological studies of tetanus in Africans have focused mainly on adults especially pregnant women and data on children are scarcely reported. We investigated the seroprevalence of protective immunity level, determined risk factors for non-protection against tetanus, and evaluated the performance of Tetanos Quick Stick® (TQS) among hospitalized children aged 1–9 years in Nigeria. Blood IgG antibody levels to tetanus was determined using enzyme-linked immunosorbent assay (ELISA) in the laboratory and TQS (an immunochromatographic test) at the bedside for 304 children admitted into emergency unit of a tertiary hospital in Ibadan, Nigeria. Demographic information and vaccination history were also collected. TQS results were compared with anti-tetanus antibody measured by ELISA using seroprotection cut-off of 0.1 IU/ml. Seroprevalence of protective level of immunity against tetanus using ELISA and TQS methods was 44.7 and 45.4% respectively. Protective level of immunity increased as age increases. Of the seven potential factors assessed, male gender and being second or more position among mother’s children were independent predictors of non-protective level of immunity. Absence of history of recent tetanus toxoid injection was significantly associated with non-protective level of immunity in univariate analysis but not logistic regression model. The agreement between the ELISA and the TQS results was good with a k coefficient of 0.931. TQS sensitivity was 95.7%, specificity 97.6%, positive predictive value 98.0%, and negative predictive values 96.0%. This study showed that lack of protective immunity against tetanus is common; few demographic characteristics correctly predict non-protection and IgG antibody levels to tetanus was accurately detected by TQS. PMID:24069018

  1. Immunity Against Tetanus Infection, Risk Factors for Non-Protection, and Validation of a Rapid Immunotest Kit among Hospitalized Children in Nigeria.

    PubMed

    Orimadegun, Adebola Emmanuel; Orimadegun, Bose Etaniamhe; Adepoju, Akinlolu Adedayo

    2013-01-01

    Seroepidemiological studies of tetanus in Africans have focused mainly on adults especially pregnant women and data on children are scarcely reported. We investigated the seroprevalence of protective immunity level, determined risk factors for non-protection against tetanus, and evaluated the performance of Tetanos Quick Stick(®) (TQS) among hospitalized children aged 1-9 years in Nigeria. Blood IgG antibody levels to tetanus was determined using enzyme-linked immunosorbent assay (ELISA) in the laboratory and TQS (an immunochromatographic test) at the bedside for 304 children admitted into emergency unit of a tertiary hospital in Ibadan, Nigeria. Demographic information and vaccination history were also collected. TQS results were compared with anti-tetanus antibody measured by ELISA using seroprotection cut-off of 0.1 IU/ml. Seroprevalence of protective level of immunity against tetanus using ELISA and TQS methods was 44.7 and 45.4% respectively. Protective level of immunity increased as age increases. Of the seven potential factors assessed, male gender and being second or more position among mother's children were independent predictors of non-protective level of immunity. Absence of history of recent tetanus toxoid injection was significantly associated with non-protective level of immunity in univariate analysis but not logistic regression model. The agreement between the ELISA and the TQS results was good with a k coefficient of 0.931. TQS sensitivity was 95.7%, specificity 97.6%, positive predictive value 98.0%, and negative predictive values 96.0%. This study showed that lack of protective immunity against tetanus is common; few demographic characteristics correctly predict non-protection and IgG antibody levels to tetanus was accurately detected by TQS. PMID:24069018

  2. Determinants of default to fully completion of immunization among children aged 12 to 23 months in south Ethiopia: unmatched case-control study

    PubMed Central

    Asfaw, Abiyot Getachew; Koye, Digsu Negese; Demssie, Amsalu Feleke; Zeleke, Ejigu Gebeye; Gelaw, Yalemzewod Assefa

    2016-01-01

    Introduction Immunization is a cost effective interventions of vaccine preventable disease. There is still, 2.5 million children die by vaccine preventable disease every year in developing countries. In Ethiopia, default to fully completion of child immunization is high and determinants of default to completions are not explored well in the study setting. The aim of the study was to identify determinants of default to fully completion of immunization among children between ages 12 to 23 months in Sodo Zurea District, Southern Ethiopia. Methods Community based unmatched case-control study was conducted. Census was done to identify cases and controls before the actual data collection. A total of 344 samples (172 cases and 172 controls) were selected by simple random sampling technique. Cases were children in the age group of 12 to 23 months old who missed at least one dose from the recommended schedule. Bivariable and multivariable binary logistic regression was used to identify the determinant factors. Odds ratio, 95%CI and p - value less than 0.05 was used to measure the presence and strength of the association. Results Mothers of infants who are unable to read and write (AOR=8.9; 95%CI: 2.4, 33.9) and attended primary school (AOR=4.1; 95% CI:1.4-15.8), mothers who had no postnatal care follow up (AOR=0.4; 95%CI: 0.3, 0.7), good maternal knowledge towards immunization (AOR= 0.5; 95% CI: 0.3, 0.8) and maternal favorable perception towards uses of health institution for maternal and child care (AOR= 0.2; 95% CI: 0.1, 0.6) were significant determinant factors to default to fully completion of immunization. Conclusion Working on maternal education, postnatal care follow up, promoting maternal knowledge and perception about child immunization are recommended measures to mitigate defaults to complete immunization. PMID:27222689

  3. Breastfeeding Among U.S. Children Born 2000 - 2009, CDC National Immunization Survey

    MedlinePlus

    ... Any" and "exclusive" breastfeeding rates by socio-demographics Breastfeeding among U.S. Children Born 2002–2013, CDC National ... Were Breastfed, by Birth Year a,b Any Breastfeeding Exclusive Breastfeeding c a Breastfeeding rates through 2008 ...

  4. Excess body mass is associated with T cell differentiation indicative of immune aging in children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity has been associated with accelerated biological ageing and immunosenescence. As the prevalence of childhood obesity is increasing, we wanted to determine if associations between obesity and immunosenescence would manifest in children. We studied 123 Mexican American adolescents aged 10–14 (m...

  5. Effects of ozone on the respiratory health, allergic sensitization, and cellular immune system in children

    SciTech Connect

    Zwick, H.; Popp, W.; Wagner, C.; Reiser, K.; Schmoeger, J.B.; Boeck, A.H.; Herkner, K.; Radunsky, K. )

    1991-11-01

    To investigate the lasting effects of high ozone concentrations under environmental conditions, we examined the respiratory health, pulmonary function, bronchial hyperresponsiveness to methacholine, allergic sensitization, and lymphocyte subpopulations of 10- to 14-yr-old children. A total of 218 children recruited from an area with high ozone concentrations (Group A) were tested against 281 children coming from an area with low ozone concentrations (Group B). As to subjective complaints, categorized as 'usually cough with or without phlegm,' 'breathlessness,' and 'susceptibility to chest colds,' there was no difference between the two groups. The lung function parameters were similar, but in Group A subjects' bronchial hyperresponsiveness occurred more frequently and was found to be more severe than in Group B (29.4 versus 19.9%, p less than 0.02; PD20 2,100 {plus minus} 87 versus 2,350 {plus minus} 58 micrograms, p less than 0.05). In both groups the number of children who had been suffering from allergic diseases and sensitization to aeroallergens, found by means of the skin test, was the same. Comparison of the total IgE levels showed no difference at all between the two groups. As far as the white blood cells are concerned, the total and differential cell count was the same, whereas lymphocyte subpopulations showed readily recognizable changes.

  6. An ERP study of conflict monitoring in 4–8-year old children: Associations with temperament

    PubMed Central

    Buss, Kristin A.; Dennis, Tracy A.; Brooker, Rebecca J.; Sippel, Lauren M.

    2011-01-01

    Although there is great interest in identifying the neural correlates of cognitive processes that create risk for psychopathology, there is a paucity of research in young children. One event-related potential (ERP), the N2, is thought to index conflict monitoring and has been linked cognitive and affective risk factors for anxiety. Most of this research, however, has been conducted with adults, adolescents, and older children, but not with younger children. To address this gap, the current study examined 26 4–8-year-olds, who completed a cued flanker task while EEG was continuously recorded. We assessed whether the N2 was detectable in this group of young children and examined associations between the N2 and factors reflecting affective risk (e.g., reduced executive attention, temperamental effortful control, and temperamental surgency). We documented an N2 effect (greater N2 amplitude to incongruent versus congruent flankers), but only in children older than 6 years of age. Increases in the N2 effect were associated with less efficient executive attention and lower temperamental effortful control. We discuss the implications of these findings and consider how they may inform future studies on biomarkers for cognitive and affective risk factors for anxiety. PMID:21666879

  7. The influence of parent-infant cosleeping, nursing, and childcare on cortisol and SIgA immunity in a sample of British children.

    PubMed

    Waynforth, David

    2007-09-01

    Substantial variation in childcare arrangements exists both within and between populations. Research has suggested negative stress-related outcomes for children who regularly attend daycare facilities. In the present study, 122 cortisol and 94 secretory immunoglobulin A (SIgA) samples from 32 British children aged between 3 and 8 were analyzed using multilevel modeling to assess effects of daycare attendance and other childcare-related variables on children's stress and SIgA immune function. Parents' reports of children's aggression and family discord within 2 hr of saliva collection were associated with elevated cortisol levels in children. With these acute stressors statistically controlled, retrospective data on parent-child cosleeping showed that children who had coslept in their parent(s) room had lower cortisol levels, as did children who had attended less daycare in the first 4 years of life. The parenting-related variables did not predict SIgA immunity. The results are discussed in the context of theories of parenting strategies. PMID:17680611

  8. The use of innate immune responses as biomarkers in a programme of integrated biological effects monitoring on flounder (Platichthys flesus) from the southern North Sea

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Broeg, Katja; Dizer, Halim; von Westernhagen, Hein; Hansen, Peter-Diedrich; Steinhagen, Dieter

    2003-10-01

    Immunological biomarkers that reflect the effects of exposure to environmental contaminants in coastal marine habitats were sought in European flounder (Platichthys flesus) from five locations in the German Bight with different anthropogenic impacts. During a 2-year period of sampling, innate immune responses were monitored from a total of 331 individual flounder of a body length of 18 to 25 cm. From the fish, plasma lysozyme, phagocytosis and respiratory burst activity of head kidney leucocytes were analysed and implemented as part of an integrated biological effects monitoring programme. As the measurements of the parameters applied here varied within wide ranges at some locations, spatial differences could not always be established, but some general trends could be drawn: plasma lysozyme activity was decreased in flounder contaminated with DDT adducts and some PCBs, while cellular functions such as phagocytosis and respiratory burst were stimulated by some chlorinated hydrocarbons. Correlation analysis also revealed connections not only between the parameters applied here and some contaminants but also with some biochemical parameters used as biomarkers in pollution monitoring: in flounder with decreased integrity of hepatocyte lysosomal membranes, immune functions also were impaired, and plasma lysozyme as well as phagocytosis activity of head kidney cells were impaired when the activity of cytochrome P450 1A was induced. The data presented here indicate that innate immune responses may be useful parameters to monitor cellular functions in a battery of biomarkers of different levels of biological organisation.

  9. Performance Monitoring in Medication-Naïve Children with Tourette Syndrome

    PubMed Central

    Eichele, Heike; Eichele, Tom; Bjelland, Ingvar; Høvik, Marie F.; Sørensen, Lin; van Wageningen, Heidi; Worren, Marius Kalsås; Hugdahl, Kenneth; Plessen, Kerstin J.

    2016-01-01

    Background: Tourette syndrome (TS) is a childhood-onset neurodevelopmental disorder and its impact on cognitive development needs further study. Evidence from neuropsychological, neuroimaging and electrophysiological studies suggests that the decline in tic severity and the ability to suppress tics relate to the development of self-regulatory functions in late childhood and adolescence. Hence, tasks measuring performance monitoring might provide insight into the regulation of tics in children with TS. Method: Twenty-five children with TS, including 14 with comorbid Attention-deficit/ hyperactivity disorder (ADHD), 39 children with ADHD and 35 typically developing children aged 8–12 years were tested with a modified Eriksen-Flanker task during a 34-channel electroencephalography (EEG) recording. Task performance, as well as stimulus-locked and response-locked event-related potentials (ERP) were analyzed and compared across groups. Results: Participants did not differ in their behavioral performance. Children with TS showed higher amplitudes of an early P3 component of the stimulus-locked ERPs in ensemble averages and in separate trial outcomes, suggesting heightened orienting and/or attention during stimulus evaluation. In response-locked averages, children with TS had a slightly higher positive complex before the motor response, likely also reflecting a late P3. Groups did not differ in post-response components, particularly in the error-related negativity (ERN) and error-related positivity (Pe). Conclusions: These findings suggest that children with TS may employ additional attentional resources as a compensatory mechanism to maintain equal behavioral performance. PMID:26973443

  10. Ambulatory EEG NeuroMonitor platform for engagement studies of children with development delays

    NASA Astrophysics Data System (ADS)

    Mahajan, Ruhi; Consul-Pacareu, Sergi; Abusaud, Mohammed; Sahadat, Md N.; Morshed, Bashir I.

    2013-05-01

    Engagement monitoring is crucial in many clinical and therapy applications such as early learning preschool classes for children with developmental delays including autism spectrum disorder (ASD), attention-deficit hyperactivity disorder (ADHD), or cerebral palsy; as it is challenging for the instructors to evaluate the individual responses of these children to determine the effectiveness of the teaching strategies due to the diverse and unique need of each child who might have difficulty in verbal or behavioral communication. This paper presents an ambulatory scalp electroencephalogram (EEG) NeuroMonitor platform to study brain engagement activities in natural settings. The developed platform is miniature (size: 2.2" x 0.8" x 0.36", weight: 41.8 gm with 800 mAh Li-ion battery and 3 snap leads) and low-power (active mode: 32 mA low power mode: under 5mA) with 2 channels (Fp1, Fp2) to record prefrontal cortex activities of the subject in natural settings while concealed within a headband. The signals from the electrodes are amplified with a low-power instrumentation amplifier; notch filtered (fc = 60Hz), then band-passed by a 2nd-order Chebyshev-I low-pass filter cascaded with a 2nd-order low-pass (fc = 125Hz). A PSoC ADC (16-bit, 256 sps) samples this filtered signal, and can either transmit it through a Class-2 Bluetooth transceiver to a remote station for real-time analysis or store it in a microSD card for offline processing. This platform is currently being evaluated to capture data in the classroom settings for engagement monitoring of children, aimed to study the effectiveness of various teaching strategies that will allow the development of personalized classroom curriculum for children with developmental delays.

  11. Evaluation of immune responses to an oral typhoid vaccine, Ty21a, in children from 2 to 5 years of age in Bangladesh.

    PubMed

    Bhuiyan, Taufiqur R; Choudhury, Feroza K; Khanam, Farhana; Saha, Amit; Sayeed, Md Abu; Salma, Umme; Lundgren, Anna; Sack, David A; Svennerholm, Ann-Mari; Qadri, Firdausi

    2014-02-19

    Young children are very susceptible to typhoid fever, emphasizing the need for vaccination in under five age groups. The parenteral Vi polysaccharide vaccine is not immunogenic in children under 2 years and the oral Ty21a vaccine (Vivotif) available in capsular formulation is only recommended for those over 5 years. We studied immune responses to a liquid formulation of Ty21a in children 2-5 years of age. Since children in developing countries are in general hypo responsive to oral vaccines, the study was designed to determine if anti-helminthic treatment prior to vaccination, improves responses. In a pilot study in 20 children aged 4-5 years, the immune responses in plasma and in antibody in lymphocyte secretions (ALS) to the enteric coated capsule formulation of Ty21a was found to be comparable to a liquid formulation (P>0.05). Based on this, children (n=252) aged ≥ 2-<3 years and ≥3-<5 years were randomized to receive a liquid formulation of Ty21a with and without previous anti-helminthic treatment. The vaccine was well tolerated with only a few mild adverse events recorded in <1% of the children. De-worming did not improve immune responses and both age groups developed 32-71% IgA, IgG, and IgM responses in plasma and 63-86% IgA responses in ALS and stool specimens to a membrane preparation (MP) of Ty21a. An early MP specific proliferative T cell response was also seen. We recommend that safety and efficacy studies with a liquid formulation of the vaccine are carried out in children under five, including those less than two years of age to determine if Ty21a is protective in these age groups and applicable as a public health tool for controlling typhoid fever in high prevalence areas of typhoid fever including Bangladesh. PMID:24440210

  12. Measles, mumps, and rubella antibody status and response to immunization in children after therapy for acute lymphoblastic leukemia.

    PubMed

    Aytac, Selin; Yalcin, S Songul; Cetin, Mualla; Yetgin, Sevgi; Gumruk, Fatma; Tuncer, Murat; Yurdakok, Kadriye; Gurgey, Aytemiz

    2010-08-01

    Seventy-seven patients with acute lymphoblastic leukemia (ALL) who were in complete remission and whose therapies had been stopped for at least 6 months before enrollment in this study were retrospectively analyzed regarding their antibody status for measles, mumps, and rubella, with the aim to demonstrate the seropositivity rate after treatment in the authors' group. Each patient's serum samples were analyzed by enzyme-linked immunosorbent assay (ELISA) method to determine the antibody titers before and after immunization. Measles serology was available in 77 children; 45 (58%) were seronegative. Initial ages of measle-seronegative patients were statistically lower than those of seropositive cases (median 3.29 versus 4.91 years, respectively). Mumps serology was available in 76 children; 36 (47%) were seronegative. Mumps-seropositive cases tended to have more frequent previous history of infection than seronegative cases (55.0% versus 28.6%, respectively, P = .05). Rubella serology was available in 76 children, and 20 (26.3%) were seronegative. It was determined that initial ages of rubella-seronegative patients were statistically lower than those of seropositive cases (median 3.03 versus 4.32 years, respectively). The authors concluded based on the results of their study that at a median of 3.31 years after completion of chemotherapy for ALL, the majority of cases had antibody levels lower than protective values for measles (58.4%); however, these values were 47.3% for mumps and 26.3% for rubella. Seroconversion rates after measles (55%) and mumps vaccination (57.1%) were still low. However, in the available cases, relatively adequate response to rubella vaccination (92.3%) was observed. PMID:20469978

  13. Cross-Sectional Study of Phoneme and Rhyme Monitoring Abilities in Children between 7 and 13 Years

    ERIC Educational Resources Information Center

    Sasisekaran, Jayanthi; Weber-Fox, Christine

    2012-01-01

    We investigated phonemic competence in production in three age groups of children (7 and 8, 10 and 11, 12 and 13 years) using rhyme and phoneme monitoring. Participants were required to name target pictures silently while monitoring covert speech for the presence or absence of a rhyme or phoneme match. Performance in the verbal tasks was compared…

  14. The Effect of Retention Interval Task Difficulty on Young Children's Prospective Memory: Testing the Intention Monitoring Hypothesis

    ERIC Educational Resources Information Center

    Mahy, Caitlin E. V.; Moses, Louis J.

    2015-01-01

    The current study examined the impact of retention interval task difficulty on 4- and 5-year-olds' prospective memory (PM) to test the hypothesis that children periodically monitor their intentions during the retention interval and that disrupting this monitoring may result in poorer PM performance. In addition, relations among PM, working memory,…

  15. Integrated Immune Experiment

    NASA Technical Reports Server (NTRS)

    Crucian, Brian

    2009-01-01

    This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  16. The Costs and Benefits of Self-Monitoring for Higher Functioning Children and Adolescents with Autism

    PubMed Central

    Henderson, Heather A.; Ono, Kim E.; McMahon, Camilla; Schwartz, Caley B.; Usher, Lauren V.; Mundy, Peter C.

    2013-01-01

    The ability to regulate behaviors and emotions depends in part on the ability to flexibly monitor one’s own progress toward a goal. Atypical patterns of response monitoring have been reported in individuals with autism spectrum disorders (ASD). In the current study we examined the error related negativity (ERN), an electrophysiological index of response monitoring, in relation to behavioral, social cognitive, and emotional presentation in higher functioning children (8–16 years) diagnosed with autism (HFA: N = 38) and an age- and IQ-matched sample of children without autism (COM: N = 36). Both HFA and COM participants displayed larger amplitude responses to error compared to correct response trials and these amplitudes did not differ by diagnostic group. For participants with HFA, larger ERN amplitudes were associated with more parent-reported autistic symptoms and more self-reported internalizing problems. However, across the full sample, larger ERN amplitudes were associated with better performance on Theory of Mind tasks. The results are discussed in terms of the utility of electrophysiological measures for understanding essential moderating processes that contribute to the spectrum of behavioral expression in the development of Autism Spectrum Disorders. PMID:24682651

  17. Strategies for Monitoring Outcomes in HIV-Exposed Uninfected Children in the United Kingdom

    PubMed Central

    Thorne, Claire; Tookey, Pat

    2016-01-01

    Surveillance of pregnancies in women living with HIV is carried out on a national basis in the United Kingdom (UK) through the National Study of HIV in Pregnancy and Childhood. There are currently around 1100–1200 HIV-exposed uninfected (HEU) infants born every year in the UK, where vertical transmission of HIV now occurs in fewer than 5 in every 1000 pregnancies. By the end of 2014, there was a cumulative total of more than 15,000 HEU children with any combination antiretroviral therapy (cART) exposure and more than 5000 with cART exposure from conception in the UK. HEU infants are increasingly being exposed to newer antiretroviral drugs for which less is known regarding both short- and long-term safety. In this commentary, we describe the approaches that have been taken to explore health outcomes in HEU children born in the UK. This includes the Children exposed to AntiRetroviral Therapy (CHART) Study, which was a consented follow-up study carried out in 2002–2005 of HEU children born in 1996–2004. The CHART Study showed that 4% of HEU children enrolled had a major health or development problem in early childhood; this was within expected UK norms, but the study was limited by small numbers and short-term follow-up. However, the problems with recruitment and retention that were encountered within the CHART Study demonstrated that comprehensive, clinic-based follow-up was not a feasible approach for long-term assessment of HEU children in the UK. We describe an alternative approach developed to monitor some aspects of their long-term health, involving the “flagging” of HEU infants for death and cancer registration with the UK Office for National Statistics. Some of the ethical concerns regarding investigation of long-term outcomes of in utero and perinatal exposure to antiretrovirals, including those relating to consent and confidentiality, are also discussed. PMID:27242792

  18. Strategies for Monitoring Outcomes in HIV-Exposed Uninfected Children in the United Kingdom.

    PubMed

    Thorne, Claire; Tookey, Pat

    2016-01-01

    Surveillance of pregnancies in women living with HIV is carried out on a national basis in the United Kingdom (UK) through the National Study of HIV in Pregnancy and Childhood. There are currently around 1100-1200 HIV-exposed uninfected (HEU) infants born every year in the UK, where vertical transmission of HIV now occurs in fewer than 5 in every 1000 pregnancies. By the end of 2014, there was a cumulative total of more than 15,000 HEU children with any combination antiretroviral therapy (cART) exposure and more than 5000 with cART exposure from conception in the UK. HEU infants are increasingly being exposed to newer antiretroviral drugs for which less is known regarding both short- and long-term safety. In this commentary, we describe the approaches that have been taken to explore health outcomes in HEU children born in the UK. This includes the Children exposed to AntiRetroviral Therapy (CHART) Study, which was a consented follow-up study carried out in 2002-2005 of HEU children born in 1996-2004. The CHART Study showed that 4% of HEU children enrolled had a major health or development problem in early childhood; this was within expected UK norms, but the study was limited by small numbers and short-term follow-up. However, the problems with recruitment and retention that were encountered within the CHART Study demonstrated that comprehensive, clinic-based follow-up was not a feasible approach for long-term assessment of HEU children in the UK. We describe an alternative approach developed to monitor some aspects of their long-term health, involving the "flagging" of HEU infants for death and cancer registration with the UK Office for National Statistics. Some of the ethical concerns regarding investigation of long-term outcomes of in utero and perinatal exposure to antiretrovirals, including those relating to consent and confidentiality, are also discussed. PMID:27242792

  19. Immune response

    MedlinePlus

    Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense system ...

  20. Biological monitoring of pesticide exposures among applicators and their children in Nicaragua.

    PubMed

    Rodríguez, Teresa; Younglove, Lisa; Lu, Chensheng; Funez, Aura; Weppner, Sarah; Barr, Dana B; Fenske, Richard A

    2006-01-01

    Exposures were assessed for seven small-scale farmers using chlorpyrifos on corn and ten banana plantation employees applying diazinon, and for one child of each worker. Metabolites (TCPYand IMPY) were measured in urine before and after applications. TCPY concentrations peaked at 27 and 8.5 hours post-application for applicators and children, respectively (geometric means, 26 and 3.0 microg/L). Proximity to spraying and spray mixture preparation in homes were important exposure factors. IMPY concentrations differed substantially across workers at two plantations (geometric means, 1.3 and 168 mirog/L); however, their children had little or no diazinon exposure. These workers and children were also exposed to chlorpyrifos, most likely through contact with chlorpyrifos-impregnated bags used in banana production. Several recommendations are offered: (1) monitor children's activities during applications; (2) do not store or prepare pesticides in homes; (3) institute sound occupational hygiene practices at banana plantations; (4) dispose of plastic insecticide bags properly at the worksite. PMID:17168218

  1. Cutting-edge technologies for diagnosis and monitoring of snoring in children

    PubMed Central

    Vlastos, Ioannis; Athanasopoulos, Ioannis

    2016-01-01

    Snoring is a very common problem in children and may be an indication of obstructive sleep apnea (OSA). Appropriate diagnosis is of importance due to detrimental effects of OSA. Polysomnography is considered the gold standard for the diagnosis of OSA. However, it is impractical for several reasons and this is why other tests have been developed as alternatives to formal polysomnography (PSG) for the assessment of children with snoring. In this mini-review basic features of PSG as well as alternative tests are presented and future perspectives are provided in addition to current guideline for the diagnosis and monitoring of childhood snoring. The aim of this review is to highlight briefly currently developed technologies that seem promising for the evaluation of snoring. PMID:26862503

  2. Cutting-edge technologies for diagnosis and monitoring of snoring in children.

    PubMed

    Vlastos, Ioannis; Athanasopoulos, Ioannis

    2016-02-01

    Snoring is a very common problem in children and may be an indication of obstructive sleep apnea (OSA). Appropriate diagnosis is of importance due to detrimental effects of OSA. Polysomnography is considered the gold standard for the diagnosis of OSA. However, it is impractical for several reasons and this is why other tests have been developed as alternatives to formal polysomnography (PSG) for the assessment of children with snoring. In this mini-review basic features of PSG as well as alternative tests are presented and future perspectives are provided in addition to current guideline for the diagnosis and monitoring of childhood snoring. The aim of this review is to highlight briefly currently developed technologies that seem promising for the evaluation of snoring. PMID:26862503

  3. Adherence with Electronic Monitoring and Symptoms in Children with Attention Deficit Hyperactivity Disorder

    PubMed Central

    Yang, Jaewon; Yoon, Byung-Moon; Lee, Moon-Soo; Joe, Sook-Haeng; Jung, In-Kwa

    2012-01-01

    Objective The primary aim of this study was to compare electronic monitoring with other measures of adherence to Osmotic-controlled Release Oral delivery System methylphenidate in children with attention-deficit hyperactivity disorder (ADHD). The secondary aim was to analyze the relationships between adherence and clinical factors, including ADHD symptoms. Methods Thirty-nine children diagnosed with ADHD were monitored for adherence to medication over the course of eight weeks. Medication adherence was assessed using the Medication Event Monitoring System (MEMS), which is a bottle cap with a microprocessor that records all instances and times that the bottle is opened; patient self-report; clinician rating; and pill count. Information, including demographic and clinical characteristics, symptom rating scale, and psychological test results, were also collected. The relationships between adherence and clinical factors, including ADHD rating scores of baseline and of the changes, were assessed. Results The rate of non-adherence measured by the MEMS was found to be 46.2%, which was considerably higher than those of the patient self-report (17.9%), clinician rating (31.7%), and pill count (12.8%) of non-adherence. The rate of adherence measured by the MEMS was not significantly associated with baseline symptom severity or symptom changes over the eight weeks, although non-adherent group showed more severe baseline symptoms and inferior improvement. Conclusion Adherence as measured by the MEMS showed a discrepancy with other measures of adherence in patients with ADHD. The symptom severity and level of improvement were not related to adherence with MEMS. Further studies are needed to evaluate the variables that may impact medication adherence in children with ADHD. PMID:22993526

  4. Electroencephalographic Monitoring in Critically Ill Children: Current Practice and Implications for Future Study Design

    PubMed Central

    Sánchez, Sarah M; Arndt, Daniel H.; Carpenter, Jessica L.; Chapman, Kevin E; Cornett, Karen M.; Dlugos, Dennis J.; Gallentine, William B.; Giza, Christopher C; Goldstein, Joshua L; Hahn, Cecil D; Lerner, Jason T; Loddenkemper, Tobias; Matsumoto, Joyce H; McBain, Kristin; Nash, Kendall B; Payne, Eric; Sánchez Fernández, Iván; Shults, Justine; Williams, Korwyn; Yang, Amy; Abend, Nicholas S.

    2014-01-01

    Purpose Survey data indicate that continuous EEG (CEEG) monitoring is used with increasing frequency to identify electrographic seizures in critically ill children, but studies of current CEEG practice have not been conducted. We aimed to describe the clinical utilization of CEEG in critically ill children at tertiary care hospitals with a particular focus on variables essential for designing feasible prospective multi-center studies evaluating the impact of electrographic seizures on outcome. Methods Eleven North American centers retrospectively enrolled 550 consecutive critically ill children who underwent CEEG. We collected data regarding subject characteristics, CEEG indications, and CEEG findings. Key Findings CEEG indications were encephalopathy with possible seizures in 67% of subjects, event characterization in 38% of subjects, and management of refractory status epilepticus in 11% of subjects. CEEG was initiated outside routine work hours in 47% of subjects. CEEG duration was <12 hours in 16%, 12-24 hours in 34%, and >24 hours in 48%. Substantial variability existed among sites in CEEG indications and neurologic diagnoses, yet within each acute neurologic diagnosis category a similar proportion of subjects at each site had electrographic seizures. Electrographic seizure characteristics including distribution and duration varied across sites and neurologic diagnoses. Significance These data provide a systematic assessment of recent CEEG use in critically ill children and indicate variability in practice. The results suggest that multi-center studies are feasible if CEEG monitoring pathways can be standardized. However, the data also indicate that electrographic seizure variability must be considered when designing studies addressing the impact of electrographic seizures on outcome. PMID:23848569

  5. Hepatitis C Virus-Specific Cell-Mediated Immune Responses in Children Born to Mothers Infected with Hepatitis C Virus

    PubMed Central

    El-Kamary, Samer S.; Hashem, Mohamed; Saleh, Doaa A.; Abdelwahab, Sayed F.; Sobhy, Maha; Shebl, Fatma M.; Shardell, Michelle D.; Strickland, G. Thomas; Shata, Mohamed Tarek

    2013-01-01

    Objective To investigate the association between hepatitis C virus (HCV)-specific cell-mediated immunity (CMI) responses and viral clearance in children born to mothers infected with HCV. Study design A cross-sectional study of children from a mother-infant cohort in Egypt were enrolled to detect CMI responses to recombinant core and nonstructural HCV antigens (nonstructural segments NS3, NS4a/b, and NS5 of the HCV genome) using an interferon-gamma enzyme-linked immunospot assay. Children born to mothers with chronic HCV were enrolled into 3 groups: transiently viremic (n = 5), aviremic (n = 36), and positive control (n = 6), which consisted of 1 child with chronic HCV from this cohort and another 5 children with chronic HCV from a companion study. Children without HCV born to mothers without HCV (n = 27) served as a negative control group. Wilcoxon rank sum test was used to compare the magnitude of CMI responses between groups. Results None of the 6 control children who were positive for HCV responded to any HCV antigen, and 4 (80%) of 5 children with transient viremia responded to at least one HCV antigen, compared with 5 (14%) of 36 and 3 (11%) of 27 children in the aviremic and negative control groups, respectively. Children with transient viremia elicited stronger responses than did negative controls (P = .005), positive controls (P = .011), or children without HCV viremia (P = .012), particularly to nonstructural antigens. Conclusions HCV-specific CMI responses were significantly higher in magnitude and frequency among transiently infected children compared with those persistently infected. This suggests CMI responses may be associated with past viral clearance and can identify children at high risk of infection, who can be targeted for health education, screening, and follow-up. PMID:22883419

  6. Community Immunity (Herd Immunity)

    MedlinePlus

    ... Content Marketing Share this: Main Content Area ​Community Immunity ("Herd" Immunity) Vaccines can prevent outbreaks of disease and save ... disease is contained. This is known as "community immunity." In the illustration below, the top box depicts ...

  7. Therapeutic Monitoring of Voriconazole in Children Less Than 3 Years of Age: A Case Report and Summary of Voriconazole Concentrations for 10 Children

    PubMed Central

    Doby, Elizabeth H.; Benjamin, Daniel K.; Blaschke, Anne J.; Ward, Robert M.; Pavia, Andrew T.; Martin, Paul L.; Driscoll, Timothy A.; Cohen-Wolkowiez, Michael; Moran, Cassandra

    2012-01-01

    Voriconazole is the treatment of choice for invasive aspergillosis and its use is increasing in pediatrics. Minimal pharmacokinetic data exist in young children. We report voriconazole concentrations for 10 children less than <3 years of age and pharmacokinetic parameters for one infant who had therapeutic drug monitoring performed. Trough concentrations were unpredictable based on dose, highlighting the need to follow values during therapy. PMID:22301479

  8. Two models for changes of EV71 immunity in infants and young children

    PubMed Central

    Tu, Xiaoming; Wang, Yongmei; Zhu, Fengcai; Chen, Feng

    2015-01-01

    Human enterovirus 71 (EV71) has been associated with outbreaks of hand-foot-and-mouth disease (HFMD) in China. Susceptibility to EV71 is associated with age, but few studies have been accomplished to measure such a relationship. A better understanding of the connection between susceptibility and age is necessary to develop strategies for control of HFMD. In 2010, a survey of an epidemic of EV71 was conducted in a northern city of Jiangsu Province in China. Samples were tested serologically to identify the EV71 neutralizing antibody. Two different mathematical models have now been employed to describe how this antibody varied with age, and parameters in the model were estimated from survey data. Both models depicted the variations in EV71-neutralizing antibody. Seroprevalence was high for neonates but decreased to near zero at 5 months of age. Subsequently, the EV71 antibody levels increased and then remained stable after about 36 months. For models 1 and 2, values for the coefficient of determination (R2) were 0.9458 and 0.9576, and values for root mean square error (RMSE) were 0.0755 and 0.0752, respectively. Model 2, formulated from the characteristics of development of the immune system, was more reliable than model 1, formulated from survey data, because the impact of the survey on the structure of the model was removed. Moreover, model 2 provided the possibility to define the parameters in a biological sense. PMID:25906390

  9. Two models for changes of EV71 immunity in infants and young children.

    PubMed

    Tu, Xiaoming; Wang, Yongmei; Zhu, Fengcai; Chen, Feng

    2015-01-01

    Human enterovirus 71 (EV71) has been associated with outbreaks of hand-foot-and-mouth disease (HFMD) in China. Susceptibility to EV71 is associated with age, but few studies have been accomplished to measure such a relationship. A better understanding of the connection between susceptibility and age is necessary to develop strategies for control of HFMD. In 2010, a survey of an epidemic of EV71 was conducted in a northern city of Jiangsu Province in China. Samples were tested serologically to identify the EV71 neutralizing antibody. Two different mathematical models have now been employed to describe how this antibody varied with age, and parameters in the model were estimated from survey data. Both models depicted the variations in EV71-neutralizing antibody. Seroprevalence was high for neonates but decreased to near zero at 5 months of age. Subsequently, the EV71 antibody levels increased and then remained stable after about 36 months. For models 1 and 2, values for the coefficient of determination (R(2)) were 0.9458 and 0.9576, and values for root mean square error (RMSE) were 0.0755 and 0.0752, respectively. Model 2, formulated from the characteristics of development of the immune system, was more reliable than model 1, formulated from survey data, because the impact of the survey on the structure of the model was removed. Moreover, model 2 provided the possibility to define the parameters in a biological sense. PMID:25906390

  10. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    PubMed

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health. PMID:25147109

  11. [Unexpectedly high proportion of preschool children immune to hepatitis A virus. Contact tracing investigation shows the need for vaccination prior to traveling abroad].

    PubMed

    Persson, Hanna; Nasta, Federico; Svensson, Ingrid; Widerström, Micael

    Hepatitis A (HAV) is a low incidence infectious disease in Sweden, and a majority of cases in this country are acquired abroad, although domestic cases are not uncommon in the day care setting. We investigated an outbreak of hepatitis A in two day care centres and found that a large proportion (23%) of the 113 unvaccinated preschool children were immune to HAV. This observation indicates that there may have been sub-clinical cases of HAV at the two centres. The results of our study underscore the importance of HAV vaccination in preschool children prior to travel to areas where this disease is common. The findings also highlight the need for up-to-date national seroepidemiological data on HAV immunity in different age groups in Sweden. Studies aimed at obtaining such information could also provide a basis for deciding whether targeted vaccination strategies against HAV are needed in the day care setting. PMID:25462320

  12. Symptom monitoring and dependent care during cancer treatment in children: pilot study.

    PubMed

    Williams, Phoebe D; Schmideskamp, Jami; Ridder, E Lavonne; Williams, Arthur R

    2006-01-01

    Symptom monitoring by parents/caregivers of children with cancer and what the caregiver and child did to help alleviate symptoms during chemotherapy were studied. The Therapy-Related Symptom Checklist (TRSC) child version was administered to parents/caregivers of 11 children and adolescents (mean age, 10.4 years; SD, 6.1 years; range, 2-18 years; 45% were boys). The Karnofsky scale was completed by clinicians to rate the child's functional status. The TRSC child version and functional status scores were inversely related. All children experienced nausea; the most frequent symptoms reported were in TRSC subscales: fatigue, nausea, eating, fever, oropharynx, pain, and hair loss. Care strategies that helped were distraction, massage, mouth rinses, and vitamins; some reported that their child received medications for pain, nausea, and vomiting. Using complementary medicine categories, the care strategies were diet/nutrition/lifestyle change (eg, more high-fat, high-calorie foods; new foods; any food the child likes; and much sleep and rest); mind/body control (eg, play, video games, television, reading, activity puzzle, breathing exercises, relaxation methods, and prayer); manual healing method (massage and skin-to-skin contact); and biologic treatments (vitamins). The first 2 categories were the most used. Systematic assessment with a self-report checklist enables the provider to identify and prioritize (according to reported severity) those symptoms needing intervention. PMID:16783117

  13. SCT for severe autoimmune diseases: consensus guidelines of the European Society for Blood and Marrow Transplantation for immune monitoring and biobanking.

    PubMed

    Alexander, T; Bondanza, A; Muraro, P A; Greco, R; Saccardi, R; Daikeler, T; Kazmi, M; Hawkey, C; Simoes, B P; Leblanc, K; Fibbe, W E; Moore, J; Snarski, E; Martin, T; Hiepe, F; Velardi, A; Toubert, A; Snowden, J A; Farge, D

    2015-02-01

    Over the past 15 years, SCT has emerged as a promising treatment option for patients with severe autoimmune diseases (ADs). Mechanistic studies recently provided the proof-of-concept that restoration of immunological tolerance can be achieved by haematopoietic SCT in chronic autoimmunity through eradication of the pathologic, immunologic memory and profound reconfiguration of the immune system, that is, immune 'resetting'. Nevertheless, a number of areas remain unresolved and warrant further investigation to refine our understanding of the underlying mechanisms of action and to optimize clinical SCT protocols. Due to the low number of patients transplanted in each centre, it is essential to adequately collect and analyse biological samples in a larger cohort of patients under standardized conditions. The European society for blood and marrow transplantation Autoimmune Diseases and Immunobiology Working Parties have, therefore, undertaken a joint initiative to develop and implement guidelines for 'good laboratory practice' in relation to procurement, processing, storage and analysis of biological specimens for immune reconstitution studies in AD patients before, during and after SCT. The aim of this document is to provide practical recommendations for biobanking of samples and laboratory immune monitoring in patients with ADs undergoing SCT, both for routine supportive care purposes and investigational studies. PMID:25387090

  14. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. PMID:26329766

  15. The effects of long-term total parenteral nutrition on gut mucosal immunity in children with short bowel syndrome: a systematic review

    PubMed Central

    Duran, Beyhan

    2005-01-01

    Background Short bowel syndrome (SBS) is defined as the malabsorptive state that often follows massive resection of the small intestine. Most cases originate in the newborn period and result from congenital anomalies. It is associated with a high morbidity, is potentially lethal and often requires months, sometimes years, in the hospital and home on total parenteral nutrition (TPN). Long-term survival without parenteral nutrition depends upon establishing enteral nutrition and the process of intestinal adaptation through which the remaining small bowel gradually increases its absorptive capacity. The purpose of this article is to perform a descriptive systematic review of the published articles on the effects of TPN on the intestinal immune system investigating whether long-term TPN induces bacterial translocation, decreases secretory immunoglobulin A (S-IgA), impairs intestinal immunity, and changes mucosal architecture in children with SBS. Methods The databases of OVID, such as MEDLINE and CINAHL, Cochran Library, and Evidence-Based Medicine were searched for articles published from 1990 to 2001. Search terms were total parenteral nutrition, children, bacterial translocation, small bowel syndrome, short gut syndrome, intestinal immunity, gut permeability, sepsis, hyperglycemia, immunonutrition, glutamine, enteral tube feeding, and systematic reviews. The goal was to include all clinical studies conducted in children directly addressing the effects of TPN on gut immunity. Results A total of 13 studies were identified. These 13 studies included a total of 414 infants and children between the ages approximately 4 months to 17 years old, and 16 healthy adults as controls; and they varied in design and were conducted in several disciplines. The results were integrated into common themes. Five themes were identified: 1) sepsis, 2) impaired immune functions: In vitro studies, 3) mortality, 4) villous atrophy, 5) duration of dependency on TPN after bowel resection

  16. A multi-functional, portable device with wireless transmission for home monitoring of children with a learning disability.

    PubMed

    Tura, A; Badanai, M; Longo, D; Quareni, L

    2004-01-01

    A portable monitoring device was developed to assist in the management of children with a learning disability. The device was designed for continuous home monitoring of blood oxygen saturation, heart and respiration rates, and patient activity. It could be worn on a belt, while the patient continued normal activities. Data were stored on a multimedia card and automatically transmitted to a PC at prescribed intervals via a Bluetooth wireless link. From the PC the data were transmitted to a Web server, where the information was made available to the staff involved in the patient's care. Preliminary clinical studies were performed with nine patients (four with Down's syndrome, three with cerebral palsy and two with mental retardation). Patients and families considered the device easy to use and to wear. The monitoring device identified events of possible clinical interest. Although it was designed for monitoring children with a learning disability, it may also be useful with other groups, such as elderly people. PMID:15494089

  17. Monitoring motor capacity changes of children during rehabilitation using body-worn sensors

    PubMed Central

    2013-01-01

    Background Rehabilitation services use outcome measures to track motor performance of their patients over time. State-of-the-art approaches use mainly patients’ feedback and experts’ observations for this purpose. We aim at continuously monitoring children in daily life and assessing normal activities to close the gap between movements done as instructed by caregivers and natural movements during daily life. To investigate the applicability of body-worn sensors for motor assessment in children, we investigated changes in movement capacity during defined motor tasks longitudinally. Methods We performed a longitudinal study over four weeks with 4 children (2 girls; 2 diagnosed with Cerebral Palsy and 2 with stroke, on average 10.5 years old) undergoing rehabilitation. Every week, the children performed 10 predefined motor tasks. Capacity in terms of quality and quantity was assessed by experts and movement was monitored using 10 ETH Orientation Sensors (ETHOS), a small and unobtrusive inertial measurement unit. Features such as smoothness of movement were calculated from the sensor data and a regression was used to estimate the capacity from the features and their relation to clinical data. Therefore, the target and features were normalized to range from 0 to 1. Results We achieved a mean RMS-error of 0.15 and a mean correlation value of 0.86 (p<0.05 for all tasks) between our regression estimate of motor task capacity and experts’ ratings across all tasks. We identified the most important features and were able to reduce the sensor setup from 10 to 3 sensors. We investigated features that provided a good estimate of the motor capacity independently of the task performed, e.g. smoothness of the movement. Conclusions We found that children’s task capacity can be assessed from wearable sensors and that some of the calculated features provide a good estimate of movement capacity over different tasks. This indicates the potential of using the sensors in daily

  18. Intraoperative Parathyroid Hormone Monitoring Corroborates the Success of Parathyroidectomy in Children

    PubMed Central

    Çelik, Ahmet; Divarcı, Emre; Dökümcü, Zafer; Ergün, Orkan; Özen, Samim; Gökşen, Damla; Darcan, Şükran; Ertan, Yeşim

    2014-01-01

    Ob­jec­ti­ve: To assess the efficacy of intraoperative parathyroid hormone (PTH) monitoring in evaluating the outcome of parathyroidectomy in pediatric patients. Methods: Intraoperative PTH monitoring during parathyroidectomy was performed in five children (3M, 2F); three had parathyroid adenomas (single gland disease) and two had primary hyperplasia. One patient had undergone two previous surgical interventions to remove the parathyroid glands, but the PTH levels had remained high with persistence of symptoms. Immunoradiometric analysis was used for PTH measurements. Preoperative PTH values were obtained to monitor the baseline levels. Serum samples were collected 20 minutes after removal of the adenoma/parathyroid gland(s) and PTH levels were compared with preoperative values. Specimens were also confirmed by frozen sectional examination. Results: Mean age of the patients was 11 years (range: 3 months-16 years). Mean preoperative PTH values were 633.3±579 pg/mL (range: 143-1300 pg/mL). Intraoperative values decreased to 18.7±5.5 pg/mL (range: 8-27 pg/mL) following removal of the gland(s). Normal calcium levels were achieved with adequate management following surgery. One patient (with multiple surgeries and found to have an ectopic parathyroid gland) had hungry bone syndrome after the operation and was treated successfully. There were no major complications. All patients maintained normal calcium/phosphorus levels in the follow-up period, ranging from 2 to 5 years. Conclusion: An ectopic parathyroid gland or another undetected adenoma can be overlooked during surgery. Owing to the short life of the hormone, intraoperative PTH monitoring to determine PTH clearance proved to be a feasible marker for adequacy and safety of surgery and “cure”. PMID:25241609

  19. Long-term outcome following splenectomy for chronic and persistent immune thrombocytopenia (ITP) in adults and children : Splenectomy in ITP.

    PubMed

    Ahmed, Rayaz; Devasia, Anup J; Viswabandya, Auro; Lakshmi, Kavitha M; Abraham, Aby; Karl, Sampath; Mathai, John; Jacob, Paul M; Abraham, Deepak; Srivastava, Alok; Mathews, Vikram; George, Biju

    2016-09-01

    The purpose of this research is to study the outcomes of splenectomy for chronic and persistent immune thrombocytopenia (ITP). This study is a retrospective analysis of 254 patients with chronic or persistent ITP who underwent splenectomy at CMC, Vellore, India between 1995 and 2009. Responses were assessed based on standard criteria. One hundred and sixty seven adults and 87 children with a median age of 29 years (range 2-64) with persistent (n = 103) or chronic ITP (n = 151) was studied. Response was seen in 229 (90.2 %) including CR in 74.4 % at a median time of 1 day (range 1-54). Infections following splenectomy were reported in 16 %. Deaths related to post splenectomy sepsis occurred in 1.57 % and major bleeding in 0.78 %. At median follow-up of 54.3 months (range 1-290), 178 (70.1 %) remain in remission. The 5-year and 10-year overall survival (OS) is 97.4 ± 1.2 % and 94.9 ± 2.1 %, respectively, while the 5-year and 10-year event-free survival (EFS) is 76.5 + 2.9 % and 71.0 + 3.9 %, respectively. Splenectomy is associated with long-term remission rates of >70 % in chronic or persistent ITP. PMID:27370992

  20. Ensuring excellence in immunization services.

    PubMed

    MacDonald, Pauline

    2016-01-01

    In order to increase uptake of measles, mumps and rubella (MMR) vaccine, a domiciliary immunization service was established in Dudley primary care trust in England in 2010. Parents of unimmunized children were offered vaccines at home. Uptake of MMR vaccine among 2 year olds rose from 89% in 2007/08 to 96.9% in 2015. Children were also given any other outstanding immunizations. The domiciliary immunization service reached vulnerable unimmunized children who may otherwise have remained unprotected against life threatening childhood illnesses. Domiciliary immunization service was set up in 2010 to reduce inequalities in uptake of MMR vaccine among children aged between 2 and 5 years. PMID:26618244

  1. Bronchiolitis: Recommendations for diagnosis, monitoring and management of children one to 24 months of age

    PubMed Central

    Friedman, Jeremy N; Rieder, Michael J; Walton, Jennifer M

    2014-01-01

    Bronchiolitis is the most common reason for admission to hospital in the first year of life. There is tremendous variation in the clinical management of this condition across Canada and around the world, including significant use of unnecessary tests and ineffective therapies. This statement pertains to generally healthy children ≤2 years of age with bronchiolitis. The diagnosis of bronchiolitis is based primarily on the history of illness and physical examination findings. Laboratory investigations are generally unhelpful. Bronchiolitis is a self-limiting disease, usually managed with supportive care at home. Groups at high risk for severe disease are described and guidelines for admission to hospital are presented. Evidence for the efficacy of various therapies is discussed and recommendations are made for management. Monitoring requirements and discharge readiness from hospital are also discussed. PMID:25414585

  2. The hepatitis B immunization programme in Singapore.

    PubMed Central

    Goh, K. T.; Doraisingham, S.; Tan, K. L.; Oon, C. J.; Ho, M. L.; Chen, A. J.; Chan, S. H.

    1989-01-01

    A voluntary immunization programme to prevent perinatal transmission of hepatitis B virus (HBV) infection in Singapore was implemented on 1 October 1985 as an integral component of the national childhood immunization programme. Up to April 1988, a total of 68,845 mothers who attended government maternal and child health clinics were screened for the disease. Of these, 2432 (3.5%) were positive for hepatitis B surface antigen (HBsAg) and 904 (1.3%) for hepatitis B e antigen (HBeAg). Virtually all the babies born to carrier mothers completed the full immunization schedule; and in addition, those of HBeAg-positive mothers were given a dose of hepatitis B immunoglobulin at birth. The hepatitis B immunization programme was extended on 1 September 1987 to cover all newborns. About 90% of the 15,943 babies delivered in government institutions from September 1987 to April 1988 were immunized at birth, with the subsequent doses being administered at maternal and child health clinics at 4-6 weeks and 5 months later. More than 85% of the children given the full course of plasma-derived and yeast-derived hepatitis B vaccine from birth continued to have protective antibody to HBV two years after immunization. The programme is being closely monitored to assess the duration of immunity and the need for booster doses, while seronegative adults are also being encouraged to be vaccinated. PMID:2523251

  3. 76 FR 60500 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-29

    ... HUMAN SERVICES Centers for Disease Control and Prevention Advisory Committee on Immunization Practices... will include discussions on: Child/adolescent immunization schedules; adult immunization schedule...; pertussis; immunization coverage among children and adolescents; and vaccine supply. Agenda items...

  4. Immune Activation Is Associated With Increased Gut Microbial Translocation in Treatment-Naive, HIV-Infected Children in a Resource-Limited Setting

    PubMed Central

    Pilakka-Kanthikeel, Sudheesh; Kris, Arheart; Selvaraj, Anbalagan; Swaminathan, Soumya; Pahwa, Savita

    2015-01-01

    Background Gut damage resulting in microbial translocation (MT) is considered a major cause of immune activation (IA) in HIV infection, but data in children are limited, particularly in the absence of antiretroviral therapy. Methods Sixty perinatally HIV-infected, antiretroviral therapy–naive children, aged 2–12 years, were evaluated for plasma levels of lipopolysaccharide, DNA sequences encoding bacterial ribosomal 16 second (16S) RNA (16S rDNA) and soluble CD14 concurrently with markers of CD4 and CD8 T-cell IA and immune exhaustion (IE), CD4 counts, and plasma viral load. At study entry, participants were classified into immune categories (ICs): IC1 (CD4% > 25), IC2 (CD4% 15–25), and IC3 (CD4% < 15). Age-matched HIV-uninfected children served as controls. Data were evaluated at study entry and at 12 months. Results Levels of MT, IA, and IE were increased in patients as compared with controls, were highest in patients in IC3 group, and did not change over 12 months. MT products lipopolysaccharide and 16S rDNA correlated with each other and each correlated with plasma viral load, soluble CD14, and T-cell IA and IE. There was a correlation of IA with IE. CD4 counts and percentage were inversely correlated with MT products and underlying CD4 activation. Conclusions In a natural history cohort of HIV-infected children not on therapy, MT was more pronounced in the most severely immunocompromised patients and was associated with IA. Strategies to reduce MT may help to reduce IA and prevent CD4 depletion. PMID:24378729

  5. Longevity of Genotype-Specific Immune Responses to Plasmodium falciparum Merozoite Surface Protein 1 in Kenyan Children from Regions of Different Malaria Transmission Intensity.

    PubMed

    Bowman, Natalie M; Juliano, Jonathan J; Snider, Cynthia J; Kharabora, Oksana; Meshnick, Steven R; Vulule, John; John, Chandy C; Moormann, Ann M

    2016-09-01

    Naturally acquired immunity to Plasmodium falciparum presents a changing landscape as malaria control programs and vaccine initiatives are implemented. Determining which immunologic indicators remain surrogates of past infection, as opposed to mediators of protection, led us to compare stability of immune responses across regions with divergent malaria transmission intensities. A repeat cross-sectional study of Kenyan children from a malaria-holoendemic area and an epidemic-prone area was used to examine longitudinal antibody and interferon-gamma (IFN-γ) responses to the 3D7 and FVO variants of merozoite surface protein 1 (MSP1). Antibodies to MSP1 were common in both study populations and did not significantly wane over a 21-month time period. IFN-γ responses were less frequent and rapidly disappeared in children after a prolonged period of no malaria transmission. Antibody and IFN-γ responses rarely correlated with each other; however, MSP1-specific IFN-γ response correlated with lack of concurrent P. falciparum parasitemia of the same genotype, though only statistically significantly in the malaria-holoendemic region (odds ratio = 0.31, 95% confidence interval = 0.12-0.84). This study affirms that antimalarial antibodies are informative for evaluation of history of malaria exposure within individuals, whereas cell-mediated immunity, though short lived under natural exposure conditions, might provide an assessment of recent infection and protection from parasitemia. PMID:27481054

  6. FastStats: Immunization

    MedlinePlus

    ... this? Submit What's this? Submit Button NCHS Home Immunization Recommend on Facebook Tweet Share Compartir Data are ... Percent of children 19-35 months old receiving vaccinations for: Diphtheria, Tetanus, Pertussis (4+ doses DTP, DT, ...

  7. Effectiveness of Using Mobile Phone Image Capture for Collecting Secondary Data: A Case Study on Immunization History Data Among Children in Remote Areas of Thailand

    PubMed Central

    Jandee, Kasemsak; Khamsiriwatchara, Amnat; Lawpoolsri, Saranath; Wongwit, Waranya; Wansatid, Peerawat

    2015-01-01

    Background Entering data onto paper-based forms, then digitizing them, is a traditional data-management method that might result in poor data quality, especially when the secondary data are incomplete, illegible, or missing. Transcription errors from source documents to case report forms (CRFs) are common, and subsequently the errors pass from the CRFs to the electronic database. Objective This study aimed to demonstrate the usefulness and to evaluate the effectiveness of mobile phone camera applications in capturing health-related data, aiming for data quality and completeness as compared to current routine practices exercised by government officials. Methods In this study, the concept of “data entry via phone image capture” (DEPIC) was introduced and developed to capture data directly from source documents. This case study was based on immunization history data recorded in a mother and child health (MCH) logbook. The MCH logbooks (kept by parents) were updated whenever parents brought their children to health care facilities for immunization. Traditionally, health providers are supposed to key in duplicate information of the immunization history of each child; both on the MCH logbook, which is returned to the parents, and on the individual immunization history card, which is kept at the health care unit to be subsequently entered into the electronic health care information system (HCIS). In this study, DEPIC utilized the photographic functionality of mobile phones to capture images of all immunization-history records on logbook pages and to transcribe these records directly into the database using a data-entry screen corresponding to logbook data records. DEPIC data were then compared with HCIS data-points for quality, completeness, and consistency. Results As a proof-of-concept, DEPIC captured immunization history records of 363 ethnic children living in remote areas from their MCH logbooks. Comparison of the 2 databases, DEPIC versus HCIS, revealed

  8. Particular Characterisation of an In-Vitro-DTH Test to Monitor Cellular Immunity - Applications for Patient Care and Space Flight

    NASA Technical Reports Server (NTRS)

    Feurecker, M.; Mayer, W.; Gruber, M.; Muckenthaler, F.; Draenert, R.; Bogner, J.; Kaufmann, I.; Crucian, B.; Rykova, M.; Morukov, B.; Sams, C.; Chouker, A.

    2010-01-01

    Goal:i) Characterization of the role of the main immune reactive cell types contributing to the cellular immune response in the in-vitro DTH and ii) Validation of the in-vitro DTH under different clinical and field conditions. Methods:As positive control whole blood was incubated in the in-vitro DTH, supernatants were gathered after 12, 24 and 48h. Readout parameters of this test are cytokines in the assay's supernatant. To determine the role of T-cells, monocytes and natural killer (NK), these cell populations were depleted using magnetic beads prior to in-vitro-DTH incubation. Validation of the test has occurred under clinical (HIV-patients, ICU) and field-conditions (parabolic/space-flights, confinement). Results:T-cell depletion abandoned almost any IL-2 production and reduced IFN-gamma production irrespective of the type of antigen, whereas CD56 depleted cultures tended to lower IL-2 secretion and IFN-gamma and to parallel a IL-10-increase after viral challenge. This IL-10-increase was seen also in CD14-depleted setups. DTH read-out was significantly different under acute stress (parabolic flight) or chronic stress (ISS), respectively. Preliminary data of HIV infected patients demonstrate that this test can display the contemporary immune status during an antiviral therapy. Conclusion:The in-vitro DTH mirrors adaptive and innate immune activation and may serve as tool also for longitudinal follow up of Th1/Th2 weighed immune response under adverse life conditions on earth and in space. It is planned to implement the assay in the on the ISS (MoCISS).

  9. Monitoring of local CD8β-expressing cell populations during Eimeria tenella infection of naïve and immune chickens.

    PubMed

    Wattrang, E; Thebo, P; Lundén, A; Dalgaard, T S

    2016-08-01

    The purpose of this study was to monitor abundance and activation of local CD8β-expressing T-cell populations during Eimeria tenella infections of naïve chickens and chickens immune by previous infections. Chickens were infected with E. tenella up to three times. Caecal T-cell receptor (TCR) γ/δ-CD8β+ cells (cytotoxic T lymphocytes; CTL) and TCRγ/δ+CD8β+ cells were characterized with respect to activation markers (blast transformation, CD25 and cell surface CD107a). Cells were also induced to degranulate in vitro as a measure of activation potential. Major findings included a prominent long-lasting, up to 6 weeks, increase in the proportion of CTL among caecal CD45+ cells in the later stages after primary E. tenella infection. These CTL also showed clear signs of activation, that is blast transformation and increased in vitro induced degranulation. At second and third E. tenella infection, chickens showed strong protective immunity but discrete signs of cellular activation were observed, for example increased in vitro induced degranulation of CTL. Thus, primary E. tenella infection induced clear recruitment and activation of local CTL. Upon subsequent infections of strongly immune chickens cellular changes were less prominent, possibly due to lower overall numbers of cells being activated because of the severe restriction of parasite replication. PMID:27138684

  10. An Immunization Education Program for Childcare Providers

    ERIC Educational Resources Information Center

    Hayney, Mary S.; Bartell, Julie C.

    2005-01-01

    The childhood immunization schedule includes at least 17 scheduled immunizations prior to the age of 24 months. Immunization laws require childcare centers to maintain immunization records and enforce immunization standards for children who attend these centers. Childcare providers generally receive little formal education about infectious…

  11. Monitors.

    ERIC Educational Resources Information Center

    Powell, David

    1984-01-01

    Provides guidelines for selecting a monitor to suit specific applications, explains the process by which graphics images are produced on a CRT monitor, and describes four types of flat-panel displays being used in the newest lap-sized portable computers. A comparison chart provides prices and specifications for over 80 monitors. (MBR)

  12. Use of a monitoring tool for growth and development in Brazilian children – systematic review

    PubMed Central

    de Almeida, Ana Claudia; Mendes, Larissa da Costa; Sad, Izabela Rocha; Ramos, Eloane Gonçalves; Fonseca, Vânia Matos; Peixoto, Maria Virginia Marques

    2016-01-01

    Abstract Objective: To assess the use of a health monitoring tool in Brazilian children, with emphasis on the variables related to growth and development, which are crucial aspects of child health care. Data source: A systematic review of the literature was carried out in studies performed in Brazil, using the Cochrane Brazil, Lilacs, SciELO and Medline databases. The descriptors and keywords used were “growth and development”, “child development”, “child health record”, “child health handbook”, “health record and child” and “child handbook”, as well as the equivalent terms in Portuguese. Studies were screened by title and summary and those considered eligible were read in full. Data synthesis: Sixty-eight articles were identified and eight articles were included in the review, as they carried out a quantitative analysis of the filling out of information. Five studies assessed the completion of the Child's Health Record and three of the Child's Health Handbook. All articles concluded that the information was not properly recorded. Growth monitoring charts were rarely filled out, reaching 96.3% in the case of weight for age. The use of the BMI chart was not reported, despite the growing rates of childhood obesity. Only two studies reported the completion of development milestones and, in these, the milestones were recorded in approximately 20% of the verified tools. Conclusions: The results of the assessed articles disclosed underutilization of the tool and reflect low awareness by health professionals regarding the recording of information in the child's health monitoring document. PMID:26705605

  13. Humoral, Mucosal, and Cell-Mediated Immunity Against Vaccine and Nonvaccine Genotypes After Administration of Quadrivalent Human Papillomavirus Vaccine to HIV-Infected Children

    PubMed Central

    Weinberg, Adriana; Song, Lin-Ye; Saah, Alfred; Brown, Martha; Moscicki, Anna B.; Meyer, William A.; Bryan, Janine; Levin, Myron J.

    2012-01-01

    Objectives. To characterize the immunogenicity of a quadrivalent human papillomavirus vaccine (QHPV) in human immunodeficiency virus (HIV)–infected children, we studied their immune responses to 3 or 4 doses. Methods. HIV-infected children aged 7–12 years with a CD4 cell percentage of ≥15% of lymphocytes, received 3 doses of QHPV with or without a fourth dose after 72 weeks. Type-specific and cross-reactive antibodies and cell-mediated immunity were measured. Results. Type-specific antibodies to HPV6, 11, and 16 were detected in 100% and ≥94% of children at 4 and 72 weeks, respectively, after the third QHPV dose. Corresponding numbers for HPV18 were 97% and 76%, respectively. A fourth QHPV dose increased seropositivity to ≥96% for all vaccine genotypes. Four weeks after the third QHPV dose, 67% of vaccinees seroconverted to HPV31, an HPV16-related genotype not in the vaccine; 69% and 39% of vaccinees developed mucosal HPV16 and 18 immunoglobulin G antibodies, respectively; and 60% and 52% of vaccinees developed cytotoxic T lymphocytes (CTLs) for HPV16 and 31, respectively. Conclusions. Three QHPV doses generated robust and persistent antibodies to HPV6, 11, and 16 but comparatively weaker responses to HPV18. A fourth dose increased antibodies against all vaccine genotypes in an anamnestic fashion. CTLs and mucosal antibodies against vaccine genotypes, as well as cross-reactive antibodies and CTL against nonvaccine genotypes, were detected. PMID:22859825

  14. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole

    1990-01-01

    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  15. Assessment of some innate immune responses in dab (Limanda limanda L.) from the North Sea as part of an integrated biological effects monitoring

    NASA Astrophysics Data System (ADS)

    Skouras, Andreas; Lang, Thomas; Vobach, Michael; Danischewski, Dirk; Wosniok, Werner; Scharsack, Jörn Peter; Steinhagen, Dieter

    2003-10-01

    The marine flatfish dab (Limanda limanda), which lives in direct contact with contaminated sediments, is frequently used as a sentinel species in international monitoring programmes on the biological effects of contaminants. In this study, immune responses were recorded as indicators of sublethal chronic effects of contaminants, in addition to measurement of the induction of mono-oxygenase ethoxyresorufin O-deethylase (EROD) in liver cells, the inhibition of acetylcholin esterase (AChE) in muscle and a quantification of grossly visible diseases and parasites. In total, 336 dab were analysed from five sampling areas in the North Sea, including the German Bight, the Dogger Bank, the Firth of Forth, and two locations close to oil and gas platforms (Ekofisk and Danfield). When considering plasma lysozyme levels, pinocytosis and respiratory burst activity of head kidney leucocytes, a clear gradient could be observed with decreased levels in individuals collected from the Firth of Forth and locations near the oil or gas platforms compared with dab from the Dogger Bank or the German Bight. Individuals with induced EROD activity displayed reduced lysozyme and respiratory burst activities. Lysozyme levels were also reduced in dab with lymphocystis or with nematodes. The data obtained indicate that the assessment of innate immune parameters in a monitoring programme provides supplementary information about immunomodulatory effects associated with the exposure of fish to contaminants. In particular, concentrations of plasma lysozyme, which can be analysed in an easy and inexpensive assay, are considered to be an appropriate parameter for use in a battery of other bioindicators.

  16. A Bivariate Mixture Model for Natural Antibody Levels to Human Papillomavirus Types 16 and 18: Baseline Estimates for Monitoring the Herd Effects of Immunization.

    PubMed

    Vink, Margaretha A; Berkhof, Johannes; van de Kassteele, Jan; van Boven, Michiel; Bogaards, Johannes A

    2016-01-01

    Post-vaccine monitoring programs for human papillomavirus (HPV) have been introduced in many countries, but HPV serology is still an underutilized tool, partly owing to the weak antibody response to HPV infection. Changes in antibody levels among non-vaccinated individuals could be employed to monitor herd effects of immunization against HPV vaccine types 16 and 18, but inference requires an appropriate statistical model. The authors developed a four-component bivariate mixture model for jointly estimating vaccine-type seroprevalence from correlated antibody responses against HPV16 and -18 infections. This model takes account of the correlation between HPV16 and -18 antibody concentrations within subjects, caused e.g. by heterogeneity in exposure level and immune response. The model was fitted to HPV16 and -18 antibody concentrations as measured by a multiplex immunoassay in a large serological survey (3,875 females) carried out in the Netherlands in 2006/2007, before the introduction of mass immunization. Parameters were estimated by Bayesian analysis. We used the deviance information criterion for model selection; performance of the preferred model was assessed through simulation. Our analysis uncovered elevated antibody concentrations in doubly as compared to singly seropositive individuals, and a strong clustering of HPV16 and -18 seropositivity, particularly around the age of sexual debut. The bivariate model resulted in a more reliable classification of singly and doubly seropositive individuals than achieved by a combination of two univariate models, and suggested a higher pre-vaccine HPV16 seroprevalence than previously estimated. The bivariate mixture model provides valuable baseline estimates of vaccine-type seroprevalence and may prove useful in seroepidemiologic assessment of the herd effects of HPV vaccination. PMID:27537200

  17. A Bivariate Mixture Model for Natural Antibody Levels to Human Papillomavirus Types 16 and 18: Baseline Estimates for Monitoring the Herd Effects of Immunization

    PubMed Central

    Vink, Margaretha A.; Berkhof, Johannes; van de Kassteele, Jan; van Boven, Michiel; Bogaards, Johannes A.

    2016-01-01

    Post-vaccine monitoring programs for human papillomavirus (HPV) have been introduced in many countries, but HPV serology is still an underutilized tool, partly owing to the weak antibody response to HPV infection. Changes in antibody levels among non-vaccinated individuals could be employed to monitor herd effects of immunization against HPV vaccine types 16 and 18, but inference requires an appropriate statistical model. The authors developed a four-component bivariate mixture model for jointly estimating vaccine-type seroprevalence from correlated antibody responses against HPV16 and -18 infections. This model takes account of the correlation between HPV16 and -18 antibody concentrations within subjects, caused e.g. by heterogeneity in exposure level and immune response. The model was fitted to HPV16 and -18 antibody concentrations as measured by a multiplex immunoassay in a large serological survey (3,875 females) carried out in the Netherlands in 2006/2007, before the introduction of mass immunization. Parameters were estimated by Bayesian analysis. We used the deviance information criterion for model selection; performance of the preferred model was assessed through simulation. Our analysis uncovered elevated antibody concentrations in doubly as compared to singly seropositive individuals, and a strong clustering of HPV16 and -18 seropositivity, particularly around the age of sexual debut. The bivariate model resulted in a more reliable classification of singly and doubly seropositive individuals than achieved by a combination of two univariate models, and suggested a higher pre-vaccine HPV16 seroprevalence than previously estimated. The bivariate mixture model provides valuable baseline estimates of vaccine-type seroprevalence and may prove useful in seroepidemiologic assessment of the herd effects of HPV vaccination. PMID:27537200

  18. Monitoring Pharmacologically Induced Immunosuppression by Immune Repertoire Sequencing to Detect Acute Allograft Rejection in Heart Transplant Patients: A Proof-of-Concept Diagnostic Accuracy Study

    PubMed Central

    Valantine, Hannah A.; Penland, Lolita; Luikart, Helen; Strehl, Calvin; Cohen, Garrett; Khush, Kiran K.; Quake, Stephen R.

    2015-01-01

    Background It remains difficult to predict and to measure the efficacy of pharmacological immunosuppression. We hypothesized that measuring the B-cell repertoire would enable assessment of the overall level of immunosuppression after heart transplantation. Methods and Findings In this proof-of-concept study, we implemented a molecular-barcode-based immune repertoire sequencing assay that sensitively and accurately measures the isotype and clonal composition of the circulating B cell repertoire. We used this assay to measure the temporal response of the B cell repertoire to immunosuppression after heart transplantation. We selected a subset of 12 participants from a larger prospective cohort study (ClinicalTrials.gov NCT01985412) that is ongoing at Stanford Medical Center and for which enrollment started in March 2010. This subset of 12 participants was selected to represent post-heart-transplant events, with and without acute rejection (six participants with moderate-to-severe rejection and six without). We analyzed 130 samples from these patients, with an average follow-up period of 15 mo. Immune repertoire sequencing enables the measurement of a patient’s net state of immunosuppression (correlation with tacrolimus level, r = −0.867, 95% CI −0.968 to −0.523, p = 0.0014), as well as the diagnosis of acute allograft rejection, which is preceded by increased immune activity with a sensitivity of 71.4% (95% CI 30.3% to 94.9%) and a specificity of 82.0% (95% CI 72.1% to 89.1%) (cell-free donor-derived DNA as noninvasive gold standard). To illustrate the potential of immune repertoire sequencing to monitor atypical post-transplant trajectories, we analyzed two more patients, one with chronic infections and one with amyloidosis. A larger, prospective study will be needed to validate the power of immune repertoire sequencing to predict rejection events, as this proof-of-concept study is limited to a small number of patients who were selected based on several

  19. Impact of IgM Antibodies on Cross-Protection against Pneumococcal Serogroups 6 and 19 after Immunization with 7-Valent Pneumococcal Conjugate Vaccine in Children.

    PubMed

    Cho, Hye-Kyung; Park, In Ho; Burton, Robert L; Kim, Kyung-Hyo

    2016-06-01

    Although it is well known that pneumococcal conjugate vaccines provide cross-protection against some vaccine-related serotypes, these mechanisms are still unclear. This study was performed to investigate the role of cross-protective IgM antibodies against vaccine-related serotypes 6A, 6C, and 19A induced in children aged 12-23 months after immunization with 7-valent pneumococcal conjugate vaccine (PCV7). We obtained serum samples from 18 Korean children aged 12-23 months after a PCV7 booster immunization. The serum IgG and IgM concentrations of serotypes 6B and 19F were measured by enzyme-linked immunosorbent assay (ELISA) in serum. The opsonic indices (OIs) against vaccine serotypes 6B and 19F and vaccine-related serotypes 6A, 6C, and 19A were determined by an opsonophagocytic killing assay (OPA) in IgM-depleted and control serum. Both IgG and IgM antibodies in ELISA and opsonic indices in OPA against serotypes 6B and 19F were demonstrated in the immune serum. IgM depletion decreased the OIs against vaccine serotypes 6B (geometric means of OIs (GMIs) of 3,009 vs. 1,396, 38% reduction) and 19F (1,117 vs. 750, 36% reduction). In addition, IgM depletion markedly decreased the OIs against vaccine-related serotypes 6A (GMIs of 961 vs. 329, 70% reduction), 6C (432 vs. 185, 72% reduction), and 19A (301 vs. 166, 58% reduction). The booster immunization PCV7 induced protective antibodies in the form of both IgG and IgM isotypes. IgM antibodies contributed to eliciting cross-protection against vaccine-related serotypes as well as against vaccine serotypes. PMID:27247505

  20. Impact of IgM Antibodies on Cross-Protection against Pneumococcal Serogroups 6 and 19 after Immunization with 7-Valent Pneumococcal Conjugate Vaccine in Children

    PubMed Central

    Burton, Robert L.

    2016-01-01

    Although it is well known that pneumococcal conjugate vaccines provide cross-protection against some vaccine-related serotypes, these mechanisms are still unclear. This study was performed to investigate the role of cross-protective IgM antibodies against vaccine-related serotypes 6A, 6C, and 19A induced in children aged 12-23 months after immunization with 7-valent pneumococcal conjugate vaccine (PCV7). We obtained serum samples from 18 Korean children aged 12-23 months after a PCV7 booster immunization. The serum IgG and IgM concentrations of serotypes 6B and 19F were measured by enzyme-linked immunosorbent assay (ELISA) in serum. The opsonic indices (OIs) against vaccine serotypes 6B and 19F and vaccine-related serotypes 6A, 6C, and 19A were determined by an opsonophagocytic killing assay (OPA) in IgM-depleted and control serum. Both IgG and IgM antibodies in ELISA and opsonic indices in OPA against serotypes 6B and 19F were demonstrated in the immune serum. IgM depletion decreased the OIs against vaccine serotypes 6B (geometric means of OIs (GMIs) of 3,009 vs. 1,396, 38% reduction) and 19F (1,117 vs. 750, 36% reduction). In addition, IgM depletion markedly decreased the OIs against vaccine-related serotypes 6A (GMIs of 961 vs. 329, 70% reduction), 6C (432 vs. 185, 72% reduction), and 19A (301 vs. 166, 58% reduction). The booster immunization PCV7 induced protective antibodies in the form of both IgG and IgM isotypes. IgM antibodies contributed to eliciting cross-protection against vaccine-related serotypes as well as against vaccine serotypes. PMID:27247505

  1. Cross-sectional study of phoneme and rhyme monitoring abilities in children between 7 and 13 years.

    PubMed

    Sasisekaran, Jayanthi; Weber-Fox, Christine

    2012-04-01

    We investigated phonemic competence in production in three age groups of children - 7 and 8 years, 10 and 11 years, 12 and 13 years-using rhyme and phoneme monitoring. Participants were required to name target pictures silently while monitoring covert speech for the presence or absence of a rhyme or phoneme match. Performance in the verbal tasks was compared to a nonverbal control task in which participants monitored tone sequence pairs for a pattern match. Repeated measures ANOVA revealed significant differences between the three age groups in phoneme monitoring while similar differences were limited to the younger age groups in rhyme monitoring. This finding supported early and on-going acquisition of rhyme- and later acquisition of segment-level units. In addition, the 7 and 8-year-olds were significantly slower in monitoring phonemes within consonant clusters compared to the 10 and 11-year-olds and in monitoring both singleton phonemes and phonemes within clusters compared to the 12 and 13-year-olds. Regression analysis revealed that age accounted for approximately 30% variance in the nonverbal and 60% variance in the verbal monitoring tasks. We attribute the observed differences to the emergence of cognitive processes such as segmentation skills that are critical to performing the verbal monitoring tasks. PMID:23204597

  2. Cross-sectional study of phoneme and rhyme monitoring abilities in children between 7 and 13 years

    PubMed Central

    Sasisekaran, Jayanthi; Weber-Fox, Christine

    2011-01-01

    We investigated phonemic competence in production in three age groups of children – 7 and 8 years, 10 and 11 years, 12 and 13 years—using rhyme and phoneme monitoring. Participants were required to name target pictures silently while monitoring covert speech for the presence or absence of a rhyme or phoneme match. Performance in the verbal tasks was compared to a nonverbal control task in which participants monitored tone sequence pairs for a pattern match. Repeated measures ANOVA revealed significant differences between the three age groups in phoneme monitoring while similar differences were limited to the younger age groups in rhyme monitoring. This finding supported early and on-going acquisition of rhyme- and later acquisition of segment-level units. In addition, the 7 and 8-year-olds were significantly slower in monitoring phonemes within consonant clusters compared to the 10 and 11-year-olds and in monitoring both singleton phonemes and phonemes within clusters compared to the 12 and 13-year-olds. Regression analysis revealed that age accounted for approximately 30% variance in the nonverbal and 60% variance in the verbal monitoring tasks. We attribute the observed differences to the emergence of cognitive processes such as segmentation skills that are critical to performing the verbal monitoring tasks. PMID:23204597

  3. Management of chronic immune thrombocytopenia in children and adolescents: lessons from an Austrian national cross-sectional study of 81 patients.

    PubMed

    Sipurzynski, J; Fahrner, B; Kerbl, R; Crazzolara, R; Jones, N; Ebetsberger, G; Jauk, B; Strenger, V; Wohlmuther, B; Schwinger, W; Lackner, H; Urban, C; Holter, W; Minkov, M; Kager, L; Benesch, M; Seidel, M G

    2016-04-01

    Chronic immune thrombocytopenia (cITP) is often associated with an underlying predisposition towards autoimmunity, recognition of which is relevant to guide treatment. International recommendations on diagnostic steps and therapeutic measures of cITP in childhood exist. However, due to the low prevalence (1-2/100,000) and a variation of availability of immunological and hematological tests and treatments across pediatric units, we postulated that these guidelines are not uniformly adhered to and that immune dysregulation syndromes remained undiscovered. To delineate the current management of children and adolescents with cITP in Austria, we performed a nationwide cross-sectional study. Between 2011 and 2014, 81 children with cITP were seen at seven centers (median age 8.75 years; range 1-17; female:male ratio 47:34) at 641 visits during 180 patient years after diagnosis of cITP (>12 months ITP duration). Additional diagnoses were noted, most frequently immune or autoimmune disorders, hematologic diseases, or infections (in 37.3%, including Evans syndrome, autoimmune lymphoproliferative syndrome, systemic lupus erythematosus, and Fanconi anemia), or other symptoms like bi- or pancytopenia (n=9), lymphoproliferation or granulomatous inflammation (n = 3). Both decision to treat as well as choice of treatment varied: smaller centers tended to observe more frequently, larger centers applied a pattern of treatment modalities that appeared to depend less on bleeding tendency than on center policy. More than 50% of therapeutic interventions occurred in bleedings scores ≤2 (of 5), suggesting a strong psychosocial intention to treat. Platelet increment upon 479 therapeutic interventions of eight types was evaluated, with multiple treatment approaches being pursued sequentially in refractory patients. These data confirm the hypothesis of heterogeneous diagnostic and therapeutic management of cITP in Austrian children and corroborate the need for (1) a precise panel of

  4. Antibody persistence and immune memory 15 months after priming with an investigational tetravalent meningococcal tetanus toxoid conjugate vaccine (MenACWY-TT) in toddlers and young children

    PubMed Central

    Knuf, Markus; Baine, Yaela; Bianco, Véronique; Boutriau, Dominique; Miller, Jacqueline M.

    2012-01-01

    The present extension study, conducted in children originally vaccinated at 12–14 mo or 3–5 y of age, assessed antibody persistence and immune memory induced by an investigational tetravalent meningococcal serogroups A, C, W-135 and Y tetanus toxoid conjugate vaccine (MenACWY-TT). In the original study, participants were randomized to receive one dose of MenACWY-TT or licensed age-appropriate meningococcal control vaccines. Fifteen months post-vaccination, all participants underwent serum sampling to evaluate antibody persistence and participants previously vaccinated as toddlers received a polysaccharide challenge to assess immune memory development.   Exploratory comparisons showed that (1) All children and ≥ 92.3% of the toddlers maintained serum bactericidal (rSBA) titers ≥ 1:8 at 15 mo post MenACWY-TT vaccination; statistically significantly higher rSBA geometric mean titers (GMTs) were observed compared with control vaccines. (2) At one month after polysaccharide challenge, all toddlers primed with MenACWY-TT or with the monovalent serogroup C conjugate vaccine had rSBA titers ≥ 1:8 and ≥ 1:128 for serogroup C and similar rSBA-GMTs; rSBA-GMTs for serogroups A, W-135 and Y were statistically significantly higher in toddlers primed with MenACWY-TT compared with the control vaccine. Thus, a single dose of MenACWY-TT induced persisting antibodies in toddlers and children and immune memory in toddlers. This study has been registered at www.clinicaltrials.gov NCT00126984. PMID:22485049

  5. Age-Dependent Association among Helicobacter pylori Infection, Serum Pepsinogen Levels and Immune Response of Children to Live Oral Cholera Vaccine CVD 103-HgR

    PubMed Central

    Muhsen, Khitam; Lagos, Rosanna; Reymann, Mardi K.; Graham, David Y.; Pasetti, Marcela F.; Levine, Myron M.

    2014-01-01

    Background Through its effects on gastric secretion, we hypothesized that Helicobacter pylori infection may influence oral immunization. Accordingly, we examined the association between H. pylori infection, serum pepsinogen (PG) (measures for H. pylori gastritis) and vibriocidal antibody (a correlate of protection) seroconversion following oral immunization with CVD 103-HgR live cholera vaccine among children of different ages. Methods Sera from 422 Chilean children who were vaccinated with a single dose of CVD 103-HgR were tested by ELISA for serum IgG antibodies to H. pylori, PG I and PG II levels and antibodies to Shigella flexneri 2a lipopolysaccharide and hepatitis A virus (as markers of low socioeconomic status and exposure to enteric pathogens). Results The likelihood of vibriocidal antibody seroconversion following vaccination with CVD 103-HgR was significantly decreased in H. pylori-seropositive children age 6 months to 4 years with PG II>8 µg/L (adjusted OR 0.14 (95% CI 0.03–0.61; P = 0.009), and also in H. pylori seropositives with lower PG II level (adjusted OR 0.34, 95% CI 0.14–0.83; P = 0.017), compared to H. pylori-seronegatives. H. pylori-seropositive children aged 5–9 years with serum PG I>30 µg/L (indicating more severe gastritis) had higher odds of vibriocidal seroconversion than those with lower PG I levels (adjusted OR 4.41, 95%CI 1.26–15.38; P = 0.02). There was no significant association between exposures to S. flexneri 2a or hepatitis A virus and vibriocidal seroconversion. Conclusions As H. pylori gastritis progresses with increasing pediatric age in developing country venues, changes in gastric secretion ensue that we believe explain the observed differences in age-related immune responses to immunization with live oral cholera vaccine. The effect of H. pylori and changes of gastric acid secretion on the immunogenicity of various oral vaccines should be studied in different developing, transitional and industrialized

  6. Assessing barriers to immunization.

    PubMed

    Niederhauser, Victoria; Ferris, Catherine

    2016-05-01

    Parental barriers to childhood immunizations vary among countries, states and communities. There is a plethora of studies that exist to examine barriers to immunizations including many intervention studies designed to improve immunization rates in children. Often, intervention studies designed to minimize barriers and increase immunization uptake among children lack the inclusion of a standardized instrument to measure accurately parental barriers to childhood immunizations before and after interventions. The Searching for Hardships and Obstacles To Shots (SHOTS) survey is a standardized survey instrument to measure parental barriers to childhood immunizations. In several studies, the SHOTS survey has demonstrated consistent reliability and has been validated in diverse populations. The inclusion of the SHOTS survey instrument in studies to examine barriers to childhood immunization will provide researchers and clinicians with a better understanding of parents' individualized barriers to immunizations. Furthermore, use of the SHOTS survey instrument to collect information about parental barriers to immunizations can lead to targeted interventions to minimize these obstacles at the individual and community level and to help us to achieve our national, state and community childhood immunization goals. PMID:26810618

  7. Satellite and in-situ monitoring of urban air pollution in relation with children's asthma

    NASA Astrophysics Data System (ADS)

    Dida, Mariana R.; Zoran, Maria A.

    2013-10-01

    Urban air pollution and especially aerosols have significant negative health effects on urban population, of which children are most exposed for the rapid increase of asthma disease. An allergic reaction to different allergens is a major contributor to asthma in urban children, but new research suggests that the allergies are just one part of a more complex story. Very early exposure to certain components of air pollution can increase the risk of developing of different allergies by age 7. The epidemiological research on the mutagenic effects of airborne particulate matter pointed their capability to reach deep lung regions, being vehicles of toxic substances. The current study presents a spatio-temporal analysis of the aerosol concentrations in relation with meteorological parameters in two size fractions (PM10 and PM2.5) and possible health effects in Bucharest metropolitan area. Both in-situ monitoring data as well as MODIS Terra/Aqua time-series satellite data of particle matter PM2.5 and PM10 concentrations have been used to qualitatively assess distribution of aerosols in the greater metropolitan are of Bucharest comparative with some other little towns in Romania during 2010- 2011 period. It was found that PM2.5 and PM10 aerosols exhibit their highest concentration mostly in the central part of the towns, mainly due to road traffic as well as in the industrialized parts outside of city's centre. Pediatric asthma can be managed through medications prescribed by a healthcare provider, but the most important aspect is to avoid urban locations with high air pollution concentrations of air particles and allergens.

  8. Measuring coverage in MNCH: challenges in monitoring the proportion of young children with pneumonia who receive antibiotic treatment.

    PubMed

    Campbell, Harry; El Arifeen, Shams; Hazir, Tabish; O'Kelly, James; Bryce, Jennifer; Rudan, Igor; Qazi, Shamim Ahmad

    2013-01-01

    Pneumonia remains a major cause of child death globally, and improving antibiotic treatment rates is a key control strategy. Progress in improving the global coverage of antibiotic treatment is monitored through large household surveys such as the Demographic and Health Surveys (DHS) and the Multiple Indicator Cluster Surveys (MICS), which estimate antibiotic treatment rates of pneumonia based on two-week recall of pneumonia by caregivers. However, these survey tools identify children with reported symptoms of pneumonia, and because the prevalence of pneumonia over a two-week period in community settings is low, the majority of these children do not have true pneumonia and so do not provide an accurate denominator of pneumonia cases for monitoring antibiotic treatment rates. In this review, we show that the performance of survey tools could be improved by increasing the survey recall period or by improving either overall discriminative power or specificity. However, even at a test specificity of 95% (and a test sensitivity of 80%), the proportion of children with reported symptoms of pneumonia who truly have pneumonia is only 22% (the positive predictive value of the survey tool). Thus, although DHS and MICS survey data on rates of care seeking for children with reported symptoms of pneumonia and other childhood illnesses remain valid and important, DHS and MICS data are not able to give valid estimates of antibiotic treatment rates in children with pneumonia. PMID:23667338

  9. Adaptive HIV-Specific B Cell-Derived Humoral Immune Defenses of the Intestinal Mucosa in Children Exposed to HIV via Breast-Feeding

    PubMed Central

    Moussa, Sandrine; Jenabian, Mohammad-Ali; Gody, Jean Chrysostome; Léal, Josiane; Grésenguet, Gérard; Le Faou, Alain; Bélec, Laurent

    2013-01-01

    Background We evaluated whether B cell-derived immune defenses of the gastro-intestinal tract are activated to produce HIV-specific antibodies in children continuously exposed to HIV via breast-feeding. Methods Couples of HIV-1-infected mothers (n = 14) and their breastfed non HIV-infected (n = 8) and HIV-infected (n = 6) babies, and healthy HIV-negative mothers and breastfed babies (n = 10) as controls, were prospectively included at the Complexe Pédiatrique of Bangui, Central African Republic. Immunoglobulins (IgA, IgG and IgM) and anti-gp160 antibodies from mother’s milk and stools of breastfed children were quantified by ELISA. Immunoaffinity purified anti-gp160 antibodies were characterized functionally regarding their capacity to reduce attachment and/or infection of R5- and X4- tropic HIV-1 strains on human colorectal epithelial HT29 cells line or monocyte-derived-macrophages (MDM). Results The levels of total IgA and IgG were increased in milk of HIV-infected mothers and stools of HIV-exposed children, indicating the activation of B cell-derived mucosal immunity. Breast milk samples as well as stool samples from HIV-negative and HIV-infected babies exposed to HIV by breast-feeding, contained high levels of HIV-specific antibodies, mainly IgG antibodies, less frequently IgA antibodies, and rarely IgM antibodies. Relative ratios of excretion by reference to lactoferrin calculated for HIV-specific IgA, IgG and IgM in stools of HIV-exposed children were largely superior to 1, indicating active production of HIV-specific antibodies by the intestinal mucosa. Antibodies to gp160 purified from pooled stools of HIV-exposed breastfed children inhibited the attachment of HIV-1NDK on HT29 cells by 63% and on MDM by 77%, and the attachment of HIV-1JRCSF on MDM by 40%; and the infection of MDM by HIV-1JRCSF by 93%. Conclusions The intestinal mucosa of children exposed to HIV by breast-feeding produces HIV-specific antibodies harbouring in vitro major

  10. Motivational incentives and methylphenidate enhance electrophysiological correlates of error monitoring in children with attention deficit/hyperactivity disorder

    PubMed Central

    Groom, Madeleine J; Liddle, Elizabeth B; Scerif, Gaia; Liddle, Peter F; Batty, Martin J; Liotti, Mario; Hollis, Chris P

    2013-01-01

    Background Children with attention deficit hyperactivity disorder (ADHD) are characterised by developmentally inappropriate levels of hyperactivity, impulsivity and/or inattention and are particularly impaired when performing tasks that require a high level of cognitive control. Methylphenidate (MPH) and motivational incentives may help improve cognitive control by enhancing the ability to monitor response accuracy and regulate performance accordingly. Methods Twenty-eight children with DSM-IV ADHD (combined type) aged 9–15 years and pairwise-matched typically developing children (CTRL) performed a go/no-go task in which the incentives attached to performance on no-go trials were manipulated. The ADHD group performed the task off and on their usual dose of MPH. CTRL children performed the task twice but were never medicated. EEG data were recorded simultaneously and two electrophysiological indices of error monitoring, the error-related negativity (ERN) and error positivity (Pe) were measured. Amplitudes of each ERP were compared between diagnostic groups (CTRL, ADHD), medication days (Off MPH, On MPH) and motivational conditions (baseline – low incentive, reward, response cost). Results Error rates were lower in the reward and response cost conditions compared with baseline across diagnostic groups and medication days. ERN and Pe amplitudes were significantly reduced in ADHD compared with CTRL, and were significantly enhanced by MPH. Incentives significantly increased ERN and Pe amplitudes in the ADHD group but had no effect in CTRL. The effects of incentives did not interact with the effects of MPH on either ERP. Effect sizes were computed and revealed larger effects of MPH than incentives on ERN and Pe amplitudes. Conclusions The findings reveal independent effects of motivational incentives and MPH on two electrophysiological markers of error monitoring in children with ADHD, suggesting that each may be important tools for enhancing or restoring cognitive

  11. Pneumococcal pneumonia prevention among adults: is the herd effect of pneumococcal conjugate vaccination in children as good a way as the active immunization of the elderly?

    PubMed

    Prato, Rosa; Fortunato, Francesca; Martinelli, Domenico

    2016-03-01

    The indirect protection of adults as a result of pneumococcal conjugate vaccination of infants has been discussed from different epidemiological points of view. In some countries, including Italy, even after pediatric vaccination, vaccine serotypes are still responsible for most pneumonia and invasive diseases in the elderly. Although the Community-Acquired Pneumonia Immunization Trial in Adults (CAPITA) produced encouraging results, it has not showed the efficacy of the 13-valent conjugate vaccine in preventing pneumococcal community-acquired pneumonia regardless of the number of episodes and serotype. Addressing these points by monitoring the direct impact of adult vaccination in real life distinguished from the effects of herd immunity will assist public health decision-making on the most effective adult pneumococcal vaccination strategies. PMID:26652736

  12. The value of Integrated Pulmonary Index (IPI) monitoring during endoscopies in children.

    PubMed

    Garah, Jamal; Adiv, Orly Eshach; Rosen, Irit; Shaoul, Ron

    2015-12-01

    The Integrated Pulmonary Index (IPI) is an algorithm included in commercially available monitors that constitutes a representation of 4 parameters: EtCO2, RR, SpO2 and PR. The IPI index has been validated for adults and children older than 1 year of age. In this study we aimed to study the value of IPI monitoring during pediatric endoscopic procedures. Our data consisted of 124 measurements of 109 patients undergoing different procedures (upper endoscopy 84 patients, colonoscopy 6 patients, both 9 patients). The data was divided into 3 groups based on the drug type used: propofol only, 5 patients (group 1); propofol & midazolam, 89 patients (group 2); propofol, midazolam and Fentanyl, 15 patients (group 3). Patients in group 2 and 3 had significantly higher IPI levels than group 1. Significantly lower IPI values were found between ages 4-6 compared to 7-12 years old. High midazolam dose was associated with lower IPI levels during the procedure. No significant differences were found for propofol doses. Patients who had an anesthetist present had lower IPI levels during the procedure compared to those who did not. No differences were noted between the different procedures. IPI alerted all apnea episodes (58 events, IPI = 1) and hypoxia (26 events, IPI ≤ 3) episodes, whereas pulse oximetry captured only the hypoxia episodes (IPI sensitivity = 1, specificity 0.98, positive predictive value 0.95). Younger patient age, use of propofol alone, higher midazolam doses and presence of anesthetist are all associated with lower IPI levels. PMID:25666393

  13. Safety, Humoral and Cell Mediated Immune Responses to Two Formulations of an Inactivated, Split-Virion Influenza A/H5N1 Vaccine in Children

    PubMed Central

    Chotpitayasunondh, Tawee; Thisyakorn, Usa; Pancharoen, Chitsanu; Pepin, Stephanie; Nougarede, Nolwenn

    2008-01-01

    Background Highly pathogenic influenza A/H5N1 has caused outbreaks in wild birds and poultry in Asia, Africa and Europe. It has also infected people, especially children, causing severe illness and death. Although the virus shows limited ability to transmit between humans, A/H5N1 represents a potential source of the next influenza pandemic. This study assesses the safety and immunogenicity of aluminium hydroxide adjuvanted (Al) and non adjuvanted influenza A/Vietnam/1194/2004 NIBRG-14 (H5N1) vaccine in children. Methods and Findings In a Phase II, open, randomised, multicentre trial 180 children aged 6 months to 17 years received two injections, 21 days apart, of vaccine containing either: 30 µg haemagglutinin (HA) with adjuvant (30 µg+Al) or 7.5 µg HA without adjuvant. An additional 60 children aged 6–35 months received two “half dose” injections (ie 15 µg+Al or 3.8 µg). Safety was followed for 21 days after vaccination. Antibody responses were assessed 21 days after each injection and cellular immune responses were explored. Vaccination appeared well tolerated in all age groups. The 30 µg+Al formulation was more immunogenic than 7.5 µg in all age groups: in these two groups 79% and 46% had haemagglutinination inhibition antibody titres ≥32 (1/dil). Among 6–35 month-olds, the full doses were more immunogenic than their half dose equivalents. Vaccination induced a predominantly Th2 response against H5 HA. Conclusions This influenza A(H5N1) vaccine was well tolerated and immunogenic in children and infants, with Al adjuvant providing a clear immunogenic advantage. These results demonstrate that an H5N1 Al-adjuvanted vaccine, previously shown to be immunogenic and safe in adults, can also be used in children, the group most at risk for pandemic influenza. Trial Registration ClinicalTrials.gov NCT00491985 PMID:19112513

  14. Accuracy evaluation of blood glucose monitoring systems in children on overnight closed-loop control.

    PubMed

    DeSalvo, Daniel J; Shanmugham, Satya; Ly, Trang T; Wilson, Darrell M; Buckingham, Bruce A

    2014-09-01

    This pilot study evaluated the difference in accuracy between the Bayer Contour® Next (CN) and HemoCue® (HC) glucose monitoring systems in children with type 1 diabetes participating in overnight closed-loop studies. Subjects aged 10-18 years old were admitted to a clinical research center and glucose values were obtained every 30 minutes overnight. Glucose values were measured using whole blood samples for CN and HC readings and results were compared to Yellow Springs Instrument (YSI) reference values obtained with plasma from the same sample. System accuracy was compared using mean absolute relative difference (MARD) and International Organization for Standardization (ISO) accuracy standards. A total of 28 subjects were enrolled in the study. Glucose measurements were evaluated at 457 time points. CN performed better than HC with an average MARD of 3.13% compared to 10.73% for HC (P < .001). With a limited sample size, CN met ISO criteria (2003 and 2013) at all glucose ranges while HC did not. CN performed very well, and would make an excellent meter for future closed-loop studies outside of a research center. PMID:24876427

  15. Monitoring Web Site Usage of e-Bug: A Hygiene and Antibiotic Awareness Resource for Children

    PubMed Central

    Rajapandian, Vijayamaharaj; Eley, Charlotte V; Hoekstra, Beverley A; Lecky, Donna M; McNulty, Cliodna AM

    2015-01-01

    Background e-Bug is an educational resource which teaches children and young people about microbes, hygiene, infection, and prudent antibiotic use. The e-Bug resources are available in over 22 different languages and they are used widely across the globe. The resources can be accessed from the e-Bug website. Objective The objective of this study was to analyze the usage of the e-Bug website in order to understand how users access the website, where and when they access the site, and to review variation in use across the different areas of the site. Methods The usage statistics for the e-Bug website were monitored by Google Analytics between September 2010 and August 2013. Results The statistics show the website had over 324,000 visits during the three years, from just under 250,000 visitors, with the number of visitors increasing year after year. Visitors accessed the website from 211 different countries, with more than 267,000 documents downloaded. The majority of visitors were from the United Kingdom and visited the English website, although countries such as France and Portugal were also frequent visitors. Conclusions These website statistics confirm that e-Bug is frequently used across Europe and highlight that e-Bug use has expanded across the world. The findings from this report will be used to inform future modifications or updates to the materials, as well as the development of new educational resources. PMID:26567127

  16. Critical assessment of the use of growth monitoring for identifying high risk children in primary health care programmes.

    PubMed Central

    Briend, A.; Bari, A.

    1989-01-01

    OBJECTIVE--To see whether change in weight was a more useful index than weight for age in assessing the risk of dying among malnourished children. DESIGN--Prospective cohort study. SETTING--Rural community in Bangladesh being served by international health organisation. PARTICIPANTS--1011 Children aged under 5, of whom 66 died. END POINT--Efficient screening method for identifying malnourished children at risk of dying. MEASUREMENTS AND MAIN RESULTS--Weight was measured every month. Weight for age and monthly change in weight averaged over one and three months were calculated. Sensitivity and specificity curves were used to compare the values of these two variables in identifying children with a high risk of dying. Weight for age was more sensitive than change in weight at all levels of specificity. Changes in weight, however, were independently related to the risk of dying even when intercurrent diseases and low weight for age were taken into account. CONCLUSIONS--For identifying children with a high risk of dying weight for age is a more efficient screening tool than a recent change in weight. Growth monitoring as currently recommended for primary health care programmes in developing countries does not seem to be the most effective approach in identifying children in need of urgent help. PMID:2503147

  17. Immune System

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Immune System KidsHealth > For Teens > Immune System Print A A ... could put us out of commission. What the Immune System Does The immune (pronounced: ih-MYOON) system, which ...

  18. Comparative analysis of lymphocyte activation marker expression and cytokine secretion profile in stimulated human peripheral blood mononuclear cell cultures: an in vitro model to monitor cellular immune function.

    PubMed

    Reddy, Manjula; Eirikis, Edward; Davis, Cuc; Davis, Hugh M; Prabhakar, Uma

    2004-10-01

    Activation of lymphocytes is a complex, yet finely regulated cascade of events that results in the expression of cytokine receptors, production and secretion of cytokines and expression of several cell surface molecules that eventually lead to divergent immune responses. Assessing the qualitative and quantitative nature of lymphocyte function following immunotherapy provides valuable information about the immune responses mediated by a therapeutic agent. To facilitate evaluation of the immunomodulatory activity of therapeutic agents, we have established a platform of in vitro immunoassays with normal human peripheral blood mononuclear cells (PBMCs) treated with several polyclonal activators that are known to exhibit different modes of action. We evaluated the kinetics of cell surface marker expression and cytokine release from PBMCs stimulated in parallel with various activating agents over a time course. These stimulating agents induced early (CD69 and CD71) and late (CD25 and HLA-DR) activation markers to varying antigen densities, indicated different cytokine profiles, and showed differential inhibition with dexamethasone (DEX), an inhibitor of early signaling events. Based on the association or correlation of the kinetics of activation marker expression and secreted cytokines, the results of our study indicate the appropriate time points for the simultaneous measurement of both these activation products. This study defines the kinetics for both measures of T cell activation and provides a comprehensive review with various polyclonal activators that can serve as a reference for monitoring lymphocyte function in clinical study samples. PMID:15541283

  19. Persistence of hepatitis A virus antibodies after primary immunization and response to revaccination in children and adolescents with perinatal HIV exposure

    PubMed Central

    Gouvêa, Aída de Fátima Thomé Barbosa; Pinto, Maria Isabel de Moraes; Miyamoto, Maristela; Machado, Daisy Maria; Pessoa, Silvana Duarte; do Carmo, Fabiana Bononi; Beltrão, Suênia Cordeiro de Vasconcelos; Succi, Regina Célia de Menezes

    2015-01-01

    OBJECTIVE: To assess possible factors associated with the loss of antibodies to hepatitis A 7 years after the primary immunization in children of HIV-infected mothers and the response to revaccination in patients seronegative for hepatitis A. METHODS: Quantification of HAV antibodies by electrochemiluminescence was performed in 39 adolescents followed up at the Pediatric Aids Clinic of Federal University of São Paulo (Unifesp): 29 HIV-infected (HIV group) (median age: 12.8 years) and 10 HIV-exposed but non-infected (ENI group) (median age: 13.4 years). All of them received two doses of HAV vaccine (Havrix(r)) in 2002. RESULTS: The median age at primary immunization (PI) was 5.4 years for HIV group and 6.5 years for ENI group. All children, from both groups, had antibodies to HAV >20 mIU/mL after PI. Seven years later, the ENI group showed a median concentration of antibodies = 253.5 mIU/mL, while the HIV group = 113.0 mIU/mL (Mann-Whitney test, p=0.085). All ENI group and 23/29 (79.3%) from HIV group mantained HAV antibodies 7 years after PI. The levels of hepatitis A antibodies in the primary vaccination were the only factor independently associated with maintaining these antibodies for 7 years. The group that lost HAV seropositivity was revaccinated and 83.3% (5/6) responded with antibodies >20 mUI/mL. CONCLUSIONS: The antibodies levels acquired in the primary vaccination in the HIV group were the main factor associated with antibodies loss after HAV immunization. PMID:25918013

  20. Altered Immune Function Associated with Disordered Neural Connectivity and Executive Dysfunctions: A Neurophysiological Study on Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Han, Yvonne M. Y.; Chan, Agnes S.; Sze, Sophia L.; Cheung, Mei-Chun; Wong, Chun-kwok; Lam, Joseph M. K.; Poon, Priscilla M. K.

    2013-01-01

    Previous studies have shown that children with autism spectrum disorders (ASDs) have impaired executive function, disordered neural connectivity, and abnormal immunologic function. The present study examined whether these abnormalities were associated. Seventeen high-functioning (HFA) and 17 low-functioning (LFA) children with ASD, aged 8-17…

  1. Kids Count: Using Output Measures to Monitor Children's Use of Reference Services.

    ERIC Educational Resources Information Center

    Walter, Virginia A.

    1995-01-01

    Examines three publications as guides for evaluating library reference services and the potential of one for the development of children's services. Highlights include public library planning, limitations, output measures for children's materials and information services, and the library role. (AEF)

  2. Applying a performance monitoring framework to increase reach and adoption of children's healthy eating and physical activity programs.

    PubMed

    Farrell, Louise; Lloyd, Beverley; Matthews, Rhonda; Bravo, Andrea; Wiggers, John; Rissel, Chris

    2014-01-01

    The allocation of a significant amount of new funding for health promotion in Australia through the National Partnership Agreement on Preventive Health (2009-14) created a unique opportunity to implement a comprehensive approach to the prevention of chronic diseases and demonstrate significant health improvements. Building on existing health promotion infrastructure in Local Health Districts, the NSW Ministry of Health adopted a scaled-up state-wide capacity-building model, designed to alter policies and practices in key children's settings to increase healthy eating and physical activity among children. NSW also introduced a performance monitoring framework to track implementation and impacts. This paper describes the model that NSW developed for monitoring state-wide programs in the Children's Healthy Eating and Physical Activity Program and presents the model's application to early childhood education and care and primary school settings, including current results. This approach to monitoring the scaling up of program implementation at the state-wide level has potential for more widespread application in other policy areas in NSW. PMID:25828447

  3. Health workers sensitization: effects on perceived quality of immunization services among mothers of under five children in Ilorin, North Central Nigeria.

    PubMed

    Goodman, O O; Aderibigbe, S A; Sekoni, O O; Osagbemi, G K; Akande, T M

    2013-09-01

    Clients' satisfaction with services received is an important dimension of evaluation that is examined only rarely in developing countries. Health care professionals have always acknowledged that satisfying the consumers at some level is essential to providing services of high quality. This is a quasi-experimental study. The study group included 150 mothers bringing their children for immunization at Alanamu Health Centre, Ilorin. The control group included 150 mothers bringing their children for immunization at Okelele Health Centre. Total population of mothers bringing their children for vaccines against tuberculosis/poliomyelitis/hepatitis B (BCG/ OPV/HBV) and against diphterite-pertussis-tetanus (DPT)/OPV/ HBV were recruited sequentially until sample size was attained. Mean waiting time at pre-intervention was 82.7 +/- 32.5 and 90.4 +/- 41.7 minutes for the study and control groups respectively. Post intervention, there was a significant decrease (p < 0.05) in the estimated waiting time in the study group (mean = 48.0 +/- 24.4 minutes) while there was no observed difference in the control p > 0.05 (mean = 88.4 +/- 40.6 minutes). Perceived adequacy of information on services being provided by the health facility was low (58%) in the study group while it was relatively higher in the control group (80%) but there was a significant increase in proportion of those that felt information was adequate only in the study group (p < 0.05) at post intervention. Waiting time in health facilities by clients should be reduced as this may give clients a positive perception of the service they have come to access. Information dissemination to clients should be encouraged among health workers as this would affect clients' knowledge and also quality of health care delivery. PMID:24783892

  4. Organising for immunization.

    PubMed

    Michie, S

    1993-06-01

    In the late 1960s, health workers from a mission hospital in rural Zambia began registering children under 14 years old within 30 miles of the hospital (about 3000 children) by incorporating the cooperation of community leaders. They wanted to give every 0-4 year old child a Road to Health card and every 5-14 year old a vaccine record card and to promote the significance of immunization to parents and community leaders. The mission hospital established mobile health units to conduct regular visits in the center of villages. Staff hugh scales from a tree and borrowed a table to conduct the clinic. They kept a good relationship and communication with the community, leading successful education and communication activities. By 1988, many younger mothers were unfamiliar with a measles or whooping cough epidemic so they tended to not have their infants immunized. Epidemics began killing children nationwide, frightening these mothers so they brought their children for immunizations. The medical mission achieved an 85-90% vaccination coverage rate with immunization clinic attendance climbing quickly. 1 mother even walked 30 miles to have her infant injected with the DPT vaccine, but 10 years earlier, she did not bring her children. Further, measles had not reached her area because the immunization level was so high that it stopped the epidemic. PMID:12318293

  5. Vitamin A supplements, routine immunization, and the subsequent risk of Plasmodium infection among children under 5 years in sub-Saharan Africa

    PubMed Central

    Hollm-Delgado, Maria-Graciela; Piel, Frédéric B; Weiss, Daniel J; Howes, Rosalind E; Stuart, Elizabeth A; Hay, Simon I; Black, Robert E

    2015-01-01

    Recent studies, partly based on murine models, suggest childhood immunization and vitamin A supplements may confer protection against malaria infection, although strong evidence to support these theories in humans has so far been lacking. We analyzed national survey data from children aged 6–59 months in four sub-Saharan African countries over an 18-month time period, to determine the risk of Plasmodium spp. parasitemia (n=8390) and Plasmodium falciparum HRP-2 (PfHRP-2)-related antigenemia (n=6121) following vitamin A supplementation and standard vaccination. Bacille Calmette Guerin-vaccinated children were more likely to be PfHRP-2 positive (relative risk [RR]=4.06, 95% confidence interval [CI]=2.00–8.28). No association was identified with parasitemia. Measles and polio vaccination were not associated with malaria. Children receiving vitamin A were less likely to present with parasitemia (RR=0.46, 95% CI=0.39–0.54) and antigenemia (RR=0.23, 95% CI=0.17–0.29). Future studies focusing on climate seasonality, placental malaria and HIV are needed to characterize better the association between vitamin A and malaria infection in different settings. DOI: http://dx.doi.org/10.7554/eLife.03925.001 PMID:25647726

  6. Vitamin A supplements, routine immunization, and the subsequent risk of Plasmodium infection among children under 5 years in sub-Saharan Africa.

    PubMed

    Hollm-Delgado, Maria-Graciela; Piel, Frédéric B; Weiss, Daniel J; Howes, Rosalind E; Stuart, Elizabeth A; Hay, Simon I; Black, Robert E

    2014-01-01

    Recent studies, partly based on murine models, suggest childhood immunization and vitamin A supplements may confer protection against malaria infection, although strong evidence to support these theories in humans has so far been lacking. We analyzed national survey data from children aged 6-59 months in four sub-Saharan African countries over an 18-month time period, to determine the risk of Plasmodium spp. parasitemia (n=8390) and Plasmodium falciparum HRP-2 (PfHRP-2)-related antigenemia (n=6121) following vitamin A supplementation and standard vaccination. Bacille Calmette Guerin-vaccinated children were more likely to be PfHRP-2 positive (relative risk [RR]=4.06, 95% confidence interval [CI]=2.00-8.28). No association was identified with parasitemia. Measles and polio vaccination were not associated with malaria. Children receiving vitamin A were less likely to present with parasitemia (RR=0.46, 95% CI=0.39-0.54) and antigenemia (RR=0.23, 95% CI=0.17-0.29). Future studies focusing on climate seasonality, placental malaria and HIV are needed to characterize better the association between vitamin A and malaria infection in different settings. PMID:25647726

  7. Monitoring

    DOEpatents

    Orr, Christopher Henry; Luff, Craig Janson; Dockray, Thomas; Macarthur, Duncan Whittemore

    2004-11-23

    The invention provides apparatus and methods which facilitate movement of an instrument relative to an item or location being monitored and/or the item or location relative to the instrument, whilst successfully excluding extraneous ions from the detection location. Thus, ions generated by emissions from the item or location can successfully be monitored during movement. The technique employs sealing to exclude such ions, for instance, through an electro-field which attracts and discharges the ions prior to their entering the detecting location and/or using a magnetic field configured to repel the ions away from the detecting location.

  8. Persistence of T-cell immune response induced by two acellular pertussis vaccines in children five years after primary vaccination.

    PubMed

    Palazzo, Raffaella; Carollo, Maria; Bianco, Manuela; Fedele, Giorgio; Schiavoni, Ilaria; Pandolfi, Elisabetta; Villani, Alberto; Tozzi, Alberto E; Mascart, Françoise; Ausiello, Clara M

    2016-01-01

    The resurgence of pertussis suggests the need for greater efforts to understand the long-lasting protective responses induced by vaccination. In this paper we dissect the persistence of T memory responses induced by primary vaccination with two different acellular pertussis (aP) vaccines, hexavalent Hexavac® vaccine (Hexavac) (Sanofi Pasteur MSD) and Infanrix hexa® (Infanrix) (Glaxo-SmithKline Biologicals). We evaluated magnitude and duration of T-cell responses to pertussis toxin (PT) by measuring T-cell proliferation, cytokines (IL-2 and IFNγ) production and memory subsets in two groups of children 5 years after primary vaccination. Some of the enrolled children received only primary vaccination, while others had the pre-school boost dose. Positive T-cell responses to PT were detected in 36% of children. Percentage of responsive children, T-cell proliferation and CD4IL-2+ cells were significantly higher in the children primed with Hexavac than in those who received Infanrix vaccine. No major effects of the boost on PT-specific proliferation were observed. Overall, our data documented a persistence of T-cell memory against PT in a minor fraction of children 5 years after primary vaccination. The different responses induced by Hexavac and Infanrix vaccine could rely on differences in PT inactivation process or excipients/adjuvants formulations. PMID:26922984

  9. Air pollutant monitoring for the East Bay Children's Respiratory Health Study

    SciTech Connect

    Singer, Brett C.; Hotchi, Toshifumi; Hodgson, Alfred T.

    2002-11-01

    This report describes the methodology and presents the summary results of the air pollutant monitoring program conducted by Lawrence Berkeley National Laboratory in support of the East Bay Children's Respiratory Health Study. The full study is examining the effects of chronic exposure to traffic-related pollutants on respiratory health among 3rd and 4th grade children attending ten neighborhood elementary schools in the San Francisco East Bay Area (Hayward, San Leandro and Oakland, CA). The demographically similar schools are located at varying distances from the I-880 and CA-92 freeways. Several schools were selected because they are located within 300 m in the predominant downwind direction (east) from either of the freeways. Measurements of multiple pollutants were made outdoors at the schools over 1-2 week intervals for 14 weeks in spring and eight weeks in fall 2001 using a custom-designed and validated package of commercially available monitoring equipment. Particulate matter was sampled over all hours (24 h per day) or during schools hours only with battery-operated programmable pumps and inlet devices for PM{sub 10} and PM{sub 2.5}. These pumps were modified to allow for up to 10 days of continuous operation. Fine particle mass and black carbon (BC) were determined from the collected filters. Nitrogen oxides (NO{sub x} and NO{sub 2}) were measured with passive samplers. Carbon monoxide (CO) was measured continuously with an electrochemical sensor. Gasoline-related volatile organic compounds (VOCs) were measured with passive samplers during three 4-week intervals in spring 2001 and two 4-week periods in early 2002. All samplers were deployed in a metal cabinet located outside at each school. Ranges of study average pollutant concentrations (all-hours) at the ten individual schools were: NO{sub x}, 33-68 ppb; NO{sub 2}, 19-31 ppb; PM{sub 10} mass, 27-32 {micro}g/m{sup 3}; PM{sub 2.5} mass, 12-15 {micro}g/m{sup 3}; and BC associated with PM{sub 2.5}, 0

  10. Time trends in pediatric Herpes zoster hospitalization rate after Varicella immunization.

    PubMed

    Critselis, Elena; Theodoridou, Kalliopi; Alexopoulou, Zoi; Theodoridou, Maria; Papaevangelou, Vassiliki

    2016-06-01

    Herpes zoster (HZ) is an emerging concern for public health officials. The aim of this study was to determine whether universal Varicella immunization implemented in 2004 had an impact on HZ hospitalization in immunocompetent children in Greece. All HZ hospitalizations were recorded during the period 1999-2011. The overall attributable hospitalization rate was 13.89 cases/1000 hospital admissions (95%CI: 11.69-16.38 cases/1000 hospital admissions). HZ hospitalization rate remained unchanged during the study period. These data provide a basis for monitoring HZ hospitalization rate among children following universal toddler immunization. PMID:27322864

  11. The State of the World's Children 1985: A Report by United Nations Children's Fund (UNICEF).

    ERIC Educational Resources Information Center

    Early Child Development and Care, 1985

    1985-01-01

    Reports four basic strategies of the current child survival revolution in the world: use of oral rehydration therapy (ORT) for preventing and treating diarrheal dehydration (the biggest single killer of children in the modern world), growth monitoring to prevent child malnutrition, breast-feeding, and immunization to provide protection against six…

  12. Immune thrombocytopenia.

    PubMed

    Maher, George M

    2014-10-01

    Immune thrombocytopenia (ITP) in children is a relatively uncommon and generally benign condition presenting as abrupt onset of bruising, petechiae and thrombocytopenia in an otherwise healthy child due to production of anti-platelet autoantibodies. Diagnosis is largely clinical and laboratory investigation should be kept to a minimum. Indications for treatment have not been standardized and include bleeding, parental anxiety and quality of life. Multiple treatments are available that have been proven to increase the platelet count; the most commonly employed include IVIG, steroids and WinRho (anti-D). Intracranial hemorrhage is the most serious potential complication but is extremely rare and splenectomy is reserved for chronically symptomatic patients who have not responded to other modalities. Identification of molecular targets may be a promising avenue for future research. PMID:25423768

  13. e-Monitoring of Asthma Therapy to Improve Compliance in children using a real-time medication monitoring system (RTMM): the e-MATIC study protocol

    PubMed Central

    2013-01-01

    Background Many children with asthma do not have sufficient asthma control, which leads to increased healthcare costs and productivity loss of parents. One of the causative factors are adherence problems. Effective interventions improving medication adherence may therefore improve asthma control and reduce costs. A promising solution is sending real time text-messages via the mobile phone network, when a medicine is about to be forgotten. As the effect of real time text-messages in children with asthma is unknown, the primary aim of this study is to determine the effect of a Real Time Medication Monitoring system (RTMM) with text-messages on adherence to inhaled corticosteroids (ICS). The secondary objective is to study the effects of RTMM on asthma control, quality of life and cost-effectiveness of treatment. Methods A multicenter, randomized controlled trial involving 220 children (4–11 years) using ICS for asthma. All children receive an RTMM-device for one year, which registers time and date of ICS doses. Children in the intervention group also receive tailored text-messages, sent only when a dose is at risk of omission. Primary outcome measure is the proportion of ICS dosages taken within the individually predefined time-interval. Secondary outcome measures include asthma control (monthly Asthma Control Tests), asthma exacerbations, healthcare use (collected from hospital records, patient reports and pharmacy record data), and disease-specific quality of life (PAQLQ questionnaire). Parental and children’s acceptance of RTMM is evaluated with online focus groups and patient questionnaires. An economic evaluation is performed adopting a societal perspective, including relevant healthcare costs and parental productivity loss. Furthermore, a decision-analytic model is developed in which different levels of adherence are associated with clinical and financial outcomes. Also, sensitivity analyses are carried out on different price levels for RTMM. Discussion

  14. The Effect of Delayed-JOLs and Sentence Generation on Children's Monitoring Accuracy and Regulation of Idiom Study

    ERIC Educational Resources Information Center

    van Loon, Mariëtte H.; de Bruin, Anique B. H.; van Gog, Tamara; van Merriënboer, Jeroen J. G.

    2013-01-01

    When studying verbal materials, both adults and children are often poor at accurately monitoring their level of learning and regulating their subsequent restudy of materials, which leads to suboptimal test performance. The present experiment investigated how monitoring accuracy and regulation of study could be improved when learning idiomatic…

  15. Community Monitoring Systems: Tracking and Improving the Well-Being of America's Children and Adolescents. NIH Publication No. 07-5852

    ERIC Educational Resources Information Center

    National Institute on Drug Abuse (NIDA), 2007

    2007-01-01

    Monitoring the well-being of children and adolescents is a critical component of efforts to prevent psychological, behavioral, and health problems and to promote their successful development. Research during the past 40 years has helped identify aspects of child and adolescent functioning that are important to monitor. These aspects, which…

  16. What Strategies Are Appropriate for Monitoring Children outside of Family Care and Evaluating the Impact of the Programs Intended to Serve Them?

    ERIC Educational Resources Information Center

    Ager, Alastair; Zimmerman, Cathy; Unlu, Kathy; Rinehart, Richard; Nyberg, Beverly; Zeanah, Charles; Hunleth, Jean; Bastiaens, Ida; Weldy, Andre; Bachman, Gretchen; Blum, Alexander B.; Strottman, Kathleen

    2012-01-01

    Objectives: To strengthen the evidence-base for policy and practice for support of children outside of family care requires effective, efficient and sustainable mechanisms for monitoring and evaluation. Toward that end, two core questions guided a systematic review of evidence: What strategies are appropriate for monitoring the needs and…

  17. 75 FR 61506 - Advisory Committee on Immunization Practices (ACIP)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... HUMAN SERVICES Centers for Disease Control and Prevention Advisory Committee on Immunization Practices...; Pertussis vaccine; Influenza vaccines; the 2011 Immunization Schedule for adults, children & adolescents... Person for More Information: Leola Mitchell, National Center for Immunization and Respiratory...

  18. Clinical and Epidemiologic Features of Severe Viral Gastroenteritis in Children: A 3-Year Surveillance, Multicentered Study in Taiwan With Partial Rotavirus Immunization.

    PubMed

    Chen, Chih-Jung; Wu, Fang-Tzy; Huang, Yhu-Chering; Chang, Wan-Chi; Wu, Ho-Sheng; Wu, Ching-Yi; Lin, Jen-Shiou; Huang, Fu-Chen; Hsiung, Chao A

    2015-08-01

    The global epidemiological landscape of childhood acute gastroenteritis (AGE) is changing after the introduction of 2 effective rotavirus vaccines in 2006. A comprehensive evaluation for viral etiology of childhood AGE in Taiwan, where rotavirus vaccination was provided by the private sector since 2006, is lacking.From 2009 to 2011, children younger than 5 years of age with AGE who were hospitalized at 3 sentinel hospitals were enrolled in this surveillance study. Stool specimens were tested for rotavirus, norovirus, enteric adenovirus, and astrovirus. The epidemiologic and clinical information was collected by questionnaire-based interviews and chart reviews.Viral agents were detected in 1055 (37.5%) of 2810 subjects, with rotavirus (21.2%) being the leading cause of disease, followed by norovirus (14.9%), enteric adenovirus (3.74%), astrovirus (2.10%), and a mixture of at least 2 of 4 above-mentioned viruses (4.06%). The majority (56%) of the viral AGE occurred in children <2 years of age. Rotavirus and norovirus were detected more frequently in cool seasons (P < 0.0001 for both), whereas no seasonal variation was observed for adenovirus and astrovirus. Adult households with diarrhea and a Vesikari score >10 were independent factors respectively associated with an increased risk of norovirus (adjusted odds ratio [aOR] 9.034, P = 0.0003) and rotavirus (aOR, 3.284, P < 0.0001) infections. Rotavirus immunization and female gender were protective factors against rotavirus (aOR, 0.198, P < 0.0001) and astrovirus (aOR, 0.382, P = 0.0299) infections, respectively.Rotavirus and norovirus are the 2 most important viral agents of childhood AGE in Taiwan with partial rotavirus immunization. In addition, different enteric viruses are associated with distinct epidemiologic and clinical features. PMID:26287425

  19. Age at Assessment a Critical Factor When Monitoring Early Communicative Skills in Children with Galactosaemia

    ERIC Educational Resources Information Center

    Lewis, Fiona M.; DeJonge, Shannon M.; Coman, David J.

    2014-01-01

    Sub-optimal language development is associated with the metabolic disorder galactosaemia (GAL). Some children with GAL are identified with language impairment from the initial stages of language learning, but a subset of children may exhibit disrupted developmental gains in speech and language skill after a period of age-appropriate skill…

  20. Systematic Monitoring of Young Children's Social-Emotional Competence and Challenging Behaviors

    ERIC Educational Resources Information Center

    Classen, Audra; Cheatham, Gregory A.

    2015-01-01

    Many children in preschool need support developing appropriate social-emotional competencies. Supportive early educators build confidence in young children to express and regulate emotions, develop solutions to problems, interact with peers, and persist when faced with challenges (Denham, 2006; Webster-Stratton & Reid, 2004). This article…

  1. A feasibility study of wearable activity monitors for pre-adolescent school-aged children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is key in the fight against childhood obesity. The objective of this study was to examine the feasibility of using certain wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 years to assess ac...

  2. A feasibility study of wearable activity monitors for pre-adolescent school-age children

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding physical activity is the key to fighting childhood obesity. The objective of this study was to examine the feasibility of using certian wearable devices to measure physical activity among children. A qualitative study was conducted with 25 children aged 7 to 10 yearsto assess acceptabi...

  3. Immune Restoration

    MedlinePlus

    ... marrow cells immune to HIV infection. Letting the immune system repair itself: CD4 counts have increased for many ... have taken ART. Some scientists believe that the immune system might be able to heal and repair itself ...

  4. Immune response

    MedlinePlus Videos and Cool Tools

    ... cells. T cells are responsible for cell-mediated immunity. This type of immunity becomes deficient in persons with HIV, the virus ... blood. B lymphocytes provide the body with humoral immunity as they circulate in the fluids in search ...

  5. Long-term anti-HBs antibody persistence and immune memory in children and adolescents who received routine childhood hepatitis B vaccination.

    PubMed

    Behre, Ulrich; Bleckmann, Gerhard; Crasta, Priya Diana; Leyssen, Maarten; Messier, Marc; Jacquet, Jeanne-Marie; Hardt, Karin

    2012-06-01

    This paper presents data from two studies that evaluated 5-y and 10-y persistence of antibodies against hepatitis B (HBV) surface antigen (anti-HBs) and immune response to an HBV vaccine challenge in children and adolescents who had received three doses of a HBV vaccine in infancy as part of routine clinical practice [NCT00519649/NCT00984139]. Anti-HBs antibody concentrations ≥ 10 mIU/ml persisted in 83.3% (95% confidence interval [CI]: 78.5–87.5) and 78.3% (95% CI: 73.1–83.0) of subjects aged 7–8 y and 12–13 y, respectively 5–10 y after infant vaccination. One month postchallenge dose, 98.2% (95% CI: 95.9–99.4) and 93.7% (95% CI: 90.2–96.2) of subjects in the two age groups, respectively had anti-HBs antibody concentrations ≥ 100 mIU/ml. Overall, 99.6% (95% CI: 98–100) and 97.2% (95% CI: 94.5–98.8) of subjects aged 7–8 y and 12–13 y mounted an anamnestic response to the HBV challenge dose, which was well-tolerated. Healthy children aged 7–8 y and adolescents aged 12–13 y received three doses of a monovalent pediatric HBV vaccine (10 μg of HBsAg) before 18 mo of age. Serum samples collected before and one month post-HBV vaccine challenge dose were tested for anti-HBs antibody concentrations. Safety assessments were made for the HBV vaccine challenge dose. A three-dose childhood HBV immunization regimen induced persistence of antibodies against HBV infection for 10 y, up to adolescence. This vaccination regimen also conferred long-term immune memory against HBV as evidenced by the strong anamnestic response to the HBV vaccine challenge, despite waning anti-HBs antibody levels. PMID:22508412

  6. Thymic indoleamine 2,3-dioxygenase-positive eosinophils in young children: potential role in maturation of the naive immune system.

    PubMed

    Tulic, Meri K; Sly, Peter D; Andrews, David; Crook, Maxine; Davoine, Francis; Odemuyiwa, Solomon O; Charles, Adrian; Hodder, Megan L; Prescott, Susan L; Holt, Patrick G; Moqbel, Redwan

    2009-11-01

    Eosinophils expressing indoleamine 2, 3-dioxygenase (IDO) may contribute to T-helper cell (Th)2 predominance. To characterize human thymus IDO+ eosinophil ontogeny relative to Th2 regulatory gene expression, we processed surgically obtained thymi from 22 children (age: 7 days to 12 years) for immunohistochemistry and molecular analysis, and measured cytokine and kynurenine levels in tissue homogenates. Luna+ eosinophils ( approximately 2% of total thymic cells) decreased in number with age (P = 0.02) and were IDO+. Thymic IDO immunoreactivity (P = 0.01) and kynurenine concentration (P = 0.01) decreased with age as well. In addition, constitutively-expressed interleukin (IL)-5 and IL-13 in thymus supernatants was highest in youngest children. Eosinophil numbers correlated positively with expression of the Th2 cytokines IL-5, IL-13 (r = 0.44, P = 0.002), and IL-4 (r = 0.46, P = 0.005), transcription factor signal transducer and activator of transcription-6 (r = 0.68, P = 0.001), and the chemokine receptor, CCR3 (r = 0.17, P = 0.04), but negatively with IL-17 mRNA (r = -0.57, P = 0.02) and toll-like receptor 4 expression (r = -0.74, P = 0.002). Taken together, these results suggest that functional thymic IDO+ eosinophils during human infant life may have an immunomodulatory role in Th2 immune responses. PMID:19815714

  7. Measles immunization strategy: measles antibody response following MMR II vaccination of children at one year of age.

    PubMed

    Ratnam, S; West, R; Gadag, V; Burris, J

    1996-01-01

    Measles antibody levels were determined by the plaque reduction neutralization (PRN) test in 580 one-year-old children before vaccination and four to six weeks after MMR II vaccination. Fifty-one (8.8%) had maternally derived measles antibody at prevaccination, and this was more common among children of women born before 1967 (10.6%) vs. 4.3%; p < 0.01). Among those with maternal antibody, only 22 (43.1%) responded with a protective PRN titre of over 120, in contrast to 463 (87.5%) of the 529 without maternal antibody at prevaccination (p < 0.0001). Also, the geometric mean titre was significantly lower for the former (114.1 vs. 378.5; p < 0.0001). Overall, 15 (2.6%) of the 580 children had no antibody response after vaccination, and a further 80 (13.8%) had a subprotective response (PRN titre < 120). This lack of response could not be attributed entirely to the presence of maternal measles antibody at the time of vaccination. The MMR II vaccine may not be sufficiently immunogenic in inducing adequate measles antibody response after a single dose given at one year of age. PMID:8753636

  8. Validity of a Sun Safety Diary Using UV Monitors in Middle School Children

    ERIC Educational Resources Information Center

    Yaroch, Amy L.; Reynolds, Kim D.; Buller, David B.; Maloy, Julie A.; Geno, Cristy R.

    2006-01-01

    This article describes a validity study conducted among middle school students comparing self-reported sun safety behaviors from a diary with readings from ultraviolet (UV) monitors worn on different body sites. The UV monitors are stickers with panels that turn increasingly darker shades of blue in the presence of increasing amounts of UV light.…

  9. Effects of a Self-Monitoring Intervention on Children with Traumatic Brain Injury

    ERIC Educational Resources Information Center

    Davies, Susan C.; Jones, Kevin M.; Rafoth, Mary A.

    2010-01-01

    The purpose of this study was to examine the effects of a self-monitoring intervention on teachers' direct behavior ratings of 3 students with traumatic brain injury. The authors used a multiple-baseline-across-participants design to evaluate the effect of the strategy on each child's classwork and classroom behavior. The self-monitoring strategy…

  10. Summer Food Service Program for Children. 1991 Monitor's Handbook. (Revised Edition).

    ERIC Educational Resources Information Center

    Food and Nutrition Service (USDA), Washington, DC.

    This handbook gives those who monitor food service sites a work knowledge of their duties and responsibilities as representatives of sponsors in the Summer Food Service Program (SFSP). The organizational structure of the SFSP and the training of monitors are reviewed. The responsibilities of visiting sites and checking site operations are…

  11. 24-hour esophageal pH-monitoring in children suspected of gastroesophageal reflux disease: Analysis of intraesophageal pH monitoring values recorded in distal and proximal channel at diagnosis

    PubMed Central

    Semeniuk, Janusz; Kaczmarski, Maciej

    2007-01-01

    AIM: To assess values of 24-h esophageal pH-monitoring parameters with dual-channel probe (distal and proximal channel) in children suspected of gastroesophageal reflux disease (GERD). METHODS: 264 children suspected of gastroesophageal reflux (GER) were enrolled in a study (mean age χ = 20.78 ± 17.23 mo). The outcomes of this study, immunoallerrgological tests and positive result of oral food challenge test with a potentially noxious nutrient, enabled to qualify children into particular study groups. RESULTS: 32 (12.1%) infants (group 1) had physiological GER diagnosed. Pathological acid GER was confirmed in 138 (52.3%) children. Primary GER was diagnosed in 76 (28.8%) children (group 2) and GER secondary to allergy to cow milk protein and/or other food (CMA/FA) in 62 (23.5%) children (group 3). 32 (12.1%) of them had CMA/FA (group 4-reference group), and in remaining 62 (23.5%) children neither GER nor CMA/FA was confirmed (group 5). Mean values of pH monitoring parameters measured in distal and proximal channel were analyzed in individual groups. This analysis showed statistically significant differentiation of mean values in the case of: number of episodes of acid GER, episodes of acid GER lasting > 5 min, duration of the longest episode of acid GER in both channels, acid GER index total and supine in proximal channel. Statistically significant differences of mean values among examined groups, especially between group 2 and 3 in the case of total acid GER index (only distal channel) were confirmed. CONCLUSION: 24-h esophageal pH monitoring confirmed pathological acid GER in 52.3% of children with typical and atypical symptoms of GERD. The similar pH-monitoring values obtained in group 2 and 3 confirm the necessity of implementation of differential diagnosis for primary vs secondary cause of GER. PMID:17876877

  12. Off-label psychopharmacologic prescribing for children: History supports close clinical monitoring

    PubMed Central

    Zito, Julie M; Derivan, Albert T; Kratochvil, Christopher J; Safer, Daniel J; Fegert, Joerg M; Greenhill, Laurence L

    2008-01-01

    The review presents pediatric adverse drug events from a historical perspective and focuses on selected safety issues associated with off-label use of medications for the psychiatric treatment of youth. Clinical monitoring procedures for major psychotropic drug classes are reviewed. Prior studies suggest that systematic treatment monitoring is warranted so as to both minimize risk of unexpected adverse events and exposures to ineffective treatments. Clinical trials to establish the efficacy and safety of drugs currently being used off-label in the pediatric population are needed. In the meantime, clinicians should consider the existing evidence-base for these drugs and institute close clinical monitoring. PMID:18793403

  13. How I treat common variable immune deficiency

    PubMed Central

    2010-01-01

    Common variable immunodeficiency is a rare immune deficiency, characterized by low levels of serum immunoglobulin G, A, and/or M with loss of antibody production. The diagnosis is most commonly made in adults between the ages of 20 and 40 years, but both children and older adults can be found to have this immune defect. The range of clinical manifestations is broad, including acute and chronic infections, inflammatory and autoimmune disease, and an increased incidence of cancer and lymphoma. For all these reasons, the disease phenotype is both heterogeneous and complex. Contributing to the complexity is that patient cohorts are generally small, criteria used for diagnosis vary, and the doses of replacement immune globulin differ. In addition, routines for monitoring patients over the years and protocols for the use of other biologic agents for complications have not been clarified or standardized. In the past few years, data from large patient registries have revealed that both selected laboratory markers and clinical phenotyping may aid in dissecting groups of subjects into biologically relevant categories. This review presents my approach to the diagnosis and treatment of patients with common variable immunodeficiency, with suggestions for the use of laboratory biomarkers and means of monitoring patients. PMID:20332369

  14. MONITORING THE EFFICACY OF MONTELUKAST USED IN CHILDREN WITH RISK OF ASTHMA.

    PubMed

    Pkhakadze, I; Alavidze, N; Gamkrelidze, S; Ekaladze, E

    2016-04-01

    The aim of the study is to evaluate the effect of Montelukast - leukotriene inhibitor in children population with risk of bronchial asthma. The research was conducted at LTD. Kutaisi Children primary care unit #3. The data were collected from January 2013 till January 2016. 104 patients (5-18 year, 43 girl, 61 boy), with potential risk of bronchial asthma were involved into the research, 47 (45%) patients out of 104 were considered as a real risk for asthma, based on Peak Expiratory Flow (PEF) and spirometry results. Patients with risk of asthma were grouped according to the method of treatment (monotherapy with inhaled glycocorticoid and inhaled glycocorticoid combined with leukotriene inhibitor). Descriptive statistics methods were used to characterize each variable. Our results indicate on positive influence of montelukast - selective leukotrien inhibitor in treatment of children with various forms of asthma. PMID:27249433

  15. Strain-specific Plasmodium falciparum multifunctional CD4(+) T cell cytokine expression in Malian children immunized with the FMP2.1/AS02A vaccine candidate.

    PubMed

    Graves, Shawna F; Kouriba, Bourema; Diarra, Issa; Daou, Modibo; Niangaly, Amadou; Coulibaly, Drissa; Keita, Yamoussa; Laurens, Matthew B; Berry, Andrea A; Vekemans, Johan; Ripley Ballou, W; Lanar, David E; Dutta, Sheetij; Gray Heppner, D; Soisson, Lorraine; Diggs, Carter L; Thera, Mahamadou A; Doumbo, Ogobara K; Plowe, Christopher V; Sztein, Marcelo B; Lyke, Kirsten E

    2016-05-17

    Based on Plasmodium falciparum (Pf) apical membrane antigen 1 (AMA1) from strain 3D7, the malaria vaccine candidate FMP2.1/AS02A showed strain-specific efficacy in a Phase 2 clinical trial in 400 Malian children randomized to 3 doses of the AMA1 vaccine candidate or control rabies vaccine on days 0, 30 and 60. A subset of 10 Pf(-) (i.e., no clinical malaria episodes) AMA1 recipients, 11 Pf(+) (clinical malaria episodes with parasites with 3D7 or Fab9-type AMA1 cluster 1 loop [c1L]) AMA1 recipients, and 10 controls were randomly chosen for analysis. Peripheral blood mononuclear cells (PBMCs) isolated on days 0, 90 and 150 were stimulated with full-length 3D7 AMA1 and c1L from strains 3D7 (c3D7) and Fab9 (cFab9). Production of IFN-γ, TNF-α, IL-2, and/or IL-17A was analyzed by flow cytometry. Among AMA1 recipients, 18/21 evaluable samples stimulated with AMA1 demonstrated increased IFN-γ, TNF-α, and IL-2 derived from CD4(+) T cells by day 150 compared to 0/10 in the control group (p<0.0001). Among AMA1 vaccines, CD4(+) cells expressing both TNF-α and IL-2 were increased in Pf(-) children compared to Pf(+) children. When PBMCs were stimulated with c3D7 and cFab9 separately, 4/18 AMA1 recipients with an AMA1-specific CD4(+) response had a significant response to one or both c1L. This suggests that recognition of the AMA1 antigen is not dependent upon c1L alone. In summary, AMA1-specific T cell responses were notably increased in children immunized with an AMA1-based vaccine candidate. The role of CD4(+)TNF-α(+)IL-2(+)-expressing T cells in vaccine-induced strain-specific protection against clinical malaria requires further exploration. Clinicaltrials.gov Identifier: NCT00460525. PMID:27087149

  16. Efficacy, safety, and dose response of intravenous anti-D immune globulin (WinRho SDF) for the treatment of idiopathic thrombocytopenic purpura in children.

    PubMed

    Freiberg, A; Mauger, D

    1998-01-01

    We analyzed data from 20 children treated for acute or chronic idiopathic (immune) thrombocytopenic purpura (ITP) at a single institution to determine the relationship between dose of intravenous anti-D immune globulin (WinRho SDF; Nabi, Boca Raton, FL), increase in platelet count, and decrease in hemoglobin in the therapy of ITP. Higher doses of anti-D were clearly associated with a greater therapeutic response in the platelet count, with no increase in hemolysis for both acute and chronic ITP. A significant correlation was found between dose and peak increase in platelet count measured in the 14 days following administration. This effect was present for both acute ITP (17 infusions, P = .0001) and chronic ITP (30 infusions, P = .038). Although hemolysis was seen in nearly all infusions, with a median hemoglobin fall of 1.9 g/dL (range, 0 to 4.2), the decrease in hemoglobin was greater than 2.5 for only three infusions, and the largest fall in hemoglobin (4.2) was in a child with an underlying hemolytic anemia. Furthermore, for both acute and chronic ITP there was no relationship between the decrease in hemoglobin and the dose given (P = .22), nor between the increase in platelet count and fall in hemoglobin (P = .27). This analysis supports the use of higher doses of anti-D for the treatment of ITP, and demonstrates the need for a trial of high-dose anti-D (>100 microg/kg) in acute and chronic ITP. PMID:9523746

  17. How can growth monitoring and special care of underweight children be improved in Zambia?

    PubMed

    Msefula, D

    1993-07-01

    Despite widespread promotion and implementation, very few growth monitoring programmes have been evaluated. Where they have, the findings have often been disappointing and the value of routine growth monitoring has been questioned. There is a concern that the process has become more of a weighing ritual rather than growth promotion. This paper highlights the findings of the evaluation study carried out to assess the performance of the Lusaka urban growth monitoring programme in Zambia. The problems faced and reasons are identified and alternate ways of offering the service are presented. Since the shortfalls are not unique to the Lusaka programme, it is hoped that this paper will stimulate a re-think in the way growth monitoring would be best implemented. PMID:8356736

  18. Accuracy of a real-time continuous glucose monitoring system in children with septic shock: A pilot study

    PubMed Central

    Prabhudesai, Sumant; Kanjani, Amruta; Bhagat, Isha; Ravikumar, Karnam G.; Ramachandran, Bala

    2015-01-01

    Aims: The aim of this prospective, observational study was to determine the accuracy of a real-time continuous glucose monitoring system (CGMS) in children with septic shock. Subjects and Methods: Children aged 30 days to 18 years admitted to the Pediatric Intensive Care Unit with septic shock were included. A real-time CGMS sensor was used to obtain interstitial glucose readings. CGMS readings were compared statistically with simultaneous laboratory blood glucose (BG). Results: Nineteen children were included, and 235 pairs of BG-CGMS readings were obtained. BG and CGMS had a correlation coefficient of 0.61 (P < 0.001) and a median relative absolute difference of 17.29%. On Clarke's error grid analysis, 222 (94.5%) readings were in the clinically acceptable zones (A and B). When BG was < 70, 70–180, and > 180 mg/dL, 44%, 100%, and 76.9% readings were in zones A and B, respectively (P < 0.001). The accuracy of CGMS was not affected by the presence of edema, acidosis, vasopressors, steroids, or renal replacement therapy. On receiver operating characteristics curve analysis, a CGMS reading <97 mg/dL predicted hypoglycemia (sensitivity 85.2%, specificity 75%, area under the curve [AUC] =0.85). A reading > 141 mg/dL predicted hyperglycemia (sensitivity 84.6%, specificity 89.6%, AUC = 0.87). Conclusion: CGMS provides a fairly, accurate estimate of BG in children with septic shock. It is unaffected by a variety of clinical variables. The accuracy over extremes of blood sugar may be a concern. We recommend larger studies to evaluate its use for the early detection of hypoglycemia and hyperglycemia. PMID:26730114

  19. Monitoring and Evaluation of Summer Workshops for Teachers of Migrant Children.

    ERIC Educational Resources Information Center

    Collins, Erik

    In this study, 3 institutes (summer 1970) for training teachers of migrant children were evaluated. Whether the 3 institutes brought about positive attitude change in the participants was selected as the basis of the evaluation, which used a non-equivalent control group design. There were 3 measures of teacher attitude: an adaptation of a semantic…

  20. MONITORING, ANALYSIS AND ESTIMATION OF AIR POLLUTION CONCENTRATIONS FOR THE DETROIT CHILDREN'S HEALTH STUDY (DCHS)

    EPA Science Inventory

    Research Issue: Spatial analyses of gaseous species and (possibly) particulate matter is in support of NHEERL APM 170 "Publish report on effects of particulate matter and volatile organic chemical air pollutants on children." under NHEERL APG "Characterize long term respiratory h...

  1. Actigraphic Monitoring during Sleep of Children with ADHD on Methylphenidate and Placebo

    ERIC Educational Resources Information Center

    Schwartz, George; Amor, Leila Ben; Grizenko, Natalie; Lageix, Philippe; Baron, Chantal; Boivin, Diane B.; Joober, Ridha

    2004-01-01

    Objective: Sleep disturbances appear as a comorbid condition in children with attention-deficit/hyperactivity disorder. The aim of this study was to investigate the relationship of activity levels during sleep and therapeutic response to methylphenidate (MPH). Method: Nightly sleep actigraphic recordings during a double-blind, placebo-controlled,…

  2. Development of Active Control within Working Memory: Active Retrieval versus Monitoring in Children

    ERIC Educational Resources Information Center

    Blain-Brière, Bénédicte; Bouchard, Caroline; Bigras, Nathalie; Cadoret, Geneviève

    2014-01-01

    This study aimed to compare children's performance on two mnemonic functions that engage the lateral prefrontal cortex. Brain imaging studies in adults have shown that the mid-ventrolateral prefrontal cortex is specifically involved in active controlled retrieval, and the mid-dorsolateral prefrontal cortex is specifically involved in…

  3. Children's Strategic Regulation, Metacognitive Monitoring, and Control Processes during Test Taking

    ERIC Educational Resources Information Center

    Krebs, Saskia S.; Roebers, Claudia M.

    2010-01-01

    Background: From the perspective of self-regulated learning, the interplay between learners' individual characteristics and the context of testing have been emphasized for assessing learning outcomes. Aims: The present study examined metacognitive processes in children's test-taking behaviour and explored their impacts on performance. Further, it…

  4. Immunization coverage and natural infection rates of vaccine-preventable diseases among children by questionnaire survey in 2005 in Japan.

    PubMed

    Baba, Koichi; Okuno, Yoshinobu; Tanaka-Taya, Keiko; Okabe, Nobuhiko

    2011-04-01

    We performed questionnaire survey in 2005, just before the introduction of the MR vaccine, concerning child vaccination and/or infection history for measles, mumps, rubella, varicella, influenza, diphtheria-pertussis-tetanus (DPT), BCG, and Japanese encephalitis. The vaccination rate against measles and rubella did not exceed 95% at any age levels. As a result, children who had contracted measles and/or rubella were observed at all age levels. The vaccination rate was 95% or higher only for BCG and DPT. The vaccination rates for influenza, mumps, and varicella, although vaccination against which diseases was being performed voluntarily, were low, and outbreaks of these diseases were expected to persist. The vaccination rates at a low level for these infectious diseases might be one of the most possible risk factors to the high prevalence of the diseases in nursery schools (daycare centers), kindergartens, and elementary schools all over Japan. PMID:20870055

  5. The prevalence of hepatitis B virus infection in Nigerian children prior to vaccine introduction into the National Programme on Immunization schedule

    PubMed Central

    Ikobah, Joanah; Okpara, Henry; Elemi, Iwasam; Ogarepe, Yeonun; Udoh, Ekong; Ekanem, Emmanuel

    2016-01-01

    Introduction Hepatitis B virus infection is a major global health problem of public health importance. In a bid to control the infection, the Nigerian government in 2004 introduced hepatitis B vaccine into the National Program on Immunization. There are no studies on the prevalence of hepatitis B in adolescent prior to 2004. The study was aimed at determining the seroprevalence and predictors of viral Hepatitis B in Nigerian children aged 11-19 years. Methods A cross sectional analytical study was conducted in July 2014. Multi-staged sampling technique was used to select 749 children from six secondary schools in Calabar, Cross River State, Nigeria. Ethical clearance was obtained from the Cross River State Medical Ethical Committee. A validated structured interviewer administered questionnaire was used to obtain information from participants following parental consent. Blood samples were obtained for qualitative detection of HBsAg using rapid chromatographic immunoassays with test kits from ABON (China) having sensitivity, specificity and accuracy of >99%, 97% and 98.5% respectively. Data was analyzed using SPSS version 20.2. Results Nine of the749 students screened were positive for HBsAg giving an overall prevalence of 1.2%. The sex specific prevalence was 0.8% for males and 1.8% for females. After multivariate analysis, age was the predictor of hepatitis B infection (OR 3.92; 95% CI 1.22-12.63; p-value 0.02). Conclusion The prevalence of HBV infection was low. Despite the low prevalence, the introduction of the vaccine is justifiable in view of the public health importance of the infection. PMID:27279955

  6. Federal Immunity Law in Higher Education: A Review of the 1997 Judicial Decisions.

    ERIC Educational Resources Information Center

    Johnsen, Christopher

    1998-01-01

    Monitors developments in 1997 in federal immunity law applicable to higher education, generally public institutions. Cases touched on Eleventh Amendment immunity (abrogation, waiver, removal, entities, interlocutory appeals, discovery), qualified immunity (claims involving motivation, interlocutory appeals), and absolute immunity. (EV)

  7. Nebraska Schools 83-84 Immunization Levels.

    ERIC Educational Resources Information Center

    Nebraska State Dept. of Health, Lincoln.

    The data contained in this report represents all of the 297,696 students, K-12, in the state of Nebraska. High levels of immunity are documented among children grades K-6. Some immunization levels of children grades 7-12 are yet below the 95 percent established as a minimum for the prevention of vaccine preventable diseases. Specifically, there…

  8. Persistence of the immune response after MenACWY-CRM vaccination and response to a booster dose, in adolescents, children and infants.

    PubMed

    Baxter, Roger; Keshavan, Pavitra; Welsch, Jo Anne; Han, Linda; Smolenov, Igor

    2016-05-01

    Persistence of bactericidal antibodies following vaccination is extremely important for protection against invasive meningococcal disease, given the epidemiology and rapid progression of meningococcal infection. We present an analysis of antibody persistence and booster response to MenACWY-CRM, in adolescents, children and infants, from 7 clinical studies. Immunogenicity was assessed using the serum bactericidal assay with both human and rabbit complement. Post-vaccination hSBA titers were high, with an age- and serogroup-specific decline in titers up to 1 y and stable levels up to 5 y The waning of hSBA titers over time was more pronounced among infants and toddlers and the greatest for serogroup A. However, rSBA titers against serogroup A were consistently higher and showed little decline over time, suggesting that protection against this serogroup may be sustained. A single booster dose of MenACWY-CRM administered at 3 to 5 y induced a robust immune response in all age groups. PMID:26829877

  9. Immunizations - diabetes

    MedlinePlus

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  10. Immunity status of adults and children against poliomyelitis virus type 1 strains CHAT and Sabin (LSc-2ab) in Germany

    PubMed Central

    2010-01-01

    Background In October 2007, the working group CEN/TC 216 of the European Committee for standardisation suggested that the Sabin oral poliovirus vaccine type 1 strain (LSc-2ab) presently used for virucidal tests should be replaced by another attenuated vaccine poliovirus type 1 strain, CHAT. Both strains were historically used as oral vaccines, but the Sabin type 1 strain was acknowledged to be more attenuated. In Germany, vaccination against poliomyelitis was introduced in 1962 using the oral polio vaccine (OPV) containing Sabin strain LSc-2ab. The vaccination schedule was changed from OPV to an inactivated polio vaccine (IPV) containing wild polio virus type 1 strain Mahoney in 1998. In the present study, we assessed potential differences in neutralising antibody titres to Sabin and CHAT in persons with a history of either OPV, IPV, or OPV with IPV booster. Methods Neutralisation poliovirus antibodies against CHAT and Sabin 1 were measured in sera of 41 adults vaccinated with OPV. Additionally, sera from 28 children less than 10 years of age and immunised with IPV only were analysed. The neutralisation assay against poliovirus was performed according to WHO guidelines. Results The neutralisation activity against CHAT in adults with OPV vaccination history was significantly lower than against Sabin poliovirus type 1 strains (Wilcoxon signed-rank test P < 0.025). In eight sera, the antibody titres measured against CHAT were less than 8, although the titre against Sabin 1 varied between 8 and 64. Following IPV booster, anti-CHAT antibodies increased rapidly in sera of CHAT-negative adults with OPV history. Sera from children with IPV history neutralised CHAT and Sabin 1 strains equally. Conclusion The lack of neutralising antibodies against the CHAT strain in persons vaccinated with OPV might be associated with an increased risk of reinfection with the CHAT polio virus type 1, and this implies a putative risk of transmission of the virus to polio-free communities. We

  11. Non-epileptic clinical diagnoses in children referred for an outpatient EEG using video monitoring.

    PubMed

    Apakama, Okwuchi; Appleton, Richard

    2006-06-01

    Simultaneous video (closed circuit television [CCTV]) and EEG recordings are important in the differentiation of epileptic and non-epileptic paroxysmal episodes and in the classification of epilepsy syndromes. An additional benefit from the observation of the child on CCTV is the possible identification of specific clinical, including genetic, conditions. This three-year prospective study of 2780 consecutive children undergoing routine EEG investigations identified 17 conditions that had not previously been diagnosed by the clinicians who had requested the EEG. PMID:16793578

  12. Temporal association of children's pesticide exposure and agricultural spraying: report of a longitudinal biological monitoring study.

    PubMed

    Koch, Denise; Lu, Chensheng; Fisker-Andersen, Jennifer; Jolley, Lance; Fenske, Richard A

    2002-08-01

    We measured organophosphorus (OP) pesticide exposures of young children living in an agricultural community over an entire year and evaluated the impact of agricultural spraying on exposure. We also examined the roles of age, sex, parental occupation, and residential proximity to fields. We recruited 44 children (2-5 years old) through a Women, Infants, and Children clinic. We collected urine samples on a biweekly basis over a 21-month period. Each child provided at least 16 urine samples, and most provided 26. We analyzed samples for the dialkylphosphate (DAP) metabolites common to the OP pesticides. DAP concentrations were elevated in months when OP pesticides were sprayed in the region's orchards. The geometric means of dimethyl and diethyl DAPs during spray months were higher than those during nonspray months (p = 0.009 for dimethyl; p = 0.018 for diethyl). Dimethyl DAP geometric means were 0.1 and 0.07 micro mol/L for spray months and nonspray months, respectively (57% difference); diethyl DAP geometric means were 0.49 and 0.35, respectively (40% difference). We also observed differences for sex of the child, with male levels higher than female levels (p = 0.005 for dimethyl; p = 0.046 for diethyl). We observed no differences due to age, parental occupation, or residential proximity to fields. This study reports for the first time the temporal pattern of pesticide exposures over the course of a full year and indicates that pesticide spraying in an agricultural region can increase children's exposure in the absence of parental work contact with pesticides or residential proximity to pesticide-treated farmland. PMID:12153767

  13. Nurses as primary advocates for immunization adherence.

    PubMed

    Holland Wade, Gail

    2014-01-01

    Immunizations, one of the greatest public health achievements, are at times hindered by a history of powerful biological, social, and cultural reactions from the public. State laws require immunizations for school entry, however some parents choose a nonmedical exemption for their children. Although many vaccine-preventable diseases are practically extinct in the United States, nurses have a unique role in increasing parents' understanding that herd immunity may not protect their unimmunized children. By listening to and addressing parents' concerns about immunizations, nurses can dispel misconceptions and help change parents' perceptions about the risks associated with immunizations. PMID:25333801

  14. Effects of Task Analysis and Self-Monitoring for Children with Autism in Multiple Social Settings

    ERIC Educational Resources Information Center

    Parker, Daniel; Kamps, Debra

    2011-01-01

    In this study, written task analyses with self-monitoring were used to teach functional skills and verbal interactions to two high-functioning students with autism in social settings with peers. A social script language intervention was included in two of the activities to increase the quantity of verbal interaction between the students and peers.…

  15. Metacognitive Monitoring and Control Processes Involved in Primary School Children's Test Performance

    ERIC Educational Resources Information Center

    Roebers, Claudia M.; Schmid, Corinne; Roderer, Thomas

    2009-01-01

    Background: Within the context of students' self-regulated learning, the interplay between learners' individual characteristics and the context of testing have been emphasized for assessing learning outcomes. Aims: The present study examined metacognitive monitoring and control processes in elementary schoolchildren's test taking behaviour and…

  16. Handwriting Skills in Children with Spina Bifida: Assessment, Monitoring and Measurement.

    ERIC Educational Resources Information Center

    Hancock, Julie; Alston, Jean

    1986-01-01

    Case studies of three students with spina bifida (ages 8-11) illustrate an individualized six-week handwriting intervention program which stressed assessment, monitoring, and measurement of changes in writing performance. Appropriate changes in physical support (sitting position, writing surface, and choice of writing tool) are recommended. (JW)

  17. Using Self-Monitoring to Increase Attending to Task and Academic Accuracy in Children with Autism

    ERIC Educational Resources Information Center

    Holifield, Cassandra; Goodman, Janet; Hazelkorn, Michael; Heflin, L. Juane

    2010-01-01

    This study was conducted to investigate the effectiveness of a self-monitoring procedure on increasing attending to task and academic accuracy in two elementary students with autism in their self-contained classroom. A multiple baseline across participants in two academic subject areas was used to assess the effectiveness of the intervention. Both…

  18. Monitoring Children's Growth in Early Literacy Skills: Effects of Feedback on Performance and Classroom Environments

    ERIC Educational Resources Information Center

    Ball, Carrie; Gettinger, Maribeth

    2009-01-01

    The study examined the benefits of providing kindergarten teachers with feedback about students' performance on early literacy progress-monitoring probes. Students were administered the "Dynamic Indicators of Basic Early Literacy Skills (DIBELS)" in fall, winter, and spring; classroom environment was evaluated using the "Early Language and…

  19. A New Method to Monitor the Contribution of Fast Food Restaurants to the Diets of US Children

    PubMed Central

    Rehm, Colin D.; Drewnowski, Adam

    2014-01-01

    Background American adults consume 11.3% of total daily calories from foods and beverages from fast food restaurants. The contribution of different types of fast food restaurants to the diets of US children is unknown. Objective To estimate the consumption of energy, sodium, added sugars, and solid fats among US children ages 4–19 y by fast food restaurant type. Methods Analyses used the first 24-h recall for 12,378 children in the 2003–2010 cycles of the nationally representative National Health and Nutrition Examination Survey (NHANES 2003–2010). NHANES data identify foods by location of origin, including stores and fast food restaurants (FFR). A novel custom algorithm divided FFRs into 8 segments and assigned meals and snacks to each. These included burger, pizza, sandwich, Mexican, Asian, fish, and coffee/snack restaurants. The contribution of each restaurant type to intakes of energy and other dietary constituents was then assessed by age group (4–11 y and 12–19 y) and by race/ethnicity. Results Store-bought foods and beverages provided 64.8% of energy, 61.9% of sodium, 68.9% of added sugars, and 60.1% of solid fats. FFRs provided 14.1% of energy, 15.9% of sodium, 10.4% of added sugars and 17.9% of solid fats. Among FFR segments, burger restaurants provided 6.2% of total energy, 5.8% of sodium, 6.2% of added sugars, and 7.6% of solid fats. Less energy was provided by pizza (3.3%), sandwich (1.4%), Mexican (1.3%), and chicken restaurants (1.2%). Non-Hispanic black children obtained a greater proportion of their total energy (7.4%), sodium (7.1%), and solid fats (9.5%) from burger restaurants as compared to non-Hispanic white children (6.0% of energy, 5.5% of sodium, and 7.3% of solid fat). Conclusions These novel analyses, based on consumption data by fast food market segment, allow public health stakeholders to better monitor the effectiveness of industry efforts to promote healthier menu options. PMID:25062277

  20. [Experience of application of social hygienic monitoring in hygiene of children and adolescents and the lessons resulting from it].

    PubMed

    2012-01-01

    The adoption of the law of the Russian Federation "On the sanitary-epidemiological welfare of population" called for the creation of a tool "measurement" of the specified condition. This tool was the socio-hygienic monitoring (SHM)--a complex system of long-term monitoring changes in the state of health of the population and the surrounding environment. Goal, objectives and the technology of SHM have been formulated in the decisions of the Government of the Russian Federation No426 of 1 June 2000 and 3385 from 26.04.2005. Methodology of SHM provides for the forecasting and management of health of the population on the basis of the establishment of cause-and-effect relations in the system of "environment-health" and making managerial decisions, proceeding from the priority of primary prevention and the establishment of priority in the conduct of recreational activities at designated areas. Currently, the country has established a system of SHM designed to operate at the federal (Russian Federation), regional (republic, kray, oblast, okrug, the mega-cities), local (city, region) level with a vertical management structure. Some experience of SHM was gained and in the hygiene of children and adolescents. On the basis of this experience purpose is to identify opportunities of SHM to solve the priority (as required by the methodology) and other own problems of hygiene of children and adolescents, to give the characteristic used in SHM criteria for the evaluation of the health of students and the status of the school environment and offer a more informative, in our opinion, the criteria. PMID:23082671

  1. Evaluation of the multiple linear regression method to monitor respiratory mechanics in ventilated neonates and young children.

    PubMed

    Rousselot, J M; Peslin, R; Duvivier, C

    1992-07-01

    A potentially useful method to monitor respiratory mechanics in artificially ventilated patients consists of analyzing the relationship between tracheal pressure (P), lung volume (V), and gas flow (V) by multiple linear regression (MLR) using a suitable model. Contrary to other methods, it does not require any particular flow waveform and, therefore, may be used with any ventilator. This approach was evaluated in three neonates and seven young children admitted into an intensive care unit for respiratory disorders of various etiologies. P and V were measured and digitized at a sampling rate of 40 Hz for periods of 20-48 s. After correction of P for the non-linear resistance of the endotracheal tube, the data were first analyzed with the usual linear monoalveolar model: P = PO + E.V + R.V where E and R are total respiratory elastance and resistance, and PO is the static recoil pressure at end-expiration. A good fit of the model to the data was seen in five of ten children. PO, E, and R were reproducible within cycles, and consistent with the patient's age and condition; the data obtained with two ventilatory modes were highly correlated. In the five instances in which the simple model did not fit the data well, they were reanalyzed with more sophisticated models allowing for mechanical non-homogeneity or for non-linearity of R or E. While several models substantially improved the fit, physiologically meaningful results were only obtained when R was allowed to change with lung volume. We conclude that the MLR method is adequate to monitor respiratory mechanics, even when the usual model is inadequate. PMID:1437330

  2. Effect of combined application insulin and insulin detemir on continous glucose monitor in children with type 1 diabetes mellitus

    PubMed Central

    Chen, Xiao-Yun; Dong, Qing; Li, Gui-Mei

    2015-01-01

    Insulin detemir is a soluble long-acting human insulin analogue at neutral pH with a unique mechanism of action, which could strengthen the effects of insulin. This study aims to explore the effects of insulin combined with insulin detemir on the continous glucose in children with type 1 diabetes mellitus. In this study, 150 patients with type 1 diabetes enrolled were included and randomly divided into 3 groups: insulin group (group A), insulin detemir group (group B) and insulin combined with insulin detemir group (group C). Each subject underwent 72 h of continuous glucose monitoring (CGM). MAGE, HbA1c and Noctumal Hypoglycemia levels were examined by using the ELISA kits. The body weight changes were also detected in this study. The results indicated that the information including age, body weight, disease duration and glucose level and HbA1c percentage on the start time point among three groups indicated no statistical differences. Insulin combined with insulin detemir decrease MAGE and HbA1c level in Group C compared to Group A and Group A (P < 0.05). Insulin combined with insulin detemir decreas noctumal hypoglycemia levels and body weight changes (P < 0.05). In conclusion, this study confirmed efficacy of insulin detemir by demonstrating non-inferiority of insulin detemir compared with insulin with respect to HbA1c, with an improved safety profile including significantly fewer hypoglycaemic episodes and less undesirable weight gain in children. PMID:26064343

  3. An SEA Monitoring Guide for Use with "The Regional Guidelines for State Approval of Private Schools for Children with Handicapping Conditions."

    ERIC Educational Resources Information Center

    Northeast Regional Resource Center, Hightstown, NJ.

    The regional guidelines for private schools with handicapped children are designed to promote comparability of state licensing and/or approval placement procedures, reduce administrative burden and attendant costs, increase effectiveness of monitoring interstate placements, and provide a firm basis for program analysis. Listed among the 20…

  4. The Effects of a Self-Monitoring and Video Self-Modeling Intervention to Increase On-Task Behavior for Children with Attention-Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Schmitt, Rachel Calkins Oxnard

    2009-01-01

    Children are diagnosed with AD/HD more often than any other disorder and interventions are needed in schools to increase on-task behavior. Most studies examining on-task behavior are conducted in special education classrooms or clinical laboratories. Previous studies have not combined video self-modeling and self-monitoring as an intervention to…

  5. Patterns of Physical Activity and Overweight among 7-13-Year-Old Russian Children: A 7-Year Nationally Representative Monitoring Study

    ERIC Educational Resources Information Center

    Tudor-Locke, Catrine; Ainsworth, Barbara E.; Popkin, B. M.

    2008-01-01

    This is a repeated cross-sectional study of overweight and physical activity (PA) and inactivity patterns of successive samples of 7-13-year-old Russian children who were surveyed six times between 1995 and 2002 as part of the Russian Longitudinal Monitoring Survey. This analysis focused on moderate/vigorous (MOD/VIG) PA (e.g., active commuting to…

  6. Continuous Multimodality Monitoring in Children after Traumatic Brain Injury—Preliminary Experience

    PubMed Central

    Young, Adam M. H.; Donnelly, Joseph; Czosnyka, Marek; Jalloh, Ibrahim; Liu, Xiuyun; Aries, Marcel J.; Fernandes, Helen M.; Garnett, Matthew R.; Smielewski, Peter; Hutchinson, Peter J.; Agrawal, Shruti

    2016-01-01

    Introduction Multimodality monitoring is regularly employed in adult traumatic brain injury (TBI) patients where it provides physiologic and therapeutic insight into this heterogeneous condition. Pediatric studies are less frequent. Methods An analysis of data collected prospectively from 12 pediatric TBI patients admitted to Addenbrooke’s Hospital, Pediatric Intensive Care Unit (PICU) between August 2012 and December 2014 was performed. Patients’ intracranial pressure (ICP), mean arterial pressure (MAP), and cerebral perfusion pressure (CPP) were monitored continuously using brain monitoring software ICM+®,) Pressure reactivity index (PRx) and ‘Optimal CPP’ (CPPopt) were calculated. Patient outcome was dichotomized into survivors and non-survivors. Results At 6 months 8/12 (66%) of the cohort survived the TBI. The median (±IQR) ICP was significantly lower in survivors 13.1±3.2 mm Hg compared to non-survivors 21.6±42.9 mm Hg (p = 0.003). The median time spent with ICP over 20 mm Hg was lower in survivors (9.7+9.8% vs 60.5+67.4% in non-survivors; p = 0.003). Although there was no evidence that CPP was different between survival groups, the time spent with a CPP close (within 10 mm Hg) to the optimal CPP was significantly longer in survivors (90.7±12.6%) compared with non-survivors (70.6±21.8%; p = 0.02). PRx provided significant outcome separation with median PRx in survivors being 0.02±0.19 compared to 0.39±0.62 in non-survivors (p = 0.02). Conclusion Our observations provide evidence that multi-modality monitoring may be useful in pediatric TBI with ICP, deviation of CPP from CPPopt, and PRx correlating with patient outcome. PMID:26978532

  7. Echinoderm immunity.

    PubMed

    Smith, L Courtney; Ghosh, Julie; Buckley, Katherine M; Clow, Lori A; Dheilly, Nolwenn M; Haug, Tor; Henson, John H; Li, Chun; Lun, Cheng Man; Majeske, Audrey J; Matranga, Valeria; Nair, Sham V; Rast, Jonathan P; Raftos, David A; Roth, Mattias; Sacchi, Sandro; Schrankel, Catherine S; Stensvåg, Klara

    2010-01-01

    A survey for immune genes in the genome for the purple sea urchin has shown that the immune system is complex and sophisticated. By inference, immune responses of all echinoderms maybe similar. The immune system is mediated by several types of coelomocytes that are also useful as sensors of environmental stresses. There are a number of large gene families in the purple sea urchin genome that function in immunity and of which at least one appears to employ novel approaches for sequence diversification. Echinoderms have a simpler complement system, a large set of lectin genes and a number of antimicrobial peptides. Profiling the immune genes expressed by coelomocytes and the proteins in the coelomic fluid provide detailed information about immune functions in the sea urchin. The importance of echinoderms in maintaining marine ecosystem stability and the disastrous effects of their removal due to disease will require future collaborations between ecologists and immunologists working towards understanding and preserving marine habitats. PMID:21528703

  8. Individual rights over public good? The future of anthropometric monitoring of school children in the fight against obesity.

    PubMed

    Stubbs, Joanne M; Achat, Helen M

    2009-02-01

    Available evidence indicates that rates of childhood overweight and obesity have been increasing over the past two decades, but inconsistencies between study methods moderate the strength of this evidence. Concomitant health problems and associated costs make it imperative that primary prevention initiatives are introduced to combat the obesity epidemic. Fundamental to informed action is anthropometric monitoring, which if properly implemented will identify changes over time in specific populations to inform policies, practices and services aimed at prevention and treatment. Sample representativeness is essential for valid trend and prevalence data, but efforts to obtain population-based anthropometric data from school children with the required written parental consent have been thwarted by low participation rates. Notable improvements in participation rates when utilising opt-out consent, in which participation is assumed unless otherwise indicated, are evident from local as well as international studies. Opt-out consent can facilitate anthropometric monitoring, delivering a more informed, best-value-for-money response to the obesity epidemic. Health and education ethics committees need to acknowledge the benefits of opt-out consent for "low-risk" anthropometric measurement, which ultimately upholds the individual's rights. PMID:19203312

  9. Children

    ERIC Educational Resources Information Center

    Headley, Clea; Campbell, Marilyn A.

    2013-01-01

    This study examined primary school teachers' knowledge of anxiety and excessive anxiety symptoms in children. Three hundred and fifteen primary school teachers completed a questionnaire exploring their definitions of anxiety and the indications they associated with excessive anxiety in primary school children. Results showed that teachers had…

  10. Thromboelastometric Monitoring of the Hemostatic Effect of Platelet Concentrates Transfusion in Thrombocytopenic Children Undergoing Chemotherapy

    PubMed Central

    Solomon, Cristina; Cadamuro, Janne; Jones, Neil

    2015-01-01

    Prophylactic platelet concentrates transfusion represents a therapeutic choice in patients with chemotherapy-induced thrombocytopenia. This prospective, non-interventional study evaluated the effects of platelet concentrates transfusion on thromboelastometric parameters of platelet function in 36 transfusion occasions for 11 thrombocytopenic children undergoing chemotherapy. Pre- and posttransfusion (1-2 hours) blood samples were analyzed using standard coagulation tests and thromboelastometry (ROTEM) measurements (EXTEM and FIBTEM tests). Platelet component of the clot was calculated based on the EXTEM and FIBTEM maximum clot elasticity (MCE) results. After transfusion, mean platelet count increased from 16.5 × 109/L to 43.0 × 109/L (P < .001) and platelet component increased from 34.1 to 73.0 (P < .001). Statistically significant increases for posttransfusion EXTEM parameters A10, A20, and maximum clot firmness (MCF) were observed compared to pretransfusion values (P < .001). The EXTEM α-angle values increased posttransfusion (P < .05). The FIBTEM measurements were comparable pre- and posttransfusion. The study showed that platelet concentrates transfusion in thrombocytopenic children undergoing chemotherapy improves platelet-related coagulation pattern. PMID:25525046

  11. Monitoring the autonomic nervous activity as the objective evaluation of music therapy for severely and multiply disabled children.

    PubMed

    Orita, Makiko; Hayashida, Naomi; Shinkawa, Tetsuko; Kudo, Takashi; Koga, Mikitoshi; Togo, Michita; Katayama, Sotetsu; Hiramatsu, Kozaburo; Mori, Shunsuke; Takamura, Noboru

    2012-01-01

    Severely and multiply disabled children (SMDC) are frequently affected in more than one area of development, resulting in multiple disabilities. The aim of the study was to evaluate the efficacy of music therapy in SMDC using monitoring changes in the autonomic nervous system, by the frequency domain analysis of heart rate variability. We studied six patients with SMDC (3 patients with cerebral palsy, 1 patient with posttraumatic syndrome after head injury, 1 patient with herpes encephalitis sequelae, and 1 patient with Lennox-Gastaut syndrome characterized by frequent seizures, developmental delay and psychological and behavioral problems), aged 18-26 (mean 22.5 ± 3.5). By frequency domain method using electrocardiography, we measured the high frequency (HF; with a frequency ranging from 0.15 to 0.4 Hz), which represents parasympathetic activity, the low frequency/high frequency ratio, which represents sympathetic activity between the sympathetic and parasympathetic activities, and heart rate. A music therapist performed therapy to all patients through the piano playing for 50 min. We monitored each study participant for 150 min before therapy, 50 min during therapy, and 10 min after therapy. Interestingly, four of 6 patients showed significantly lower HF components during music therapy than before therapy, suggesting that these four patients might react to music therapy through the suppression of parasympathetic nervous activities. Thus, music therapy can suppress parasympathetic nervous activities in some patients with SMDC. The monitoring changes in the autonomic nervous activities could be a powerful tool for the objective evaluation of music therapy in patients with SMDC. PMID:22729251

  12. [Current status and recommendations on the use of continuous blood glucose monitoring systems in children and adolescents with type 1 diabetes mellitus].

    PubMed

    Torres Lacruz, M; Barrio Castellanos, R; García Cuartero, B; Gómez Gila, A; González Casado, I; Hermoso López, F; Luzuriaga Tomás, C; Oyarzabal Irigoyen, M; Rica Etxebarria, I; Rodríguez Rigual, M

    2011-08-01

    Glucose monitoring methods have made great advances in the last decade with the appearance of the continuous glucose monitoring systems (CGMS) that measure the glucose levels in the interstitial liquid, providing information about glucose patterns and trends, but do not replace the self-monitoring of capillary glucose. Improvement in diabetes control using the CGMS depends on the motivation and training received by the patient and family and on the continuity in its use. Due to the development and widespread use of these systems in clinical practice, the diabetes group of the Sociedad Española de Endocrinología Pediátrica has drafted a document of consensus for their indication and use in children and adolescents. Only a limited number of trials have been performed in children and adolescent populations. More data are needed on the use of this technology in order to define the impact on metabolic control. PMID:21478062

  13. Neisseria meningitidis Group A IgG1 and IgG2 Subclass Immune Response in African Children Aged 12–23 Months Following Meningococcal Vaccination

    PubMed Central

    Holme, Daniel; Findlow, Helen; Sow, Samba O.; Idoko, Olubukola T.; Preziosi, Marie-Pierre; Carlone, George; Plikaytis, Brian D.; Borrow, Ray

    2015-01-01

    Background. A group A meningococcal conjugate vaccine, PsA-TT, was licensed in 2010 and was previously studied in a phase 2 clinical trial to evaluate its safety and immunogenicity in African children 12–23 months of age. Methods. Subjects received either PsA-TT; meningococcal group A, C, W, Y polysaccharide vaccine (PsACWY); or Haemophilus influenzae type b conjugate vaccine (Hib-TT). Forty weeks following primary vaccination, the 3 groups were further randomized to receive either PsA-TT, one-fifth dose of PsACWY, or Hib-TT. Group A–specific immunoglobulin G (IgG) subclass response was characterized using an enzyme-linked immunosorbent assay. Results. The predominant IgG subclass response, regardless of vaccine, was IgG1. One month following primary vaccination, the geometric mean concentrations (GMCs) of IgG1 and IgG2 in the PsA-TT group were 21.73 µg/mL and 6.27 µg/mL, whereas in the PsACWY group the mean GMCs were 2.01 µg/mL and 0.97 µg/mL, respectively (P < .0001). Group A–specific IgG1 and IgG2 GMCs remained greater in the PsA-TT group than in the PsACWY group 40 weeks following primary vaccination (P < .0001). One week following revaccination, those given 2 doses of PsA-TT had the greatest IgG1 and IgG2 GMCs of 125.23 µg/mL and 36.12 µg/mL, respectively (P = .0008), and demonstrated a significant increase in IgG1:IgG2 mean ratio, indicative of the T-cell–dependent response associated with conjugate vaccines. Conclusions. Vaccination of African children aged 12–24 months with either PsA-TT or PsACWY elicited a predominantly IgG1 response. The IgG1:IgG2 mean ratio decreased following successive vaccination with PsACWY, indicating a shift toward IgG2, suggestive of the T-cell–independent immune response commonly associated with polysaccharide antigens. Clinical Trials Registration. SRCTN78147026. PMID:26553689

  14. Blood pressure monitoring at the wrist: is it reliable in children and adolescents?

    PubMed

    Bald, M; Westhues, R; Bonzel, K E

    1996-01-01

    We studied in children and adolescents the performance of two devices for blood pressure measurements at the wrist: "Blood pressure watch" (BPW) and Omron R1 (OR1). They were tested against auscultatory blood pressure readings at the upper arm. Wrist circumference correlated to the aged was greater than 13.5 cm in nearby all subjects older than 12 years. BPW overestimated systolic blood pressure for more than 10 mm Hg and diastolic blood pressure for 4 to 7 mm Hg in all subjects. OR1 underestimated both systolic and diastolic blood pressure by 5 to 6 mm Hg in the group with a wrist greater than 13.5 cm and by 8 to 9 mm Hg in the group with a smaller wrist. No difference was found between left and right wrists by OR1. PMID:8896309

  15. Clinical significance of HLA-DR+, CD19+, CD10+ immature B-cell phenotype and CD34+ cell detection in bone marrow lymphocytes from children affected with immune thrombocytopenic purpura.

    PubMed

    Callea, V; Comis, M; Iaria, G; Sculli, G; Morabito, F; Lombardo, V T

    1997-01-01

    In children with immune thrombocytopenic purpura (ITP), bone marrow lymphocytes can express the common acute lymphoblastic leukemia antigen (CALLA) pattern with no evidence of leukemia or lymphoma. Bone marrow lymphocytes from 23 children and 20 adults affected with ITP were studied to determine the incidence and the clinical impact of lymphocytes with the immature B-cell phenotype and CD34+ cell expression. In this investigation we identified a group consisting of 52% of the children who showed the immature B phenotype, while the remaining 48%, similarly to adult ITP displayed an increase of T-cell antigens. CD34 was positive in 53% of children, but it was present in only half of the patients with the immature B phenotype and it was always absent in adults. IgH genes disclosed a germline configuration in all six patients in the immature B phenotype group. No difference was found in the two groups of children in terms of age, presentation of the disease or final outcome. Finally, no patient in either children's group has developed an acute lymphoproliferative disorder. PMID:9299867

  16. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  17. Immune Therapies for Neuroblastoma

    PubMed Central

    Navid, Fariba; Armstrong, Michael; Barfield, Raymond C.

    2009-01-01

    Neuroblastoma, a solid tumor arising from developing cells of the sympathetic nervous system, is the most common extracranial tumor in children. The prognosis for high-risk neuroblastoma remains poor with conventional treatment, and new approaches are therefore being explored to treat this disease. One such alternative therapy that holds promise is immune therapy. We review here the recent advances in 4 types of immune therapy – cytokine, vaccine, antibody, and cellular therapy – to treat neuroblastoma. We present preclinical research and clinical trials on several promising candidates such as IL-12, dendritic cell vaccines, anti-GD2 antibodies, and allogeneic hematopoietic stem cell transplant. An optimal treatment plan for neuroblastoma will most likely involve multimodal approaches and combinations of immune therapies. PMID:19342881

  18. Building a National Immunization System: A Guide to Immunization Services and Resources.

    ERIC Educational Resources Information Center

    Franklin, Paula; And Others

    Over the past several years, outbreaks of vaccine-preventable diseases have drawn greater attention to the problem of low immunization rates in the U.S. In response to this problem, the federal government created the Vaccines for Children program as a foundation for a new national immunization policy to ensure proper and timely immunizations for…

  19. [Monitoring and antibiotic resistance profile of tracheal aspirate microbiota in ICU children with severe craniocerebral trauma].

    PubMed

    Lazareva, A V; Katosova, L K; Kryzhanovskaya, O A; Ponomarenko, O A; Karaseva, O V; Gorelik, A L; Mayanskiy, N A

    2014-01-01

    Nosocomial infections and their rational antibiotic treatment represent a major challenge for the healthcare nowadays. In this context, gramnegative bacteria including Pseudomonas aeruginosa, Acinetobacter baumanii and Enterobacteriaceae spp. are etiologically important and characterized by a significant level of antibiotic resistance. To examine dynamics of the respiratory tract colonization by hospital flora, tracheal aspirates obtained at three time points from 69 children with severe craniocerebral trauma during their stay in ICU were analysed. Colonization was observed on the 4th day of the ICU stay with predomination of K. pneumoniae (45%) and A. baumanii (27-37%). P. aeruginosa was detected after the 8th day of the ICU stay with the isolation rate of 33%. Substantial proportions of P. aeruginosa (61%), A. baumanii (78%) and K. pneumoniae (25%) were resistant to carbapenems. In 65 carbapemen resistant isolates, the presence of carbapenemases was examined using PCRs. OXA-48 carbapenemase was detected in 11 out of 14 (78%) K. pneumoniae isolates. Among the A. baumanii isolates, 30/31 (97%) carried OXA-40 and 1/31 (3%) had OXA-23 carbapenemases. None of the examined A. baumanii and K. pneumoniae isolates produced metallo-betalactamases (MBL). In contrast, all 20 carbapenem resistant P. aeruginosa isolates produced a MBL, and in 12 out of 20 (60%) of theme VIM-2 was detected. Thus, gramnegative nosocomial microflora rapidly colonizes ICU patients and has a high level of resistance to antibiotics, including carbapenems. PMID:25975102

  20. Ciclosporin monitoring in kidney-transplanted children: high-performance liquid chromatography versus radioimmunoassay.

    PubMed

    Khoss, A E; Hamilton, G; Illievich, V; Mühlbacher, F; Roth, E; Steger, H; Wladika, W; Howanietz, H; Balzar, E

    Due to large individual differences in absorption, utilization and metabolism of the predominantly used drug ciclosporin (CsA) for selective immunosuppression in kidney graft recipients, therapeutic blood levels (immunosuppression/toxicity) can be maintained only by frequent measurements of the CsA concentrations in blood samples and dosage readjustments. The purpose of the present study was to investigate the usefulness of a high-performance liquid chromatography (HPLC) method for native CsA and a radioimmunoassay (RIA) method for CsA and metabolites measuring simultaneously using both HPLC and RIA and creatinine serum levels (Crea) in whole blood samples from 19 kidney-transplanted children over a 3-year observation period. By comparison of the results of HPLC, RIA and Crea determinations (n = 1,284) we found a highly variable metabolization rate (RIA/HPLC ratio) of 5.25 +/- 2.33 (range 1.37-12.9). No direct correlation was found between changes in RIA/HPLC ratios and kidney function, rejection and infection periods. Dosage/HPLC and dosage/RIA showed no significant correlation. A higher correlation between HPLC, Crea and nephrotoxicity was found than between RIA and Crea. Because of rapid and large variations of CsA metabolization rates in young allograft recipients, we recommend measurements of CsA blood concentrations with any HPLC method specific for unchanged drug, since CsA metabolites detected by RIA, at least those which are most abundant, have less immunosuppressive and toxic effects. PMID:3075152

  1. Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies

    PubMed Central

    Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse

    2015-01-01

    In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6–35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3–17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4+ T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6–35 months and 3–17 years. These studies have been registered at www.clinicaltrials.gov NCT00971321 and NCT00964158. PMID:26176592

  2. Increasing immunization coverage.

    PubMed

    Hammer, Lawrence D; Curry, Edward S; Harlor, Allen D; Laughlin, James J; Leeds, Andrea J; Lessin, Herschel R; Rodgers, Chadwick T; Granado-Villar, Deise C; Brown, Jeffrey M; Cotton, William H; Gaines, Beverly Marie Madry; Gambon, Thresia B; Gitterman, Benjamin A; Gorski, Peter A; Kraft, Colleen A; Marino, Ronald Vincent; Paz-Soldan, Gonzalo J; Zind, Barbara

    2010-06-01

    In 1977, the American Academy of Pediatrics issued a statement calling for universal immunization of all children for whom vaccines are not contraindicated. In 1995, the policy statement "Implementation of the Immunization Policy" was published by the American Academy of Pediatrics, followed in 2003 with publication of the first version of this statement, "Increasing Immunization Coverage." Since 2003, there have continued to be improvements in immunization coverage, with progress toward meeting the goals set forth in Healthy People 2010. Data from the 2007 National Immunization Survey showed that 90% of children 19 to 35 months of age have received recommended doses of each of the following vaccines: inactivated poliovirus (IPV), measles-mumps-rubella (MMR), varicella-zoster virus (VZB), hepatitis B virus (HBV), and Haemophilus influenzae type b (Hib). For diphtheria and tetanus and acellular pertussis (DTaP) vaccine, 84.5% have received the recommended 4 doses by 35 months of age. Nevertheless, the Healthy People 2010 goal of at least 80% coverage for the full series (at least 4 doses of DTaP, 3 doses of IPV, 1 dose of MMR, 3 doses of Hib, 3 doses of HBV, and 1 dose of varicella-zoster virus vaccine) has not yet been met, and immunization coverage of adolescents continues to lag behind the goals set forth in Healthy People 2010. Despite these encouraging data, a vast number of new challenges that threaten continued success toward the goal of universal immunization coverage have emerged. These challenges include an increase in new vaccines and new vaccine combinations as well as a significant number of vaccines currently under development; a dramatic increase in the acquisition cost of vaccines, coupled with a lack of adequate payment to practitioners to buy and administer vaccines; unanticipated manufacturing and delivery problems that have caused significant shortages of various vaccine products; and the rise of a public antivaccination movement that uses the

  3. Home point-of-care international normalised ratio monitoring sustained by a non-selective educational program in children.

    PubMed

    Bajolle, Fanny; Lasne, Dominique; Elie, Caroline; Cheurfi, Radhia; Grazioli, Aurélie; Traore, Maladon; Souillard, Patrick; Boudjemline, Younes; Jourdain, Patrick; Bonnet, Damien

    2012-10-01

    Adverse events related to vitamin K antagonist (VKA) therapy might be reduced by point-of-care international normalised ratio (POC INR) monitoring supported by an education program (EP). Our aim was to evaluate the efficacy of a non-selective VKA paediatric EP (regardless of the social, economic, educational or linguistic levels) by analysing the time spent in the therapeutic range (TTR), VKA adverse events and compliance to treatment, and INR control prescriptions. The EP was modified from the pediatric EP previously described but improved by a specifically devised child-focused game. One hundred four consecutive children (median age 8 years) receiving VKA were included in a standardised EP. Patients were in self-testing, and dose adjustments were made by a single physician for three tolerance ranges according to the underlying disease: [2.5-4], [1.8-3.2], and [1.5-2.5]. The median follow-up was 481 days [70-1,001]. The overall TTR was 81.4% [36-100]. The TTR were 74%, 85.6% and 89% for the ranges [2.5-4], [1.8-3.2], and [1.5-2.5], respectively. These results were sustainable during the study period. Only one serious VKA adverse event was recorded. The median number of POC INR tests was 2.5 [1.6-5.7] INR per patient and month. Patients/families performed POC INR when requested in 86.9% of the cases. More than 90% of the families found the EP supportive and wished to follow a long-term reinforcement program. In conclusion, this non-selective child-focused EP for VKA therapy, strongly supported by our dedicated game, is useful in maintaining efficacy, safety and compliance to anticoagulation and its monitoring. PMID:22955724

  4. Protect the Circle of Life: Immunize Our Nations

    MedlinePlus

    ... Children (VFC) Stop Transmission of Polio (STOP) Vaccine Management Business Improvement Project (VMBIP) Global Immunizations & Vaccinations Immunization Program Evaluation (IPE) Assessment, Feedback, Incentives, and Exchange (AFIX) Comprehensive Clinic Assessment Software Application (CoCASA) Instant ...

  5. Influence of health providers on pediatrics' immunization rate.

    PubMed

    Al-lela, Omer Q B; Baidi Bahari, Mohd; Al-abbassi, Mustafa G; Salih, Muhannad R M; Basher, Amena Y

    2012-12-01

    To identify the immunization providers' characteristics associated with immunization rate in children younger than 2 years. A cohort and a cluster sampling design were implemented; 528 children between 18 and 70 months of age were sampled in five public health clinics in Mosul-Iraq. Providers' characterizations were obtained. Immunization rate for the children was assessed. Risk factors for partial immunization were explored using both bivariate analyses and multi-level logistic regression models. Less than half of the children had one or more than one missed dose, considered as partial immunization cases. The study found significant association of immunization rate with provider's type. Two factors were found that strongly impacted on immunization rate in the presence of other factors: birthplace and immunization providers' type. PMID:22538210

  6. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  7. Immunity-based diagnosis for a motherboard.

    PubMed

    Shida, Haruki; Okamoto, Takeshi; Ishida, Yoshiteru

    2011-01-01

    We have utilized immunity-based diagnosis to detect abnormal behavior of components on a motherboard. The immunity-based diagnostic model monitors voltages of some components, CPU temperatures, and fan speeds. We simulated abnormal behaviors of some components on the motherboard, and we utilized the immunity-based diagnostic model to evaluate motherboard sensors in two experiments. These experiments showed that the immunity-based diagnostic model was an effective method for detecting abnormal behavior of components on the motherboard. PMID:22163857

  8. Maternal immunization

    PubMed Central

    Moniz, Michelle H; Beigi, Richard H

    2014-01-01

    Maternal immunization holds tremendous promise to improve maternal and neonatal health for a number of infectious conditions. The unique susceptibilities of pregnant women to infectious conditions, as well as the ability of maternally-derived antibody to offer vital neonatal protection (via placental transfer), together have produced the recent increased attention on maternal immunization. The Advisory Committee on Immunization Practices (ACIP) currently recommends 2 immunizations for all pregnant women lacking contraindication, inactivated Influenza and tetanus toxoid, reduced diphtheria toxoid, and acellular pertussis (Tdap). Given ongoing research the number of vaccines recommended during pregnancy is likely to increase. Thus, achieving high vaccination coverage of pregnant women for all recommended immunizations is a key public health enterprise. This review will focus on the present state of vaccine acceptance in pregnancy, with attention to currently identified barriers and determinants of vaccine acceptance. Additionally, opportunities for improvement will be considered. PMID:25483490

  9. Mexico's immunization programme gets results.

    PubMed

    1994-04-01

    With a decline of almost 60% over the past decade in the mortality of children under age 5 years old to the current rate of 33 child deaths/1000 live births, Mexico has joined the 20 countries listed by UNICEF as making the most progress in reducing child mortality since 1980. Much of this progress can be attributed to Mexico's immunization program, which has brought the proportion of fully immunized children under age 5 years to 94% over the past 5 years. Mexico's president has been instrumental in the program's success, having a personal interest in childhood vaccination and supervising the twice-yearly immunization coverage surveys. Even though presidential elections are being held this year, the immunization program should remain strong regardless of who wins because all of Mexico's political parties have pledged to remain committed to immunization. Awareness in the population about the need for vaccination is maintained with the help of the mass media, especially radio and television. The country's enthusiasm for vaccination seems to be paying off in terms of declining child mortality and the eradication of wild poliovirus. The immunization program reaches all but 2-3% of Mexico's children, despite some logistical difficulties and resistance to vaccines among certain religious groups such as the Mennonites and Jehovah's witnesses. PMID:12321777

  10. Child weighing by the unschooled: a report of a controlled study of growth monitoring over 12 months of Maasai children using direct recording scales.

    PubMed

    Meegan, M; Morley, D C; Brown, R

    1994-01-01

    Growth monitoring was developed as a clinic-based programme in the early 1960s, and has spread widely in many countries. The results of weighing children are usually presented in a graphic form, unintelligible to most mothers and difficult for many health workers to interpret. This study suggests that the TALC Direct Recording Scale will allow growth monitoring to be undertaken even by illiterate mothers in the community and reports the results of a trial with a group of illiterate mothers amongst the Maasai of Kenya. PMID:7886753

  11. Achalasia Previously Diagnosed as Gastroesophageal Reflux Disease by Relying on Esophageal Impedance-pH Monitoring: Use of High-Resolution Esophageal Manometry in Children.

    PubMed

    Pyun, Jung Eun; Choi, Da Min; Lee, Jung Hwa; Yoo, Kee Hwan; Shim, Jung Ok

    2015-03-01

    Gastroesophageal reflux disorder (GERD) is the most common esophageal disorder in children. Achalasia occurs less commonly but has similar symptoms to GERD. A nine-year old boy presented with vomiting, heartburn, and nocturnal cough. The esophageal impedance-pH monitor revealed nonacidic GERD (all-refluxate clearance percent time of 20.9%). His symptoms persisted despite medical treatment for GERD, and he was lost to follow up. Four years later, he presented with heartburn, solid-food dysphagia, daily post-prandial vomiting, and failure to thrive. Endoscopy showed a severely dilated esophagus with candidiasis. High-resolution manometry was performed, and he was diagnosed with classic achalasia (also known as type I). His symptoms resolved after two pneumatic dilatation procedures, and his weight and height began to catch up to his peers. Clinicians might consider using high-resolution manometry in children with atypical GERD even after evaluation with an impedance-pH monitor. PMID:25866734

  12. Maternal Immunization

    PubMed Central

    Chu, Helen Y.; Englund, Janet A.

    2014-01-01

    Maternal immunization has the potential to protect the pregnant woman, fetus, and infant from vaccine-preventable diseases. Maternal immunoglobulin G is actively transported across the placenta, providing passive immunity to the neonate and infant prior to the infant's ability to respond to vaccines. Currently inactivated influenza, tetanus toxoid, and acellular pertussis vaccines are recommended during pregnancy. Several other vaccines have been studied in pregnancy and found to be safe and immunogenic and to provide antibody to infants. These include pneumococcus, group B Streptococcus, Haemophilus influenzae type b, and meningococcus vaccines. Other vaccines in development for potential maternal immunization include respiratory syncytial virus, herpes simplex virus, and cytomegalovirus vaccines. PMID:24799324

  13. Immunity challenge.

    PubMed

    Davenport, R John

    2003-06-11

    As people get older, their immune systems falter. The elderly are more susceptible to infections than youngsters are, and hyperactive inflammatory responses appear to contribute to some age-associated illnesses, including Alzheimer's disease and atherosclerosis. Investigating the effect of aging on the immune system was once a scientific stepchild, but card-carrying immunologists are now tackling the problem head-on. Despite the immune system's complexity, researchers have started to make sense of how its components change with age. As the research progresses, scientists hope to bolster elderly people's response to infectious diseases and quiet the inflammation that can make aging a painful experience. PMID:12844525

  14. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies

    PubMed Central

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M.; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  15. Introduction of sequential inactivated polio vaccine-oral polio vaccine schedule for routine infant immunization in Brazil's National Immunization Program.

    PubMed

    Domingues, Carla Magda Allan S; de Fátima Pereira, Sirlene; Cunha Marreiros, Ana Carolina; Menezes, Nair; Flannery, Brendan

    2014-11-01

    In August 2012, the Brazilian Ministry of Health introduced inactivated polio vaccine (IPV) as part of sequential polio vaccination schedule for all infants beginning their primary vaccination series. The revised childhood immunization schedule included 2 doses of IPV at 2 and 4 months of age followed by 2 doses of oral polio vaccine (OPV) at 6 and 15 months of age. One annual national polio immunization day was maintained to provide OPV to all children aged 6 to 59 months. The decision to introduce IPV was based on preventing rare cases of vaccine-associated paralytic polio, financially sustaining IPV introduction, ensuring equitable access to IPV, and preparing for future OPV cessation following global eradication. Introducing IPV during a national multivaccination campaign led to rapid uptake, despite challenges with local vaccine supply due to high wastage rates. Continuous monitoring is required to achieve high coverage with the sequential polio vaccine schedule. PMID:25316829

  16. Evidence for extended age dependent maternal immunity in infected children: mother to child transmission of HIV infection and potential interventions including sulfatides of the human fetal adnexa and complementary or alternative medicines.

    PubMed

    Bhargav, Hemant; Huilgol, Vidya; Metri, Kashinath; Sundell, I Birgitta; Tripathi, Satyam; Ramagouda, Nagaratna; Jadhav, Mahesh; Raghuram, Nagarathna; Ramarao, Nagendra Hongasandra; Koka, Prasad S

    2012-01-01

    -ART children, a significant correlation was observed between the age of the child and CD4 counts (measured separately in the months of June 2011 and December 2011). Both the CD4 counts measured in June 2011 (n=6; r=-0.82, p= 0.04) as well as in December 2011 (n=6; r=-0.97, p=0.001) showed a significant decline as the age progressed. Also, at the same center, among on-ART children, the CD4 counts in June 2011 (n=7) and December 2011 (n=8) were significantly different between the children in the age group of 8 below years, and those in the age group of 14 years and above (p= 0.005). As HIV infected children grow in age, they may lose maternal derived immunity as shown by the decrease in CD4 counts, irrespective of their ART status. It is to be expected from these results that the conferred maternal immunity (possibly primarily humoral and secondarily cytotoxic immune responses) to the virus acquired at child birth taper off and eventually overcome by the generation of mutant HIV strains in the children, as the life spans of the infected children progress. We have discussed safer therapeutic interventions whose efficacy on HIV/AIDS may be synergistic to or even substitute the existing treatment strategies. Some of such interventions may even be customized to help eliminate MTCT. Further, these virus infected pregnant mother patient blood / serum samples could prove useful in the vaccine development against HIV infection. PMID:23619381

  17. Immunization Coverage

    MedlinePlus

    ... underused vaccines is increasing. Immunization currently averts an estimated 2 to 3 million deaths every year. An ... avoided, however, if global vaccination coverage improves. An estimated 19.4 million infants worldwide are still missing ...

  18. Immune response

    MedlinePlus

    ... inflammation and tissue repair. In: Goldman L, Schafer AI, eds. Goldman's Cecil Medicine . 24th ed. Philadelphia, PA: ... and adaptive immune systems. In: Goldman L, Schafer AI, eds. Goldman's Cecil Medicine . 24th ed. Philadelphia, PA: ...

  19. Immune response

    MedlinePlus Videos and Cool Tools

    The immune system includes specialized white blood cells, called lymphocytes that adapt themselves to fight specific foreign invaders. These cells develop into two groups in the bone marrow. From the bone ...

  20. An update on the strategies used for the treatment of chronic hepatitis B in children.

    PubMed

    Clemente, Maria Grazia; Vajro, Pietro

    2016-05-01

    Chronic hepatitis B (CHB) in children shows a variety of clinical presentations, which influence its natural course and treatment options. This report provides an overview of the ongoing strategies in pediatric CHB management. Interferon-α represents the first choice of treatment in children showing HBV replication and hepatic inflammation (immune active CHB), while the recommendation is to monitor inactive/immune-tolerant children (normal transaminases and low/absent viral replication). When circumstances preclude the use of Interferon-α and in cases of compensated/decompensated cirrhosis, entecavir for children above 2 years of age or tenofovir for children above 12 years of age are the nucleos(t)ide analogues recommended by the most recent guidelines. PMID:26752166

  1. Immune Responses to Circulating and Vaccine Viral Strains in HIV-Infected and Uninfected Children and Youth Who Received the 2013/2014 Quadrivalent Live-Attenuated Influenza Vaccine

    PubMed Central

    Weinberg, Adriana; Curtis, Donna; Ning, Mariangeli Freitas; Claypool, David Jeremy; Jalbert, Emilie; Patterson, Julie; Frank, Daniel N.; Ir, Diana; Armon, Carl

    2016-01-01

    The live-attenuated influenza vaccine (LAIV) has generally been more efficacious than the inactivated vaccine in children. However, LAIV is not recommended for HIV-infected children because of insufficient data. We compared cellular, humoral, and mucosal immune responses to the 2013–2014 LAIV quadrivalent (LAIV4) in HIV-infected and uninfected children 2–25 years of age (yoa). We analyzed the responses to the vaccine H1N1 (H1N1-09), to the circulating H1N1 (H1N1-14), which had significant mutations compared to H1N1-09 and to B Yamagata (BY), which had the highest effectiveness in 2013–2014. Forty-six HIV-infected and 56 uninfected participants with prior influenza immunization had blood and nasal swabs collected before and after LAIV4 for IFNγ T and IgG/IgA memory B-cell responses (ELISPOT), plasma antibodies [hemagglutination inhibition (HAI) and microneutralization (MN)], and mucosal IgA (ELISA). The HIV-infected participants had median CD4+ T cells = 645 cells/μL and plasma HIV RNA = 20 copies/mL. Eighty-four percent were on combination anti-retroviral therapy. Regardless of HIV status, significant increases in T-cell responses were observed against BY, but not against H1N1-09. H1N1-09 T-cell immunity was higher than H1N1-14 both before and after vaccination. LAIV4 significantly increased memory IgG B-cell immunity against H1N1-14 and BY in uninfected, but not in HIV-infected participants. Regardless of HIV status, H1N1-09 memory IgG B-cell immunity was higher than H1N1-14 and lower than BY. There were significant HAI titer increases after vaccination in all groups and against all viruses. However, H1N1-14 MN titers were significantly lower than H1N1-09 before and after vaccination overall and in HIV-uninfected vaccinees. Regardless of HIV status, LAIV4 increased nasal IgA concentrations against all viruses. The fold-increase in H1N1-09 IgA was lower than BY. Overall, participants <9 yoa had decreased BY-specific HAI and nasal IgA responses

  2. We Must Immunize Every Child by Two.

    ERIC Educational Resources Information Center

    Carter, Rosalynn; Bumpers, Betty F.

    1992-01-01

    Discusses the development and initial implementation of the "Every Child by Two" project. The project is designed to immunize as many newborn through two-year-old children in the United States as possible against communicable childhood diseases, such as measles, and to create a program to systematically immunize this age group in the future. (BB)

  3. Examining the social determinants of children's developmental health: protocol for building a pan-Canadian population-based monitoring system for early childhood development

    PubMed Central

    Guhn, Martin; Janus, Magdalena; Enns, Jennifer; Brownell, Marni; Forer, Barry; Duku, Eric; Muhajarine, Nazeem; Raos, Rob

    2016-01-01

    Introduction Early childhood is a key period to establish policies and practices that optimise children's health and development, but Canada lacks nationally representative data on social indicators of children's well-being. To address this gap, the Early Development Instrument (EDI), a teacher-administered questionnaire completed for kindergarten-age children, has been implemented across most Canadian provinces over the past 10 years. The purpose of this protocol is to describe the Canadian Neighbourhoods and Early Child Development (CanNECD) Study, the aims of which are to create a pan-Canadian EDI database to monitor trends over time in children's developmental health and to advance research examining the social determinants of health. Methods and analysis Canada-wide EDI records from 2004 to 2014 (representing over 700 000 children) will be linked to Canada Census and Income Taxfiler data. Variables of socioeconomic status derived from these databases will be used to predict neighbourhood-level EDI vulnerability rates by conducting a series of regression analyses and latent variable models at provincial/territorial and national levels. Where data are available, we will measure the neighbourhood-level change in developmental vulnerability rates over time and model the socioeconomic factors associated with those trends. Ethics and dissemination Ethics approval for this study was granted by the Behavioural Research Ethics Board at the University of British Columbia. Study findings will be disseminated to key partners, including provincial and federal ministries, schools and school districts, collaborative community groups and the early childhood development research community. The database created as part of this longitudinal population-level monitoring system will allow researchers to associate practices, programmes and policies at school and community levels with trends in developmental health outcomes. The CanNECD Study will guide future early childhood

  4. Vitamin A and immune function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vitamin A deficiency increases the risk of death from infectious diseases in infants and young children in areas of the world where vitamin A deficiency is common. This increased risk apparently results from impaired innate and adaptive immune function. Retinoic acid is the major metabolite of vit...

  5. Immune thrombocytopenia.

    PubMed

    Kistangari, Gaurav; McCrae, Keith R

    2013-06-01

    Immune thrombocytopenia (ITP) is a common hematologic disorder characterized by isolated thrombocytopenia. ITP presents as a primary or a secondary form. ITP may affect individuals of all ages, with peaks during childhood and in the elderly, in whom the age-specific incidence of ITP is greatest. Bleeding is the most common clinical manifestation of ITP. The pathogenesis of ITP is complex, involving alterations in humoral and cellular immunity. Corticosteroids remain the most common first line therapy for ITP. This article summarizes the classification and diagnosis of primary and secondary ITP, as well as the pathogenesis and options for treatment. PMID:23714309

  6. [Setting-up an epidemiological monitoring system of mortality by trauma in children under 15 years of age in metropolitan France].

    PubMed

    Lasbeur, L; Thélot, B

    2014-11-01

    In metropolitan France in 2009, trauma was the leading cause of death among children under 15 years of age: 459 deaths (source CépiDc), with 236 deaths by home and leisure injuries (HLI). These rough mortality data do not describe the circumstances of the trauma responsible for the death. The "Fatal home and leisure injury among children under 15 years old-MAC-15" feasibility study was set up in 2009 in France in the following regions: Île-de-France, Nord-Pas-de-Calais, and Provence-Alpes-Côte d'Azur. The main objective of the survey was to understand exactly how these accidents occurred and determine their risk factors. Its secondary objectives were to test the feasibility and analyze the possibility of extending and/or scaling up the monitoring of these deaths. Case reporting was made through death certificates, contacts with regional health agencies, and media surveillance. A detailed record was completed by the medical certifier. In 2009, 76 HLI-related deaths in under 15-year-old children were identified by the survey in the three regions. The victims were mostly boys. The most common cause of death was drowning, followed by suffocation, falls, and fires. The survey contributed to precisely determining the risk factors of HLIs in children and, most often, to identifying the cause responsible for the fatal accident. The feasibility conclusions of this survey are positive, data collection is effective and practicable, and its quality and exhaustiveness were demonstrated. Implementation of the "detailed analyses of the deaths by trauma among children under 15 years old" survey is proposed. This survey will be extended to all deaths by trauma among children in Metropolitan France. PMID:25267189

  7. Creating Powerful Learning Opportunities for All Children: The Development and Use of a Self-Monitoring Checklist for Teachers. Draft.

    ERIC Educational Resources Information Center

    Hague, Sally A.; Walker, Carole

    Powerful learning is the premise that the type of education provided for gifted children works well for all children. This long-range study examined the usefulness of elements from a more aggressive approach to powerful learning than the one implicit in the accelerated schools model--specifically a teacher checklist, collegial coaching, reflective…

  8. Maladaptive Conflict Monitoring as Evidence for Executive Dysfunction in Children with Chromosome 22q11.2 Deletion Syndrome

    ERIC Educational Resources Information Center

    Bish, Joel P.; Ferrante, Samantha M.; McDonald-McGinn, Donna; Zackai, Elaine; Simon, Tony J.

    2005-01-01

    Using an adaptation of the Attentional Networks Test, we investigated aspects of executive control in children with chromosome 22q11.2 deletion syndrome (DS22q11.2), a common but not well understood disorder that produces non-verbal cognitive deficits and a marked incidence of psychopathology. The data revealed that children with DS22q11.2…

  9. The Impact of Retrieval Processes, Age, General Achievement Level, and Test Scoring Scheme for Children's Metacognitive Monitoring and Controlling

    ERIC Educational Resources Information Center

    Krebs, Saskia Susanne; Roebers, Claudia Maria

    2012-01-01

    This multi-phase study examined the influence of retrieval processes on children's metacognitive processes in relation to and in interaction with achievement level and age. First, N = 150 9/10- and 11/12-year old high and low achievers watched an educational film and predicted their test performance. Children then solved a cloze test regarding the…

  10. Direct measurement of peptide-specific CD8+ T cells using HLA-A2:Ig dimer for monitoring the in vivo immune response to a HER2/neu vaccine in breast and prostate cancer patients.

    PubMed

    Woll, Michael M; Fisher, Christine M; Ryan, Gayle B; Gurney, Jennifer M; Storrer, Catherine E; Ioannides, Constantin G; Shriver, Craig D; Moul, Judd W; McLeod, David G; Ponniah, Sathibalan; Peoples, George E

    2004-07-01

    HER2/neu is a proto-oncogene and a member of the epidermal growth factor receptor family of proteins that is overexpressed in numerous types of human cancer. We are currently conducting clinical trials with the HER2/neu E75 peptide vaccine in breast and prostate cancer patients. We have evaluated the use of HLA-A2 dimer molecule for the immunological monitoring of cancer patients receiving the E75 peptide vaccine. Peripheral blood samples from patients receiving the vaccine were stained with HLA-A2 dimers containing the vaccine peptide E75 or control peptides and analyzed by flow cytometry. We compared the HLA-A2 dimer assay to standard methods of immunologic monitoring (IFN-gamma release, lymphocyte proliferation, and cytotoxicity). The HLA-A2 dimer assay was also compared with the HLA-A2 tetramer assay. E75 peptide-specific CD8 T cells were detected directly in the peripheral blood of patients by staining with E75-HLA-A2 dimers and CD8 antibodies. T cell cultures generated by repeated stimulations using E75 peptide-pulsed dendritic cells showed increased staining with E75-peptide loaded HLA-A2 dimers. Simultaneously analysis by the dimer assay and standard immunologic assays demonstrated that the dimer-staining assay correlated well with these methods of immunologic monitoring. A direct comparison using E75-specific HLA-A2 tetramers and HLA-A2 dimers for the detection of E75-specific CD8 T cells in peripheral blood showed comparable results with the two assays. Our findings indicate that the HLA-A2 dimer is a powerful new tool for directly quantifying and monitoring immune responses of antigen-specific T cells in peptide vaccine clinical trials. PMID:15163902

  11. Plant Immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants are faced with defending themselves against a multitude of pathogens, including bacteria, fungi, viruses, nematodes, etc. Immunity is multi-layered and complex. Plants can induce defenses when they recognize small peptides, proteins or double-stranded RNA associated with pathogens. Recognitio...

  12. The Cost Effectiveness of Hepatitis Immunization for US College Students

    ERIC Educational Resources Information Center

    Jacobs, R. Jake; Saab, Sammy; Meyerhoff, Allen S.

    2003-01-01

    Hepatitis B immunization is recommended for all American children, and hepatitis A immunization is recommended for children who live in areas with elevated disease rates. Because hepatitis A and B occur most commonly in young adults, the authors examined the cost effectiveness of college-based vaccination. They developed epidemiologic models to…

  13. Brief Report: Immune Factors in Autism: A Critical Review.

    ERIC Educational Resources Information Center

    Krause, Ilan; He, Ziao-Song; Gershwin, M. Eric; Shoenfeld, Yehuda

    2002-01-01

    This article reviews studies linking autistic disorder with various immune factors. It concludes that although various immune system abnormalities have been reported in children with autism, previous studies are largely association based and it remains difficult to draw conclusions regarding the role of immune factors in the etiopathogenesis of…

  14. Monitoring Children with Reading Disabilities' Response to Phonics Intervention: Are There Differences between Intervention Aligned and General Skill Progress Monitoring Assessments?

    ERIC Educational Resources Information Center

    Olinghouse, Natalie G.; Lambert, Warren; Compton, Donald L.

    2006-01-01

    This study investigated whether 2 different progress monitoring assessments differentially predicted growth in reading skills associated with systematic phonics instruction. Oral reading fluency (ORE) was compared with an intervention aligned word list (IAWL) as predictors of growth in untimed and timed decoding and word identification and text…

  15. Evaluation of the Immune Response to Interferon Gamma Release Assay and Tuberculin Skin Test Among BCG Vaccinated Children in East of Egypt: A Cross-Sectional Study.

    PubMed

    Beshir, Mohamed Refaat; Zidan, Alaa Ebrahim; El-Saadny, Hosam Fathi; Ramadan, Raghdaa Abdelaziz; Karam, Nehad Ahmed; Amin, Ezzat Kamel; Mohamed, Marwa Zakaria; Abdelsamad, Nahla Mohamed

    2016-04-01

    Bacille Calmette-Guérin vaccine (BCG) vaccination is used routinely in most of countries, especially developing one. The efficacy of the BCG vaccination generally decreases with time. The tuberculin skin test (TST) is a most popular diagnostic test for suspicion of tuberculosis (TB) in children till now, but it has many false positives. The interferon-gamma release assay (IGRA) is more specific than TST for detection of childhood TB, as it is more specific to Mycobacterium tuberculosis.Evaluate the interferon gamma response and TST reaction in BCG vaccinated children in east of Egypt.150 children were included in the study aged 1 month to 12 years; the collected data from the children included, full history taking, clinical examination, examination for the presence or absence of BCG scar under direct light. All the children had performed TST, IGRA.TST was done for all studied group reveal 51.3% with size of reaction <5 mm, 39.3% with size of reaction = 5 to 9 mm while 9.3% with size of reaction ≥10 mm. Mean size of reaction was 4.07 mm. Interferon gamma release assay was done for all studied group reveal 5 children (3.3%) with positive test. There was significant difference between the size of TST reaction and age (P < 0.01) with old children were more frequent to show positive reaction. Also, children with age range 1 month to 1 year were frequently have negative IGRA test, while children with age range 4 years to 12 years were frequently have positive test (P < 0.01). There was moderate agreement between IGRA and TST results (Kappa [κ] = 0.475). With high agreement between IGRA and TST results in children with absent BCG scar (κ = 1000).Therefore, Interferon gamma release assays have higher specificity and lower cross-reactions with BCG vaccination and nontuberculous Mycobacteraie than TST. PMID:27124042

  16. Evaluation of the Immune Response to Interferon Gamma Release Assay and Tuberculin Skin Test Among BCG Vaccinated Children in East of Egypt

    PubMed Central

    Beshir, Mohamed Refaat; Zidan, Alaa Ebrahim; El-Saadny, Hosam Fathi; Ramadan, Raghdaa Abdelaziz; Karam, Nehad Ahmed; Amin, Ezzat Kamel; Mohamed, Marwa Zakaria; Abdelsamad, Nahla Mohamed

    2016-01-01

    Abstract Bacille Calmette-Guérin vaccine (BCG) vaccination is used routinely in most of countries, especially developing one. The efficacy of the BCG vaccination generally decreases with time. The tuberculin skin test (TST) is a most popular diagnostic test for suspicion of tuberculosis (TB) in children till now, but it has many false positives. The interferon-gamma release assay (IGRA) is more specific than TST for detection of childhood TB, as it is more specific to Mycobacterium tuberculosis. Evaluate the interferon gamma response and TST reaction in BCG vaccinated children in east of Egypt. 150 children were included in the study aged 1 month to 12 years; the collected data from the children included, full history taking, clinical examination, examination for the presence or absence of BCG scar under direct light. All the children had performed TST, IGRA. TST was done for all studied group reveal 51.3% with size of reaction <5 mm, 39.3% with size of reaction = 5 to 9 mm while 9.3% with size of reaction ≥10 mm. Mean size of reaction was 4.07 mm. Interferon gamma release assay was done for all studied group reveal 5 children (3.3%) with positive test. There was significant difference between the size of TST reaction and age (P < 0.01) with old children were more frequent to show positive reaction. Also, children with age range 1 month to 1 year were frequently have negative IGRA test, while children with age range 4 years to 12 years were frequently have positive test (P < 0.01). There was moderate agreement between IGRA and TST results (Kappa [κ] = 0.475). With high agreement between IGRA and TST results in children with absent BCG scar (κ = 1000). Therefore, Interferon gamma release assays have higher specificity and lower cross-reactions with BCG vaccination and nontuberculous Mycobacteraie than TST. PMID:27124042

  17. Overcoming Challenges to Childhood Immunizations Status.

    PubMed

    Sabnis, Svapna S; Conway, James H

    2015-10-01

    Vaccines are one of the greatest public health achievements, preventing both mortality and morbidity. However, overall immunization rates are still below the 90% target for Healthy People 2020. There remain significant disparities in immunization rates between children of different racial/ethnic groups, as well as among economically disadvantaged populations. There are systemic issues and challenges in providing access to immunization opportunities. In addition, vaccine hesitancy contributes to underimmunization. Multiple strategies are needed to improve immunization rates, including improving access to vaccines and minimizing financial barriers to families. Vaccine status should be assessed and vaccines given at all possible opportunities. PMID:26318942

  18. Federal immunity Law in Higher Education.

    ERIC Educational Resources Information Center

    Johnsen, Christopher; Todd, James C.

    1999-01-01

    Monitors and analyzes developments in immunity law in 1998 applicable to higher education. The review suggests that the extent of a plaintiff's constitutional rights and the scope of a public official's qualified immunity depend to a not insignificant degree on which circuit, or even which panel, decides the case. (SLD)

  19. Immune Thrombocytopenia

    PubMed Central

    Kistanguri, Gaurav; McCrae, Keith R.

    2013-01-01

    Immune thrombocytopenia (ITP) is a common hematologic disorder characterized by isolated thrombocytopenia. ITP presents as a primary form characterized by isolated thrombocytopenia (platelet count < 100 × 109/L) in the absence of other causes or disorders that may be associated with thrombocytopenia, or a secondary form in which immune thrombocytopenia develops in association with another disorder that is usually immune or infectious. ITP may affect individuals of all ages, with peaks during childhood and in the elderly, in whom the age specific incidence of ITP is greatest. Bleeding is the most common clinical manifestation of ITP, with the risk of bleeding and related morbidity increased in elderly patients. The pathogenesis of ITP is complex, involving alterations in humoral and cellular immunity. Thrombocytopenia is caused by antibodies that react with glycoproteins expressed on platelets and megakaryocytes (glycoprotein IIb/IIIa, Ib/IX and others), causing shortened survival of circulating platelets and impairing platelet production. Diminished numbers and function of regulatory T cells, as well as the effects of cytotoxic T cells also contribute to the pathogenesis of ITP. Corticosteroids remain the most common first line therapy for ITP, occasionally in conjunction with intravenous immunoglobulin (IVIg) and anti-Rh(D). However, these agents do not lead to durable remissions in the majority of adults with ITP, and considerable heterogeneity exists in the use of second line approaches, which may include splenectomy, Rituximab, or thrombopoietin receptor agonists (TRAs). This review summarizes the classification and diagnosis of primary and secondary ITP, as well as the pathogenesis and options for treatment. Remarkable advances in the understanding and management of ITP have been achieved over the last decade, though many questions remain. PMID:23714309

  20. Immunization Schedules for Adults

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Adults in Easy-to-read Formats ... previous immunizations. View or Print a Schedule Recommended Immunizations for Adults (19 Years and Older) by Age ...

  1. Malaria Vaccine Protection Short-Lived in Young Children

    MedlinePlus

    ... a situation where unvaccinated children have more natural immunity than vaccinated children, and therefore get less malaria," ... may allow a person to develop some natural immunity to the parasite, Plowe suggested. "You're basically ...

  2. Desensitization and immune tolerance induction in children with severe factor IX deficiency; inhibitors and adverse reactions to replacement therapy: a case-report and literature review.

    PubMed

    Bon, Andrea; Morfini, Massimo; Dini, Alessandro; Mori, Francesca; Barni, Simona; Gianluca, Sottilotta; de Martino, Maurizio; Novembre, Elio

    2015-01-01

    Hemophilia B is a rare X-linked recessive disorder with plasma factor IX (FIX) deficiency. 1-3% of patients treated with exogenous FIX-containing products develop inhibitors (i.e. polyclonal high affinity immunoglobulins) that neutralize the procoagulant activity of a specific coagulation factor. Although the incidence of inhibitors in hemophilia B patients is low, most are "high titer" and frequently associated with the development of severe allergic or anaphylactic reactions. Immune tolerance induction as a strategy for inhibitor eradication was first described in 1984. Unfortunately, the overall reported success of immune tolerance induction in FIX deficiency with inhibitors is approximately 25-40%.We report the case of a 2-year-old boy with hemophilia B severe FIX deficiency (<1%), inhibitor antibodies to FIX development, and a history of adverse reactions to FIX infusions, who underwent a successful desensitization and immune tolerance induction with a daily FIX infusion. With this regimen the inhibitor titer decreased with effective bleeding prevention. PMID:25887512

  3. [The epidemiological analysis of monitoring of the immune status in liquidators of consequences of the Chernobyl accident for early identification of risk groups and diagnostics of oncological diseases. Report 2. Dependence of frequency and changes in the immune status on risk factors of radiation accident].

    PubMed

    Oradovskaia, I V; Pashchenkova, Iu G; Feoktistov, V V; Nikonova, M F; Vikulov, G Kh; Bozheskaia, N V; Smirnova, N N

    2011-01-01

    liquidators-86. Specific features of changes in IS depending on a dose of external gamma-irradiation have been established. Increase in the frequency of MN among liquidators, in relation to the number of examinees in each age group, with age has been revealed. Distinctions in the age dynamics of IS in liquidators in the presence and in the absence of MN manifested themselves in a stable level of values of CD3+, CD4+, CD8(+)-T-lymphocytes, immune regulation index, CD95+, serum IgA at the age between 40 and 70 years old with a subsequent reduction in indicators and increase in the content of CD8(+)-T-lymphocytes with age in the absence of MN; continuous increase of CD3-16/56(+)-NK-cells in the presence of MN and decrease in the values after 70 in the absence of MN. Also revealed in IS of the both age groups of liquidators over 70 with and without MN was the deficiency of the T-cell component (CD3+, CD4(+)-T-lymphocytes, CD4+/CD8+ index) and the increase in absolute values of CD8(+)-T-lymphocytes. The growing deficiency of CD4(+)-T-lymphocytes during monitoring against the background of ever rising values of CD8(+)-T-lymphocytes leading to the weakening of the immune regulation due to progressing disorders of the T-lymphocyte regulatory subpopulation distribution can serve an indicator for the adverse prognosis of the life expectancy in the presence of MN. PMID:21520623

  4. Accuracy and Usefulness of the HEDIS Childhood Immunization Measures

    PubMed Central

    Solomon, Barry S.; Kim, Julia M.; Miller, Marlene R.

    2012-01-01

    OBJECTIVE: With the use of Centers for Disease Control and Prevention (CDC) immunization recommendations as the gold standard, our objectives were to measure the accuracy (“is this child up-to-date on immunizations?”) and usefulness (“is this child due for catch-up immunizations?”) of the Healthcare Effectiveness Data and Information Set (HEDIS) childhood immunization measures. METHODS: For children aged 24 to 35 months from the 2009 National Immunization Survey, we assessed the accuracy and usefulness of the HEDIS childhood immunization measures for 6 individual immunizations and a composite. RESULTS: A total of 12 096 children met all inclusion criteria and composed the study sample. The HEDIS measures had >90% accuracy when compared with the CDC gold standard for each of the 6 immunizations (range, 94.3%–99.7%) and the composite (93.8%). The HEDIS measure was least accurate for hepatitis B and pneumococcal conjugate immunizations. The proportion of children for which the HEDIS measure yielded a nonuseful result (ie, an incorrect answer to the question, “is this child due for catch-up immunization?”) ranged from 0.33% (varicella) to 5.96% (pneumococcal conjugate). The most important predictor of HEDIS measure accuracy and usefulness was the CDC-recommended number of immunizations due at age 2 years; children with zero or all immunizations due were the most likely to be correctly classified. CONCLUSIONS: HEDIS childhood immunization measures are, on the whole, accurate and useful. Certain immunizations (eg, hepatitis B, pneumococcal conjugate) and children (eg, those with a single overdue immunization), however, are more prone to HEDIS misclassification. PMID:22451701

  5. [Evaluation of postvaccinal pertussis immunity by using immunoenzyme analysis].

    PubMed

    Khardina, A A; Lapaeva, I A; Amelina, I P; Rusakova, E V; Kuliakina, M N

    1989-01-01

    The effectiveness of adsorbed DPT vaccine manufactured in the USSR, evaluated by its capacity of inducing the formation of the main classes of immunoglobulins and by the duration of immune response to the acellular complex of protective antigens (pertussis toxin and agglutinogen-2), was studied with the use of modified EIA. Out of 273 children immunized with adsorbed DPT vaccine in the course of this study, 87.2% had IgG-antibodies, 14.1% had IgA-antibodies and 3.2% of the children had IgM-antibodies. The level of immunity in children having received the full course of immunization with adsorbed DPT vaccine was significantly higher in comparison with children given only the primary course of immunization and nonimmunized children of the same age. Antipertussis immunity was found to decrease two years after the completion of the course of immunization with adsorbed DPT vaccine and in children over 5-6 years of age. Adsorbed DPT vaccine prevented the disease, but not infection. The level of postinfection immunity was higher than that of postvaccinal immunity. PMID:2540600

  6. Philippine campaign boosts child immunizations.

    PubMed

    Manuel-santana, R

    1993-03-01

    In 1989, USAID awarded the Philippines a 5-year, US $50 million Child Survival Program targeting improvement in immunization coverage of children, prenatal care coverage for pregnant women, and contraceptive prevalence. Upon successful completion of performance benchmarks at the end of each year, USAID released monies to fund child survival activities for the following year. This program accomplished a major program goal, which was decentralization of health planning. The Philippine Department of Health soon incorporated provincial health planning. The Philippine Department of Health soon incorporated provincial health planning in its determination of allocation of resources. Social marketing activities contributed greatly to success in achieving the goal of boosting the immunization coverage rate for the 6 antigens listed under the Expanded Program for Immunization (51%-85% of infants, 1986-1991). In fact, rural health officers in Tarlac Province in Central Luzon went from household to household to talk to mothers about the benefits of immunizing a 1-year-old child, thereby contributing greatly to their achieving a 95% full immunization coverage rate by December 1991. Social marketing techniques included modern marketing strategies and multimedia channels. They first proved successful in metro Manila which, at the beginning of the campaign, had the lowest immunization rate of all 14 regions. Every Wednesday was designated immunization day and was when rural health centers vaccinated the children. Social marketing also successfully publicized oral rehydration therapy (ORT), breast feeding, and tuberculosis control. Another contributing factor to program success in child survival activities was private sector involvement. For example, the Philippine Pediatric Society helped to promote ORT as the preferred treatment for acute diarrhea. Further, the commercial sector distributed packets of oral rehydration salts and even advertised its own ORT product. At the end of 2

  7. Uptake of oral rotavirus vaccine and timeliness of routine immunization in Brazil’s National Immunization Program

    PubMed Central

    Flannery, Brendan; Samad, Samia; de Moraes, José Cássio; Tate, Jacqueline E.; Danovaro-Holliday, M. Carolina; de Oliveira, Lúcia Helena; Rainey, Jeanette J.

    2015-01-01

    Introduction In March, 2006, oral rotavirus vaccine was added to Brazil’s infant immunization schedule with recommended upper age limits for initiating (by age 14 weeks) and completing (by age 24 weeks) the two-dose series to minimize age-specific risk of intussusception following rotavirus vaccination. Several years after introduction, estimated coverage with rotavirus vaccine (83%) was lower compared to coverage for other recommended childhood immunizations (≥94%). Methods We analyzed data from Brazil’s national immunization program on uptake of oral rotavirus vaccine by geographic region and compared administrative coverage estimates for first and second doses of oral rotavirus vaccine (Rota1 and Rota2) with first and second doses of diphtheria-tetanus-pertussis-Haemophilus influenzae type b vaccine (DTP-Hib1 and DTP-Hib2). For 27 Brazilian cities, we compared differences between estimated rotavirus and DTP-Hib coverage in 2010 with delayed receipt of DTP-Hib vaccine among a cohort of children surveyed before rotavirus introduction. Results In 2010, infant vaccination coverage was 99.0% for DTP-Hib1 versus 95.2% for Rota1 (3.8% difference), and 98.4% for DTP-Hib2 versus 83.0% for Rota2 (15.4% difference), with substantial regional variation. Differences between DTP-Hib and rotavirus vaccination coverage in Brazilian cities correlated with delay in DTP-Hib vaccination among children surveyed. Age restrictions for initiating and completing the rotavirus vaccination series likely contributed to lower coverage with rotavirus vaccine in Brazil. Conclusion To maximize benefits of rotavirus vaccination, strategies are needed to improve timeliness of routine immunizations; monitoring rotavirus vaccine uptake and intussusception risk is needed to guide further recommendations for rotavirus vaccination. PMID:23313652

  8. A prototype of a novel cell phone application for tracking the vaccination coverage of children in rural communities.

    PubMed

    Katib, Anas; Rao, Deepthi; Rao, Praveen; Williams, Karen; Grant, Jim

    2015-11-01

    Immunization saves millions of lives against vaccine-preventable diseases. Yet, 24 million children born every year do not receive proper immunization during their first year. UNICEF and WHO have emphasized the need to strengthen the immunization surveillance and monitoring in developing countries to reduce childhood deaths. In this regard, we present a software application called Jeev to track the vaccination coverage of children in rural communities. Jeev synergistically combines the power of smartphones and the ubiquity of cellular infrastructure, QR codes, and national identification cards. We present the design of Jeev and highlight its unique features along with a detailed evaluation of its performance and power consumption using the National Immunization Survey datasets. We are in discussion with a non-profit organization in Haiti to pilot test Jeev in order to study its effectiveness and identify socio-cultural issues that may arise in a large-scale deployment. PMID:26363678

  9. Estimation of immunization providers' activities cost, medication cost, and immunization dose errors cost in Iraq.

    PubMed

    Al-lela, Omer Qutaiba B; Bahari, Mohd Baidi; Al-abbassi, Mustafa G; Salih, Muhannad R M; Basher, Amena Y

    2012-06-01

    The immunization status of children is improved by interventions that increase community demand for compulsory and non-compulsory vaccines, one of the most important interventions related to immunization providers. The aim of this study is to evaluate the activities of immunization providers in terms of activities time and cost, to calculate the immunization doses cost, and to determine the immunization dose errors cost. Time-motion and cost analysis study design was used. Five public health clinics in Mosul-Iraq participated in the study. Fifty (50) vaccine doses were required to estimate activities time and cost. Micro-costing method was used; time and cost data were collected for each immunization-related activity performed by the clinic staff. A stopwatch was used to measure the duration of activity interactions between the parents and clinic staff. The immunization service cost was calculated by multiplying the average salary/min by activity time per minute. 528 immunization cards of Iraqi children were scanned to determine the number and the cost of immunization doses errors (extraimmunization doses and invalid doses). The average time for child registration was 6.7 min per each immunization dose, and the physician spent more than 10 min per dose. Nurses needed more than 5 min to complete child vaccination. The total cost of immunization activities was 1.67 US$ per each immunization dose. Measles vaccine (fifth dose) has a lower price (0.42 US$) than all other immunization doses. The cost of a total of 288 invalid doses was 744.55 US$ and the cost of a total of 195 extra immunization doses was 503.85 US$. The time spent on physicians' activities was longer than that spent on registrars' and nurses' activities. Physician total cost was higher than registrar cost and nurse cost. The total immunization cost will increase by about 13.3% owing to dose errors. PMID:22521848

  10. Patterns of postnatal growth in HIV-infected and HIV-exposed children

    PubMed Central

    Isanaka, Sheila; Duggan, Christopher; Fawzi, Wafaie W.

    2009-01-01

    HIV infection can contribute to disturbances in both linear growth and weight gain in early childhood, with disturbances often apparent as early as 3 mo of age. There is little evidence for a difference in the early growth of HIV-exposed but uninfected children compared to healthy controls. Owing to the close association of growth with immune function and clinical progression, an understanding of growth patterns may be an important tool to ensure the provision of appropriate care to HIV-infected and exposed children. Timely growth monitoring may be used to improve the clinical course and quality of life of these children. PMID:19519675

  11. The impact of WIC and AFDC in screening and delivering childhood immunizations.

    PubMed

    Birkhead, G S; Cicirello, H G; Talarico, J

    1996-01-01

    Two publicly funded programs, the Special Supplemental Food Program for Women, Infants and Children (WIC) and Aid to Families with Dependent Children (AFDC), serve large numbers of children who may be at risk for poor immunization status. A review of the literature as well as conference abstracts and program reports for studies of immunization initiatives carried out in these settings was conducted. Although the available literature is limited, it does indicate that children in these programs have low immunization levels and that interventions to improve their immunization status can be successful. Measures to improve immunization status should be implemented through WIC and AFDC. PMID:10186653

  12. Immune biomarker panel monitoring utilizing IDO enzyme activity and CD4 ATP levels: prediction of acute rejection versus viral replication events

    PubMed Central

    Dharnidharka, Vikas R.; Gupta, Sushil; Khasawneh, Eihab Al; Haafiz, Allah; Shuster, Jonathan J.; Theriaque, Douglas W.; Shahlaee, Amir H.; Garrett, Timothy J.

    2011-01-01

    Infections have become as important an event as acute rejection post-transplant for long-term allograft survival. Less invasive biomarkers tested so far predict risk for one event or the other, not both. We prospectively tested blood and urine monthly for twelve months post-transplant from children receiving a kidney transplant. The indoleamine 2,3 dioxygenase (IDO) enzyme pathway was assessed by mass spectrometry assays using the ratio of product L-kynurenine (kyn) to substrate tryptophan (trp). Kyn/trp ratios and blood CD4 T-cell ATP levels were correlated with acute rejection or major infection events or stable group (no events) in the next 30 days. The 25 subjects experienced 6 discrete episodes of acute rejection in 5 subjects and 16 discrete events of major infection in 14 subjects (7 BK viruria, 6 cytomegaloviremia, 1 Epstein-Barr and cytomegaloviremia, 2 transplant pyelonephritis). Mean serum kyn/trp ratios were significantly elevated in the group that experienced acute rejection (p = 0.02).Within-subject analyses revealed that over time, urine kyn/trp ratios showed an increase (p = 0.01) and blood CD4-ATP levels showed a decrease (p = 0.007) prior to a major infection event. These pilot results suggest that a panel of biomarkers together can predict over- or under-immunosuppression, but need independent validation. PMID:21492353

  13. Pathobiology of secondary immune thrombocytopenia

    PubMed Central

    Cines, Douglas B.; Liebman, Howard; Stasi, Roberto

    2009-01-01

    Primary immune thrombocytopenic purpura (ITP) remains a diagnosis of exclusion both from nonimmune causes of thrombocytopenia and immune thrombocytopenia that develops in the context of other disorders (secondary immune thrombocytopenia). The pathobiology, natural history, and response to therapy of the diverse causes of secondary ITP differ from each other and from primary ITP, so accurate diagnosis is essential. Immune thrombocytopenia can be secondary to medications or to a concurrent disease, such as an autoimmune condition (eg, systemic lupus erythematosus [SLE], antiphospholipid antibody syndrome [APS], immune thyroid disease, or Evans syndrome), a lymphoproliferative disease (eg, chronic lymphocytic leukemia or large granular T-lymphocyte lymphocytic leukemia), or chronic infection, eg, with Helicobacter pylori, human immunodeficiency virus (HIV), or hepatitis C virus (HCV). Response to infection may generate antibodies that cross-react with platelet antigens (HIV, H pylori) or immune complexes that bind to platelet Fcγ receptors (HCV) and platelet production may be impaired by infection of megakaryocyte bone marrow-dependent progenitor cells (HCV and HIV), decreased production of thrombopoietin (TPO), and splenic sequestration of platelets secondary to portal hypertension (HCV). Sudden and severe onset of thrombocytopenia has been observed in children after vaccination for measles, mumps, and rubella or natural viral infections, including Epstein-Barr virus, cytomegalovirus, and varicella zoster virus. This thrombocytopenia may be caused by cross-reacting antibodies and closely mimics acute ITP of childhood. Proper diagnosis and treatment of the underlying disorder, where necessary, play an important role in patient management. PMID:19245930

  14. How to give an immunization.

    PubMed

    1986-07-01

    This article provides information on the 6 major childhood immunizations and the 3 basic types of injections (intradermal, subcutaneous, and intramuscular). The Expanded Program on Immunization (EPI) has recommended the following vaccination schedule: birth, Bacillus Calmette-Guerin (BCG), oral polio; 6 weeks, diphtheria-pertussis-tetanus (DPT), oral polio; 10 weeks, DPT, oral polio; 14 weeks, DPT, oral polio; and 9 months, measles. The timing of immunization is crucial. DPT and measles vaccines may be ineffective if administered too early since maternal antibodies block new immune response; however, the longer the time between the wearing off of maternal protection and vaccination, the longer the unprotected exposure to disease. 3.5 million children in the Third World die each year from the 6 childhood diseases against which immunization provides protection. Of the 90 million 1-year-olds in January 1986, only 18% had received injections against measles, 38% had received DPT injections, and 34% had received oral polio vacine. The EPI is endeavoring to achieve the goal of universal child immunization by 1990. PMID:12314495

  15. The effects of self-monitoring on the procedural integrity of a behavioral intervention for young children with developmental disabilities.

    PubMed

    Plavnick, Joshua B; Ferreri, Summer J; Maupin, Angela N

    2010-01-01

    The effects of self-monitoring on the procedural integrity of token economy implementation by 3 staff in a special education classroom were evaluated. The subsequent changes in academic readiness behaviors of 2 students with low-incidence disabilities were measured. Multiple baselines across staff and students showed that procedural integrity increased when staff used monitoring checklists, and students' academic readiness behavior also increased. Results are discussed with respect to the use of self-monitoring and the importance of procedural integrity in public school settings. PMID:21119907

  16. [Immune stimulative potency of milk proteins].

    PubMed

    Ambroziak, Adam; Cichosz, Grazyna

    2014-02-01

    Milk proteins are characterized by the highest immune stimulative potency from among all the proteins present in human diet. Whey proteins and numerous growth factors that regulate insulin secretion, differentiation of intestine epithelium cells, and also tissue restoration, are priceless in stimulation the immune system. Lactoferrin shows the most comprehensive pro-health properties: antioxidative, anticancer, immune stimulative and even chemopreventive. Also peptides and amino acids formed from casein and whey proteins possess immune stimulative activity. The most valuable proteins, i.e. lactoferrin, immune globulins, lactoperoxidase and lisozyme, together with bioactive peptides, are resistant to pepsin and trypsin activity. This is why they maintain their exceptional biological activity within human organism. Properly high consumption of milk proteins conditions correct function of immune system, especially at children and elderly persons. PMID:24720113

  17. Monitoring of cerebral hemodynamics during open-heart surgery in children using near-infrared intensity-modulated spectroscopy

    NASA Astrophysics Data System (ADS)

    Kohl-Bareis, Matthias; Watson, Russell W.; Chow, Gabriel; Roberts, Idris; Delpy, David T.; Cope, Mark

    1997-08-01

    Neurological impairments following cardiopulmonary bypass (CPB) during open heart surgery can result from microembolism and ischaemia. Here we present preliminary results from monitoring cerebral hemodynamics during CPB with near infrared intensity modulated spectroscopy. In particular, the study had two main objectives: (1) to monitor the oxy- and deoxy hemoglobin concentrations and their changes during the CPB surgery and (2) to monitor the transport scattering coefficient ((mu) s') of the brain especially during cooling and rewarming. A new method for the calculation of absolute absorption coefficients ((mu) a) was also tested. This method is based upon the monitoring of attenuation and phase changes that are induced by variations in absorption. These variations can be generated either by alterations in the tissue oxygenation or by injecting a dye (indocyanine green) into the CPB circuit. Absolute oxy- and deoxyhemoglobin concentrations and their changes during the CPB were calculated. The preliminary results suggest that cooling of the brain does not significantly alter (mu) s'.

  18. 50 years of immunization in India: progress and future.

    PubMed

    Vashishtha, V M; Kumar, P

    2013-01-01

    Immunization is one of the most cost effective public health interventions and largely responsible for reduction of under5 mortality rate. However, vaccine preventable diseases (VPDs) are still responsible for over 5 lakh deaths annually in India. This underlines the need of further improvement. Today, India is a leading producer and exporter of vaccines, still the country is home to one-third of the worlds unimmunized children. There are a number of reasons why India lags behind its many less developed neighbors in vaccination rates. They include huge population with relatively high growth rate, geographical diversity and some hard to reach populations, lack of awareness regarding vaccination, inadequate delivery of health services, inadequate supervision and monitoring, lack of micro-planning and general lack of inter-sectoral coordination, and weak VPD surveillance system. In this article, we discuss some of the remedial measures to remove obstacles and improve immunization status of the country. Heightened political and bureaucratic will, increasing demand for vaccination by using effective Information, education and communication (IEC), creating more delivery points for routine immunization, proper monitoring of the program, and changing overall objective of the program from merely targeting coverage to more meaningful monitoring of the VPD reduction and demand creation referred as the output of entire vaccination program. Successful AFP surveillance network should serve as platform for an efficient integrated disease surveillance system. AEFI and postmarketing surveillance systems should be urgently upgraded, and there is need of strengthening the regulatory capacity of the country. Restructuring of EPI with induction of some new vaccines, clear-cut guidelines on the policy of introduction of newer vaccines, and establishing a separate, independent department of public health are few other areas that need urgent attention. PMID:23396784

  19. Factors Influencing Childhood Immunization in Uganda

    PubMed Central

    2013-01-01

    This paper investigates the factors associated with childhood immunization in Uganda. We used nationally-representative data from Uganda Demographic and Health Survey (UDHS) of 2006. Both bivariate and multivariate approaches were employed in the analysis. The bivariate approach involved generating average percentages of children who were immunized, with analysis of pertinent background characteristics. The multivariate approach involved employing maximum likelihood probit technique and generating marginal effects to ascertain the probability of being immunized, given the same background characteristics. It revealed that slightly over 50% of children in Uganda were fully immunized. Additionally, 89%, 24%, 52%, and 64% received BCG, DPT, polio and measles vaccines respectively. Factors which have a significant association with childhood immunization are: maternal education (especially at post-secondary level), exposure to media, maternal healthcare utilization, maternal age, occupation type, immunization plan, and regional and local peculiarities. Children whose mothers had post-secondary education were twice as likely to be fully immunized compared to their counterparts whose mothers had only primary education (p<0.01). Thus, gender parity in education enhancement efforts is crucial. There is also a need to increase media penetration, maternal healthcare utilization, and to ensure parity across localities and regions. PMID:23617212

  20. Factors influencing childhood immunization in Uganda.

    PubMed

    Bbaale, Edward

    2013-03-01

    This paper investigates the factors associated with childhood immunization in Uganda. We used nationally-representative data from Uganda Demographic and Health Survey (UDHS) of 2006. Both bivariate and multivariate approaches were employed in the analysis. The bivariate approach involved generating average percentages of children who were immunized, with analysis of pertinent background characteristics. The multivariate approach involved employing maximum likelihood probit technique and generating marginal effects to ascertain the probability of being immunized, given the same background characteristics. It revealed that slightly over 50% of children in Uganda were fully immunized. Additionally, 89%, 24%, 52%, and 64% received BCG, DPT, polio and measles vaccines respectively. Factors which have a significant association with childhood immunization are: maternal education (especially at post-secondary level), exposure to media, maternal healthcare utilization, maternal age, occupation type, immunization plan, and regional and local peculiarities. Children whose mothers had post-secondary education were twice as likely to be fully immunized compared to their counterparts whose mothers had only primary education (p < 0.01). Thus, gender parity in education enhancement efforts is crucial. There is also a need to increase media penetration, maternal healthcare utilization, and to ensure parity across localities and regions. PMID:23617212

  1. Varicella-zoster immunization in pediatric liver transplant recipients: safe and immunogenic.

    PubMed

    Posfay-Barbe, K M; Pittet, L F; Sottas, C; Grillet, S; Wildhaber, B E; Rodriguez, M; Kaiser, L; Belli, D C; McLin, V A; Siegrist, C A

    2012-11-01

    Varicella can have a severe course in immunosuppressed patients. Although prevention is fundamental, live-attenuated varicella-zoster (VZV) vaccine is not currently recommended in transplant recipients. Our aims were to (1) evaluate VZV immunity in pediatric liver transplant (LT) recipients; (2) immunize (two doses) seronegative patients post-LT; (3) monitor vaccine safety, (4) assess B and T cell vaccine responses. All patients followed at the Swiss National Pediatric LT Center were approached and 77/79 (97.5%) were enrolled (median age 7.8 years). Vaccine safety was monitored by standardized diary cards and phone calls. VZV-specific serology and CD4(+) T cells were assessed before and after immunization. Thirty-nine patients (51.1%) were seronegative including 14 children immunized pre-LT. Thirty-six of 39 seronegative patients were immunized post-LT (median 3.0 years post LT). Local (54.8%) and systemic (64.5%) reactions were mild and transient. The frequency of VZV-specific CD4(+) T cells and antibody titers increased significantly (respectively from 0.085% to 0.16%, p = 0.04 and 21.0 to 1134.5 IU/L, p < 0.001). All children reached seroprotective titers and 31/32 (97%) patients assessed remained seroprotected at follow-up (median 1.7 years). No breakthrough disease was reported during follow-up (median 4.1 years). Thereby, VZV vaccine appears to be safe, immunogenic and provide protection against disease in pediatric LT patients. PMID:22994936

  2. Remarks by Donna Shalala at the Childhood Immunization Outreach Meeting.

    ERIC Educational Resources Information Center

    Shalala, Donna E.

    1995-01-01

    Notes how the Childhood Immunization Initiative is building a system to sustain increases in immunization rates into the future. Discusses five elements of the Immunization Initiative: improvement in delivery services, monitoring, vaccine quality, cost, and federal commitment to supporting public health efforts and building a coordinated national…

  3. Impact of early life exposures to geohelminth infections on the development of vaccine immunity, allergic sensitization, and allergic inflammatory diseases in children living in tropical Ecuador: the ECUAVIDA birth cohort study

    PubMed Central

    2011-01-01

    Background Geohelminth infections are highly prevalent infectious diseases of childhood in many regions of the Tropics, and are associated with significant morbidity especially among pre-school and school-age children. There is growing concern that geohelminth infections, particularly exposures occurring during early life in utero through maternal infections or during infancy, may affect vaccine immunogenicity in populations among whom these infections are endemic. Further, the low prevalence of allergic disease in the rural Tropics has been attributed to the immune modulatory effects of these infections and there is concern that widespread use of anthelmintic treatment in high-risk groups may be associated with an increase in the prevalence of allergic diseases. Because the most widely used vaccines are administered during the first year of life and the antecedents of allergic disease are considered to occur in early childhood, the present study has been designed to investigate the impact of early exposures to geohelminths on the development of protective immunity to vaccines, allergic sensitization, and allergic disease. Methods/Design A cohort of 2,403 neonates followed up to 8 years of age. Primary exposures are infections with geohelminth parasites during the last trimester of pregnancy and the first 2 years of life. Primary study outcomes are the development of protective immunity to common childhood vaccines (i.e. rotavirus, Haemophilus influenzae type B, Hepatitis B, tetanus toxoid, and oral poliovirus type 3) during the first 5 years of life, the development of eczema by 3 years of age, the development of allergen skin test reactivity at 5 years of age, and the development of asthma at 5 and 8 years of age. Potential immunological mechanisms by which geohelminth infections may affect the study outcomes will be investigated also. Discussion The study will provide information on the potential effects of early exposures to geohelminths (during pregnancy and

  4. Brain immune interactions and air pollution: macrophage inhibitory factor (MIF), prion cellular protein (PrPC), Interleukin-6 (IL-6), interleukin 1 receptor antagonist (IL-1Ra), and interleukin-2 (IL-2) in cerebrospinal fluid and MIF in serum differentiate urban children exposed to severe vs. low air pollution

    PubMed Central

    Calderón-Garcidueñas, Lilian; Cross, Janet V.; Franco-Lira, Maricela; Aragón-Flores, Mariana; Kavanaugh, Michael; Torres-Jardón, Ricardo; Chao, Chih-kai; Thompson, Charles; Chang, Jing; Zhu, Hongtu; D'Angiulli, Amedeo

    2013-01-01

    Mexico City Metropolitan Area children chronically exposed to high concentrations of air pollutants exhibit an early brain imbalance in genes involved in oxidative stress, inflammation, innate and adaptive immune responses along with accumulation of misfolded proteins observed in the early stages of Alzheimer and Parkinson's diseases. A complex modulation of serum cytokines and chemokines influences children's brain structural and gray/white matter volumetric responses to air pollution. The search for biomarkers associating systemic and CNS inflammation to brain growth and cognitive deficits in the short term and neurodegeneration in the long-term is our principal aim. We explored and compared a profile of cytokines, chemokines (Multiplexing LASER Bead Technology) and Cellular prion protein (PrPC) in normal cerebro-spinal-fluid (CSF) of urban children with high vs. low air pollution exposures. PrPC and macrophage inhibitory factor (MIF) were also measured in serum. Samples from 139 children ages 11.91 ± 4.2 years were measured. Highly exposed children exhibited significant increases in CSF MIF (p = 0.002), IL6 (p = 0.006), IL1ra (p = 0.014), IL-2 (p = 0.04), and PrPC (p = 0.039) vs. controls. MIF serum concentrations were higher in exposed children (p = 0.009). Our results suggest CSF as a MIF, IL6, IL1Ra, IL-2, and PrPC compartment that can possibly differentiate air pollution exposures in children. MIF, a key neuro-immune mediator, is a potential biomarker bridge to identify children with CNS inflammation. Fine tuning of immune-to-brain communication is crucial to neural networks appropriate functioning, thus the short and long term effects of systemic inflammation and dysregulated neural immune responses are of deep concern for millions of exposed children. Defining the linkage and the health consequences of the brain / immune system interactions in the developing brain chronically exposed to air pollutants ought to be of pressing importance for public health

  5. Immunizations in Pediatrics: An Update

    PubMed Central

    Ford-Jones, E.L.; Gold, R.

    1990-01-01

    A Vaccine Evaluation Center has been established in Canada to evaluate vaccines from the developmental stage through to post-marketing surveillance. Special populations need special treatment, particularly day care attendees, children infected with HIV, immunocompromised patients, children who have had a splenectomy, premature infants, the hospitalized child, the traveller, health care workers, and pregnant women. Real and imaginary adverse reactions, their management, and their presentation are discussed. The use of acetaminophen prophylaxis to minimize the most common adverse reactions to diphtheria-pertussis-tetanus-polio immunization is recommended. The most remarkable of the new developments in modern vaccines is the recombinant hepatitis B vaccine. PMID:21233925

  6. Motivational Incentives and Methylphenidate Enhance Electrophysiological Correlates of Error Monitoring in Children with Attention Deficit/Hyperactivity Disorder

    ERIC Educational Resources Information Center

    Groom, Madeleine J.; Liddle, Elizabeth B.; Scerif, Gaia; Liddle, Peter F.; Batty, Martin J.; Liotti, Mario; Hollis, Chris P.

    2013-01-01

    Background: Children with attention deficit hyperactivity disorder (ADHD) are characterised by developmentally inappropriate levels of hyperactivity, impulsivity and/or inattention and are particularly impaired when performing tasks that require a high level of cognitive control. Methylphenidate (MPH) and motivational incentives may help improve…

  7. Strategies to improve immunization services in urban Africa.

    PubMed

    Cutts, F T

    1991-01-01

    The urban poor constitute a rapidly increasing proportion of the population in developing countries. Focusing attention on underserved urban slums and squatter settlements will contribute greatly to immunization programme goals, because these areas account for 30-50% of urban populations, usually provide low access to health services, carry a large burden of disease mortality, and act as sources of infection for the city and surrounding rural areas. Improvement of urban immunization programmes requires intersectorial collaboration, use of all opportunities to vaccinate eligible children and mothers, identification of low-coverage neighbourhoods and execution of extra activities in these neighbourhoods, and community mobilization to identify and refer persons for vaccination. Improved disease surveillance helps to identify high-risk populations and document programme impact. New developments in vaccines, such as the high-dose Edmonston-Zagreb vaccine, will allow changes in the immunization schedule that facilitate the control of specific diseases. Finally, operational research can assist managers to conduct urban situation assessments, evaluate programme performance at the "micro" level, and design and monitor interventions. PMID:1934234

  8. Interleukin-6 Induced "Acute" Phenotypic Microenvironment Promotes Th1 Anti-Tumor Immunity in Cryo-Thermal Therapy Revealed By Shotgun and Parallel Reaction Monitoring Proteomics.

    PubMed

    Xue, Ting; Liu, Ping; Zhou, Yong; Liu, Kun; Yang, Li; Moritz, Robert L; Yan, Wei; Xu, Lisa X

    2016-01-01

    Cryo-thermal therapy has been emerged as a promising novel therapeutic strategy for advanced breast cancer, triggering higher incidence of tumor regression and enhanced remission of metastasis than routine treatments. To better understand its anti-tumor mechanism, we utilized a spontaneous metastatic mouse model and quantitative proteomics to compare N-glycoproteome changes in 94 serum samples with and without treatment. We quantified 231 highly confident N-glycosylated proteins using iTRAQ shotgun proteomics. Among them, 53 showed significantly discriminated regulatory patterns over the time course, in which the acute phase response emerged as the most enhanced pathway. The anti-tumor feature of the acute response was further investigated using parallel reaction monitoring target proteomics and flow cytometry on 23 of the 53 significant proteins. We found that cryo-thermal therapy reset the tumor chronic inflammation to an "acute" phenotype, with up-regulation of acute phase proteins including IL-6 as a key regulator. The IL-6 mediated "acute" phenotype transformed IL-4 and Treg-promoting ICOSL expression to Th1-promoting IFN-γ and IL-12 production, augmented complement system activation and CD86(+)MHCII(+) dendritic cells maturation and enhanced the proliferation of Th1 memory cells. In addition, we found an increased production of tumor progression and metastatic inhibitory proteins under such "acute" environment, favoring the anti-metastatic effect. Moreover, cryo-thermal on tumors induced the strongest "acute" response compared to cryo/hyperthermia alone or cryo-thermal on healthy tissues, accompanying by the most pronounced anti-tumor immunological effect. In summary, we demonstrated that cryo-thermal therapy induced, IL-6 mediated "acute" microenvironment shifted the tumor chronic microenvironment from Th2 immunosuppressive and pro-tumorigenic to Th1 immunostimulatory and tumoricidal state. Moreover, the magnitude of "acute" and "danger" signals play a key

  9. Integrated Circuit Immunity

    NASA Technical Reports Server (NTRS)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  10. Monitoring air pollution effects on children for supporting public health policy: the protocol of the prospective cohort MAPEC study

    PubMed Central

    Feretti, D; Ceretti, E; De Donno, A; Moretti, M; Carducci, A; Bonetta, S; Marrese, M R; Bonetti, A; Covolo, L; Bagordo, F; Villarini, M; Verani, M; Schilirò, T; Limina, R M; Grassi, T; Monarca, S; Casini, B; Carraro, E; Zani, C; Mazzoleni, G; Levaggi, R; Gelatti, U

    2014-01-01

    Introduction Genotoxic biomarkers have been studied largely in adult population, but few studies so far have investigated them in children exposed to air pollution. Children are a high-risk group as regards the health effects of air pollution and some studies suggest that early exposure during childhood can play an important role in the development of chronic diseases in adulthood. The objective of the project is to evaluate the associations between the concentration of urban air pollutants and biomarkers of early biological effect in children, and to propose a model for estimating the global risk of early biological effects due to air pollutants and other factors in children. Methods and analysis Two biomarkers of early biological effects, DNA damage by the comet assay and the micronuclei (MN) test, will be investigated in oral mucosa cells of 6–8-year-old children. Concurrently, some toxic airborne pollutants (polycyclic aromatic hydrocarbon (PAH) and nitro-PAH) and in vitro air mutagenicity and toxicity in ultra-fine air particulates (PM0.5) will be evaluated. Furthermore, demographic and socioeconomic variables, other sources of exposures to air pollutants and lifestyle variables will be assessed by a structured questionnaire. The associations between sociodemographic, environmental and other exposure variables and biomarkers of early biological effect using univariate and multivariate models will be analysed. A tentative model for calculating the global absolute risk of having early biological effects caused by air pollution and other variables will be proposed. Ethics and dissemination The project has been approved by the Ethics Committees of the local Health Authorities. The results will be communicated to local Public Health Agencies, for supporting educational programmes and health policy strategies. LIFE+2012 Environment Policy and Governance. LIFE12 ENV/IT/000614. PMID:25227631

  11. Childhood immunization 1979. Disturbing statistics for metropolitan Sydney.

    PubMed

    Menser, M A; Collins, E; Wu, S W; Hudson, J

    1980-08-01

    Twenty-seven per cent of children (24 out of 90) born consecutively in an inner-city hospital had not completed their primary courses of immunization at the end of the first year of life. Many of the parents of these children had no knowledge of how many doses of vaccine their children required. When 578 schoolchildren aged 12 years were studied, only 40% of these were found to be immune to all three poliovirus serotypes and 12% were not immune to diphtheria. The proportion of children who were not immune to diphtheria varied greatly, and was 24% in one school. The reasons for these low levels of immunity are discussed, and several recommendations are made. It is suggested that a standard immunization record card or book be adopted throughout Australia, and that this card be issued to the newborn child. It is also suggested that consideration be given to the introduction of laws which require that evidence of immunization (or certification of exemption from immunization) be presented at the time of school entry. In the meantime, mopping-up programmes should be conducted in schools where herd immunity is low and a poliomyelitis vaccine (Sabin) booster should be recommended for all children at the age of 12 years. PMID:7421679

  12. Immunization and private sector participation.

    PubMed

    1998-10-01

    Representatives from Belize, Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, and Panama met August 19-20 in Honduras to discuss promoting and strengthening the participation of the private medical sector in immunization and surveillance programs for vaccine-preventable diseases. Participants met to analyze countries' experiences in incorporating the private medical sector into immunization and surveillance activities for vaccine-preventable diseases; to review regional and global goals for vaccine-preventable diseases, cold chain requirements, and issues related to introducing new vaccines into routine immunization schedules; and to sign agreements to facilitate the incorporation of the private medical sector into immunization and surveillance activities in the region. Country experiences are outlined. The Ministries of Health and the Societies/Associations of Pediatrics established specific objectives designed to develop and/or strengthen private medical sector participation in immunization. Agreements reached on epidemiological surveillance, a basic vaccination schedule, quality vaccines, the cold chain, national committees on immunization practices, annual work plans, technical cooperation, monitoring, and information, education, and promotion are described. PMID:12321836

  13. Low immune cell ARA and high plasma 12-HETE and 17-HDHA in iron-deficient South African school children with allergy.

    PubMed

    Malan, L; Baumgartner, J; Calder, P C; Smuts, C M

    2016-07-01

    Allergy has been associated with altered fatty acid and inflammatory status. In this cross-sectional study of 321 rural iron deficient (ID) South African children (aged 6-11 years), a subsample (n=111) of children with parent-reported allergy data were divided into an allergic (n=30) and non-allergic (n=81) group and compared. PBMC arachidonic acid (ARA; P=0.010) and the PBMC ARA to dihomo-gamma-linolenic acid (DGLA) ratio (P=0.035) were lower in the allergic children. Plasma 12-hydroxyeicosatetraenoic acid and 17-hydroxydocosahexaenoic acid (17-HDHA) were higher (P=0.040 and 0.020, respectively) in the allergic group. Thus, a fatty acid composition and lipid mediator levels indicative of increased release of ARA from PBMC membranes, increased inflammation as well as the resolving thereof, were associated with parent-reported allergy symptoms. This study used baseline data of an intervention study which was registered at clinicaltrials.gov as NCT01092377. PMID:27255641

  14. Iraqi parents' views of barriers to childhood immunization.

    PubMed

    Al-Lela, O Q B; Bahari, M B; Al-Abbassi, M G; Salih, M R M; Basher, A Y

    2013-03-01

    Deficiencies in knowledge about immunization among parents often leads to poor utake or errors in immunization dosage and timing. The aims of this study were to determine Iraqi parents' views of barriers to immunization and beliefs about ways to promote immunization. A questionnaire survey was carried out among 528 Iraqi parents with children who had incomplete immunization status. The main barriers to immunization agreed by the parents were lack of vaccine availability (51.5% of parents) and parents' lack of education (42.4%), while 88.4% of parents thought that lack of funding was not an important barrier. More than 60% of the parents suggested promoting childhood immunization via the media, and 77.5% thought that an increase in funding would not remove barriers to childhood immunization. Better vaccine availability in public health clinics and improving parents' literacy might enhance immunization uptake in Iraq. PMID:23879083

  15. Interleukin-6 Induced “Acute” Phenotypic Microenvironment Promotes Th1 Anti-Tumor Immunity in Cryo-Thermal Therapy Revealed By Shotgun and Parallel Reaction Monitoring Proteomics

    PubMed Central

    Xue, Ting; Liu, Ping; Zhou, Yong; Liu, Kun; Yang, Li; Moritz, Robert L.; Yan, Wei; Xu, Lisa X.

    2016-01-01

    Cryo-thermal therapy has been emerged as a promising novel therapeutic strategy for advanced breast cancer, triggering higher incidence of tumor regression and enhanced remission of metastasis than routine treatments. To better understand its anti-tumor mechanism, we utilized a spontaneous metastatic mouse model and quantitative proteomics to compare N-glycoproteome changes in 94 serum samples with and without treatment. We quantified 231 highly confident N-glycosylated proteins using iTRAQ shotgun proteomics. Among them, 53 showed significantly discriminated regulatory patterns over the time course, in which the acute phase response emerged as the most enhanced pathway. The anti-tumor feature of the acute response was further investigated using parallel reaction monitoring target proteomics and flow cytometry on 23 of the 53 significant proteins. We found that cryo-thermal therapy reset the tumor chronic inflammation to an “acute” phenotype, with up-regulation of acute phase proteins including IL-6 as a key regulator. The IL-6 mediated “acute” phenotype transformed IL-4 and Treg-promoting ICOSL expression to Th1-promoting IFN-γ and IL-12 production, augmented complement system activation and CD86+MHCII+ dendritic cells maturation and enhanced the proliferation of Th1 memory cells. In addition, we found an increased production of tumor progression and metastatic inhibitory proteins under such “acute” environment, favoring the anti-metastatic effect. Moreover, cryo-thermal on tumors induced the strongest “acute” response compared to cryo/hyperthermia alone or cryo-thermal on healthy tissues, accompanying by the most pronounced anti-tumor immunological effect. In summary, we demonstrated that cryo-thermal therapy induced, IL-6 mediated “acute” microenvironment shifted the tumor chronic microenvironment from Th2 immunosuppressive and pro-tumorigenic to Th1 immunostimulatory and tumoricidal state. Moreover, the magnitude of “acute” and

  16. The ImmProve Project: Leveraging electronic health record data to promote immunization delivery

    PubMed Central

    Bundy, David G.; Persing, Nichole M.; Solomon, Barry S.; King, Tracy M.; Murakami, Peter; Thompson, Richard E.; Engineer, Lilly D.; Lehmann, Christoph U.; Miller, Marlene R.

    2013-01-01

    Objective Though an essential pediatric preventive service, immunizations are challenging to deliver reliably. Our objective was to measure the impact on pediatric immunization rates of providing clinicians with electronic health record-derived immunization prompting. Methods Operating in a large, urban, hospital-based pediatric primary care clinic, we evaluated 2 interventions to improve immunization delivery to children ages 2, 6, and 13 years: point-of-care, patient-specific electronic clinical decision support (CDS) when children overdue for immunizations presented for care and provider-specific bulletins listing children overdue for immunizations. Results Overall, the proportion of children up-to-date for a composite of recommended immunizations at ages 2, 6, and 13 years was not different in the intervention (CDS active) and historical control (CDS not active) periods; historical immunization rates were high. The proportion of children receiving 2 doses of hepatitis A immunization prior to their second birthday was significantly improved during the intervention period. Human papilloma virus (HPV) immunization delivery was low during both control and intervention periods and was unchanged for 13-year-olds. For 14-year-olds, however, 4 of the 5 highest quarterly rates of complete HPV immunization occurred in the final year of the intervention. Provider-specific bulletins listing children overdue for immunizations increased the likelihood of identified children receiving catch-up hepatitis A immunizations (hazard ratio: 1.32 [95% confidence interval (CI): 1.12–1.56]); results for HPV and the composite of recommended immunizations were of a similar magnitude but not statistically significant. Conclusions In our patient population, with high baseline uptake of recommended immunizations, electronic health record-derived immunization prompting had a limited effect on immunization delivery. Benefit was more clearly demonstrated for newer immunizations with lower

  17. Home monitoring of transcutaneous oxygen tension in the early detection of hypoxaemia in infants and young children.

    PubMed Central

    Poets, C F; Samuels, M P; Noyes, J P; Jones, K A; Southall, D P

    1991-01-01

    Twenty three patients (age range 0.5-40 months) with recurrent cyanotic episodes underwent physiological recordings, including transcutaneous oxygen tension (TcPO2) from a monitor modified for use at home (Kontron 821S). Of 69 episodes in which the arterial oxygen saturation (SaO2, Nellcor N200) was less than or equal to 80% for greater than or equal to 20 seconds and/or central cyanosis was present, the TcPO2 monitor alarmed (less than or equal to 20 mmHg or 2.67 kPa) in every episode. The pulse oximeter identified hypoxaemia in 62 out of 69 episodes, failing in seven episodes due to signal loss from movement artefact. In only seven of 69 episodes was there an accompanying apnoeic pause (greater than or equal to 20 seconds), and heart rate fell to less than or equal to 80 beats/minute in only five of 28 episodes in which an electrocardiogram was recorded. In 32 episodes in which SaO2 fell to less than or equal to 60%, the TcPO2 monitor alarmed after a median time interval of 16 seconds (maximum time interval 30 seconds). The TcPO2 monitor was then used in an uncontrolled trial at home in 350 patients at increased risk of sudden death and/or hypoxaemia. Indications for monitoring included apparent life threatening events or cyanotic episodes (n = 163), prematurity and prematurity related disorders (n = 86), and sudden unexpected death in one or more siblings (n = 122). The TcPO2 monitor detected cyanotic episodes at home in 81 patients, 52 of whom received vigorous stimulation and/or mouth to mouth resuscitation. Twenty one of these 52 patients had further hypoxaemic episodes documented in hospital with pulse oximetry. In 30 patients, the TcPo2 monitor also identified the gradual development of hypoxaemia, as confirmed by pulse oximetry. Twenty of these needed additional inspired oxygen and six subsequently needed ventilatory support in hospital. This TcPo2 monitor is a reliable detector of both sudden and gradual onset hypoxaemia and is able to be used by parents

  18. Safety monitoring of drugs granted exclusivity under the Best Pharmaceuticals for Children Act: what the FDA has learned.

    PubMed

    Mathis, L L; Iyasu, S

    2007-08-01

    The Best Pharmaceuticals for Children Act (BPCA) was signed into law on 4 January 2002, shortly after the pediatric exclusivity provision of the Food and Drug Administration (FDA) Modernization Act expired on 1 January 2002. This Act provides six months of marketing exclusivity for a drug when a pharmaceutical company studies that drug for use in the pediatric population as requested by the FDA. Section 17 of the BPCA specifically requires that the FDA review all adverse events reported for drugs that receive pediatric exclusivity. In most of the cases, no unexpected adverse events were reported in the pediatric population; however, in some cases, this focused safety review provided information important to the safety of medication use in children. PMID:17632537

  19. Monitoring metals in the population living in the vicinity of a hazardous waste incinerator: levels in hair of school children.

    PubMed

    Nadal, Martí; Bocio, Ana; Schuhmacher, Marta; Domingo, Jose L

    2005-06-01

    Hair samples of 134 school children (12-14 yr old) living in three residential zones in the vicinity of a new hazardous waste incinerator (HWI) (Constanti, Tarragona County, Catalonia, Spain) were analyzed by inductively coupled plasma-mass spectrometry (ICP-MS) for arsenic (As), beryllium (Be), cadmium (Cd), chromium (Cr), mercury (Hg), manganese (Mn), nickel (Ni), lead (Pb), tin (Sn), thallium (Tl), and vanadium (V) concentrations. These concentrations were compared with those obtained in a baseline survey performed in the same area during the period of construction of the HWI. Current mean concentrations ranged from values under the respective limit of detection (As, Be, Cd, Tl, and V) to 0.70 and 0.86 microg/g for Hg and Pb, respectively. In comparison to the baseline survey, the levels of Cr, Mn, Ni, Pb, and Sn showed a significant reduction, whereas Hg concentrations were similar. No significant differences were observed according to the sex of the children. However, some differences were noted, especially for Pb and Cr, with respect to the specific zone of residence. In general terms, the current metal levels in hair of school children are similar or even lower than those recently reported for a number of industrial and residential areas of various regions and countries. PMID:15930590