Sample records for chimeric alphavirus vaccine
-
Sun, Yuan; Li, Hong-Yu; Tian, Da-Yong; Han, Qiu-Ying; Zhang, Xin; Li, Na; Qiu, Hua-Ji
2011-10-26
Low efficacy of gene-based vaccines due to inefficient gene delivery and expression has been major bottleneck of their applications. Efforts have been made to improve the efficacy, such as gene gun and electroporation, but the strategies are difficult to put into practical use. In this study, we developed and evaluated an adenovirus-delivered, alphavirus replicon-vectored vaccine (chimeric vector-based vaccine) expressing the E2 gene of classical swine fever virus (CSFV) (rAdV-SFV-E2). Rabbits immunized with rAdV-SFV-E2 developed CSFV-specific antibodies as early as 9 days and as long as 189 days and completely protected from challenge with C-strain. Pigs immunized with rAdV-SFV-E2 (n=5) developed robust humoral and cell-mediated responses to CSFV and were completely protected from subsequent lethal CSFV infection clinically and virologically. The level of immunity and protection induced by rAdV-SFV-E2 was comparable to that provided by the currently used live attenuated vaccine, C-strain. In contrast, both the conventional alphavirus replicon-vectored vaccine pSFV1CS-E2 and conventional adenovirus-vectored vaccine rAdV-E2 provided incomplete protection. The chimeric vector-based vaccine represents the first gene-based vaccine that is able to confer sterile immunity and complete protection against CSFV. The new-concept vaccination strategy may also be valuable in vaccine development against other pathogens. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Immune Interference After Sequential Alphavirus Vaccine Vaccinations
2009-01-01
education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or...western equine encephalitis (EEE and WEE) vaccines before live attenuated Venezuelan (VEE) vaccine had significantly lower rates of antibody response than...Venezuelan equine encephalitis virus, VEE, vaccines, alphavirus, antibody responses, human studies 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF
-
A Novel Self-Replicating Chimeric Lentivirus-Like Particle
Young, Kelly R.; Madden, Victoria J.; Johnson, Philip R.; Johnston, Robert E.
2012-01-01
Successful live attenuated vaccines mimic natural exposure to pathogens without causing disease and have been successful against several viruses. However, safety concerns prevent the development of attenuated human immunodeficiency virus (HIV) as a vaccine candidate. If a safe, replicating virus vaccine could be developed, it might have the potential to offer significant protection against HIV infection and disease. Described here is the development of a novel self-replicating chimeric virus vaccine candidate that is designed to provide natural exposure to a lentivirus-like particle and to incorporate the properties of a live attenuated virus vaccine without the inherent safety issues associated with attenuated lentiviruses. The genome from the alphavirus Venezuelan equine encephalitis virus (VEE) was modified to express SHIV89.6P genes encoding the structural proteins Gag and Env. Expression of Gag and Env from VEE RNA in primate cells led to the assembly of particles that morphologically and functionally resembled lentivirus virions and that incorporated alphavirus RNA. Infection of CD4+ cells with chimeric lentivirus-like particles was specific and productive, resulting in RNA replication, expression of Gag and Env, and generation of progeny chimeric particles. Further genome modifications designed to enhance encapsidation of the chimeric virus genome and to express an attenuated simian immunodeficiency virus (SIV) protease for particle maturation improved the ability of chimeric lentivirus-like particles to propagate in cell culture. This study provides proof of concept for the feasibility of creating chimeric virus genomes that express lentivirus structural proteins and assemble into infectious particles for presentation of lentivirus immunogens in their native and functional conformation. PMID:22013035
-
A novel self-replicating chimeric lentivirus-like particle.
Jurgens, Christy K; Young, Kelly R; Madden, Victoria J; Johnson, Philip R; Johnston, Robert E
2012-01-01
Successful live attenuated vaccines mimic natural exposure to pathogens without causing disease and have been successful against several viruses. However, safety concerns prevent the development of attenuated human immunodeficiency virus (HIV) as a vaccine candidate. If a safe, replicating virus vaccine could be developed, it might have the potential to offer significant protection against HIV infection and disease. Described here is the development of a novel self-replicating chimeric virus vaccine candidate that is designed to provide natural exposure to a lentivirus-like particle and to incorporate the properties of a live attenuated virus vaccine without the inherent safety issues associated with attenuated lentiviruses. The genome from the alphavirus Venezuelan equine encephalitis virus (VEE) was modified to express SHIV89.6P genes encoding the structural proteins Gag and Env. Expression of Gag and Env from VEE RNA in primate cells led to the assembly of particles that morphologically and functionally resembled lentivirus virions and that incorporated alphavirus RNA. Infection of CD4⁺ cells with chimeric lentivirus-like particles was specific and productive, resulting in RNA replication, expression of Gag and Env, and generation of progeny chimeric particles. Further genome modifications designed to enhance encapsidation of the chimeric virus genome and to express an attenuated simian immunodeficiency virus (SIV) protease for particle maturation improved the ability of chimeric lentivirus-like particles to propagate in cell culture. This study provides proof of concept for the feasibility of creating chimeric virus genomes that express lentivirus structural proteins and assemble into infectious particles for presentation of lentivirus immunogens in their native and functional conformation.
-
Dissecting the Role of E2 Protein Domains in Alphavirus Pathogenicity.
Weger-Lucarelli, James; Aliota, Matthew T; Wlodarchak, Nathan; Kamlangdee, Attapon; Swanson, Ryan; Osorio, Jorge E
2015-12-16
Alphaviruses represent a diverse set of arboviruses, many of which are important pathogens. Chikungunya virus (CHIKV), an arthritis-inducing alphavirus, is the cause of a massive ongoing outbreak in the Caribbean and South America. In contrast to CHIKV, other related alphaviruses, such as Venezuelan equine encephalitis virus (VEEV) and Semliki Forest virus (SFV), can cause encephalitic disease. E2, the receptor binding protein, has been implicated as a determinant in cell tropism, host range, pathogenicity, and immunogenicity. Previous reports also have demonstrated that E2 contains residues important for host range expansions and monoclonal antibody binding; however, little is known about what role each protein domain (e.g., A, B, and C) of E2 plays on these factors. Therefore, we constructed chimeric cDNA clones between CHIKV and VEEV or SFV to probe the effect of each domain on pathogenicity in vitro and in vivo. CHIKV chimeras containing each of the domains of the E2 (ΔDomA, ΔDomB, and ΔDomC) from SFV, but not VEEV, were successfully rescued. Interestingly, while all chimeric viruses were attenuated compared to CHIKV in mice, ΔDomB virus showed similar rates of infection and dissemination in Aedes aegypti mosquitoes, suggesting differing roles for the E2 protein in different hosts. In contrast to CHIKV; ΔDomB, and to a lesser extent ΔDomA, caused neuron degeneration and demyelination in mice infected intracranially, suggesting a shift toward a phenotype similar to SFV. Thus, chimeric CHIKV/SFV provide insights on the role the alphavirus E2 protein plays on pathogenesis. Chikungunya virus (CHIKV) has caused large outbreaks of acute and chronic arthritis throughout Africa and Southeast Asia and has now become a massive public health threat in the Americas, causing an estimated 1.2 million human cases in just over a year. No approved vaccines or antivirals exist for human use against CHIKV or any other alphavirus. Despite the threat, little is known about
-
Thibodeaux, Brett A.; Panella, Amanda N.; Roehrig, John T.
2010-01-01
Diagnosis of human arboviral infections relies heavily on serological techniques such as the immunoglobulin M (IgM) antibody capture enzyme-linked immunosorbent assay (MAC-ELISA) and the indirect IgG ELISA. Broad application of these assays is hindered by the lack of standardized positive human control sera that react with a wide variety of flaviviruses (e.g., dengue, West Nile, yellow fever, Japanese encephalitis, Saint Louis encephalitis, and Powassan viruses), or alphaviruses (e.g., Eastern equine encephalitis, Western equine encephalitis, Venezuelan equine encephalitis, and chikungunya viruses) that can cause human disease. We have created human-murine chimeric monoclonal antibodies (cMAbs) by combining the variable regions of flavivirus (6B6C-1) or alphavirus (1A4B-6) broadly cross-reactive murine MAbs (mMAbs) with the constant region of human IgG1. These cMAbs may be used as standardized reagents capable of replacing human infection-immune-positive control sera in indirect IgG ELISA for diagnosis of all human flaviviral or alphaviral infections. The IgG cMAbs secreted from plasmid-transformed Sp2/0-Ag14 cells had serological activity identical to that of the parent mMAbs, as measured by ELISA using multiple flaviviruses or alphaviruses. PMID:20739503
-
Thibodeaux, Brett A; Panella, Amanda N; Roehrig, John T
2010-10-01
Diagnosis of human arboviral infections relies heavily on serological techniques such as the immunoglobulin M (IgM) antibody capture enzyme-linked immunosorbent assay (MAC-ELISA) and the indirect IgG ELISA. Broad application of these assays is hindered by the lack of standardized positive human control sera that react with a wide variety of flaviviruses (e.g., dengue, West Nile, yellow fever, Japanese encephalitis, Saint Louis encephalitis, and Powassan viruses), or alphaviruses (e.g., Eastern equine encephalitis, Western equine encephalitis, Venezuelan equine encephalitis, and chikungunya viruses) that can cause human disease. We have created human-murine chimeric monoclonal antibodies (cMAbs) by combining the variable regions of flavivirus (6B6C-1) or alphavirus (1A4B-6) broadly cross-reactive murine MAbs (mMAbs) with the constant region of human IgG1. These cMAbs may be used as standardized reagents capable of replacing human infection-immune-positive control sera in indirect IgG ELISA for diagnosis of all human flaviviral or alphaviral infections. The IgG cMAbs secreted from plasmid-transformed Sp2/0-Ag14 cells had serological activity identical to that of the parent mMAbs, as measured by ELISA using multiple flaviviruses or alphaviruses.
-
Current strategic thinking for the development of a trivalent alphavirus vaccine for human use.
Wolfe, Daniel N; Heppner, D Gray; Gardner, Shea N; Jaing, Crystal; Dupuy, Lesley C; Schmaljohn, Connie S; Carlton, Kevin
2014-09-01
Vaccinations against the encephalitic alphaviruses (western, eastern, and Venezuelan equine encephalitis virus) are of significant interest to biological defense, public health, and agricultural communities alike. Although vaccines licensed for veterinary applications are used in the Western Hemisphere and attenuated or inactivated viruses have been used under Investigational New Drug status to protect at-risk personnel, there are currently no licensed vaccines for use in humans. Here, we will discuss the need for a trivalent vaccine that can protect humans against all three viruses, recent progress to such a vaccine, and a strategy to continue development to Food and Drug Administration licensure. © The American Society of Tropical Medicine and Hygiene.
-
Alphavirus-based DNA vaccine breaks immunological tolerance by activating innate antiviral pathways
Leitner, Wolfgang W.; Hwang, Leroy N.; Deveer, Michael J.; Zhou, Aimin; Silverman, Robert H.; Williams, Bryan R.G.; Dubensky, Thomas W.; Ying, Han; Restifo, Nicholas P.
2006-01-01
Cancer vaccines targeting ‘self’ antigens that are expressed at consistently high levels by tumor cells are potentially useful in immunotherapy, but immunological tolerance may block their function. Here, we describe a novel, naked DNA vaccine encoding an alphavirus replicon (self-replicating mRNA) and the self/tumor antigen tyrosinase-related protein-1. Unlike conventional DNA vaccines, this vaccine can break tolerance and provide immunity to melanoma. The vaccine mediates production of double-stranded RNA, as evidenced by the autophosphorylation of protein kinase R. Double-stranded RNA is critical to vaccine function because both the immunogenicity and the anti-tumor activity of the vaccine are blocked in mice deficient for the RNase L enzyme, a key component of the 2′,5′-linked oligoadenylate synthetase antiviral pathway involved in double-stranded RNA recognition. This study shows for the first time that alphaviral replicon-encoding DNA vaccines activate innate immune pathways known to drive antiviral immune responses, and points the way to strategies for improving the efficacy of immunization with naked DNA. PMID:12496961
-
Deinococcus Mn2+-peptide complex: A novel approach to alphavirus vaccine development.
Gayen, Manoshi; Gupta, Paridhi; Morazzani, Elaine M; Gaidamakova, Elena K; Knollmann-Ritschel, Barbara; Daly, Michael J; Glass, Pamela J; Maheshwari, Radha K
2017-06-22
Over the last ten years, Chikungunya virus (CHIKV), an Old World alphavirus has caused numerous outbreaks in Asian and European countries and the Americas, making it an emerging pathogen of great global health importance. Venezuelan equine encephalitis virus (VEEV), a New World alphavirus, on the other hand, has been developed as a bioweapon in the past due to its ease of preparation, aerosol dispersion and high lethality in aerosolized form. Currently, there are no FDA approved vaccines against these viruses. In this study, we used a novel approach to develop inactivated vaccines for VEEV and CHIKV by applying gamma-radiation together with a synthetic Mn-decapeptide-phosphate complex (MnDpPi), based on manganous-peptide-orthophosphate antioxidants accumulated in the extremely radiation-resistant bacterium Deinococcus radiodurans. Classical gamma-irradiated vaccine development approaches are limited by immunogenicity-loss due to oxidative damage to the surface proteins at the high doses of radiation required for complete virus-inactivation. However, addition of MnDpPi during irradiation process selectively protects proteins, but not the nucleic acids, from the radiation-induced oxidative damage, as required for safe and efficacious vaccine development. Previously, this approach was used to develop a bacterial vaccine. In the present study, we show that this approach can successfully be applied to protecting mice against viral infections. Irradiation of VEEV and CHIKV in the presence of MnDpPi resulted in substantial epitope preservation even at supra-lethal doses of gamma-rays (50,000Gy). Irradiated viruses were found to be completely inactivated and safe in vivo (neonatal mice). Upon immunization, VEEV inactivated in the presence of MnDpPi resulted in drastically improved protective efficacy. Thus, the MnDpPi-based gamma-inactivation approach described here can readily be applied to developing vaccines against any pathogen of interest in a fast and cost
-
Pan, Chien-Hsiung; Greer, Catherine E; Hauer, Debra; Legg, Harold S; Lee, Eun-Young; Bergen, M Jeff; Lau, Brandyn; Adams, Robert J; Polo, John M; Griffin, Diane E
2010-04-01
Measles remains a major cause of child mortality, in part due to an inability to vaccinate young infants with the current live attenuated virus vaccine (LAV). To explore new approaches to infant vaccination, chimeric Venezuelan equine encephalitis/Sindbis virus (VEE/SIN) replicon particles were used to express the hemagglutinin (H) and fusion (F) proteins of measles virus (MV). Juvenile rhesus macaques vaccinated intradermally with a single dose of VEE/SIN expressing H or H and F proteins (VEE/SIN-H or VEE/SIN-H+F, respectively) developed high titers of MV-specific neutralizing antibody and gamma-interferon (IFN-gamma)-producing T cells. Infant macaques vaccinated with two doses of VEE/SIN-H+F also developed neutralizing antibody and IFN-gamma-producing T cells. Control animals were vaccinated with LAV or with a formalin-inactivated measles vaccine (FIMV). Neutralizing antibody remained above the protective level for more than 1 year after vaccination with VEE/SIN-H, VEE/SIN-H+F, or LAV. When challenged with wild-type MV 12 to 17 months after vaccination, all vaccinated juvenile and infant monkeys vaccinated with VEE/SIN-H, VEE/SIN-H+F, and LAV were protected from rash and viremia, while FIMV-vaccinated monkeys were not. Antibody was boosted by challenge in all groups. T-cell responses to challenge were biphasic, with peaks at 7 to 25 days and at 90 to 110 days in all groups, except for the LAV group. Recrudescent T-cell activity coincided with the presence of MV RNA in peripheral blood mononuclear cells. We conclude that VEE/SIN expressing H or H and F induces durable immune responses that protect from measles and offers a promising new approach for measles vaccination. The viral and immunological factors associated with long-term control of MV replication require further investigation.
-
Blignaut, Belinda; Visser, Nico; Theron, Jacques; Rieder, Elizabeth; Maree, Francois F
2011-04-01
Chimeric foot-and-mouth disease viruses (FMDV) of which the antigenic properties can be readily manipulated is a potentially powerful approach in the control of foot-and-mouth disease (FMD) in sub-Saharan Africa. FMD vaccine application is complicated by the extensive variability of the South African Territories (SAT) type viruses, which exist as distinct genetic and antigenic variants in different geographical regions. A cross-serotype chimeric virus, vKNP/SAT2, was engineered by replacing the external capsid-encoding region (1B-1D/2A) of an infectious cDNA clone of the SAT2 vaccine strain, ZIM/7/83, with that of SAT1 virus KNP/196/91. The vKNP/SAT2 virus exhibited comparable infection kinetics, virion stability and antigenic profiles to the KNP/196/91 parental virus, thus indicating that the functions provided by the capsid can be readily exchanged between serotypes. As these qualities are necessary for vaccine manufacturing, high titres of stable chimeric virus were obtained. Chemically inactivated vaccines, formulated as double-oil-in-water emulsions, were produced from intact 146S virion particles of both the chimeric and parental viruses. Inoculation of guinea pigs with the respective vaccines induced similar antibody responses. In order to show compliance with commercial vaccine requirements, the vaccines were evaluated in a full potency test. Pigs vaccinated with the chimeric vaccine produced neutralizing antibodies and showed protection against homologous FMDV challenge, albeit not to the same extent as for the vaccine prepared from the parental virus. These results provide support that chimeric vaccines containing the external capsid of field isolates can be successfully produced and that they induce protective immune responses in FMD host species.
-
[Immunogenicity of chimeric gene vaccine Mtb8.4/hIL12].
Li, Hui; Li, Rong; Zhong, Sen; Luo, Yue-bei; Ren, Hong; Deng, Cun-liang
2006-09-01
To construct chimeric gene vaccine Mtb8.4/hIL-12, express it in COS-7 cells and study its immunogenicity. Chimeric gene Mtb8.4/hIL-12 was amplified by PCR and cloned into the eukaryotic vector pCI-neo to construct the recombinant plasmid pCI-neo-Mtb8.4/hIL12. After the recombinant plasmid was identified by restriction enzyme digestion analysis, PCR and DNA sequencing, COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12 through cationic liposome. 48 hours later, the expression of mRNA was detected by RT-PCR and the level of hIL-12 in culture supernatant and cell lysates were detected by Western blot. C57BL/6N mice were vaccinated with chimeric gene vaccine Mtb8.4/hIL-12 three times at the interval of 3 weeks each time. Four weeks after the final inoculation, three mice were sacrificed to assess the cytotoxicity of CTLs and response to cytokine. The recombinant plasmid pCI-neo-Mtb8.4/hIL12 was constructed successfully. After COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12, chimeric gene Mtb8.4/hIL12 was expressed in COS-7 cells. The chimeric gene vaccine could induce strong antigen-specific immune response. With the increase of IFN-gamma and IL-2 secretion and the decrease of IL-4 secretion, the cytotoxicity of specific CTLs was heightened. Recombinant plasmid pCI-neo-Mtb8.4/hIL12 has been successfully constructed and expressed in COS-7 cells. The constructed chimeric gene vaccine Mtb8.4/hIL12 is of strong immunogenicity and can obviously induce the cytotoxicity of CTLs.
-
Alphavirus replicon approach to promoterless analysis of IRES elements.
Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F
2007-04-10
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.
-
Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements
Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.
2007-01-01
Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813
-
Yang, Shi-gui; Wo, Jian-er; Li, Min-wei; Mi, Fen-fang; Yu, Cheng-bo; Lv, Guo-liang; Cao, Hong-Cui; Lu, Hai-feng; Wang, Bao-hong; Zhu, Hanping; Li, Lan-Juan
2009-12-09
Several approaches are being taken worldwide to develop vaccines against H5N1 viruses; most of them, however, pose both practical and immunological challenges. One potential strategy for improving the immunogenicity of vaccines involves the use of alphavirus replicons and VP22, a herpes simplex type 1 (HSV-1) protein. In this study, we analysed the antigenic peptides and homogeneity of the HA sequences (human isolates of the H5N1 subtype, from 1997 to 2003) and explored a novel alphavirus replicon system of VP22 fused with HA, to assess whether the immunogenicity of an HA-based replicon vaccine could be induced and augmented via fusion with VP22. Further, replicon particles expressing VP22, and enhanced green fluorescent protein (EGFP) were individually used as controls. Cellular immune responses in mice immunised with replicons were evaluated by identifying specific intracellular cytokine production with flow cytometry (FCM). Animal-based experimentation indicated that both the IL-4 expression of CD4(+) T cells and the IFN-gamma expression of CD8(+) T cells were significantly increased in mice immunised with VPR-HA and VPR-VP22/HA. A dose titration effect vis-à-vis both IL-4 expression and IFN-gamma expression were observed in VPR-HA- and VPR-VP22/HA-vaccinated mice. Our results revealed that both VPR-VP22/HA and VPR-HA replicon particles presented a promising approach for developing vaccines against human-avian influenza, and VP22 could enhance the immunogenicity of the HA antigens to which it is fused.
-
Kim, Se Mi; Kim, Young-Il; Park, Su-Jin; Kim, Eun-Ha; Kwon, Hyeok-il; Si, Young-Jae; Lee, In-Won; Song, Min-Suk
2017-01-01
ABSTRACT In order to produce a dually effective vaccine against H9 and H5 avian influenza viruses that aligns with the DIVA (differentiating infected from vaccinated animals) strategy, we generated a chimeric H9/H5N2 recombinant vaccine that expressed the whole HA1 region of A/CK/Korea/04163/04 (H9N2) and the HA2 region of recent highly pathogenic avian influenza (HPAI) A/MD/Korea/W452/14 (H5N8) viruses. The chimeric H9/H5N2 virus showed in vitro and in vivo growth properties and virulence that were similar to those of the low-pathogenic avian influenza (LPAI) H9 virus. An inactivated vaccine based on this chimeric virus induced serum neutralizing (SN) antibodies against both H9 and H5 viruses but induced cross-reactive hemagglutination inhibition (HI) antibody only against H9 viruses. Thus, this suggests its compatibility for use in the DIVA strategy against H5 strains. Furthermore, the chimeric H9/H5N2 recombinant vaccine protected immunized chickens against lethal challenge by HPAI H5N8 viruses and significantly attenuated virus shedding after infection by both H9N2 and HPAI H5N8 viruses. In mice, serological analyses confirmed that HA1- and HA2 stalk-specific antibody responses were induced by vaccination and that the DIVA principle could be employed through the use of an HI assay against H5 viruses. Furthermore, each HA1- and HA2 stalk-specific antibody response was sufficient to inhibit viral replication and protect the chimeric virus-immunized mice from lethal challenge with both mouse-adapted H9N2 and wild-type HPAI H5N1 viruses, although differences in vaccine efficacy against a homologous H9 virus (HA1 head domain immune-mediated protection) and a heterosubtypic H5 virus (HA2 stalk domain immune-mediated protection) were observed. Taken together, these results demonstrate that the novel chimeric H9/H5N2 recombinant virus is a low-pathogenic virus, and this chimeric vaccine is suitable for a DIVA vaccine with broad-spectrum neutralizing antibody against H5
-
Barnett, Susan W; Burke, Brian; Sun, Yide; Kan, Elaine; Legg, Harold; Lian, Ying; Bost, Kristen; Zhou, Fengmin; Goodsell, Amanda; Zur Megede, Jan; Polo, John; Donnelly, John; Ulmer, Jeffrey; Otten, Gillis R; Miller, Christopher J; Vajdy, Michael; Srivastava, Indresh K
2010-06-01
We have previously shown that rhesus macaques were partially protected against high-dose intravenous challenge with simian-human immunodeficiency virus SHIV(SF162P4) following sequential immunization with alphavirus replicon particles (VRP) of a chimeric recombinant VEE/SIN alphavirus (derived from Venezuelan equine encephalitis virus [VEE] and the Sindbis virus [SIN]) encoding human immunodeficiency virus type 1 HIV-1(SF162) gp140DeltaV2 envelope (Env) and trimeric Env protein in MF59 adjuvant (R. Xu, I. K. Srivastava, C. E. Greer, I. Zarkikh, Z. Kraft, L. Kuller, J. M. Polo, S. W. Barnett, and L. Stamatatos, AIDS Res. Hum. Retroviruses 22:1022-1030, 2006). The protection did not require T-cell immune responses directed toward simian immunodeficiency virus (SIV) Gag. We extend those findings here to demonstrate antibody-mediated protection against mucosal challenge in macaques using prime-boost regimens incorporating both intramuscular and mucosal routes of delivery. The macaques in the vaccination groups were primed with VRP and then boosted with Env protein in MF59 adjuvant, or they were given VRP intramuscular immunizations alone and then challenged with SHIV(SF162P4) (intrarectal challenge). The results demonstrated that these vaccines were able to effectively protect the macaques to different degrees against subsequent mucosal SHIV challenge, but most noteworthy, all macaques that received the intramuscular VRP prime plus Env protein boost were completely protected. A statistically significant association was observed between the titer of virus neutralizing and binding antibodies as well as the avidity of anti-Env antibodies measured prechallenge and protection from infection. These results highlight the merit of the alphavirus replicon vector prime plus Env protein boost vaccine approach for the induction of protective antibody responses and are of particular relevance to advancing our understanding of the potential correlates of immune protection against
-
Next-generation dengue vaccines: novel strategies currently under development.
Durbin, Anna P; Whitehead, Stephen S
2011-10-01
Dengue has become the most important arboviral infection worldwide with more than 30 million cases of dengue fever estimated to occur each year. The need for a dengue vaccine is great and several live attenuated dengue candidate vaccines are proceeding through clinical evaluation. The need to induce a balanced immune response against all four DENV serotypes with a single vaccine has been a challenge for dengue vaccine developers. A live attenuated DENV chimeric vaccine produced by Sanofi Pasteur has recently entered Phase III evaluation in numerous dengue-endemic regions of the world. Viral interference between serotypes contained in live vaccines has required up to three doses of the vaccine be given over a 12-month period of time. For this reason, novel DENV candidate vaccines are being developed with the goal of achieving a protective immune response with an immunization schedule that can be given over the course of a few months. These next-generation candidates include DNA vaccines, recombinant adenovirus vectored vaccines, alphavirus replicons, and sub-unit protein vaccines. Several of these novel candidates will be discussed.
-
Hooper, Jay W.; Ferro, Anthony M.; Golden, Joseph W.; Silvera, Peter; Dudek, Jeanne; Alterson, Kim; Custer, Max; Rivers, Bryan; Morris, John; Owens, Gary; Smith, Jonathan F.; Kamrud, Kurt I.
2009-01-01
Naturally occurring smallpox was eradicated as a result of successful vaccination campaigns during the 1960s and 70s. Because of its highly contagious nature and high mortality rate, smallpox has significant potential as a biological weapon. Unfortunately, the current vaccine for orthopoxviruses is contraindicated for large portions of the population. Thus, there is a need for new, safe, and effective orthopoxvirus vaccines. Alphavirus replicon vectors, derived from strains of Venezuelan equine encephalitis virus, are being used to develop alternatives to the current smallpox vaccine. Here, we demonstrated that virus-like replicon particles (VRP) expressing the vaccinia virus A33R, B5R, A27L, and L1R genes elicited protective immunity in mice comparable to vaccination with live-vaccinia virus. Furthermore, cynomolgus macaques vaccinated with a combination of the four poxvirus VRPs (4pox-VRP) developed antibody responses to each antigen. These antibody responses were able to neutralize and inhibit the spread of both vaccinia virus and monkeypox virus. Macaques vaccinated with 4pox-VRP, flu HA VRP (negative control), or live-vaccinia virus (positive control) were challenged intravenously with 5 × 106 PFU of monkeypox virus 1 month after the second VRP vaccination. Four of the six negative control animals succumbed to monkeypox and the remaining two animals demonstrated either severe or grave disease. Importantly, all 10 macaques vaccinated with the 4pox-VRP vaccine survived without developing severe disease. These findings revealed that a single-boost VRP smallpox vaccine shows promise as a safe alternative to the currently licensed live-vaccinia virus smallpox vaccine. PMID:19833247
-
Kim, Shin-Hee; Paldurai, Anandan; Samal, Siba K
2017-03-01
Avian influenza (AI) is an economically-important disease of poultry worldwide. The use of vaccines to control AI has increased because of frequent outbreaks of the disease in endemic countries. Newcastle disease virus (NDV) vectored vaccine has shown to be effective in protecting chickens against a highly pathogenic avian influenza virus (HPAIV) infection. However, preexisting antibodies to NDV vector might affect protective efficacy of the vaccine in the field. As an alternative strategy, we evaluated vaccine efficacy of a chimeric NDV vectored vaccine in which the ectodomains of F and HN proteins were replaced by those of avian paramyxovirus serotype-2. The chimeric NDV vector stably expressed the HA protein in vivo, did not cross-react with NDV, was attenuated to be used as a safe vaccine, and provided a partial protection of 1-day-old immunized chickens against HPAIV subtype H5N1challenge, indicating its potential use for early protection of chickens. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Chimeric parasites as tools to study Plasmodium immunology and assess malaria vaccines.
Cockburn, Ian
2013-01-01
The study of pathogen immunity relies upon being able to track antigen specific immune responses and assess their protective capacity. To study immunity to Plasmodium antigens, chimeric rodent or human malaria parasites that express proteins from other Plasmodium species or unrelated species have been developed. Different types of chimeric parasites have been used to address a range of specific questions. Parasites expressing model T cell epitopes have been used to monitor cellular immune responses to the preerythrocytic and blood stages of malaria. Other parasites have been used to assess the functional significance of immune responses targeting particular proteins. Finally, a number of rodent malaria parasites that express vaccine-candidate antigens from P. falciparum and P. vivax have been used in functional assays of vaccine-induced antibody responses. Here, I review the experimental contributions that have been made using these parasites, and discuss the potential of these approaches to continue advancing our understanding of malaria immunology and vaccine research.
-
Debbink, Kari; Lindesmith, Lisa C; Donaldson, Eric F; Swanstrom, Jesica; Baric, Ralph S
2014-07-01
There is currently no licensed vaccine for noroviruses, and development is hindered, in part, by an incomplete understanding of the host adaptive immune response to these highly heterogeneous viruses and rapid GII.4 norovirus molecular evolution. Emergence of a new predominant GII.4 norovirus strain occurs every 2 to 4 years. To address the problem of GII.4 antigenic variation, we tested the hypothesis that chimeric virus-like particle (VLP)-based vaccine platforms, which incorporate antigenic determinants from multiple strains into a single genetic background, will elicit a broader immune response against contemporary and emergent strains. Here, we compare the immune response generated by chimeric VLPs to that of parental strains and a multivalent VLP cocktail. Results demonstrate that chimeric VLPs induce a more broadly cross-blocking immune response than single parental VLPs and a similar response to a multivalent GII.4 VLP cocktail. Furthermore, we show that incorporating epitope site A alone from one strain into the background of another is sufficient to induce a blockade response against the strain donating epitope site A. This suggests a mechanism by which population-wide surveillance of mutations in a single epitope could be used to evaluate antigenic changes in order to identify potential emergent strains and quickly reformulate vaccines against future epidemic strains as they emerge in human populations. Noroviruses are gastrointestinal pathogens that infect an estimated 21 million people per year in the United States alone. GII.4 noroviruses account for >70% of all outbreaks, making them the most clinically important genotype. GII.4 noroviruses undergo a pattern of epochal evolution, resulting in the emergence of new strains with altered antigenicity over time, complicating vaccine design. This work is relevant to norovirus vaccine design as it demonstrates the potential for development of a chimeric VLP-based vaccine platform that may broaden the
-
Protective and immunological behavior of chimeric yellow fever dengue vaccine.
Halstead, Scott B; Russell, Philip K
2016-03-29
Clinical observations from the third year of the Sanofi Pasteur chimeric yellow fever dengue tetravalent vaccine (CYD) trials document both protection and vaccination-enhanced dengue disease among vaccine recipients. Children who were 5 years-old or younger when vaccinated experienced a DENV disease resulting in hospitalization at 5 times the rate of controls. On closer inspection, hospitalized cases among vaccinated seropositives, those at highest risk to hospitalized disease accompanying a dengue virus (DENV) infection, were greatly reduced by vaccination. But, seronegative individuals of all ages after being vaccinated were only modestly protected from mild to moderate disease throughout the entire observation period despite developing neutralizing antibodies at high rates. Applying a simple epidemiological model to the data, vaccinated seronegative individuals of all ages were at increased risk of developing hospitalized disease during a subsequent wild type DENV infection. The etiology of disease in placebo and vaccinated children resulting in hospitalization during a DENV infection, while clinically similar are of different origin. The implications of the observed mixture of DENV protection and enhanced disease in CYD vaccinees are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Chockalingam, A K; Thiyagarajan, S; Govindasamy, N; Patnaikuni, R; Garlapati, S; Golla, R R; Joyappa, D H; Krishnamshetty, P; Veluvarti, V V S; Veluvati, V V S
2010-01-01
Since foot-and-mouth disease virus (FMDV) serotypes display a great genetic and antigenic diversity, there is a constant requirement to monitor the performance of FMDV vaccines in the field with respect to their antigenic coverage. To avoid possible antigenic changes in field FMDV isolates during their adaptation to BHK-21 cells, a standard step used in production of conventional FMDV vaccines, the custom-made chimeric conventional or DNA vaccines, in which antigenic determinants are replaced with those of appropriate field strains, should be constructed. Using this approach, we made a plasmid-based chimeric FMDV DNA vaccine containing structural genes of serotype O in the genome backbone of serotype Asia 1, all under the control of Human cytomegalovirus (HCMV) immediate early gene promoter. BHK-21 cells transfected with the chimeric DNA vaccine did not show cytopathic effect (CPE), but expressed virus-specific proteins as demonstrated by 35S-methionine labeling and immunoprecipitation. Guinea pigs immunized with the chimeric DNA vaccine produced virus-specific antibodies assayed by ELISA and virus neutralization test (VNT), respectively. The chimeric DNA vaccine showed a partial protection of guinea pigs challenged with the virulent FMDV. Although the chimeric DNA vaccine, in general, was not as effective as a conventional one, this study encourages further work towards the development of genetically engineered custom-made chimeric vaccines against FMDV.
-
Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro
2017-08-01
DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p < 0.05) at day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Luo, Yugang; Yuan, Ying; Ankenbauer, Robert G; Nelson, Lynn D; Witte, Steven B; Jackson, James A; Welch, Siao-Kun W
2012-06-06
Bovine viral diarrhea virus (BVDV) infections are enzootic in the cattle population and continue to cause significant economic losses to the beef and dairy industries worldwide. Extent of the damages has stimulated increasing interest in control programs directed at eradicating BVDV infections. Use of a BVDV marker vaccine would facilitate eradication efforts as a negatively marked vaccine would enable differentiation of infected from vaccinated animals (DIVA). We describe here the construction of three chimeric BVDVs containing glycoprotein E(rns) of heterologous pestiviruses and the evaluation of the chimera viruses as potential marker vaccines against BVDV infections. Chimeric NADL/G-E(rns), NADL/R-E(rns), and NADL/P-E(rns) were constructed by replacing the E(rns) gene of the full-length BVDV (NADL strain) genome with the E(rns) genes of giraffe (G-E(rns)), reindeer (R-E(rns)), or pronghorn antelope (P-E(rns)) pestiviruses, respectively. Each chimeric NADL virus was viable and infectious in RD 420 (bovine testicular) and BK-6 (bovine kidney) cells. By immunohistochemistry assays, NADL/G-E(rns) and NADL/R-E(rns) chimeric viruses reacted to BVDV E(rns) specific monoclonal antibody (mAb) 15C5, whereas the NADL/P-E(rns) chimeric virus did not. In an animal vaccination study, inactivated vaccines made from two chimeric viruses and the wild type NADL BVDV induced similar neutralizing antibody responses. NADL/P-E(rns)-vaccinated animals were distinguished from animals vaccinated with the wild type virus by means of a companion serological DIVA assay. These results show that chimeric NADL/P-E(rns) virus containing the E(rns) gene of pronghorn antelope pestivirus could be a potential marker vaccine candidate for use in a BVDV control and eradication program. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Li, Xiao-Feng; Dong, Hao-Long; Wang, Hong-Jiang; Huang, Xing-Yao; Qiu, Ye-Feng; Ji, Xue; Ye, Qing; Li, Chunfeng; Liu, Yang; Deng, Yong-Qiang; Jiang, Tao; Cheng, Gong; Zhang, Fu-Chun; Davidson, Andrew D; Song, Ya-Jun; Shi, Pei-Yong; Qin, Cheng-Feng
2018-02-14
The global spread of Zika virus (ZIKV) and its unexpected association with congenital defects necessitates the rapid development of a safe and effective vaccine. Here we report the development and characterization of a recombinant chimeric ZIKV vaccine candidate (termed ChinZIKV) that expresses the prM-E proteins of ZIKV using the licensed Japanese encephalitis live-attenuated vaccine SA14-14-2 as the genetic backbone. ChinZIKV retains its replication activity and genetic stability in vitro, while exhibiting an attenuation phenotype in multiple animal models. Remarkably, immunization of mice and rhesus macaques with a single dose of ChinZIKV elicits robust and long-lasting immune responses, and confers complete protection against ZIKV challenge. Significantly, female mice immunized with ChinZIKV are protected against placental and fetal damage upon ZIKV challenge during pregnancy. Overall, our study provides an alternative vaccine platform in response to the ZIKV emergency, and the safety, immunogenicity, and protection profiles of ChinZIKV warrant further clinical development.
-
Gershoni-Yahalom, Orly; Landes, Shimon; Kleiman-Shoval, Smadar; Ben-Nathan, David; Kam, Michal; Lachmi, Bat-El; Khinich, Yevgeny; Simanov, Michael; Samina, Itzhak; Eitan, Anat; Cohen, Irun R; Rager-Zisman, Bracha; Porgador, Angel
2010-01-01
The protective efficacy and immunogenicity of a chimeric peptide against West Nile virus (WNV) was evaluated. This virus is the aetiological agent of West Nile fever, which has recently emerged in the western hemisphere. The rapid spread of WNV throughout North America, as well as the constantly changing epidemiology and transmission of the virus by blood transfusion and transplantation, have raised major public-health concerns. Currently, there are no effective treatments for WNV or vaccine for human use. We previously identified a novel, continuous B-cell epitope from domain III of the WNV envelope protein, termed Ep15. To test whether this epitope can protect against WNV infection, we synthesized a linear chimeric peptide composed of Ep15 and the heat-shock protein 60 peptide, p458. The p458 peptide is an effective carrier peptide for subunit vaccines against other infectious agents. We now report that mice immunized with the chimeric peptide, p458-Ep15, were resistant to lethal challenges with three different WNV strains. Moreover, their brains were free of viral genome and infectious virus. Mice immunized with Ep15 alone or with p431-Ep15, a control conjugate, were not protected. The chimeric p458-Ep15 peptide induced WNV-specific immunoglobulin G antibodies that neutralized the virus and induced the secretion of interferon-γin vitro. Challenge of chimeric peptide-immunized mice considerably enhanced WNV-specific neutralizing antibodies. We conclude that this chimeric peptide can be used for formulation of a human vaccine against WNV. PMID:20331473
-
Gershoni-Yahalom, Orly; Landes, Shimon; Kleiman-Shoval, Smadar; Ben-Nathan, David; Kam, Michal; Lachmi, Bat-El; Khinich, Yevgeny; Simanov, Michael; Samina, Itzhak; Eitan, Anat; Cohen, Irun R; Rager-Zisman, Bracha; Porgador, Angel
2010-08-01
The protective efficacy and immunogenicity of a chimeric peptide against West Nile virus (WNV) was evaluated. This virus is the aetiological agent of West Nile fever, which has recently emerged in the western hemisphere. The rapid spread of WNV throughout North America, as well as the constantly changing epidemiology and transmission of the virus by blood transfusion and transplantation, have raised major public-health concerns. Currently, there are no effective treatments for WNV or vaccine for human use. We previously identified a novel, continuous B-cell epitope from domain III of the WNV envelope protein, termed Ep15. To test whether this epitope can protect against WNV infection, we synthesized a linear chimeric peptide composed of Ep15 and the heat-shock protein 60 peptide, p458. The p458 peptide is an effective carrier peptide for subunit vaccines against other infectious agents. We now report that mice immunized with the chimeric peptide, p458-Ep15, were resistant to lethal challenges with three different WNV strains. Moreover, their brains were free of viral genome and infectious virus. Mice immunized with Ep15 alone or with p431-Ep15, a control conjugate, were not protected. The chimeric p458-Ep15 peptide induced WNV-specific immunoglobulin G antibodies that neutralized the virus and induced the secretion of interferon-gammain vitro. Challenge of chimeric peptide-immunized mice considerably enhanced WNV-specific neutralizing antibodies. We conclude that this chimeric peptide can be used for formulation of a human vaccine against WNV.
-
Mandell, Robert B.; Koukuntla, Ramesh; Mogler, Laura J. K.; Carzoli, Andrea K.; Freiberg, Alexander N.; Holbrook, Michael R.; Martin, Brian K.; Staplin, William R.; Vahanian, Nicholas N.; Link, Charles J.; Flick, Ramon
2009-01-01
Virus-like particles (VLPs) present viral antigens in a native conformation and are effectively recognized by the immune system and therefore are considered as suitable and safe vaccine candidates against many viral diseases. Here we demonstrate that chimeric VLPs containing Rift Valley fever virus (RVFV) glycoproteins GN and GC, nucleoprotein N and the gag protein of Moloney murine leukemia virus represent an effective vaccine candidate against Rift Valley fever, a deadly disease in humans and livestock. Long-lasting humoral and cellular immune responses are demonstrated in a mouse model by the analysis of neutralizing antibody titers and cytokine secretion profiles. Vaccine efficacy studies were performed in mouse and rat lethal challenge models resulting in high protection rates. Taken together, these results demonstrate that replication-incompetent chimeric RVF VLPs are an efficient RVFV vaccine candidate. PMID:19932911
-
Development of chimeric candidate vaccine against HPV18: a proof of concept.
Wahiduzzaman, Mohammed; Sharma, Chandresh; Dey, Bindu; Bhatla, Neerja; Singh, Neeta
2015-06-01
Human papillomaviruses (HPVs) are prerequisite for the development of cervical cancer, with HPV16 and HPV18 being the most prevalent. Despite the fact that two prophylactic vaccines against HPVs are in the market, wide-scale application of the vaccine in developing countries is a major problem as far as cost of the vaccine and lack of therapeutic efficacy are concerned. Hence, the aim of our study was to develop HPV18 L1E7 chimeric virus-like particles (CVLPs) vaccine candidate possessing both, prophylactic and therapeutic potential against HPV18-associated cervical cancer. In this study, we have developed a potential candidate vaccine against HPV18 involving HPV18 L1E7 CVLPs, which was expressed in E. coli and assembled in vitro. These CVLPs were able to induce a neutralizing antibody response as well as a cell-mediated immune response in mice.
-
Wang, Min; Jokinen, Jenny; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.
2018-01-01
Lassa virus (LASV) is the most prevalent rodent-borne arenavirus circulated in West Africa. With population at risk from Senegal to Nigeria, LASV causes Lassa fever and is responsible for thousands of deaths annually. High genetic diversity of LASV is one of the challenges for vaccine R&D. We developed multivalent virus-like particle vectors (VLPVs) derived from the human Venezuelan equine encephalitis TC-83 IND vaccine (VEEV) as the next generation of alphavirus-based bicistronic RNA replicon particles. The genes encoding VEEV structural proteins were replaced with LASV glycoproteins (GPC) from distantly related clades I and IV with individual 26S promoters. Bicistronic RNA replicons encoding wild-type LASV GPC (GPCwt) and C-terminally deleted, non-cleavable modified glycoprotein (ΔGPfib), were encapsidated into VLPV particles using VEEV capsid and glycoproteins provided in trans. In transduced cells, VLPVs induced simultaneous expression of LASV GPCwt and ΔGPfib from 26S alphavirus promoters. LASV ΔGPfib was predominantly expressed as trimers, accumulated in the endoplasmic reticulum, induced ER stress and apoptosis promoting antigen cross-priming. VLPV vaccines were immunogenic and protective in mice and upregulated CD11c+/CD8+ dendritic cells playing the major role in cross-presentation. Notably, VLPV vaccination resulted in induction of cross-reactive multifunctional T cell responses after stimulation of immune splenocytes with peptide cocktails derived from LASV from clades I-IV. Multivalent RNA replicon-based LASV vaccines can be applicable for first responders, international travelers visiting endemic areas, military and lab personnel. PMID:29287681
-
Feenstra, Femke; Pap, Janny S; van Rijn, Piet A
2015-02-04
Bluetongue is a disease of ruminants caused by the bluetongue virus (BTV). Bluetongue outbreaks can be controlled by vaccination, however, currently available vaccines have several drawbacks. Further, there are at least 26 BTV serotypes, with low cross protection. A next-generation vaccine based on live-attenuated BTV without expression of non-structural proteins NS3/NS3a, named Disabled Infectious Single Animal (DISA) vaccine, was recently developed for serotype 8 by exchange of the serotype determining outer capsid protein VP2. DISA vaccines are replicating vaccines but do not cause detectable viremia, and induce serotype specific protection. Here, we exchanged VP2 of laboratory strain BTV1 for VP2 of European serotypes 2, 4, 8 and 9 using reverse genetics, without observing large effects on virus growth. Exchange of VP2 from serotype 16 and 25 was however not possible. Therefore, chimeric VP2 proteins of BTV1 containing possible immunogenic regions of these serotypes were studied. BTV1, expressing 1/16 chimeric VP2 proteins was functional in virus replication in vitro and contained neutralizing epitopes of both serotype 1 and 16. For serotype 25 this approach failed. We combined VP2 exchange with the NS3/NS3a negative phenotype in BTV1 as previously described for serotype 8 DISA vaccine. DISA vaccine with 1/16 chimeric VP2 containing amino acid region 249-398 of serotype 16 raised antibodies in sheep neutralizing both BTV1 and BTV16. This suggests that DISA vaccine could be protective for both parental serotypes present in chimeric VP2. We here demonstrate the application of the BT DISA vaccine platform for several serotypes and further extend the application for serotypes that are unsuccessful in single VP2 exchange. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Characterization of a new chimeric marker vaccine candidate with a mutated antigenic E2-epitope.
Reimann, Ilona; Depner, Klaus; Utke, Katrin; Leifer, Immanuel; Lange, Elke; Beer, Martin
2010-04-21
A new chimeric pestivirus "CP7_E1E2alf_TLA", based on the infectious cDNA of bovine viral diarrhea virus (BVDV) strain CP7, was constructed. The substitution of BVDV E1 and E2 with the respective proteins of classical swine fever (CSF) strain Alfort 187 allows an optimal heterodimerization of E1 and E2 in the chimeric virus, which is beneficial for efficient and authentic virus assembly and growth. In addition, for implementation of E2-based marker diagnostics, the previously described antigenic CSFV-specific TAVSPTTLR epitope was exchanged with the corresponding E2-epitope of BVDV strain CP7. Recombinant virus CP7_E1E2alf_TLA displayed a growth defect, and was not reacting with monoclonal antibodies used in commercial E2 antibody blocking ELISAs. Therefore, efficacy as well as marker properties of CP7_E1E2alf_TLA were investigated in an animal experiment with both a high dose and a low dose vaccine preparation. All CP7_E1E2alf_TLA-vaccinated animals seroconverted until day 28 post-vaccination with neutralizing antibodies. Furthermore, at the day of challenge infection CP7_E1E2alf_TLA-immunized animals showed distinct lower ELISA values in a commercial CSFV E2 antibody test in comparison to the C-strain vaccinated controls. However, E2-ELISA reactivity as well as neutralizing titers were directly connected to the dosage used for vaccination, and only the low dose group had E2-ELISA values below threshold until challenge infection. Following challenge infection with highly virulent CSFV strain Koslov, all vaccinees were protected, however, short-term fever episodes and very limited CSFV genome detection with very low copy numbers could be observed. In conclusion, manipulation of the TAVSPTTLR-epitope within the tested chimeric virus resulted in an slightly reduced efficacy, but the E2 marker properties unexpectedly did not allow a clear differentiation of infected from vaccinated animals in some cases. Copyright 2009 Elsevier B.V. All rights reserved.
-
Boxus, Mathieu; Fochesato, Michel; Miseur, Agnès; Mertens, Emmanuel; Dendouga, Najoua; Brendle, Sarah; Balogh, Karla K.; Christensen, Neil D.
2016-01-01
ABSTRACT At least 15 high-risk human papillomaviruses (HPVs) are linked to anogenital preneoplastic lesions and cancer. Currently, there are three licensed prophylactic HPV vaccines based on virus-like particles (VLPs) of the L1 major capsid protein from HPV-2, -4, or -9, including the AS04-adjuvanted HPV-16/18 L1 vaccine. The L2 minor capsid protein contains HPV-neutralizing epitopes that are well conserved across numerous high-risk HPVs. Therefore, the objective of our study was to assess the capacity to broaden vaccine-mediated protection using AS04-adjuvanted vaccines based on VLP chimeras of L1 with one or two L2 epitopes. Several chimeric VLPs were constructed by inserting L2 epitopes within the DE loop and/or C terminus of L1. Based on the shape, yield, size, and immunogenicity, one of seven chimeras was selected for further evaluation in mouse and rabbit challenge models. The chimeric VLP consisted of HPV-18 L1 with insertions of HPV-33 L2 (amino acid residues 17 to 36; L1 DE loop) and HPV-58 L2 (amino acid residues 56 to 75; L1 C terminus). This chimeric L1/L2 VLP vaccine induced persistent immune responses and protected against all of the different HPVs evaluated (HPV-6, -11, -16, -31, -35, -39, -45, -58, and -59 as pseudovirions or quasivirions) in both mouse and rabbit challenge models. The degree and breadth of protection in the rabbit were further enhanced when the chimeric L1/L2 VLP was formulated with the L1 VLPs from the HPV-16/18 L1 vaccine. Therefore, the novel HPV-18 L1/L2 chimeric VLP (alone or in combination with HPV-16 and HPV-18 L1 VLPs) formulated with AS04 has the potential to provide broad protective efficacy in human subjects. IMPORTANCE From evaluations in human papillomavirus (HPV) protection models in rabbits and mice, our study has identified a prophylactic vaccine with the potential to target a wide range of HPVs linked to anogenital cancer. The three currently licensed vaccines contain virus-like particles (VLPs) of the L1 major
-
USDA-ARS?s Scientific Manuscript database
Chimeric foot-and-mouth disease viruses (FMDV) of which the antigenic properties can be readily manipulated is a potentially powerful approach in the control of foot-and-mouth disease (FMD) in sub-Saharan Africa. FMD vaccine application is complicated by the extensive variability of the South Africa...
-
Lin, Xu'ai; Xiao, Guohui; Luo, Dongjiao; Kong, Liangliang; Chen, Xu; Sun, Dexter; Yan, Jie
2016-10-14
Leptospirosis is an important reemerging zoonosis, with more than half a million cases reported annually, and is caused by pathogenic Leptospira species. Development of a universal vaccine is one of the major strategic goals to overcome the disease burden of leptospirosis. In this study, a chimeric multi-epitope protein-based vaccine was designed and tested for its potency to induce a specific immune response and provide protection against L. interrogans infection. The protein, containing four repeats of six T- and B-cell combined epitopes from the leptospiral outer membrane proteins, OmpL1, LipL32 and LipL21, was expressed and purified. Western blot analysis showed that the recombinant protein (named r4R) mainly expressed in a soluble pattern, and reacted with antibodies raised in rabbit against heat-killed Leptospira and in guinea pigs against the r4R vaccine. Microscopic agglutination tests showed that r4R antisera was immunological cross-reactive with a range of Chinese standard reference strains of Leptospira belonging to different serogroups. In guinea pigs, the r4R vaccine induced a Th1-biased immune response, as reflected by the IgG2a/IgG1 ratio and cytokine production of stimulated splenocytes derived from immunized animals. Finally, r4R-immunized guinea pigs showed increased survival of lethal Leptospira challenges compared with PBS-immunized animals and tissue damage and leptospiral colonization of the kidney were reduced. The multi-epitope chimeric r4R protein is a promising antigen for the development of a universal cross-reactive vaccine against leptospirosis.
-
Ramírez-Gualito, Karla; Richter, Monique; Matzapetakis, Manolis; Singer, David; Berger, Stefan
2013-04-26
Rational design of peptide vaccines becomes important for the treatment of some diseases such as Alzheimer's disease (AD) and related disorders. In this study, as part of a larger effort to explore correlations of structure and activity, we attempt to characterize the doubly phosphorylated chimeric peptide vaccine targeting a hyperphosphorylated epitope of the Tau protein. The 28-mer linear chimeric peptide consists of the double phosphorylated B cell epitope Tau₂₂₉₋₂₃₇[pThr231/pSer235] and the immunomodulatory T cell epitope Ag85B₂₄₁₋₂₅₅ originating from the well-known antigen Ag85B of the Mycobacterium tuberculosis, linked by a four amino acid sequence -GPSL-. NMR chemical shift analysis of our construct demonstrated that the synthesized peptide is essentially unfolded with a tendency to form a β-turn due to the linker. In conclusion, the -GPSL- unit presumably connects the two parts of the vaccine without transferring any structural information from one part to the other. Therefore, the double phosphorylated epitope of the Tau peptide is flexible and accessible.
-
Ye, Ling; Wen, Zhiyuan; Dong, Ke; Wang, Xi; Bu, Zhigao; Zhang, Huizhong; Compans, Richard W.; Yang, Chinglai
2011-01-01
Several conserved neutralizing epitopes have been identified in the HIV Env protein and among these, the MPER of gp41 has received great attention and is widely recognized as a promising target. However, little success has been achieved in eliciting MPER-specific HIV neutralizing antibodies by a number of different vaccine strategies. We investigated the ability of HA/gp41 chimeric protein-based vaccines, which were designed to enhance the exposure of the MPER in its native conformation, to induce MPER-specific HIV neutralizing antibodies. In characterization of the HA/gp41 chimeric protein, we found that by mutating an unpaired Cys residue (Cys-14) in its HA1 subunit to a Ser residue, the modified chimeric protein HA-C14S/gp41 showed increased reactivity to a conformation-sensitive monoclonal antibody against HA and formed more stable trimers in VLPs. On the other hand, HA-C14S/gp41 and HA/gp41 chimeric proteins expressed on the cell surfaces exhibited similar reactivity to monoclonal antibodies 2F5 and 4E10. Immunization of guinea pigs using the HA-C14S/gp41 DNA or VLP vaccines induced antibodies against the HIV gp41 as well as to a peptide corresponding to a segment of MPER at higher levels than immunization by standard HIV VLPs. Further, sera from vaccinated guinea pigs were found to exhibit HIV neutralizing activities. Moreover, sera from guinea pigs vaccinated by HA-C14S/gp41 DNA and VLP vaccines but not the standard HIV VLPs, were found to neutralize HIV pseudovirions containing a SIV-4E10 chimeric Env protein. The virus neutralization could be blocked by a MPER-specific peptide, thus demonstrating induction of MPER-specific HIV neutralizing antibodies by this novel vaccine strategy. These results show that induction of MPER-specific HIV neutralizing antibodies can be achieved through a rationally designed vaccine strategy. PMID:21625584
-
Espinosa, Diego A; Yadava, Anjali; Angov, Evelina; Maurizio, Paul L; Ockenhouse, Christian F; Zavala, Fidel
2013-08-01
The development of vaccine candidates against Plasmodium vivax-the most geographically widespread human malaria species-is challenged by technical difficulties, such as the lack of in vitro culture systems and availability of animal models. Chimeric rodent Plasmodium parasites are safe and useful tools for the preclinical evaluation of new vaccine formulations. We report the successful development and characterization of chimeric Plasmodium berghei parasites bearing the type I repeat region of P. vivax circumsporozoite protein (CSP). The P. berghei-P. vivax chimeric strain develops normally in mosquitoes and produces highly infectious sporozoites that produce patent infection in mice that are exposed to the bites of as few as 3 P. berghei-P. vivax-infected mosquitoes. Using this transgenic parasite, we demonstrate that monoclonal and polyclonal antibodies against P. vivax CSP strongly inhibit parasite infection and thus support the notion that these antibodies play an important role in protective immunity. The chimeric parasites we developed represent a robust model for evaluating protective immune responses against P. vivax vaccines based on CSP.
-
BST2/Tetherin Inhibition of Alphavirus Exit
Ooi, Yaw Shin; Dubé, Mathieu; Kielian, Margaret
2015-01-01
Alphaviruses such as chikungunya virus (CHIKV) and Semliki Forest virus (SFV) are small enveloped RNA viruses that bud from the plasma membrane. Tetherin/BST2 is an interferon-induced host membrane protein that inhibits the release of many enveloped viruses via direct tethering of budded particles to the cell surface. Alphaviruses have highly organized structures and exclude host membrane proteins from the site of budding, suggesting that their release might be insensitive to tetherin inhibition. Here, we demonstrated that exogenously-expressed tetherin efficiently inhibited the release of SFV and CHIKV particles from host cells without affecting virus entry and infection. Alphavirus release was also inhibited by the endogenous levels of tetherin in HeLa cells. While rubella virus (RuV) and dengue virus (DENV) have structural similarities to alphaviruses, tetherin inhibited the release of RuV but not DENV. We found that two recently identified tetherin isoforms differing in length at the N-terminus exhibited distinct capabilities in restricting alphavirus release. SFV exit was efficiently inhibited by the long isoform but not the short isoform of tetherin, while both isoforms inhibited vesicular stomatitis virus exit. Thus, in spite of the organized structure of the virus particle, tetherin specifically blocks alphavirus release and shows an interesting isoform requirement. PMID:25912717
-
Reisler, Ronald B; Gibbs, Paul H; Danner, Denise K; Boudreau, Ellen F
2012-11-26
We compared the effect on primary vaccination plaque-reduction neutralization 80% titers (PRNT80) responses of same-day administration (at different injection sites) of two similar investigational inactivated alphavirus vaccines, eastern equine encephalitis (EEE) vaccine (TSI-GSD 104) and western equine encephalitis (WEE) vaccine (TSI-GSD 210) to separate administration. Overall, primary response rate for EEE vaccine was 524/796 (66%) and overall primary response rate for WEE vaccine was 291/695 (42%). EEE vaccine same-day administration yielded a 59% response rate and a responder geometric mean titer (GMT)=89 while separate administration yielded a response rate of 69% and a responder GMT=119. WEE vaccine same-day administration yielded a 30% response rate and a responder GMT=53 while separate administration yielded a response rate of 54% and a responder GMT=79. EEE response rates for same-day administration (group A) vs. non-same-day administration (group B) were significantly affected by gender. A logistic regression model predicting response to EEE comparing group B to group A for females yielded an OR=4.10 (95% CL 1.97-8.55; p=.0002) and for males yielded an OR=1.25 (95% CL 0.76-2.07; p=.3768). WEE response rates for same-day administration vs. non-same-day administration were independent of gender. A logistic regression model predicting response to WEE comparing group B to group A yielded an OR=2.14 (95% CL 1.22-3.73; p=.0077). We report immune interference occurring with same-day administration of two completely separate formalin inactivated viral vaccines in humans. These findings combined with the findings of others regarding immune interference would argue for a renewed emphasis on studying the immunological mechanisms of induction of inactivated viral vaccine protection. Copyright © 2012. Published by Elsevier Ltd.
-
Yang, Zhenhua; Wu, Rui; Li, Robert W; Li, Ling; Xiong, Zhongliang; Zhao, Haizhong; Guo, Deyin; Pan, Zishu
2012-04-01
A trans-complemented chimeric CSF-JE virus replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The CSFV E2 gene was deleted, and a fragment containing the region encoding a truncated envelope protein (tE, amino acid 292-402, domain III) of JE virus (JEV) was inserted into the resultant plasmid, pA187delE2, to generate the recombinant cDNA clone pA187delE2/JEV-tE. Porcine kidney 15 (PK15) cells that constitutively express the CSFV E2p7 proteins were then transfected with in vitro-transcribed RNA from pA187delE2/JEV-tE. As a result, the chimeric CSF-JE virus replicon particle (VRP), rv187delE2/JEV-tE, was rescued. In a mouse model, immunization with the chimeric CSF-JE VRP induced strong production of JEV-specific antibody and conferred protection against a lethal JEV challenge. Pigs immunized with CSF-JE VRP displayed strong anti-CSFV and anti-JEV antibody responses and protection against CSFV and JEV challenge infections. Our evidence suggests that E2-complemented CSF-JE VRP not only has potential as a live-attenuated non-transmissible vaccine candidate against CSF and JE but also serves as a potential DIVA (Differentiating Infected from Vaccinated Animals) vaccine for CSF in pigs. Together, our data suggest that the non-transmissible chimeric VRP expressing foreign antigenic proteins may represent a promising strategy for bivalent DIVA vaccine design. Copyright © 2012 Elsevier B.V. All rights reserved.
-
1990-01-01
and DEN in the Caribbean, Mexico , and South and Central apparently in epidemic cycles spanning several years America testify to the intensity of...vesiculates, weeks, even in those patients with continued rheu- confusion with varicella may occur. Occasionally, the matic symptoms and signs. C...izootic from 1969 to 1972 that extended throughout ALPHAVIRUSES / 749 Central America and Mexico to finally reach south in field epidemiology
-
Alaro, James R.; Partridge, Andrea; Miura, Kazutoyo; Diouf, Ababacar; Lopez, Ana M.; Angov, Evelina; Long, Carole A.
2013-01-01
The C-terminal 19-kDa domain of Plasmodium falciparum merozoite surface protein 1 (PfMSP119) is an established target of protective antibodies. However, clinical trials of PfMSP142, a leading blood-stage vaccine candidate which contains the protective epitopes of PfMSP119, revealed suboptimal immunogenicity and efficacy. Based on proof-of-concept studies in the Plasmodium yoelii murine model, we produced a chimeric vaccine antigen containing recombinant PfMSP119 (rPfMSP119) fused to the N terminus of P. falciparum merozoite surface protein 8 that lacked its low-complexity Asn/Asp-rich domain, rPfMSP8 (ΔAsn/Asp). Immunization of mice with the chimeric rPfMSP1/8 vaccine elicited strong T cell responses to conserved epitopes associated with the rPfMSP8 (ΔAsn/Asp) fusion partner. While specific for PfMSP8, this T cell response was adequate to provide help for the production of high titers of antibodies to both PfMSP119 and rPfMSP8 (ΔAsn/Asp) components. This occurred with formulations adjuvanted with either Quil A or with Montanide ISA 720 plus CpG oligodeoxynucleotide (ODN) and was observed in both inbred and outbred strains of mice. PfMSP1/8-induced antibodies were highly reactive with two major alleles of PfMSP119 (FVO and 3D7). Of particular interest, immunization with PfMSP1/8 elicited higher titers of PfMSP119-specific antibodies than a combined formulation of rPfMSP142 and rPfMSP8 (ΔAsn/Asp). As a measure of functionality, PfMSP1/8-specific rabbit IgG was shown to potently inhibit the in vitro growth of blood-stage parasites of the FVO and 3D7 strains of P. falciparum. These data support the further testing and evaluation of this chimeric PfMSP1/8 antigen as a component of a multivalent vaccine for P. falciparum malaria. PMID:23897613
-
Genome-Scale Phylogeny of the Alphavirus Genus Suggests a Marine Origin
Palacios, G.; Tesh, R. B.; Savji, N.; Guzman, H.; Sherman, M.; Weaver, S. C.; Lipkin, W. I.
2012-01-01
The genus Alphavirus comprises a diverse group of viruses, including some that cause severe disease. Using full-length sequences of all known alphaviruses, we produced a robust and comprehensive phylogeny of the Alphavirus genus, presenting a more complete evolutionary history of these viruses compared to previous studies based on partial sequences. Our phylogeny suggests the origin of the alphaviruses occurred in the southern oceans and spread equally through the Old and New World. Since lice appear to be involved in aquatic alphavirus transmission, it is possible that we are missing a louse-borne branch of the alphaviruses. Complete genome sequencing of all members of the genus also revealed conserved residues forming the structural basis of the E1 and E2 protein dimers. PMID:22190718
-
Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B
2013-01-01
The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.
-
Lozano, José Manuel; Varela, Yahson; Silva, Yolanda; Ardila, Karen; Forero, Martha; Guasca, Laura; Guerrero, Yuly; Bermudez, Adriana; Alba, Patricia; Vanegas, Magnolia; Patarroyo, Manuel Elkin
2017-11-01
Rational strategies for obtaining malaria vaccine candidates should include not only a proper selection of target antigens for antibody stimulation, but also a versatile molecular design based on ordering the right pieces from the complex pathogen molecular puzzle towards more active and functional immunogens. Classical Plasmodium falciparum antigens regarded as vaccine candidates have been selected as model targets in this study. Among all possibilities we have chosen epitopes of Pf CSP, STARP; MSA1 and Pf 155/RESA from pre- and erythrocyte stages respectively for designing a large 82-residue chimeric immunogen. A number of options aimed at diminishing steric hindrance for synthetic procedures were assessed based on standard Fmoc chemistry such as building block orthogonal ligation; pseudo-proline and microwave-assisted procedures, therefore the large-chimeric target was produced, characterized and immunologically tested. Antigenicity and functional in vivo efficacy tests of the large-chimera formulations administered alone or as antigen mixtures have proven the stimulation of high antibody titers, showing strong correlation with protection and parasite clearance of vaccinated BALB/c mice after being lethally challenged with both P. berghei -ANKA and P. yoelii 17XL malaria strains. Besides, 3D structure features shown by the large-chimera encouraged as to propose using these rational designed large synthetic molecules as reliable vaccine candidate-presenting systems.
-
The Alphavirus Exit Pathway: What We Know and What We Wish We Knew
2018-01-01
Alphaviruses are enveloped positive sense RNA viruses and include serious human pathogens, such as the encephalitic alphaviruses and Chikungunya virus. Alphaviruses are transmitted to humans primarily by mosquito vectors and include species that are classified as emerging pathogens. Alphaviruses assemble highly organized, spherical particles that bud from the plasma membrane. In this review, we discuss what is known about the alphavirus exit pathway during a cellular infection. We describe the viral protein interactions that are critical for virus assembly/budding and the host factors that are involved, and we highlight the recent discovery of cell-to-cell transmission of alphavirus particles via intercellular extensions. Lastly, we discuss outstanding questions in the alphavirus exit pathway that may provide important avenues for future research. PMID:29470397
-
Isakova-Sivak, Irina; Korenkov, Daniil; Smolonogina, Tatiana; Kotomina, Tatiana; Donina, Svetlana; Matyushenko, Victoria; Mezhenskaya, Daria; Krammer, Florian; Rudenko, Larisa
2018-05-01
The development of influenza vaccines that can provide broad protection against all drifted seasonal virus variants, zoonotic infections and emerging pandemic strains, has been a priority for two decades. Here we propose a strategy of inducing broadly-reactive anti-stalk antibody by sequential immunizations with live attenuated influenza vaccines (LAIVs) expressing chimeric HAs (cHAs). These vaccines are designed to contain identical hemagglutinin stalk domains from H1N1 virus but antigenically unrelated globular head domains from avian influenza virus subtypes H5, H8 and H9. Mouse experiments demonstrated enhanced cross-protection of cHA-containing LAIVs compared to the relevant vaccine viruses expressing natural HAs, and this enhanced protection was driven by stalk-HA-reactive IgG antibodies. The establishment of fully functional cross-protective immunity after two doses of cHA LAIV vaccination in naïve animals suggests that a similar effect might be expected after a single cHA LAIV dose in primed individuals, or after two to three doses in naïve children. Copyright © 2018 Elsevier Inc. All rights reserved.
-
A Novel System for Visualizing Alphavirus Assembly
Steel, J. Jordan; Geiss, Brian J.
2015-01-01
Alphaviruses are small, enveloped RNA viruses that form infectious particles by budding through the cellular plasma membrane. To help visualize and understand the intracellular assembly of alphavirus virions we have developed a bimolecular fluorescence complementation-based system (BiFC) that allows visualization of capsid and E2 subcellular localization and association in live cells. In this system, N- or C-terminal Venus fluorescent protein fragments (VN- and VC-) are fused to the N-terminus of the capsid protein on the Sindbis virus structural polyprotein, which results in the formation of fluorescent capsid-like structures in the absence of viral genomes that associate with the plasma membrane of cells. Mutation of the capsid autoprotease active site blocks structural polyprotein processing and alters the subcellular distribution of capsid fluorescence. Incorporating mCherry into the extracellular domain of the E2 glycoprotein allows the visualization of E2 glycoprotein localization and showed a close association of the E2 and capsid proteins at the plasma membrane as expected. These results suggest that this system is a useful new tool to study alphavirus assembly in live cells and may be useful in identifying molecules that inhibit alphavirus virion formation. PMID:26122073
-
Nasveld, Peter E; Marjason, Joanne; Bennett, Sonya; Aaskov, John; Elliott, Suzanne; McCarthy, Karen; Kanesa-thasan, Niranjan; Feroldi, Emmanuel
2010-01-01
A randomized, double-blind, study was conducted to evaluate the safety, tolerability and immunogenicity of a live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) co-administered with live attenuated yellow fever (YF) vaccine (YF-17D strain; Stamaril®, Sanofi Pasteur) or administered sequentially. Participants (n = 108) were randomized to receive: YF followed by JE-CV 30 days later, JE followed by YF 30 days later, or the co-administration of JE and YF followed or preceded by placebo 30 days later or earlier. Placebo was used in a double-dummy fashion to ensure masking. Neutralizing antibody titers against JE-CV, YF-17D and selected wild-type JE virus strains was determined using a 50% serum-dilution plaque reduction neutralization test (PRNT50). Seroconversion was defined as the appearance of a neutralizing antibody titer above the assay cut-off post-immunization when not present pre-injection at day 0, or a least a four-fold rise in neutralizing antibody titer measured before the pre-injection day 0 and later post vaccination samples. There were no serious adverse events. Most adverse events (AEs) after JE vaccination were mild to moderate in intensity, and similar to those reported following YF vaccination. Seroconversion to JE-CV was 100% and 91% in the JE/YF and YF/JE sequential vaccination groups, respectively, compared with 96% in the co-administration group. All participants seroconverted to YF vaccine and retained neutralizing titers above the assay cut-off at month six. Neutralizing antibodies against JE vaccine were detected in 82–100% of participants at month six. These results suggest that both vaccines may be successfully co-administered simultaneously or 30 days apart. PMID:20864814
-
Nuccitelli, Annalisa; Cozzi, Roberta; Gourlay, Louise J; Donnarumma, Danilo; Necchi, Francesca; Norais, Nathalie; Telford, John L; Rappuoli, Rino; Bolognesi, Martino; Maione, Domenico; Grandi, Guido; Rinaudo, C Daniela
2011-06-21
Structural vaccinology is an emerging strategy for the rational design of vaccine candidates. We successfully applied structural vaccinology to design a fully synthetic protein with multivalent protection activity. In Group B Streptococcus, cell-surface pili have aroused great interest because of their direct roles in virulence and importance as protective antigens. The backbone subunit of type 2a pilus (BP-2a) is present in six immunogenically different but structurally similar variants. We determined the 3D structure of one of the variants, and experimentally demonstrated that protective antibodies specifically recognize one of the four domains that comprise the protein. We therefore constructed a synthetic protein constituted by the protective domain of each one of the six variants and showed that the chimeric protein protects mice against the challenge with all of the type 2a pilus-carrying strains. This work demonstrates the power of structural vaccinology and will facilitate the development of an optimized, broadly protective pilus-based vaccine against Group B Streptococcus by combining the uniquely generated chimeric protein with protective pilin subunits from two other previously identified pilus types. In addition, this work describes a template procedure that can be followed to develop vaccines against other bacterial pathogens.
-
Genetic stability of a dengue vaccine based on chimeric yellow fever/dengue viruses.
Mantel, N; Girerd, Y; Geny, C; Bernard, I; Pontvianne, J; Lang, J; Barban, V
2011-09-02
A tetravalent dengue vaccine based on four live, attenuated, chimeric viruses (CYD1-4), constructed by replacing the genes coding for premembrane (prM) and envelope (E) proteins of the yellow fever (YF)-17D vaccine strain with those of the four serotypes of dengue virus, is in clinical phase III evaluation. We assessed the vaccine's genetic stability by fully sequencing each vaccine virus throughout the development and manufacturing process. The four viruses displayed complete genetic stability, with no change from premaster seed lots to bulk lots. When pursuing the virus growth beyond bulk lots, a few genetic variations were observed. Usually both the initial nucleotide and the new one persisted, and mutations appeared after a relatively high number of virus duplication cycles (65-200, depending on position). Variations were concentrated in the prM-E and non-structural (NS)4B regions. PrM-E variations had no impact on lysis-plaque size or neurovirulence in mice. None of the variations located in the YF-17D-derived genes corresponded with reversion to the wild-type Yellow Fever sequence. Variations in NS4B likely reflect virus adaptation to Vero cells growth. A low to undetectable viremia has been reported previously [1-3] in vaccinated non-human and human primates. Combined with the data reported here about the genetic stability of the vaccine strains, the probability of in vivo emergence of mutant viruses appears very low. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Janewongwirot, Pakpoom; Puthanakit, Thanyawee; Anugulruengkitt, Suvaporn; Jantarabenjakul, Watsamon; Phasomsap, Chayapa; Chumket, Sompong; Yoksan, Sutee; Pancharoen, Chitsanu
2016-10-17
Japanese Encephalitis chimeric virus vaccine (JE-CV) and SA14-14-2 vaccine are live-attenuated JE vaccines produced from the same virus strain. Data on interchangeability is limited. To evaluate the immunogenicity and safety of JE-CV booster after primary vaccination with SA14-14-2 vaccine. This study was an open-label clinical trial in Thai children who had received a primary SA14-14-2 vaccination at 12-24monthsbefore enrollment (ClinicalTrials.gov NCT02602652). JE-CV was administered. A 50% plaque reduction neutralization test (PRNT 50 ) against three virus strains; JE-CV, SA-14-14-2andwild-type JE virus was measured before and 28-days post vaccination. The laboratory was performed at PRNT 50 titers ⩾10 (1/dil) were considered seroprotective against JE. Geometric mean titer (GMT) of PRNT 50 was calculated. Adverse events were observed for 28days. From March 2014 to June 2015, 50 children (64% male) were enrolled. Mean age and duration after primary vaccination was 26.9 (SD 4.6) and 12.8 (SD 2.7) months, respectively. The proportion of participants who had PRNT 50 pre and post-booster vaccination were 92% and 96% against JE-CV virus, 56% and 98% against SA-14-14-2 strain and 70% and 98% against wild-type JE virus, respectively. Solicited injection site reactions including erythema, pain and swelling occurred in 18%, 10% and 4% of subjects, respectively. Four children (8%) had fever (⩾37.7Celsius). Eight children (16%) had adverse events, which were not related to the vaccine. AJE-CV booster dose is highly immunogenic and safe among children who previously received SA14-14-2 vaccine. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
-
Lv, Lishan; Li, Xiaoming; Liu, Genmei; Li, Ran; Liu, Qiliang; Shen, Huifang; Wang, Wei; Xue, Chunyi
2014-01-01
Infectious bronchitis virus (IBV) poses a severe threat to the poultry industry and causes heavy economic losses worldwide. Vaccination is the most effective method of preventing infection and controlling the spread of IBV, but currently available inactivated and attenuated virus vaccines have some disadvantages. We developed a chimeric virus-like particle (VLP)-based candidate vaccine for IBV protection. The chimeric VLP was composed of matrix 1 protein from avian influenza H5N1 virus and a fusion protein neuraminidase (NA)/spike 1 (S1) that was generated by fusing IBV S1 protein to the cytoplasmic and transmembrane domains of NA protein of avian influenza H5N1 virus. The chimeric VLPs elicited significantly higher S1-specific antibody responses in intramuscularly immunized mice and chickens than inactivated IBV viruses. Furthermore, the chimeric VLPs induced significantly higher neutralization antibody levels than inactivated H120 virus in SPF chickens. Finally, the chimeric VLPs induced significantly higher IL-4 production in mice. These results demonstrate that chimeric VLPs have the potential for use in vaccines against IBV infection. PMID:24378590
-
Lv, Lishan; Li, Xiaoming; Liu, Genmei; Li, Ran; Liu, Qiliang; Shen, Huifang; Wang, Wei; Xue, Chunyi; Cao, Yongchang
2014-01-01
Infectious bronchitis virus (IBV) poses a severe threat to the poultry industry and causes heavy economic losses worldwide. Vaccination is the most effective method of preventing infection and controlling the spread of IBV, but currently available inactivated and attenuated virus vaccines have some disadvantages. We developed a chimeric virus-like particle (VLP)-based candidate vaccine for IBV protection. The chimeric VLP was composed of matrix 1 protein from avian influenza H5N1 virus and a fusion protein neuraminidase (NA)/spike 1 (S1) that was generated by fusing IBV S1 protein to the cytoplasmic and transmembrane domains of NA protein of avian influenza H5N1 virus. The chimeric VLPs elicited significantly higher S1-specific antibody responses in intramuscularly immunized mice and chickens than inactivated IBV viruses. Furthermore, the chimeric VLPs induced significantly higher neutralization antibody levels than inactivated H120 virus in SPF chickens. Finally, the chimeric VLPs induced significantly higher IL-4 production in mice. These results demonstrate that chimeric VLPs have the potential for use in vaccines against IBV infection.
-
Mucosal and systemic adjuvant activity of alphavirus replicon particles
NASA Astrophysics Data System (ADS)
Thompson, Joseph M.; Whitmore, Alan C.; Konopka, Jennifer L.; Collier, Martha L.; Richmond, Erin M. B.; Davis, Nancy L.; Staats, Herman F.; Johnston, Robert E.
2006-03-01
Vaccination represents the most effective control measure in the fight against infectious diseases. Local mucosal immune responses are critical for protection from, and resolution of, infection by numerous mucosal pathogens. Antigen processing across mucosal surfaces is the natural route by which mucosal immunity is generated, as peripheral antigen delivery typically fails to induce mucosal immune responses. However, we demonstrate in this article that mucosal immune responses are evident at multiple mucosal surfaces after parenteral delivery of Venezuelan equine encephalitis virus replicon particles (VRP). Moreover, coinoculation of null VRP (not expressing any transgene) with inactivated influenza virions, or ovalbumin, resulted in a significant increase in antigen-specific systemic IgG and fecal IgA antibodies, compared with antigen alone. Pretreatment of VRP with UV light largely abrogated this adjuvant effect. These results demonstrate that alphavirus replicon particles possess intrinsic systemic and mucosal adjuvant activity and suggest that VRP RNA replication is the trigger for this activity. We feel that these observations and the continued experimentation they stimulate will ultimately define the specific components of an alternative pathway for the induction of mucosal immunity, and if the activity is evident in humans, will enable new possibilities for safe and inexpensive subunit and inactivated vaccines. vaccine vector | Venezuelan equine encephalitis virus | viral immunology | RNA virus
-
Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong
2006-04-01
To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56
-
Wenthur, Cody J; Cai, Xiaoqing; Ellis, Beverly A; Janda, Kim D
2017-08-15
Given the need for further improvements in anti-cocaine vaccination strategies, a chimeric hapten (GNET) was developed that combines chemically-stable structural features from steady-state haptens with the hydrolytic functionality present in transition-state mimetic haptens. Additionally, as a further investigation into the generation of an improved bifunctional antibody pool, sequential vaccination with steady-state and transition-state mimetic haptens was undertaken. While GNET induced the formation of catalytically-active antibodies, it did not improve overall behavioral efficacy. In contrast, the resulting pool of antibodies from GNE/GNT co-administration demonstrated intermediate efficacy as compared to antibodies developed from either hapten alone. Overall, improved antibody catalytic efficiency appears necessary to achieve the synergistic benefits of combining cocaine hydrolysis with peripheral sequestration. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Aguilera, Brenda Eugenia; Chávez-Calvillo, Gabriela; Elizondo-Quiroga, Darwin; Jimenez-García, Mónica Noemí; Carrillo-Tripp, Mauricio; Silva-Rosales, Laura; Hernández-Gutiérrez, Rodolfo; Gutiérrez-Ortega, Abel
2017-05-01
Porcine circovirus type 2 (PCV2) still represents a major problem to the swine industry worldwide, causing high mortality rates in infected animals. Virus-like particles (VLPs) have gained attention for vaccine development, serving both as scaffolds for epitope expression and immune response enhancers. The commercial subunit vaccines against PCV2 consist of VLPs formed by the self-assembly of PCV2 capsid protein (CP) expressed in the baculovirus vector system. In this work, a PCV2 protective epitope was inserted into three different regions of papaya ringspot virus (PRSV) CP, namely, the N- and C-termini and a predicted antigenic region located near the N-terminus. Wild-type and chimeric CPs were modeled in silico, expressed in Escherichia coli, purified, and visualized by transmission electron microscopy. This is the first report that shows the formation of chimeric VLPs using PRSV as epitope-presentation scaffold. Moreover, it was found that PCV2 epitope localization strongly influences VLP length. Also, the estimated yields of the chimeric VLPs at a small-scale level ranged between 65 and 80 mg/L of culture medium. Finally, the three chimeric VLPs induced high levels of immunoglobulin G against the PCV2 epitope in immunized BALB/c mice, suggesting that these chimeric VLPs can be used for swine immunoprophylaxis against PCV2. © 2016 International Union of Biochemistry and Molecular Biology, Inc.
-
Preclinical and clinical development of a YFV 17 D-based chimeric vaccine against West Nile virus.
Dayan, Gustavo H; Pugachev, Konstantin; Bevilacqua, Joan; Lang, Jean; Monath, Thomas P
2013-12-09
Substantial success has been achieved in the development and implementation of West Nile (WN) vaccines for horses; however, no human WN vaccines are approved. This review focuses on the construction, pre-clinical and clinical characterization of ChimeriVax-WN02 for humans, a live chimeric vaccine composed of a yellow fever (YF) 17D virus in which the prM-E envelope protein genes are replaced with the corresponding genes of the WN NY99 virus. Pre-clinical studies demonstrated that ChimeriVax-WN02 was significantly less neurovirulent than YF 17D in mice and rhesus and cynomolgus monkeys. The vaccine elicited neutralizing antibody titers after inoculation in hamsters and monkeys and protected immunized animals from lethal challenge including intracerebral inoculation of high dose of WN NY99 virus. Safety, viremia and immunogenicity of ChimeriVax-WN02 were assessed in one phase I study and in two phase II clinical trials. No safety signals were detected in the three clinical trials with no remarkable differences in incidence of adverse events (AEs) between vaccine and placebo recipients. Viremia was transient and the mean viremia levels were low. The vaccine elicited strong and durable neutralizing antibody and cytotoxic T cell responses. WN epidemiology impedes a classical licensure pathway; therefore, innovative licensure strategies should be explored.
-
siRNA Screen Identifies Trafficking Host Factors that Modulate Alphavirus Infection
Radoshitzky, Sheli R.; Pegoraro, Gianluca; Chī, Xiǎolì; Dǒng, Lián; Chiang, Chih-Yuan; Jozwick, Lucas; Clester, Jeremiah C.; Cooper, Christopher L.; Courier, Duane; Langan, David P.; Underwood, Knashka; Kuehl, Kathleen A.; Sun, Mei G.; Caì, Yíngyún; Yú, Shuǐqìng; Burk, Robin; Zamani, Rouzbeh; Kota, Krishna; Kuhn, Jens H.; Bavari, Sina
2016-01-01
Little is known about the repertoire of cellular factors involved in the replication of pathogenic alphaviruses. To uncover molecular regulators of alphavirus infection, and to identify candidate drug targets, we performed a high-content imaging-based siRNA screen. We revealed an actin-remodeling pathway involving Rac1, PIP5K1- α, and Arp3, as essential for infection by pathogenic alphaviruses. Infection causes cellular actin rearrangements into large bundles of actin filaments termed actin foci. Actin foci are generated late in infection concomitantly with alphavirus envelope (E2) expression and are dependent on the activities of Rac1 and Arp3. E2 associates with actin in alphavirus-infected cells and co-localizes with Rac1–PIP5K1-α along actin filaments in the context of actin foci. Finally, Rac1, Arp3, and actin polymerization inhibitors interfere with E2 trafficking from the trans-Golgi network to the cell surface, suggesting a plausible model in which transport of E2 to the cell surface is mediated via Rac1- and Arp3-dependent actin remodeling. PMID:27031835
-
Tropical arthritogenic alphaviruses.
Mejía, Carla-Ruth; López-Vélez, Rogelio
Tropical alphaviruses have special tropism for bone and joint tissue. Patients can develop chronic rheumatic disorders similar to rheumatoid arthritis and ankylosing spondylitis. The prototype is Chikungunya virus, although other lesser known viruses in our environment such as Sindbis, Ross River, Mayaro, O'nyong nyong and Barmah Forest viruses have the potential to be sped through vectors and cause chronic rheumatic disease. International population movements have increased the numbers of patients diagnosed with these tropical viruses in areas in which they are not endemic. Since they can leave persistent symptoms and affect the quality of life of the patients, it is important that we be aware of them. Changes in ecosystems have favored the expansion of competent mosquitoes, making fears of local transmission in southern Europe a reality. The objective of this review is to provide a clinical approach to the different arthritogenic tropical alphaviruses, especially those in which chronic rheumatic disease is more frequent. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.
-
Long-term follow-up of Japanese encephalitis chimeric virus vaccine: Immune responses in children.
Chokephaibulkit, Kulkanya; Sirivichayakul, Chukiat; Thisyakorn, Usa; Pancharoen, Chitsanu; Boaz, Mark; Bouckenooghe, Alain; Feroldi, Emmanuel
2016-11-04
A single dose of live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) was shown to be immunogenic and well tolerated when given either as a booster to formalin-inactivated Japanese encephalitis (JE)-vaccine (mouse brain-derived vaccine [MBDV])-primed 2-5-year-olds, or as a primary vaccination to JE-vaccine-naïve 12-24-month-old toddlers in Thailand. A 5-year follow-up assessment of immune response persistence over time was conducted. Four additional visits (at 2, 3, 4, and 5years) for immunologic assessments were added to the original 12-month open-label crossover study, in which 100 healthy children aged 2-5years with a history of two-dose primary vaccination with MBDV (according to the Thai Expanded Program for Immunization schedule), and 200 healthy JE-vaccine-naïve 12-24-month-old toddlers, were randomized 1:1 to receive JE-CV, containing ⩾4 log 10 plaque forming units, 1month before or after hepatitis A control vaccine. In MBDV-primed 2-5-year-olds (n=78), the immune response to the JE-CV vaccine persisted up to at least 5years after vaccination with a single dose of JE-CV, with all (n=78) children seroprotected at the year 5 visit (geometric mean titers [GMT]: 2521/dil). There was no decrease of seroprotection rate over time (100% at 6months post-vaccination and 96.8% (90.3-98.9) at 5yearspost-vaccination). In JE-vaccine-naïve toddlers, a protective immune response persisted up to at least 5years in 58.8% (50.9-66.4) after a single-dose administration of JE-CV (GMT 26.71/dil; sensitivity analysis). A single-dose of JE-CV as a booster following MBDV administration provided long-lasting immunity. In JE-vaccine-naïve toddlers, despite relatively high seroprotection rates persisting over time, a subsequent booster dose is recommended following a JE-CV primary vaccination for long-term protection. This study was registered on www.clinicaltrials.gov (NCT00621764). Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Alphavirus entry into host cells.
Vancini, Ricardo; Hernandez, Raquel; Brown, Dennis
2015-01-01
Viruses have evolved to exploit the vast complexity of cellular processes for their success within the host cell. The entry mechanisms of enveloped viruses (viruses with a surrounding outer lipid bilayer membrane) are usually classified as being either endocytotic or fusogenic. Different mechanisms have been proposed for Alphavirus entry and genome delivery. Indirect observations led to a general belief that enveloped viruses can infect cells either by protein-assisted fusion with the plasma membrane in a pH-independent manner or by endocytosis and fusion with the endocytic vacuole in a low-pH environment. The mechanism of Alphavirus penetration has been recently revisited using direct observation of the processes by electron microscopy under conditions of different temperatures and time progression. Under conditions nonpermissive for endocytosis or any vesicular transport, events occur which allow the entry of the virus genome into the cells. When drug inhibitors of cellular functions are used to prevent entry, only ionophores are found to significantly inhibit RNA delivery. Arboviruses are agents of significant human and animal disease; therefore, strategies to control infections are needed and include development of compounds which will block critical steps in the early infection events. It appears that current evidence points to an entry mechanism, in which alphaviruses infect cells by direct penetration of cell plasma membranes through a pore structure formed by virus and, possibly, host proteins. © 2015 Elsevier Inc. All rights reserved.
-
Neurological Sequelae Resulting from Encephalitic Alphavirus Infection
Ronca, Shannon E.; Dineley, Kelly T.; Paessler, Slobodan
2016-01-01
The recent surge in viral clinical cases and associated neurological deficits have reminded us that viral infections can lead to detrimental, long-term effects, termed sequelae, in survivors. Alphaviruses are enveloped, single-stranded positive-sense RNA viruses in the Togaviridae family. Transmission of alphaviruses between and within species occurs mainly via the bite of an infected mosquito bite, giving alphaviruses a place among arboviruses, or arthropod-borne viruses. Alphaviruses are found throughout the world and typically cause arthralgic or encephalitic disease in infected humans. Originally detected in the 1930s, today the major encephalitic viruses include Venezuelan, Western, and Eastern equine encephalitis viruses (VEEV, WEEV, and EEEV, respectively). VEEV, WEEV, and EEEV are endemic to the Americas and are important human pathogens, leading to thousands of human infections each year. Despite awareness of these viruses for nearly 100 years, we possess little mechanistic understanding regarding the complications (sequelae) that emerge after resolution of acute infection. Neurological sequelae are those complications involving damage to the central nervous system that results in cognitive, sensory, or motor deficits that may also manifest as emotional instability and seizures in the most severe cases. This article serves to provide an overview of clinical cases documented in the past century as well as a summary of the reported neurological sequelae due to VEEV, WEEV, and EEEV infection. We conclude with a treatise on the utility of, and practical considerations for animal models applied to the problem of neurological sequelae of viral encephalopathies in order to decipher mechanisms and interventional strategies. PMID:27379085
-
Jose, Joyce; Taylor, Aaron B; Kuhn, Richard J
2017-02-14
Sindbis virus (SINV [genus Alphavirus , family Togaviridae ]) is an enveloped, mosquito-borne virus. Alphaviruses cause cytolytic infections in mammalian cells while establishing noncytopathic, persistent infections in mosquito cells. Mosquito vector adaptation of alphaviruses is a major factor in the transmission of epidemic strains of alphaviruses. Though extensive studies have been performed on infected mammalian cells, the morphological and structural elements of alphavirus replication and assembly remain poorly understood in mosquito cells. Here we used high-resolution live-cell imaging coupled with single-particle tracking and electron microscopy analyses to delineate steps in the alphavirus life cycle in both the mammalian host cell and insect vector cells. Use of dually labeled SINV in conjunction with cellular stains enabled us to simultaneously determine the spatial and temporal differences of alphavirus replication complexes (RCs) in mammalian and insect cells. We found that the nonstructural viral proteins and viral RNA in RCs exhibit distinct spatial organization in mosquito cytopathic vacuoles compared to replication organelles from mammalian cells. We show that SINV exploits filopodial extensions for virus dissemination in both cell types. Additionally, we propose a novel mechanism for replication complex formation around glycoprotein-containing vesicles in mosquito cells that produced internally released particles that were seen budding from the vesicles by live imaging. Finally, by characterizing mosquito cell lines that were persistently infected with fluorescent virus, we show that the replication and assembly machinery are highly modified, and this allows continuous production of alphaviruses at reduced levels. IMPORTANCE Reemerging mosquito-borne alphaviruses cause serious human epidemics worldwide. Several structural and imaging studies have helped to define the life cycle of alphaviruses in mammalian cells, but the mode of virus replication
-
Poot, J; Janssen, L H M; van Kasteren-Westerneng, T J; van der Heijden-Liefkens, K H A; Schijns, V E J C; Heckeroth, A
2009-07-16
Chimerical protein "Q", composed of antigenic ribosomal and histone sequences, in combination with live BCG is a promising canine leishmaniasis vaccine candidate; one of the few vaccine candidates that have been tested successfully in dogs. Unfortunately, live BCG is not an appropriate adjuvant for commercial application due to safety problems in dogs. In order to find a safe adjuvant with similar efficacy to live BCG, muramyl dipeptide, aluminium hydroxide, Matrix C and killed Propionibacterium acnes in combination with either E. coli- or baculovirus-produced recombinant JPCM5_Q protein were tested. Groups of five or seven dogs were vaccinated with six different adjuvant-antigen combinations and challenged with a high dose intravenous injection of Leishmania infantum JPC strain promastigotes. All candidate vaccines proved to be safe, and both humoral and cellular responses to the recombinant proteins were detected at the end of the prime-boost vaccination scheme. However, clinical and parasitological data obtained during the 10 month follow-up period indicated that protection was not induced by either of the six candidate vaccines. Although no direct evidence was obtained, our data suggest that live BCG may have a significant protective effect against challenge with L. infantum in dogs.
-
Chimeric OspA genes, proteins and methods of use thereof
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crowe, Brian A.; Livey, Ian; O'Rourke, Maria
The invention relates to the development of chimeric OspA molecules for use in a new Lyme vaccine. More specifically, the chimeric OspA molecules comprise the proximal portion from one OspA serotype, together with the distal portion from another OspA serotype, while retaining antigenic properties of both of the parent polypeptides. The chimeric OspA molecules are delivered alone or in combination to provide protection against a variety of Borrelia genospecies. The invention also provides methods for administering the chimeric OspA molecules to a subject in the prevention and treatment of Lyme disease or borreliosis.
-
Schuchman, Ryan; Kilianski, Andy; Piper, Amanda; Vancini, Ricardo; Ribeiro, José M C; Sprague, Thomas R; Nasar, Farooq; Boyd, Gabrielle; Hernandez, Raquel; Glaros, Trevor
2018-05-09
Recent advances in mass spectrometry methods and instrumentation now allow for more accurate identification of proteins in low abundance. This technology was applied to Sindbis virus, the prototypical alphavirus to investigate the viral proteome. To determine if host proteins are specifically packaged into alphavirus virions, Sindbis virus (SINV) was grown in multiple host cells representing vertebrate and mosquito hosts and total protein content of purified virions was determined. This analysis identified host factors not previously associated with alphavirus entry, replication, or egress. One host protein, sorting nexin 5 (SNX5), was shown to be critical for the replication of three different alphaviruses, Sindbis, Mayaro and Chikungunya virus. The most significant finding was that in addition to the host proteins, SINV non-structural protein 2 (nsP2) was detected within virions grown in all host cells examined. The protein and RNA-interacting capabilities of nsP2 coupled with its presence in the virion support a role for nsP2 during packaging and/or entry of progeny virus. This function has not been identified for this protein. Taken together, this strategy identified at least one host factor integrally involved in alphavirus replication. Identification of other host proteins provides insight into alphavirus-host interactions during viral replication in both vertebrate and invertebrate hosts. This method of virus proteome analysis may also be useful for the identification of protein candidates for host-based therapeutics. IMPORTANCE Pathogenic Alphaviruses, such as Chikungunya and Mayaro virus, continue to plague public health in developing and developed countries alike. Alphaviruses belong to a group of viruses vectored in nature by hematophagous (blood-feeding) insects and are termed Arboviruses (arthropod-borne viruses). This group of viruses contains many human pathogens such as dengue fever, West Nile and Yellow fever viruses. With few exceptions there are
-
Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil; Kirnbauer, Reinhard
2017-01-01
Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17-36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous HPV
-
Huber, Bettina; Schellenbacher, Christina; Shafti-Keramat, Saeed; Jindra, Christoph; Christensen, Neil
2017-01-01
Common cutaneous human papillomavirus (HPV) types induce skin warts, whereas species beta HPV are implicated, together with UV-radiation, in the development of non-melanoma skin cancer (NMSC) in immunosuppressed patients. Licensed HPV vaccines contain virus-like particles (VLP) self-assembled from L1 major capsid proteins that provide type-restricted protection against mucosal HPV infections causing cervical and other ano-genital and oro-pharyngeal carcinomas and warts (condylomas), but do not target heterologous HPV. Experimental papillomavirus vaccines have been designed based on L2 minor capsid proteins that contain type-common neutralization epitopes, to broaden protection to heterologous mucosal and cutaneous HPV types. Repetitive display of the HPV16 L2 cross-neutralization epitope RG1 (amino acids (aa) 17–36) on the surface of HPV16 L1 VLP has greatly enhanced immunogenicity of the L2 peptide. To more directly target cutaneous HPV, L1 fusion proteins were designed that incorporate the RG1 homolog of beta HPV17, the beta HPV5 L2 peptide aa53-72, or the common cutaneous HPV4 RG1 homolog, inserted into DE surface loops of HPV1, 5, 16 or 18 L1 VLP scaffolds. Baculovirus expressed chimeric proteins self-assembled into VLP and VLP-raised NZW rabbit immune sera were evaluated by ELISA and L1- and L2-based pseudovirion (PsV) neutralizing assays, including 12 novel beta PsV types. Chimeric VLP displaying the HPV17 RG1 epitope, but not the HPV5L2 aa53-72 epitope, induced cross-neutralizing humoral immune responses to beta HPV. In vivo cross-protection was evaluated by passive serum transfer in a murine PsV challenge model. Immune sera to HPV16L1-17RG1 VLP (cross-) protected against beta HPV5/20/24/38/96/16 (but not type 76), while antisera to HPV5L1-17RG1 VLP cross-protected against HPV20/24/96 only, and sera to HPV1L1-4RG1 VLP cross-protected against HPV4 challenge. In conclusion, RG1-based VLP are promising next generation vaccine candidates to target cutaneous
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya
Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A{sup ⁎}02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A{sup ⁎}02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimericmore » SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. - Highlights: • We constructed chimeric SV40-VLPs carrying an influenza virus-derived CTL epitope. • Chimeric SV40-VLPs induce influenza-specific CTLs in mice without adjuvants. • Chimeric SV40-VLPs induce heterosubtypic protection against influenza A viruses. • Chimeric SV40-VLPs induce long-lasting memory CTLs. • Chimeric SV40-VLPs is a promising vaccine platform with self-adjuvant properties.« less
-
Guy, Bruno; Guirakhoo, Farshad; Barban, Veronique; Higgs, Stephen; Monath, Thomas P; Lang, Jean
2010-01-08
Dengue viruses (DENV), West Nile virus (WNV) and Japanese encephalitis virus (JEV) are major global health and growing medical problems. While a live-attenuated vaccine exists since decades against the prototype flavivirus, yellow fever virus (YFV), there is an urgent need for vaccines against dengue or West Nile diseases, and for improved vaccines against Japanese encephalitis. Live-attenuated chimeric viruses were constructed by replacing the genes coding for Premembrane (prM) and Envelope (E) proteins from YFV 17D vaccine strain with those of heterologous flaviviruses (ChimeriVax technology). This technology has been used to produce vaccine candidates for humans, for construction of a horse vaccine for West Nile fever, and as diagnostic reagents for dengue, Japanese encephalitis, West Nile and St. Louis encephalitis infections. This review focuses on human vaccines and their characterization from the early stages of research through to clinical development. Phenotypic and genetic properties and stability were examined, preclinical evaluation through in vitro or animal models, and clinical testing were carried out. Theoretical environmental concerns linked to the live and genetically modified nature of these vaccines have been carefully addressed. Results of the extensive characterizations are in accordance with the immunogenicity and excellent safety profile of the ChimeriVax-based vaccine candidates, and support their development towards large-scale efficacy trials and registration.
-
Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.
Wei, Y; Wang, S; Wang, X
2014-01-01
Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.
-
Mxra8 is a receptor for multiple arthritogenic alphaviruses.
Zhang, Rong; Kim, Arthur S; Fox, Julie M; Nair, Sharmila; Basore, Katherine; Klimstra, William B; Rimkunas, Rebecca; Fong, Rachel H; Lin, Hueylie; Poddar, Subhajit; Crowe, James E; Doranz, Benjamin J; Fremont, Daved H; Diamond, Michael S
2018-05-01
Arthritogenic alphaviruses comprise a group of enveloped RNA viruses that are transmitted to humans by mosquitoes and cause debilitating acute and chronic musculoskeletal disease 1 . The host factors required for alphavirus entry remain poorly characterized 2 . Here we use a genome-wide CRISPR-Cas9-based screen to identify the cell adhesion molecule Mxra8 as an entry mediator for multiple emerging arthritogenic alphaviruses, including chikungunya, Ross River, Mayaro and O'nyong nyong viruses. Gene editing of mouse Mxra8 or human MXRA8 resulted in reduced levels of viral infection of cells and, reciprocally, ectopic expression of these genes resulted in increased infection. Mxra8 bound directly to chikungunya virus particles and enhanced virus attachment and internalization into cells. Consistent with these findings, Mxra8-Fc fusion protein or anti-Mxra8 monoclonal antibodies blocked chikungunya virus infection in multiple cell types, including primary human synovial fibroblasts, osteoblasts, chondrocytes and skeletal muscle cells. Mutagenesis experiments suggest that Mxra8 binds to a surface-exposed region across the A and B domains of chikungunya virus E2 protein, which are a speculated site of attachment. Finally, administration of the Mxra8-Fc protein or anti-Mxra8 blocking antibodies to mice reduced chikungunya and O'nyong nyong virus infection as well as associated foot swelling. Pharmacological targeting of Mxra8 could form a strategy for mitigating infection and disease by multiple arthritogenic alphaviruses.
-
Kawano, Masaaki; Morikawa, Katsuma; Suda, Tatsuya; Ohno, Naohito; Matsushita, Sho; Akatsuka, Toshitaka; Handa, Hiroshi; Matsui, Masanori
2014-01-05
Virus-like particles (VLPs) are a promising vaccine platform due to the safety and efficiency. However, it is still unclear whether polyomavirus-based VLPs are useful for this purpose. Here, we attempted to evaluate the potential of polyomavirus VLPs for the antiviral vaccine using simian virus 40 (SV40). We constructed chimeric SV40-VLPs carrying an HLA-A*02:01-restricted, cytotoxic T lymphocyte (CTL) epitope derived from influenza A virus. HLA-A*02:01-transgenic mice were then immunized with the chimeric SV40-VLPs. The chimeric SV40-VLPs effectively induced influenza-specific CTLs and heterosubtypic protection against influenza A viruses without the need of adjuvants. Because DNase I treatment of the chimeric SV40-VLPs did not disrupt CTL induction, the intrinsic adjuvant property may not result from DNA contaminants in the VLP preparation. In addition, immunization with the chimeric SV40-VLPs generated long-lasting memory CTLs. We here propose that the chimeric SV40-VLPs harboring an epitope may be a promising CTL-based vaccine platform with self-adjuvant properties. © 2013 Elsevier Inc. All rights reserved.
-
Li, Haitao; Li, Zhiyong; Xie, Yinli; Qin, Xiaodong; Qi, Xingcai; Sun, Peng; Bai, Xingwen; Ma, Youji; Zhang, Zhidong
2016-02-01
Foot-and-mouth disease is a highly contagious, acute viral disease of cloven-hoofed animal species causing severe economic losses worldwide. Among the seven serotypes of foot-and-mouth disease virus (FMDV), serotype O is predominant, but its viral capsid is more acid sensitive than other serotypes, making it more difficult to produce empty serotype O VLPs in the low pH insect hemolymph. Therefore, a novel chimeric virus-like particle (VLP)-based candidate vaccine for serotype O FMDV was developed and characterized in the present study. The chimeric VLPs were composed of antigenic VP1 from serotype O and segments of viral capsid proteins from serotype Asia1. These VLPs elicited significantly higher FMDV-specific antibody levels in immunized mice than did the inactivated vaccine. Furthermore, the chimeric VLPs protected guinea pigs from FMDV challenge with an efficacy similar to that of the inactivated vaccine. These results suggest that chimeric VLPs have the potential for use in vaccines against serotype O FMDV infection. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Sherman, Michael B; Weaver, Scott C
2010-10-01
Western equine encephalitis virus (WEEV; Togaviridae, Alphavirus) is an enveloped RNA virus that is typically transmitted to vertebrate hosts by infected mosquitoes. WEEV is an important cause of viral encephalitis in humans and horses in the Americas, and infection results in a range of disease, from mild flu-like illnesses to encephalitis, coma, and death. In addition to spreading via mosquito vectors, human WEEV infections can potentially occur directly via aerosol transmission. Due to its aerosol infectivity and virulence, WEEV is thus classified as a biological safety level 3 (BSL-3) agent. Because of its highly infectious nature and containment requirements, it has not been possible to investigate WEEV's structure or assembly mechanism using standard structural biology techniques. Thus, to image WEEV and other BSL-3 agents, we have constructed a first-of-its-kind BSL-3 cryoelectron microscopy (cryoEM) containment facility. cryoEM images of WEEV were used to determine the first three-dimensional structure of this important human pathogen. The overall organization of WEEV is similar to those of other alphaviruses, consistent with the high sequence similarity among alphavirus structural proteins. Surprisingly, the nucleocapsid of WEEV, a New World virus, is more similar to the Old World alphavirus Sindbis virus than to other New World alphaviruses.
-
Pan, X-X; Zhao, B-X; Teng, Y-M; Xia, W-Y; Wang, J; Li, X-F; Liao, G-Y; Yang, С; Chen, Y-D
2016-01-01
Rotavirus and poliovirus continue to present significant risks and burden of disease to children in developing countries. Developing a combined vaccine may effectively prevent both illnesses and may be advantageous in terms of maximizing compliance and vaccine coverage at the same visit. Recently, we sought to generate a vaccine vector by incorporating multiple epitopes into the rotavirus group antigenic protein, VP6. In the present study, a foreign epitope presenting a system using VP6 as a vector was created with six sites on the outer surface of the vector that could be used for insertion of foreign epitopes, and three VP6-based PV1 epitope chimeric proteins were constructed. The chimeric proteins were confirmed by immunoblot, immunofluorescence assay, and injected into guinea pigs to analyze the epitope-specific humoral response. Results showed that these chimeric proteins reacted with anti-VP6F and -PV1 antibodies, and elicited antibodies against both proteins in guinea pigs. Antibodies against the chimeric proteins carrying PV1 epitopes neutralized rotavirus Wa and PV1 infection in vitro. Our study contributes to a better understanding of the use of VP6-based vectors as multiple-epitope delivery vehicles and the epitopes displayed in this form could be considered for development of epitope-based vaccines against rotavirus and poliovirus.
-
TC83 replicon vectored vaccine provides protection against Junin virus in guinea pigs.
Seregin, Alexey V; Yun, Nadezhda E; Poussard, Allison L; Peng, Bi-Hung; Smith, Jennifer K; Smith, Jeanon N; Salazar, Milagros; Paessler, Slobodan
2010-07-05
Junin virus (JUNV) is the etiological agent of the potentially lethal, reemerging human disease, Argentine hemorrhagic fever (AHF). The mechanism of the disease development is not well understood and no antiviral therapy is available. Candid 1, a live-attenuated vaccine, has been developed by the US Army and is being used in the endemic area to prevent AHF. This vaccine is only approved for use in Argentina. In this study we have used the alphavirus-based approach to engineer a replicon system based on a human (United States Food and Drug Administration Investigational New Drug status) vaccine TC83 that express heterologous viral antigens, such as glycoproteins (GPC) of Junin virus (JUNV). Preclinical studies testing the immunogenicity and efficacy of TC83/GPC were performed in guinea pigs. A single dose of the live-attenuated alphavirus based vaccine expressing only GPC was immunogenic and provided partial protection, while a double dose of the same vaccine provided a complete protection against JUNV. This is the first scientific report to our knowledge that the immune response against GPC alone is sufficient to prevent lethal disease against JUNV in an animal model. Copyright 2010. Published by Elsevier Ltd.
-
Wang, Chong; Zheng, Xuexing; Gai, Weiwei; Wong, Gary; Wang, Hualei; Jin, Hongli; Feng, Na; Zhao, Yongkun; Zhang, Weijiao; Li, Nan; Zhao, Guoxing; Li, Junfu; Yan, Jinghua; Gao, Yuwei; Hu, Guixue; Yang, Songtao; Xia, Xianzhu
2017-04-01
Middle East respiratory syndrome coronavirus (MERS-CoV) has continued spreading since its emergence in 2012 with a mortality rate of 35.6%, and is a potential pandemic threat. Prophylactics and therapies are urgently needed to address this public health problem. We report here the efficacy of a vaccine consisting of chimeric virus-like particles (VLP) expressing the receptor binding domain (RBD) of MERS-CoV. In this study, a fusion of the canine parvovirus (CPV) VP2 structural protein gene with the RBD of MERS-CoV can self-assemble into chimeric, spherical VLP (sVLP). sVLP retained certain parvovirus characteristics, such as the ability to agglutinate pig erythrocytes, and structural morphology similar to CPV virions. Immunization with sVLP induced RBD-specific humoral and cellular immune responses in mice. sVLP-specific antisera from these animals were able to prevent pseudotyped MERS-CoV entry into susceptible cells, with neutralizing antibody titers reaching 1: 320. IFN-γ, IL-4 and IL-2 secreting cells induced by the RBD were detected in the splenocytes of vaccinated mice by ELISpot. Furthermore, mice inoculated with sVLP or an adjuvanted sVLP vaccine elicited T-helper 1 (Th1) and T-helper 2 (Th2) cell-mediated immunity. Our study demonstrates that sVLP displaying the RBD of MERS-CoV are promising prophylactic candidates against MERS-CoV in a potential outbreak situation. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Kim, Nan-Sun; Mbongue, Jacques C.; Nicholas, Dequina A.; Esebanmen, Grace E.; Unternaehrer, Juli J.; Firek, Anthony F.; Langridge, William H. R.
2016-01-01
A chimeric protein vaccine composed of the cholera toxin B subunit fused to proinsulin (CTB-INS) was shown to suppress type 1 diabetes onset in NOD mice and upregulate biosynthesis of the tryptophan catabolic enzyme indoleamine 2, 3-dioxygenase (IDO1) in human dendritic cells (DCs). Here we demonstrate siRNA inhibition of the NF-κB-inducing kinase (NIK) suppresses vaccine-induced IDO1 biosynthesis as well as IKKα phosphorylation. Chromatin immunoprecipitation (ChIP) analysis of CTB-INS inoculated DCs showed that RelB bound to NF-κB consensus sequences in the IDO1 promoter, suggesting vaccine stimulation of the non-canonical NF-κB pathway activates IDO1 expression in vivo. The addition of Tumor Necrosis Factor Associated Factors (TRAF) TRAF 2, 3 and TRAF6 blocking peptides to vaccine inoculated DCs was shown to inhibit IDO1 biosynthesis. This experimental outcome suggests vaccine activation of the TNFR super-family receptor pathway leads to upregulation of IDO1 biosynthesis in CTB-INS inoculated dendritic cells. Together, our experimental data suggest the CTB-INS vaccine uses a TNFR-dependent signaling pathway of the non-canonical NF-κB signaling pathway resulting in suppression of dendritic cell mediated type 1 diabetes autoimmunity. PMID:26881431
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kolokoltsova, Olga A.; Domina, Aaron M.; Kolokoltsov, Andrey A.
2008-07-20
Virus-host interactions essential for alphavirus pathogenesis are poorly understood. To address this shortcoming, we coupled retrovirus insertional mutagenesis and a cell survival selection strategy to generate clonal cell lines broadly resistant to Sindbis virus (SINV) and other alphaviruses. Resistant cells had significantly impaired SINV production relative to wild-type (WT) cells, although virus binding and fusion events were similar in both sets of cells. Analysis of the retroviral integration sites identified the neurofibromin 1 (NF1) gene as disrupted in alphavirus-resistant cell lines. Subsequent analysis indicated that expression of NF1 was significantly reduced in alphavirus-resistant cells. Importantly, independent down-regulation of NF1 expressionmore » in WT HEK 293 cells decreased virus production and increased cell viability during SINV infection, relative to infected WT cells. Additionally, we observed hyperactive RAS signalling in the resistant HEK 293 cells, which was anticipated because NF1 is a negative regulator of RAS. Expression of constitutively active RAS (HRAS-G12V) in a WT HEK 293 cell line resulted in a marked delay in virus production, compared with infected cells transfected with parental plasmid or dominant-negative RAS (HRAS-S17N). This work highlights novel host cell determinants required for alphavirus pathogenesis and suggests that RAS signalling may play an important role in neuronal susceptibility to SINV infection.« less
-
Functional dissection of the alphavirus capsid protease: sequence requirements for activity.
Thomas, Saijo; Rai, Jagdish; John, Lijo; Günther, Stephan; Drosten, Christian; Pützer, Brigitte M; Schaefer, Stephan
2010-11-18
The alphavirus capsid is multifunctional and plays a key role in the viral life cycle. The nucleocapsid domain is released by the self-cleavage activity of the serine protease domain within the capsid. All alphaviruses analyzed to date show this autocatalytic cleavage. Here we have analyzed the sequence requirements for the cleavage activity of Chikungunya virus capsid protease of genus alphavirus. Amongst alphaviruses, the C-terminal amino acid tryptophan (W261) is conserved and found to be important for the cleavage. Mutating tryptophan to alanine (W261A) completely inactivated the protease. Other amino acids near W261 were not having any effect on the activity of this protease. However, serine protease inhibitor AEBSF did not inhibit the activity. Through error-prone PCR we found that isoleucine 227 is important for the effective activity. The loss of activity was analyzed further by molecular modelling and comparison of WT and mutant structures. It was found that lysine introduced at position 227 is spatially very close to the catalytic triad and may disrupt electrostatic interactions in the catalytic site and thus inactivate the enzyme. We are also examining other sequence requirements for this protease activity. We analyzed various amino acid sequence requirements for the activity of ChikV capsid protease and found that amino acids outside the catalytic triads are important for the activity.
-
Molecular Studies of Alphavirus Immunogenicity
1992-12-03
RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian
-
Current status of flavivirus vaccines.
Barrett, A D
2001-12-01
Although there are approximately 68 flaviviruses recognized, vaccines have been developed to control very few human flavivirus diseases. Licensed live attenuated vaccines have been developed for yellow fever (strain 17D) and Japanese encephalitis (strain SA14-14-2) viruses, and inactivated vaccines have been developed for Japanese encephalitis and tick-borne encephalitis viruses. The yellow fever live attenuated 17D vaccine is one of the most efficacious and safe vaccines developed to date and has been used to immunize more than 300 million people. A number of experimental vaccines are being developed, most notably for dengue. Candidate tetravalent live attenuated dengue vaccines are undergoing clinical trials. Other vaccines are being developed using reverse genetics, DNA vaccines, and recombinant immunogens. In addition, the yellow fever 17D vaccine has been used as a backbone to generate chimeric viruses containing the premembrane and envelope protein genes from other flaviviruses. The "Chimerivax" platform has been used to construct chimeric Japanese encephalitis and dengue viruses that are in different phases of development. Similar strategies are being used by other laboratories.
-
Vitti, Antonella; Nuzzaci, Maria; Condelli, Valentina; Piazzolla, Pasquale
2014-01-01
Edible vaccines must survive digestive process and preserve the specific structure of the antigenic peptide to elicit effective immune response. The stability of a protein to digestive process can be predicted by subjecting it to the in vitro assay with simulated gastric fluid (SGF) and simulated intestinal fluid (SIF). Here, we describe the protocol of producing and using chimeric Cucumber mosaic virus (CMV) displaying Hepatitis C virus (HCV) derived peptide (R9) in double copy as an oral vaccine. Its stability after treatment with SGF and SIF and the preservation of the antigenic properties were verified by SDS-PAGE and immuno western blot techniques.
-
Nasveld, Peter E; Marjason, Joanne; Bennett, Sonya; Aaskov, John; Elliott, Suzanne; McCarthy, Karen; Kanesa-Thasan, Niranjan; Feroldi, Emmanuel; Reid, Mark
2010-11-01
A randomized, double-blind, study was conducted to evaluate the safety, tolerability and immunogenicity of a live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) co-administered with live attenuated yellow fever vaccine (YF-17D strain; Stamaril®, Sanofi Pasteur) or administered successively. Participants (n = 108) were randomized to receive: YF followed by JE-CV 30 days later, JE followed by YF 30 days later, or the co-administration of JE and YF followed or preceded by placebo 30 days later or earlier. Placebo was used in a double-dummy fashion to ensure masking. Neutralizing antibody titers against JE-CV, YF-17D and selected wild-type JE strains was determined using a 50% serum-dilution plaque reduction neutralization test. Seroconversion was defined as the appearance of a neutralizing antibody titer above the assay cut-off post-immunization when not present pre-injection at day 0, or a least a four-fold rise in neutralizing antibody titer measured before the pre-injection day 0 and later post vaccination samples. There were no serious adverse events. Most adverse events (AEs) after JE vaccination were mild to moderate in intensity, and similar to those reported following YF vaccination. Seroconversion to JE-CV was 100% and 91% in the JE/YF and YF/JE sequential vaccination groups, respectively, compared with 96% in the co-administration group. All participants seroconverted to YF vaccine and retained neutralizing titers above the assay cut-off at month six. Neutralizing antibodies against JE vaccine were detected in 82-100% of participants at month six. These results suggest that both vaccines may be successfully co-administered simultaneously or 30 days apart.
-
Jin, Dong; Yu, Xin; Chen, Bing; Li, Zhitao; Ding, Jia; Zhao, Xiuyun; Qi, Gaofu
2017-06-01
Development of EGF and VEGF vaccines with high antigenicity for combined immunotherapy of EGF-EGFR signaling-dependent epithelial tumors such as breast cancer. EGF genes from mouse, human and chicken were randomly assembled to chimeric genes by DNA shuffling, then a chimeric EGF was selected out by PCR, SDS-PAGE and immunization for combined immunotherapy of breast cancer with a previously constructed chimeric VEGF vaccine from shuffling. Combined vaccination with chimeric EGF and VEGF from shuffling could induce high titer of antibodies against EGF and VEGF to inhibit tumor growth and angiogenesis, and improve the survival rate of mice with breast cancer. Combined vaccination with EGF and VEGF from shuffling showed better immunotherapy on EGF-EGFR signaling-dependent epithelial tumors such as breast cancer than the single-agent EGF vaccination.
-
DNA-launched live-attenuated vaccines for biodefense applications
Pushko, Peter; Lukashevich, Igor S.; Weaver, Scott C.; Tretyakova, Irina
2016-01-01
Summary A novel vaccine platform uses DNA immunization to launch live-attenuated virus vaccines in vivo. This technology has been applied for vaccine development against positive-strand RNA viruses with global public health impact including alphaviruses and flaviviruses. The DNA-launched vaccine represents the recombinant plasmid that encodes the full-length genomic RNA of live-attenuated virus downstream from a eukaryotic promoter. When administered in vivo, the genomic RNA of live-attenuated virus is transcribed. The RNA initiates limited replication of a genetically defined, live-attenuated vaccine virus in the tissues of the vaccine recipient, thereby inducing a protective immune response. This platform combines the strengths of reverse genetics, DNA immunization and the advantages of live-attenuated vaccines, resulting in a reduced chance of genetic reversions, increased safety, and improved immunization. With this vaccine technology, the field of DNA vaccines is expanded from those that express subunit antigens to include a novel type of DNA vaccines that launch live-attenuated viruses. PMID:27055100
-
Thim, Hanna L.; Villoing, Stéphane; McLoughlin, Marian; Christie, Karen Elina; Grove, Søren; Frost, Petter; Jørgensen, Jorunn B.
2014-01-01
Most commercial vaccines offered to the aquaculture industry include inactivated antigens (Ag) formulated in oil adjuvants. Safety concerns are related to the use of oil adjuvants in multivalent vaccines for fish, since adverse side effects (e.g., adhesions) can appear. Therefore, there is a request for vaccine formulations for which protection will be maintained or improved, while the risk of side effects is reduced. Here, by using an inactivated salmonid alphavirus (SAV) as the test Ag, the combined use of two Toll-like receptor (TLR) ligand adjuvants, CpG oligonucleotides (ODNs) and poly I:C, as well as a genetic adjuvant consisting of a DNA plasmid vector expressing the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) was explored. VHSV-G DNA vaccine was intramuscularly injected in combination with intraperitoneal injection of either SAV Ag alone or combined with the oil adjuvant, Montanide ISA763, or the CpG/polyI:C combo. Adjuvant formulations were evaluated for their ability to boost immune responses and induce protection against SAV in Atlantic salmon, following cohabitation challenge. It was observed that CpG/polyI:C-based formulations generated the highest neutralizing antibody titres (nAbs) before challenge, which endured post challenge. nAb responses for VHSV G-DNA- and oil-adjuvanted formulations were marginal compared to the CpG/poly I:C treatment. Interestingly, heat-inactivated sera showed reduced nAb titres compared to their non-heated counterparts, which suggests a role of complement-mediated neutralization against SAV. Consistently elevated levels of innate antiviral immune genes in the CpG/polyI:C injected groups suggested a role of IFN-mediated responses. Co-delivery of the VHSV-G DNA construct with either CpG/polyI:C or oil-adjuvanted SAV vaccine generated higher CD4 responses in head kidney at 48 h compared to injection of this vector or SAV Ag alone. The results demonstrate that a combination of pattern recognizing receptor (PRR
-
Barban, Veronique; Munoz-Jordan, Jorge L; Santiago, Gilberto A; Mantel, Nathalie; Girerd, Yves; Gulia, Sandrine; Claude, Jean-Baptiste; Lang, Jean
2012-08-01
The objective of the study was to evaluate if the antibodies elicited after immunization with a tetravalent dengue vaccine, based on chimeric yellow fever 17D/dengue viruses, can neutralize a large range of dengue viruses (DENV). A panel of 82 DENVs was developed from viruses collected primarily during the last decade in 30 countries and included the four serotypes and the majority of existing genotypes. Viruses were isolated and minimally amplified before evaluation against a tetravalent polyclonal serum generated during vaccine preclinical evaluation in monkey, a model in which protection efficacy of this vaccine has been previously demonstrated (Guirakhoo et al., 2004). Neutralization was observed across all the DENV serotypes, genotypes, geographical origins and isolation years. These data indicate that antibodies elicited after immunization with this dengue vaccine candidate should widely protect against infection with contemporary DENV lineages circulating in endemic countries. Copyright © 2012 Elsevier Inc. All rights reserved.
-
Liu, Xue-lan; Shan, Wen-jie; Xu, Shan-shan; Zhang, Jin-jing; Xu, Fa-zhi; Xia, Sheng-lin; Dai, Yin
2015-09-01
The heterologous epitope-peptide from different viruses may represent an attractive candidate vaccine. In order to evaluate the role of cell-permeable peptide (PEP-1) and Ii-Key moiety from the invariant chain (Ii) of MHC on the heterologous peptide chimeras, we linked the two vehicles to hybrid epitopes on the VP2 protein (aa197-209) of the infectious bursal disease virus and HN protein (aa345-353) of the Newcastle disease virus. The chimeric vaccines were prepared and injected into mice. The immune effects were measured by indirect ELISA. The results showed that the vehicle(s) could significantly boost immune effects against the heterologous epitope peptide. The Ii-Key-only carrier induced more effective immunological responses, compared with the PEP-1 and Ii-Key hybrid vehicle. The carrier-peptide hybrids all showed strong colocalization with major histocompatibility complex (MHC) class II molecules compared with the epitope-peptide (weakly-binding) after co-transfection into 293T cells. Together, our results lay the groundwork for designing new hybrid vaccines based on Ii-Key and/or PEP-1 peptides. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
-
Residue-level resolution of alphavirus envelope protein interactions in pH-dependent fusion.
Zeng, Xiancheng; Mukhopadhyay, Suchetana; Brooks, Charles L
2015-02-17
Alphavirus envelope proteins, organized as trimers of E2-E1 heterodimers on the surface of the pathogenic alphavirus, mediate the low pH-triggered fusion of viral and endosomal membranes in human cells. The lack of specific treatment for alphaviral infections motivates our exploration of potential antiviral approaches by inhibiting one or more fusion steps in the common endocytic viral entry pathway. In this work, we performed constant pH molecular dynamics based on an atomic model of the alphavirus envelope with icosahedral symmetry. We have identified pH-sensitive residues that cause the largest shifts in thermodynamic driving forces under neutral and acidic pH conditions for various fusion steps. A series of conserved interdomain His residues is identified to be responsible for the pH-dependent conformational changes in the fusion process, and ligand binding sites in their vicinity are anticipated to be potential drug targets aimed at inhibiting viral infections.
-
Vaccines and immunization strategies for dengue prevention
Liu, Yang; Liu, Jianying; Cheng, Gong
2016-01-01
Dengue is currently the most significant arboviral disease afflicting tropical and sub-tropical countries worldwide. Dengue vaccines, such as the multivalent attenuated, chimeric, DNA and inactivated vaccines, have been developed to prevent dengue infection in humans, and they function predominantly by stimulating immune responses against the dengue virus (DENV) envelope (E) and nonstructural-1 proteins (NS1). Of these vaccines, a live attenuated chimeric tetravalent DENV vaccine developed by Sanofi Pasteur has been licensed in several countries. However, this vaccine renders only partial protection against the DENV2 infection and is associated with an unexplained increased incidence of hospitalization for severe dengue disease among children younger than nine years old. In addition to the virus-based vaccines, several mosquito-based dengue immunization strategies have been developed to interrupt the vector competence and effectively reduce the number of infected mosquito vectors, thus controlling the transmission of DENV in nature. Here we summarize the recent progress in the development of dengue vaccines and novel immunization strategies and propose some prospective vaccine strategies for disease prevention in the future. PMID:27436365
-
Chikungunya Virus Vaccines: Viral Vector-Based Approaches.
Ramsauer, Katrin; Tangy, Frédéric
2016-12-15
In 2013, a major chikungunya virus (CHIKV) epidemic reached the Americas. In the past 2 years, >1.7 million people have been infected. In light of the current epidemic, with millions of people in North and South America at risk, efforts to rapidly develop effective vaccines have increased. Here, we focus on CHIKV vaccines that use viral-vector technologies. This group of vaccine candidates shares an ability to potently induce humoral and cellular immune responses by use of highly attenuated and safe vaccine backbones. So far, well-described vectors such as modified vaccinia virus Ankara, complex adenovirus, vesicular stomatitis virus, alphavirus-based chimeras, and measles vaccine Schwarz strain (MV/Schw) have been described as potential vaccines. We summarize here the recent data on these experimental vaccines, with a focus on the preclinical and clinical activities on the MV/Schw-based candidate, which is the first CHIKV-vectored vaccine that has completed a clinical trial. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
-
Travassos da Rosa, A P; Turell, M J; Watts, D M; Powers, A M; Vasconcelos, P F; Jones, J W; Klein, T A; Dohm, D J; Shope, R E; Degallier, N; Popov, V L; Russell, K L; Weaver, S C; Guzman, H; Calampa, C; Brault, A C; Lemon, A P; Tesh, R B
2001-01-01
This report describes Trocara virus, a newly recognized member of the genus Alphavirus, that has been isolated from Aedes serratus mosquitoes collected at two widely separated sites in the Amazon Basin. Biological, antigenic and genetic characteristics of the new virus are given. Results of these studies indicate that Trocara virus is the first member of a newly discovered antigenic complex within the family Togaviridae genus Alphavirus. The public health and veterinary importance of Trocara virus is still unknown.
-
Suárez, Marisela; Sordo, Yusmel; Prieto, Yanet; Rodríguez, María P; Méndez, Lídice; Rodríguez, Elsa M; Rodríguez-Mallon, Alina; Lorenzo, Elianet; Santana, Elaine; González, Nemecio; Naranjo, Paula; Frías, María Teresa; Carpio, Yamila; Estrada, Mario Pablo
2017-08-03
Classical swine fever is an economically important, highly contagious disease of swine worldwide. Subunit vaccines are a suitable alternative for the control of classical swine fever. However, such vaccines have as the main drawback the relatively long period of time required to induce a protective response, which hampers their use under outbreak conditions. In this work, a lentivirus-based gene delivery system is used to obtain a stable recombinant HEK 293 cell line for the expression of E2-CSFV antigen fused to porcine CD154 as immunostimulant molecule. The E2-CD154 chimeric protein was secreted into the medium by HEK293 cells in a concentration around 50mg/L in suspension culture conditions using spinner bottles. The E2-CD154 immunized animals were able to overcome the challenge with a high virulent CSF virus strain performed 7days after a unique dose of the vaccine without clinical manifestations of the disease. Specific anti-CSFV neutralizing antibodies and IFN-γ were induced 8days after challenge equivalent to 14days post-vaccination. The present work constitutes the first report of a subunit vaccine able to confer complete protection by the end of the first week after a single vaccination. These results suggest that the E2-CD154 antigen could be potentially used under outbreak conditions to stop CSFV spread and for eradication programs in CSF enzootic areas. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mourez, Thomas; APHP, GH Saint-Louis-Lariboisiere, Laboratoire de Bacteriologie-Virologie, F-75010 Paris; Universite Paris 7 Denis Diderot, F-75010 Paris
2011-10-25
We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimericmore » particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Voss, Kelsey; Amaya, Moushimi; Mueller, Claudius
New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated inmore » Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses. - Highlights: • VEEV infection activated multiple components of the ERK signaling cascade. • Inhibition of ERK activation using Ag-126 inhibited VEEV multiplication. • Activation of ERK by Ceramide C6 increased infectious titers of TC-83. • Ag-126 inhibited virulent strains of all New World alphaviruses. • Ag-126 treatment increased percent survival of infected cells.« less
-
Zhang, Di; Tözsér, József; Waugh, David S.
2009-01-01
Alphaviruses cause serious diseases that pose a potential health threat to both humans and livestock. The nonstructural protein 2 (nsp2) encoded by alphaviruses is a multifunctional enzyme that is essential for viral replication and maturation. Its 39-kDa C-terminal domain (nsp2pro) is a cysteine protease that is responsible for cleaving a viral polyprotein at three sites to generate nonstructural proteins 1, 2, 3 and 4. In the present study, we evaluated nsp2pro domains from the following three sources as reagents for site-specific cleavage of fusion proteins: Venezuelan Equine Encephalitis Virus (VEEV), Semliki Forest Virus (SFV) and Sindbis Virus (SIN). All three alphavirus proteases cleaved model fusion protein substrates with high specificity but they were much less efficient enzymes than potyviral proteases from tobacco etch virus (TEV) and tobacco vein mottling virus (TVMV). Oligopeptide substrates were also cleaved with very low efficiency by the alphavirus proteases. We conclude that, in general, alphavirus nsp2pro proteases are not very useful tools for the removal of affinity tags from recombinant proteins although they do remain promising therapeutic targets for the treatment of a variety of diseases. PMID:19013248
-
Shabani, Samaneh H; Zakeri, Sedigheh; Salmanian, Ali H; Amani, Jafar; Mehrizi, Akram A; Snounou, Georges; Nosten, François; Andolina, Chiara; Mourtazavi, Yousef; Djadid, Navid D
2017-10-01
The circumsporozoite protein (CSP) of the malaria parasite Plasmodium vivax is a major pre-erythrocyte vaccine candidate. The protein has a central repeat region that belongs to one of repeat families (VK210, VK247, and the P. vivax-like). In the present study, computer modelling was employed to select chimeric proteins, comprising the conserved regions and different arrangements of the repeat elements (VK210 and VK247), whose structure is similar to that of the native counterparts. DNA encoding the selected chimeras (named CS127 and CS712) were synthetically constructed based on E. coli codons, then cloned and expressed. Mouse monoclonal antibodies (mAbs; anti-Pv-210-CDC and -Pv-247-CDC), recognized the chimeric antigens in ELISA, indicating correct conformation and accessibility of the B-cell epitopes. ELISA using IgG from plasma samples collected from 221 Iranian patients with acute P. vivax showed that only 49.32% of the samples reacted to both CS127 and CS712 proteins. The dominant subclass for the two chimeras was IgG1 (48% of the positive responders, OD 492 =0.777±0.420 for CS127; 48.41% of the positive responders, OD 492 =0.862±0.423 for CS712, with no statistically significant difference P>0.05; Wilcoxon signed ranks test). Binding assays showed that both chimeric proteins bound to immobilized heparan sulphate and HepG2 hepatocyte cells in a concentration-dependent manner, saturable at 80μg/mL. Additionally, anti-CS127 and -CS712 antibodies raised in mice recognized the native protein on the surface of P. vivax sporozoite with high intensity, confirming the presence of common epitopes between the recombinant forms and the native proteins. In summary, despite structural differences at the molecular level, the expression levels of both chimeras were satisfactory, and their conformational structure retained biological function, thus supporting their potential for use in the development of vivax-based vaccine. Copyright © 2017 Elsevier Ltd. All rights
-
Chimeric Rhinoviruses Displaying MPER Epitopes Elicit Anti-HIV Neutralizing Responses
Yi, Guohua; Lapelosa, Mauro; Bradley, Rachel; Mariano, Thomas M.; Dietz, Denise Elsasser; Hughes, Scott; Wrin, Terri; Petropoulos, Chris; Gallicchio, Emilio; Levy, Ronald M.; Arnold, Eddy; Arnold, Gail Ferstandig
2013-01-01
Background The development of an effective AIDS vaccine has been a formidable task, but remains a critical necessity. The well conserved membrane-proximal external region (MPER) of the HIV-1 gp41 glycoprotein is one of the crucial targets for AIDS vaccine development, as it has the necessary attribute of being able to elicit antibodies capable of neutralizing diverse isolates of HIV. Methodology/Principle Findings Guided by X-ray crystallography, molecular modeling, combinatorial chemistry, and powerful selection techniques, we designed and produced six combinatorial libraries of chimeric human rhinoviruses (HRV) displaying the MPER epitopes corresponding to mAbs 2F5, 4E10, and/or Z13e1, connected to an immunogenic surface loop of HRV via linkers of varying lengths and sequences. Not all libraries led to viable chimeric viruses with the desired sequences, but the combinatorial approach allowed us to examine large numbers of MPER-displaying chimeras. Among the chimeras were five that elicited antibodies capable of significantly neutralizing HIV-1 pseudoviruses from at least three subtypes, in one case leading to neutralization of 10 pseudoviruses from all six subtypes tested. Conclusions Optimization of these chimeras or closely related chimeras could conceivably lead to useful components of an effective AIDS vaccine. While the MPER of HIV may not be immunodominant in natural infection by HIV-1, its presence in a vaccine cocktail could provide critical breadth of protection. PMID:24039745
-
Wang, Danher; Suhrbier, Andreas; Penn-Nicholson, Adam; Woraratanadharm, Jan; Gardner, Joy; Luo, Min; Le, Thuy T.; Anraku, Itaru; Sakalian, Michael; Einfeld, David; Dong, John Y.
2011-01-01
Chikungunya virus, a mosquito-borne alphavirus, recently caused the largest epidemic ever seen for this virus. Chikungunya disease primarily manifests as a painful and debilitating arthralgia/arthritis, and no effective drug or vaccine is currently available. Here we describe a recombinant chikungunya virus vaccine comprising a non-replicating complex adenovirus vector encoding the structural polyprotein cassette of chikungunya virus. A single immunisation with this vaccine consistently induced high titres of anti-chikungunya virus antibodies that neutralised both an old Asian isolate and a Réunion Island isolate from the recent epidemic. The vaccine also completely protected mice against viraemia and arthritic disease caused by both virus isolates. PMID:21320541
-
Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.; Dziuba, Natallia; Zacks, Michele A.; Grund, Anna H.; Frolov, Ilya; Campbell, Gerald A.; Weaver, Scott C.; Estes, D. Mark
2007-01-01
We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta (αβ) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ( γδ) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chain and a minority of vaccinated immunoglobulin heavy chain-deficient (μMT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3+ T cells are required for protection. PMID:17610927
-
Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan
2018-01-01
Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526
-
Fassbinder-Orth, Carol A; Killpack, Tess L; Goto, Dylan S; Rainwater, Ellecia L; Shearn-Bochsler, Valerie I
2018-01-01
Increasingly, ecoimmunology studies aim to use relevant pathogen exposure to examine the impacts of infection on physiological processes in wild animals. Alphaviruses are arthropod-borne, single-stranded RNA (ssRNA) viruses ("arboviruses") responsible for millions of cases of human illnesses each year. Buggy Creek virus (BCRV) is a unique alphavirus that is transmitted by a cimicid insect, the swallow bug, and is amplified in two avian species: the house sparrow (Passer domesticus) and the cliff swallow (Petrochelidon pyrrhonota). BCRV, like many alphaviruses, exhibits age-dependent susceptibility where the young are most susceptible to developing disease and exhibit a high mortality rate. However, alphavirus disease etiology in nestling birds is unknown. In this study, we infected nestling house sparrows with Buggy Creek virus and measured virological, pathological, growth, and digestive parameters following infection. Buggy Creek virus caused severe encephalitis in all infected nestlings, and the peak viral concentration in brain tissue was over 34 times greater than any other tissue. Growth, tissue development, and digestive function were all significantly impaired during BCRV infection. However, based on histopathological analysis performed, this impairment does not appear to be the result of direct tissue damage by the virus, but likely caused by encephalitis and neuronal invasion and impairment of the central nervous system. This is the first study to examine the course of alphavirus diseases in nestling birds and these results will improve our understanding of age-dependent infections of alphaviruses in vertebrate hosts.
-
Fassbinder-Orth, Carol A.; Killpack, Tess L.; Goto, Dylan S.; Rainwater, Ellecia L.; Shearn-Bochsler, Valerie I.
2018-01-01
Increasingly, ecoimmunology studies aim to use relevant pathogen exposure to examine the impacts of infection on physiological processes in wild animals. Alphaviruses are arthropod-borne, single-stranded RNA (ssRNA) viruses (“arboviruses”) responsible for millions of cases of human illnesses each year. Buggy Creek virus (BCRV) is a unique alphavirus that is transmitted by a cimicid insect, the swallow bug, and is amplified in two avian species: the house sparrow (Passer domesticus) and the cliff swallow (Petrochelidon pyrrhonota). BCRV, like many alphaviruses, exhibits age-dependent susceptibility where the young are most susceptible to developing disease and exhibit a high mortality rate. However, alphavirus disease etiology in nestling birds is unknown. In this study, we infected nestling house sparrows with Buggy Creek virus and measured virological, pathological, growth, and digestive parameters following infection. Buggy Creek virus caused severe encephalitis in all infected nestlings, and the peak viral concentration in brain tissue was over 34 times greater than any other tissue. Growth, tissue development, and digestive function were all significantly impaired during BCRV infection. However, based on histopathological analysis performed, this impairment does not appear to be the result of direct tissue damage by the virus, but likely caused by encephalitis and neuronal invasion and impairment of the central nervous system. This is the first study to examine the course of alphavirus diseases in nestling birds and these results will improve our understanding of age-dependent infections of alphaviruses in vertebrate hosts.
-
The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang Fanglin; Wu Xingan; Luo Wen
2007-03-23
Hemorrhagic fever with renal syndrome (HFRS), which is characterized by severe symptoms and high mortality, is caused by hantavirus. There are still no effective prophylactic vaccines directed to HFRS until now. In this research, we fused expressed G2 fragment of M segment and 0.7 kb fragment of S segment. We expect it could be a candidate vaccine. Chimeric gene G2S0.7 was first expressed in prokaryotic expression system pGEX-4T. After inducing expressed fusion proteins, GST-G2S0.7 was induced and its molecular weight was about 100 kDa. Meanwhile, the fusion protein kept the activity of its parental proteins. Further, BALB/c mice were vaccinatedmore » by the chimeric gene. ELISA, cell microculture neutralization test in vitro were used to detect the humoral immune response in immunized BALB/c mice. Lymphocyte proliferation assay was used to detect the cellular immune response. The results showed that the chimeric gene could simultaneously evoke specific antibody against nucleocapsid protein (NP) and glycoprotein (GP). And the immunized mice of every group elicited neutralizing antibodies with different titers. But the titers were low. Lymphocyte proliferation assay results showed that the stimulation indexes of splenocytes of chimeric gene to NP and GP were significantly higher than that of control. It suggested that the chimeric gene of Hantaan virus containing G2 fragment of M segment and 0.7 kb fragment of S segment could directly elicit specific anti-Hantaan virus humoral and cellular immune response in BALB/c mice.« less
-
Smith, Jessica L.; Pugh, Christine L.; Cisney, Emily D.; Keasey, Sarah L.; Guevara, Carolina; Ampuero, Julia S.; Comach, Guillermo; Gomez, Doris; Ochoa-Diaz, Margarita; Hontz, Robert D.
2018-01-01
ABSTRACT Mayaro virus (MAYV), Venezuelan equine encephalitis virus (VEEV), and chikungunya virus (CHIKV) are vector-borne alphaviruses that cocirculate in South America. Human infections by these viruses are frequently underdiagnosed or misdiagnosed, especially in areas with high dengue virus endemicity. Disease may progress to debilitating arthralgia (MAYV, CHIKV), encephalitis (VEEV), and death. Few standardized serological assays exist for specific human alphavirus infection detection, and antigen cross-reactivity can be problematic. Therefore, serological platforms that aid in the specific detection of multiple alphavirus infections will greatly expand disease surveillance for these emerging infections. In this study, serum samples from South American patients with PCR- and/or isolation-confirmed infections caused by MAYV, VEEV, and CHIKV were examined by using a protein microarray assembled with recombinant capsid, envelope protein 1 (E1), and E2 from nine New and Old World alphaviruses. Notably, specific antibody recognition of E1 was observed only with MAYV infections, whereas E2 was specifically targeted by antibodies from all of the alphavirus infections investigated, with evidence of cross-reactivity to E2 of o’nyong-nyong virus only in CHIKV-infected patient serum samples. Our findings suggest that alphavirus structural protein microarrays can distinguish infections caused by MAYV, VEEV, and CHIKV and that this multiplexed serological platform could be useful for high-throughput disease surveillance. IMPORTANCE Mayaro, chikungunya, and Venezuelan equine encephalitis viruses are closely related alphaviruses that are spread by mosquitos, causing diseases that produce similar influenza-like symptoms or more severe illnesses. Moreover, alphavirus infection symptoms can be similar to those of dengue or Zika disease, leading to underreporting of cases and potential misdiagnoses. New methods that can be used to detect antibody responses to multiple
-
Yang, Lisheng; Liu, Yajing; Li, Shuxuan; Zhao, Huan; Lin, Qiaona; Yu, Hai; Huang, Xiumin; Zheng, Qingbing; Cheng, Tong; Xia, Ningshao
2016-11-21
Hand, foot, and mouth disease (HFMD) is a highly contagious disease that mainly affects infants and children. Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the major pathogens of HFMD. Two EV71 vaccines were recently licensed in China and the administration of the EV71 vaccines is believed to significantly reduce the number of HFMD-related severe or fatal cases. However, a monovalent EV71 vaccine cannot cross-protect against CA16 infection, this may result in that it cannot effectively control the overall HFMD epidemic. In this study, a chimeric EV71, whose VP1/210-225 epitope was replaced by that of CA16, was constructed using a reverse genetics technique to produce a candidate EV71/CA16 bivalent vaccine strain. The chimeric EV71 was infectious and showed similar growth characteristics as its parental strain. The replacement of the VP1/210-225 epitope did not significantly affect the antigenicity and immunogenicity of EV71. More importantly, the chimeric EV71 could induce protective immunity against both EV71 and CA16, and protect neonatal mice against either EV71 or CA16 lethal infections, the chimeric EV71 constructed in this study was shown to be a feasible and promising candidate bivalent vaccine against both EV71 and CA16. The construction of a chimeric enterovirus also provides an alternative platform for broad-spectrum HFMD vaccines development. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
Kim, Dong Soo; Houillon, Guy; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Lee, Jin; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Kim, Hee Soo; Bang, Joon; Naimi, Zulaikha; Bosch-Castells, Valérie; Boaz, Mark; Bouckenooghe, Alain
2014-01-01
A new live attenuated Japanese encephalitis chimeric virus vaccine (JE-CV) has been developed based on innovative technology to give protection against JE with an improved immunogenicity and safety profile. In this phase 3, observer-blind study, 274 children aged 12-24 months were randomized 1:1 to receive one dose of JE-CV (Group JE-CV) or the SA14-14-2 vaccine currently used to vaccinate against JE in the Republic of Korea (Group SA14-14-2). JE neutralizing antibody titers were assessed using PRNT50 before and 28 days after vaccination. The primary endpoint of non-inferiority of seroconversion rates on D28 was demonstrated in the Per Protocol analysis set as the difference between Group JE-CV and Group SA14-14-2 was 0.9 percentage points (95% confidence interval [CI]: -2.35; 4.68), which was above the required -10%. Seroconversion and seroprotection rates 28 days after administration of a single vaccine dose were 100% in Group JE-CV and 99.1% in Group SA14-14-2; all children except one (Group SA14-14-2) were seroprotected. Geometric mean titers (GMTs) increased in both groups from D0 to D28; GM of titer ratios were slightly higher in Group JE-CV (182 [95% CI: 131; 251]) than Group SA14-14-2 (116 [95% CI: 85.5, 157]). A single dose of JE-CV was well tolerated and no safety concerns were identified. In conclusion, a single dose of JE-CV or SA14-14-2 vaccine elicited a comparable immune response with a good safety profile. Results obtained in healthy Korean children aged 12-24 months vaccinated with JE-CV are consistent with those obtained in previous studies conducted with JE-CV in toddlers.
-
Interferons and Alphavirus Pathogenesis: Implications for Developing Medical Countermeasures
2005-12-01
respiratory tract with Venezuelan equine encephalomyelitis virus in normal and operated Macaca rhesus monkeys. II. Results of histological examination... respiratory tract with Venezuelan equine encephalomyelitis virus in normal and operated Macaca rhesus monkeys. I. Results of virological examination. Acta...alphavirus family: Venezuelan equine encephalitis virus (VEEV), eastern equine encephalitis virus (EEEV), and western equine encephalitis virus (WEEV). I
-
Maximova, Olga A.; Speicher, James M.; Skinner, Jeff R.; Murphy, Brian R.; St Claire, Marisa C.; Ragland, Danny R.; Herbert, Richard L.; Pare, Dan R.; Moore, Rashida M.; Pletnev, Alexander G.
2014-01-01
The upsurge of West Nile virus (WNV) human infections in 2012 suggests that the US can expect periodic WNV outbreaks in the future. Availability of safe and effective vaccines against WNV in endemic areas, particularly for aging populations that are at high risk of West Nile neuroinvasive disease (WNND), could be beneficial. WN/DEN4Δ30 is a live, attenuated chimeric vaccine against WNV produced by replacement of the genes encoding the pre-membrane and envelope protein genes of the vaccine virus against dengue virus type 4 (DEN4Δ30) with corresponding sequences derived from a wild type WNV. Following intrathalamic inoculation of nonhuman primates (NHPs), a comprehensive neuropathogenesis study was performed and neurovirulence of WN/DEN4Δ30 vaccine candidate was compared to that of two parental viruses (i.e., WNV and DEN4Δ30), as well as to that of an attenuated flavivirus surrogate reference (i.e., yellow fever YF 17D). Clinical and virological data, as well as results of a semi-quantitative histopathological analysis, demonstrated that WN/DEN4Δ30 vaccine is highly attenuated for the central nervous system (CNS) of NHPs in comparison to a wild type WNV. Importantly, based on the virus replicative ability in the CNS of NHPs and the degree of induced histopathological changes, the level of neuroattenuation of WN/DEN4Δ30 vaccine was similar to that of YF 17D, and therefore within an acceptable range. In addition, we show that the DEN4Δ30 vaccine tested in this study also has a low neurovirulence profile. In summary, our results demonstrate a high level of neuroattenuation of two vaccine candidates, WN/DEN4Δ30 and DEN4Δ30. We also show here a remarkable sensitivity of our WNV-NY99 NHP model, as well as striking resemblance of the observed neuropathology to that seen in human WNND. These results support the use of this NHP model for translational studies of WNV neuropathogenesis and/or testing the effectiveness of vaccines and therapeutic approaches. PMID
-
Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain
2013-01-01
Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36–42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing. PMID:23442823
-
Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain
2013-04-01
Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36-42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing.
-
Kosalaraksa, Pope; Watanaveeradej, Veerachai; Pancharoen, Chitsanu; Capeding, Maria Rosario; Feroldi, Emmanuel; Bouckenooghe, Alain
2017-04-01
Japanese encephalitis (JE) is an important mosquito-borne viral disease that is endemic in Asia, Western Pacific countries and Northern Australia. Although there is no antiviral treatment, vaccination is effective in preventing this disease. We followed a cohort of 596 children for 5 years after primary vaccination at 12-18 months of age with JE chimeric virus vaccine (JE-CV; IMOJEV) in a multicenter, phase III trial in Thailand and the Philippines to assess antibody persistence and safety. At the end of the 5 years, a subgroup of 85 participants, at 1 site in Thailand, was followed after administration of a JE-CV booster vaccination. JE antibody titers were measured annually after primary vaccination and 28 days after booster vaccination using a 50% plaque reduction neutralization test. Seroprotection was defined as a JE-CV neutralizing antibody titer ≥10 (1/dil). Kaplan-Meier survival analysis was used to estimate the proportion of participants maintaining protective JE-CV neutralizing antibody titers. At 1, 2, 3, 4 and 5 years after vaccination with JE-CV, 88.5%, 82.9%, 78.2%, 74.0% and 68.6% of the participants followed remained seroprotected. Geometric mean titers in the subgroup assessed after receipt of a booster dose increased from 61.2 (95% confidence interval: 43.8-85.7) pre-booster to 4951 (95% confidence interval: 3928-6241) 28 days post-booster, with all participants seroprotected. There were no safety concerns identified. Protective immune responses persisted for at least 5 years after a JE-CV primary immunization in the majority of participants. JE-CV booster induced a robust immune response even after a 5-year interval.
-
Tian, Jing-Hui; Glenn, Gregory; Flyer, David; Zhou, Bin; Liu, Ye; Sullivan, Eddie; Wu, Hua; Cummings, James F; Elllingsworth, Larry; Smith, Gale
2017-07-24
challenged with historical or epidemic strains of C. difficile. The use of chimeric fusion proteins is an attractive approach to producing multivalent antitoxin vaccines and therapeutic polyclonal antibodies for prevention and treatment of C. difficile infections (CDI). Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
-
Engineering Foot-and-Mouth Disease Viruses with Improved Growth Properties for Vaccine Development
Zheng, Haixue; Guo, Jianhong; Jin, Ye; Yang, Fan; He, Jijun; Lv, Lv; Zhang, Kesan; Wu, Qiong; Liu, Xiangtao; Cai, Xuepeng
2013-01-01
Background No licensed vaccine is currently available against serotype A foot-and-mouth disease (FMD) in China, despite the isolation of A/WH/CHA/09 in 2009, partly because this strain does not replicate well in baby hamster kidney (BHK) cells. Methodology/Principal Findings A novel plasmid-based reverse genetics system was used to construct a chimeric strain by replacing the P1 gene in the vaccine strain O/CHA/99 with that from the epidemic stain A/WH/CHA/09. The chimeric virus displayed growth kinetics similar to those of O/CHA/99 and was selected for use as a candidate vaccine strain after 12 passages in BHK cells. Cattle were vaccinated with the inactivated vaccine and humoral immune responses were induced in most of the animals on day 7. A challenge infection with A/WH/CHA/09 on day 28 indicated that the group given a 4-µg dose was fully protected and neither developed viremia nor seroconverted to a 3ABC antigen. Conclusions/Significance Our data demonstrate that the chimeric virus not only propagates well in BHK cells and has excellent antigenic matching against serotype A FMD, but is also a potential marker vaccine to distinguish infection from vaccination. These results suggest that reverse genetics technology is a useful tool for engineering vaccines for the prevention and control of FMD. PMID:23372840
-
Working towards dengue as a vaccine-preventable disease: challenges and opportunities.
Shrivastava, Ambuj; Tripathi, Nagesh K; Dash, Paban K; Parida, Manmohan
2017-10-01
Dengue is an emerging viral disease that affects the human population around the globe. Recent advancements in dengue virus research have opened new avenues for the development of vaccines against dengue. The development of a vaccine against dengue is a challenging task because any of the four serotypes of dengue viruses can cause disease. The development of a dengue vaccine aims to provide balanced protection against all the serotypes. Several dengue vaccine candidates are in the developmental stages such as inactivated, live attenuated, recombinant subunit, and plasmid DNA vaccines. Area covered: The authors provide an overview of the progress made in the development of much needed dengue vaccines. The authors include their expert opinion and their perspectives for future developments. Expert opinion: Human trials of a live attenuated tetravalent chimeric vaccine have clearly demonstrated its potential as a dengue vaccine. Other vaccine candidate molecules such as DENVax, a recombinant chimeric vaccine andTetraVax, are at different stages of development at this time. The authors believe that the novel strategies for testing and improving the immune response of vaccine candidates in humans will eventually lead to the development of a successful dengue vaccine in future.
-
Sousa, Ivanildo P; Carvalho, Carlos A M; Ferreira, Davis F; Weissmüller, Gilberto; Rocha, Gustavo M; Silva, Jerson L; Gomes, Andre M O
2011-01-21
Alphaviruses are enveloped arboviruses. The viral envelope is derived from the host cell and is positioned between two icosahedral protein shells (T = 4). Because the viral envelope contains glycoproteins involved in cell recognition and entry, the integrity of the envelope is critical for the success of the early events of infection. Differing levels of cholesterol in different hosts leads to the production of alphaviruses with distinct levels of this sterol loaded in the envelope. Using Mayaro virus, a New World alphavirus, we investigated the role of cholesterol on the envelope of alphavirus particles assembled in either mammalian or mosquito cells. Our results show that although quite different in their cholesterol content, Mayaro virus particles obtained from both cells share a similar high level of lateral organization in their envelopes. This organization, as well as viral stability and infectivity, is severely compromised when cholesterol is depleted from the envelope of virus particles isolated from mammalian cells, but virus particles isolated from mosquito cells are relatively unaffected by cholesterol depletion. We suggest that it is not cholesterol itself, but rather the organization of the viral envelope, that is critical for the biological activity of alphaviruses.
-
Muthamilselvan, Thangarasu; Lee, Chin-Wei; Cho, Yu-Hsin; Wu, Feng-Chao; Hu, Chung-Chi; Liang, Yu-Chuan; Lin, Na-Sheng; Hsu, Yau-Heiu
2016-01-01
We describe a novel strategy to produce vaccine antigens using a plant cell-suspension culture system in lieu of the conventional bacterial or animal cell-culture systems. We generated transgenic cell-suspension cultures from Nicotiana benthamiana leaves carrying wild-type or chimeric Bamboo mosaic virus (BaMV) expression constructs encoding the viral protein 1 (VP1) epitope of foot-and-mouth disease virus (FMDV). Antigens accumulated to high levels in BdT38 and BdT19 transgenic cell lines co-expressing silencing suppressor protein P38 or P19. BaMV chimeric virus particles (CVPs) were subsequently purified from the respective cell lines (1.5 and 2.1 mg CVPs/20 g fresh weight of suspended biomass, respectively), and the resulting CVPs displayed VP1 epitope on the surfaces. Guinea pigs vaccinated with purified CVPs produced humoral antibodies. This study represents an important advance in the large-scale production of immunopeptide vaccines in a cost-effective manner using a plant cell-suspension culture system. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
-
Vaccines licensed and in clinical trials for the prevention of dengue.
Torresi, J; Ebert, G; Pellegrini, M
2017-05-04
Dengue has become a major global public health threat with almost half of the world's population living in at-risk areas. Vaccination would likely represent an effective strategy for the management of dengue disease in endemic regions, however to date there is only one licensed preventative vaccine for dengue infection. The development of a vaccine against dengue virus (DENV) has been hampered by an incomplete understanding of protective immune responses against DENV. The most clinically advanced dengue vaccine is the chimeric yellow fever-dengue vaccine (CYD) that employs the yellow fever virus 17D strain as the replication backbone (Chimerivax-DEN; CYD-TDV). This vaccine had an overall pooled protective efficacy of 65.6% but was substantially more effective against severe dengue and dengue hemorrhagic fever. Several other vaccine approaches have been developed including live attenuated chimeric dengue vaccines (DENVax and LAV Delta 30), DEN protein subunit V180 vaccine (DEN1-80E) and DENV DNA vaccines. These vaccines have been shown to be immunogenic in animals and also safe and immunogenic in humans. However, these vaccines are yet to progress to phase III trials to determine their protective efficacy against dengue. This review will summarize the details of vaccines that have progressed to clinical trials in humans.
-
Vaccines licensed and in clinical trials for the prevention of dengue
Torresi, J.; Ebert, G.; Pellegrini, M.
2017-01-01
ABSTRACT Dengue has become a major global public health threat with almost half of the world's population living in at-risk areas. Vaccination would likely represent an effective strategy for the management of dengue disease in endemic regions, however to date there is only one licensed preventative vaccine for dengue infection. The development of a vaccine against dengue virus (DENV) has been hampered by an incomplete understanding of protective immune responses against DENV. The most clinically advanced dengue vaccine is the chimeric yellow fever-dengue vaccine (CYD) that employs the yellow fever virus 17D strain as the replication backbone (Chimerivax-DEN; CYD-TDV). This vaccine had an overall pooled protective efficacy of 65.6% but was substantially more effective against severe dengue and dengue hemorrhagic fever. Several other vaccine approaches have been developed including live attenuated chimeric dengue vaccines (DENVax and LAV Delta 30), DEN protein subunit V180 vaccine (DEN1–80E) and DENV DNA vaccines. These vaccines have been shown to be immunogenic in animals and also safe and immunogenic in humans. However, these vaccines are yet to progress to phase III trials to determine their protective efficacy against dengue. This review will summarize the details of vaccines that have progressed to clinical trials in humans. PMID:28281864
-
Pierce, Kristen K; Whitehead, Stephen S; Kirkpatrick, Beth D; Grier, Palmtama L; Jarvis, Adrienne; Kenney, Heather; Carmolli, Marya P; Reynolds, Cynthia; Tibery, Cecilia M; Lovchik, Janece; Janiak, Anna; Luke, Catherine J; Durbin, Anna P; Pletnev, Alexander G
2017-01-01
West Nile virus (WNV) is a major cause of mosquito-borne illness in the United States. Human disease ranges from mild febrile illness to severe fatal neurologic infection. Adults aged >60 years are more susceptible to neuroinvasive disease accompanied by a high mortality rate or long-lasting neurologic sequelae. A chimeric live attenuated West Nile virus vaccine, rWN/DEN4Δ30, was shown to be safe and immunogenic in healthy adults aged 18-50 years. This study evaluated rWN/DEN4Δ30 in flavivirus-naive adults aged 50-65 years and found it to be safe and immunogenic. Outbreaks of WNV infection tend to be unpredictable, and a safe and effective vaccine will be an important public health tool. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
-
2014-01-01
Background Despite the use of chemical acaricides, tick infestations continue to affect animal health and production worldwide. Tick vaccines have been proposed as a cost-effective and environmentally friendly alternative for tick control. Vaccination with the candidate tick protective antigen, Subolesin (SUB), has been shown experimentally to be effective in controlling vector infestations and pathogen infection. Furthermore, Escherichia coli membranes containing the chimeric antigen composed of SUB fused to Anaplasma marginale Major Surface Protein 1a (MSP1a) (SUB-MSP1a) were produced using a simple low-cost process and proved to be effective for the control of cattle tick, Rhipicephalus (Boophilus) microplus and R. annulatus infestations in pen trials. In this research, field trials were conducted to characterize the effect of vaccination with SUB-MSP1a on tick infestations and the prevalence of tick-borne pathogens in a randomized controlled prospective study. Methods Two cattle and two sheep farms with similar geographical locations and production characteristics were randomly assigned to control and vaccinated groups. Ticks were collected, counted, weighed and classified and the prevalence of tick-borne pathogens at the DNA and serological levels were followed for one year prior to and 9 months after vaccination. Results Both cattle and sheep developed antibodies against SUB in response to vaccination. The main effect of the vaccine in cattle was the 8-fold reduction in the percent of infested animals while vaccination in sheep reduced tick infestations by 63%. Female tick weight was 32-55% lower in ticks collected from both vaccinated cattle and sheep when compared to controls. The seroprevalence of Babesia bigemina was lower by 30% in vaccinated cattle, suggesting a possible role for the vaccine in decreasing the prevalence of this tick-borne pathogen. The effect of the vaccine in reducing the frequency of one A. marginale msp4 genotype probably reflected
-
Torina, Alessandra; Moreno-Cid, Juan A; Blanda, Valeria; Fernández de Mera, Isabel G; de la Lastra, José M Pérez; Scimeca, Salvatore; Blanda, Marcellocalogero; Scariano, Maria Elena; Briganò, Salvatore; Disclafani, Rosaria; Piazza, Antonio; Vicente, Joaquín; Gortázar, Christian; Caracappa, Santo; Lelli, Rossella Colomba; de la Fuente, José
2014-01-08
Despite the use of chemical acaricides, tick infestations continue to affect animal health and production worldwide. Tick vaccines have been proposed as a cost-effective and environmentally friendly alternative for tick control. Vaccination with the candidate tick protective antigen, Subolesin (SUB), has been shown experimentally to be effective in controlling vector infestations and pathogen infection. Furthermore, Escherichia coli membranes containing the chimeric antigen composed of SUB fused to Anaplasma marginale Major Surface Protein 1a (MSP1a) (SUB-MSP1a) were produced using a simple low-cost process and proved to be effective for the control of cattle tick, Rhipicephalus (Boophilus) microplus and R. annulatus infestations in pen trials. In this research, field trials were conducted to characterize the effect of vaccination with SUB-MSP1a on tick infestations and the prevalence of tick-borne pathogens in a randomized controlled prospective study. Two cattle and two sheep farms with similar geographical locations and production characteristics were randomly assigned to control and vaccinated groups. Ticks were collected, counted, weighed and classified and the prevalence of tick-borne pathogens at the DNA and serological levels were followed for one year prior to and 9 months after vaccination. Both cattle and sheep developed antibodies against SUB in response to vaccination. The main effect of the vaccine in cattle was the 8-fold reduction in the percent of infested animals while vaccination in sheep reduced tick infestations by 63%. Female tick weight was 32-55% lower in ticks collected from both vaccinated cattle and sheep when compared to controls. The seroprevalence of Babesia bigemina was lower by 30% in vaccinated cattle, suggesting a possible role for the vaccine in decreasing the prevalence of this tick-borne pathogen. The effect of the vaccine in reducing the frequency of one A. marginale msp4 genotype probably reflected the reduction in the
-
Maximova, Olga A; Speicher, James M; Skinner, Jeff R; Murphy, Brian R; St Claire, Marisa C; Ragland, Danny R; Herbert, Richard L; Pare, Dan R; Moore, Rashida M; Pletnev, Alexander G
2014-05-30
The upsurge of West Nile virus (WNV) human infections in 2012 suggests that the US can expect periodic WNV outbreaks in the future. Availability of safe and effective vaccines against WNV in endemic areas, particularly for aging populations that are at high risk of West Nile neuroinvasive disease (WNND), could be beneficial. WN/DEN4Δ30 is a live, attenuated chimeric vaccine against WNV produced by replacement of the genes encoding the pre-membrane and envelope protein genes of the vaccine virus against dengue virus type 4 (DEN4Δ30) with corresponding sequences derived from a wild type WNV. Following intrathalamic inoculation of nonhuman primates (NHPs), a comprehensive neuropathogenesis study was performed and neurovirulence of WN/DEN4Δ30 vaccine candidate was compared to that of two parental viruses (i.e., WNV and DEN4Δ30), as well as to that of an attenuated flavivirus surrogate reference (i.e., yellow fever YF 17D). Clinical and virological data, as well as results of a semi-quantitative histopathological analysis, demonstrated that WN/DEN4Δ30 vaccine is highly attenuated for the central nervous system (CNS) of NHPs in comparison to a wild type WNV. Importantly, based on the virus replicative ability in the CNS of NHPs and the degree of induced histopathological changes, the level of neuroattenuation of WN/DEN4Δ30 vaccine was similar to that of YF 17D, and therefore within an acceptable range. In addition, we show that the DEN4Δ30 vaccine tested in this study also has a low neurovirulence profile. In summary, our results demonstrate a high level of neuroattenuation of two vaccine candidates, WN/DEN4Δ30 and DEN4Δ30. We also show here a remarkable sensitivity of our WNV-NY99 NHP model, as well as striking resemblance of the observed neuropathology to that seen in human WNND. These results support the use of this NHP model for translational studies of WNV neuropathogenesis and/or testing the effectiveness of vaccines and therapeutic approaches. Published
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paessler, Slobodan; Yun, Nadezhda E.; Judy, Barbara M.
2007-10-25
We evaluated the safety and immunogenicity of a chimeric alphavirus vaccine candidate in mice with selective immunodeficiencies. This vaccine candidate was highly attenuated in mice with deficiencies in the B and T cell compartments, as well as in mice with deficient gamma-interferon responsiveness. However, the level of protection varied among the strains tested. Wild type mice were protected against lethal VEEV challenge. In contrast, alpha/beta ({alpha}{beta}) TCR-deficient mice developed lethal encephalitis following VEEV challenge, while mice deficient in gamma/delta ({gamma}{delta}) T cells were protected. Surprisingly, the vaccine potency was diminished by 50% in animals lacking interferon-gamma receptor alpha chain (R1)-chainmore » and a minority of vaccinated immunoglobulin heavy chain-deficient ({mu}MT) mice survived challenge, which suggests that neutralizing antibody may not be absolutely required for protection. Prolonged replication of encephalitic VEEV in the brain of pre-immunized mice is not lethal and adoptive transfer experiments indicate that CD3{sup +} T cells are required for protection.« less
-
Tang, Shubing; Xuan, Baoqin; Ye, Xiaohua; Huang, Zhong; Qian, Zhikang
2016-01-01
Virus-like particles (VLPs) can be used as powerful nanoscale weapons to fight against virus infection. In addition to direct use as vaccines, VLPs have been extensively exploited as platforms on which to display foreign antigens for prophylactic vaccination and immunotherapeutic treatment. Unfortunately, fabrication of new chimeric VLP vaccines in a versatile, site-specific and highly efficient manner is beyond the capability of traditional VLP vaccine design approaches, genetic insertion and chemical conjugation. In this study, we described a greatly improved VLP display strategy by chemoenzymatic site-specific tailoring antigens on VLPs surface with high efficiency. Through the transpeptidation mediated by sortase A, one protein and two epitopes containing N-terminal oligoglycine were conjugated to the LPET motif on the surface of hepatitis B virus core protein (HBc) VLPs with high density. All of the new chimeric VLPs induced strong specific IgG responses. Furthermore, the chimeric VLPs with sortase A tagged enterovirus 71 (EV71) SP70 epitope could elicit effective antibodies against EV71 lethal challenging as well as the genetic insertion chimeric VLPs. The sortase A mediated chemoenzymatic site-specific tailoring of the HBc VLP approach shows great potential in new VLP vaccine design for its simplicity, site specificity, high efficiency, and versatility. PMID:27170066
-
Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa
2015-01-01
Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636
-
Bennett, R S; Gresko, A K; Nelson, J T; Murphy, B R; Whitehead, S S
2012-01-01
La Crosse virus (LACV) and Jamestown Canyon virus (JCV), family Bunyaviridae, are mosquito-borne viruses that are endemic in North America and recognized as etiologic agents of encephalitis in humans. Both viruses belong to the California encephalitis virus serogroup, which causes 70 to 100 cases of encephalitis a year. As a first step in creating live attenuated viral vaccine candidates for this serogroup, we have generated a recombinant LACV expressing the attachment/fusion glycoproteins of JCV. The JCV/LACV chimeric virus contains full-length S and L segments derived from LACV. For the M segment, the open reading frame (ORF) of LACV is replaced with that derived from JCV and is flanked by the untranslated regions of LACV. The resulting chimeric virus retained the same robust growth kinetics in tissue culture as observed for either parent virus, and the virus remains highly infectious and immunogenic in mice. Although both LACV and JCV are highly neurovirulent in 21 day-old mice, with 50% lethal dose (LD₅₀) values of 0.1 and 0.5 log₁₀ PFU, respectively, chimeric JCV/LACV is highly attenuated and does not cause disease even after intracerebral inoculation of 10³ PFU. Parenteral vaccination of mice with 10¹ or 10³ PFU of JCV/LACV protected against lethal challenge with LACV, JCV, and Tahyna virus (TAHV). The chimeric virus was infectious and immunogenic in rhesus monkeys and induced neutralizing antibodies to JCV, LACV, and TAHV. When vaccinated monkeys were challenged with JCV, they were protected against the development of viremia. Generation of highly attenuated yet immunogenic chimeric bunyaviruses could be an efficient general method for development of vaccines effective against these pathogenic viruses.
-
Balasuriya, Udeni B. R.; Lee, Chong-kyo
2014-01-01
In this review, we mainly focus on zoonotic encephalitides caused by arthropod-borne viruses (arboviruses) of the families Flaviviridae (genus Flavivirus) and Togaviridae (genus Alphavirus) that are important in both humans and domestic animals. Specifically, we will focus on alphaviruses (Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus) and flaviviruses (Japanese encephalitis virus and West Nile virus). Most of these viruses were originally found in tropical regions such as Africa and South America or in some regions in Asia. However, they have dispersed widely and currently cause diseases around the world. Global warming, increasing urbanization and population size in tropical regions, faster transportation and rapid spread of arthropod vectors contribute in continuous spreading of arboviruses into new geographic areas causing reemerging or resurging diseases. Most of the reemerging arboviruses also have emerged as zoonotic disease agents and created major public health issues and disease epidemics. PMID:24427764
-
Go, Yun Young; Balasuriya, Udeni B R; Lee, Chong-Kyo
2014-01-01
In this review, we mainly focus on zoonotic encephalitides caused by arthropod-borne viruses (arboviruses) of the families Flaviviridae (genus Flavivirus) and Togaviridae (genus Alphavirus) that are important in both humans and domestic animals. Specifically, we will focus on alphaviruses (Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus) and flaviviruses (Japanese encephalitis virus and West Nile virus). Most of these viruses were originally found in tropical regions such as Africa and South America or in some regions in Asia. However, they have dispersed widely and currently cause diseases around the world. Global warming, increasing urbanization and population size in tropical regions, faster transportation and rapid spread of arthropod vectors contribute in continuous spreading of arboviruses into new geographic areas causing reemerging or resurging diseases. Most of the reemerging arboviruses also have emerged as zoonotic disease agents and created major public health issues and disease epidemics.
-
The Enigmatic Alphavirus Non-Structural Protein 3 (nsP3) Revealing Its Secrets at Last
Götte, Benjamin; Liu, Lifeng
2018-01-01
Alphaviruses encode 4 non-structural proteins (nsPs), most of which have well-understood functions in capping and membrane association (nsP1), polyprotein processing and RNA helicase activity (nsP2) and as RNA-dependent RNA polymerase (nsP4). The function of nsP3 has been more difficult to pin down and it has long been referred to as the more enigmatic of the nsPs. The protein comprises three domains, an N-terminal macro domain, a central zinc-binding domain and a C-terminal hypervariable domain (HVD). In this article, we review old and new literature about the functions of the three domains. Much progress in recent years has contributed to a picture of nsP3, particularly through its HVD as a hub for interactions with host cell molecules, with multiple effects on the biology of the host cell at early points in infection. These and many future discoveries will provide targets for anti-viral therapies as well as strategies for modification of vectors for vaccine and oncolytic interventions. PMID:29495654
-
Kim, Dong Soo; Jang, Gwang Cheon; Cha, Sung-Ho; Choi, Soo-Han; Kim, Hwang Min; Kim, Ji Hong; Kang, Jin Han; Kim, Jong-Hyun; Kim, Ki Hwan; Bang, Joon; Naimi, Zulaikha; Bouckenooghe, Alain; Bosch-Castells, Valérie; Houillon, Guy
2016-02-01
This study evaluated the effect of a booster vaccination of a new, live attenuated, Japanese encephalitis chimeric vaccine (JE-CV). Previously this vaccine has been used as a booster 12 months after priming with an inactivated vaccine and at >24 months after priming with the same JE-CV. This study evaluates the immunogenicity and safety of the JE-CV given at 12-24 months after JE-CV priming. Phase III, open-label study in the Republic of Korea in which 119 children previously vaccinated with JE-CV at 12-24 months of age received a JE-CV booster at 12-24 months after primary vaccination. JE neutralizing antibody titers were measured using >50% plaque reduction neutralization test prebooster and 1 month postbooster vaccination. Seroprotection (SP) was defined as ≥10 (1/dil). Safety was assessed for 28 days postvaccination by parental reports. Serious adverse events were monitored for 6 months postvaccination. Antibody persistence was high prebooster (SP rate 93.5%). There was a strong anamnestic response postbooster vaccination, with an SP rate of 100% and a >50-fold increase in geometric mean titer from the prebooster level. Both antibody persistence and the booster response were independent of whether the booster was given at 12-17 or 18-24 months. The safety profile was good and comparable with the primary vaccination; there were no vaccine-related serious adverse events and no deaths. This study confirms the suitability of a JE-CV booster vaccination at 12-24 months after a primary dose of the same vaccine given at 12-24 months of age in children in the Republic of Korea.
-
Kim, Jeong Tae; Kim, Youn Hwan; Ghanem, Ali M
2015-11-01
Complex defects present structural and functional challenges to reconstructive surgeons. When compared to multiple free flaps or staged reconstruction, the use of chimeric flaps to reconstruct such defects have many advantages such as reduced number of operative procedures and donor site morbidity as well as preservation of recipient vessels. With increased popularity of perforator flaps, chimeric flaps' harvest and design has benefited from 'perforator concept' towards more versatile and better reconstruction solutions. This article discusses perforator based chimeric flaps and presents a practice based classification system that incorporates the perforator flap concept into "Perforator Chimerism". The authors analyzed a variety of chimeric patterns used in 31 consecutive cases to present illustrative case series and their new classification system. Accordingly, chimeric flaps are classified into four types. Type I: Classical Chimerism, Type II: Anastomotic Chimerism, Type III: Perforator Chimerism and Type IV Mixed Chimerism. Types I on specific source vessel anatomy whilst Type II requires microvascular anastomosis to create the chimeric reconstructive solution. Type III chimeric flaps utilizes the perforator concept to raise two components of tissues without microvascular anastomosis between them. Type IV chimeric flaps are mixed type flaps comprising any combination of Types I to III. Incorporation of the perforator concept in planning and designing chimeric flaps has allowed safe, effective and aesthetically superior reconstruction of complex defects. The new classification system aids reconstructive surgeons and trainees to understand chimeric flaps design, facilitating effective incorporation of this important reconstructive technique into the armamentarium of the reconstruction toolbox. Copyright © 2015 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
-
Vaccine platforms to control Lassa fever.
Lukashevich, Igor S; Pushko, Peter
2016-09-01
Lassa virus (LASV), the most prominent human pathogen of the Arenaviridae, is transmitted to humans from infected rodents and can cause Lassa Fever (LF). The sizeable disease burden in West Africa, numerous imported LF cases worldwide, and the possibility that LASV can be used as an agent of biological warfare make a strong case for vaccine development. There are no licensed LASV vaccines and the antiviral treatment is limited to an off-label use of ribavirin that is only partially effective. LASV vaccine development is hampered by high cost of biocontainment requirement, the absence of appropriate small animal models, genetic diversity of LASV species, and by high HIV-1 prevalence in LASV endemic areas. Over the past 15 years several vaccine platforms have been developed. Natural history of LASV and pathogenesis of the disease provide strong justification for replication-competent (RC) vaccine as one of the most feasible approaches to control LF. Development of LASV vaccine candidates based on reassortant, recombinant, and alphavirus replicon technologies is covered in this review. Expert commentary: Two lead RC vaccine candidates, reassortant ML29 and recombinant VSV/LASV, have been successfully tested in non-human primates and have been recommended by international vaccine experts for rapid clinical development. Both platforms have powerful molecular tools to further secure safety, improve immunogenicity, and cross-protection. These platforms are well positioned to design multivalent vaccines to protect against all LASV strains citculatrd in West Africa. The regulatory pathway of Candid #1, the first live-attenuated arenaviral vaccine against Argentine hemorrhagic, will be a reasonable guideline for LASV vaccine efficacy trials.
-
Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-09-01
Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier
-
Rouxel, Ronan Nicolas; Svitek, Nicholas; von Messling, Veronika
2009-08-06
CDV infects a broad range of carnivores, and over the past decades it has caused outbreaks in a variety of wild carnivore populations. Since the currently available live-attenuated vaccine is not sufficiently safe in these highly susceptible species, we produced a chimeric virus combining the replication complex of the measles Moraten vaccine strain with the envelope of a recent CDV wild type isolate. The resulting virus did not cause disease or immunosuppression in ferrets and conferred protection from challenge with a lethal wild type strain, demonstrating its potential value for wildlife conservation efforts.
-
Strauss, E G; Levinson, R; Rice, C M; Dalrymple, J; Strauss, J H
1988-05-01
We have sequenced the nsP3 and nsP4 region of two alphaviruses, Ross River virus and O'Nyong-nyong virus, in order to examine these viruses for the presence or absence of an opal termination codon present between nsP3 and nsP4 in many alphaviruses. We found that Ross River virus possesses an in-phase opal termination codon between nsP3 and nsP4, whereas in O'Nyong-nyong virus this termination codon is replaced by an arginine codon. Previous studies have shown that two other alphaviruses, Sindbis virus and Middelburg virus, possess an opal termination codon separating nsP3 and nsP4 [E.G. Strauss, C.M. Rice, and J.H. Strauss (1983), Proc. Natl. Acad. Sci. USA 80, 5271-5275], whereas Semliki Forest virus possesses an arginine codon in lieu of the opal codon [K. Takkinen (1986), Nucleic Acids Res. 14, 5667-5682]. Thus, of the five alphaviruses examined to date, three possess the opal codon and two do not. Production of nsP4 requires readthrough of the opal codon in those alphaviruses that possess this termination codon and the function of the termination codon may be to regulate the amount of nsP4 produced. It is an open question then as to whether alphaviruses with no termination codon use other mechanisms to regulate the activity of this gene. The nsP4s of these five alphaviruses are highly conserved, sharing 71-76% amino acid sequence similarity, and all five contain the Gly-Asp-Asp motif found in many RNA virus replicases. The nsP3s are somewhat less conserved, sharing 52-73% amino acid sequence similarity throughout most of the protein, but each possesses a nonconserved C-terminal domain of 134 to 246 amino acids of unknown function.
-
McCormick, Kara; Jiang, Zhiyong; Zhu, Longchao; Lawson, Steven R.; Langenhorst, Robert; Ransburgh, Russell; Brunick, Colin; Tracy, Miranda C.; Hurtig, Heather R.; Mabee, Leah M.; Mingo, Mark; Li, Yanhua; Webby, Richard J.
2015-01-01
Background and Objectives Influenza A viruses cause highly contagious diseases in a variety of hosts, including humans and pigs. To develop a vaccine that can be broadly effective against genetically divergent strains of the virus, in this study we employed molecular breeding (DNA shuffling) technology to create a panel of chimeric HA genes. Methods and Results Each chimeric HA gene contained genetic elements from parental swine influenza A viruses that had a history of zoonotic transmission, and also from a 2009 pandemic virus. Each parental virus represents a major phylogenetic clade of influenza A H1N1 viruses. Nine shuffled HA constructs were initially screened for immunogenicity in mice by DNA immunization, and one chimeric HA (HA-129) was expressed on both a A/Puerto Rico/8/34 backbone with mutations associated with a live, attenuated phenotype (PR8LAIV-129) and a A/swine/Texas/4199-2/98 backbone (TX98-129). When delivered to mice, the PR8LAIV-129 induced antibodies against all four parental viruses, which was similar to the breadth of immunity observed when HA-129 was delivered as a DNA vaccine. This chimeric HA was then tested as a candidate vaccine in a nursery pig model, using inactivated TX98-129 virus as the backbone. The results demonstrate that pigs immunized with HA-129 developed antibodies against all four parental viruses, as well as additional primary swine H1N1 influenza virus field isolates. Conclusion This study established a platform for creating novel genes of influenza viruses using a molecular breeding approach, which will have important applications toward future development of broadly protective influenza virus vaccines. PMID:26061265
-
Opriessnig, T.; Shen, H. G.; Pal, N.; Ramamoorthy, S.; Huang, Y. W.; Lager, K. M.; Beach, N. M.; Halbur, P. G.; Meng, X. J.
2011-01-01
The live chimeric porcine circovirus type 2 (PCV2) vaccine with the capsid gene of the emerging subtype 2b cloned in the genomic backbone of the nonpathogenic PCV1 is attenuated in vivo and induces protective immunity against PCV2. To further determine the safety and efficacy of this experimental vaccine, we tested for evidence of pig-to-pig transmission by commingling nonvaccinated and vaccinated pigs, determined potential upregulation by simultaneous vaccination and infection with porcine parvovirus (PPV) and porcine reproductive and respiratory syndrome virus (PRRSV), and determined vaccine efficacy by challenging pigs 4 weeks after vaccination with PCV2b, PRRSV, and PPV. Forty-six 21-day-old, PCV2-naïve pigs were randomly assigned to one of six groups. Twenty-nine of 46 pigs were challenged with PCV2b, PRRSV, and PPV at day 28, 8/46 remained nonvaccinated and nonchallenged and served as negative controls, and 9/46 remained nonchallenged and served as vaccination controls. All animals were necropsied at day 49. PCV1-PCV2 viremia was detected in nonvaccinated contact pigs commingled with vaccinated pigs, indicating pig-to-pig transmission; however, PCV1-PCV2 DNA levels remained low in all vaccinated and contact pigs regardless of concurrent infection. Finally, vaccination 28 days before challenge resulted in significantly (P < 0.05) decreased amounts of PCV2 in tissues and sera and significantly (P < 0.05) reduced macroscopic and microscopic lesions. The results of this study indicate that the experimental live-attenuated chimeric PCV2 vaccine, although transmissible to contact pigs, remains attenuated in pigs concurrently infected with PRRSV and PPV and induces protective immunity against PCV2b when it is administered 28 days before PCV2 exposure. PMID:21653745
-
Opriessnig, T; Shen, H G; Pal, N; Ramamoorthy, S; Huang, Y W; Lager, K M; Beach, N M; Halbur, P G; Meng, X J
2011-08-01
The live chimeric porcine circovirus type 2 (PCV2) vaccine with the capsid gene of the emerging subtype 2b cloned in the genomic backbone of the nonpathogenic PCV1 is attenuated in vivo and induces protective immunity against PCV2. To further determine the safety and efficacy of this experimental vaccine, we tested for evidence of pig-to-pig transmission by commingling nonvaccinated and vaccinated pigs, determined potential upregulation by simultaneous vaccination and infection with porcine parvovirus (PPV) and porcine reproductive and respiratory syndrome virus (PRRSV), and determined vaccine efficacy by challenging pigs 4 weeks after vaccination with PCV2b, PRRSV, and PPV. Forty-six 21-day-old, PCV2-naïve pigs were randomly assigned to one of six groups. Twenty-nine of 46 pigs were challenged with PCV2b, PRRSV, and PPV at day 28, 8/46 remained nonvaccinated and nonchallenged and served as negative controls, and 9/46 remained nonchallenged and served as vaccination controls. All animals were necropsied at day 49. PCV1-PCV2 viremia was detected in nonvaccinated contact pigs commingled with vaccinated pigs, indicating pig-to-pig transmission; however, PCV1-PCV2 DNA levels remained low in all vaccinated and contact pigs regardless of concurrent infection. Finally, vaccination 28 days before challenge resulted in significantly (P < 0.05) decreased amounts of PCV2 in tissues and sera and significantly (P < 0.05) reduced macroscopic and microscopic lesions. The results of this study indicate that the experimental live-attenuated chimeric PCV2 vaccine, although transmissible to contact pigs, remains attenuated in pigs concurrently infected with PRRSV and PPV and induces protective immunity against PCV2b when it is administered 28 days before PCV2 exposure.
-
Riabov, V.; Tretyakova, I.; Alexander, R. B.; Pushko, P.; Klyushnenkova, E. N.
2015-01-01
The goal of this study was to determine if an alphavirus-based vaccine encoding human Prostate-Specific Antigen (PSA) could generate an effective anti-tumor immune response in a stringent mouse model of prostate cancer. DR2bxPSA F1 male mice expressing human PSA and HLA-DRB1*1501 transgenes were vaccinated with virus-like particle vector encoding PSA (VLPV-PSA) followed by the challenge with Transgenic Adenocarcinoma of Mouse Prostate cells engineered to express PSA (TRAMP-PSA). PSA-specific cellular and humoral immune responses were measured before and after tumor challenge. PSA and CD8 reactivity in the tumors was detected by immunohistochemistry. Tumor growth was compared in vaccinated and control groups. We found that VLPV-PSA could infect mouse dendritic cells in vitro and induce a robust PSA-specific immune response in vivo. A substantial proportion of splenic CD8+ T cells (19.6±7.4%) produced IFNγ in response to the immunodominant peptide PSA65–73. In the blood of vaccinated mice, 18.4±4.1% of CD8+ T cells were PSA-specific as determined by the staining with H-2Db/PSA65–73 dextramers. VLPV-PSA vaccination also strongly stimulated production of IgG2a/b anti-PSA antibodies. Tumors in vaccinated mice showed low levels of PSA expression and significant CD8 T cell infiltration. Tumor growth in VLPV-PSA vaccinated mice was significantly delayed at early time points (p=0.002, Gehan-Breslow test). Our data suggest that TC-83-based VLPV-PSA vaccine can efficiently overcome immune tolerance to PSA, mediate rapid clearance of PSA-expressing tumor cells and delay tumor growth. The VLPV-PSA vaccine will undergo further testing for the immunotherapy of prostate cancer. PMID:26319744
-
Frameshifting in alphaviruses: a diversity of 3' stimulatory structures.
Chung, Betty Y-W; Firth, Andrew E; Atkins, John F
2010-03-26
Programmed ribosomal frameshifting allows the synthesis of alternative, N-terminally coincident, C-terminally distinct proteins from the same RNA. Many viruses utilize frameshifting to optimize the coding potential of compact genomes, to circumvent the host cell's canonical rule of one functional protein per mRNA, or to express alternative proteins in a fixed ratio. Programmed frameshifting is also used in the decoding of a small number of cellular genes. Recently, specific ribosomal -1 frameshifting was discovered at a conserved U_UUU_UUA motif within the sequence encoding the alphavirus 6K protein. In this case, frameshifting results in the synthesis of an additional protein, termed TF (TransFrame). This new case of frameshifting is unusual in that the -1 frame ORF is very short and completely embedded within the sequence encoding the overlapping polyprotein. The present work shows that there is remarkable diversity in the 3' sequences that are functionally important for efficient frameshifting at the U_UUU_UUA motif. While many alphavirus species utilize a 3' RNA structure such as a hairpin or pseudoknot, some species (such as Semliki Forest virus) apparently lack any intra-mRNA stimulatory structure, yet just 20 nt 3'-adjacent to the shift site stimulates up to 10% frameshifting. The analysis, both experimental and bioinformatic, significantly expands the known repertoire of -1 frameshifting stimulators in mammalian and insect systems.
-
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
-
Taylor, Adam; Liu, Xiang; Zaid, Ali; Goh, Lucas Y H; Hobson-Peters, Jody; Hall, Roy A; Merits, Andres; Mahalingam, Suresh
2017-02-21
Mosquito-transmitted chikungunya virus (CHIKV) is an arthritogenic alphavirus of the Togaviridae family responsible for frequent outbreaks of arthritic disease in humans. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleolus. In encephalitic alphaviruses, nuclear translocation induces host cell transcriptional shutoff; however, the role of capsid protein nucleolar localization in arthritogenic alphaviruses remains unclear. Using recombinant enhanced green fluorescent protein (EGFP)-tagged expression constructs and CHIKV infectious clones, we describe a nucleolar localization sequence (NoLS) in the N-terminal region of capsid protein, previously uncharacterized in CHIKV. Mutation of the NoLS by site-directed mutagenesis reduced efficiency of nuclear import of CHIKV capsid protein. In the virus, mutation of the capsid protein NoLS (CHIKV-NoLS) attenuated replication in mammalian and mosquito cells, producing a small-plaque phenotype. Attenuation of CHIKV-NoLS is likely due to disruption of the viral replication cycle downstream of viral RNA synthesis. In mice, CHIKV-NoLS infection caused no disease signs compared to wild-type CHIKV (CHIKV-WT)-infected mice; lack of disease signs correlated with significantly reduced viremia and decreased expression of proinflammatory factors. Mice immunized with CHIKV-NoLS, challenged with CHIKV-WT at 30 days postimmunization, develop no disease signs and no detectable viremia. Serum from CHIKV-NoLS-immunized mice is able to efficiently neutralize CHIKV infection in vitro Additionally, CHIKV-NoLS-immunized mice challenged with the related alphavirus Ross River virus showed reduced early and peak viremia postchallenge, indicating a cross-protective effect. The high degree of CHIKV-NoLS attenuation may improve CHIKV antiviral and rational vaccine design. IMPORTANCE CHIKV is a mosquito-borne pathogen capable of causing explosive epidemics of incapacitating joint pain
-
An alphavirus temperature-sensitive capsid mutant reveals stages of nucleocapsid assembly
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Yan, E-mail: yzheng15@students.kgi.edu; Kielian, Margaret, E-mail: margaret.kielian@einstein.yu.edu
2015-10-15
Alphaviruses have a nucleocapsid core composed of the RNA genome surrounded by an icosahedral lattice of capsid protein. An insertion after position 186 in the capsid protein produced a strongly temperature-sensitive growth phenotype. Even when the structural proteins were synthesized at the permissive temperature (28 °C), subsequent incubation of the cells at the non-permissive temperature (37 °C) dramatically decreased mutant capsid protein stability and particle assembly. Electron microscopy confirmed the presence of cytoplasmic nucleocapsids in mutant-infected cells cultured at the permissive temperature, but these nucleocapsids were not stable to sucrose gradient separation. In contrast, nucleocapsids isolated from mutant virus particlesmore » had similar stability to that of wildtype virus. Our data support a model in which cytoplasmic nucleocapsids go through a maturation step during packaging into virus particles. The insertion site lies in the interface between capsid proteins in the assembled nucleocapsid, suggesting the region where such a stabilizing transition occurs. - Highlights: • We characterize an alphavirus capsid insertion mutation. • These capsid mutants are highly temperature sensitive for growth. • The insertion affects nucleocapsid stability. • Results suggest that the nucleocapsid is stabilized during virus budding.« less
-
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
-
New developments in flavivirus vaccines with special attention to yellow fever.
Pugachev, Konstantin V; Guirakhoo, Farshad; Monath, Thomas P
2005-10-01
Here we review recent epidemiological trends in flavivirus diseases, findings related to existing vaccines, and new directions in flavivirus vaccine research. We emphasize the need for stepped-up efforts to stop further spread and intensification of these infections worldwide. Although the incidence and geographic distribution of flavivirus diseases have increased in recent years, human vaccines are available only for yellow fever, Japanese encephalitis, tick-borne encephalitis and Kyasanur forest disease. Factors contributing to resurgence include insufficient supplies of available vaccines, incomplete vaccination coverage and relaxation in vector control. Research has been underway for 60 years to develop effective vaccines against dengue, and recent progress is encouraging. The development of vaccines against West Nile, virus recently introduced to North America, has been initiated. In addition, there is considerable interest in improving existing vaccines with respect to increasing safety (e.g. eliminating the newly recognized syndrome of yellow fever vaccine-associated viscerotropic adverse disease), and to reducing the cost and number of doses required for effective immunization. Traditional approaches to flavivirus vaccines are still employed, while recent advancements in biotechnology produced new approaches to vaccine design, such as recombinant live virus, subunit and DNA vaccines. Live chimeric vaccines against dengue, Japanese encephalitis and West Nile based on yellow fever 17D virus (ChimeriVax) are in phase I/II trials, with encouraging results. Other chimeric dengue, tick-borne encephalitis and West Nile virus candidates were developed based on attenuated dengue backbones. To further reduce the impact of flavivirus diseases, vaccination policies and vector control programs in affected countries require revision.
-
Update on the current status of cytomegalovirus vaccines.
Sung, Heungsup; Schleiss, Mark R
2010-11-01
Human cytomegalovirus (HCMV) is ubiquitous in all populations, and is the most commonly recognized cause of congenital viral infection in developed countries. On the basis of the economic costs saved and the improvement in quality of life that could potentially be conferred by a successful vaccine for prevention of congenital HCMV infection, the Institute of Medicine has identified HCMV vaccine development as a major public health priority. An effective vaccine could potentially also be beneficial in preventing or ameliorating HCMV disease in immunocompromised individuals. Although there are no licensed HCMV vaccines currently available, enormous progress has been made in the last decade, as evidenced by the recently reported results of a Phase II trial of a glycoprotein B vaccine for the prevention of HCMV infection in seronegative women of childbearing age. HCMV vaccines currently in clinical trials include: glycoprotein B subunit vaccines; alphavirus replicon particle vaccines; DNA vaccines; and live-attenuated vaccines. A variety of vaccine strategies are also being examined in preclinical systems and animal models of infection. These include: recombinant vesicular stomatitis virus vaccines; recombinant modified vaccinia virus Ankara; replication-deficient adenovirus-vectored vaccines; and recombinant live-attenuated virus vaccines generated by mutagenesis of cloned rodent CMV genomes maintained as bacterial artificial chromosomes in Escherichia coli. In this article, we provide an overview of the current state of clinical trials and preclinical development of vaccines against HCMV, with an emphasis on studies that have been conducted in the past 5 years. We also summarize a number of recent advances in the study of the biology of HCMV, particularly with respect to epithelial and endothelial cell entry of the virus, which have implications for future vaccine design.
-
Khalil, Syed Muaz; Tonkin, Daniel R.; Mattocks, Melissa D.; Snead, Andrew T.; Johnston, Robert E.; White, Laura J.
2014-01-01
Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life. PMID:24882043
-
Lin, Yinling; Kwon, Taewoo; Polo, John; Zhu, Yi-Fei; Coates, Stephen; Crawford, Kevin; Dong, Christine; Wininger, Mark; Hall, John; Selby, Mark; Coit, Doris; Medina-Selby, Angelica; McCoin, Colin; Ng, Philip; Drane, Debbie; Chien, David; Han, Jang; Vajdy, Michael; Houghton, Michael
2008-01-01
Broad, multispecific CD4+ and CD8+ T-cell responses to the hepatitis C virus (HCV), as well as virus-cross-neutralizing antibodies, are associated with recovery from acute infection and may also be associated in chronic HCV patients with a favorable response to antiviral treatment. In order to recapitulate all of these responses in an ideal vaccine regimen, we have explored the use of recombinant HCV polypeptides combined with various Th1-type adjuvants and replication-defective alphaviral particles encoding HCV proteins in various prime/boost modalities in BALB/c mice. Defective chimeric alphaviral particles derived from the Sindbis and Venezuelan equine encephalitis viruses encoding either the HCV envelope glycoprotein gpE1/gpE2 heterodimer (E1E2) or nonstructural proteins 3, 4, and 5 (NS345) elicited strong CD8+ T-cell responses but low CD4+ T helper responses to these HCV gene products. In contrast, recombinant E1E2 glycoproteins adjuvanted with MF59 containing a CpG oligonucleotide elicited strong CD4+ T helper responses but no CD8+ T-cell responses. A recombinant NS345 polyprotein also stimulated strong CD4+ T helper responses but no CD8+ T-cell responses when adjuvanted with Iscomatrix containing CpG. Optimal elicitation of broad CD4+ and CD8+ T-cell responses to E1E2 and NS345 was obtained by first priming with Th1-adjuvanted proteins and then boosting with chimeric, defective alphaviruses expressing these HCV genes. In addition, this prime/boost regimen resulted in the induction of anti-E1E2 antibodies capable of cross-neutralizing heterologous HCV isolates in vitro. This vaccine formulation and regimen may therefore be optimal in humans for protection against this highly heterogeneous global pathogen. PMID:18508900
-
USDA-ARS?s Scientific Manuscript database
The objective of this study was to determine the safety and efficacy of a new live-attenuated chimeric PCV1/2b vaccine. Forty-six, 21-day-old, PCV2-naïve pigs were randomly assigned to one of six groups (Negative controls, positive controls, Vac-0, Vac-0-PCV2, Contact-PCV2, Vac-28-PCV2). All pigs we...
-
Blakely, Pennelope K; Huber, Amanda K; Irani, David N
2016-08-25
Alphaviruses can cause fatal encephalitis in humans. Natural infections occur via the bite of infected mosquitos, but aerosol transmissibility makes some of these viruses potential bioterrorism agents. Central nervous system (CNS) host responses contribute to alphavirus pathogenesis in experimental models and are logical therapeutic targets. We investigated whether reactive oxygen species (ROS) generated by nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Nox) activity within the CNS contributes to fatal alphavirus encephalitis in mice. Infected animals were treated systemically with the angiotensin receptor-blocking drug, telmisartan, given its ability to cross the blood-brain barrier, selectively block type-1 angiotensin receptors (AT1R), and inhibit Nox-derived ROS production in vascular smooth muscle and other extraneural tissues. Clinical, virological, biochemical, and histopathological outcomes were followed over time. The importance of the angiotensin II (Ang II)/AT1R axis in disease pathogenesis was confirmed by demonstrating increased Ang II levels in the CNS following infection, enhanced disease survival when CNS Ang II production was suppressed, increased AT1R expression on microglia and tissue-infiltrating myeloid cells, and enhanced disease survival in AT1R-deficient mice compared to wild-type (WT) controls. Systemic administration of telmisartan protected WT mice from lethal encephalitis caused by two different alphaviruses in a dose-dependent manner without altering virus replication or exerting any anti-inflammatory effects in the CNS. Infection triggered up-regulation of multiple Nox subunits in the CNS, while drug treatment inhibited local Nox activity, ROS production, and oxidative neuronal damage. Telmisartan proved ineffective in Nox-deficient mice, demonstrating that this enzyme is its main target in this experimental setting. Nox-derived ROS, likely arising from CNS myeloid cells triggered by AT1R signaling, are pathogenic during
-
Paz De la Rosa, Georgina; Monroy-García, Alberto; Mora-García, María de Lourdes; Peña, Cristina Gehibie Reynaga; Hernández-Montes, Jorge; Weiss-Steider, Benny; Gómez-Lim, Miguel Angel
2009-01-06
Even though two prophylactic vaccines against HPV are currently licensed, infections by the virus continue to be a major health problem mainly in developing countries. The cost of the vaccines limits wide-scale application in poor countries. A promising strategy for producing affordable and efficient vaccines involves the expression of recombinant immunogens in plants. Several HPV genes have been expressed in plants, including L1, which can self-assemble into virus-like particles. A plant-based, dual prophylactic/therapeutic vaccine remains an attractive possibility. We sought to express in tomato plants chimeric HPV 16 VLPs containing L1 fused to a string of epitopes from HPV 16 E6 and E7 proteins. The L1 employed had been modified to eliminate a strong inhibitory region at the 5' end of the molecule to increase expression levels. Several tomato lines were obtained expressing either L1 alone or L1-E6/E7 from 0.05% to 0.1% of total soluble protein. Stable integration of the transgenes was verified by Southern blot. Northern and western blot revealed successful expression of the transgenes at the mRNA and protein level. The chimeric VLPs were able to assemble adequately in tomato cells. Intraperitoneal administration in mice was able to elicit both neutralizing antibodies against the viral particle and cytotoxic T-lymphocytes activity against the epitopes. In this work, we report for the first time the expression in plants of a chimeric particle containing the HPV 16 L1 sequence and a string of T-cell epitopes from HPV 16 E6 and E7 fused to the C-terminus. The particles were able to induce a significant antibody and cytotoxic T-lymphocytes response. Experiments in vivo are in progress to determine whether the chimeric particles are able to induce regression of disease and resolution of viral infection in mice. Chimeric particles of the type described in this work may potentially be the basis for developing prophylactic/therapeutic vaccines. The fact that they are
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shustov, Alexandr V.; Frolov, Ilya, E-mail: ivfrolov@UAB.ed
In our previous studies, we have stated to build a new strategy for developing defective, pseudoinfectious flaviviruses (PIVs) and applying them as a new type of vaccine candidates. PIVs combined the efficiency of live vaccines with the safety of inactivated or subunit vaccines. The results of the present work demonstrate further development of chimeric PIVs encoding dengue virus 2 (DEN2V) glycoproteins and yellow fever virus (YFV)-derived replicative machinery as potential vaccine candidates. The newly designed PIVs have synergistically functioning mutations in the prM and NS2A proteins, which abolish processing of the latter proteins and make the defective viruses capable ofmore » producing either only noninfectious, immature and/or subviral DEN2V particles. The PIV genomes can be packaged to high titers into infectious virions in vitro using the NS1-deficient YFV helper RNAs, and both PIVs and helpers can then be passaged as two-component genome viruses at an escalating scale.« less
-
Chimeric Lyssavirus Glycoproteins with Increased Immunological Potential
Jallet, Corinne; Jacob, Yves; Bahloul, Chokri; Drings, Astrid; Desmezieres, Emmanuel; Tordo, Noël; Perrin, Pierre
1999-01-01
The rabies virus glycoprotein molecule (G) can be divided into two parts separated by a flexible hinge: the NH2 half (site II part) containing antigenic site II up to the linear region (amino acids [aa] 253 to 275 encompassing epitope VI [aa 264]) and the COOH half (site III part) containing antigenic site III and the transmembrane and cytoplasmic domains. The structural and immunological roles of each part were investigated by cell transfection and mouse DNA-based immunization with homogeneous and chimeric G genes formed by fusion of the site II part of one genotype (GT) with the site III part of the same or another GT. Various site II-site III combinations between G genes of PV (Pasteur virus strain) rabies (GT1), Mokola (GT3), and EBL1 (European bat lyssavirus 1 [GT5]) viruses were tested. Plasmids pGPV-PV, pGMok-Mok, pGMok-PV, and pGEBL1-PV induced transient expression of correctly transported and folded antigens in neuroblastoma cells and virus-neutralizing antibodies against parental viruses in mice, whereas, pG-PVIII (site III part only) and pGPV-Mok did not. The site III part of PV (GT1) was a strong inducer of T helper cells and was very effective at presenting the site II part of various GTs. Both parts are required for correct folding and transport of chimeric G proteins which have a strong potential value for immunological studies and development of multivalent vaccines. Chimeric plasmid pGEBL1-PV broadens the spectrum of protection against European lyssavirus genotypes (GT1, GT5, and GT6). PMID:9847325
-
Nishiyama, Shoko; Slack, Olga A. L.; Lokugamage, Nandadeva; Hill, Terence E.; Juelich, Terry L.; Zhang, Lihong; Smith, Jennifer K.; Perez, David; Gong, Bin; Freiberg, Alexander N.; Ikegami, Tetsuro
2016-01-01
ABSTRACT Rift Valley fever is a mosquito-borne zoonotic disease affecting ruminants and humans. Rift Valley fever virus (RVFV: family Bunyaviridae, genus Phlebovirus) causes abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or retinitis in humans. The live-attenuated MP-12 vaccine is conditionally licensed for veterinary use in the US. However, this vaccine lacks a marker for the differentiation of vaccinated from infected animals (DIVA). NSs gene is dispensable for RVFV replication, and thus, rMP-12 strains lacking NSs gene is applicable to monitor vaccinated animals. However, the immunogenicity of MP-12 lacking NSs was not as high as parental MP-12. Thus, chimeric MP-12 strains encoding NSs from either Toscana virus (TOSV), sandfly fever Sicilian virus (SFSV) or Punta Toro virus Adames strain (PTA) were characterized previously. Although chimeric MP-12 strains are highly immunogenic, the attenuation through the S-segment remains unknown. Using pathogenic ZH501 strain, we aimed to demonstrate the attenuation of ZH501 strain through chimeric S-segment encoding either the NSs of TOSV, SFSV, PTA, or Punta Toro virus Balliet strain (PTB). In addition, we characterized rZH501 encoding a human dominant-negative PKR (PKRΔE7), which also enhances the immunogenicity of MP-12. Study done on mice revealed that attenuation of rZH501 occurred through the S-segment encoding either PKRΔE7 or SFSV NSs. However, rZH501 encoding either TOSV, PTA, or PTB NSs in the S-segment uniformly caused lethal encephalitis. Our results indicated that the S-segments encoding PKRΔE7 or SFSV NSs are attenuated and thus applicable toward next generation MP-12 vaccine candidates that encode a DIVA marker. PMID:27248570
-
Nishiyama, Shoko; Slack, Olga A L; Lokugamage, Nandadeva; Hill, Terence E; Juelich, Terry L; Zhang, Lihong; Smith, Jennifer K; Perez, David; Gong, Bin; Freiberg, Alexander N; Ikegami, Tetsuro
2016-11-16
Rift Valley fever is a mosquito-borne zoonotic disease affecting ruminants and humans. Rift Valley fever virus (RVFV: family Bunyaviridae, genus Phlebovirus) causes abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or retinitis in humans. The live-attenuated MP-12 vaccine is conditionally licensed for veterinary use in the US. However, this vaccine lacks a marker for the differentiation of vaccinated from infected animals (DIVA). NSs gene is dispensable for RVFV replication, and thus, rMP-12 strains lacking NSs gene is applicable to monitor vaccinated animals. However, the immunogenicity of MP-12 lacking NSs was not as high as parental MP-12. Thus, chimeric MP-12 strains encoding NSs from either Toscana virus (TOSV), sandfly fever Sicilian virus (SFSV) or Punta Toro virus Adames strain (PTA) were characterized previously. Although chimeric MP-12 strains are highly immunogenic, the attenuation through the S-segment remains unknown. Using pathogenic ZH501 strain, we aimed to demonstrate the attenuation of ZH501 strain through chimeric S-segment encoding either the NSs of TOSV, SFSV, PTA, or Punta Toro virus Balliet strain (PTB). In addition, we characterized rZH501 encoding a human dominant-negative PKR (PKRΔE7), which also enhances the immunogenicity of MP-12. Study done on mice revealed that attenuation of rZH501 occurred through the S-segment encoding either PKRΔE7 or SFSV NSs. However, rZH501 encoding either TOSV, PTA, or PTB NSs in the S-segment uniformly caused lethal encephalitis. Our results indicated that the S-segments encoding PKRΔE7 or SFSV NSs are attenuated and thus applicable toward next generation MP-12 vaccine candidates that encode a DIVA marker.
-
Ni, Bing; Yang, Ri-gao; Li, Yan-qiu; Wu, Yu-zhang
2004-01-01
To explore the immunological effect of genetic vaccine based on alpha-virus and to seek out better forms of gene vaccines. Expression plasmid P1A/pSMART2a and packaging plasmid helper were cotransfected into mammalian 293 cells by calcium phosphate precipitation method and high level of recombinant alpha-virus P1A/SFV was prepared. Following identification of rSFV and its expression, BALB/c mice were inoculated with rSFV, and the production of antigen-specific antibody and the cytotoxic effect of CTLs were determined. In the preventive and therapeutic experiments, the percents of tumor-free and of survival mice immunized with rSFV were observed. The recombinant SFV could express correctly in cultured cells. After being inoculated into the mice, rSFV could prime stronger CTL response than that in control mice. When the ratio of E/T cells was 100:1, the (51)Cr release rate reached 75%. No antibody could be detected in mice from all groups. The immunological effect of P1A/SFV among all groups was the best in both preventive and therapeutic experiment within experimental deadline. On 60th day in preventive experiment, the percent of tumor-free animal in P1A/SFV group reached 60%, whereas that was only 20% in P1A/pCI-neogroup. On 60th day in therapeutic experiment, survival rate of mice in P1A/SFV group reached 50%, but only 10% mice could survive in all control groups. Compared with common gene vaccines, the genetic vaccine based on recombinant SFV has the best immunological effect, which provides some new strategies for clinical genetic therapy of tumors.
-
Marker vaccine strategies and candidate CSFV marker vaccines.
Dong, Xiao-Nan; Chen, Ying-Hua
2007-01-04
Classical swine fever (CSF) is an economically important highly contagious disease of swine worldwide. Classical swine fever virus (CSFV) is its etiological agent, and the only natural hosts are domestic pigs and wild boars. Although field CSFV strains vary in the virulence, they all result in serious losses in pig industry. Highly virulent field strains generally cause acute disease and high mortality; moderately virulent field strains raise subacute or chronic infections; postnatal infection by low virulent field strains produces subclinical infection and mortality in the new-born piglets. CSFV can cross the placental barrier, and this transplacental transmission usually results in mortality of fetuses and birth of congenitally infected pigs with a late-onset disease and death. Two main strategies to control CSF epidemic are systematic prophylactic vaccination with live attenuated vaccines (such as C-strain) and non-vaccination stamping-out policy. But neither of them is satisfying enough. Marker vaccine and companion serological diagnostic test is thought to be a promising strategy for future control and eradication of CSF. During the past 15 years, various candidate marker vaccines were constructed and evaluated in the animal experiments, including recombinant chimeric vaccines, recombinant deletion vaccines, DNA vaccines, subunit vaccines and peptide vaccines. Among them, two subunit vaccines entered the large scale marker vaccine trial of EU in 1999. Although they failed to fulfil all the demands of the Scientific Veterinary Committee, they successfully induced solid immunity against CSFV in the vaccinated pigs. It can be expected that new potent marker vaccines might be commercially available and used in systematic prophylactic vaccination campaign or emergency vaccination in the next 15 years. Here, we summarized current strategies and candidate CSFV marker vaccines. These strategies and methods are also helpful for the development of new
-
Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto
2016-01-01
An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299
-
Update on the current status of cytomegalovirus vaccines
Sung, Heungsup; Schleiss, Mark R
2013-01-01
Human cytomegalovirus (HCMV) is ubiquitous in all populations, and is the most commonly recognized cause of congenital viral infection in developed countries. On the basis of the economic costs saved and the improvement in quality of life that could potentially be conferred by a successful vaccine for prevention of congenital HCMV infection, the Institute of Medicine has identified HCMV vaccine development as a major public health priority. An effective vaccine could potentially also be beneficial in preventing or ameliorating HCMV disease in immunocompromised individuals. Although there are no licensed HCMV vaccines currently available, enormous progress has been made in the last decade, as evidenced by the recently reported results of a Phase II trial of a glycoprotein B vaccine for the prevention of HCMV infection in seronegative women of childbearing age. HCMV vaccines currently in clinical trials include: glycoprotein B subunit vaccines; alphavirus replicon particle vaccines; DNA vaccines; and live-attenuated vaccines. A variety of vaccine strategies are also being examined in preclinical systems and animal models of infection. These include: recombinant vesicular stomatitis virus vaccines; recombinant modified vaccinia virus Ankara; replication-deficient adenovirus-vectored vaccines; and recombinant live-attenuated virus vaccines generated by mutagenesis of cloned rodent CMV genomes maintained as bacterial artificial chromosomes in Escherichia coli. In this article, we provide an overview of the current state of clinical trials and preclinical development of vaccines against HCMV, with an emphasis on studies that have been conducted in the past 5 years. We also summarize a number of recent advances in the study of the biology of HCMV, particularly with respect to epithelial and endothelial cell entry of the virus, which have implications for future vaccine design. PMID:21087108
-
Trisubstituted Thieno[3,2-b]pyrrole 5-Carboxamides as Potent Inhibitors of Alphaviruses.
Ching, Kuan-Chieh; Kam, Yiu-Wing; Merits, Andres; Ng, Lisa F P; Chai, Christina L L
2015-12-10
Chikungunya virus (CHIKV) is a re-emerging vector-borne alphavirus and is transmitted to humans by Aedes mosquitoes. Despite the re-emergence of CHIKV as an epidemic threat, there is no approved effective antiviral treatment currently available for CHIKV. Herein, we report the synthesis and structure-activity relationship studies of a class of thieno[3,2-b]pyrroles and the discovery of a trisubstituted thieno[3,2-b]pyrrole 5-carboxamide 15c that exhibits potent inhibitory activity against in vitro CHIKV infection. Compound 15c displayed low micromolar activity (EC50 value of ca. 2 μM) and limited cytotoxic liability (CC50 > 100 μM) therefore furnishing a selectivity index of greater than 32. Notably, 15c not only controlled viral RNA production, but efficiently inhibited the expression of CHIKV nsP1, nsP3, capsid, and E2 proteins at a concentration as low as 2.5 μM. More importantly, 15c also demonstrated broad spectrum antiviral activity against other clinically important alphaviruses such as O'nyong-nyong virus and Sindbis virus.
-
Characterization of a candidate tetravalent vaccine based on 2'-O-methyltransferase mutants
Züst, Roland; Li, Shi-Hua; Xie, Xuping; Velumani, Sumathy; Chng, Melissa; Toh, Ying-Xiu; Zou, Jing; Dong, Hongping; Shan, Chao; Pang, Jassia; Qin, Cheng-Feng; Newell, Evan W.; Shi, Pei-Yong
2018-01-01
Dengue virus (DENV) is one of the most widespread arboviruses. The four DENV serotypes infect about 400 million people every year, causing 96 million clinical dengue cases, of which approximately 500’000 are severe and potentially life-threatening. The only licensed vaccine has a limited efficacy and is only recommended in regions with high endemicity. We previously reported that 2’-O-methyltransferase mutations in DENV-1 and DENV-2 block their capacity to inhibit type I IFNs and render the viruses attenuated in vivo, making them amenable as vaccine strains; here we apply this strategy to all four DENV serotypes to generate a tetravalent, non-chimeric live-attenuated dengue vaccine. 2’-O-methyltransferase mutants of all four serotypes are highly sensitive to type I IFN inhibition in human cells. The tetravalent formulation is attenuated and immunogenic in mice and cynomolgus macaques and elicits a response that protects from virus challenge. These results show the potential of 2’-O-methyltransferase mutant viruses as a safe, tetravalent, non-chimeric dengue vaccine. PMID:29298302
-
Vietheer, Patricia T K; Boo, Irene; Drummer, Heidi E; Netter, Hans-Jürgen
2007-01-01
Virus-like particles (VLPs) are highly immunogenic and proven to induce protective immunity. The small surface antigen (HBsAg-S) of hepatitis B virus (HBV) self-assembles into VLPs and its use as a vaccine results in protective antiviral immunity against HBV infections. Chimeric HBsAg-S proteins carrying foreign epitopes allow particle formation and have the ability to induce anti-foreign humoral and cellular immune responses. The insertion of the hypervariable region 1 (HVR1) sequence derived from the envelope protein 2 (E2) of hepatitis C virus (HCV) into the major antigenic site of HBsAg-S ('a'-determinant) resulted in the formation of highly immunogenic VLPs that retained the antigenicity of the inserted HVR1 sequence. BALB/c mice were immunized with chimeric VLPs, which resulted in antisera with anti-HCV activity. The antisera were able to immunoprecipitate native HCV envelope complexes (E1E2) containing homologous or heterologous HVR1 sequences. HCV E1E2 pseudotyped HIV-1 particles (HCVpp) were used to measure entry into HuH-7 target cells in the presence or absence of antisera that were raised against chimeric VLPs. Anti-HVR1 VLP sera interfered with entry of entry-competent HCVpps containing either homologous or heterologous HVR1 sequences. Also, immunizations with chimeric VLPs induced antisurface antigen (HBsAg) antibodies, indicating that HBV-specific antigenicity and immunogenicity of the 'a'-determinant region is retained. A multivalent vaccine against different pathogens based on the HBsAg delivery platform should be possible. We hypothesize that custom design of VLPs with an appropriate set of HCV-neutralizing epitopes will induce antibodies that would serve to decrease the viral load at the initial infecting inoculum.
-
Monath, Thomas P; Seligman, Stephen J; Robertson, James S; Guy, Bruno; Hayes, Edward B; Condit, Richard C; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T
2015-01-01
The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called "chimeric virus vaccines"). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus, Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were exchanged for the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of
-
Chen, Weiqiang; Foo, Suan-Sin; Zaid, Ali; Teng, Terk-Shin; Herrero, Lara J; Wolf, Stefan; Tharmarajah, Kothila; Vu, Luan D; van Vreden, Caryn; Taylor, Adam; Freitas, Joseph R; Li, Rachel W; Woodruff, Trent M; Gordon, Richard; Ojcius, David M; Nakaya, Helder I; Kanneganti, Thirumala-Devi; O'Neill, Luke A J; Robertson, Avril A B; King, Nicholas J; Suhrbier, Andreas; Cooper, Matthew A; Ng, Lisa F P; Mahalingam, Suresh
2017-10-01
Mosquito-borne viruses can cause severe inflammatory diseases and there are limited therapeutic solutions targeted specifically at virus-induced inflammation. Chikungunya virus (CHIKV), a re-emerging alphavirus responsible for several outbreaks worldwide in the past decade, causes debilitating joint inflammation and severe pain. Here, we show that CHIKV infection activates the NLRP3 inflammasome in humans and mice. Peripheral blood mononuclear cells isolated from CHIKV-infected patients showed elevated NLRP3, caspase-1 and interleukin-18 messenger RNA expression and, using a mouse model of CHIKV infection, we found that high NLRP3 expression was associated with peak inflammatory symptoms. Inhibition of NLRP3 activation using the small-molecule inhibitor MCC950 resulted in reduced CHIKV-induced inflammation and abrogated osteoclastogenic bone loss and myositis, but did not affect in vivo viral replication. Mice treated with MCC950 displayed lower expression levels of the cytokines interleukin-6, chemokine ligand 2 and tumour necrosis factor in joint tissue. Interestingly, MCC950 treatment abrogated disease signs in mice infected with a related arthritogenic alphavirus, Ross River virus, but not in mice infected with West Nile virus-a flavivirus. Here, using mouse models of alphavirus-induced musculoskeletal disease, we demonstrate that NLRP3 inhibition in vivo can reduce inflammatory pathology and that further development of therapeutic solutions targeting inflammasome function could help treat arboviral diseases.
-
Monath, Thomas P.; Seligman, Stephen J.; Robertson, James S.; Guy, Bruno; Hayes, Edward B.; Condit, Richard C.; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T
2015-01-01
The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called “chimeric virus vaccines”). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were replaced by the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of
-
Longley, Rhea J; Halbroth, Benedict R; Salman, Ahmed M; Ewer, Katie J; Hodgson, Susanne H; Janse, Chris J; Khan, Shahid M; Hill, Adrian V S; Spencer, Alexandra J
2017-03-01
Efforts are under way to improve the efficacy of subunit malaria vaccines through assessments of new adjuvants, vaccination platforms, and antigens. In this study, we further assessed the Plasmodium falciparum antigen upregulated in infective sporozoites 3 (PfUIS3) as a vaccine candidate. PfUIS3 was expressed in the viral vectors chimpanzee adenovirus 63 (ChAd63) and modified vaccinia virus Ankara (MVA) and used to immunize mice in a prime-boost regimen. We previously demonstrated that this regimen could provide partial protection against challenge with chimeric P. berghei parasites expressing PfUIS3. We now show that ChAd63-MVA PfUIS3 can also provide partial cross-species protection against challenge with wild-type P. berghei parasites. We also show that PfUIS3-specific cellular memory responses could be recalled in human volunteers exposed to P. falciparum parasites in a controlled human malaria infection study. When ChAd63-MVA PfUIS3 was coadministered with the vaccine candidate P. falciparum thrombospondin-related adhesion protein (PfTRAP) expressed in the ChAd63-MVA system, there was no significant change in immunogenicity to either vaccine. However, when mice were challenged with double chimeric P. berghei - P. falciparum parasites expressing both PfUIS3 and PfTRAP, vaccine efficacy was improved to 100% sterile protection. This synergistic effect was evident only when the two vaccines were mixed and administered at the same site. We have therefore demonstrated that vaccination with PfUIS3 can induce a consistent delay in patent parasitemia across mouse strains and against chimeric parasites expressing PfUIS3 as well as wild-type P. berghei ; when this vaccine is combined with another partially protective regimen (ChAd63-MVA PfTRAP), complete protection is induced. Copyright © 2017 Longley et al.
-
Phillips, Aaron T; Schountz, Tony; Toth, Ann M; Rico, Amber B; Jarvis, Donald L; Powers, Ann M; Olson, Ken E
2014-02-01
Alphaviruses are mosquito-borne viruses that cause significant disease in animals and humans. Western equine encephalitis virus (WEEV) and eastern equine encephalitis virus (EEEV), two New World alphaviruses, can cause fatal encephalitis, and EEEV is a select agent of concern in biodefense. However, we have no antiviral therapies against alphaviral disease, and current vaccine strategies target only a single alphavirus species. In an effort to develop new tools for a broader response to outbreaks, we designed and tested a novel alphavirus vaccine comprised of cationic lipid nucleic acid complexes (CLNCs) and the ectodomain of WEEV E1 protein (E1ecto). Interestingly, we found that the CLNC component, alone, had therapeutic efficacy, as it increased survival of CD-1 mice following lethal WEEV infection. Immunization with the CLNC-WEEV E1ecto mixture (lipid-antigen-nucleic acid complexes [LANACs]) using a prime-boost regimen provided 100% protection in mice challenged with WEEV subcutaneously, intranasally, or via mosquito. Mice immunized with LANACs mounted a strong humoral immune response but did not produce neutralizing antibodies. Passive transfer of serum from LANAC E1ecto-immunized mice to nonimmune CD-1 mice conferred protection against WEEV challenge, indicating that antibody is sufficient for protection. In addition, the LANAC E1ecto immunization protocol significantly increased survival of mice following intranasal or subcutaneous challenge with EEEV. In summary, our LANAC formulation has therapeutic potential and is an effective vaccine strategy that offers protection against two distinct species of alphavirus irrespective of the route of infection. We discuss plausible mechanisms as well the potential utility of our LANAC formulation as a pan-alphavirus vaccine.
-
IMOJEV(®): a Yellow fever virus-based novel Japanese encephalitis vaccine.
Appaiahgari, Mohan Babu; Vrati, Sudhanshu
2010-12-01
Japanese encephalitis (JE) is a disease of the CNS caused by Japanese encephalitis virus (JEV). The disease appears in the form of frequent outbreaks in most south- and southeast Asian countries and the virus has become endemic in several areas. There is no licensed therapy available and disease control by vaccination is considered to be most effective. Mouse brain-derived inactivated JE vaccines, although immunogenic, have several limitations in terms of safety, availability and requirement for multiple doses. Owing to these drawbacks, the WHO called for the development of novel, safe and more efficacious JE vaccines. Several candidate vaccines have been developed and at least three of them that demonstrated strong immunogenicity after one or two doses of the vaccine in animal models were subsequently tested in various clinical trials. One of these vaccines, IMOJEV(®) (JE-CV and previously known as ChimeriVax™-JE), is a novel recombinant chimeric virus vaccine, developed using the Yellow fever virus (YFV) vaccine vector YFV17D, by replacing the cDNA encoding the envelope proteins of YFV with that of an attenuated JEV strain SA14-14-2. IMOJEV was found to be safe, highly immunogenic and capable of inducing long-lasting immunity in both preclinical and clinical trials. Moreover, a single dose of IMOJEV was sufficient to induce protective immunity, which was similar to that induced in adults by three doses of JE-VAX(®), a mouse brain-derived inactivated JE vaccine. Recently, Phase III trials evaluating the immunogenicity and safety of the chimeric virus vaccine have been successfully completed in some JE-endemic countries and the vaccine manufacturers have filed an application for vaccine registration. IMOJEV may thus be licensed for use in humans as an improved alternative to the currently licensed JE vaccines.
-
Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I
2014-10-01
Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.
-
De la Rosa, Georgina Paz; Monroy-García, Alberto; Mora-García, María de Lourdes; Peña, Cristina Gehibie Reynaga; Hernández-Montes, Jorge; Weiss-Steider, Benny; Lim, Miguel Angel Gómez
2009-01-01
Background Even though two prophylactic vaccines against HPV are currently licensed, infections by the virus continue to be a major health problem mainly in developing countries. The cost of the vaccines limits wide-scale application in poor countries. A promising strategy for producing affordable and efficient vaccines involves the expression of recombinant immunogens in plants. Several HPV genes have been expressed in plants, including L1, which can self-assemble into virus-like particles. A plant-based, dual prophylactic/therapeutic vaccine remains an attractive possibility. Results We sought to express in tomato plants chimeric HPV 16 VLPs containing L1 fused to a string of epitopes from HPV 16 E6 and E7 proteins. The L1 employed had been modified to eliminate a strong inhibitory region at the 5' end of the molecule to increase expression levels. Several tomato lines were obtained expressing either L1 alone or L1-E6/E7 from 0.05% to 0.1% of total soluble protein. Stable integration of the transgenes was verified by Southern blot. Northern and western blot revealed successful expression of the transgenes at the mRNA and protein level. The chimeric VLPs were able to assemble adequately in tomato cells. Intraperitoneal administration in mice was able to elicit both neutralizing antibodies against the viral particle and cytotoxic T-lymphocytes activity against the epitopes. Conclusion In this work, we report for the first time the expression in plants of a chimeric particle containing the HPV 16 L1 sequence and a string of T-cell epitopes from HPV 16 E6 and E7 fused to the C-terminus. The particles were able to induce a significant antibody and cytotoxic T-lymphocytes response. Experiments in vivo are in progress to determine whether the chimeric particles are able to induce regression of disease and resolution of viral infection in mice. Chimeric particles of the type described in this work may potentially be the basis for developing prophylactic
-
Matzinger, Shannon R; Opriessnig, Tanja; Xiao, Chao-Ting; Catanzaro, Nicholas; Beach, Nathan M; Slade, David E; Nitzel, Gregory P; Meng, Xiang-Jin
2016-11-01
Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus-associated disease (PCVAD). Available commercial vaccines all target PCV2a subtype, although the circulating predominant subtype worldwide is PCV2b, and the emerging PCV2d subtype is also increasingly associated with PCVAD. Here we molecularly bred genetically-divergent strains representing PCV2a, PCV2b, PCV2c, PCV2d, and "divergent PCV2a" subtypes by DNA-shuffling of the capsid genes to produce a chimeric virus representing PCV2 global genetic diversity. When placed in the PCV2a backbone, one chimeric virus (PCV2-3cl14) induced higher neutralizing antibody titers against different PCV2 subtypes. Subsequently, a candidate vaccine (PCV1-3cl14) was produced by cloning the shuffled 3cl14 capsid into the backbone of the non-pathogenic PCV1. A vaccine efficacy study revealed that chimeric virus PCV1-3cl14 induces protective immunity against challenge with PCV2b or PCV2d in pigs. The chimeric PCV1-3cl14 virus is a strong candidate for a novel vaccine in pigs infected with variable PCV2 strains. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Kim, Shin-Hee; Samal, Siba K
2017-07-24
Avian Influenza virus (AIV) is an important pathogen for both human and animal health. There is a great need to develop a safe and effective vaccine for AI infections in the field. Live-attenuated Newcastle disease virus (NDV) vectored AI vaccines have shown to be effective, but preexisting antibodies to the vaccine vector can affect the protective efficacy of the vaccine in the field. To improve the efficacy of AI vaccine, we generated a novel vectored vaccine by using a chimeric NDV vector that is serologically distant from NDV. In this study, the protective efficacy of our vaccines was evaluated by using H5N1 highly pathogenic avian influenza virus (HPAIV) strain A/Vietnam/1203/2004, a prototype strain for vaccine development. The vaccine viruses were three chimeric NDVs expressing the hemagglutinin (HA) protein in combination with the neuraminidase (NA) protein, matrix 1 protein, or nonstructural 1 protein. Comparison of their protective efficacy between a single and prime-boost immunizations indicated that prime immunization of 1-day-old SPF chicks with our vaccine viruses followed by boosting with the conventional NDV vector strain LaSota expressing the HA protein provided complete protection of chickens against mortality, clinical signs and virus shedding. Further verification of our heterologous prime-boost immunization using commercial broiler chickens suggested that a sequential immunization of chickens with chimeric NDV vector expressing the HA and NA proteins following the boost with NDV vector expressing the HA protein can be a promising strategy for the field vaccination against HPAIVs and against highly virulent NDVs. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Evolution and spread of Venezuelan equine encephalitis complex alphavirus in the Americas
Dugan, Vivian G.; Auguste, Albert J.; Lin, David; Adams, A. Paige; Chen, Rubing; Gorchakov, Rodion; Leal, Grace; Estrada-Franco, Jose G.; Pandya, Jyotsna; Halpin, Rebecca A.; Hari, Kumar; Jain, Ravi; Stockwell, Timothy B.; Das, Suman R.; Wentworth, David E.; Smith, Martin D.; Kosakovsky Pond, Sergei L.; Weaver, Scott C.
2017-01-01
Venezuelan equine encephalitis (VEE) complex alphaviruses are important re-emerging arboviruses that cause life-threatening disease in equids during epizootics as well as spillover human infections. We conducted a comprehensive analysis of VEE complex alphaviruses by sequencing the genomes of 94 strains and performing phylogenetic analyses of 130 isolates using complete open reading frames for the nonstructural and structural polyproteins. Our analyses confirmed purifying selection as a major mechanism influencing the evolution of these viruses as well as a confounding factor in molecular clock dating of ancestors. Times to most recent common ancestors (tMRCAs) could be robustly estimated only for the more recently diverged subtypes; the tMRCA of the ID/IAB/IC/II and IE clades of VEE virus (VEEV) were estimated at ca. 149–973 years ago. Evolution of the IE subtype has been characterized by a significant evolutionary shift from the rest of the VEEV complex, with an increase in structural protein substitutions that are unique to this group, possibly reflecting adaptation to its unique enzootic mosquito vector Culex (Melanoconion) taeniopus. Our inferred tree topologies suggest that VEEV is maintained primarily in situ, with only occasional spread to neighboring countries, probably reflecting the limited mobility of rodent hosts and mosquito vectors. PMID:28771475
-
Opriessnig, Tanja; O'Neill, Kevin; Gerber, Priscilla F; de Castro, Alessandra M M G; Gimenéz-Lirola, Luis G; Beach, Nathan M; Zhou, Lei; Meng, Xiang-Jin; Wang, Chong; Halbur, Patrick G
2013-01-07
The predominant genotype of porcine circovirus (PCV) in the pig population today is PCV2b yet PCV2a-based commercial vaccines are considered effective in protecting against porcine circovirus associated disease. The objective of this study was to compare the ability of PCV2a- and PCV2b-based vaccines to control PCV2b viremia in a challenge model that mimics the U.S. field situation. Sixty-three pigs were randomly assigned to one of eight groups. Sixteen pigs were vaccinated with an experimental live-attenuated chimeric PCV1-2a vaccine based on genotype 2a and another 16 pigs with a chimeric PCV1-2b vaccine based on genotype 2b. Challenge was done 28 days post vaccination (dpv) using PCV2b (or a combination of PCV2a and PCV2b), porcine reproductive and respiratory syndrome virus (PRRSV), and porcine parvovirus (PPV) to mimic what commonly occurs in the field. The experiment was terminated 21 days post challenge (dpc) or 49dpv. Pigs vaccinated with the chimeric PCV1-2b vaccine had significantly higher levels of PCV1-2b viremia and shedding of the PCV1-2b vaccine virus in feces and nasal secretions but also a more robust humoral immune response as evidenced by significantly higher ELISA S/P ratios compared to the PCV1-2a vaccination. Regardless of challenge, the PCV1-2b vaccination significantly reduced the prevalence and amount of PCV2 viremia compared to the PCV1-2a vaccination. Interestingly, in the non-vaccinated pigs concurrent PCV2a infection resulted in clinical disease and increased macroscopic lung lesions compared to pigs challenged with PCV2b alone, further supporting the idea that concurrent PCV2a/PCV2b infection is necessary for optimal PCV2 replication. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Hemann, Michelle; Beach, Nathan M; Meng, Xiang-Jin; Wang, Chong; Halbur, Patrick G; Opriessnig, Tanja
2014-01-01
The objective of this pilot study was to determine the efficacy of inactivated (1 or 2 dose) and live-attenuated chimeric porcine circovirus (PCV)1-2 vaccines in sows using the PCV2-spiked semen model. Thirty-five sows were randomly divided into 6 groups: negative and positive controls, 1 dose inactivated PCV1-2 vaccine challenged (1-VAC-PCV2), 2 dose inactivated PCV1-2 vaccine challenged (2-VAC-PCV2), 1 dose live-attenuated PCV1-2 vaccine unchallenged (1-LIVE-VAC), and 1 dose live-attenuated PCV1-2 vaccine challenged (1-LIVE-VAC-PCV2). The inactivated PCV1-2 vaccine induced higher levels of PCV2-specific antibodies in dams. All vaccination strategies provided good protection against PCV2 viremia in dams, whereas the majority of the unvaccinated sows were viremic. Four of the 35 dams became pregnant: a negative control, a positive control, a 2-VAC-PCV2 sow, and a 1-LIVE-VAC-PCV2 sow. The PCV2 DNA was detected in 100%, 67%, and 29% of the fetuses obtained from the positive control, inactivated vaccinated, or live-attenuated vaccinated dams, respectively. The PCV2 antigen in hearts was only detectable in the positive control litter (23% of the fetuses). The PCV1-2 DNA was detected in 29% of the fetuses in the litter from the 1-LIVE-VAC-PCV2 dam. Under the conditions of this pilot study, both vaccines protected against PCV2 viremia in breeding age animals; however, vertical transmission was not prevented.
-
Hemann, Michelle; Beach, Nathan M.; Meng, Xiang-Jin; Wang, Chong; Halbur, Patrick G.; Opriessnig, Tanja
2014-01-01
The objective of this pilot study was to determine the efficacy of inactivated (1 or 2 dose) and live-attenuated chimeric porcine circovirus (PCV)1-2 vaccines in sows using the PCV2-spiked semen model. Thirty-five sows were randomly divided into 6 groups: negative and positive controls, 1 dose inactivated PCV1-2 vaccine challenged (1-VAC-PCV2), 2 dose inactivated PCV1-2 vaccine challenged (2-VAC-PCV2), 1 dose live-attenuated PCV1-2 vaccine unchallenged (1-LIVE-VAC), and 1 dose live-attenuated PCV1-2 vaccine challenged (1-LIVE-VAC-PCV2). The inactivated PCV1-2 vaccine induced higher levels of PCV2-specific antibodies in dams. All vaccination strategies provided good protection against PCV2 viremia in dams, whereas the majority of the unvaccinated sows were viremic. Four of the 35 dams became pregnant: a negative control, a positive control, a 2-VAC-PCV2 sow, and a 1-LIVE-VAC-PCV2 sow. The PCV2 DNA was detected in 100%, 67%, and 29% of the fetuses obtained from the positive control, inactivated vaccinated, or live-attenuated vaccinated dams, respectively. The PCV2 antigen in hearts was only detectable in the positive control litter (23% of the fetuses). The PCV1-2 DNA was detected in 29% of the fetuses in the litter from the 1-LIVE-VAC-PCV2 dam. Under the conditions of this pilot study, both vaccines protected against PCV2 viremia in breeding age animals; however, vertical transmission was not prevented. PMID:24396175
-
Fraiberk, Martin; Hájková, Michaela; Krulová, Magdaléna; Kojzarová, Martina; Drda Morávková, Alena; Pšikal, Ivan
2017-01-01
The aim of this study was to develop a suitable vaccine antigen against porcine circovirus 2 (PCV2), the causative agent of post-weaning multi-systemic wasting syndrome, which causes significant economic losses in swine breeding. Chimeric antigens containing PCV2b Cap protein sequences based on the mouse polyomavirus (MPyV) nanostructures were developed. First, universal vectors for baculovirus-directed production of chimeric MPyV VLPs or pentamers of the major capsid protein, VP1, were designed for their exploitation as vaccines against other pathogens. Various strategies were employed based on: A) exposure of selected immunogenic epitopes on the surface of MPyV VLPs by insertion into a surface loop of the VP1 protein, B) insertion of foreign protein molecules inside the VLPs, or C) fusion of a foreign protein or its part with the C-terminus of VP1 protein, to form giant pentamers of a chimeric protein. We evaluated these strategies by developing a recombinant vaccine against porcine circovirus 2. All candidate vaccines induced the production of antibodies against the capsid protein of porcine circovirus after immunization of mice. The candidate vaccine, Var C, based on fusion of mouse polyomavirus and porcine circovirus capsid proteins, could induce the production of antibodies with the highest PCV2 neutralizing capacity. Its ability to induce the production of neutralization antibodies was verified after immunization of pigs. The advantage of this vaccine, apart from its efficient production in insect cells and easy purification, is that it represents a DIVA (differentiating infected from vaccinated animals) vaccine, which also induces an immune response against the mouse polyoma VP1 protein and is thus able to distinguish between vaccinated and naturally infected animals. PMID:28922413
-
Boot, Maikel; Cobos Jiménez, Viviana; Kootstra, Neeltje A.; Sanders, Rogier W.
2013-01-01
HIV-1 acquisition can be prevented by broadly neutralizing antibodies (BrNAbs) that target the envelope glycoprotein complex (Env). An ideal vaccine should therefore be able to induce BrNAbs that can provide immunity over a prolonged period of time, but the low intrinsic immunogenicity of HIV-1 Env makes the elicitation of such BrNAbs challenging. Co-stimulatory molecules can increase the immunogenicity of Env and we have engineered a soluble chimeric Env trimer with an embedded granulocyte-macrophage colony-stimulating factor (GM-CSF) domain. This chimeric molecule induced enhanced B and helper T cell responses in mice compared to Env without GM-CSF. We studied whether we could optimize the activity of the embedded GM-CSF as well as the antigenic structure of the Env component of the chimeric molecule. We assessed the effect of truncating GM-CSF, removing glycosylation-sites in GM-CSF, and adjusting the linker length between GM-CSF and Env. One of our designed EnvGM-CSF chimeras improved GM-CSF-dependent cell proliferation by 6-fold, reaching the same activity as soluble recombinant GM-CSF. In addition, we incorporated GM-CSF into a cleavable Env trimer and found that insertion of GM-CSF did not compromise Env cleavage, while Env cleavage did not compromise GM-CSF activity. Importantly, these optimized EnvGM-CSF proteins were able to differentiate human monocytes into cells with a macrophage-like phenotype. Chimeric EnvGM-CSF should be useful for improving humoral immunity against HIV-1 and these studies should inform the design of other chimeric proteins. PMID:23565193
-
Mahdavi, Manijeh; Keyhanfar, Mehrnaz; Jafarian, Abbas; Mohabatkar, Hassan; Rabbani, Mohammad
2014-12-01
Because of direct stimulating immune system against disease, vaccination or active immunotherapy is preferable compared to passive immunotherapy. For this purpose, a newly designed chimeric peptide containing epitopes for both B and T cells from HER2 ECD subdomain III was proposed. To evaluate the effects of the active immunization, a discontinuous B cell epitope peptide was selected based on average antigenicity by bioinformatics analysis. The selected peptide was collinearly synthesized as a chimera with a T helper epitope from the protein sequence of measles virus fusion (208-302) using the GPSL linker. Three mice were immunized with the chimeric peptide. Reactive antibodies with HER2 protein in ELISA and immunofluorescence assays with no cross-reactivity were generated. The 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay indicated that the anti-peptide sera had inhibitory effects on proliferation of SK-BR-3 cells. Hence, the newly designed, discontinuous chimeric peptide representing B and T cell epitopes from subdomain III of HER2-ECD can form the basis for future vaccines design, where these data can be applied for monoclonal antibody production targeting the distinct epitope of HER2 receptor compared to the two broadly used anti-HER2 monoclonal antibodies, Herceptin and pertuzumab.
-
Chimeric enzymes with improved cellulase activities
Xu, Qi; Baker, John O; Himmel, Michael E
2015-03-31
Nucleic acid molecules encoding chimeric cellulase polypeptides that exhibit improved cellulase activities are disclosed herein. The chimeric cellulase polypeptides encoded by these nucleic acids and methods to produce the cellulases are also described, along with methods of using chimeric cellulases for the conversion of cellulose to sugars such as glucose.
-
DNA and RNA-based vaccines: principles, progress and prospects
Leitner, Wolfgang W.; Ying, Han; Restifo, Nicholas P.
2007-01-01
DNA vaccines were introduced less than a decade ago but have already been applied to a wide range of infectious and malignant diseases. Here we review the current understanding of the mechanisms underlying the activities of these new vaccines. We focus on recent strategies designed to enhance their function including the use of immunostimulatory (CpG) sequences, dendritic cells (DC), co-stimulatory molecules and cytokine- and chemokine-adjuvants. Although genetic vaccines have been significantly improved, they may not be sufficiently immunogenic for the therapeutic vaccination of patients with infectious diseases or cancer in clinical trials. One promising approach aimed at dramatically increasing the immunogenicity of genetic vaccines involves making them ‘self-replicating’. This can be accomplished by using a gene encoding RNA replicase, a polyprotein derived from alphaviruses, such as Sindbis virus. Replicase-containing RNA vectors are significantly more immunogenic than conventional plasmids, immunizing mice at doses as low as 0.1 μg of nucleic acid injected once intramuscularly. Cells transfected with ‘self-replicating’ vectors briefly produce large amounts of antigen before undergoing apoptotic death. This death is a likely result of requisite double-stranded (ds) RNA intermediates, which also have been shown to super-activate DC. Thus, the enhanced immunogenicity of ‘self-replicating’ genetic vaccines may be a result of the production of pro-inflammatory dsRNA, which mimics an RNA-virus infection of host cells. PMID:10580187
-
Rahhal, Dina N.; Xu, Hong; Huang, Wei-Chao; Wu, Shengli; Wen, Yujie; Huang, Yiming; Ildstad, Suzanne T.
2009-01-01
Background Mixed chimerism induces donor-specific tolerance to composite tissue allotransplants (CTA). In the present studies, we used a nonmyeloablative conditioning approach to establish chimerism and promote CTA acceptance. Methods WF (RT1Au) rats were conditioned with 600-300 cGy total body irradiation (TBI, day-1), 100 × 106 T cell-depleted ACI (RT1Aabl) bone marrow cells were transplanted day 0, followed by a 11-day course of tacrolimus and one dose of anti-lymphocyte serum (day 10). Heterotopic osteomyocutaneous flap transplantation was performed 4-6 weeks after bone marrow transplantation. Results Mixed chimerism was initially achieved in almost all recipients, but long-term acceptance of CTA was only achieved in rats treated with 600 cGy TBI. When anti-αβ-TCR mAb (day-3) was added into the regimens, donor chimerism was similar to recipients preconditioned without anti-αβ-TCR mAb. However, the long-term CTA survival was significantly improved in chimeras receiving ≥ 300 cGy TBI plus anti-αβ-TCR mAb. Higher levels of donor chimerism were associated with CTA acceptance. The majority of flap-acceptors lost peripheral blood (PB) chimerism within 6 months. However, donor chimerism persisted in transplanted bone at significantly higher levels compared to other hematopoietic compartments. The compartment donor chimerism may be responsible for the maintenance of tolerance to CTA. Long-term acceptors were tolerant to a donor skin graft challenge even in the absence of PB chimerism. Conclusions Mixed chimerism established by nonmyeloablative conditioning induces long-term acceptance of CTA which is associated with persistent chimerism preferentially in transplanted donor bone. PMID:19920776
-
Peptide Vaccines for Leishmaniasis.
De Brito, Rory C F; Cardoso, Jamille M De O; Reis, Levi E S; Vieira, Joao F; Mathias, Fernando A S; Roatt, Bruno M; Aguiar-Soares, Rodrigo Dian D O; Ruiz, Jeronimo C; Resende, Daniela de M; Reis, Alexandre B
2018-01-01
Due to an increase in the incidence of leishmaniases worldwide, the development of new strategies such as prophylactic vaccines to prevent infection and decrease the disease have become a high priority. Classic vaccines against leishmaniases were based on live or attenuated parasites or their subunits. Nevertheless, the use of whole parasite or their subunits for vaccine production has numerous disadvantages. Therefore, the use of Leishmania peptides to design more specific vaccines against leishmaniases seems promising. Moreover, peptides have several benefits in comparison with other kinds of antigens, for instance, good stability, absence of potentially damaging materials, antigen low complexity, and low-cost to scale up. By contrast, peptides are poor immunogenic alone, and they need to be delivered correctly. In this context, several approaches described in this review are useful to solve these drawbacks. Approaches, such as, peptides in combination with potent adjuvants, cellular vaccinations, adenovirus, polyepitopes, or DNA vaccines have been used to develop peptide-based vaccines. Recent advancements in peptide vaccine design, chimeric, or polypeptide vaccines and nanovaccines based on particles attached or formulated with antigenic components or peptides have been increasingly employed to drive a specific immune response. In this review, we briefly summarize the old, current, and future stands on peptide-based vaccines, describing the disadvantages and benefits associated with them. We also propose possible approaches to overcome the related weaknesses of synthetic vaccines and suggest future guidelines for their development.
-
Vaccine Platforms to Control Arenaviral Hemorrhagic Fevers.
Carrion, Ricardo; Bredenbeek, Peter; Jiang, Xiaohong; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S
2012-11-20
Arenaviruses are rodent-borne emerging human pathogens. Diseases caused by these viruses, e.g., Lassa fever (LF) in West Africa and South American hemorrhagic fevers (HFs), are serious public health problems in endemic areas. We have employed replication-competent and replication-deficient strategies to design vaccine candidates potentially targeting different groups "at risk". Our leader LF vaccine candidate, the live reassortant vaccine ML29, is safe and efficacious in all tested animal models including non-human primates. In this study we showed that treatment of fatally infected animals with ML29 two days after Lassa virus (LASV) challenge protected 80% of the treated animals. In endemic areas, where most of the target population is poor and many live far from health care facilities, a single-dose vaccination with ML29 would be ideal solution. Once there is an outbreak, a fast-acting vaccine or post-exposure prophylaxis would be best. The 2(nd) vaccine technology is based on Yellow Fever (YF) 17D vaccine. We designed YF17D-based recombinant viruses expressing LASV glycoproteins (GP) and showed protective efficacy of these recombinants. In the current study we developed a novel technology to clone LASV nucleocapsid within YF17D C gene. Low immunogenicity and stability of foreign inserts must be addressed to design successful LASV/YFV bivalent vaccines to control LF and YF in overlapping endemic areas of West Africa. The 3(rd) platform is based on the new generation of alphavirus replicon virus-like-particle vectors (VLPV). Using this technology we designed VLPV expressing LASV GP with enhanced immunogenicity and bivalent VLPV expressing cross-reactive GP of Junin virus (JUNV) and Machupo virus (MACV), causative agents of Argentinian and Bolivian HF, respectively. A prime-boost regimen required for VLPV immunization might be practical for medical providers, military, lab personnel, and visitors in endemic areas.
-
Rahhal, Dina N; Xu, Hong; Huang, Wei-Chao; Wu, Shengli; Wen, Yujie; Huang, Yiming; Ildstad, Suzanne T
2009-09-27
Mixed chimerism induces donor-specific tolerance to composite tissue allotransplants (CTAs). In the present studies, we used a nonmyeloablative conditioning approach to establish chimerism and promote CTA acceptance. Wistar Furth (RT1A(u)) rats were conditioned with 600 to 300 cGy total body irradiation (TBI, day-1), and 100 x 10(6) T-cell-depleted ACI (RT1A(abl)) bone marrow cells were transplanted on day 0, followed by a 11-day course of tacrolimus and one dose of antilymphocyte serum (day 10). Heterotopic osteomyocutaneous flap transplantation was performed 4 to 6 weeks after bone marrow transplantation. Mixed chimerism was initially achieved in almost all recipients, but long-term acceptance of CTA was only achieved in rats treated with 600 cGy TBI. When anti-alphabeta-T-cell receptor (TCR) monoclonal antibody (mAb) (day-3) was added into the regimens, donor chimerism was similar to recipients preconditioned without anti-alphabeta-TCR mAb. However, the long-term CTA survival was significantly improved in chimeras receiving more than or equal to 300 cGy TBI plus anti-alphabeta-TCR mAb. Higher levels of donor chimerism were associated with CTA acceptance. The majority of flap acceptors lost peripheral blood chimerism within 6 months. However, donor chimerism persisted in the transplanted bone at significantly higher levels compared with other hematopoietic compartments. The compartment donor chimerism may be responsible for the maintenance of tolerance to CTA. Long-term acceptors were tolerant to a donor skin graft challenge even in the absence of peripheral blood chimerism. Mixed chimerism established by nonmyeloablative conditioning induces long-term acceptance of CTA, which is associated with persistent chimerism preferentially in the transplanted donor bone.
-
Dengue vaccine development: strategies and challenges.
Ramakrishnan, Lakshmy; Pillai, Madhavan Radhakrishna; Nair, Radhakrishnan R
2015-03-01
Infection with dengue virus may result in dengue fever or a more severe outcome, such as dengue hemorrhagic syndrome/shock. Dengue virus infection poses a threat to endemic regions for four reasons: the presence of four serotypes, each with the ability to cause a similar disease outcome, including fatality; difficulties related to vector control; the lack of specific treatment; and the nonavailability of a suitable vaccine. Vaccine development is considered challenging due to the severity of the disease observed in individuals who have acquired dengue-specific immunity, either passively or actively. Therefore, the presence of vaccine-induced immunity against a particular serotype may prime an individual to severe disease on exposure to dengue virus. Vaccine development strategies include live attenuated vaccines, chimeric, DNA-based, subunit, and inactivated vaccines. Each of the candidates is in various stages of preclinical and clinical development. Issues pertaining to selection pressures, viral interaction, and safety still need to be evaluated in order to induce a complete protective immune response against all four serotypes. This review highlights the various strategies that have been employed in vaccine development, and identifies the obstacles to producing a safe and effective vaccine.
-
Emerging human papillomavirus vaccines
Ma, Barbara; Maraj, Bharat; Tran, Nam Phuong; Knoff, Jayne; Chen, Alexander; Alvarez, Ronald D; Hung, Chien-Fu; Wu, T.-C.
2013-01-01
Introduction Identification of human papillomavirus (HPV) as the etiologic factor of cervical, anogenital, and a subset of head and neck cancers has stimulated the development of preventive and therapeutic HPV vaccines to control HPV-associated malignancies. Excitement has been generated by the commercialization of two preventive L1-based vaccines, which use HPV virus-like particles (VLPs) to generate capsid-specific neutralizing antibodies. However, factors such as high cost and requirement for cold chain have prevented widespread implementation where they are needed most. Areas covered Next generation preventive HPV vaccine candidates have focused on cost-effective stable alternatives and generating broader protection via targeting multivalent L1 VLPs, L2 capsid protein, and chimeric L1/L2 VLPs. Therapeutic HPV vaccine candidates have focused on enhancing T cell-mediated killing of HPV-transformed tumor cells, which constitutively express HPV-encoded proteins, E6 and E7. Several therapeutic HPV vaccines are in clinical trials. Expert opinion Although progress is being made, cost remains an issue inhibiting the use of preventive HPV vaccines in countries that carry the majority of the cervical cancer burden. In addition, progression of therapeutic HPV vaccines through clinical trials may require combination strategies employing different therapeutic modalities. As research in the development of HPV vaccines continues, we may generate effective strategies to control HPV-associated malignancies. PMID:23163511
-
Dickson, Alexa M.; Anderson, John R.; Barnhart, Michael D.; Sokoloski, Kevin J.; Oko, Lauren; Opyrchal, Mateusz; Galanis, Evanthia; Wilusz, Carol J.; Morrison, Thomas E.; Wilusz, Jeffrey
2012-01-01
We have demonstrated previously that the cellular HuR protein binds U-rich elements in the 3′ untranslated region (UTR) of Sindbis virus RNA and relocalizes from the nucleus to the cytoplasm upon Sindbis virus infection in 293T cells. In this study, we show that two alphaviruses, Ross River virus and Chikungunya virus, lack the conserved high-affinity U-rich HuR binding element in their 3′ UTRs but still maintain the ability to interact with HuR with nanomolar affinities through alternative binding elements. The relocalization of HuR protein occurs during Sindbis infection of multiple mammalian cell types as well as during infections with three other alphaviruses. Interestingly, the relocalization of HuR is not a general cellular reaction to viral infection, as HuR protein remained largely nuclear during infections with dengue and measles virus. Relocalization of HuR in a Sindbis infection required viral gene expression, was independent of the presence of a high-affinity U-rich HuR binding site in the 3′ UTR of the virus, and was associated with an alteration in the phosphorylation state of HuR. Sindbis virus-induced HuR relocalization was mechanistically distinct from the movement of HuR observed during a cellular stress response, as there was no accumulation of caspase-mediated HuR cleavage products. Collectively, these data indicate that virus-induced HuR relocalization to the cytoplasm is specific to alphavirus infections and is associated with distinct posttranslational modifications of this RNA-binding protein. PMID:22915590
-
Wu, Meizhi; Zhao, Lin; Zhu, Lei; Chen, Zhange; Li, Huangjin
2013-03-01
Chimeric peptide MVF-EGFR(237-267), comprising a B-cell epitope from the dimerization interface of human epidermal growth factor receptor (EGFR) and a promiscuous T-cell epitope from measles virus fusion protein (MVF), is a promising candidate antigen peptide for therapeutic vaccine. To establish a high-efficiency preparation process of this small peptide, the coding sequence was cloned into pET-21b and pET-32a respectively, to be expressed alone or in the form of fusion protein with thioredoxin (Trx) and His(6)-tag in Escherichia coli BL21 (DE3). The chimeric peptide failed to be expressed alone, but over-expressed in the fusion form, which presented as soluble protein and took up more than 30% of total proteins of host cells. The fusion protein was seriously degraded during the cell disruption, in which endogenous metalloproteinase played a key role. Degradation of target peptide was inhibited by combined application of EDTA in the cell disruption buffer and a step of Source 30Q anion exchange chromatography (AEC) before metal-chelating chromatography (MCAC) for purifying His(6)-tagged fusion protein. The chimeric peptide was recovered from the purified fusion protein by enterokinase digestion at a yield of 3.0 mg/L bacteria culture with a purity of more than 95%. Immunogenicity analysis showed that the recombinant chimeric peptide was able to arouse more than 1×10(4) titers of specific antibody in BALB/c mice. Present work laid a solid foundation for the development of therapeutic peptide vaccine targeting EGFR dimerization and provided a convenient and low-cost preparation method for small peptides. Copyright © 2012 Elsevier Inc. All rights reserved.
-
Roohvand, Farzin; Kossari, Niloufar
2012-04-01
Developing a vaccine against HCV is an important medical and global priority. Unavailability and potential dangers associated with using attenuated HCV viral particles for vaccine preparation have resulted in the use of HCV genes and proteins formulated in novel vaccine modalities. In part one of this review, advances in basic knowledge for HCV vaccine design were provided. Herein, a detailed and correlated patents (searched by Espacenet) and literatures (searched by Pubmed) review on HCV vaccine formulations and modalities is provided, including: subunit, DNA, epitopic-peptide/polytopic, live vector- and whole yeast-based vaccines. Less-touched areas in vaccine studies such as mucosal, plant-based, and chimeric HBV/HCV vaccines are also discussed. Furthermore, results of preclinical/clinical studies on selected HCV vaccines as well as pros and cons of different strategies are reviewed. Finally, potential strategies for creation and/or improvement of HCV vaccine formulations are discussed. Promising outcomes of a few HCV vaccine modalities in phase I/II clinical trials predict the accessibility of at least partially effective vaccines to inhibit or treat the chronic state of HCV infection (specially in combination with standard antiviral therapy). ChronVac-C (plasmid DNA), TG4040 (MVA-based), and GI-5005 (whole yeast-based) might be the most obvious HCV vaccine candidates to be approved in the near future.
-
Piñeyro, Pablo E; Kenney, Scott P; Giménez-Lirola, Luis G; Heffron, C Lynn; Matzinger, Shannon R; Opriessnig, Tanja; Meng, Xiang-Jin
2015-12-02
Co-infection of pigs in the field with porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) is common and poses a major concern in effective control of PCV2 and PRRSV. We previously demonstrated that insertion of foreign epitope tags in the C-terminus of PCV2 ORF2 produced infectious virions that elicited humoral immune responses against both PCV2 capsid and inserted epitope tags. In this study, we aimed to determine whether the non-pathogenic chimeric virus PCV1-2a, which is the basis for the licensed PCV2 vaccine Fostera PCV, can express PRRSV antigenic epitopes, thus generating dual immunity as a potential bivalent vaccine against both PCV2 and PPRSV. Four different linear B-cell antigenic epitopes of PRRSV were inserted into the C-terminus of the capsid gene of the PCV1-2a vaccine virus. We showed that insertion of 12 (PRRSV-GP2 epitope II, PRRSV-GP3 epitope I, and PRRSV-GP5 epitope I), and 14 (PRRSV-GP5 epitope IV) amino acid residues did not impair the replication of the resulting PCV1-2a-PRRSVEPI chimeric viruses in vitro. The four chimeric PCV1-2a viruses expressing PRRSV B-cell linear epitopes were successfully rescued and characterized. An immunogenicity study in pigs revealed that two of the four chimeric viruses, PCV1-2a-PRRSVEPIGP3IG and PCV1-2a-PRRSVEPIEPIGP5IV, elicited neutralizing antibodies against PRRSV VR2385 as well as PCV2 (strains PCV2a, PCV2b, and mPCV2b). The results have important implications for exploring the potential use of PCV1-2a vaccine virus as a live virus vector to develop bivalent MLVs against both PCV2 and PRRSV. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Subgenomic Reporter RNA System for Detection of Alphavirus Infection in Mosquitoes
Steel, J. Jordan; Franz, Alexander W. E.; Sanchez-Vargas, Irma; Olson, Ken E.; Geiss, Brian J.
2013-01-01
Current methods for detecting real-time alphavirus (Family Togaviridae) infection in mosquitoes require the use of recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which produces a translatable RNA species only when infectious virus is present and providing viral replication proteins. This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The detection system is relatively species specific and only detects closely related viruses, but can detect low levels of alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus infection in mosquito cell culture and in live transgenic mosquitoes. PMID:24367703
-
Current status and future prospects of yellow fever vaccines.
Beck, Andrew S; Barrett, Alan D T
2015-01-01
Yellow fever 17D vaccine is one of the oldest live-attenuated vaccines in current use that is recognized historically for its immunogenic and safe properties. These unique properties of 17D are presently exploited in rationally designed recombinant vaccines targeting not only flaviviral antigens but also other pathogens of public health concern. Several candidate vaccines based on 17D have advanced to human trials, and a chimeric recombinant Japanese encephalitis vaccine utilizing the 17D backbone has been licensed. The mechanism(s) of attenuation for 17D are poorly understood; however, recent insights from large in silico studies have indicated particular host genetic determinants contributing to the immune response to the vaccine, which presumably influences the considerable durability of protection, now in many cases considered to be lifelong. The very rare occurrence of severe adverse events for 17D is discussed, including a recent fatal case of vaccine-associated viscerotropic disease.
-
Current Status and Future Prospects of Yellow Fever Vaccines
Beck, Andrew S.; Barrett, Alan D.T.
2017-01-01
Summary Yellow fever 17D vaccine is one of the oldest live-attenuated vaccines in current use that is recognized for historically immunogenic and safe properties. These unique properties of 17D are presently exploited in rationally designed recombinant vaccines targeting not only flaviviral antigens but also other pathogens of public health concern. Several candidate vaccines based on 17D have advanced to human trials, and a chimeric recombinant Japanese encephalitis vaccine utilizing the 17D backbone has been licensed. The mechanism(s) of attenuation for 17D are poorly understood; however, recent insights from large in silico studies have indicated particular host genetic determinants contributing to the immune response to the vaccine, which presumably influences the considerable durability of protection, now in many cases considered to be life-long. The very rare occurrence of severe adverse events for 17D is discussed, including a recent fatal case of vaccine-associated viscerotropic disease. PMID:26366673
-
Liu, Ye V.; Massare, Michael J.; Barnard, Dale L.; Kort, Thomas; Nathan, Margret; Wang, Lei; Smith, Gale
2011-01-01
SARS-CoV was the cause of the global pandemic in 2003 that infected over 8000 people in 8 months. Vaccines against SARS are still not available. We developed a novel method to produce high levels of a recombinant SARS virus-like particles (VLPs) vaccine containing the SARS spike (S) protein and the influenza M1 protein using the baculovirus insect cell expression system. These chimeric SARS VLPs have a similar size and morphology to the wild type SARS-CoV. We tested the immunogenicity and protective efficacy of purified chimeric SARS VLPs and full length SARS S protein vaccines in a mouse lethal challenge model. The SARS VLP vaccine, containing 0.8 μg of SARS S protein, completely protected mice from death when administered intramuscular (IM) or intranasal (IN) routes in the absence of an adjuvant. Likewise, the SARS VLP vaccine, containing 4 μg of S protein without adjuvant, reduced lung virus titer to below detectable level, protected mice from weight loss, and elicited a high level of neutralizing antibodies against SARS-CoV. Sf9 cell-produced full length purified SARS S protein was also an effective vaccine against SARS-CoV but only when co-administered IM with aluminum hydroxide. SARS-CoV VLPs are highly immunogenic and induce neutralizing antibodies and provide protection against lethal challenge. Sf9 cell-based VLP vaccines are a potential tool to provide protection against novel pandemic agents. PMID:21762752
-
Rapid Engineering of Foot-and-Mouth Disease Vaccine and Challenge Viruses
Lee, Seo-Yong; Lee, Yeo-Joo; Kim, Rae-Hyung; Park, Jeong-Nam; Park, Min-Eun; Ko, Mi-Kyeong; Choi, Joo-Hyung; Chu, Jia-Qi; Lee, Kwang-Nyeong; Kim, Su-Mi; Tark, Dongseob; Lee, Hyang-Sim; Ko, Young-Joon; Seo, Min-Goo; Park, Jung-Won; Kim, Byounghan; Lee, Myoung-Heon
2017-01-01
ABSTRACT There are seven antigenically distinct serotypes of foot-and-mouth disease virus (FMDV), each of which has intratypic variants. In the present study, we have developed methods to efficiently generate promising vaccines against seven serotypes or subtypes. The capsid-encoding gene (P1) of the vaccine strain O1/Manisa/Turkey/69 was replaced with the amplified or synthetic genes from the O, A, Asia1, C, SAT1, SAT2, and SAT3 serotypes. Viruses of the seven serotype were rescued successfully. Each chimeric FMDV with a replacement of P1 showed serotype-specific antigenicity and varied in terms of pathogenesis in pigs and mice. Vaccination of pigs with an experimental trivalent vaccine containing the inactivated recombinants based on the main serotypes O, A, and Asia1 effectively protected them from virus challenge. This technology could be a potential strategy for a customized vaccine with challenge tools to protect against epizootic disease caused by specific serotypes or subtypes of FMDV. IMPORTANCE Foot-and-mouth disease (FMD) virus (FMDV) causes significant economic losses. For vaccine preparation, the selection of vaccine strains was complicated by high antigenic variation. In the present study, we suggested an effective strategy to rapidly prepare and evaluate mass-produced customized vaccines against epidemic strains. The P1 gene encoding the structural proteins of the well-known vaccine virus was replaced by the synthetic or amplified genes of viruses of seven representative serotypes. These chimeric viruses generally replicated readily in cell culture and had a particle size similar to that of the original vaccine strain. Their antigenicity mirrored that of the original serotype from which their P1 gene was derived. Animal infection experiments revealed that the recombinants varied in terms of pathogenicity. This strategy will be a useful tool for rapidly generating customized FMD vaccines or challenge viruses for all serotypes, especially for FMD
-
Rapid Engineering of Foot-and-Mouth Disease Vaccine and Challenge Viruses.
Lee, Seo-Yong; Lee, Yeo-Joo; Kim, Rae-Hyung; Park, Jeong-Nam; Park, Min-Eun; Ko, Mi-Kyeong; Choi, Joo-Hyung; Chu, Jia-Qi; Lee, Kwang-Nyeong; Kim, Su-Mi; Tark, Dongseob; Lee, Hyang-Sim; Ko, Young-Joon; Seo, Min-Goo; Park, Jung-Won; Kim, Byounghan; Lee, Myoung-Heon; Lee, Jong-Soo; Park, Jong-Hyeon
2017-08-15
There are seven antigenically distinct serotypes of foot-and-mouth disease virus (FMDV), each of which has intratypic variants. In the present study, we have developed methods to efficiently generate promising vaccines against seven serotypes or subtypes. The capsid-encoding gene (P1) of the vaccine strain O1/Manisa/Turkey/69 was replaced with the amplified or synthetic genes from the O, A, Asia1, C, SAT1, SAT2, and SAT3 serotypes. Viruses of the seven serotype were rescued successfully. Each chimeric FMDV with a replacement of P1 showed serotype-specific antigenicity and varied in terms of pathogenesis in pigs and mice. Vaccination of pigs with an experimental trivalent vaccine containing the inactivated recombinants based on the main serotypes O, A, and Asia1 effectively protected them from virus challenge. This technology could be a potential strategy for a customized vaccine with challenge tools to protect against epizootic disease caused by specific serotypes or subtypes of FMDV. IMPORTANCE Foot-and-mouth disease (FMD) virus (FMDV) causes significant economic losses. For vaccine preparation, the selection of vaccine strains was complicated by high antigenic variation. In the present study, we suggested an effective strategy to rapidly prepare and evaluate mass-produced customized vaccines against epidemic strains. The P1 gene encoding the structural proteins of the well-known vaccine virus was replaced by the synthetic or amplified genes of viruses of seven representative serotypes. These chimeric viruses generally replicated readily in cell culture and had a particle size similar to that of the original vaccine strain. Their antigenicity mirrored that of the original serotype from which their P1 gene was derived. Animal infection experiments revealed that the recombinants varied in terms of pathogenicity. This strategy will be a useful tool for rapidly generating customized FMD vaccines or challenge viruses for all serotypes, especially for FMD-free countries
-
Suzuki, Saori; Mori, Ken-Ichi; Higashino, Atsunori; Iwasaki, Yuki; Yasutomi, Yasuhiro; Maki, Noboru; Akari, Hirofumi
2016-01-01
The development of effective hepatitis C virus (HCV) vaccines is essential for the prevention of further HCV dissemination, especially in developing countries. Therefore the aim of this study is to establish a feasible and immunocompetent surrogate animal model of HCV infection that will help in evaluation of the protective efficacy of newly developing HCV vaccine candidates. To circumvent the narrow host range of HCV, an HCV genotype 1b-based chimeric clone carrying E1, E2 and p6 regions from GB virus B (GBV-B), which is closely related to HCV, was generated. The chimera between HCV and GBV-B, named HCV/G, replicated more efficiently as compared with the HCV clone in primary marmoset hepatocytes. Furthermore, it was found that the chimera persistently replicated in a tamarin for more than 2 years after intrahepatic inoculation of the chimeric RNA. Although relatively low (<200 copies/mL), the viral RNA loads in plasma were detectable intermittently during the observation period. Of note, the chimeric RNA was found in the pellet fraction obtained by ultracentrifugation of the plasma at 73 weeks, indicating production of the chimeric virus. Our results will help establish a novel non-human primate model for HCV infection on the basis of the HCV/G chimera in the major framework of the HCV genome. © 2015 The Societies and John Wiley & Sons Australia, Ltd.
-
Stoermer, Kristina A.; Burrack, Adam; Oko, Lauren; Montgomery, Stephanie A.; Borst, Luke B.; Gill, Ronald G.; Morrison, Thomas E.
2012-01-01
Chikungunya virus (CHIKV) and Ross River virus (RRV) cause a debilitating, and often chronic, musculoskeletal inflammatory disease in humans. Macrophages constitute the major inflammatory infiltrates in musculoskeletal tissues during these infections. However, the precise macrophage effector functions that affect the pathogenesis of arthritogenic alphaviruses have not been defined. We hypothesized that the severe damage to musculoskeletal tissues observed in RRV or CHIKV-infected mice would promote a wound healing response characterized by M2-like macrophages. Indeed, we found that RRV and CHIKV-induced musculoskeletal inflammatory lesions, and macrophages present in these lesions, have a unique gene expression pattern characterized by high expression of arginase 1 and Ym1/Chi3l3 in the absence of FIZZ1/Relmα that is consistent with an M2-like activation phenotype. Strikingly, mice specifically deleted for Arg1 in neutrophils and macrophages had dramatically reduced viral loads and improved pathology in musculoskeletal tissues at late times post-RRV infection. These findings indicate that arthritogenic alphavirus infection drives a unique myeloid cell activation program in inflamed musculoskeletal tissues that inhibits virus clearance and impedes disease resolution in an Arg1-dependent manner. PMID:22972923
-
Mixed chimerism and split tolerance
Al-Adra, David P.
2011-01-01
Establishing hematopoietic mixed chimerism can lead to donor-specific tolerance to transplanted organs and may eliminate the need for long-term immunosuppressive therapy, while also preventing chronic rejection. In this review, we discuss central and peripheral mechanisms of chimerism induced tolerance. However, even in the long-lasting presence of a donor organ or donor hematopoietic cells, some allogeneic tissues from the same donor can be rejected; a phenomenon known as split tolerance. With the current goal of creating mixed chimeras using clinically feasible amounts of donor bone marrow and with minimal conditioning, split tolerance may become more prevalent and its mechanisms need to be explored. Some predisposing factors that may increase the likelihood of split tolerance are immunogenicity of the graft, certain donor-recipient combinations, prior sensitization, location and type of graft and minimal conditioning chimerism induction protocols. Additionally, split tolerance may occur due to a differential susceptibility of various types of tissues to rejection. The mechanisms involved in a tissue’s differential susceptibility to rejection include the presence of polymorphic tissue-specific antigens and variable sensitivity to indirect pathway effector mechanisms. Finally, we review the clinical attempts at allograft tolerance through the induction of chimerism; studies that are revealing the complex relationship between chimerism and tolerance. This relationship often displays split tolerance, and further research into its mechanisms is warranted. PMID:22509425
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamshchikov, Vladimir, E-mail: yaximik@gmail.com; Manuvakhova, Marina; Rodriguez, Efrain
Direct attenuation of West Nile (WN) virus strain NY99 for the purpose of vaccine development is not feasible due to its high virulence and pathogenicity. Instead, we created highly attenuated chimeric virus W1806 with the serological identity of NY99. To further attenuate W1806, we investigated effects of mutations found in Japanese encephalitis virus vaccine SA14-14-2. WN viruses carrying all attenuating mutations lost infectivity in mammalian, but not in mosquito cells. No single reversion restored infectivity in mammalian cells, although increased infectivity in mosquito cells was observed. To identify a subset of mutations suitable for further attenuation of W1806, we analyzedmore » effects of E{sub 138}K and K{sub 279}M changes on virulence, growth properties, and immunogenicity of derivatized W956, from which chimeric W1806 inherited its biological properties and attenuation profile. Despite strong dominant attenuating effect, introduction of only two mutations was not sufficient for attenuating W1806 to the safety level acceptable for human use. - Highlights: • Further attenuation of a WN vaccine precursor is outlined. • Effect of SA14-14-2 attenuating mutations is tested. • Mechanism of attenuation is proposed and illustrated. • The need for additional attenuating mutations is justified.« less
-
Wang, Ying; Ren, Jilong; Song, Yuran; Hai, Tang; Zhou, Qi; Liu, Zhonghua
2016-07-25
With the advancements of stem cells and regenerative medicine, interspecies chimera has become a hot topic and will pave a new way of providing donor sources in organ transplantation. However, the interspecies chimera is confronted with a number of scientific questions and technical obstacles, including selections of appropriate embryonic stage and appropriate culture medium; those factors will deeply influence the developmental balance between donor cells and receptor embryos. Due to its relatively rapid reproductive cycle and similar organ size to human's, porcine is a very potential donor candidate to study these questions. To compare the development and chimeric efficiency of interspecies embryos, we tested and evaluated three different culture systems, PZM-3 (Porcine zygotic medium), culture medium for iPSCs (N2B27) and 3.5 h of N2B27 before PZM-3 (N2B27(3.5 h)), and two different embryonic stages, 8-cell and blastocyst in mouse-porcine chimeric embryos using parthenogenetically activated porcine embryos and mouse induced pluripotent stem cells (miPS). The results showed that, PZM-3 was beneficial for both development of chimeric embryos and miPSCs proliferation in porcine embryos in the 8-cell injection group. After early blastocyst injection, the chimeric efficiency did not appear significantly different among the three culture systems but was lower than 8-cell injection. In summary, the results suggest that 8-cell injection and PZM-3 culture medium are more beneficial to the in vitro development and chimeric efficiency of mouse-porcine chimeric embryos.
-
Cost-Effectiveness of Dengue Vaccination Programs in Brazil
Shim, Eunha
2017-01-01
The first approved dengue vaccine, CYD-TDV, a chimeric, live-attenuated, tetravalent dengue virus vaccine, was recently licensed in 13 countries, including Brazil. In light of recent vaccine approval, we modeled the cost-effectiveness of potential vaccination policies mathematically based on data from recent vaccine efficacy trials that indicated that vaccine efficacy was lower in seronegative individuals than in seropositive individuals. In our analysis, we investigated several vaccination programs, including routine vaccination, with various vaccine coverage levels and those with and without large catch-up campaigns. As it is unclear whether the vaccine protects against infection or just against disease, our model incorporated both direct and indirect effects of vaccination. We found that in the presence of vaccine-induced indirect protection, the cost-effectiveness of dengue vaccination decreased with increasing vaccine coverage levels because the marginal returns of herd immunity decreases with vaccine coverage. All routine dengue vaccination programs that we considered were cost-effective, reducing dengue incidence significantly. Specifically, a routine dengue vaccination of 9-year-olds would be cost-effective when the cost of vaccination per individual is less than $262. Furthermore, the combination of routine vaccination and large catch-up campaigns resulted in a greater reduction of dengue burden (by up to 93%) than routine vaccination alone, making it a cost-effective intervention as long as the cost per course of vaccination is $255 or less. Our results show that dengue vaccination would be cost-effective in Brazil even with a relatively low vaccine efficacy in seronegative individuals. PMID:28500811
-
In Vitro Assembly of Alphavirus Cores by Using Nucleocapsid Protein Expressed in Escherichia coli
Tellinghuisen, Timothy L.; Hamburger, Agnes E.; Fisher, Bonnie R.; Ostendorp, Ralf; Kuhn, Richard J.
1999-01-01
The production of the alphavirus virion is a multistep event requiring the assembly of the nucleocapsid core in the cytoplasm and the maturation of the glycoproteins in the endoplasmic reticulum and the Golgi apparatus. These components associate during the budding process to produce the mature virion. The nucleocapsid proteins of Sindbis virus and Ross River virus have been produced in a T7-based Escherichia coli expression system and purified. In the presence of single-stranded but not double-stranded nucleic acid, the proteins oligomerize in vitro into core-like particles which resemble the native viral nucleocapsid cores. Despite their similarities, Sindbis virus and Ross River virus capsid proteins do not form mixed core-like particles. Truncated forms of the Sindbis capsid protein were used to establish amino acid requirements for assembly. A capsid protein starting at residue 19 [CP(19–264)] was fully competent for in vitro assembly, whereas proteins with further N-terminal truncations could not support assembly. However, a capsid protein starting at residue 32 or 81 was able to incorporate into particles in the presence of CP(19–264) or could inhibit assembly if its molar ratio relative to CP(19–264) was greater than 1:1. This system provides a basis for the molecular dissection of alphavirus core assembly. PMID:10364277
-
Lu, Yudong; Li, Zhong; Teng, Huan; Xu, Hongke; Qi, Songnan; He, Jian'an; Gu, Dayong; Chen, Qijun; Ma, Hongwei
2015-08-21
Linear B-cell epitopes are ideal biomarkers for the serodiagnosis of infectious diseases. However, the long-predicted diagnostic value of epitopes has not been realized. Here, we demonstrated a method, diagnostic epitopes in four steps (DEIFS), that delivers a combination of epitopes for the serodiagnosis of infectious diseases with a high success rate. Using DEIFS for malaria, we identified 6 epitopes from 8 peptides and combined them into 3 chimeric peptide constructs. Along with 4 other peptides, we developed a rapid diagnostic test (RDT), which is able to differentiate Plasmodium falciparum (P. falciparum) from Plasmodium vivax (P. vivax) infections with 95.6% overall sensitivity and 99.1% overall specificity. In addition to applications in diagnosis, DEIFS could also be used in the diagnosis of virus and bacterium infections, discovery of vaccine candidates, evaluation of vaccine potency, and study of disease progression.
-
Lu, Yudong; Li, Zhong; Teng, Huan; Xu, Hongke; Qi, Songnan; He, Jian’an; Gu, Dayong; Chen, Qijun; Ma, Hongwei
2015-01-01
Linear B-cell epitopes are ideal biomarkers for the serodiagnosis of infectious diseases. However, the long-predicted diagnostic value of epitopes has not been realized. Here, we demonstrated a method, diagnostic epitopes in four steps (DEIFS), that delivers a combination of epitopes for the serodiagnosis of infectious diseases with a high success rate. Using DEIFS for malaria, we identified 6 epitopes from 8 peptides and combined them into 3 chimeric peptide constructs. Along with 4 other peptides, we developed a rapid diagnostic test (RDT), which is able to differentiate Plasmodium falciparum (P. falciparum) from Plasmodium vivax (P. vivax) infections with 95.6% overall sensitivity and 99.1% overall specificity. In addition to applications in diagnosis, DEIFS could also be used in the diagnosis of virus and bacterium infections, discovery of vaccine candidates, evaluation of vaccine potency, and study of disease progression. PMID:26293607
-
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-08
... Exclusive License: Purified Inactivated Dengue Tetravalent Vaccine Containing a Common 30 Nucleotide Deletion in the 3'-UTR of Dengue Types 1,2,3, and 4 AGENCY: National Institutes of Health, Public Health...., ``Development of Mutations Useful for Attenuating Dengue Viruses and Chimeric Dengue Viruses''-- European Patent...
-
Medina, Gladys; Garzaro, Domingo J.; Barrios, Miguel; Auguste, Albert J.; Weaver, Scott C.; Pujol, Flor H.
2015-01-01
Several species of alphaviruses have been previously described in the Americas, some of which are associated with encephalitis and others are associated with arthralgia. Venezuelan equine encephalitis virus (VEEV) and eastern equine encephalitis virus (EEEV) are endemic to Venezuela, with the former being responsible for major outbreaks of severe and often fatal disease in animals and humans. The aim of this study was to analyze the genetic diversity of Venezuelan alphaviruses isolated during two decades (1973–1999) of surveillance in northern Venezuela. Phylogenetic analysis indicated the circulation of a VEEV subtype IAB strain 8 years after the last reported outbreak. Thirteen strains within two subclades of South American lineage III of EEEV were also found in Venezuela. Considerable genetic variability was observed among Venezuelan Una virus strains, which were widely distributed among the clades. The first Venezuelan Mayaro sequence was also characterized. PMID:25940191
-
Medina, Gladys; Garzaro, Domingo J; Barrios, Miguel; Auguste, Albert J; Weaver, Scott C; Pujol, Flor H
2015-07-01
Several species of alphaviruses have been previously described in the Americas, some of which are associated with encephalitis and others are associated with arthralgia. Venezuelan equine encephalitis virus (VEEV) and eastern equine encephalitis virus (EEEV) are endemic to Venezuela, with the former being responsible for major outbreaks of severe and often fatal disease in animals and humans. The aim of this study was to analyze the genetic diversity of Venezuelan alphaviruses isolated during two decades (1973-1999) of surveillance in northern Venezuela. Phylogenetic analysis indicated the circulation of a VEEV subtype IAB strain 8 years after the last reported outbreak. Thirteen strains within two subclades of South American lineage III of EEEV were also found in Venezuela. Considerable genetic variability was observed among Venezuelan Una virus strains, which were widely distributed among the clades. The first Venezuelan Mayaro sequence was also characterized. © The American Society of Tropical Medicine and Hygiene.
-
The use of transgenic parasites in malaria vaccine research.
Othman, Ahmad Syibli; Marin-Mogollon, Catherin; Salman, Ahmed M; Franke-Fayard, Blandine M; Janse, Chris J; Khan, Shahid M
2017-07-01
Transgenic malaria parasites expressing foreign genes, for example fluorescent and luminescent proteins, are used extensively to interrogate parasite biology and host-parasite interactions associated with malaria pathology. Increasingly transgenic parasites are also exploited to advance malaria vaccine development. Areas covered: We review how transgenic malaria parasites are used, in vitro and in vivo, to determine protective efficacy of different antigens and vaccination strategies and to determine immunological correlates of protection. We describe how chimeric rodent parasites expressing P. falciparum or P. vivax antigens are being used to directly evaluate and rank order human malaria vaccines before their advancement to clinical testing. In addition, we describe how transgenic human and rodent parasites are used to develop and evaluate live (genetically) attenuated vaccines. Expert commentary: Transgenic rodent and human malaria parasites are being used to both identify vaccine candidate antigens and to evaluate both sub-unit and whole organism vaccines before they are advanced into clinical testing. Transgenic parasites combined with in vivo pre-clinical testing models (e.g. mice) are used to evaluate vaccine safety, potency and the durability of protection as well as to uncover critical protective immune responses and to refine vaccination strategies.
-
Lin, Xiaoyun; Chen, Shao; Xue, Xiangyang; Lu, Lijun; Zhu, Shanli; Li, Wenshu; Chen, Xiangmin; Zhong, Xiaozhi; Jiang, Pengfei; Sename, Torsoo Sophia; Zheng, Yi; Zhang, Lifang
2016-01-01
Epstein–Barr virus (EBV) is prevalent throughout the world and is associated with several malignant diseases in humans. Latent membrane protein 2 (LMP2) of EBV plays a crucial role in the pathogenesis of EBV-associated tumors; therefore, LMP2 has been considered to be a potential immunodiagnostic and immunotherapeutic target. A multi-epitope-based antigen is a promising option for therapeutic vaccines and diagnoses of such malignancies. In this study, we systematically screened cytotoxic T lymphocyte (CTL), helper T cell (Th) and B-cell epitopes within EBV-LMP2 using bioinformatics. Based on the screen, two peptides rich in overlapping epitopes of both T cells and B cells were selected to construct a plasmid containing the sequence for a chimeric multi-epitope protein referred to as EBV-LMP2m, which is composed of LMP2aa195∼232 and LMP2aa419∼436. The EBV-LMP2m protein was expressed in E. coli BL21 (DE3) after prokaryotic codon optimization. Inoculation of the purified chimeric antigen in BALB/c mice induced not only high levels of specific IgG in the serum and secretory IgA in the vaginal mucus but also a specific CTL response. By using purified EBV-LMP2m as an antigen, the presence of specific IgG in the serum specimens of 202 nasopharyngeal carcinoma (NPC) patients was effectively detected with 52.84% sensitivity and 95.40% specificity, which represents an improvement over the traditional detection method based on VCA-IgA (60.53% sensitivity and 76.86% specificity). The above results indicate that EBV-LMP2m may be used not only as a potential target antigen for EBV-associated tumors but also a diagnostic agent for NPC patients. PMID:25864917
-
Jaramillo Ortiz, José Manuel; Del Médico Zajac, María Paula; Zanetti, Flavia Adriana; Molinari, María Paula; Gravisaco, María José; Calamante, Gabriela; Wilkowsky, Silvina Elizabeth
2014-08-06
In this study, a recombinant modified vaccinia virus Ankara vector expressing a chimeric multi-antigen was obtained and evaluated as a candidate vaccine in homologous and heterologous prime-boost immunizations with a recombinant protein cocktail. The chimeric multi-antigen comprises immunodominant B and T cell regions of three Babesia bovis proteins. Humoral and cellular immune responses were evaluated in mice to compare the immunogenicity induced by different immunization schemes. The best vaccination scheme was achieved with a prime of protein cocktail and a boost with the recombinant virus. This scheme induced high level of specific IgG antibodies and secreted IFN and a high degree of activation of IFNγ(+) CD4(+) and CD8(+) specific T cells. This is the first report in which a novel vaccine candidate was constructed based on a rationally designed multi-antigen and evaluated in a prime-boost regime, optimizing the immune response necessary for protection against bovine babesiosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Fedorova, E A; Smolonogina, T A; Isakova-Sivak, I N; Koren'kov, D A; Kotomina, T S; Leont'eva, G F; Suvorov, A N; Rudenko, L G
2018-04-01
A project of an experimental recombinant vector vaccine for prevention of diseases caused by pathogenic streptococci based on ScaAB lipoprotein of Streptococcus agalactiae and a coldadapted strain of live influenza vaccine as a vector was developed. The sequence of ScaAB lipoprotein was analyzed and fragments forming immunodominant epitopes were determined. Chimeric molecules of influenza virus hemagglutinin H7 carrying insertions of bacterial origin were constructed. Based on the results of simulation, the most promising variants were selected; they represented fragments of lipoprotein ScaAB lacking N-terminal domain bound to hemagglutinin via a flexible linker. These insertions should minimally modulate the properties of the influenza strain, while retaining potential immunogenicity to a wide group of pathogenic streptococci.
-
Jiang, George; Shi, Meng; Conteh, Solomon; Richie, Nancy; Banania, Glenna; Geneshan, Harini; Valencia, Anais; Singh, Priti; Aguiar, Joao; Limbach, Keith; Kamrud, Kurt I.; Rayner, Jonathan; Smith, Jonathan; Bruder, Joseph T.; King, C. Richter; Tsuboi, Takafumi; Takeo, Satoru; Endo, Yaeta; Doolan, Denise L.; Richie, Thomas L.; Weiss, Walter R.
2009-01-01
Using newer vaccine platforms which have been effective against malaria in rodent models, we tested five immunization regimens against Plasmodium knowlesi in rhesus monkeys. All vaccines included the same four P. knowlesi antigens: the pre-erythrocytic antigens CSP, SSP2, and erythrocytic antigens AMA1, MSP1. We used four vaccine platforms for prime or boost vaccinations: plasmids (DNA), alphavirus replicons (VRP), attenuated adenovirus serotype 5 (Ad), or attenuated poxvirus (Pox). These four platforms combined to produce five different prime/boost vaccine regimens: Pox alone, VRP/Pox, VRP/Ad, Ad/Pox, and DNA/Pox. Five rhesus monkeys were immunized with each regimen, and five Control monkeys received a mock vaccination. The time to complete vaccinations was 420 days. All monkeys were challenged twice with 100 P. knowlesi sporozoites given IV. The first challenge was given 12 days after the last vaccination, and the monkeys receiving the DNA/Pox vaccine were the best protected, with 3/5 monkeys sterilely protected and 1/5 monkeys that self-cured its parasitemia. There was no protection in monkeys that received Pox malaria vaccine alone without previous priming. The second sporozoite challenge was given 4 months after the first. All 4 monkeys that were protected in the first challenge developed malaria in the second challenge. DNA, VRP and Ad5 vaccines all primed monkeys for strong immune responses after the Pox boost. We discuss the high level but short duration of protection in this experiment and the possible benefits of the long interval between prime and boost. PMID:19668343
-
NASA Astrophysics Data System (ADS)
Rayaprolu, Vamseedhar; Moore, Alan; Che-Yen Wang, Joseph; Goh, Boon Chong; Perilla, Juan R.; Zlotnick, Adam; Mukhopadhyay, Suchetana
2017-12-01
In vitro assembly of alphavirus nucleocapsid cores, called core-like particles (CLPs), requires a polyanionic cargo. There are no sequence or structure requirements to encapsidate single-stranded nucleic acid cargo. In this work, we wanted to determine how the length of the cargo impacts the stability and structure of the assembled CLPs. We hypothesized that cargo neutralizes the basic region of the alphavirus capsid protein and if the cargo is long enough, it will also act to scaffold the CP monomers together. Experimentally we found that CLPs encapsidating short 27mer oligonucleotides were less stable than CLPs encapsidating 48mer or 90mer oligonucleotides under different chemical and thermal conditions. Furthermore, cryo-EM studies showed there were structural differences between CLPs assembled with 27mer and 48mer cargo. To mimic the role of the cargo in CLP assembly we made a mutant (4D) where we substituted a cluster of four Lys residues in the CP with four Asp residues. We found that these few amino acid substitutions were enough to initiate CLP assembly in the absence of cargo. The cargo-free 4D CLPs show higher resistance to ionic strength and increased temperature compared to wild-type cargo containing CLPs suggesting their CLP assembly mechanism might also be different.
-
Chimeric Antigen Receptor T Cell Therapy in Hematology.
Ataca, Pınar; Arslan, Önder
2015-12-01
It is well demonstrated that the immune system can control and eliminate cancer cells. Immune-mediated elimination of tumor cells has been discovered and is the basis of both cancer vaccines and cellular therapies including hematopoietic stem cell transplantation. Adoptive T cell transfer has been improved to be more specific and potent and to cause less off-target toxicity. Currently, there are two forms of engineered T cells being tested in clinical trials: T cell receptor (TCR) and chimeric antigen receptor (CAR) modified T cells. On 1 July 2014, the United States Food and Drug Administration granted 'breakthrough therapy' designation to anti-CD19 CAR T cell therapy. Many studies were conducted to evaluate the benefits of this exciting and potent new treatment modality. This review summarizes the history of adoptive immunotherapy, adoptive immunotherapy using CARs, the CAR manufacturing process, preclinical and clinical studies, and the effectiveness and drawbacks of this strategy.
-
Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe
2014-01-01
The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.
-
Burlaud-Gaillard, Julien; Sellin, Caroline; Georgeault, Sonia; Uzbekov, Rustem; Lebos, Claude; Guillaume, Jean-Marc; Roingeard, Philippe
2014-01-01
The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM) showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM) studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy). CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations. PMID:24681578
-
The Complexity of a Dengue Vaccine: A Review of the Human Antibody Response
Flipse, Jacky; Smit, Jolanda M.
2015-01-01
Dengue is the most prevalent mosquito-borne viral disease worldwide. Yet, there are no vaccines or specific antivirals available to prevent or treat the disease. Several dengue vaccines are currently in clinical or preclinical stages. The most advanced vaccine is the chimeric tetravalent CYD-TDV vaccine of Sanofi Pasteur. This vaccine has recently cleared Phase III, and efficacy results have been published. Excellent tetravalent seroconversion was seen, yet the protective efficacy against infection was surprisingly low. Here, we will describe the complicating factors involved in the generation of a safe and efficacious dengue vaccine. Furthermore, we will discuss the human antibody responses during infection, including the epitopes targeted in humans. Also, we will discuss the current understanding of the assays used to evaluate antibody response. We hope this review will aid future dengue vaccine development as well as fundamental research related to the phenomenon of antibody-dependent enhancement of dengue virus infection. PMID:26065421
-
Classical swine fever vaccines-State-of-the-art.
Blome, Sandra; Moß, Claudia; Reimann, Ilona; König, Patricia; Beer, Martin
2017-07-01
Due to its impact on animal health and pig industry, classical swine fever (CSF) is still one of the most important viral diseases of pigs. To control the disease, safe and highly efficacious live attenuated vaccines exist for decades. These vaccines have usually outstanding efficacy and safety but lack differentiability of infected from vaccinated animals (DIVA or marker strategy). In contrast, the first generation of E2 subunit marker vaccines shows constraints in efficacy, application, and production. To overcome these limitations, new generations of marker vaccines are developed. A wide range of approaches have been tried including recombinant vaccines, recombinant inactivated vaccines or subunit vaccines, vector vaccines, and DNA/RNA vaccines. During the last years, especially attenuated deletion vaccines or chimeric constructs have shown potential. At present, especially two new constructs have been intensively tested, the adenovirus-delivered, Semliki Forest virus replicon-vectored marker vaccine candidate "rAdV-SFV-E2" and the pestivirus chimera "CP7_E2alf". The later was recently licensed by the European Medicines Agency. Under field conditions, all marker vaccines have to be accompanied by a potent test system. Particularly this point shows still weaknesses and it is important to embed vaccination in a well-established vaccination strategy and a suitable diagnostic workflow. In summary, conventional vaccines are a standard in terms of efficacy. However, only vaccines with DIVA will allow improved eradication strategies e.g. also under emergency vaccination conditions in free regions. To answer this demand, new generations of marker vaccines have been developed and add now to the tool box of CSF control. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Status of vaccine research and development of vaccines for HIV-1.
Safrit, Jeffrey T; Fast, Patricia E; Gieber, Lisa; Kuipers, Hester; Dean, Hansi J; Koff, Wayne C
2016-06-03
Human immunodeficiency virus (HIV) is the cause of one of the most lethal pandemics in human history, although in recent years access to highly effective anti-retroviral therapy has provided new hope worldwide. Transmission of HIV by sexual contact, childbirth and injection drug use has been reduced, but 2 million are newly infected each year, and much of the transmission is from people who do not know their status. In addition to known methods, a preventive vaccine is needed to end the pandemic. The extraordinary mutability and genetic diversity of HIV is an enormous challenge, but vaccines are being designed for broad coverage. Computer-aided design of mosaic immunogens, incorporating many epitopes from the entire genome or from conserved regions aim to induce CD8+ T cells to kill virus-infected cells or inhibit virus replication, while trimeric envelope proteins or synthetic mimics aim to induce broadly reactive neutralizing antibodies similar to those cloned from some infected patients. Induction of more potent and durable responses may require new adjuvants or replicating chimeric vectors chimeras that bear HIV genes. Passive or genetic delivery of broadly neutralizing antibodies may provide broad protection and/or lead to insights for vaccine designers. Proof-of-concept trials in non-human primates and in one human efficacy trial have provided scientific clues for a vaccine that could provide broad and durable protection against HIV. The use of vaccines to destroy HIV reservoirs as part of therapy or cure is now also being explored. Copyright © 2016 World Health Organization. Published by Elsevier Ltd.. All rights reserved.
-
Gore, Milind M.
2017-01-01
ABSTRACT Japanese encephalitis (JE) is a serious public health concern in most of Asia. The disease is caused by JE virus (JEV), a flavivirus transmitted by Culex mosquitoes. Several vaccines have been developed to control JE in endemic areas as well as to protect travelers and military personnel who visit or are commissioned from non-endemic to endemic areas. The vaccines include inactivated vaccines produced in mouse brain or cell cultures, live attenuated vaccines, and a chimeric vaccine based on the live attenuated yellow fever virus 17D vaccine strain. All the marketed vaccines belong to the JEV genotype III, but have been shown to be efficacious against other genotypes and strains, with varying degrees of cross-neutralization, albeit at levels deemed to be protective. The protective responses have been shown to last three or more years, depending on the type of vaccine and the number of doses. This review presents a brief account of the different JE vaccines, their immunogenicity and protective ability, and the impact of JE vaccines in reducing the burden of disease in endemic countries. PMID:28301270
-
Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wogulis, Mark; Sweeney, Matthew; Heu, Tia
The present invention relates to chimeric GH61 polypeptides having cellulolytic enhancing activity. The present invention also relates to polynucleotides encoding the chimeric GH61 polypeptides; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the chimeric GH61 polypeptides.
-
Dengue Dynamics and Vaccine Cost-Effectiveness Analysis in the Philippines
Shim, Eunha
2016-01-01
Dengue is one of the most problematic vector-borne diseases in the Philippines, with an estimated 842,867 cases resulting in medical costs of $345 million U.S. dollars annually. In December 2015, the first dengue vaccine, known as chimeric yellow fever virus–dengue virus tetravalent dengue vaccine, was approved for use in the Philippines and is given to children 9 years of age. To estimate the cost-effectiveness of dengue vaccination in the Philippines, we developed an age-structured model of dengue transmission and vaccination. Using our model, we compared two vaccination scenarios entailing routine vaccination programs both with and without catch-up vaccination. Our results indicate that the higher the cost of vaccination, the less cost-effective the dengue vaccination program. With the current dengue vaccination program that vaccinates children 9 years of age, dengue vaccination is cost-effective for vaccination costs up to $70 from a health-care perspective and up to $75 from a societal perspective. Under a favorable scenario consisting of 1 year of catch-up vaccinations that target children 9–15 years of age, followed by regular vaccination of 9-year-old children, vaccination is cost-effective at costs up to $72 from a health-care perspective and up to $78 from a societal perspective. In general, dengue vaccination is expected to reduce the incidence of both dengue fever and dengue hemorrhagic fever /dengue shock syndrome. Our results demonstrate that even at relatively low vaccine efficacies, age-targeted vaccination may still be cost-effective provided the vaccination cost is sufficiently low. PMID:27601519
-
Chimeric autologous/allogeneic constructs for skin regeneration.
Rasmussen, Cathy Ann; Tam, Joshua; Steiglitz, Barry M; Bauer, Rebecca L; Peters, Noel R; Wang, Ying; Anderson, R Rox; Allen-Hoffmann, B Lynn
2014-08-01
The ideal treatment for severe cutaneous injuries would eliminate the need for autografts and promote fully functional, aesthetically pleasing autologous skin regeneration. NIKS progenitor cell-based skin tissues have been developed to promote healing by providing barrier function and delivering wound healing factors. Independently, a device has recently been created to "copy" skin by harvesting full-thickness microscopic tissue columns (MTCs) in lieu of autografts traditionally harvested as sheets. We evaluated the feasibility of combining these two technologies by embedding MTCs in NIKS-based skin tissues to generate chimeric autologous/allogeneic constructs. Chimeric constructs have the potential to provide immediate wound coverage, eliminate painful donor site wounds, and promote restoration of a pigmented skin tissue possessing hair follicles, sweat glands, and sebaceous glands. After MTC insertion, chimeric constructs and controls were reintroduced into air-interface culture and maintained in vitro for several weeks. Tissue viability, proliferative capacity, and morphology were evaluated after long-term culture. Our results confirmed successful MTC insertion and integration, and demonstrated the feasibility of generating chimeric autologous/allogeneic constructs that preserved the viability, proliferative capacity, and structure of autologous pigmented skin. These feasibility studies established the proof-of-principle necessary to further develop chimeric autologous/allogeneic constructs for the treatment of complex skin defects. Reprint & Copyright © 2014 Association of Military Surgeons of the U.S.
-
Measles-derived vaccines to prevent emerging viral diseases.
Frantz, Phanramphoei N; Teeravechyan, Samaporn; Tangy, Frédéric
2018-02-01
Infectious disease epidemics match wars and natural disasters in their capacity to threaten lives and damage economies. Like SARS previously and Zika recently, the Ebola crisis in 2015 showed how vulnerable the world is to these epidemics, with over 11,000 people dying in the outbreak. In addition to causing immense human suffering, these epidemics particularly affect low- and middle-income countries. Many of these deadly infectious diseases that have epidemic potential can become global health emergencies in the absence of effective vaccines. But very few vaccines against these threats have been developed to create proven medical products. The measles vaccine is an efficient, live attenuated, replicating virus that has been safely administered to 2 billion children over the last 40 years, affording life-long protection after a single dose. Taking advantage of these characteristics, this attenuated virus was transformed into a versatile chimeric or recombinant vaccine vector with demonstrated proof-of-principle in humans and a preclinical track record of rapid adaptability and effectiveness for a variety of pathogens. Clinical trials have shown the safety and immunogenicity of this vaccine platform in individuals with preexisting immunity to measles. This review describes the potential of this platform to develop new vaccines against emerging viral diseases. Copyright © 2018. Published by Elsevier Masson SAS.
-
An overview of bioinformatics tools for epitope prediction: implications on vaccine development.
Soria-Guerra, Ruth E; Nieto-Gomez, Ricardo; Govea-Alonso, Dania O; Rosales-Mendoza, Sergio
2015-02-01
Exploitation of recombinant DNA and sequencing technologies has led to a new concept in vaccination in which isolated epitopes, capable of stimulating a specific immune response, have been identified and used to achieve advanced vaccine formulations; replacing those constituted by whole pathogen-formulations. In this context, bioinformatics approaches play a critical role on analyzing multiple genomes to select the protective epitopes in silico. It is conceived that cocktails of defined epitopes or chimeric protein arrangements, including the target epitopes, may provide a rationale design capable to elicit convenient humoral or cellular immune responses. This review presents a comprehensive compilation of the most advantageous online immunological software and searchable, in order to facilitate the design and development of vaccines. An outlook on how these tools are supporting vaccine development is presented. HIV and influenza have been taken as examples of promising developments on vaccination against hypervariable viruses. Perspectives in this field are also envisioned. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Wang, Ledan; Cai, Yiqi; Xiong, Yirong; Du, Wangqi; Cen, Danwei; Zhang, Chanqiong; Song, Yiling; Zhu, Shanli; Xue, Xiangyang; Zhang, Lifang
2017-05-16
Chlamydia trachomatis (Ct) is one of the most frequently encountered sexual infection all over the world, yielding tremendous reproductive problems (e.g. infertility and ectopic pregnancy) in the women. This work described the design of a plasmid vaccine that protect mice from Ct infection, and reduce productive tract damage by generating effective antibody and cytotoxic T cell immunity. The vaccine, s was composed of MOMP multi-epitope and HPV16L2 genes carried in pcDNA plasmid (i.e. pcDNA3.1/MOMP/HPV16L). In transfection, the vaccine expressed the chimeric genes (i.e. MOMP and HPV16L2), as demonstrated via western blot, RT-PCR and fluorescence imaging. In vitro, the vaccine transfected COS-7 cells and expressed the proteins corresponding to the genes carried in the vaccine. Through intramuscular immunization in BALB/c mice, the vaccine induced higher levels of anti-Ct IgG titer, anti-HPV16L2 IgG titer in serum and IgA titer in local mucosal secretions, compared to plasmid vaccines that carry only Ct MOMP multi-epitope or HPV16L2 chimeric component only. In mice intravaginally challenged with Ct, the vaccines pcDNA3.1/MOMP/HPV16L2 generated a higher level of genital protection compared to other vaccine formulations. Additionally, histochemical staining indicated that pcDNA3.1/MOMP/HPV16L2 eliminated mouse genital tract tissue pathologies induced by Ct infection. This work demonstrated that pcDNA/MOMP/HPV16L2 vaccine can protect against Ct infection by regulating antibody production, cytotoxic T cell killing functions and reducing pathological damage in mice genital tract. This work can potentially offer us a new vaccine platform against Ct infection.
-
Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal
2013-12-01
Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.
-
Droplet Digital PCR-Based Chimerism Analysis for Primary Immunodeficiency Diseases.
Okano, Tsubasa; Tsujita, Yuki; Kanegane, Hirokazu; Mitsui-Sekinaka, Kanako; Tanita, Kay; Miyamoto, Satoshi; Yeh, Tzu-Wen; Yamashita, Motoi; Terada, Naomi; Ogura, Yumi; Takagi, Masatoshi; Imai, Kohsuke; Nonoyama, Shigeaki; Morio, Tomohiro
2018-04-01
In the current study, we aimed to accurately evaluate donor/recipient or male/female chimerism in samples from patients who underwent hematopoietic stem cell transplantation (HSCT). We designed the droplet digital polymerase chain reaction (ddPCR) for SRY and RPP30 to detect the male/female chimerism. We also developed mutation-specific ddPCR for four primary immunodeficiency diseases. The accuracy of the male/female chimerism analysis using ddPCR was confirmed by comparing the results with those of conventional methods (fluorescence in situ hybridization and short tandem repeat-PCR) and evaluating dilution assays. In particular, we found that this method was useful for analyzing small samples. Thus, this method could be used with patient samples, especially to sorted leukocyte subpopulations, during the early post-transplant period. Four mutation-specific ddPCR accurately detected post-transplant chimerism. ddPCR-based male/female chimerism analysis and mutation-specific ddPCR were useful for all HSCT, and these simple methods contribute to following the post-transplant chimerism, especially in disease-specific small leukocyte fractions.
-
Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts
Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso
2012-01-01
Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898
-
New Japanese encephalitis vaccines: alternatives to production in mouse brain.
Halstead, Scott B; Thomas, Stephen J
2011-03-01
Japanese encephalitis virus (JEV), a flavivirus maintained in a zoonotic cycle and transmitted by the mosquito Culex tritaeniorhynchus, causes epidemics of encephalitis throughout much of Asia. Resident populations, including short- or long-term visitors to enzootic regions, are at risk of infection and disease. For the past several decades, killed viral vaccines prepared in tissue culture or mouse brain have been used effectively to immunize travelers and residents of enzootic countries. Cost, efficacy and safety concerns led to the development of a live-attenuated virus vaccine (SA14-14-2) and more recently, to the licensure in the USA, Europe, Canada, and Australia of a purified inactivated, tissue culture-based Japanese encephalitis vaccine (IXIARO(®), referred to as IC51; Intercell AG, Vienna, Austria). In addition, a live-attenuated yellow fever-Japanese encephalitis chimeric vaccine (IMOJEV™, referred to as Japanese encephalitis-CV; Sanofi Pasteur, Lyon, France) was recently licensed in Australia and is under review in Thailand. A broad portfolio of safe and effective Japanese encephalitis vaccines has become available to meet the needs of at-risk populations; when appropriately delivered, these new vaccines should greatly diminish the burden of disease.
-
Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7.
van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W; Daemen, Toos
2015-03-24
The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV) targeting human papillomavirus (HPV). Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7) via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus.
-
Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7
van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W.; Daemen, Toos
2015-01-01
The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV) targeting human papillomavirus (HPV). Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7) via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus. PMID:26343186
-
Dengue Dynamics and Vaccine Cost-Effectiveness Analysis in the Philippines.
Shim, Eunha
2016-11-02
Dengue is one of the most problematic vector-borne diseases in the Philippines, with an estimated 842,867 cases resulting in medical costs of $345 million U.S. dollars annually. In December 2015, the first dengue vaccine, known as chimeric yellow fever virus-dengue virus tetravalent dengue vaccine, was approved for use in the Philippines and is given to children 9 years of age. To estimate the cost-effectiveness of dengue vaccination in the Philippines, we developed an age-structured model of dengue transmission and vaccination. Using our model, we compared two vaccination scenarios entailing routine vaccination programs both with and without catch-up vaccination. Our results indicate that the higher the cost of vaccination, the less cost-effective the dengue vaccination program. With the current dengue vaccination program that vaccinates children 9 years of age, dengue vaccination is cost-effective for vaccination costs up to $70 from a health-care perspective and up to $75 from a societal perspective. Under a favorable scenario consisting of 1 year of catch-up vaccinations that target children 9-15 years of age, followed by regular vaccination of 9-year-old children, vaccination is cost-effective at costs up to $72 from a health-care perspective and up to $78 from a societal perspective. In general, dengue vaccination is expected to reduce the incidence of both dengue fever and dengue hemorrhagic fever /dengue shock syndrome. Our results demonstrate that even at relatively low vaccine efficacies, age-targeted vaccination may still be cost-effective provided the vaccination cost is sufficiently low. © The American Society of Tropical Medicine and Hygiene.
-
Chokephaibulkit, K; Houillon, G; Feroldi, E; Bouckenooghe, A
2016-01-01
JE-CV (IMOJEV®, Sanofi Pasteur, France) is a live attenuated virus vaccine constructed by inserting coding sequences of the prM and E structural proteins of the Japanese encephalitis SA14-14-2 virus into the genome of yellow fever 17D virus. Primary immunization with JE-CV requires a single dose of the vaccine. This article reviews clinical trials of JE-CV in children aged up to 6 years conducted in countries across South-East Asia. Strong and persistent antibody responses were observed after single primary and booster doses, with 97% of children seroprotected up to five years after booster vaccination. Models of long-term antibody persistence predict a median duration of protection of approximately 30 years after a booster dose. The safety and reactogenicity profiles of JE-CV primary and booster doses are comparable to other widely used childhood vaccines.
-
Meza, Beatriz; Ascencio, Felipe; Sierra-Beltrán, Arturo Pedro; Torres, Javier; Angulo, Carlos
2017-04-01
Helicobacter pylori have colonized the gastric mucosa of half of the population worldwide. This bacterium is classified as a definitive type I carcinogen by the World Health Organization and no effective vaccine has been found against it yet. Thus, a logical and rational vaccine design against H. pylori is necessary. Because of its tremendous complexity and elicited immune responses, the vaccine design should considered multiple antigens to enhance immune-protection, involved in the different stages of pathogenesis besides inducing a specific immune response by B- and T-cell multi-epitopes. In this study, emphasis was placed on the design of a new unique vaccine named CTB-multiHp. In silico techniques were used to design a chimeric construct consisting of cholera toxin B subunit fused to multi-epitope of urease B (residue 148-158, 188-198), cytotoxin-associated gene A (residue 584-602), neutrophil activating protein (residue 4-28), vacuolating cytotoxin gene A (residue 63-81), H. pylori adhesine A (residue77-99), heat shock protein A (residue 32-54) and gamma glutamyl transpeptidase (residue 271-293). The tertiary structure and features of the vaccine were analyzed. The chimeric protein was expressed in Escherichia coli BL21 and the serology analyses indicated that the CTB-multiHp protein produced exhibit immune-reactivity. The results showed that CTB-multiHp could be a good vaccine candidate against H. pylori. Ongoing studies will evaluate the effects of CTB-multiHp against H. pylori infection. Copyright © 2017 Elsevier B.V. All rights reserved.
-
A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates
Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R.; Bett, Andrew J.
2016-01-01
Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses. PMID:27008550
-
A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.
Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R; Bett, Andrew J
2016-01-01
Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.
-
Live vaccines for human metapneumovirus designed by reverse genetics.
Buchholz, Ursula J; Nagashima, Kunio; Murphy, Brian R; Collins, Peter L
2006-10-01
Human metapneumovirus (HMPV) was first described in 2001 and has quickly become recognized as an important cause of respiratory tract disease worldwide, especially in the pediatric population. A vaccine against HMPV is required to prevent severe disease associated with infection in infancy. The primary strategy is to develop a live-attenuated virus for intranasal immunization, which is particularly well suited against a respiratory virus. Reverse genetics provides a means of developing highly characterized 'designer' attenuated vaccine candidates. To date, several promising vaccine candidates have been developed, each using a different mode of attenuation. One candidate involves deletion of the G glycoprotein, providing attenuation that is probably based on reduced efficiency of attachment. A second candidate involves deletion of the M2-2 protein, which participates in regulating RNA synthesis and whose deletion has the advantageous property of upregulating transcription and increasing antigen synthesis. A third candidate involves replacing the P protein gene of HMPV with its counterpart from the related avian metapneumovirus, thereby introducing attenuation owing to its chimeric nature and host range restriction. Another live vaccine strategy involves using an attenuated parainfluenza virus as a vector to express HMPV protective antigens, providing a bivalent pediatric vaccine. Additional modifications to provide improved vaccines will also be discussed.
-
Plant-made vaccines against West Nile virus are potent, safe, and economically feasible
Chen, Qiang
2015-01-01
The threat of West Nile virus (WNV) epidemics with increasingly severe neuroinvasive infections demands the development and licensing of effective vaccines. To date, vaccine candidates based on inactivated, live-attenuated, or chimeric virus, and viral DNA and WNV protein subunits have been developed. Some have been approved for veterinary use or are under clinical investigation, yet no vaccine has been licensed for human use. Reaching the milestone of a commercialized human vaccine, however, may largely depend on the economics of vaccine production. Analysis suggests that currently only novel low-cost production technologies would allow vaccination to outcompete the cost of surveillance and clinical treatment. Here, we review progress using plants to address the economic challenges of WNV vaccine production. The advantages of plants as hosts for vaccine production in cost, speed and scalability, especially those of viral vector-based transient expression systems, are discussed. The progress in developing WNV subunit vaccines in plants is reviewed within the context of their expression, characterization, downstream processing, and immunogenicity in animal models. The development of vaccines based on enveloped and non-enveloped virus-like particles is also discussed. These advancements suggest that plants may provide a production platform that offers potent, safe and affordable human vaccines against WNV. PMID:25676782
-
Shieh, Fwu-Shan; Jongeneel, Patrick; Steffen, Jamin D; Lin, Selena; Jain, Surbhi; Song, Wei; Su, Ying-Hsiu
2017-01-01
Identification of viral integration sites has been important in understanding the pathogenesis and progression of diseases associated with particular viral infections. The advent of next-generation sequencing (NGS) has enabled researchers to understand the impact that viral integration has on the host, such as tumorigenesis. Current computational methods to analyze NGS data of virus-host junction sites have been limited in terms of their accessibility to a broad user base. In this study, we developed a software application (named ChimericSeq), that is the first program of its kind to offer a graphical user interface, compatibility with both Windows and Mac operating systems, and optimized for effectively identifying and annotating virus-host chimeric reads within NGS data. In addition, ChimericSeq's pipeline implements custom filtering to remove artifacts and detect reads with quantitative analytical reporting to provide functional significance to discovered integration sites. The improved accessibility of ChimericSeq through a GUI interface in both Windows and Mac has potential to expand NGS analytical support to a broader spectrum of the scientific community.
-
Shieh, Fwu-Shan; Jongeneel, Patrick; Steffen, Jamin D.; Lin, Selena; Jain, Surbhi; Song, Wei
2017-01-01
Identification of viral integration sites has been important in understanding the pathogenesis and progression of diseases associated with particular viral infections. The advent of next-generation sequencing (NGS) has enabled researchers to understand the impact that viral integration has on the host, such as tumorigenesis. Current computational methods to analyze NGS data of virus-host junction sites have been limited in terms of their accessibility to a broad user base. In this study, we developed a software application (named ChimericSeq), that is the first program of its kind to offer a graphical user interface, compatibility with both Windows and Mac operating systems, and optimized for effectively identifying and annotating virus-host chimeric reads within NGS data. In addition, ChimericSeq’s pipeline implements custom filtering to remove artifacts and detect reads with quantitative analytical reporting to provide functional significance to discovered integration sites. The improved accessibility of ChimericSeq through a GUI interface in both Windows and Mac has potential to expand NGS analytical support to a broader spectrum of the scientific community. PMID:28829778
-
Mazur, Natalie I; Higgins, Deborah; Nunes, Marta C; Melero, José A; Langedijk, Annefleur C; Horsley, Nicole; Buchholz, Ursula J; Openshaw, Peter J; McLellan, Jason S; Englund, Janet A; Mejias, Asuncion; Karron, Ruth A; Simões, Eric Af; Knezevic, Ivana; Ramilo, Octavio; Piedra, Pedro A; Chu, Helen Y; Falsey, Ann R; Nair, Harish; Kragten-Tabatabaie, Leyla; Greenough, Anne; Baraldi, Eugenio; Papadopoulos, Nikolaos G; Vekemans, Johan; Polack, Fernando P; Powell, Mair; Satav, Ashish; Walsh, Edward E; Stein, Renato T; Graham, Barney S; Bont, Louis J
2018-06-15
The global burden of disease caused by respiratory syncytial virus (RSV) is increasingly recognised, not only in infants, but also in older adults (aged ≥65 years). Advances in knowledge of the structural biology of the RSV surface fusion glycoprotein have revolutionised RSV vaccine development by providing a new target for preventive interventions. The RSV vaccine landscape has rapidly expanded to include 19 vaccine candidates and monoclonal antibodies (mAbs) in clinical trials, reflecting the urgency of reducing this global health problem and hence the prioritisation of RSV vaccine development. The candidates include mAbs and vaccines using four approaches: (1) particle-based, (2) live-attenuated or chimeric, (3) subunit, (4) vector-based. Late-phase RSV vaccine trial failures highlight gaps in knowledge regarding immunological protection and provide lessons for future development. In this Review, we highlight promising new approaches for RSV vaccine design and provide a comprehensive overview of RSV vaccine candidates and mAbs in clinical development to prevent one of the most common and severe infectious diseases in young children and older adults worldwide. Copyright © 2018 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd.. All rights reserved.
-
Bone marrow chimerism as a strategy to produce tolerance in solid organ allotransplantation.
Hu, Min; Alexander, Stephen I; Yi, Shounan
2016-12-01
Clinical transplant tolerance has been most successfully achieved combining hematopoietic chimerism with kidney transplantation. This review outlines this strategy in animal models and human transplantation, and possible clinical challenges. Kidney transplant tolerance has been achieved through chimerism in several centers beginning with Massachusetts General Hospital's success with mixed chimerism in human leukocyte antigen (HLA)-mismatched patients and the Stanford group with HLA-matched patients, and the more recent success of the Northwestern protocol achieving full chimerism. This has challenged the original view that stable mixed chimerism is necessary for organ graft tolerance. However, among the HLA-mismatched kidney transplant-tolerant patients, loss of mixed chimerism does not lead to renal-graft rejection, and the development of host Foxp3+ regulatory T cells has been observed. Recent animal models suggest that graft tolerance through bone marrow chimerism occurs through both clonal deletion and regulatory immune cells. Further, Tregs have been shown to improve chimerism in animal models. Animal studies continue to suggest ways to improve our current clinical strategies. Advances in chimerism protocols suggest that tolerance may be clinically achievable with relative safety for HLA-mismatched kidney transplants.
-
Identifying Attenuating Mutations: Tools for a New Vaccine Design against Flaviviruses.
Khou, Cécile; Pardigon, Nathalie
2017-01-01
Emerging Flaviviruses pose an increasing threat to global human health. To date, human vaccines against yellow fever virus (YFV), Japanese encephalitis virus (JEV), dengue virus (DV), and tick-borne encephalitis virus (TBEV) exist. However, there is no human vaccine against other Flaviviruses such as Zika virus (ZIKV) and West Nile virus (WNV). In order to restrict their spread and to protect populations against the diseases they induce, vaccines against these emerging viruses must be designed. Obtaining new live attenuated Flavivirus vaccines using molecular biology methods is now possible. Molecular infectious clones of the parental viruses are relatively easy to generate. Key mutations present in live attenuated vaccines or mutations known to have a key role in the Flavivirus life cycle and/or interactions with their hosts can be identified by sequencing, and are then inserted in infectious clones by site-directed mutagenesis. More recently, the use of chimeric viruses and large-scale reencoding and introduction of microRNA target sequences have also been tested. Indeed, a combination of these methods will help in designing new generations of vaccines against emerging and reemerging Flaviviruses. © 2017 S. Karger AG, Basel.
-
Chimeric mitochondrial peptides from contiguous regular and swinger RNA.
Seligmann, Hervé
2016-01-01
Previous mass spectrometry analyses described human mitochondrial peptides entirely translated from swinger RNAs, RNAs where polymerization systematically exchanged nucleotides. Exchanges follow one among 23 bijective transformation rules, nine symmetric exchanges (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric exchanges (X → Y → Z → X, e.g. A → C → G → A), multiplying by 24 DNA's protein coding potential. Abrupt switches from regular to swinger polymerization produce chimeric RNAs. Here, human mitochondrial proteomic analyses assuming abrupt switches between regular and swinger transcriptions, detect chimeric peptides, encoded by part regular, part swinger RNA. Contiguous regular- and swinger-encoded residues within single peptides are stronger evidence for translation of swinger RNA than previously detected, entirely swinger-encoded peptides: regular parts are positive controls matched with contiguous swinger parts, increasing confidence in results. Chimeric peptides are 200 × rarer than swinger peptides (3/100,000 versus 6/1000). Among 186 peptides with > 8 residues for each regular and swinger parts, regular parts of eleven chimeric peptides correspond to six among the thirteen recognized, mitochondrial protein-coding genes. Chimeric peptides matching partly regular proteins are rarer and less expressed than chimeric peptides matching non-coding sequences, suggesting targeted degradation of misfolded proteins. Present results strengthen hypotheses that the short mitogenome encodes far more proteins than hitherto assumed. Entirely swinger-encoded proteins could exist.
-
Bentley, Carol; Yates, Jenna; Salimi, Maryam; Greig, Jenny; Wiblin, Sarah; Hassanali, Tasneem; Banham, Alison H.
2017-01-01
Therapeutic monoclonal antibodies targeting cell surface or secreted antigens are among the most effective classes of novel immunotherapies. However, the majority of human proteins and established cancer biomarkers are intracellular. Peptides derived from these intracellular proteins are presented on the cell surface by major histocompatibility complex class I (MHC-I) and can be targeted by a novel class of T-cell receptor mimic (TCRm) antibodies that recognise similar epitopes to T-cell receptors. Humoural immune responses to MHC-I tetramers rarely generate TCRm antibodies and many antibodies recognise the α3 domain of MHC-I and β2 microglobulin (β2m) that are not directly involved in presenting the target peptide. Here we describe the production of functional chimeric human-murine HLA-A2-H2Dd tetramers and modifications that increase their bacterial expression and refolding efficiency. These chimeric tetramers were successfully used to generate TCRm antibodies against two epitopes derived from wild type tumour suppressor p53 (RMPEAAPPV and GLAPPQHLIRV) that have been used in vaccination studies. Immunisation with chimeric tetramers yielded no antibodies recognising the human α3 domain and β2m and generated TCRm antibodies capable of specifically recognising the target peptide/MHC-I complex in fully human tetramers and on the cell surface of peptide pulsed T2 cells. Chimeric tetramers represent novel immunogens for TCRm antibody production and may also improve the yield of tetramers for groups using these reagents to monitor CD8 T-cell immune responses in HLA-A2 transgenic mouse models of immunotherapy. PMID:28448627
-
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
2012-01-01
Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561
-
van den Pol, Anthony N; Mao, Guochao; Chattopadhyay, Anasuya; Rose, John K; Davis, John N
2017-03-15
Recombinant vesicular stomatitis virus (VSV)-based chimeric viruses that include genes from other viruses show promise as vaccines and oncolytic viruses. However, the critical safety concern is the neurotropic nature conveyed by the VSV glycoprotein. VSVs that include the VSV glycoprotein (G) gene, even in most recombinant attenuated strains, can still show substantial adverse or lethal actions in the brain. Here, we test 4 chimeric viruses in the brain, including those in which glycoprotein genes from Nipah, chikungunya (CHIKV), and influenza H5N1 viruses were substituted for the VSV glycoprotein gene. We also test a virus-like vesicle (VLV) in which the VSV glycoprotein gene is expressed from a replicon encoding the nonstructural proteins of Semliki Forest virus. VSVΔG-CHIKV, VSVΔG-H5N1, and VLV were all safe in the adult mouse brain, as were VSVΔG viruses expressing either the Nipah F or G glycoprotein. In contrast, a complementing pair of VSVΔG viruses expressing Nipah G and F glycoproteins were lethal within the brain within a surprisingly short time frame of 2 days. Intranasal inoculation in postnatal day 14 mice with VSVΔG-CHIKV or VLV evoked no adverse response, whereas VSVΔG-H5N1 by this route was lethal in most mice. A key immune mechanism underlying the safety of VSVΔG-CHIKV, VSVΔG-H5N1, and VLV in the adult brain was the type I interferon response; all three viruses were lethal in the brains of adult mice lacking the interferon receptor, suggesting that the viruses can infect and replicate and spread in brain cells if not blocked by interferon-stimulated genes within the brain. IMPORTANCE Vesicular stomatitis virus (VSV) shows considerable promise both as a vaccine vector and as an oncolytic virus. The greatest limitation of VSV is that it is highly neurotropic and can be lethal within the brain. The neurotropism can be mostly attributed to the VSV G glycoprotein. Here, we test 4 chimeric viruses of VSV with glycoprotein genes from Nipah
-
Mao, Guochao; Chattopadhyay, Anasuya; Rose, John K.; Davis, John N.
2017-01-01
ABSTRACT Recombinant vesicular stomatitis virus (VSV)-based chimeric viruses that include genes from other viruses show promise as vaccines and oncolytic viruses. However, the critical safety concern is the neurotropic nature conveyed by the VSV glycoprotein. VSVs that include the VSV glycoprotein (G) gene, even in most recombinant attenuated strains, can still show substantial adverse or lethal actions in the brain. Here, we test 4 chimeric viruses in the brain, including those in which glycoprotein genes from Nipah, chikungunya (CHIKV), and influenza H5N1 viruses were substituted for the VSV glycoprotein gene. We also test a virus-like vesicle (VLV) in which the VSV glycoprotein gene is expressed from a replicon encoding the nonstructural proteins of Semliki Forest virus. VSVΔG-CHIKV, VSVΔG-H5N1, and VLV were all safe in the adult mouse brain, as were VSVΔG viruses expressing either the Nipah F or G glycoprotein. In contrast, a complementing pair of VSVΔG viruses expressing Nipah G and F glycoproteins were lethal within the brain within a surprisingly short time frame of 2 days. Intranasal inoculation in postnatal day 14 mice with VSVΔG-CHIKV or VLV evoked no adverse response, whereas VSVΔG-H5N1 by this route was lethal in most mice. A key immune mechanism underlying the safety of VSVΔG-CHIKV, VSVΔG-H5N1, and VLV in the adult brain was the type I interferon response; all three viruses were lethal in the brains of adult mice lacking the interferon receptor, suggesting that the viruses can infect and replicate and spread in brain cells if not blocked by interferon-stimulated genes within the brain. IMPORTANCE Vesicular stomatitis virus (VSV) shows considerable promise both as a vaccine vector and as an oncolytic virus. The greatest limitation of VSV is that it is highly neurotropic and can be lethal within the brain. The neurotropism can be mostly attributed to the VSV G glycoprotein. Here, we test 4 chimeric viruses of VSV with glycoprotein genes from
-
Halstead, Scott B
2018-02-26
A tetravalent live-attenuated 3-dose vaccine composed of chimeras of yellow fever 17D and the four dengue viruses (CYD, also called Dengvaxia) completed phase 3 clinical testing in over 35,000 children leading to a recommendation that vaccine be administered to >/ = 9 year-olds residing in highly dengue- endemic countries. When clinical trial results were assessed 2 years after the first dose, vaccine efficacy among seropositives was high, but among seronegatives efficacy was marginal. Breakthrough dengue hospitalizations of vaccinated children occurred continuously over a period of 4-5 years post 3rd dose in an age distribution suggesting these children had been vaccinated when seronegative. This surmise was validated recently when the manufacturer reported that dengue NS1 IgG antibodies were absent in sera from hospitalized vaccinated children, an observation consistent with their having received Dengvaxia when seronegative. Based upon published efficacy data and in compliance with initial published recommendations by the manufacturer and WHO the Philippine government undertook to vaccinate 800,000-plus 9 year-olds starting in April 2016. Eighteen months later, dengue hospitalizations and a deaths were reported among vaccinated children. The benefits of administering Dengvaxia predicted by the manufacturer, WHO and others derive from scoring dengue hospitalizations of vaccinated children as vaccine failures rather than as vaccine enhanced dengue disease. Recommended regimens for administration of Dengvaxia should have been structured to warn of and avoid serious adverse events.
-
Dengue Fever: Causes, Complications, and Vaccine Strategies
Khanna, Ira
2016-01-01
Dengue is a highly endemic infectious disease of the tropical countries and is rapidly becoming a global burden. It is caused by any of the 4 serotypes of dengue virus and is transmitted within humans through female Aedes mosquitoes. Dengue disease varies from mild fever to severe conditions of dengue hemorrhagic fever and shock syndrome. Globalization, increased air travel, and unplanned urbanization have led to increase in the rate of infection and helped dengue to expand its geographic and demographic distribution. Dengue vaccine development has been a challenging task due to the existence of four antigenically distinct dengue virus serotypes, each capable of eliciting cross-reactive and disease-enhancing antibody response against the remaining three serotypes. Recently, Sanofi Pasteur's chimeric live-attenuated dengue vaccine candidate has been approved in Mexico, Brazil, and Philippines for usage in adults between 9 and 45 years of age. The impact of its limited application to the public health system needs to be evaluated. Simultaneously, the restricted application of this vaccine candidate warrants continued efforts in developing a dengue vaccine candidate which is additionally efficacious for infants and naïve individuals. In this context, alternative strategies of developing a designed vaccine candidate which does not allow production of enhancing antibodies should be explored, as it may expand the umbrella of efficacy to include infants and naïve individuals. PMID:27525287
-
Rodrigues, Ana F; Soares, Hugo R; Guerreiro, Miguel R; Alves, Paula M; Coroadinha, Ana S
2015-09-01
Vaccination is one of the most effective interventions in global health. The worldwide vaccination programs significantly reduced the number of deaths caused by infectious agents. A successful example was the eradication of smallpox in 1979 after two centuries of vaccination campaigns. Since the first variolation administrations until today, the knowledge on immunology has increased substantially. This knowledge combined with the introduction of cell culture and DNA recombinant technologies revolutionized vaccine design. This review will focus on vaccines against human viral pathogens, recent developments on vaccine design and cell substrates used for their manufacture. While the production of attenuated and inactivated vaccines requires the use of the respective permissible cell substrates, the production of recombinant antigens, virus-like particles, vectored vaccines and chimeric vaccines requires the use - and often the development - of specific cell lines. Indeed, the development of novel modern viral vaccine designs combined with, the stringent safety requirements for manufacture, and the better understanding on animal cell metabolism and physiology are increasing the awareness on the importance of cell line development and engineering areas. A new era of modern vaccinology is arriving, offering an extensive toolbox to materialize novel and creative ideas in vaccine design and its manufacture. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Licensed Dengue Vaccine: Public Health Conundrum and Scientific Challenge.
Halstead, Scott B
2016-10-05
A tetravalent live attenuated vaccine composed of chimeras of yellow fever 17D and the four dengue viruses (chimeric yellow fever dengue [CYD]) manufactured by Sanofi Pasteur has completed phase III clinical testing in over 35,000 children 2-16 years of age. The vaccine was recently licensed in four countries. During the first 2 years of observation, CYD vaccine efficacy ranged between 30% and 79% in 10 different countries with an overall efficacy of 56.8%. During year 3, there was an overall efficacy against hospitalization of 16.7%, but a relative risk of hospitalization of 1.6 among children younger than 9 years and 4.95 in children 5 years of age and younger. Vaccination of seronegative children resulted in universal broad dengue neutralizing antibody responses, but poor protection against breakthrough dengue cases. Unless proven otherwise, such breakthrough cases in vaccinated subjects should be regarded as vaccine antibody-enhanced (ADE). The provenance of these cases can be studied serologically using original antigenic sin immune responses in convalescent sera. In conventional dengue vaccine efficacy clinical trials, persons vaccinated as seronegatives may be hospitalized with breakthrough ADE infections, whereas in the placebo group, dengue infection of monotypic immunes results in hospitalization. Vaccine efficacy trial design must identify dengue disease etiology by separately measuring efficacy in seronegatives and seropositives. The reason(s) why CYD vaccine failed to raise protective dengue virus immunity are unknown. To achieve a safe and protective dengue vaccine, careful studies of monotypic CYD vaccines in humans should precede field trials of tetravalent formulations. © The American Society of Tropical Medicine and Hygiene.
-
Jimenez-Guardeño, Jose M; Regla-Nava, Jose A; Nieto-Torres, Jose L; DeDiego, Marta L; Castaño-Rodriguez, Carlos; Fernandez-Delgado, Raul; Perlman, Stanley; Enjuanes, Luis
2015-10-01
A SARS-CoV lacking the full-length E gene (SARS-CoV-∆E) was attenuated and an effective vaccine. Here, we show that this mutant virus regained fitness after serial passages in cell culture or in vivo, resulting in the partial duplication of the membrane gene or in the insertion of a new sequence in gene 8a, respectively. The chimeric proteins generated in cell culture increased virus fitness in vitro but remained attenuated in mice. In contrast, during SARS-CoV-∆E passage in mice, the virus incorporated a mutated variant of 8a protein, resulting in reversion to a virulent phenotype. When the full-length E protein was deleted or its PDZ-binding motif (PBM) was mutated, the revertant viruses either incorporated a novel chimeric protein with a PBM or restored the sequence of the PBM on the E protein, respectively. Similarly, after passage in mice, SARS-CoV-∆E protein 8a mutated, to now encode a PBM, and also regained virulence. These data indicated that the virus requires a PBM on a transmembrane protein to compensate for removal of this motif from the E protein. To increase the genetic stability of the vaccine candidate, we introduced small attenuating deletions in E gene that did not affect the endogenous PBM, preventing the incorporation of novel chimeric proteins in the virus genome. In addition, to increase vaccine biosafety, we introduced additional attenuating mutations into the nsp1 protein. Deletions in the carboxy-terminal region of nsp1 protein led to higher host interferon responses and virus attenuation. Recombinant viruses including attenuating mutations in E and nsp1 genes maintained their attenuation after passage in vitro and in vivo. Further, these viruses fully protected mice against challenge with the lethal parental virus, and are therefore safe and stable vaccine candidates for protection against SARS-CoV.
-
Qi, Gaofu; Li, Jingjing; Wang, Shengying; Xin, Shanshan; Du, Peng; Zhang, Qingye; Zhao, Xiuyun
2011-04-01
Vaccination against cholesteryl ester transfer protein (CETP) is proven to be effective for inhibiting atherosclerosis in animal models. In this study, the proteases-resistant intestinal trefoil factor (TFF3) was used as a molecular vehicle to construct chimeric TFF3 (cTFF3) containing CETP B cell epitope and tetanus toxin helper T cell epitope. It was found that cTFF3 still preserved a trefoil structure, and can resist proteases digestion in vitro. After oral immunization with cTFF3, the CETP-specific IgA and IgG could be found in intestine lavage fluid and serum, and the anti-CETP antibodies could inhibit partial CETP activity to increase high-density lipoprotein cholesterol, decrease low-density lipoprotein cholesterol, and inhibit atherosclerosis in animals. Therefore, TFF3 is a potential molecular vehicle for developing oral peptide vaccines. Our research highlights a novel strategy for developing oral peptide vaccines in the future. Copyright © 2010 Elsevier Inc. All rights reserved.
-
Mechanism of attenuation of a chimeric influenza A/B transfectant virus.
Luo, G; Bergmann, M; Garcia-Sastre, A; Palese, P
1992-08-01
The ribonucleoprotein transfection system for influenza virus allowed us to construct an influenza A virus containing a chimeric neuraminidase (NA) gene in which the noncoding sequence is derived from the NS gene of influenza B virus (T. Muster, E. K. Subbarao, M. Enami, B. P. Murphy, and P. Palese, Proc. Natl. Acad. Sci. USA 88:5177-5181, 1991). This transfectant virus is attenuated in mice and grows to lower titers in tissue culture than wild-type virus. Since such a virus has characteristics desirable for a live attenuated vaccine strain, attempts were made to characterize this virus at the molecular level. Our analysis suggests that the attenuation of the virus is due to changes in the cis signal sequences, which resulted in a reduction of transcription and replication of the chimeric NA gene. The major finding concerns a sixfold reduction in NA-specific viral RNA in the virion, causing a reduction in the ratio of infectious particles to physical particles compared with the ratio in wild-type virus. Although the NA-specific mRNA level is also reduced in transfectant virus-infected cells, it does not appear to contribute to the attenuation characteristics of the virus. The levels of the other RNAs and their expression appear to be unchanged for the transfectant virus. It is suggested that downregulation of the synthesis of one viral RNA segment leads to the generation of defective viruses during each replication cycle. We believe that this represents a general principle for attenuation which may be applied to other segmented viruses containing either single-stranded or double-stranded RNA.
-
Recurrent chimeric RNAs enriched in human prostate cancer identified by deep sequencing
Kannan, Kalpana; Wang, Liguo; Wang, Jianghua; Ittmann, Michael M.; Li, Wei; Yen, Laising
2011-01-01
Transcription-induced chimeric RNAs, possessing sequences from different genes, are expected to increase the proteomic diversity through chimeric proteins or altered regulation. Despite their importance, few studies have focused on chimeric RNAs especially regarding their presence/roles in human cancers. By deep sequencing the transcriptome of 20 human prostate cancer and 10 matched benign prostate tissues, we obtained 1.3 billion sequence reads, which led to the identification of 2,369 chimeric RNA candidates. Chimeric RNAs occurred in significantly higher frequency in cancer than in matched benign samples. Experimental investigation of a selected 46 set led to the confirmation of 32 chimeric RNAs, of which 27 were highly recurrent and previously undescribed in prostate cancer. Importantly, a subset of these chimeras was present in prostate cancer cell lines, but not detectable in primary human prostate epithelium cells, implying their associations with cancer. These chimeras contain discernable 5′ and 3′ splice sites at the RNA junction, indicating that their formation is mediated by splicing. Their presence is also largely independent of the expression of parental genes, suggesting that other factors are involved in their production and regulation. One chimera, TMEM79-SMG5, is highly differentially expressed in human cancer samples and therefore a potential biomarker. The prevalence of chimeric RNAs may allow the limited number of human genes to encode a substantially larger number of RNAs and proteins, forming an additional layer of cellular complexity. Together, our results suggest that chimeric RNAs are widespread, and increased chimeric RNA events could represent a unique class of molecular alteration in cancer. PMID:21571633
-
Porcine induced pluripotent stem cells produce chimeric offspring.
West, Franklin D; Terlouw, Steve L; Kwon, Dae Jin; Mumaw, Jennifer L; Dhara, Sujoy K; Hasneen, Kowser; Dobrinsky, John R; Stice, Steven L
2010-08-01
Ethical and moral issues rule out the use of human induced pluripotent stem cells (iPSCs) in chimera studies that would determine the full extent of their reprogrammed state, instead relying on less rigorous assays such as teratoma formation and differentiated cell types. To date, only mouse iPSC lines are known to be truly pluripotent. However, initial mouse iPSC lines failed to form chimeric offspring, but did generate teratomas and differentiated embryoid bodies, and thus these specific iPSC lines were not completely reprogrammed or truly pluripotent. Therefore, there is a need to address whether the reprogramming factors and process used eventually to generate chimeric mice are universal and sufficient to generate reprogrammed iPSC that contribute to chimeric offspring in additional species. Here we show that porcine mesenchymal stem cells transduced with 6 human reprogramming factors (POU5F1, SOX2, NANOG, KLF4, LIN28, and C-MYC) injected into preimplantation-stage embryos contributed to multiple tissue types spanning all 3 germ layers in 8 of 10 fetuses. The chimerism rate was high, 85.3% or 29 of 34 live offspring were chimeras based on skin and tail biopsies harvested from 2- to 5-day-old pigs. The creation of pluripotent porcine iPSCs capable of generating chimeric offspring introduces numerous opportunities to study the facets significantly affecting cell therapies, genetic engineering, and other aspects of stem cell and developmental biology.
-
Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter
2012-04-01
Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.
-
Plant-made vaccines against West Nile virus are potent, safe, and economically feasible.
Chen, Qiang
2015-05-01
The threat of West Nile virus (WNV) epidemics with increasingly severe neuroinvasive infections demands the development and licensing of effective vaccines. To date, vaccine candidates based on inactivated, live-attenuated, or chimeric virus, and viral DNA and WNV protein subunits have been developed. Some have been approved for veterinary use or are under clinical investigation, yet no vaccine has been licensed for human use. Reaching the milestone of a commercialized human vaccine, however, may largely depend on the economics of vaccine production. Analysis suggests that currently only novel low-cost production technologies would allow vaccination to outcompete the cost of surveillance and clinical treatment. Here, we review progress using plants to address the economic challenges of WNV vaccine production. The advantages of plants as hosts for vaccine production in cost, speed and scalability, especially those of viral vector-based transient expression systems, are discussed. The progress in developing WNV subunit vaccines in plants is reviewed within the context of their expression, characterization, downstream processing, and immunogenicity in animal models. The development of vaccines based on enveloped and non-enveloped virus-like particles is also discussed. These advancements suggest that plants may provide a production platform that offers potent, safe and affordable human vaccines against WNV. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
The utility of Plasmodium berghei as a rodent model for anti-merozoite malaria vaccine assessment
Goodman, Anna L.; Forbes, Emily K.; Williams, Andrew R.; Douglas, Alexander D.; de Cassan, Simone C.; Bauza, Karolis; Biswas, Sumi; Dicks, Matthew D. J.; Llewellyn, David; Moore, Anne C.; Janse, Chris J.; Franke-Fayard, Blandine M.; Gilbert, Sarah C.; Hill, Adrian V. S.; Pleass, Richard J.; Draper, Simon J.
2013-01-01
Rodent malaria species Plasmodium yoelii and P. chabaudi have been widely used to validate vaccine approaches targeting blood-stage merozoite antigens. However, increasing data suggest the P. berghei rodent malaria may be able to circumvent vaccine-induced anti-merozoite responses. Here we confirm a failure to protect against P. berghei, despite successful antibody induction against leading merozoite antigens using protein-in-adjuvant or viral vectored vaccine delivery. No subunit vaccine approach showed efficacy in mice following immunization and challenge with the wild-type P. berghei strains ANKA or NK65, or against a chimeric parasite line encoding a merozoite antigen from P. falciparum. Protection was not improved in knockout mice lacking the inhibitory Fc receptor CD32b, nor against a Δsmac P. berghei parasite line with a non-sequestering phenotype. An improved understanding of the mechanisms responsible for protection, or failure of protection, against P. berghei merozoites could guide the development of an efficacious vaccine against P. falciparum. PMID:23609325
-
Mosaic Origins of a Complex Chimeric Mitochondrial Gene in Silene vulgaris
Storchova, Helena; Müller, Karel; Lau, Steffen; Olson, Matthew S.
2012-01-01
Chimeric genes are significant sources of evolutionary innovation that are normally created when portions of two or more protein coding regions fuse to form a new open reading frame. In plant mitochondria astonishingly high numbers of different novel chimeric genes have been reported, where they are generated through processes of rearrangement and recombination. Nonetheless, because most studies do not find or report nucleotide variation within the same chimeric gene, evolution after the origination of these chimeric genes remains unstudied. Here we identify two alleles of a complex chimera in Silene vulgaris that are divergent in nucleotide sequence, genomic position relative to other mitochondrial genes, and expression patterns. Structural patterns suggest a history partially influenced by gene conversion between the chimeric gene and functional copies of subunit 1 of the mitochondrial ATP synthase gene (atp1). We identified small repeat structures within the chimeras that are likely recombination sites allowing generation of the chimera. These results establish the potential for chimeric gene divergence in different plant mitochondrial lineages within the same species. This result contrasts with the absence of diversity within mitochondrial chimeras found in crop species. PMID:22383961
-
Halstead, Scott B
2018-06-01
The scientific community now possesses information obtained directly from human beings that makes it possible to understand why breakthrough-enhanced dengue virus (DENV) infections occurred in children receiving Sanofi Pasteur's Dengvaxia tetravalent live attenuated vaccine and to predict the possibility of breakthrough-enhanced DENV infections following immunization with two other tetravalent live attenuated vaccines now in phase III testing. Based upon recent research, Dengvaxia, lacking DENV nonstructural protein antigens, did not protect seronegatives because it failed to raise a competent T-cell response and/or antibodies to NS1. It is also possible that chimeric structure does not present the correct virion conformation permitting the development of protective neutralizing antibodies. A premonitory signal shared by the Sanofi Pasteur and the Takeda vaccines was the failure of fully immunized subhuman primates to prevent low-level viremia and/or anamnestic antibody responses to live DENV challenge. The vaccine developed by the National Institute of Allergy and Infectious Diseases (National Institutes of Health [NIH]) has met virtually all of the goals needed to demonstrate preclinical efficacy and safety for humans. Each monovalent vaccine was comprehensively studied for reactogenicity and immunogenicity in human volunteers. Protective immunity in subjects receiving tetravalent candidate vaccines was evidenced by the fact that when vaccinated subjects were given further doses of vaccine or different strains of DENV the result was "solid immunity," a nonviremic and nonanamnestic immune response. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.
-
Bao, Huihui; Ramanathan, Aarti A; Kawalakar, Omkar; Sundaram, Senthil G; Tingey, Colleen; Bian, Charoran B; Muruganandam, Nagarajan; Vijayachari, Paluru; Sardesai, Niranjan Y; Weiner, David B; Ugen, Kenneth E; Muthumani, Karuppiah
2013-02-01
Chikungunya virus (CHIKV) is an important emerging mosquito-borne alphavirus, indigenous to tropical Africa and Asia. It can cause epidemic fever and acute illness characterized by fever and arthralgias. The epidemic cycle of this infection is similar to dengue and urban yellow fever viral infections. The generation of an efficient vaccine against CHIKV is necessary to prevent and/or control the disease manifestations of the infection. In this report, we studied immune response against a CHIKV-envelope DNA vaccine (pEnv) and the role of the CHIKV nonstructural gene 2 (nsP2) as an adjuvant for the induction of protective immune responses in a relevant mouse challenge model. When injected with the CHIKV pEnv alone, 70% of the immunized mice survived CHIKV challenge, whereas when co-injected with pEnv+pnsP2, 90% of the mice survived viral challenge. Mice also exhibited a delayed onset signs of illness, and a marked decrease in morbidity, suggesting a nsP2 mediated adjuvant effect. Co-injection of the pnsP2 adjuvant with pEnv also qualitatively and quantitatively increased antigen specific neutralizing antibody responses compared to vaccination with pEnv alone. In sum, these novel data imply that the addition of nsP2 to the pEnv vaccine enhances anti-CHIKV-Env immune responses and maybe useful to include in future CHIKV clinical vaccination strategies.
-
Erwin-Cohen, Rebecca A; Porter, Aimee I; Pittman, Phillip R; Rossi, Cynthia A; DaSilva, Luis
2017-01-02
Venezuelan equine encephalitis virus (VEEV) is an important human and animal alphavirus pathogen transmitted by mosquitoes. The virus is endemic in Central and South America, but has also caused equine outbreaks in southwestern areas of the United States. In an effort to better understand the molecular mechanisms of the development of immunity to this important pathogen, we performed transcriptional analysis from whole, unfractionated human blood of patients who had been immunized with the live-attenuated vaccine strain of VEEV, TC-83. We compared changes in the transcriptome between naïve individuals who were mock vaccinated with saline to responses of individuals who received TC-83. Significant transcriptional changes were noted at days 2, 7, and 14 following vaccination. The top canonical pathways revealed at early and intermediate time points (days 2 and 7) included the involvement of the classic interferon response, interferon-response factors, activation of pattern recognition receptors, and engagement of the inflammasome. By day 14, the top canonical pathways included oxidative phosphorylation, the protein ubiquitination pathway, natural killer cell signaling, and B-cell development. Biomarkers were identified that differentiate between vaccinees and control subjects, at early, intermediate, and late stages of the development of immunity as well as markers which were common to all 3 stages following vaccination but distinct from the sham-vaccinated control subjects. The study represents a novel examination of molecular processes that lead to the development of immunity against VEEV in humans and which may be of value as diagnostic targets, to enhance modern vaccine design, or molecular correlates of protection.
-
A recombinant virus vaccine that protects against both Chikungunya and Zika virus infections.
Chattopadhyay, Anasuya; Aguilar, Patricia V; Bopp, Nathen E; Yarovinsky, Timur O; Weaver, Scott C; Rose, John K
2018-06-22
Chikungunya virus (CHIKV) and Zika virus (ZIKV) have recently expanded their range in the world and caused serious and widespread outbreaks of near pandemic proportions. There are no licensed vaccines that protect against these co-circulating viruses that are transmitted by invasive mosquito vectors. We report here on the development of a single-dose, bivalent experimental vaccine for CHIKV and ZIKV. This vaccine is based on a chimeric vesicular stomatitis virus (VSV) that expresses the CHIKV envelope polyprotein (E3-E2-6K-E1) in place of the VSV glycoprotein (G) and also expresses the membrane-envelope (ME) glycoproteins of ZIKV. This vaccine induced neutralizing antibody responses to both CHIKV and ZIKV in wild-type mice and in interferon receptor-deficient A129 mice, animal models for CHIKV and ZIKV infection. A single vaccination of A129 mice with the vector protected these mice against infection with both CHIKV and ZIKV. Our single-dose vaccine could provide durable, low-cost protection against both CHIKV and ZIKV for people traveling to or living in areas where both viruses are circulating, which include most tropical regions in the world. Copyright © 2018. Published by Elsevier Ltd.
-
Lee, Kun-Hsiung
2014-01-01
The generation of a fertile embryonic stem cell (ESC)-derived or F0 (100 % coat color chimerism) mice is the final criterion in proving that the ESC is truly pluripotent. Many methods have been developed to produce chimeric mice. To date, the most popular methods for generating chimeric embryos is well sandwich aggregation between zona pellucida (ZP) removed (denuded) 2.5-day post-coitum (dpc) embryos and ESC clumps, or direct microinjection of ESCs into the cavity (blastocoel) of 3.5-dpc blastocysts. However, due to systemic limitations and the disadvantages of conventional microinjection, aggregation, and coculturing, two novel methods (vial coculturing and hypertonic microinjection) were developed in recent years at my laboratory.Coculturing 2.5-dpc denuded embryos with ESCs in 1.7-mL vials for ~3 h generates chimeras that have significantly high levels of chimerism (including 100 % coat color chimerism) and germline transmission. This method has significantly fewer instrumental and technological limitations than existing methods, and is an efficient, simple, inexpensive, and reproducible method for "mass production" of chimeric embryos. For laboratories without a microinjection system, this is the method of choice for generating chimeric embryos. Microinjecting ESCs into a subzonal space of 2.5-dpc embryos can generate germline-transmitted chimeras including 100 % coat color chimerism. However, this method is adopted rarely due to the very small and tight space between ZP and blastomeres. Using a laser pulse or Piezo-driven instrument/device to help introduce ESCs into the subzonal space of 2.5-dpc embryos demonstrates the superior efficiency in generating ESC-derived (F0) chimeras. Unfortunately, due to the need for an expensive instrument/device and extra fine skill, not many studies have used either method. Recently, ESCs injected into the large subzonal space of 2.5-dpc embryos in an injection medium containing 0.2-0.3 M sucrose very efficiently generated
-
Rostamian, Mosayeb; Mousavy, Seyed Jafar; Ebrahimi, Firouz; Ghadami, Seyyed Abolghasem; Sheibani, Nader; Minaei, Mohammad Ebrahim; Arefpour Torabi, Mohammad Ali
2012-01-01
Recently, botulinum neurotoxin (BoNT)-derived recombinant proteins have been suggested as potential botulism vaccines. Here, with concentrating on BoNT type E (BoNT/E), we studied two of these binding domain-based recombinant proteins: a multivalent chimer protein, which is composed of BoNT serotypes A, B and E binding subdomains, and a monovalent recombinant protein, which contains 93 amino acid residues from recombinant C-terminal heavy chain of BoNT/E (rBoNT/E-HCC). Both proteins have an identical region (48 aa) that contains one of the most important BoNT/E epitopes (YLTHMRD sequence). The recombinant protein efficiency in antibody production, their structural differences, and their BoNT/E-epitope location were compared by using ELISA, circular dichroism, computational modeling, and hydrophobicity predictions. Immunological studies indicated that the antibody yield against rBoNT/E-HCC was higher than chimer protein. Cross ELISA confirmed that the antibodies against the chimer protein recognized rBoNT/E-HCC more efficiently. However, both antibody groups (anti-chimer and anti-rBoNT/E-HCC antibodies) were able to recognize other proteins. Structural studies with circular dichroism showed that chimer proteins have slightly more secondary structures than rBoNT/E-HCC. The immunological results suggested that the above-mentioned identical region in rBoNT/E-HCC is more exposed. Circular dichroism, computational protein modeling and hydrophobicity predictions indicated a more exposed location for the identical region in rBoNT/E-HCC than the chimer protein, which is strongly in agreement with immunological results.
-
Nakamura, Ryotaro; La Rosa, Corinna; Longmate, Jeffrey; Drake, Jennifer; Slape, Cynthia; Zhou, Qiao; Lampa, Melanie G.; O'Donnell, Margaret; Cai, Ji-Lian; Farol, Len; Salhotra, Amandeep; Snyder, David S.; Aldoss, Ibrahim; Forman, Stephen J.; Miller, Jeffrey S.; Zaia, John A.; Diamond, Don J.
2016-01-01
Summary Background Cytomegalovirus (CMV) seropositive recipients of allogeneic hematopoietic cell transplantation (HCT) are at risk for CMV reactivation. Stimulating viral immunity by vaccination may achieve CMV viremia control, without the need for antivirals. The aim of the trial is to assess safety, immunogenicity, and possible clinical benefit of CMVPepVax vaccine in HCT recipients. Methods In this randomised, open-label phase 1b trial, HCT recipients were enrolled at a single USA transplant center. Eligible patients were CMV seropositive, HLA A*0201-positive, 18–75 years, receiving HCT from matched related or unrelated donors. Patients were reassessed on day 28 post-HCT for eligibility, and 36 patients were randomised either to the vaccine (VA) or observation arm (OA), in blocks stratified by CMV donor serostatus. CMVPepVax was administered subcutaneously on days 28 and 56. CMVPepVax is a chimeric peptide composed of a cytotoxic CD8 T-cell epitope from CMV-pp65, and a tetanus T-helper epitope. It is formulated with the adjuvant PF03512676 (Pfizer Inc) a Toll-like receptor 9 agonist, which augments cellular immunity. The primary outcome was safety; secondary outcomes included immunogenicity, prevention of CMV reactivation, and clinical outcomes. Statistical analyses included all 36 randomized patients and were performed as per protocol. This study is registered as NCT01588015@www.clinicaltrials.gov. This trial is closed to accrual and a final analysis is presented in this report. Findings Between October 31, 2012, and November 5, 2014, 36 HCT recipients were randomised into the study. CMVPepVax was administered to 18 patients, with no adverse effect on HCT or rate of acute GVHD, and no unexpected adverse events. One serious adverse event (grade 1 fever) was attributed to CMVPepVax vaccination and resolved within 48 hours. Higher relapse free survival (1 versus 7 events, logrank p=0·015), a 2 fold increase in CMV-pp65 CD8 T cells during the first 100 days
-
Chen, Jeng-Chang; Chang, Ming-Ling; Huang, Shiu-Feng; Chang, Pei-Yeh; Muench, Marcus O; Fu, Ren-Huei; Ou, Liang-Shiou; Kuo, Ming-Ling
2008-01-01
It was reported that the dose of self-antigens can determine the consequence of deletional tolerance and donor T cells are critical for tolerance induction in mixed chimeras. This study aimed at assessing the effect of cell doses and marrow T cells on engraftment and tolerance induction after prenatal bone marrow transplantation. Intraperitoneal cell transplantation was performed in FVB/N (H-2K(q)) mice at gestational day 14 with escalating doses of adult C57BL/6 (H-2K(b)) marrows. Peripheral chimerism was examined postnatally by flow cytometry and tolerance was tested by skin transplantation. Transplantation of light-density marrow cells showed a dose response. High-level chimerism emerged with a threshold dose of 5.0 x 10(6) and host leukocytes could be nearly replaced at a dose of 7.5-10.0 x 10(6). High-dose transplants conferred a steady long-lasting donor-specific tolerance but were accompanied by >50% incidence of graft-versus-host disease. Depletion of marrow T cells lessened graft-versus-host disease to the detriment of engraftment. With low-level chimerism, tolerance was a graded phenomenon dependent upon the level of chimerism. Durable chimerism within 6 months required a threshold of > or = 2% chimerism at 1 month of age and predicted a 50% chance of long-term tolerance, whereas transient chimerism (<2%) only caused hyporesponsiveness to the donor. Tolerance induction did not succeed without peripheral chimerism even if a large amount of injected donor cells persisted in the peritoneum. Neither did an increase in cell doses or donor T-cell contents benefit skin graft survivals unless it had substantially improved peripheral chimerism. Thus, peripheral chimerism level can be a simple and straightforward test to predict the degree of prenatal immune tolerance.
-
Tolerance in Nonhuman Primates by Delayed Mixed Chimerism
2017-12-01
person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB control ...induction of mixed chimerism in a non -human primate (NHP) model. This approach, in contrast to protocols which have already reached clinical trials...principle of delayed induction of mixed chimerism in a non -human primate (NHP) model. This approach, in contrast to protocols which have already reached
-
Thionin-D4E1 chimeric protein protects plants against bacterial infections
Stover, Eddie W; Gupta, Goutam; Hao, Guixia
2017-08-08
The generation of a chimeric protein containing a first domain encoding either a pro-thionon or thionin, a second domain encoding D4E1 or pro-D4E1, and a third domain encoding a peptide linker located between the first domain and second domain is described. Either the first domain or the second domain is located at the amino terminal of the chimeric protein and the other domain (second domain or first domain, respectively) is located at the carboxyl terminal. The chimeric protein has antibacterial activity. Genetically altered plants and their progeny expressing a polynucleotide encoding the chimeric protein resist diseases caused by bacteria.
-
Global Foot-and-Mouth Disease Research Update and Gap Analysis: 3 - Vaccines.
Robinson, L; Knight-Jones, T J D; Charleston, B; Rodriguez, L L; Gay, C G; Sumption, K J; Vosloo, W
2016-06-01
This study assessed research knowledge gaps in the field of FMDV (foot-and-mouth disease virus) vaccines. The study took the form of a literature review (2011-15) combined with research updates collected in 2014 from 33 institutes from across the world. Findings were used to identify priority areas for future FMD vaccine research. Vaccines play a vital role in FMD control, used both to limit the spread of the virus during epidemics in FMD-free countries and as the mainstay of disease management in endemic regions, particularly where sanitary controls are difficult to apply. Improvements in the performance or cost-effectiveness of FMD vaccines will allow more widespread and efficient disease control. FMD vaccines have changed little in recent decades, typically produced by inactivation of whole virus, the quantity and stability of the intact viral capsids in the final preparation being key for immunogenicity. However, these are exciting times and several promising novel FMD vaccine candidates have recently been developed. This includes the first FMD vaccine licensed for manufacture and use in the USA; this adenovirus-vectored FMD vaccine causes in vivo expression of viral capsids in vaccinated animals. Another promising vaccine candidate comprises stabilized empty FMDV capsids produced in vitro in a baculovirus expression system. Recombinant technologies are also being developed to improve otherwise conventionally produced inactivated vaccines, for example, by creating a chimeric vaccine virus to increase capsid stability and by inserting sequences into the vaccine virus for desired antigen expression. Other important areas of ongoing research include enhanced adjuvants, vaccine quality control procedures and predicting vaccine protection from immune correlates, thus reducing dependency on animal challenge studies. Globally, the degree of independent vaccine evaluation is highly variable, and this is essential for vaccine quality. Previously neglected, the
-
Hoyos-López, Richard; Suaza-Vasco, Juan; Rúa-Uribe, Guillermo; Uribe, Sandra; Gallego-Gómez, Juan Carlos
2016-01-01
Arboviruses belonging to the genera Flavivirus and Alphavirus were detected in mosquitoes in a rural area of San Bernardo del Viento (Córdoba, Colombia). A total of 22,180 mosquitoes were collected, sorted into 2,102 pools, and tested by generic/nested reverse transcription-polymerase chain reaction. Venezuelan equine encephalitis virus, dengue virus, West Nile virus, St. Louis encephalitis virus, yellow fever virus, and Culex flavivirus were detected and identified by sequencing. The detection of arboviral pathogens in this zone represents possible circulation and indicates a human health risk, demonstrating the importance of virological surveillance activities. PMID:27706377
-
Xu, Bingze; Lundgren, Mats; Magnusson, Ann-Christine; Fuentes, Alexis
2010-11-01
The active vaccine component recombinant chimeric IgE Fc-fragment opossum-human-opossum (OSO) has been expressed in CHO-K1 cells. It contains two identical polypeptide chains with 338 amino acid residues in each chain connected by two disulfide bridges. The cell lines were adapted to suspension culture in a serum-free medium. An expression level of 60 mg/L was obtained after 8 days in a shaking flask at a temperature of 31.5 degrees C. The OSO protein has been purified to homogeneity by a combination of three chromatographic steps. Virus inactivation and reduction by solvent detergent treatment and nano-filtration were included in the process. The residual host cell protein content was less than 50 ng/mg OSO as analyzed by ELISA. Purity was analyzed by SDS-PAGE under reducing and non-reducing conditions and was estimated by densitometry to be above 99.0%. The dimer content was less than 0.1% as estimated by analytical size exclusion chromatography. The molecular mass, as estimated by SDS-PAGE, is 90 kDa. A value of around 74 kDa was calculated from its amino acid composition. This indicates that the protein is heavily glycosylated containing around 18% carbohydrate. Isoelectric focusing in polyacrylamide gel disclosed a ladder type band pattern with pI values in the pH-range 7.0-8.3, indicating a variation in the sialic acid content. The OSO protein is not stable at temperatures above 40 degrees C and at pH values below 4 indicating that virus inactivation by incubating the protein solution at higher temperature or at lower pH is not possible. Copyright 2010 Elsevier Inc. All rights reserved.
-
USDA-ARS?s Scientific Manuscript database
Introduction Influenza A virus (IAV) is an important pathogen in swine, and the main intervention strategy is vaccination to induce neutralizing antibodies against the hemagglutinin (HA). Three major antigenic clusters, cyan, red, and green, were identified among H3N2 viruses circulating in pigs in ...
-
Gardner, Christina L.; Burke, Crystal W.; Higgs, Stephen T.; Klimstra, William B.; Ryman, Kate D.
2012-01-01
In humans, chikungunya virus (CHIKV) infection causes fever, rash, and acute and persisting polyarthalgia/arthritis associated with joint swelling. We report a new CHIKV disease model in adult mice that distinguishes the wild-type CHIKV-LR strain from the live-attenuated vaccine strain (CHIKV-181/25). Although eight-week old normal mice inoculated in the hind footpad developed no hind limb swelling with either virus, CHIKV-LR replicated in musculoskeletal tissues and caused detectable inflammation. In mice deficient in STAT1-dependent interferon (IFN) responses, CHIKV-LR caused significant swelling of the inoculated and contralateral limbs and dramatic inflammatory lesions, while CHIKV-181/25 vaccine and another arthritogenic alphavirus, Sindbis, failed to induce swelling. IFN responses suppressed CHIKV-LR and CHIKV-181/25 replication equally in dendritic cells in vitro whereas macrophages were refractory to infection independently of STAT1-mediated IFN responses. Glycosaminoglycan (GAG) binding may be a CHIKV vaccine attenuation mechanism as CHIKV-LR infectivity was not dependent upon GAG, while CHIKV-181/25 was highly dependent. PMID:22305131
-
Schumacher, Jens; Bacic, Tijana; Staritzbichler, René; Daneschdar, Matin; Klamp, Thorsten; Arnold, Philipp; Jägle, Sabrina; Türeci, Özlem; Markl, Jürgen; Sahin, Ugur
2018-04-13
Virus-like-particles (VLPs) are attractive nanoparticulate scaffolds for broad applications in material/biological sciences and medicine. Prior their functionalization, specific adaptations have to be carried out. These adjustments frequently lead to disordered particles, but the particle integrity is an essential factor for the VLP suitability. Therefore, major requirements for particle stabilization exist. The objective of this study was to evaluate novel stabilizing elements for functionalized chimeric hepatitis B virus core antigen virus-like particles (HBcAg-VLP), with beneficial characteristics for vaccine development, imaging or delivery. The effects of a carboxy-terminal polyhistidine-peptide and an intradimer disulfide-bridge on the stability of preclinically approved chimeric HBcAg-VLPs were assessed. We purified recombinant chimeric HBcAg-VLPs bearing different modified C-termini and compared their physical and chemical particle stability by quantitative protein-biochemical and biophysical techniques. We observed lower chemical resistance of T = 3- compared to T = 4-VLP (triangulation number) capsids and profound impairment of accessibility of hexahistidine-peptides in assembled VLPs. Histidines attached to the C-terminus were associated with superior mechanical and/or chemical particle stability depending on the number of histidine moieties. A molecular modeling approach based on cryo-electron microscopy and biolayer interferometry revealed the underlying structural mechanism for the strengthening of the integrity of VLPs. Interactions triggering capsid stabilization occur on a highly conserved residue on the basis of HBcAg-monomers as well as on hexahistidine-peptides of adjacent monomers. This new stabilization mechanism appears to mimic an evolutionary conserved stabilization concept for hepadnavirus core proteins. These findings establish the genetically simply transferable C-terminal polyhistidine-peptide as a general stabilizing element
-
Functional analysis of aldehyde oxidase using expressed chimeric enzyme between monkey and rat.
Itoh, Kunio; Asakawa, Tasuku; Hoshino, Kouichi; Adachi, Mayuko; Fukiya, Kensuke; Watanabe, Nobuaki; Tanaka, Yorihisa
2009-01-01
Aldehyde oxidase (AO) is a homodimer with a subunit molecular mass of approximately 150 kDa. Each subunit consists of about 20 kDa 2Fe-2S cluster domain storing reducing equivalents, about 40 kDa flavine adenine dinucleotide (FAD) domain and about 85 kDa molybdenum cofactor (MoCo) domain containing a substrate binding site. In order to clarify the properties of each domain, especially substrate binding domain, chimeric cDNAs were constructed by mutual exchange of 2Fe-2S/FAD and MoCo domains between monkey and rat. Chimeric monkey/rat AO was referred to one with monkey type 2Fe-2S/FAD domains and a rat type MoCo domain. Rat/monkey AO was vice versa. AO-catalyzed 2-oxidation activities of (S)-RS-8359 were measured using the expressed enzyme in Escherichia coli. Substrate inhibition was seen in rat AO and chimeric monkey/rat AO, but not in monkey AO and chimeric rat/monkey AO, suggesting that the phenomenon might be dependent on the natures of MoCo domain of rat. A biphasic Eadie-Hofstee profile was observed in monkey AO and chimeric rat/monkey AO, but not rat AO and chimeric monkey/rat AO, indicating that the biphasic profile might be related to the properties of MoCo domain of monkey. Two-fold greater V(max) values were observed in monkey AO than in chimeric rat/monkey AO, and in chimeric monkey/rat AO than in rat AO, suggesting that monkey has the more effective electron transfer system than rat. Thus, the use of chimeric enzymes revealed that 2Fe-2S/FAD and MoCo domains affect the velocity and the quantitative profiles of AO-catalyzed (S)-RS-8359 2-oxidation, respectively.
-
Plant-derived virus-like particles as vaccines
Chen, Qiang; Lai, Huafang
2013-01-01
Virus-like particles (VLPs) are self-assembled structures derived from viral antigens that mimic the native architecture of viruses but lack the viral genome. VLPs have emerged as a premier vaccine platform due to their advantages in safety, immunogenicity, and manufacturing. The particulate nature and high-density presentation of viral structure proteins on their surface also render VLPs as attractive carriers for displaying foreign epitopes. Consequently, several VLP-based vaccines have been licensed for human use and achieved significant clinical and economical success. The major challenge, however, is to develop novel production platforms that can deliver VLP-based vaccines while significantly reducing production times and costs. Therefore, this review focuses on the essential role of plants as a novel, speedy and economical production platform for VLP-based vaccines. The advantages of plant expression systems are discussed in light of their distinctive posttranslational modifications, cost-effectiveness, production speed, and scalability. Recent achievements in the expression and assembly of VLPs and their chimeric derivatives in plant systems as well as their immunogenicity in animal models are presented. Results of human clinical trials demonstrating the safety and efficacy of plant-derived VLPs are also detailed. Moreover, the promising implications of the recent creation of “humanized” glycosylation plant lines as well as the very recent approval of the first plant-made biologics by the U. S. Food and Drug Administration (FDA) for plant production and commercialization of VLP-based vaccines are discussed. It is speculated that the combined potential of plant expression systems and VLP technology will lead to the emergence of successful vaccines and novel applications of VLPs in the near future. PMID:22995837
-
Visceral Leishmaniasis: Advancements in Vaccine Development via Classical and Molecular Approaches
Joshi, Sumit; Rawat, Keerti; Yadav, Narendra Kumar; Kumar, Vikash; Siddiqi, Mohammad Imran; Dube, Anuradha
2014-01-01
Visceral leishmaniasis (VL) or kala-azar, a vector-borne protozoan disease, shows endemicity in larger areas of the tropical, subtropical and the Mediterranean countries. WHO report suggested that an annual incidence of VL is nearly 200,000 to 400,000 cases, resulting in 20,000 to 30,000 deaths per year. Treatment with available anti-leishmanial drugs are not cost effective, with varied efficacies and higher relapse rate, which poses a major challenge to current kala-azar control program in Indian subcontinent. Therefore, a vaccine against VL is imperative and knowing the fact that recovered individuals developed lifelong immunity against re-infection, it is feasible. Vaccine development program, though time taking, has recently gained momentum with the emergence of omic era, i.e., from genomics to immunomics. Classical as well as molecular methodologies have been overtaken with alternative strategies wherein proteomics based knowledge combined with computational techniques (immunoinformatics) speed up the identification and detailed characterization of new antigens for potential vaccine candidates. This may eventually help in the designing of polyvalent synthetic and recombinant chimeric vaccines as an effective intervention measures to control the disease in endemic areas. This review focuses on such newer approaches being utilized for vaccine development against VL. PMID:25202307
-
Diagnostic value of highly-sensitive chimerism analysis after allogeneic stem cell transplantation.
Sellmann, Lea; Rabe, Kim; Bünting, Ivonne; Dammann, Elke; Göhring, Gudrun; Ganser, Arnold; Stadler, Michael; Weissinger, Eva M; Hambach, Lothar
2018-05-02
Conventional analysis of host chimerism (HC) frequently fails to detect relapse before its clinical manifestation in patients with hematological malignancies after allogeneic stem cell transplantation (allo-SCT). Quantitative PCR (qPCR)-based highly-sensitive chimerism analysis extends the detection limit of conventional (short tandem repeats-based) chimerism analysis from 1 to 0.01% host cells in whole blood. To date, the diagnostic value of highly-sensitive chimerism analysis is hardly defined. Here, we applied qPCR-based chimerism analysis to 901 blood samples of 71 out-patients with hematological malignancies after allo-SCT. Receiver operating characteristics (ROC) curves were calculated for absolute HC values and for the increments of HC before relapse. Using the best cut-offs, relapse was detected with sensitivities of 74 or 85% and specificities of 69 or 75%, respectively. Positive predictive values (PPVs) were only 12 or 18%, but the respective negative predictive values were 98 or 99%. Relapse was detected median 38 or 45 days prior to clinical diagnosis, respectively. Considering also durations of steadily increasing HC of more than 28 days improved PPVs to more than 28 or 59%, respectively. Overall, highly-sensitive chimerism analysis excludes relapses with high certainty and predicts relapses with high sensitivity and specificity more than a month prior to clinical diagnosis.
-
Nieto-Torres, Jose L.; DeDiego, Marta L.; Castaño-Rodriguez, Carlos; Fernandez-Delgado, Raul; Perlman, Stanley; Enjuanes, Luis
2015-01-01
A SARS-CoV lacking the full-length E gene (SARS-CoV-∆E) was attenuated and an effective vaccine. Here, we show that this mutant virus regained fitness after serial passages in cell culture or in vivo, resulting in the partial duplication of the membrane gene or in the insertion of a new sequence in gene 8a, respectively. The chimeric proteins generated in cell culture increased virus fitness in vitro but remained attenuated in mice. In contrast, during SARS-CoV-∆E passage in mice, the virus incorporated a mutated variant of 8a protein, resulting in reversion to a virulent phenotype. When the full-length E protein was deleted or its PDZ-binding motif (PBM) was mutated, the revertant viruses either incorporated a novel chimeric protein with a PBM or restored the sequence of the PBM on the E protein, respectively. Similarly, after passage in mice, SARS-CoV-∆E protein 8a mutated, to now encode a PBM, and also regained virulence. These data indicated that the virus requires a PBM on a transmembrane protein to compensate for removal of this motif from the E protein. To increase the genetic stability of the vaccine candidate, we introduced small attenuating deletions in E gene that did not affect the endogenous PBM, preventing the incorporation of novel chimeric proteins in the virus genome. In addition, to increase vaccine biosafety, we introduced additional attenuating mutations into the nsp1 protein. Deletions in the carboxy-terminal region of nsp1 protein led to higher host interferon responses and virus attenuation. Recombinant viruses including attenuating mutations in E and nsp1 genes maintained their attenuation after passage in vitro and in vivo. Further, these viruses fully protected mice against challenge with the lethal parental virus, and are therefore safe and stable vaccine candidates for protection against SARS-CoV. PMID:26513244
-
Shamshad, Ghassan Umair; Ahmed, Suhaib; Bhatti, Farhat Abbas; Ali, Nadir
2012-12-01
To determine the frequency of mixed donor chimerism in patients of non-malignant haematological diseases after allogeneic bone marrow transplant. A cross-sectional, observational study. Department of Haematology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from July 2010 to June 2011. Donor chimerism was assessed in patients of aplastic anaemia and beta-thalassaemia major who underwent allogeneic bone marrow transplantation (BMT). Peripheral blood samples were used to assess chimerism status by analysis of short tandem repeats (STR). In patients where pre-transplant blood sample was not available, swab of buccal mucosa was used for pre-transplant STR profile. A standard set of primers for STR markers were used and the amplified DNA was resolved by gel electrophoresis and stained with silver nitrate. The percentage of donor origin DNA was estimated by densitometer. Out of 84 patients, 52 (62%) were males, while 32 (38%) were females. In patients of beta-thalassaemia major, 31 (62%) developed mixed donor chimerism (MC), 13 (26%) developed complete donor chimerism (CC) and 6 (12%) had graft failure. In aplastic anaemia, 17 patients (50%) achieved MC, 13 (38.2%) had CC and 4 (11.8%) developed graft failure. The combined frequency of mixed donor chimerism for both the diseases was 58.3%. D3S1358 was the most informative STR marker in these patients. Majority of the studied patients developed mixed donor chimerism following bone marrow transplantation, whereas only a minor percentage of the patients had graft failure. Analysis of D3S1358 was the most informative in assessing donor chimerism in patients who underwent BMT.
-
Tseng, Andrew; Suguiura, Igor Massahiro de Souza; McDonough, Sean P; Sritrakul, Tepyuda; Li, Ting; Lin, Yi-Pin; Gillilan, Richard E
2017-01-01
Pathogens rely on proteins embedded on their surface to perform tasks essential for host infection. These obligatory structures exposed to the host immune system provide important targets for rational vaccine design. Here, we use a systematically designed series of multi-domain constructs in combination with small angle X-ray scattering (SAXS) to determine the structure of the main immunoreactive region from a major antigen from Leptospira interrogans, LigB. An anti-LigB monoclonal antibody library exhibits cell binding and bactericidal activity with extensive domain coverage complementing the elongated architecture observed in the SAXS structure. Combining antigenic motifs in a single-domain chimeric immunoglobulin-like fold generated a vaccine that greatly enhances leptospiral protection over vaccination with single parent domains. Our study demonstrates how understanding an antigen’s structure and antibody accessible surfaces can guide the design and engineering of improved recombinant antigen-based vaccines. PMID:29210669
-
Zheng, Xiaoyan; Chen, Hui; Wang, Ran; Fan, Dongying; Feng, Kaihao; Gao, Na; An, Jing
2017-01-01
Dengue virus (DV) is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.
-
Establishment of Donor Chimerism Using Allogeneic Bone Marrow with AMP Cell Co-infusion
2016-09-01
specific immunosuppression. Induction of tolerance to the CTA is the ideal solution. Combined mixed allogeneic chimerism induction and kidney ...transplantation has been shown to induce robust tolerance to the kidney allograft despite transient mixed chimerism in non-human primates and humans...solution. Mixed chimerism induction via hematopoietic cell transplantation (HCT) has been shown to facilitate tolerance induction to kidney allografts
-
Chimeric Antigen Receptor–Modified T Cells for Acute Lymphoid Leukemia
Barrett, David; Aplenc, Richard; Porter, David L.; Rheingold, Susan R.; Teachey, David T.; Chew, Anne; Hauck, Bernd; Wright, J. Fraser; Milone, Michael C.; Levine, Bruce L.; June, Carl H.
2014-01-01
Summary Chimeric antigen receptor–modified T cells with specificity for CD19 have shown promise in the treatment of chronic lymphocytic leukemia (CLL). It remains to be established whether chimeric antigen receptor T cells have clinical activity in acute lymphoblastic leukemia (ALL). Two children with relapsed and refractory pre–B-cell ALL received infusions of T cells transduced with anti-CD19 antibody and a T-cell signaling molecule (CTL019 chimeric antigen receptor T cells), at a dose of 1.4×106 to 1.2×107 CTL019 cells per kilogram of body weight. In both patients, CTL019 T cells expanded to a level that was more than 1000 times as high as the initial engraftment level, and the cells were identified in bone marrow. In addition, the chimeric antigen receptor T cells were observed in the cerebrospinal fluid (CSF), where they persisted at high levels for at least 6 months. Eight grade 3 or 4 adverse events were noted. The cytokine-release syndrome and B-cell aplasia developed in both patients. In one child, the cytokine-release syndrome was severe; cytokine blockade with etanercept and tocilizumab was effective in reversing the syndrome and did not prevent expansion of chimeric antigen receptor T cells or reduce anti-leukemic efficacy. Complete remission was observed in both patients and is ongoing in one patient at 11 months after treatment. The other patient had a relapse, with blast cells that no longer expressed CD19, approximately 2 months after treatment. Chimeric antigen receptor–modified T cells are capable of killing even aggressive, treatment-refractory acute leukemia cells in vivo. The emergence of tumor cells that no longer express the target indicates a need to target other molecules in addition to CD19 in some patients with ALL. PMID:23527958
-
Chimeric antigen receptor-modified T cells for acute lymphoid leukemia.
Grupp, Stephan A; Kalos, Michael; Barrett, David; Aplenc, Richard; Porter, David L; Rheingold, Susan R; Teachey, David T; Chew, Anne; Hauck, Bernd; Wright, J Fraser; Milone, Michael C; Levine, Bruce L; June, Carl H
2013-04-18
Chimeric antigen receptor-modified T cells with specificity for CD19 have shown promise in the treatment of chronic lymphocytic leukemia (CLL). It remains to be established whether chimeric antigen receptor T cells have clinical activity in acute lymphoblastic leukemia (ALL). Two children with relapsed and refractory pre-B-cell ALL received infusions of T cells transduced with anti-CD19 antibody and a T-cell signaling molecule (CTL019 chimeric antigen receptor T cells), at a dose of 1.4×10(6) to 1.2×10(7) CTL019 cells per kilogram of body weight. In both patients, CTL019 T cells expanded to a level that was more than 1000 times as high as the initial engraftment level, and the cells were identified in bone marrow. In addition, the chimeric antigen receptor T cells were observed in the cerebrospinal fluid (CSF), where they persisted at high levels for at least 6 months. Eight grade 3 or 4 adverse events were noted. The cytokine-release syndrome and B-cell aplasia developed in both patients. In one child, the cytokine-release syndrome was severe; cytokine blockade with etanercept and tocilizumab was effective in reversing the syndrome and did not prevent expansion of chimeric antigen receptor T cells or reduce antileukemic efficacy. Complete remission was observed in both patients and is ongoing in one patient at 11 months after treatment. The other patient had a relapse, with blast cells that no longer expressed CD19, approximately 2 months after treatment. Chimeric antigen receptor-modified T cells are capable of killing even aggressive, treatment-refractory acute leukemia cells in vivo. The emergence of tumor cells that no longer express the target indicates a need to target other molecules in addition to CD19 in some patients with ALL.
-
A mucosally targeted subunit vaccine candidate eliciting HIV-1 transcytosis-blocking Abs
Matoba, Nobuyuki; Magérus, Aude; Geyer, Brian C.; Zhang, Yunfang; Muralidharan, Mrinalini; Alfsen, Annette; Arntzen, Charles J.; Bomsel, Morgane; Mor, Tsafrir S.
2004-01-01
A vaccine that would engage the mucosal immune system against a broad range of HIV-1 subtypes and prevent epithelial transmission is highly desirable. Here we report fusing the mucosal targeting B subunit of cholera toxin to the conserved galactosylceramide-binding domain (including the ELDKWA-neutralizing epitope) of the HIV-1 gp41 envelope protein, which mediates the transcytosis of HIV-1 across the mucosal epithelia. Chimeric protein expressed in bacteria or plants assembled into oligomers that were capable of binding galactosyl-ceramide and GM1 gangliosides. Mucosal (intranasal) administration in mice of the purified chimeric protein followed by an i.p. boost resulted in transcytosis-neutralizing serum IgG and mucosal IgA responses and induced immunological memory. Plant production of mucosally targeted immunogens could be particularly useful for immunization programs in developing countries, where desirable product traits include low cost of manufacture, heat stability, and needle-free delivery. PMID:15347807
-
Establishment of donor Chimerism Using Allogeneic Bone Marrow with AMP Cell Co-infusion
2017-09-01
the ideal solution. Combined mixed allogeneic chimerism induction and kidney transplantation has been shown to induce robust tolerance to the kidney ...induction to kidney allografts in non-human primates and humans despite the transience of donor chimerism. However, evidence indicates that durable mixed...chimerism may be required for tolerance induction to tissues or organs other than kidney . Amnion-derived multipotent progenitor (AMP) cells possess
-
Systematic evaluation of atmospheric chemistry-transport model CHIMERE
NASA Astrophysics Data System (ADS)
Khvorostyanov, Dmitry; Menut, Laurent; Mailler, Sylvain; Siour, Guillaume; Couvidat, Florian; Bessagnet, Bertrand; Turquety, Solene
2017-04-01
Regional-scale atmospheric chemistry-transport models (CTM) are used to develop air quality regulatory measures, to support environmentally sensitive decisions in the industry, and to address variety of scientific questions involving the atmospheric composition. Model performance evaluation with measurement data is critical to understand their limits and the degree of confidence in model results. CHIMERE CTM (http://www.lmd.polytechnique.fr/chimere/) is a French national tool for operational forecast and decision support and is widely used in the international research community in various areas of atmospheric chemistry and physics, climate, and environment (http://www.lmd.polytechnique.fr/chimere/CW-articles.php). This work presents the model evaluation framework applied systematically to the new CHIMERE CTM versions in the course of the continuous model development. The framework uses three of the four CTM evaluation types identified by the Environmental Protection Agency (EPA) and the American Meteorological Society (AMS): operational, diagnostic, and dynamic. It allows to compare the overall model performance in subsequent model versions (operational evaluation), identify specific processes and/or model inputs that could be improved (diagnostic evaluation), and test the model sensitivity to the changes in air quality, such as emission reductions and meteorological events (dynamic evaluation). The observation datasets currently used for the evaluation are: EMEP (surface concentrations), AERONET (optical depths), and WOUDC (ozone sounding profiles). The framework is implemented as an automated processing chain and allows interactive exploration of the results via a web interface.
-
Gil, Luciana A. F.; da Cunha, Carlos Eduardo P.; Moreira, Gustavo M. S. G.; Salvarani, Felipe M.; Assis, Ronnie A.; Lobato, Francisco Carlos F.; Mendonça, Marcelo; Dellagostin, Odir A.; Conceição, Fabricio R.
2013-01-01
Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle. PMID:23936080
-
Development of novel vaccines using DNA shuffling and screening strategies.
Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha
2004-02-01
DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.
-
Bukh, Jens; Meuleman, Philip; Tellier, Raymond; Engle, Ronald E.; Feinstone, Stephen M.; Eder, Gerald; Satterfield, William C.; Govindarajan, Sugantha; Krawczynski, Krzysztof; Miller, Roger H.; Leroux-Roels, Geert; Purcell, Robert H.
2010-01-01
Chimpanzees represent the only animal model for studies of the natural history of hepatitis C virus (HCV). To generate virus stocks of important HCV variants, we infected chimpanzees with HCV strains of genotypes 1–6 and determined the infectivity titer of acute-phase plasma pools in additional animals. The courses of first- and second-passage infections were similar, with early appearance of viremia, HCV RNA titers of >104.7 IU/mL, and development of acute hepatitis; the chronicity rate was 56%. The challenge pools had titers of 103–105 chimpanzee infectious doses/mL. Human liver–chimeric mice developed high-titer infections after inoculation with the challenge viruses of genotypes 1–6. Inoculation studies with different doses of the genotype 1b pool suggested that a relatively high virus dose is required to consistently infect chimeric mice. The challenge pools represent a unique resource for studies of HCV molecular virology and for studies of pathogenesis, protective immunity, and vaccine efficacy in vivo. PMID:20353362
-
Huang, Claire Y.-H.; Kinney, Richard M.; Livengood, Jill A.; Bolling, Bethany; Arguello, John J.; Luy, Betty E.; Silengo, Shawn J.; Boroughs, Karen L.; Stovall, Janae L.; Kalanidhi, Akundi P.; Brault, Aaron C.; Osorio, Jorge E.; Stinchcomb, Dan T.
2013-01-01
Background We have developed a manufacturing strategy that can improve the safety and genetic stability of recombinant live-attenuated chimeric dengue vaccine (DENVax) viruses. These viruses, containing the pre-membrane (prM) and envelope (E) genes of dengue serotypes 1–4 in the replicative background of the attenuated dengue-2 PDK-53 vaccine virus candidate, were manufactured under cGMP. Methodology/Principal Findings After deriving vaccine viruses from RNA-transfected Vero cells, six plaque-purified viruses for each serotype were produced. The plaque-purified strains were then analyzed to select one stock for generation of the master seed. Full genetic and phenotypic characterizations of the master virus seeds were conducted to ensure these viruses retained the previously identified attenuating determinants and phenotypes of the vaccine viruses. We also assessed vector competence of the vaccine viruses in sympatric (Thai) Aedes aegypti mosquito vectors. Conclusion/Significance All four serotypes of master vaccine seeds retained the previously defined safety features, including all three major genetic loci of attenuation, small plaques, temperature sensitivity in mammalian cells, reduced replication in mosquito cell cultures, and reduced neurovirulence in new-born mice. In addition, the candidate vaccine viruses demonstrated greatly reduced infection and dissemination in Aedes aegypti mosquitoes, and are not likely to be transmissible by these mosquitoes. This manufacturing strategy has successfully been used to produce the candidate tetravalent vaccine, which is currently being tested in human clinical trials in the United States, Central and South America, and Asia. PMID:23738026
-
Laassri, Majid; Bidzhieva, Bella; Speicher, James; Pletnev, Alexander G; Chumakov, Konstantin
2011-05-01
Genetic stability is an important characteristic of live viral vaccines because an accumulation of mutants can cause reversion to a virulent phenotype as well as a loss of immunogenic properties. This study was aimed at evaluating the genetic stability of a live attenuated West Nile (WN) virus vaccine candidate that was generated by replacing the pre-membrane and envelope protein genes of dengue 4 virus with those from WN. Chimeric virus was serially propagated in Vero, SH-SY5Y human neuroblastoma and HeLa cells and screened for point mutations using hybridization with microarrays of overlapping oligonucleotide probes covering the entire genome. The analysis revealed several spontaneous mutations that led to amino acid changes, most of which were located in the envelope (E) and non-structural NS4A, NS4B, and NS5 proteins. Viruses passaged in Vero and SH-SY5Y cells shared two common mutations: G(2337) C (Met(457) Ile) in the E gene and A(6751) G (Lys(125) Arg) in the NS4A gene. Quantitative assessment of the contents of these mutants in viral stocks indicated that they accumulated independently with different kinetics during propagation in cell cultures. Mutant viruses grew better in Vero cells compared to the parental virus, suggesting that they have a higher fitness. When tested in newborn mice, the cell culture-passaged viruses did not exhibit increased neurovirulence. The approach described in this article could be useful for monitoring the molecular consistency and quality control of vaccine strains. Copyright © 2011 Wiley-Liss, Inc.
-
Laassri, Majid; Bidzhieva, Bella; Speicher, James; Pletnev, Alexander G.; Chumakov, Konstantin
2012-01-01
Genetic stability is an important characteristic of live viral vaccines because an accumulation of mutants can cause reversion to a virulent phenotype as well as a loss of immunogenic properties. This study was aimed at evaluating the genetic stability of a live attenuated West Nile (WN) virus vaccine candidate that was generated by replacing the pre-membrane and envelope protein genes of dengue 4 virus with those from WN. Chimeric virus was serially propagated in Vero, SH-SY5Y human neuroblastoma and HeLa cells and screened for point mutations using hybridization with microarrays of overlapping oligonucleotide probes covering the entire genome. The analysis revealed several spontaneous mutations that led to amino acid changes, most of which were located in the envelope (E) and non-structural NS4A, NS4B, and NS5 proteins. Viruses passaged in Vero and SH-SY5Y cells shared two common mutations: G2337C (Met457Ile) in the E gene and A6751G (Lys125Arg) in the NS4A gene. Quantitative assessment of the contents of these mutants in viral stocks indicated that they accumulated independently with different kinetics during propagation in cell cultures. Mutant viruses grew better in Vero cells compared to the parental virus, suggesting that they have a higher fitness. When tested in newborn mice, the cell culture-passaged viruses did not exhibit increased neurovirulence. The approach described in this paper could be useful for monitoring the molecular consistency and quality control of vaccine strains. PMID:21360544
-
Assessment of amiodarone-induced phospholipidosis in chimeric mice with a humanized liver.
Sanoh, Seigo; Yamachika, Yuto; Tamura, Yuka; Kotake, Yaichiro; Yoshizane, Yasumi; Ishida, Yuji; Tateno, Chise; Ohta, Shigeru
2017-01-01
It is important to consider susceptibility to drug-induced toxicity between animals and humans. Chimeric mice with a humanized liver are expected to predict hepatotoxicity in humans. Drug-induced phospholipidosis (DIPL), in which phospholipids accumulate, is a known entity. In this study, we examined whether chimeric mice can reveal species differences in DIPL. Changes in various phosphatidylcholine (PhC) molecules were investigated in the liver of chimeric mice after administering amiodarone, which induces phospholipidosis. Liquid chromatography-tandem mass spectrometry revealed that levels of PhCs tended to increase in the liver after administration of amiodarone. The liver of chimeric mice consists of human hepatocytes and residual mouse hepatocytes. We used imaging mass spectrometry (IMS) to evaluate the increase of PhCs in human and mouse hepatocytes after administration of amiodarone. IMS visualizes localization of endogenous and exogenous molecules in tissues. The IMS analysis suggested that the localized levels of several PhCs tended to be higher in the human hepatocytes than those in mouse hepatocytes, and PhC levels changed in response to amiodarone. Chimeric mice with a humanized liver will be useful to evaluate species differences in DIPL between mice and humans.
-
Faith-based perspectives on the use of chimeric organisms for medical research.
Degeling, Chris; Irvine, Rob; Kerridge, Ian
2014-04-01
Efforts to advance our understanding of neurodegenerative diseases involve the creation chimeric organisms from human neural stem cells and primate embryos--known as prenatal chimeras. The existence of potential mentally complex beings with human and non-human neural apparatus raises fundamental questions as to the ethical permissibility of chimeric research and the moral status of the creatures it creates. Even as bioethicists find fewer reasons to be troubled by most types of chimeric organisms, social attitudes towards the non-human world are often influenced by religious beliefs. In this paper scholars representing eight major religious traditions provide a brief commentary on a hypothetical case concerning the development and use of prenatal human-animal chimeric primates in medical research. These commentaries reflect the plurality and complexity within and between religious discourses of our relationships with other species. Views on the moral status and permissibility of research on neural human animal chimeras vary. The authors provide an introduction to those who seek a better understanding of how faith-based perspectives might enter into biomedical ethics and public discourse towards forms of biomedical research that involves chimeric organisms.
-
On the origin of sex as vaccination.
Sterrer, Wolfgang
2002-06-21
In the theory of the origin of sex as vaccination, I propose that the eukaryote genome accreted from prokaryan symbiont genomes in numerous rounds of lateral gene transfer during which sex diverged from unilateral parasitic infection, as an increasingly ritualized, reciprocal vaccination against superinfection. Sex-as-syngamy (fusion sex) arose when infected proto-eukaryan hosts began swapping nuclearized genomes containing coevolved, vertically transmitted ("attenuated") symbionts that conveyed protection against horizontal superinfection by more virulent symbionts. Sex-as-meiosis (fission sex) evolved as a host strategy to uncouple (and thereby emasculate) the acquired symbiont genomes. The chimeric nature, distribution over discrete chromosomes, and mosaic composition of the eukaryan nuclear genome derive from multiple rounds of acquiring and uncoupling prokaryan genomes. Genome compatibility-based recognition of self and mates came to define sex, mate choice, and the biological species. By generating unique individuality, sex now persists as an elaborate (hence tamper-proof) periodic device for an organism to thwart both endo- and exogenous challengers, and stay ahead of an environment whose capriciousness may largely result from the success of its own forebears.
-
Chimeric Antigen Receptor–Modified T Cells in Chronic Lymphoid Leukemia
Porter, David L.; Levine, Bruce L.; Kalos, Michael; Bagg, Adam; June, Carl H.
2012-01-01
SUMMARY We designed a lentiviral vector expressing a chimeric antigen receptor with specificity for the B-cell antigen CD19, coupled with CD137 (a costimulatory receptor in T cells [4-1BB]) and CD3-zeta (a signal-transduction component of the T-cell antigen receptor) signaling domains. A low dose (approximately 1.5×105 cells per kilogram of body weight) of autologous chimeric antigen receptor–modified T cells reinfused into a patient with refractory chronic lymphocytic leukemia (CLL) expanded to a level that was more than 1000 times as high as the initial engraftment level in vivo, with delayed development of the tumor lysis syndrome and with complete remission. Apart from the tumor lysis syndrome, the only other grade 3/4 toxic effect related to chimeric antigen receptor T cells was lymphopenia. Engineered cells persisted at high levels for 6 months in the blood and bone marrow and continued to express the chimeric antigen receptor. A specific immune response was detected in the bone marrow, accompanied by loss of normal B cells and leukemia cells that express CD19. Remission was ongoing 10 months after treatment. Hypogammaglobulinemia was an expected chronic toxic effect. PMID:21830940
-
Lundberg, Lindsay; Pinkham, Chelsea; de la Fuente, Cynthia; Brahms, Ashwini; Shafagati, Nazly; Wagstaff, Kylie M; Jans, David A; Tamir, Sharon; Kehn-Hall, Kylene
2016-11-01
The capsid structural protein of the New World alphavirus, Venezuelan equine encephalitis virus (VEEV), interacts with the host nuclear transport proteins importin α/β1 and CRM1. Novel selective inhibitor of nuclear export (SINE) compounds, KPT-185, KPT-335 (verdinexor), and KPT-350, target the host's primary nuclear export protein, CRM1, in a manner similar to the archetypical inhibitor Leptomycin B. One major limitation of Leptomycin B is its irreversible binding to CRM1; which SINE compounds alleviate because they are slowly reversible. Chemically inhibiting CRM1 with these compounds enhanced capsid localization to the nucleus compared to the inactive compound KPT-301, as indicated by immunofluorescent confocal microscopy. Differences in extracellular versus intracellular viral RNA, as well as decreased capsid in cell free supernatants, indicated the inhibitors affected viral assembly, which led to a decrease in viral titers. The decrease in viral replication was confirmed using a luciferase-tagged virus and through plaque assays. SINE compounds had no effect on VEEV TC83_Cm, which encodes a mutated form of capsid that is unable to enter the nucleus. Serially passaging VEEV in the presence of KPT-185 resulted in mutations within the nuclear localization and nuclear export signals of capsid. Finally, SINE compound treatment also reduced the viral titers of the related eastern and western equine encephalitis viruses, suggesting that CRM1 maintains a common interaction with capsid proteins across the New World alphavirus genus.
-
Construction of yellow fever-influenza A chimeric virus particles.
Oliveira, B C E P D; Liberto, M I M; Barth, O M; Cabral, M C
2002-12-01
In order to obtain a better understanding of the functional mechanisms involved in the fusogenesis of enveloped viruses, the influenza A (X31) and the yellow fever (17DD) virus particles were used to construct a chimeric structure based on their distinct pH requirements for fusion, and the distinct malleability of their nucleocapsids. The malleable nucleocapsid of the influenza A virus particle is characterized by a pleomorphic configuration when observed by electron microscopy. A heat inactivated preparation of X31 virus was used as a lectin to interact with the sialic acid domains present in the 17DD virus envelope. The E spikes of 17DD virus were induced to promote fusion of both envelopes, creating a double genome enveloped structure, the chimeric yellow fever-influenza A virus particle. These chimeric viral particles, originally denominated 'partículas virais quiméricas' (PVQ), were characterized by their infectious capacity for different biological systems. Cell inoculation with PVQ resulted in viral products that showed similar characteristics to those obtained after 17DD virus infections. Our findings open new opportunities towards the understanding of both virus particles and aspects of cellular physiologic quality control. The yellow fever-influenza A chimeric particles, by means of their hybrid composition, should be a valuable tool in the study of cell biology and the function of viral components. Copyright 2002 Elsevier Science B.V.
-
Shen, H G; Beach, N M; Huang, Y W; Halbur, P G; Meng, X J; Opriessnig, T
2010-08-23
The efficacies of commercial porcine circovirus type 2 (PCV2) vaccines and a live PCV1-2a chimeric vaccine were compared in conventional, PCV2-positive piglets using a PCV2-porcine reproductive and respiratory syndrome virus (PRRSV)-porcine parvovirus (PPV) coinfection challenge model. Seventy-three, 2-week-old pigs were randomized into seven groups including five vaccinated and two control groups. Pigs in the vaccinated groups were vaccinated at 3 weeks (one dose) or at 3 and 6 weeks (two dose) of age. All vaccine regimens tested were effective in reducing naturally occurring PCV2 viremia at 16 weeks of age and after PCV2 challenge, demonstrating the capability of the products to induce a lasting protective immunity despite the presence of PCV2 viremia at the time of vaccination. Copyright 2010 Elsevier Ltd. All rights reserved.
-
Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk
2017-01-04
Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Theoretical design of a new chimeric protein for the treatment of breast cancer
Soleimani, Meysam; Mahnam, Karim; Mirmohammad-Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Jahanian-Najafabadi, Ali
2016-01-01
p28 and NRC peptides are two anticancer peptides with various mechanisms have shown to be effective against breast cancer. Therefore, it seems that construction of a chimeric protein containing the two peptides might cause synergistic cytotoxic effects. However, since the two peptides bear opposite charges, production of a chimeric protein in which the two moieties do not intervene each other is difficult. In this study, our goal was to find a suitable peptide linker for the new chimeric protein in a manner that none of the peptides intervene the other’s function. We selected some linkers with different characteristics and lengths and created a small library of the chimeric proteins harboring these linkers. Homology modeling and molecular dynamic simulation revealed that (PA)5P and (EAAAK)3 linkers can separate the p28 and NRC peptides effectively. Thus, the chimeric protein linked with (PA)5P or (EAAAK)3 linkers might show synergistic and stronger anticancer effects than the separate peptide moieties because they could exert their cytotoxic effects freely which is not influenced by the other part. PMID:27499788
-
Athanasiou, Evita; Agallou, Maria; Tastsoglou, Spyros; Kammona, Olga; Hatzigeorgiou, Artemis; Kiparissides, Costas; Karagouni, Evdokia
2017-01-01
Visceral leishmaniasis, caused by Leishmania ( L .) donovani and L. infantum protozoan parasites, can provoke overwhelming and protracted epidemics, with high case-fatality rates. An effective vaccine against the disease must rely on the generation of a strong and long-lasting T cell immunity, mediated by CD4 + T H1 and CD8 + T cells. Multi-epitope peptide-based vaccine development is manifesting as the new era of vaccination strategies against Leishmania infection. In this study, we designed chimeric peptides containing HLA-restricted epitopes from three immunogenic L. infantum proteins (cysteine peptidase A, histone H1, and kinetoplastid membrane protein 11), in order to be encapsulated in poly(lactic- co -glycolic) acid nanoparticles with or without the adjuvant monophosphoryl lipid A (MPLA) or surface modification with an octapeptide targeting the tumor necrosis factor receptor II. We aimed to construct differentially functionalized peptide-based nanovaccine candidates and investigate their capacity to stimulate the immunomodulatory properties of dendritic cells (DCs), which are critical regulators of adaptive immunity generated upon vaccination. According to our results, DCs stimulation with the peptide-based nanovaccine candidates with MPLA incorporation or surface modification induced an enhanced maturation profile with prominent IL-12 production, promoting allogeneic T cell proliferation and intracellular production of IFNγ by CD4 + and CD8 + T cell subsets. In addition, DCs stimulated with the peptide-based nanovaccine candidate with MPLA incorporation exhibited a robust transcriptional activation, characterized by upregulated genes indicative of vaccine-driven DCs differentiation toward type 1 phenotype. Immunization of HLA A2.1 transgenic mice with this peptide-based nanovaccine candidate induced peptide-specific IFNγ-producing CD8 + T cells and conferred significant protection against L. infantum infection. Concluding, our findings supported that
-
Athanasiou, Evita; Agallou, Maria; Tastsoglou, Spyros; Kammona, Olga; Hatzigeorgiou, Artemis; Kiparissides, Costas; Karagouni, Evdokia
2017-01-01
Visceral leishmaniasis, caused by Leishmania (L.) donovani and L. infantum protozoan parasites, can provoke overwhelming and protracted epidemics, with high case-fatality rates. An effective vaccine against the disease must rely on the generation of a strong and long-lasting T cell immunity, mediated by CD4+ TH1 and CD8+ T cells. Multi-epitope peptide-based vaccine development is manifesting as the new era of vaccination strategies against Leishmania infection. In this study, we designed chimeric peptides containing HLA-restricted epitopes from three immunogenic L. infantum proteins (cysteine peptidase A, histone H1, and kinetoplastid membrane protein 11), in order to be encapsulated in poly(lactic-co-glycolic) acid nanoparticles with or without the adjuvant monophosphoryl lipid A (MPLA) or surface modification with an octapeptide targeting the tumor necrosis factor receptor II. We aimed to construct differentially functionalized peptide-based nanovaccine candidates and investigate their capacity to stimulate the immunomodulatory properties of dendritic cells (DCs), which are critical regulators of adaptive immunity generated upon vaccination. According to our results, DCs stimulation with the peptide-based nanovaccine candidates with MPLA incorporation or surface modification induced an enhanced maturation profile with prominent IL-12 production, promoting allogeneic T cell proliferation and intracellular production of IFNγ by CD4+ and CD8+ T cell subsets. In addition, DCs stimulated with the peptide-based nanovaccine candidate with MPLA incorporation exhibited a robust transcriptional activation, characterized by upregulated genes indicative of vaccine-driven DCs differentiation toward type 1 phenotype. Immunization of HLA A2.1 transgenic mice with this peptide-based nanovaccine candidate induced peptide-specific IFNγ-producing CD8+ T cells and conferred significant protection against L. infantum infection. Concluding, our findings supported that encapsulation
-
Tumor radioimmunoimaging of chimeric antibody in nude mice with hepatoma xenograft
Gong, Yi; Liu, Kang-Da; Zhou, Ge; Xue, Qiong; Chen, Shao-Liang; Tang, Zhao-You
1998-01-01
AIM: To study the radioimmunoimaging (RAII) using the human/mouse chimeric Ab to evaluate its targeting activity in animal models. METHODS: To chimeric Ab was labeled with 131I. RAII was performed at different intervals after injection of radio-labeled Abs in nude mice with human hepatoma xenograft, and tissue distribution of radioactivity was measured. Comparison was made in the chimeric Ab between the single segment Ab and previous murine mAb against HBxAg. RESULTS: The experimental objects developed tumor-positive image after 2 days of radio-labeled Abs injection, and the peak accumulation of radioactivity fell on the 7th day. The tumor/liver ratioactivity of the chimeric Ab, single segment Ab, anti-HBx mAb, and the control group was 281 ± 0.21, 2.44 ± 0.16, 4.60 ± 0.19, and 0.96 ± 0.14, respectively. CONCLUSION: The genetic engineering Abs have a considerable targeting activity which can be used as a novel humanized vector in the targeting treatment of liver cancer. PMID:11819217
-
Kumar, Shantanu; Ochoa, Wendy; Singh, Pratik; Hsu, Catherine; Schneemann, Anette; Manchester, Marianne; Olson, Mark; Reddy, Vijay
2009-05-25
Viruses-like particles (VLPs) are frequently being used as platforms for polyvalent display of foreign epitopes of interest on their capsid surface to improve their presentation enhancing the antigenicity and host immune response. In the present study, we used the VLPs of Tomato bushy stunt virus (TBSV), an icosahedral plant virus, as a platform to display 180 copies of 16 amino acid epitopes of ricin toxin fused to the C-terminal end of a modified TBSV capsid protein (NDelta52). Expression of the chimeric recombinant protein in insect cells resulted in spontaneous assembly of VLPs displaying the ricin epitope. Cryo-electron microscopy and image reconstruction of the chimeric VLPs at 22 A resolution revealed the locations and orientation of the ricin epitope exposed on the TBSV capsid surface. Furthermore, injection of chimeric VLPs into mice generated antisera that detected the native ricin toxin. The ease of fusing of short peptides of 15-20 residues and their ability to form two kinds (T=1, T=3) of bio-nanoparticles that result in the display of 60 or 180 copies of less constrained and highly exposed antigenic epitopes makes TBSV an attractive and versatile display platform for vaccine design.
-
Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1
Almoguera, Concepción; Rojas, Anabel; Jordano, Juan
2002-01-01
We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363
-
Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja
2013-09-24
We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013
-
Mixed Donor Chimerism Following Simultaneous Pancreas-Kidney Transplant.
Rashidi, Armin; Brennan, Daniel C; Amarillo, Ina E; Wellen, Jason R; Cashen, Amanda
2018-06-01
Graft-versus-host disease after solid-organ transplant is exceedingly rare. Although the precise pathogenetic mechanisms are unknown, a progressive increase in donor chimerism is a requirement for its development. The incidence of mixed donor chimerism and its timeline after simultaneous pancreas-kidney transplant is unknown. After encountering 2 cases of graft-versus-host disease after simultaneous pancreas-kidney transplant at our institution over a period of < 2 years, a collaborative pilot study was conducted by the bone marrow transplant, nephrology, and abdominal transplant surgery teams. We enrolled all consecutive patients undergoing sex-mismatched simultaneous pancreas-kidney transplant over 1 year and longitudinally monitored donor chimerism using fluorescence in situ hybridization for sex chromosomes. We found no evidence for chimerism in our 7 patients. In a comprehensive literature review, we found a total of 25 previously reported cases of graft-versus-host disease after kidney, pancreas, and simultaneous pancreas-kidney transplants. The median onset of graft-versus-host disease was approximately 5 weeks after transplant, with a median of about 2 weeks of delay between first presentation and diagnosis. Skin, gut, and bone marrow were almost equally affected at initial presentation, and fever of unknown origin occurred in more than half of patients. The median survival measured from the first manifestation of graft-versus-host disease was only 48 days. Within the limitations related to small sample size, our results argue against an unusually high risk of graft-versus-host disease after simultaneous pancreas-kidney transplant. Collaboration between solid-organ and stem cell transplant investigators can be fruitful and can improve our understanding of the complications that are shared between the 2 fields.
-
1992-01-01
The immunogenicity of a chimeric T/B cell peptide corresponding to antigenically characterized epitopes of the Chlamydia trachomatis major outer membrane protein (MOMP) was studied in mice to further define its potential use in the development of a subunit vaccine in preventing blinding trachoma in humans. The chimeric peptide, designated A8-VDI, corresponds to a conserved MOMP T helper (Th) cell epitope(s) (A8, residues 106-130) and serovar A VDI (residues 66-80), which contains the serovar-specific neutralizing epitope 71VAGLEK76. Mice immunized with peptide A8-VDI produced high-titered polyclonal IgG antibodies which recognized the VAGLEK-neutralizing epitope. Peptide A8-VDI primed A/J mice to produce high-titered serum-neutralizing antibodies in response to a secondary immunization with intact chlamydial elementary bodies (EBs). Peptide A8-VDI, but not peptide VDI alone, was immunogenic in six different inbred strains of mice disparate at H-2, indicating that the Th cell epitope(s) contained in the A8 portion of the chimera was recognized in the context of multiple major histocompatibility complex (MHC) haplotypes. An unexpected finding of this work was that different inbred strains of mice immunized with the chimeric peptide produced antibodies of differing fine specificities to the VDI portion of the chimera. Some mouse strains produced anti-VDI antibodies that did not recognize the VAGLEK-neutralizing epitope. The ability of mice to respond to the VAGLEK-neutralizing site was not dependent on MHC haplotype since mouse strains of the same H-2 haplotype produced anti-VDI antibodies of differing fine specificity. PMID:1370528
-
Complexity of Human Antibody Response to Dengue Virus: Implication for Vaccine Development.
Tsai, Wen-Yang; Lin, Hong-En; Wang, Wei-Kung
2017-01-01
The four serotypes of dengue virus (DENV) are the leading cause of arboviral diseases in humans. Decades of efforts have made remarkable progress in dengue vaccine development. Despite the first dengue vaccine (dengvaxia from Sanofi Pasteur), a live-attenuated tetravalent chimeric yellow fever-dengue vaccine, has been licensed by several countries since 2016, its overall moderate efficacy (56.5-60.8%) in the presence of neutralizing antibodies during the Phase 2b and 3 trials, lower efficacy among dengue naïve compared with dengue experienced individuals, and increased risk of hospitalization among young children during the follow-up highlight the need for a better understanding of humoral responses after natural DENV infection. Recent studies of more than 300 human monoclonal antibodies (mAbs) against DENV have led to the discovery of several novel epitopes on the envelope protein recognized by potent neutralizing mAbs. This information together with in-depth studies on polyclonal sera and B-cells following natural DENV infection has tremendous implications for better immunogen design for a safe and effective dengue vaccine. This review outlines the progress in our understanding of mouse mAbs, human mAbs, and polyclonal sera against DENV envelope and precursor membrane proteins, two surface proteins involved in vaccine development, following natural infection; analyses of these discoveries have provided valuable insight into new strategies involving molecular technology to induce more potent neutralizing antibodies and less enhancing antibodies for next-generation dengue vaccine development.
-
Complexity of Human Antibody Response to Dengue Virus: Implication for Vaccine Development
Tsai, Wen-Yang; Lin, Hong-En; Wang, Wei-Kung
2017-01-01
The four serotypes of dengue virus (DENV) are the leading cause of arboviral diseases in humans. Decades of efforts have made remarkable progress in dengue vaccine development. Despite the first dengue vaccine (dengvaxia from Sanofi Pasteur), a live-attenuated tetravalent chimeric yellow fever-dengue vaccine, has been licensed by several countries since 2016, its overall moderate efficacy (56.5–60.8%) in the presence of neutralizing antibodies during the Phase 2b and 3 trials, lower efficacy among dengue naïve compared with dengue experienced individuals, and increased risk of hospitalization among young children during the follow-up highlight the need for a better understanding of humoral responses after natural DENV infection. Recent studies of more than 300 human monoclonal antibodies (mAbs) against DENV have led to the discovery of several novel epitopes on the envelope protein recognized by potent neutralizing mAbs. This information together with in-depth studies on polyclonal sera and B-cells following natural DENV infection has tremendous implications for better immunogen design for a safe and effective dengue vaccine. This review outlines the progress in our understanding of mouse mAbs, human mAbs, and polyclonal sera against DENV envelope and precursor membrane proteins, two surface proteins involved in vaccine development, following natural infection; analyses of these discoveries have provided valuable insight into new strategies involving molecular technology to induce more potent neutralizing antibodies and less enhancing antibodies for next-generation dengue vaccine development. PMID:28775720
-
Strategic evaluation of vaccine candidate antigens for the prevention of Visceral Leishmaniasis.
Duthie, Malcolm S; Favila, Michelle; Hofmeyer, Kimberley A; Tutterrow, Yeung L; Reed, Steven J; Laurance, John D; Picone, Alessandro; Guderian, Jeffrey; Bailor, H Remy; Vallur, Aarthy C; Liang, Hong; Mohamath, Raodoh; Vergara, Julie; Howard, Randall F; Coler, Rhea N; Reed, Steven G
2016-05-27
Infection with Leishmania parasites results in a range of clinical manifestations and outcomes, the most severe of which is visceral leishmaniasis (VL). Vaccination will likely provide the most effective long-term control strategy, as the large number of vectors and potential infectious reservoirs renders sustained interruption of Leishmania parasite transmission extremely difficult. Selection of the best vaccine is complicated because, although several vaccine antigen candidates have been proposed, they have emerged following production in different platforms. To consolidate the information that has been generated into a single vaccine platform, we expressed seven candidates as recombinant proteins in E. coli. After verifying that each recombinant protein could be recognized by VL patients, we evaluated their protective efficacy against experimental L. donovani infection of mice. Administration in formulation with the Th1-potentiating adjuvant GLA-SE indicated that each antigen could elicit antigen-specific Th1 responses that were protective. Considering the ability to reduce parasite burden along with additional factors such as sequence identity across Leishmania species, we then generated a chimeric fusion protein comprising a combination of the 8E, p21 and SMT proteins. This E. coli -expressed fusion protein was also demonstrated to protect against L. donovani infection. These data indicate a novel recombinant vaccine antigen with the potential for use in VL control programs. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
-
Design of chimeric peptide ligands to galanin receptors and substance P receptors.
Langel, U; Land, T; Bartfai, T
1992-06-01
Several chimeric peptides were synthesized and found to be high-affinity ligands for both galanin and substance P receptors in membranes from the rat hypothalamus. The peptide galantide, composed of the N-terminal part of galanin and C-terminal part of substance P (SP), galanin-(1-12)-Pro-SP-(5-11) amide, which is the first galanin antagonist to be reported, recognizes two classes of galanin binding sites (KD(1) less than 0.1 nM and KD(2) approximately 6 nM) in the rat hypothalamus, while it appears to bind to a single population of SP receptors (KD approximately 40 nM). The chimeric peptide has higher affinity towards galanin receptors than the endogenous peptide galanin-(1-29) (KD approximately 1 nM) or its N-terminal fragment galanin-(1-13) (KD approximately 1 microM), which constitutes the N-terminus of the chimeric peptide. Galantide has also higher affinity for the SP receptors than the C-terminal SP fragment-(4-11) amide (KD = 0.4 microM), which constitutes its C-terminal portion. Substitution of amino acid residues, which is of importance for recognition of galanin by galanin receptors, such as [Trp2], in the galanin portion of the chimeric peptide or substitution of ([Phe7] or [Met11]-amide) in the SP portion of chimeric peptide both cause significant loss in affinity of the analogs of galantide for both the galanin- and the SP-receptors. These results suggest that the high affinity of the chimeric peptide, galantide, may in part be accounted for by simultaneous recognition/binding to both receptors.(ABSTRACT TRUNCATED AT 250 WORDS)
-
Evaluation of chimeric yellow fever 17D/dengue viral replication in ticks.
Kazimírová, Mária; Mantel, Nathalie; Raynaud, Sandrine; Slovák, Mirko; Ustaniková, Katarína; Lang, Jean; Guy, Bruno; Barban, Veronique; Labuda, Milan
2012-11-01
Chimeric yellow fever 17D/DENV-1-4 viruses (CYD-1-4) have been developed as a tetravalent dengue vaccine candidate which is currently being evaluated in efficacy trials in Asia and America. While YF 17D and DENV are mosquito-borne flaviviruses, it has been shown that CYD-1-4 do not replicate after oral infection in mosquitoes and are not transmitted to new hosts. To further document the risk of environmental dissemination of these viruses, we evaluated the replication of CYD-1-4 in ticks, the vector of tick-borne encephalitis virus (TBEV), another member of the flavivirus family. Females of two hard tick species, Ixodes ricinus and Rhipicephalus appendiculatus, were inoculated intracoelomically with CYD-1-4 viruses and parent viruses (DENV-1-4 and YF 17D). Virus persistence and replication was assessed 2, 16, and 44 days post-inoculation by plaque titration and qRT-PCR. CYD-1-4 viruses were detected in I. ricinus ticks at early time points post-inoculation, but with infectious titers at least 100-fold lower than those observed in TBEV-infected ticks. Unlike TBEV, complete viral clearance occurred by day 44 in most ticks except for CYD-2, which had a tendency to decline. In addition, while about 70% of TBEV-infected I. ricinus nymphs acquired infection by co-feeding with infected tick females on non-viremic hosts, no co-feeding transmission of CYD-2 virus was detected. Based on these results, we conclude that the risk of dissemination of the candidate vaccine viruses by tick bite is highly unlikely.
-
Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang
2005-05-01
To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.
-
Dinga, J N; Gamua, S D; Titanji, V P K
2017-08-01
It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.
-
USDA-ARS?s Scientific Manuscript database
A trans-complemented CSF- JE chimeric viral replicon was constructed using an infectious cDNA clone of the CSF virus (CSFV) Alfort/187 strain. The E2 gene of CSFV Alfort/187 strain was deleted and the resultant plasmid pA187delE2 was inserted by a fragment containing the region coding for a truncate...
-
Ryu, Je-Young; Siswanto, Antoni; Harimoto, Kenichi; Tagawa, Yoh-ichi
2013-06-01
The pancreatic islet is an assembly of specific endocrine cells. There are many conflicting reports regarding whether the acinus develops from single or multiple progenitor cells. This study investigated the development and maintenance clonality of the pancreatic acinus and duct using a chimeric analysis with EGFP and DsRed2 transgenic mice. Chimeric mice (G-R mice) were obtained by the aggregation method, using 8-cell stage embryos from EGFP and DsRed2 transgenic mice. The islets from the G-R mice were chimeric and mosaic, consisting of either EGFP- or DsRed2-positive populations, as in previous reports. On the other hand, most acini developed from either EGFP or DsRed2 origin, but some were chimeric. Interestingly, these chimeric acini were clearly separated into two-color regions and were not mosaic. Some large intralobular pancreatic ducts consisting of more than 10 cells were found to be chimeric, but no small ducts made up of less than 9 cells were chimeric. Our histological observations suggest that the pancreatic acinus polyclonally and directionally is maintained by multiple progenitor cells. Pancreatic large ducts also seem to develop polyclonally and might result from the assembly of small ducts that develop from a single origin. These findings provide useful information for further understanding pancreatic maintenance.
-
Slaney, Clare Y; von Scheidt, Bianca; Davenport, Alexander J; Beavis, Paul A; Westwood, Jennifer A; Mardiana, Sherly; Tscharke, David C; Ellis, Sarah; Prince, H Miles; Trapani, Joseph A; Johnstone, Ricky W; Smyth, Mark J; Teng, Michele W; Ali, Aesha; Yu, Zhiya; Rosenberg, Steven A; Restifo, Nicholas P; Neeson, Paul; Darcy, Phillip K; Kershaw, Michael H
2017-05-15
Purpose: While adoptive transfer of T cells bearing a chimeric antigen receptor (CAR) can eliminate substantial burdens of some leukemias, the ultimate challenge remains the eradication of large solid tumors for most cancers. We aimed to develop an immunotherapy approach effective against large tumors in an immunocompetent, self-antigen preclinical mouse model. Experimental Design: In this study, we generated dual-specific T cells expressing both a CAR specific for Her2 and a TCR specific for the melanocyte protein (gp100). We used a regimen of adoptive cell transfer incorporating vaccination (ACTIV), with recombinant vaccinia virus expressing gp100, to treat a range of tumors including orthotopic breast tumors and large liver tumors. Results: ACTIV therapy induced durable complete remission of a variety of Her2 + tumors, some in excess of 150 mm 2 , in immunocompetent mice expressing Her2 in normal tissues, including the breast and brain. Vaccinia virus induced extensive proliferation of T cells, leading to massive infiltration of T cells into tumors. Durable tumor responses required the chemokine receptor CXCR3 and exogenous IL2, but were independent of IFNγ. Mice were resistant to tumor rechallenge, indicating immune memory involving epitope spreading. Evidence of limited neurologic toxicity was observed, associated with infiltration of cerebellum by T cells, but was only transient. Conclusions: This study supports a view that it is possible to design a highly effective combination immunotherapy for solid cancers, with acceptable transient toxicity, even when the target antigen is also expressed in vital tissues. Clin Cancer Res; 23(10); 2478-90. ©2016 AACR . ©2016 American Association for Cancer Research.
-
Directed evolution can rapidly improve the activity of chimeric assembly-line enzymes
Fischbach, Michael A.; Lai, Jonathan R.; Roche, Eric D.; Walsh, Christopher T.; Liu, David R.
2007-01-01
Nonribosomal peptides (NRPs) are produced by NRP synthetase (NRPS) enzymes that function as molecular assembly lines. The modular architecture of NRPSs suggests that a domain responsible for activating a building block could be replaced with a domain from a foreign NRPS to create a chimeric assembly line that produces a new variant of a natural NRP. However, such chimeric NRPS modules are often heavily impaired, impeding efforts to create novel NRP variants by swapping domains from different modules or organisms. Here we show that impaired chimeric NRPSs can be functionally restored by directed evolution. Using rounds of mutagenesis coupled with in vivo screens for NRP production, we rapidly isolated variants of two different chimeric NRPSs with ≈10-fold improvements in enzyme activity and product yield, including one that produces new derivatives of the potent NRP/polyketide antibiotic andrimid. Because functional restoration in these examples required only modest library sizes (103 to 104 clones) and three or fewer rounds of screening, our approach may be widely applicable even for NRPSs from genetically challenging hosts. PMID:17620609
-
Mooij, P; Bogers, W M; Oostermeijer, H; Koornstra, W; Ten Haaft, P J; Verstrepen, B E; Van Der Auwera, G; Heeney, J L
2000-05-01
Current strategies in human immunodeficiency virus type 1 (HIV-1) vaccine development are often based on the production of different vaccine antigens according to particular genetic clades of HIV-1 variants. To determine if virus virulence or genetic distance had a greater impact on HIV-1 vaccine efficacy, we designed a series of heterologous chimeric simian/human immunodeficiency virus (SHIV) challenge experiments in HIV-1 subunit-vaccinated rhesus macaques. Of a total of 22 animals, 10 nonimmunized animals served as controls; the remainder were vaccinated with the CCR5 binding envelope of HIV-1(W6.1D). In the first study, heterologous challenge included two nonpathogenic SHIV chimeras encoding the envelopes of the divergent clade B HIV-1(han2) and HIV-1(sf13) strains. In the second study, all immunized animals were rechallenged with SHIV(89. 6p), a virus closely related to the vaccine strain but highly virulent. Protection from either of the divergent SHIV(sf13) or SHIV(han2) challenges was demonstrated in the majority of the vaccinated animals. In contrast, upon challenge with the more related but virulent SHIV(89.6p), protection was achieved in only one of the previously protected vaccinees. A secondary but beneficial effect of immunization on virus load and CD4(+) T-cell counts was observed despite failure to protect from infection. In addition to revealing different levels of protective immunity, these results suggest the importance of developing vaccine strategies capable of protecting from particularly virulent variants of HIV-1.
-
Structural differences observed in arboviruses of the alphavirus and flavivirus genera.
Hernandez, Raquel; Brown, Dennis T; Paredes, Angel
2014-01-01
Arthropod borne viruses have developed a complex life cycle adapted to alternate between insect and vertebrate hosts. These arthropod-borne viruses belong mainly to the families Togaviridae, Flaviviridae, and Bunyaviridae. This group of viruses contains many pathogens that cause febrile, hemorrhagic, and encephalitic disease or arthritic symptoms which can be persistent. It has been appreciated for many years that these viruses were evolutionarily adapted to function in the highly divergent cellular environments of both insect and mammalian phyla. These viruses are hybrid in nature, containing viral-encoded RNA and proteins which are glycosylated by the host and encapsulate viral nucleocapsids in the context of a host-derived membrane. From a structural perspective, these virus particles are macromolecular machines adapted in design to assemble into a packaging and delivery system for the virus genome and, only when associated with the conditions appropriate for a productive infection, to disassemble and deliver the RNA cargo. It was initially assumed that the structures of the virus from both hosts were equivalent. New evidence that alphaviruses and flaviviruses can exist in more than one conformation postenvelopment will be discussed in this review. The data are limited but should refocus the field of structural biology on the metastable nature of these viruses.
-
Martins, V T; Duarte, M C; Lage, D P; Costa, L E; Carvalho, A M R S; Mendes, T A O; Roatt, B M; Menezes-Souza, D; Soto, M; Coelho, E A F
2017-01-01
In this study, a recombinant chimeric protein (RCP), which was composed of specific CD4 + and CD8 + T-cell epitopes to murine and human haplotypes, was evaluated as an immunogen against Leishmania infantum infection in a murine model. BALB/c mice received saline were immunized with saponin or with RCP with or without an adjuvant. The results showed that RCP/saponin-vaccinated mice presented significantly higher levels of antileishmanial IFN-γ, IL-12 and GM-CSF before and after challenge, which were associated with the reduction of IL-4 and IL-10 mediated responses. These animals showed significant reductions in the parasite burden in all evaluated organs, when both limiting dilution and quantitative real-time PCR techniques were used. In addition, the protected animals presented higher levels of parasite-specific nitrite, as well as the presence of anti-Leishmania IgG2a isotype antibodies. In conclusion, the RCP/saponin vaccine could be considered as a prophylactic alternative to prevent against VL. © 2016 John Wiley & Sons Ltd.
-
Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.
Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J
2014-11-04
Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Chimeric Mice with Competent Hematopoietic Immunity Reproduce Key Features of Severe Lassa Fever.
Oestereich, Lisa; Lüdtke, Anja; Ruibal, Paula; Pallasch, Elisa; Kerber, Romy; Rieger, Toni; Wurr, Stephanie; Bockholt, Sabrina; Pérez-Girón, José V; Krasemann, Susanne; Günther, Stephan; Muñoz-Fontela, César
2016-05-01
Lassa fever (LASF) is a highly severe viral syndrome endemic to West African countries. Despite the annual high morbidity and mortality caused by LASF, very little is known about the pathophysiology of the disease. Basic research on LASF has been precluded due to the lack of relevant small animal models that reproduce the human disease. Immunocompetent laboratory mice are resistant to infection with Lassa virus (LASV) and, to date, only immunodeficient mice, or mice expressing human HLA, have shown some degree of susceptibility to experimental infection. Here, transplantation of wild-type bone marrow cells into irradiated type I interferon receptor knockout mice (IFNAR-/-) was used to generate chimeric mice that reproduced important features of severe LASF in humans. This included high lethality, liver damage, vascular leakage and systemic virus dissemination. In addition, this model indicated that T cell-mediated immunopathology was an important component of LASF pathogenesis that was directly correlated with vascular leakage. Our strategy allows easy generation of a suitable small animal model to test new vaccines and antivirals and to dissect the basic components of LASF pathophysiology.
-
Alloreactive Regulatory T Cells Allow the Generation of Mixed Chimerism and Transplant Tolerance.
Ruiz, Paulina; Maldonado, Paula; Hidalgo, Yessia; Sauma, Daniela; Rosemblatt, Mario; Bono, Maria Rosa
2015-01-01
The induction of donor-specific transplant tolerance is one of the main goals of modern immunology. Establishment of a mixed chimerism state in the transplant recipient has proven to be a suitable strategy for the induction of long-term allograft tolerance; however, current experimental recipient preconditioning protocols have many side effects, and are not feasible for use in future therapies. In order to improve the current mixed chimerism induction protocols, we developed a non-myeloablative bone-marrow transplant (NM-BMT) protocol using retinoic acid (RA)-induced alloantigen-specific Tregs, clinically available immunosuppressive drugs, and lower doses of irradiation. We demonstrate that RA-induced alloantigen-specific Tregs in addition to a NM-BMT protocol generates stable mixed chimerism and induces tolerance to allogeneic secondary skin allografts in mice. Therefore, the establishment of mixed chimerism through the use of donor-specific Tregs rather than non-specific immunosuppression could have a potential use in organ transplantation.
-
Versatile bio-ink for covalent immobilization of chimeric avidin on sol-gel substrates.
Heikkinen, Jarkko J; Kivimäki, Liisa; Määttä, Juha A E; Mäkelä, Inka; Hakalahti, Leena; Takkinen, Kristiina; Kulomaa, Markku S; Hytönen, Vesa P; Hormi, Osmo E O
2011-10-15
A bio-ink for covalent deposition of thermostable, high affinity biotin-binding chimeric avidin onto sol-gel substrates was developed. The bio-ink was prepared from heterobifunctional crosslinker 6-maleimidohexanoic acid N-hydroxysuccinimide which was first reacted either with 3-aminopropyltriethoxysilane or 3-aminopropyldimethylethoxysilane to form silane linkers 6-maleimide-N-(3-(triethoxysilyl)propyl)hexanamide or -(ethoxydimethylsilyl)propyl)-hexanamide. C-terminal cysteine genetically engineered to chimeric avidin was reacted with the maleimide group of silane linker in methanol/PBS solution to form a suspension, which was printed on sol-gel modified PMMA film. Different concentrations of chimeric avidin and ratios between silane linkers were tested to find the best properties for the bio-ink to enable gravure or inkjet printing. Bio-ink prepared from 3-aminopropyltriethoxysilane was found to provide the highest amount of active immobilized chimeric avidin. The developed bio-ink was shown to be valuable for automated fabrication of avidin-functionalized polymer films. Copyright © 2011 Elsevier B.V. All rights reserved.
-
Nilaratanakul, Voraphoj; Chen, Jie; Tran, Oanh; Baxter, Victoria K; Troisi, Elizabeth M; Yeh, Jane X; Griffin, Diane E
2018-04-01
Sindbis virus (SINV) infection of neurons in the brain and spinal cord in mice provides a model system for investigating recovery from encephalomyelitis and antibody-mediated clearance of virus from the central nervous system (CNS). To determine the roles of IgM and IgG in recovery, we compared the responses of immunoglobulin-deficient activation-induced adenosine deaminase-deficient (AID -/- ), secretory IgM-deficient (sIgM -/- ), and AID -/- sIgM -/- double-knockout (DKO) mice with those of wild-type (WT) C57BL/6 mice for disease, clearance of infectious virus and viral RNA from brain and spinal cord, antibody responses, and B cell infiltration into the CNS. Because AID is essential for immunoglobulin class switch recombination and somatic hypermutation, AID -/- mice produce only germ line IgM, while sIgM -/- mice secrete IgG but no IgM and DKO mice produce no secreted immunoglobulin. After intracerebral infection with the TE strain of SINV, most mice recovered. Development of neurologic disease occurred slightly later in sIgM -/- mice, but disease severity, weight loss, and survival were similar between the groups. AID -/- mice produced high levels of SINV-specific IgM, while sIgM -/- mice produced no IgM and high levels of IgG2a compared to WT mice. All mice cleared infectious virus from the spinal cord, but DKO mice failed to clear infectious virus from brain and had higher levels of viral RNA in the CNS late after infection. The numbers of infected cells and the amount of cell death in brain were comparable. We conclude that antibody is required and that either germ line IgM or IgG is sufficient for clearance of virus from the CNS. IMPORTANCE Mosquito-borne alphaviruses that infect neurons can cause fatal encephalomyelitis. Recovery requires a mechanism for the immune system to clear virus from infected neurons without harming the infected cells. Antiviral antibody has previously been shown to be a noncytolytic means for alphavirus clearance. Antibody
-
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-24
.../US2009/006294, filed November 24, 2009; entitled ``Virus Like Particle Compositions and Methods of Use... invention relates to compositions and methods of use as vaccines of virus-like particles (VLPs) expressing one or more alphavirus capsid or envelope proteins, and in particular Chikungunya [[Page 58416
-
Evidence for Transcript Networks Composed of Chimeric RNAs in Human Cells
Borel, Christelle; Mudge, Jonathan M.; Howald, Cédric; Foissac, Sylvain; Ucla, Catherine; Chrast, Jacqueline; Ribeca, Paolo; Martin, David; Murray, Ryan R.; Yang, Xinping; Ghamsari, Lila; Lin, Chenwei; Bell, Ian; Dumais, Erica; Drenkow, Jorg; Tress, Michael L.; Gelpí, Josep Lluís; Orozco, Modesto; Valencia, Alfonso; van Berkum, Nynke L.; Lajoie, Bryan R.; Vidal, Marc; Stamatoyannopoulos, John; Batut, Philippe; Dobin, Alex; Harrow, Jennifer; Hubbard, Tim; Dekker, Job; Frankish, Adam; Salehi-Ashtiani, Kourosh; Reymond, Alexandre; Antonarakis, Stylianos E.; Guigó, Roderic; Gingeras, Thomas R.
2012-01-01
The classic organization of a gene structure has followed the Jacob and Monod bacterial gene model proposed more than 50 years ago. Since then, empirical determinations of the complexity of the transcriptomes found in yeast to human has blurred the definition and physical boundaries of genes. Using multiple analysis approaches we have characterized individual gene boundaries mapping on human chromosomes 21 and 22. Analyses of the locations of the 5′ and 3′ transcriptional termini of 492 protein coding genes revealed that for 85% of these genes the boundaries extend beyond the current annotated termini, most often connecting with exons of transcripts from other well annotated genes. The biological and evolutionary importance of these chimeric transcripts is underscored by (1) the non-random interconnections of genes involved, (2) the greater phylogenetic depth of the genes involved in many chimeric interactions, (3) the coordination of the expression of connected genes and (4) the close in vivo and three dimensional proximity of the genomic regions being transcribed and contributing to parts of the chimeric RNAs. The non-random nature of the connection of the genes involved suggest that chimeric transcripts should not be studied in isolation, but together, as an RNA network. PMID:22238572
-
78 FR 16505 - Prospective Grant of Exclusive License: Chimeric West Nile/Dengue Viruses
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-15
... Grant of Exclusive License: Chimeric West Nile/Dengue Viruses AGENCY: Centers for Disease Control and... giving an exclusive license, in the field of use of in vitro diagnostics for dengue virus infection, to.... Provisional Application 61/049,342, filed 4/30/2008, entitled ``Engineered, Chimeric West Nile/Dengue Viruses...
-
Jarvi, Susan I; Hu, Darcy; Misajon, Kathleen; Coller, Beth-Ann; Wong, Teri; Lieberman, Michael M
2013-01-01
Although West Nile Virus (WNV) has not been reported in Hawai'i, eventual introduction appears unavoidable with potential adverse effects on avian species. Nēnē (Branta sandvicensis) are endemic endangered Hawaiian geese that are susceptible to WNV. We demonstrate that a vaccine developed against WNV for humans (WN-80E) is also highly immunogenic in Nēnē and does not produce adverse biologic effects. Six captive, nonbreeding Nēnē were immunized with two 10-μg doses (4 wk apart) of the WN-80E recombinant protein adjuvanted with Montanide ISA720. Two Nēnē were similarly injected with "mock" preparation as controls. Blood samples were collected before the first dose, then 2 wk and 6 mo after the second dose. WNV-specific antibody titers were determined by an endpoint enzyme-linked immunosorbent assay. An unpaired t-test demonstrated significantly higher geometric mean titers for immunized vs. control groups 2 wk after dose 2 (4,129 and 100, respectively, P=0.010) and 6 mo after dose 2 (246 and 63, respectively, P=0.002). Daily observations revealed no swelling at the site of injection and no serious adverse biological effects from the immunization. The vaccine containing the WN-80E and Montanide ISA720 adjuvant appears to be safe and immunogenic in Nēnē. This protein-based WNV vaccine may be safer for use in Hawai'i than killed virus and live chimeric or recombinant canarypox-vectored vaccines because it cannot cause disease.
-
Ui, Hiroki; Yamayoshi, Seiya; Uraki, Ryuta; Kiso, Maki; Oishi, Kohei; Murakami, Shin; Mimori, Shigetaka; Kawaoka, Yoshihiro
2017-04-04
Vaccination is the first line of protection against influenza virus infection in humans. Although inactivated and live-attenuated vaccines are available, each vaccine has drawbacks in terms of immunogenicity and safety. To overcome these issues, our group has developed a replication-incompetent PB2-knockout (PB2-KO) influenza virus that replicates only in PB2-expressing cells. Here we generated PB2-KO viruses possessing the hemagglutinin (HA) and neuraminidase (NA) segments from H1N1pdm09 or type B viruses and tested their vaccine potential. The two PB2-KO viruses propagated efficiently in PB2-expressing cells, and expressed chimeric HA as expected. Virus-specific IgG and IgA antibodies were detected in mice immunized with the viruses, and the immunized mice showed milder clinical signs and/or lower virus replication levels in the respiratory tract upon virus challenge. Our results indicate that these PB2-KO viruses have potential as vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Urgesi, Cosimo; Bricolo, Emanuela; Aglioti, Salvatore M
2005-08-01
Cerebral dominance and hemispheric metacontrol were investigated by testing the ability of healthy participants to match chimeric, entire, or half faces presented tachistoscopically. The two hemi-faces compounding chimeric or entire stimuli were presented simultaneously or asynchronously at different exposure times. Participants did not consciously detect chimeric faces for simultaneous presentations lasting up to 40 ms. Interestingly, a 20 ms separation between each half-chimera was sufficient to induce detection of conflicts at a conscious level. Although the presence of chimeric faces was not consciously perceived, performance on chimeric faces was poorer than on entire- and half-faces stimuli, thus indicating an implicit processing of perceptual conflicts. Moreover, the precedence of hemispheric stimulation over-ruled the right hemisphere dominance for face processing, insofar as the hemisphere stimulated last appeared to influence the response. This dynamic reversal of cerebral dominance, however, was not caused by a shift in hemispheric specialization, since the level of performance always reflected the right hemisphere specialization for face recognition. Thus, the dissociation between hemispheric dominance and specialization found in the present study hints at the existence of hemispheric metacontrol in healthy individuals.
-
Piñeyro, Pablo E; Kenney, Scott P; Giménez-Lirola, Luis G; Opriessnig, Tanja; Tian, Debin; Heffron, C Lynn; Meng, Xiang-Jin
2016-02-02
We previously demonstrated that the C-terminus of the capsid gene of porcine circovirus type 2 (PCV2) is an immune reactive epitope displayed on the surface of virions. Insertion of foreign epitope tags in the C-terminus produced infectious virions that elicited humoral immune responses against both PCV2 capsid and the inserted epitope tags, whereas mutation in the N terminus impaired viral replication. Since the non-pathogenic porcine circovirus type 1 (PCV1) shares similar genomic organization and significant sequence identity with pathogenic PCV2, in this study we evaluated whether PCV1 can serve as a vaccine delivery virus vector. Four different antigenic determinants of porcine reproductive and respiratory syndrome virus (PRRSV) were inserted in the C-terminus of the PCV1 capsid gene, the infectivity and immunogenicity of the resulting viruses are determined. We showed that an insertion of 12 (PRRSV-GP2 epitope II, PRRSV-GP3 epitope I, and PRRSV-GP5 epitope I), and 14 (PRRSV-GP5 epitope IV) amino acid residues did not affect PCV1 replication. We successfully rescued and characterized four chimeric PCV1 viruses expressing PRRSV linear antigenic determinants (GP2 epitope II: aa 40-51, ASPSHVGWWSFA; GP3 epitope I: aa 61-72, QAAAEAYEPGRS; GP5 epitope I: aa 35-46, SSSNLQLIYNLT; and GP5 epitope IV: aa 187-200, TPVTRVSAEQWGRP). We demonstrated that all chimeric viruses were stable and infectious in vitro and three chimeric viruses were infectious in vivo. An immunogenicity study in pigs revealed that PCV1-VR2385EPI chimeric viruses elicited neutralizing antibodies against PRRSV-VR2385. The results have important implications for further evaluating PCV1 as a potential vaccine delivery vector. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Endemic eastern equine encephalitis in the Amazon region of Peru.
Aguilar, Patricia V; Robich, Rebecca M; Turell, Michael J; O'Guinn, Monica L; Klein, Terry A; Huaman, Alfredo; Guevara, Carolina; Rios, Zonia; Tesh, Robert B; Watts, Douglas M; Olson, James; Weaver, Scott C
2007-02-01
Eastern equine encephalitis virus (EEEV) causes severe neurologic disease in North America, but only two fatal human cases have been documented in South America. To test the hypothesis that alphavirus heterologous antibodies cross-protect, animals were vaccinated against other alphaviruses and challenged up to 3 months later with EEEV. Short-lived cross-protection was detected, even in the absence of cross-neutralizing antibodies. To assess exposure to EEEV in Peru, sera from acutely ill and healthy persons were tested for EEEV and other alphavirus antibodies, as well as for virus isolation. No EEEV was isolated from patients living in an EEEV-enzootic area, and only 2% of individuals with febrile illness had EEEV-reactive IgM. Only 3% of healthy persons from the enzootic region had EEEV-neutralizing antibodies. Our results suggest that humans are exposed but do not develop apparent infection with EEEV because of poor infectivity and/or avirulence of South American strains.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Shantanu; Ochoa, Wendy; Singh, Pratik
2009-05-25
Viruses-like particles (VLPs) are frequently being used as platforms for polyvalent display of foreign epitopes of interest on their capsid surface to improve their presentation enhancing the antigenicity and host immune response. In the present study, we used the VLPs of Tomato bushy stunt virus (TBSV), an icosahedral plant virus, as a platform to display 180 copies of 16 amino acid epitopes of ricin toxin fused to the C-terminal end of a modified TBSV capsid protein (NDELTA52). Expression of the chimeric recombinant protein in insect cells resulted in spontaneous assembly of VLPs displaying the ricin epitope. Cryo-electron microscopy and imagemore » reconstruction of the chimeric VLPs at 22 A resolution revealed the locations and orientation of the ricin epitope exposed on the TBSV capsid surface. Furthermore, injection of chimeric VLPs into mice generated antisera that detected the native ricin toxin. The ease of fusing of short peptides of 15-20 residues and their ability to form two kinds (T = 1, T = 3) of bio-nanoparticles that result in the display of 60 or 180 copies of less constrained and highly exposed antigenic epitopes makes TBSV an attractive and versatile display platform for vaccine design.« less
-
Chimeric antigen receptors: driving immunology towards synthetic biology
Sadelain, Michel
2017-01-01
The advent of second generation CARs and the CD19 paradigm have ushered a new therapeutic modality in oncology. In contrast to earlier forms of adoptive cell therapy, which were based on the isolation and expansion of naturally occurring T cells, CAR therapy is based on the design and manufacture of engineered T cells with optimized properties. A new armamentarium, comprising not only CARs but also chimeric costimulatory receptors, chimeric cytokine receptors, inhibitory receptors and synthetic Notch receptors, expressed in naïve, central memory or stem cell-like memory T cells, is being developed for clinical use in a wide range of cancers. Immunological principles are thus finding a new purpose thanks to advances in genetic engineering, synthetic biology and cell manufacturing sciences. PMID:27372731
-
Cord Blood Chimerism And Relapse After Haplo-Cord Transplantation
van Besien, Koen; Koshy, Nebu; Gergis, Usama; Mayer, Sebastian; Cushing, Melissa; Rennert, Hannah; Slotky, Ronit; Mark, Tomer; Pearse, Roger; Rossi, Adriana; Phillips, Adrienne; Vasovic, Liljana; Ferrante, Rosanna; Hsu, Michael; Shore, Tsiporah
2018-01-01
Haplo-cord stem cell transplantation combines the infusion of CD34 selected hematopoietic progenitors from a haplo-identical donor with an umbilical cord blood graft from an unrelated donor and allows faster count recovery, with low rates of disease recurrence and chronic GVHD. But the contribution of the umbilical cord blood graft to long-term transplant outcome remains unclear. We analyzed 39 recipients of haplo-cord transplants with AML and MDS, engrafted and in remission at 2 months. Median age was 66 (18-72) and all had intermediate, high, or very high risk disease. Less than 20% UCB chimerism in the CD33 lineage was associated with an increased rate of disease recurrence (54% vs 11% P<0.0001) and decrease in one year progression-free (20% vs 55%, P=0.004) and overall survival (30% vs 62%, P=0.02). Less than 100% UCB chimerism in the CD3 lineage was associated with increase rate of disease recurrence (46% vs 12%, P=0.007) Persistent haplo-chimerism in the CD3 lineage was associated with an increased rate of disease recurrence (40% vs 15%, P=0.009) Chimerism did not predict for treatment related mortality. The cumulative incidence of acute GVHD by day 100 was 43%. The cumulative incidence of moderate/severe chronic GVHD was only 5%. Engraftment of the umbilical cord blood grafts provides powerful GVL effects which protect against disease recurrence and is associated with low risk of chronic GVHD. Engraftment of CD34 selected haplo-identical cells can lead to rapid development of circulating T-cells, but when these cells dominate, GVL-effects are limited and rates of disease recurrence are high. PMID:27333804
-
Chimeric recombinant antibody fragments in cardiac troponin I immunoassay.
Hyytiä, Heidi; Heikkilä, Taina; Brockmann, Eeva-Christine; Kekki, Henna; Hedberg, Pirjo; Puolakanaho, Tarja; Lövgren, Timo; Pettersson, Kim
2015-03-01
To introduce a novel nanoparticle-based immunoassay for cardiac troponin I (cTnI) utilizing chimeric antibody fragments and to demonstrate that removal of antibody Fc-part and antibody chimerization decrease matrix related interferences. A sandwich-type immunoassay for cTnI based on recombinant chimeric (mouse variable/human constant) antigen binding (cFab) antibodies and intrinsically fluorescent nanoparticles was developed. To test whether using chimeric antibody fragments helps to avoid matrix related interferences, samples (n=39) with known amounts of triglycerides, bilirubin, rheumatoid factor (RF) or human anti-mouse antibodies (HAMAs) were measured with the novel assay, along with a previously published nanoparticle-based research assay with the same antibody epitopes. The limit of detection (LoD) was 3.30ng/L. Within-laboratory precision for 29ng/L and 2819ng/L cTnI were 13.7% and 15.9%, respectively. Regression analysis with Siemens ADVIA Centaur® yielded a slope (95% confidence intervals) of 0.18 (0.17-1.19) and a y-intercept of 1.94 (-1.28-3.91) ng/L. When compared to a previously published nanoparticle-based assay, the novel assay showed substantially reduced interference in the tested interference prone samples, 15.4 vs. 51.3%. A rheumatoid factor containing sample was decreased from 241ng/L to
-
Kading, Rebekah C; Borland, Erin M; Cranfield, Mike; Powers, Ann M
2013-07-01
Vector-borne and zoonotic pathogens have comprised a significant proportion of the emerging infectious diseases in humans in recent decades. The role of many wildlife species as reservoirs for arthropod-borne viral pathogens is poorly understood. We investigated the exposure history of various African wildlife species from the Congo basin to mosquito-borne flaviviruses and alphaviruses by testing archived serum samples. Sera from 24 African forest buffalo (Syncerus caffer nanus), 34 African elephants (Loxodonta africana), 40 duikers (Cephalophus and Philantomba spp.), 25 mandrills (Mandrillus sphinx), 32 mountain gorillas (Gorilla beringei beringei), five Grauer's gorillas (Gorilla beringei graueri), two L'Hoest's monkeys (Cercopithecus lhoesti), two golden monkeys (Cercopithecus kandti), and three chimpanzees (Pan troglodytes) sampled between 1991 and 2009 were tested for antibodies against chikungunya virus (CHIKV), o'nyong-nyong virus (ONNV), West Nile virus (WNV), dengue 2 virus (DENV-2), and yellow fever virus (YFV) by plaque reduction neutralization test. Specific neutralizing antibodies against ONNV were found in African forest buffalo in the Democratic Republic of the Congo (DRC) and Gabon, duikers in the DRC, and mandrills in Gabon, providing novel evidence of enzootic circulation of ONNV in these countries. African forest buffalo in the DRC and Gabon also demonstrated evidence of exposure to CHIKV, WNV, and DENV-2, while mandrills in Gabon were antibody positive for CHIKV, DENV-2, WNV, and YFV. All of the elephants tested had a strong neutralizing antibody response to WNV. We also document results from a survey of gorillas for arboviruses, of which 4/32 (13%) had antibody to an alphavirus or flavivirus. Overall, our results demonstrate a high prevalence of neutralizing antibodies against multiple arboviruses in wildlife in equatorial Africa.
-
Steel, Ryan WJ; Kappe, Stefan HI; Sack, Brandon K
2016-01-01
Malaria remains a significant public health burden with 214 million new infections and over 400,000 deaths in 2015. Elucidating relevant Plasmodium parasite biology can lead to the identification of novel ways to control and ultimately eliminate the parasite within geographic areas. Particularly, the development of an effective vaccine that targets the clinically silent pre-erythrocytic stages of infection would significantly augment existing malaria elimination tools by preventing both the onset of blood-stage infection/disease as well as spread of the parasite through mosquito transmission. In this Perspective, we discuss the role of small animal models in pre-erythrocytic stage vaccine development, highlighting how human liver-chimeric and human immune system mice are emerging as valuable components of these efforts. PMID:27855488
-
Steel, Ryan Wj; Kappe, Stefan Hi; Sack, Brandon K
2016-12-01
Malaria remains a significant public health burden with 214 million new infections and over 400,000 deaths in 2015. Elucidating relevant Plasmodium parasite biology can lead to the identification of novel ways to control and ultimately eliminate the parasite within geographic areas. Particularly, the development of an effective vaccine that targets the clinically silent pre-erythrocytic stages of infection would significantly augment existing malaria elimination tools by preventing both the onset of blood-stage infection/disease as well as spread of the parasite through mosquito transmission. In this Perspective, we discuss the role of small animal models in pre-erythrocytic stage vaccine development, highlighting how human liver-chimeric and human immune system mice are emerging as valuable components of these efforts.
-
Renukaradhya, Gourapura J; Meng, Xiang-Jin; Calvert, Jay G; Roof, Michael; Lager, Kelly M
2015-08-07
Porcine reproductive and respiratory syndrome (PRRS) caused by PRRS virus (PRRSV) was reported in the late 1980s. PRRS still is a huge economic concern to the global pig industry with a current annual loss estimated at one billion US dollars in North America alone. It has been 20 years since the first modified live-attenuated PRRSV vaccine (PRRSV-MLV) became commercially available. PRRSV-MLVs provide homologous protection and help in reducing shedding of heterologous viruses, but they do not completely protect pigs against heterologous field strains. There have been many advances in understanding the biology and ecology of PRRSV; however, the complexities of virus-host interaction and PRRSV vaccinology are not yet completely understood leaving a significant gap for improving breadth of immunity against diverse PRRS isolates. This review provides insights on immunization efforts using infectious PRRSV-based vaccines since the 1990s, beginning with live PRRSV immunization, development and commercialization of PRRSV-MLV, and strategies to overcome the deficiencies of PRRSV-MLV through use of replicating viral vectors expressing multiple PRRSV membrane proteins. Finally, powerful reverse genetics systems (infectious cDNA clones) generated from more than 20 PRRSV isolates of both genotypes 1 and 2 viruses have provided a great resource for exploring many innovative strategies to improve the safety and cross-protective efficacy of live PRRSV vaccines. Examples include vaccines with diminished ability to down-regulate the immune system, positive and negative marker vaccines, multivalent vaccines incorporating antigens from other porcine pathogens, vaccines that carry their own cytokine adjuvants, and chimeric vaccine viruses with the potential for broad cross-protection against heterologous strains. To combat this devastating pig disease in the future, evaluation and commercialization of such improved live PRRSV vaccines is a shared goal among PRRSV researchers, pork
-
Tumor-targeting domains for chimeric antigen receptor T cells.
Bezverbnaya, Ksenia; Mathews, Ashish; Sidhu, Jesse; Helsen, Christopher W; Bramson, Jonathan L
2017-01-01
Immunotherapy with chimeric antigen receptor (CAR) T cells has been advancing steadily in clinical trials. Since the ability of engineered T cells to recognize intended tumor-associated targets is crucial for the therapeutic success, antigen-binding domains play an important role in shaping T-cell responses. Single-chain antibody and T-cell receptor fragments, natural ligands, repeat proteins, combinations of the above and universal tag-specific domains have all been used in the antigen-binding moiety of chimeric receptors. Here we outline the advantages and disadvantages of different domains, discuss the concepts of affinity and specificity, and highlight the recent progress of each targeting strategy.
-
Development of a mouse-feline chimeric antibody against feline tumor necrosis factor-alpha.
Doki, Tomoyoshi; Takano, Tomomi; Hohdatsu, Tsutomu
2016-10-01
Feline infectious peritonitis (FIP) is a fatal inflammatory disease caused by FIP virus infection. Feline tumor necrosis factor (fTNF)-alpha is closely involved in the aggravation of FIP pathology. We previously described the preparation of neutralizing mouse anti-fTNF-alpha monoclonal antibody (mAb 2-4) and clarified its role in the clinical condition of cats with FIP using in vitro systems. However, administration of mouse mAb 2-4 to cat may lead to a production of feline anti-mouse antibodies. In the present study, we prepared a mouse-feline chimeric mAb (chimeric mAb 2-4) by fusing the variable region of mouse mAb 2-4 to the constant region of feline antibody. The chimeric mAb 2-4 was confirmed to have fTNF-alpha neutralization activity. Purified mouse mAb 2-4 and chimeric mAb 2-4 were repeatedly administered to cats, and the changes in the ability to induce feline anti-mouse antibody response were investigated. In the serum of cats treated with mouse mAb 2-4, feline anti-mouse antibody production was induced, and the fTNF-alpha neutralization effect of mouse mAb 2-4 was reduced. In contrast, in cats treated with chimeric mAb 2-4, the feline anti-mouse antibody response was decreased compared to that of mouse mAb 2-4-treated cats.
-
Oura, Tetsu; Ko, Dicken S.C.; Boskovic, Svjetlan; O'Neil, John J.; Chipashvili, Vaja; Koulmanda, Maria; Hotta, Kiyohiko; Kawai, Kento; Nadazdin, Ognjenka; Smith, R. Neal; Cosimi, A. B.; Kawai, Tatsuo
2016-01-01
Background We have previously reported successful induction of transient mixed chimerism and long-term acceptance of renal allografts in MHC-mismatched nonhuman primates. In this study, we attempted to extend this tolerance induction approach to islet allografts. Methods A total of eight recipients underwent MHC mismatched combined islet and bone marrow (BM) transplantation after induction of diabetes by streptozotocin. Three recipients were treated after a nonmyeloablative conditioning regimen that includes low dose total body and thymic irradiation, horse ATG (Atgam), six doses of anti-CD154 monoclonal antibody (mAb) and a one month course of cyclosporine (CyA) (Islet-A). In Islet-B, anti-CD8 mAb was administered in place of CyA. In Islet-C, two recipients were treated with Islet-B but without Atgam. The results were compared with previously reported results of eight cynomolgus monkeys that received combined kidney and bone marrow transplantation (Kidney-A) following the same conditioning regimen used in Islet-A. Results The majority of Kidney/BM recipients achieved long-term renal allograft survival after induction of transient chimerism. However, prolonged islet survival was not achieved in similarly conditioned Islet/BM recipients (Islet-A), despite induction of comparable levels of chimerism. In order to rule out islet allograft loss due to calcineurin inhibitor (CNI) toxicity, three recipients were treated with anti-CD8 mAb in place of CNI. Although these recipients developed significantly superior mixed chimerism and more prolonged islet allograft survival (61, 103, and 113 days), islet function was lost soon after the disappearance of chimerism. In Islet-C recipients, neither prolonged chimerism nor islet survival was observed (30 and 40 days). Conclusion Significant improvement of mixed chimerism induction and islet allograft survival were achieved with a CNI-free regimen that includes anti-CD8 mAb. However, unlike the kidney allograft, islet allograft
-
Oura, Tetsu; Ko, Dicken S C; Boskovic, Svjetlan; O'Neil, John J; Chipashvili, Vaja; Koulmanda, Maria; Hotta, Kiyohiko; Kawai, Kento; Nadazdin, Ognjenka; Smith, R Neal; Cosimi, A B; Kawai, Tatsuo
2016-01-01
We have previously reported successful induction of transient mixed chimerism and long-term acceptance of renal allografts in MHC mismatched nonhuman primates. In this study, we attempted to extend this tolerance induction approach to islet allografts. A total of eight recipients underwent MHC mismatched combined islet and bone marrow (BM) transplantation after induction of diabetes by streptozotocin. Three recipients were treated after a nonmyeloablative conditioning regimen that included low-dose total body and thymic irradiation, horse Atgam (ATG), six doses of anti-CD154 monoclonal antibody (mAb), and a 1-month course of cyclosporine (CyA) (Islet A). In Islet B, anti-CD8 mAb was administered in place of CyA. In Islet C, two recipients were treated with Islet B, but without ATG. The results were compared with previously reported results of eight cynomolgus monkeys that received combined kidney and BM transplantation (Kidney A) following the same conditioning regimen used in Islet A. The majority of kidney/BM recipients achieved long-term renal allograft survival after induction of transient chimerism. However, prolonged islet survival was not achieved in similarly conditioned islet/BM recipients (Islet A), despite induction of comparable levels of chimerism. In order to rule out islet allograft loss due to CyA toxicity, three recipients were treated with anti-CD8 mAb in place of CyA. Although these recipients developed significantly superior mixed chimerism and more prolonged islet allograft survival (61, 103, and 113 days), islet function was lost soon after the disappearance of chimerism. In Islet C recipients, neither prolonged chimerism nor islet survival was observed (30 and 40 days). Significant improvement of mixed chimerism induction and islet allograft survival were achieved with a CyA-free regimen that included anti-CD8 mAb. However, unlike the kidney allograft, islet allograft tolerance was not induced with transient chimerism. Induction of more
-
Alga-Produced Cholera Toxin-Pfs25 Fusion Proteins as Oral Vaccines
Gregory, James A.; Topol, Aaron B.; Doerner, David Z.
2013-01-01
Infectious diseases disproportionately affect indigent regions and are the greatest cause of childhood mortality in developing countries. Practical, low-cost vaccines for use in these countries are paramount to reducing disease burdens and concomitant poverty. Algae are a promising low-cost system for producing vaccines that can be orally delivered, thereby avoiding expensive purification and injectable delivery. We engineered the chloroplast of the eukaryotic alga Chlamydomonas reinhardtii to produce a chimeric protein consisting of the 25-kDa Plasmodium falciparum surface protein (Pfs25) fused to the β subunit of the cholera toxin (CtxB) to investigate an alga-based whole-cell oral vaccine. Pfs25 is a promising malaria transmission-blocking vaccine candidate that has been difficult to produce in traditional recombinant systems due to its structurally complex tandem repeats of epidermal growth factor-like domains. The noncatalytic CtxB domain of the cholera holotoxin assembles into a pentameric structure and acts as a mucosal adjuvant by binding GM1 ganglioside receptors on gut epithelial cells. We demonstrate that CtxB-Pfs25 accumulates as a soluble, properly folded and functional protein within algal chloroplasts, and it is stable in freeze-dried alga cells at ambient temperatures. In mice, oral vaccination using freeze-dried algae that produce CtxB-Pfs25 elicited CtxB-specific serum IgG antibodies and both CtxB- and Pfs25-specific secretory IgA antibodies. These data suggest that algae are a promising system for production and oral delivery of vaccine antigens, but as an orally delivered adjuvant, CtxB is best suited for eliciting secretory IgA antibodies for vaccine antigens against pathogens that invade mucosal surfaces using this strategy. PMID:23603678
-
Mercier, Annie; Sun, Zhao; Hamel, Jean-François
2011-01-01
The concept of intraorganismal genetic heterogeneity resulting from allogeneic fusion (i.e. chimerism) has almost exclusively been explored in modular organisms that have the capacity to reproduce asexually, such as colonial ascidians and corals. Apart from medical conditions in mammals, the natural development of chimeras across ontogenetic stages has not been investigated in any unitary organism incapable of asexual propagation. Furthermore, chimerism was mainly studied among gregarious settlers to show that clustering of genetically similar individuals upon settlement promotes the occurrence of multi-chimeras exhibiting greater fitness. The possible occurrence of chimeric embryos and larvae prior to settlement has not received any attention. Here we document for the first time the presence of natural chimeras in brooded embryos and larvae of a unitary cnidarian, the sea anemone Urticina felina. Rates of visible bi- and multi-chimerism of up to 3.13 per cent were measured in the broods of 16 females. Apart from these sectorial chimeras, monitored fusion events also yielded homogeneous chimeric entities (mega-larvae) suggesting that the actual rates of natural chimerism in U. felina are greater than predicted by visual assessment. In support of this assumption, the broods of certain individuals comprised a dominant proportion (to 90%) of inexplicably large embryos and larvae (relative to oocyte size). Findings of fusion and chimerism in a unitary organism add a novel dimension to the framework within which the mechanisms and evolutionary significance of genetic heterogeneity in animal taxa can be explored. PMID:21508035
-
Lam, Jian Hang; Chua, Yen Leong; Lee, Pei Xuan; Martínez Gómez, Julia María; Ooi, Eng Eong; Alonso, Sylvie
2017-12-21
Declining levels of maternal antibodies were shown to sensitize infants born to dengue-immune mothers to severe disease during primary infection, through the process of antibody-dependent enhancement of infection (ADE). With the recent approval for human use of Sanofi-Pasteur's chimeric dengue vaccine CYD-TDV and several vaccine candidates in clinical development, the scenario of infants born to vaccinated mothers has become a reality. This raises 2 questions: will declining levels of maternal vaccine-induced antibodies cause ADE; and, will maternal antibodies interfere with vaccination efficacy in the infant? To address these questions, the above scenario was modeled in mice. Type I IFN-deficient female mice were immunized with live attenuated DENV2 PDK53, the core component of the tetravalent DENVax candidate currently under clinical development. Pups born to PDK53-immunized dams acquired maternal antibodies that strongly neutralized parental strain 16681, but not the heterologous DENV2 strain D2Y98P-PP1, and instead caused ADE during primary infection with this strain. Furthermore, pups failed to seroconvert after PDK53 vaccination, owing to maternal antibody interference. However, a cross-protective multifunctional CD8+ T cell response did develop. Thus, our work advocates for the development of dengue vaccine candidates that induce protective CD8+ T cells despite the presence of enhancing, interfering maternal antibodies.
-
Development of Murine Cyp3a Knockout Chimeric Mice with Humanized Liver.
Kato, Kota; Ohbuchi, Masato; Hamamura, Satoko; Ohshita, Hiroki; Kazuki, Yasuhiro; Oshimura, Mitsuo; Sato, Koya; Nakada, Naoyuki; Kawamura, Akio; Usui, Takashi; Kamimura, Hidetaka; Tateno, Chise
2015-08-01
We developed murine CYP3A knockout ko chimeric mice with humanized liver expressing human P450S similar to those in humans and whose livers and small intestines do not express murine CYP3A this: approach may overcome effects of residual mouse metabolic enzymes like Cyp3a in conventional chimeric mice with humanized liver, such as PXB-mice [urokinase plasminogen activator/severe combined immunodeficiency (uPA/SCID) mice repopulated with over 70% human hepatocytes] to improve the prediction of drug metabolism and pharmacokinetics in humans. After human hepatocytes were transplanted into Cyp3a KO/uPA/SCID host mice, human albumin levels logarithmically increased until approximately 60 days after transplantation, findings similar to those in PXB-mice. Quantitative real-time-polymerase chain reaction analyses showed that hepatic human P450s, UGTs, SULTs, and transporters mRNA expression levels in Cyp3a KO chimeric mice were also similar to those in PXB-mice and confirmed the absence of Cyp3a11 mRNA expression in mouse liver and intestine. Findings for midazolam and triazolam metabolic activities in liver microsomes were comparable between Cyp3a KO chimeric mice and PXB-mice. In contrast, these activities in the intestine of Cyp3a KO chimeric mice were attenuated compared with PXB-mice. Owing to the knockout of murine Cyp3a, hepatic Cyp2b10 and 2c55 mRNA levels in Cyp3a KO/uPA/SCID mice (without hepatocyte transplants) were 8.4- and 61-fold upregulated compared with PXB-mice, respectively. However, human hepatocyte transplantation successfully restored Cyp2b10 level nearly fully and Cyp2c55 level partly (still 13-fold upregulated) compared with those in PXB-mice. Intestinal Cyp2b10 and 2c55 were also repressed by human hepatocyte transplantation in Cyp3a KO chimeric mice. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
-
Mutso, Margit; Morro, Ainhoa Moliner; Smedberg, Cecilia; Kasvandik, Sergo; Aquilimeba, Muriel; Teppor, Mona; Tarve, Liisi; Lulla, Aleksei; Lulla, Valeria; Saul, Sirle; Thaa, Bastian; McInerney, Gerald M; Merits, Andres; Varjak, Margus
2018-04-27
Infection by Chikungunya virus (CHIKV) of the Old World alphaviruses (family Togaviridae) in humans can cause arthritis and arthralgia. The virus encodes four non-structural proteins (nsP) (nsP1, nsp2, nsP3 and nsP4) that act as subunits of the virus replicase. These proteins also interact with numerous host proteins and some crucial interactions are mediated by the unstructured C-terminal hypervariable domain (HVD) of nsP3. In this study, a human cell line expressing EGFP tagged with CHIKV nsP3 HVD was established. Using quantitative proteomics, it was found that CHIKV nsP3 HVD can bind cytoskeletal proteins, including CD2AP, SH3KBP1, CAPZA1, CAPZA2 and CAPZB. The interaction with CD2AP was found to be most evident; its binding site was mapped to the second SH3 ligand-like element in nsP3 HVD. Further assessment indicated that CD2AP can bind to nsP3 HVDs of many different New and Old World alphaviruses. Mutation of the short binding element hampered the ability of the virus to establish infection. The mutation also abolished ability of CD2AP to co-localise with nsP3 and replication complexes of CHIKV; the same was observed for Semliki Forest virus (SFV) harbouring a similar mutation. Similar to CD2AP, its homolog SH3KBP1 also bound the identified motif in CHIKV and SFV nsP3.
-
A chimeric human-mouse model of Sjögren's syndrome.
Young, Nicholas A; Wu, Lai-Chu; Bruss, Michael; Kaffenberger, Benjamin H; Hampton, Jeffrey; Bolon, Brad; Jarjour, Wael N
2015-01-01
Despite recent advances in the understanding of Sjögren's Syndrome (SjS), the pathogenic mechanisms remain elusive and an ideal model for early drug discovery is not yet available. To establish a humanized mouse model of SjS, peripheral blood mononuclear cells (PBMCs) from healthy volunteers or patients with SjS were transferred into immunodeficient NOD-scid IL-2rγ(null) mouse recipients to produce chimeric mice. While no difference was observed in the distribution of cells, chimeric mice transferred with PBMCs from SjS patients produced enhanced cytokine levels, most significantly IFN-γ and IL-10. Histological examination revealed enhanced inflammatory responses in the lacrimal and salivary glands of SjS chimeras, as measured by digital image analysis and blinded histopathological scoring. Infiltrates were primarily CD4+, with minimal detection of CD8+ T-cells and B-cells. These results demonstrate a novel chimeric mouse model of human SjS that provides a unique in vivo environment to test experimental therapeutics and investigate T-cell disease pathology. Copyright © 2014. Published by Elsevier Inc.
-
Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element
Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.
2007-01-01
Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743
-
Engineering Chimeric Antigen Receptors
Kulemzin, S. V.; Kuznetsova, V. V.; Mamonkin, M.; Taranin, A. V.; Gorchakov, A. A.
2017-01-01
Chimeric antigen receptors (CARs) are recombinant protein molecules that redirect cytotoxic lymphocytes toward malignant and other target cells. The high feasibility of manufacturing CAR-modified lymphocytes for the therapy of cancer has spurred the development and optimization of new CAR T cells directed against a broad range of target antigens. In this review, we describe the main structural and functional elements constituting a CAR, discuss the roles of these elements in modulating the anti-tumor activity of CAR T cells, and highlight alternative approaches to CAR engineering. PMID:28461969
-
Scott, Naomi M; Ng, Royce L X; McGonigle, Terence A; Gorman, Shelley; Hart, Prue H
2015-11-01
During respiratory inflammation, it is generally assumed that dendritic cells differentiating from the bone marrow are immunogenic rather than immunoregulatory. Using chimeric mice, the outcomes of airways inflammation on bone marrow progenitor cells were studied. Immune responses were analyzed in chimeric mice engrafted for >16 weeks with bone marrow cells from mice with experimental allergic airways disease (EAAD). Responses to sensitization and challenge with the allergen causing inflammation in the bone marrow-donor mice were significantly reduced in the chimeric mice engrafted with bone marrow cells from mice with EAAD (EAAD-chimeric). Responses to intranasal LPS and topical fluorescein isothiocyanate (non-specific challenges) were significantly attenuated. Fewer activated dendritic cells from the airways and skin of the EAAD-chimeric mice could be tracked to the draining lymph nodes, and may contribute to the significantly reduced antigen/chemical-induced hypertrophy in the draining nodes, and the reduced immune responses to sensitizing allergens. Dendritic cells differentiating in vitro from the bone marrow of >16 weeks reconstituted EAAD-chimeric mice retained an ability to poorly prime immune responses when transferred into naïve mice. Dendritic cells developing from bone marrow progenitors during airways inflammation are altered such that daughter cells have reduced antigen priming capabilities.
-
Shao, Renfu; Barker, Stephen C
2011-02-15
The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.
-
Chimeric Protein Complexes in Hybrid Species Generate Novel Phenotypes
Piatkowska, Elzbieta M.; Naseeb, Samina; Knight, David; Delneri, Daniela
2013-01-01
Hybridization between species is an important mechanism for the origin of novel lineages and adaptation to new environments. Increased allelic variation and modification of the transcriptional network are the two recognized forces currently deemed to be responsible for the phenotypic properties seen in hybrids. However, since the majority of the biological functions in a cell are carried out by protein complexes, inter-specific protein assemblies therefore represent another important source of natural variation upon which evolutionary forces can act. Here we studied the composition of six protein complexes in two different Saccharomyces “sensu stricto” hybrids, to understand whether chimeric interactions can be freely formed in the cell in spite of species-specific co-evolutionary forces, and whether the different types of complexes cause a change in hybrid fitness. The protein assemblies were isolated from the hybrids via affinity chromatography and identified via mass spectrometry. We found evidence of spontaneous chimericity for four of the six protein assemblies tested and we showed that different types of complexes can cause a variety of phenotypes in selected environments. In the case of TRP2/TRP3 complex, the effect of such chimeric formation resulted in the fitness advantage of the hybrid in an environment lacking tryptophan, while only one type of parental combination of the MBF complex allowed the hybrid to grow under respiratory conditions. These phenotypes were dependent on both genetic and environmental backgrounds. This study provides empirical evidence that chimeric protein complexes can freely assemble in cells and reveals a new mechanism to generate phenotypic novelty and plasticity in hybrids to complement the genomic innovation resulting from gene duplication. The ability to exchange orthologous members has also important implications for the adaptation and subsequent genome evolution of the hybrids in terms of pattern of gene loss. PMID
-
Kaur, Ramanjit; Mudgal, Rajat; Narwal, Manju; Tomar, Shailly
2018-06-26
Alphavirus non-structural protein, nsP1 has a distinct molecular mechanism of capping the viral RNAs than the conventional capping mechanism of host. Thus, alphavirus capping enzyme nsP1 is a potential drug target. nsP1 catalyzes the methylation of guanosine triphosphate (GTP) by transferring the methyl group from S-adenosylmethionine (SAM) to a GTP molecule at its N7 position with the help of nsP1 methyltransferase (MTase) followed by guanylylation (GT) reaction which involves the formation of m 7 GMP-nsP1 covalent complex by nsP1 guanylyltransferase (GTase). In subsequent reactions, m 7 GMP moiety is added to the 5' end of the viral ppRNA by nsP1 GTase resulting in the formation of cap0 structure. In the present study, chikungunya virus (CHIKV) nsP1 MTase and GT reactions were confirmed by an indirect non-radioactive colorimetric assay and western blot assay using an antibody specific for the m 7 G cap, respectively. The purified recombinant CHIKV nsP1 has been used for the development of a rapid and sensitive non-radioactive enzyme linked immunosorbent assay (ELISA) to identify the inhibitors of CHIKV nsP1. The MTase reaction is followed by GT reaction and resulted in m 7 GMP-nsP1 covalent complex formation. The developed ELISA nsP1 assay measures this m 7 GMP-nsP1 complex by utilizing anti-m 7 G cap monoclonal antibody. The mutation of a conserved residue Asp63 to Ala revealed its role in nsP1 enzyme reaction. Inductively coupled plasma mass spectroscopy (ICP-MS) was used to determine the presence of magnesium ions (Mg 2+ ) in the purified nsP1 protein. The divalent metal ion selectivity and investigation show preference for Mg 2+ ion by CHIKV nsP1. Additionally, using the developed ELISA nsP1 assay, the inhibitory effects of sinefungin, aurintricarboxylic acid (ATA) and ribavirin were determined and the IC 50 values were estimated to be 2.69 µM, 5.72 µM and 1.18 mM, respectively. Copyright © 2018. Published by Elsevier B.V.
-
Huang, Lihong; Liu, Shukai; Zang, Fuyu; Xing, Jinchao; Zhang, Youyue; Liang, Jiaqi; Zhang, Guihong
2017-01-01
In the swine industry, porcine reproductive and respiratory syndrome (PRRS) is a highly contagious disease which causes heavy economic losses worldwide. Effective prevention and disease control is an important issue. In this study, we described the construction of a Japanese encephalitis virus (JEV) DNA-based replicon with a cytomegalovirus (CMV) promoter based on the genome of Japanese encephalitis live vaccine virus SA14-14-2, which is capable of offering a potentially novel way to develop and produce vaccines against a major pathogen of global health. This JEV DNA-based replicon contains a large deletion in the structural genes (C-prM-E). A PRRSV GP5/M was inserted into the deletion position of JEV DNA-based replicons to develop a chimeric replicon vaccine candidate for PRRSV. The results showed that BALB/c mice models with the replicon vaccines pJEV-REP-G-2A-M-IRES and pJEV-REP-G-2A-M stimulated antibody responses and induced a cellular immune response. Analysis of ELSA data showed that vaccination with the replicon vaccine expressing GP5/M induced a better antibodies response than traditional DNA vaccines. Therefore, the results suggested that this ectopic expression system based on JEV DNA-based replicons may represent a useful molecular platform for various biological applications, and the JEV DNA-based replicons expressing GP5/M can be further developed into a novel, safe vaccine candidate for PRRS. PMID:28740748
-
Tomusange, Khamis; Wijesundara, Danushka; Gummow, Jason; Garrod, Tamsin; Li, Yanrui; Gray, Lachlan; Churchill, Melissa; Grubor-Bauk, Branka; Gowans, Eric J
2016-06-30
DNA vaccines are cost-effective to manufacture on a global scale and Tat-based DNA vaccines have yielded protective outcomes in preclinical and clinical models of human immunodeficiency virus (HIV), highlighting the potential of such vaccines. However, Tat-based DNA vaccines have been poorly immunogenic, and despite the administration of multiple doses and/or the addition of adjuvants, these vaccines are not in general use. In this study, we improved Tat immunogenicity by fusing it with the oligomerisation domain of a chimeric C4-binding protein (C4b-p), termed IMX313, resulting in Tat heptamerisation and linked Tat to the leader sequence of tissue plasminogen activator (TPA) to ensure that the bulk of heptamerised Tat is secreted. Mice vaccinated with secreted Tat fused to IMX313 (pVAX-sTat-IMX313) developed higher titres of Tat-specific serum IgG, mucosal sIgA and cell-mediated immune (CMI) responses, and showed superior control of EcoHIV infection, a surrogate murine HIV challenge model, compared with animals vaccinated with other test vaccines. Given the crucial contribution of Tat to HIV-1 pathogenesis and the precedent of Tat-based DNA vaccines in conferring some level of protection in animal models, we believe that the virologic control demonstrated with this novel multimerised Tat vaccine highlights the promise of this vaccine candidate for humans.
-
Salman, Ahmed M.; Montoya-Díaz, Eduardo; West, Heather; Lall, Amar; Atcheson, Erwan; Lopez-Camacho, Cesar; Ramesar, Jai; Bauza, Karolis; Collins, Katharine A.; Brod, Florian; Reis, Fernando; Pappas, Leontios; González-Cerón, Lilia; Janse, Chris J.; Hill, Adrian V. S.; Khan, Shahid M.; Reyes-Sandoval, Arturo
2017-01-01
Development of a protective and broadly-acting vaccine against the most widely distributed human malaria parasite, Plasmodium vivax, will be a major step towards malaria elimination. However, a P. vivax vaccine has remained elusive by the scarcity of pre-clinical models to test protective efficacy and support further clinical trials. In this study, we report the development of a highly protective CSP-based P. vivax vaccine, a virus-like particle (VLP) known as Rv21, able to provide 100% sterile protection against a stringent sporozoite challenge in rodent models to malaria, where IgG2a antibodies were associated with protection in absence of detectable PvCSP-specific T cell responses. Additionally, we generated two novel transgenic rodent P. berghei parasite lines, where the P. berghei csp gene coding sequence has been replaced with either full-length P. vivax VK210 or the allelic VK247 csp that additionally express GFP-Luciferase. Efficacy of Rv21 surpassed viral-vectored vaccination using ChAd63 and MVA. We show for the first time that a chimeric VK210/247 antigen can elicit high level cross-protection against parasites expressing either CSP allele, which provide accessible and affordable models suitable to support the development of P. vivax vaccines candidates. Rv21 is progressing to GMP production and has entered a path towards clinical evaluation. PMID:28417968
-
Han, Kai; Zhang, Jin; Zhang, Weiyun; Wang, Shibo; Xu, Luming; Zhang, Chi; Zhang, Xianzheng; Han, Heyou
2017-03-28
Geometrical shape of nanoparticles plays an important role in cellular internalization. However, the applicability in tumor selective therapeutics is still scarcely reported. In this article, we designed a tumor extracellular acidity-responsive chimeric peptide with geometrical shape switch for enhanced tumor internalization and photodynamic therapy. This chimeric peptide could self-assemble into spherical nanoparticles at physiological condition. While at tumor extracellular acidic microenvironment, chimeric peptide underwent detachment of acidity-sensitive 2,3-dimethylmaleic anhydride groups. The subsequent recovery of ionic complementarity between chimeric peptides resulted in formation of rod-like nanoparticles. Both in vitro and in vivo studies demonstrated that this acidity-triggered geometrical shape switch endowed chimeric peptide with accelerated internalization in tumor cells, prolonged accumulation in tumor tissue, enhanced photodynamic therapy, and minimal side effects. Our results suggested that fusing tumor microenvironment with geometrical shape switch should be a promising strategy for targeted drug delivery.
-
Isolation of chicken embryonic stem cell and preparation of chicken chimeric model.
Zhang, Yani; Yang, Haiyan; Zhang, Zhentao; Shi, Qingqing; Wang, Dan; Zheng, Mengmeng; Li, Bichun; Song, Jiuzhou
2013-03-01
Chicken embryonic stem cells (ESCs) were separated from blastoderms at stage-X and cultured in vitro. Alkaline phosphatase activity and stage-specific embryonic antigen-1 staining was conducted to detect ESCs. Then, chicken ESCs were transfected with linearized plasmid pEGFP-N1 in order to produce chimeric chicken. Firstly, the optimal electrotransfection condition was compared; the results showed the highest transfection efficiency was obtained when the field strength and pulse duration was 280 V and 75 μs, respectively. Secondly, the hatchability of shedding methods, drilling a window at the blunt end of egg and drilling a window at the lateral shell of egg was compared, the results showed that the hatchability was the highest for drilling a window at the lateral shell of egg. Thirdly, the hatchability of microinjection (ESCs was microinjected into chick embryo cavity) was compared too, the results showed there were significant difference between the injection group transfected with ESCs and that of other two groups. In addition, five chimeric chickens were obtained in this study and EGFP gene was expressed in some organs, but only two chimeric chicken expressed EGFP gene in the gonad, indicating that the chimeric chicken could be obtained through chick embryo cavity injection by drilling a window at the lateral shell of egg.
-
Production of infectious chimeric hepatitis C virus genotype 2b harboring minimal regions of JFH-1.
Murayama, Asako; Kato, Takanobu; Akazawa, Daisuke; Sugiyama, Nao; Date, Tomoko; Masaki, Takahiro; Nakamoto, Shingo; Tanaka, Yasuhito; Mizokami, Masashi; Yokosuka, Osamu; Nomoto, Akio; Wakita, Takaji
2012-02-01
To establish a cell culture system for chimeric hepatitis C virus (HCV) genotype 2b, we prepared a chimeric construct harboring the 5' untranslated region (UTR) to the E2 region of the MA strain (genotype 2b) and the region of p7 to the 3' UTR of the JFH-1 strain (genotype 2a). This chimeric RNA (MA/JFH-1.1) replicated and produced infectious virus in Huh7.5.1 cells. Replacement of the 5' UTR of this chimera with that from JFH-1 (MA/JFH-1.2) enhanced virus production, but infectivity remained low. In a long-term follow-up study, we identified a cell culture-adaptive mutation in the core region (R167G) and found that it enhanced virus assembly. We previously reported that the NS3 helicase (N3H) and the region of NS5B to 3' X (N5BX) of JFH-1 enabled replication of the J6CF strain (genotype 2a), which could not replicate in cells. To reduce JFH-1 content in MA/JFH-1.2, we produced a chimeric viral genome for MA harboring the N3H and N5BX regions of JFH-1, combined with a JFH-1 5' UTR replacement and the R167G mutation (MA/N3H+N5BX-JFH1/R167G). This chimeric RNA replicated efficiently, but virus production was low. After the introduction of four additional cell culture-adaptive mutations, MA/N3H+N5BX-JFH1/5am produced infectious virus efficiently. Using this chimeric virus harboring minimal regions of JFH-1, we analyzed interferon sensitivity and found that this chimeric virus was more sensitive to interferon than JFH-1 and another chimeric virus containing more regions from JFH-1 (MA/JFH-1.2/R167G). In conclusion, we established an HCV genotype 2b cell culture system using a chimeric genome harboring minimal regions of JFH-1. This cell culture system may be useful for characterizing genotype 2b viruses and developing antiviral strategies.
-
Lassa-Vesicular Stomatitis Chimeric Virus Safely Destroys Brain Tumors
Wollmann, Guido; Drokhlyansky, Eugene; Davis, John N.; Cepko, Connie
2015-01-01
ABSTRACT High-grade tumors in the brain are among the deadliest of cancers. Here, we took a promising oncolytic virus, vesicular stomatitis virus (VSV), and tested the hypothesis that the neurotoxicity associated with the virus could be eliminated without blocking its oncolytic potential in the brain by replacing the neurotropic VSV glycoprotein with the glycoprotein from one of five different viruses, including Ebola virus, Marburg virus, lymphocytic choriomeningitis virus (LCMV), rabies virus, and Lassa virus. Based on in vitro infections of normal and tumor cells, we selected two viruses to test in vivo. Wild-type VSV was lethal when injected directly into the brain. In contrast, a novel chimeric virus (VSV-LASV-GPC) containing genes from both the Lassa virus glycoprotein precursor (GPC) and VSV showed no adverse actions within or outside the brain and targeted and completely destroyed brain cancer, including high-grade glioblastoma and melanoma, even in metastatic cancer models. When mice had two brain tumors, intratumoral VSV-LASV-GPC injection in one tumor (glioma or melanoma) led to complete tumor destruction; importantly, the virus moved contralaterally within the brain to selectively infect the second noninjected tumor. A chimeric virus combining VSV genes with the gene coding for the Ebola virus glycoprotein was safe in the brain and also selectively targeted brain tumors but was substantially less effective in destroying brain tumors and prolonging survival of tumor-bearing mice. A tropism for multiple cancer types combined with an exquisite tumor specificity opens a new door to widespread application of VSV-LASV-GPC as a safe and efficacious oncolytic chimeric virus within the brain. IMPORTANCE Many viruses have been tested for their ability to target and kill cancer cells. Vesicular stomatitis virus (VSV) has shown substantial promise, but a key problem is that if it enters the brain, it can generate adverse neurologic consequences, including death. We
-
Recombinant constructs of Borrelia burgdorferi
Dattwyler, Raymond J.; Gomes-Solecki, Maria J. C.; Luft, Benjamin J.; Dunn, John J.
2007-02-20
Novel chimeric nucleic acids, encoding chimeric Borrelia proteins comprising OspC or an antigenic fragment thereof and OspA or an antigenic fragment thereof, are disclosed. Chimeric proteins encoded by the nucleic acid sequences are also disclosed. The chimeric proteins are useful as vaccine immunogens against Lyme borreliosis, as well as for immunodiagnostic reagents.
-
Nash;, Richard A.; Yunosov;, Murad; Abrams;, Kraig; Hwang;, Billanna; Castilla-Llorente;, Cristina; Chen;, Peter; Farivar;, Alexander S.; Georges;, George E.; Hackman;, Robert C.; Lamm;, Wayne J.E.; Lesnikova;, Marina; Ochs;, Hans D.; Randolph-Habecker;, Julie; Ziegler;, Stephen F.; Storb;, Rainer; Storer;, Barry; Madtes;, David K.; Glenny;, Robb; Mulligan, Michael S.
2010-01-01
Long-term survival after lung transplantation is limited by acute and chronic graft rejection. Induction of immune tolerance by first establishing mixed hematopoietic chimerism (MC) is a promising strategy to improve outcomes. In a preclinical canine model, stable MC was established in recipients after reduced-intensity conditioning and hematopoietic cell transplantation from a DLA-identical donor. Delayed lung transplantation was performed from the stem cell donor without pharmacological immunosuppression. Lung graft survival without loss of function was prolonged in chimeric (n=5) vs. nonchimeric (n=7) recipients (p≤0.05, Fisher’s test). There were histological changes consistent with low grade rejection in 3/5 of the lung grafts in chimeric recipients at ≥1 year. Chimeric recipients after lung transplantation had a normal immune response to a T-dependent antigen. Compared to normal dogs, there were significant increases of CD4+INFγ+, CD4+IL-4+ and CD8+ INFγ+ T-cell subsets in the blood (p <0.0001 for each of the 3 T-cell subsets). Markers for regulatory T-cell subsets including foxP3, IL10 and TGFβ were also increased in CD3+ T cells from the blood and peripheral tissues of chimeric recipients after lung transplantation. Establishing MC is immunomodulatory and observed changes were consistent with activation of both the effector and regulatory immune response. PMID:19422333
-
Gotoh, Masahiro; Ichikawa, Hitoshi; Arai, Eri; Chiku, Suenori; Sakamoto, Hiromi; Fujimoto, Hiroyuki; Hiramoto, Masaki; Nammo, Takao; Yasuda, Kazuki; Yoshida, Teruhiko; Kanai, Yae
2014-01-01
The aim of this study was to clarify the participation of expression of chimeric transcripts in renal carcinogenesis. Whole transcriptome analysis (RNA sequencing) and exploration of candidate chimeric transcripts using the deFuse program were performed on 68 specimens of cancerous tissue (T) and 11 specimens of non-cancerous renal cortex tissue (N) obtained from 68 patients with clear cell renal cell carcinomas (RCCs) in an initial cohort. As positive controls, two RCCs associated with Xp11.2 translocation were analyzed. After verification by reverse transcription (RT)-PCR and Sanger sequencing, 26 novel chimeric transcripts were identified in 17 (25%) of the 68 clear cell RCCs. Genomic breakpoints were determined in five of the chimeric transcripts. Quantitative RT-PCR analysis revealed that the mRNA expression levels for the MMACHC, PTER, EPC2, ATXN7, FHIT, KIFAP3, CPEB1, MINPP1, TEX264, FAM107A, UPF3A, CDC16, MCCC1, CPSF3, and ASAP2 genes, being partner genes involved in the chimeric transcripts in the initial cohort, were significantly reduced in 26 T samples relative to the corresponding 26 N samples in the second cohort. Moreover, the mRNA expression levels for the above partner genes in T samples were significantly correlated with tumor aggressiveness and poorer patient outcome, indicating that reduced expression of these genes may participate in malignant progression of RCCs. As is the case when their levels of expression are reduced, these partner genes also may not fully function when involved in chimeric transcripts. These data suggest that generation of chimeric transcripts may participate in renal carcinogenesis by inducing dysfunction of tumor-related genes. PMID:25230976
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Engel, Amber R., E-mail: engelam@mail.nih.go; Rumyantsev, Alexander A., E-mail: alexander.rumyantsev@sanofipasteur.co; Maximova, Olga A., E-mail: maximovao@mail.nih.go
Tick-borne encephalitis (TBE) is a severe disease affecting thousands of people throughout Eurasia. Despite the use of formalin-inactivated vaccines in endemic areas, an increasing incidence of TBE emphasizes the need for an alternative vaccine that will induce a more durable immunity against TBE virus (TBEV). The chimeric attenuated virus vaccine candidate containing the structural protein genes of TBEV on a dengue virus genetic background (TBEV/DEN4) retains a high level of neurovirulence in both mice and monkeys. Therefore, attenuating mutations were introduced into the envelope (E{sub 315}) and NS5 (NS5{sub 654,655}) proteins, and into the 3' non-coding region ({Delta}30) of TBEV/DEN4.more » The variant that contained all three mutations (v{Delta}30/E{sub 315}/NS5{sub 654,655}) was significantly attenuated for neuroinvasiveness and neurovirulence and displayed a reduced level of replication and virus-induced histopathology in the brains of mice. The high level of safety in the central nervous system indicates that v{Delta}30/E{sub 315}/NS5{sub 654,655} should be further evaluated as a TBEV vaccine.« less
-
Ma, Kimberly K.; Petroff, Margaret G.; Coscia, Lisa A.; Armenti, Vincent T.; Adams Waldorf, Kristina M.
2013-01-01
Thousands of women with organ transplantation have undergone successful pregnancies, however little is known about how the profound immunologic changes associated with pregnancy might influence tolerance or rejection of the allograft. Pregnant women with a solid organ transplant are complex chimeras with multiple foreign cell populations from the donor organ, fetus, and mother of the pregnant woman. We consider the impact of complex chimerism and pregnancy-associated immunologic changes on tolerance of the allograft both during pregnancy and the postpartum period. Mechanisms of allograft tolerance are likely dynamic during pregnancy and affected by the influx of fetal microchimeric cells, HLA relationships (between the fetus, pregnant woman and/or donor), peripheral T cell tolerance to fetal cells, and fetal minor histocompatibility antigens. Further research is necessary to understand the complex immunology during pregnancy and the postpartum period of women with a solid organ transplant. PMID:23974274
-
Ikeda, Koki; Koga, Tomoaki; Sasaki, Fumiyuki; Ueno, Ayumi; Saeki, Kazuko; Okuno, Toshiaki; Yokomizo, Takehiko
2017-05-13
DYKDDDDK peptide (FLAG) is a useful tool for investigating the function and localization of proteins whose antibodies (Abs) are not available. We recently established a high-affinity monoclonal antibody (mAb) for FLAG (clone 2H8). The 2H8 Ab is highly sensitive for detecting FLAG-tagged proteins by flowcytometry and immunoprecipitation, but it can yield nonspecific signals in immunohistochemistry of mouse tissues because it is of mouse origin. In this study, we reduced nonspecific signals by generating a chimeric 2H8 Ab with Fc fragments derived from human immunoglobulin. We fused a 5' terminal cDNA fragments for the Fab region of 2H8 mAb with 3' terminal cDNA fragments for Fc region of human IgG1. We transfected both chimeric plasmids and purified the resulting human-mouse chimeric 2H8. The chimeric 2H8 Ab successfully detected FLAG-tagged proteins in flowcytometry with anti-human IgG secondary Ab with comparable sensitivity to 2H8 mAb. Importantly, chimeric 2H8 detected specific FLAG peptide signals without nonspecific signals in immunohistochemical analysis with mouse tissues. This human-mouse chimeric high-affinity anti-FLAG Ab will prove useful for future immunohistochemical analysis of mouse tissues. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
-
Sanoh, Seigo; Ohta, Shigeru
2014-03-01
Preclinical studies in animal models are used routinely during drug development, but species differences of pharmacokinetics (PK) between animals and humans have to be taken into account in interpreting the results. Human hepatocytes are also widely used to examine metabolic activities mediated by cytochrome P450 (P450) and other enzymes, but such in vitro metabolic studies also have limitations. Recently, chimeric mice with humanized liver (h-chimeric mice), generated by transplantation of human donor hepatocytes, have been developed as a model for the prediction of metabolism and PK in humans, using both in vitro and in vivo approaches. The expression of human-specific metabolic enzymes and metabolic activities was confirmed in humanized liver of h-chimeric mice with high replacement ratios, and several reports indicate that the profiles of P450 and non-P450 metabolism in these mice adequately reflect those in humans. Further, the combined use of h-chimeric mice and r-chimeric mice, in which endogenous hepatocytes are replaced with rat hepatocytes, is a promising approach for evaluation of species differences in drug metabolism. Recent work has shown that data obtained in h-chimeric mice enable the semi-quantitative prediction of not only metabolites, but also PK parameters, such as hepatic clearance, of drug candidates in humans, although some limitations remain because of differences in the metabolic activities, hepatic blood flow and liver structure between humans and mice. In addition, fresh h-hepatocytes can be isolated reproducibly from h-chimeric mice for metabolic studies. Copyright © 2013 John Wiley & Sons, Ltd.
-
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
NASA Astrophysics Data System (ADS)
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
-
Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA.
Chwalenia, Katarzyna; Qin, Fujun; Singh, Sandeep; Tangtrongstittikul, Panjapon; Li, Hui
2017-11-22
cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.
-
Novel chimeric peptide with enhanced cell specificity and anti-inflammatory activity.
Kim, Young-Min; Kim, Nam-Hong; Lee, Jong-Wan; Jang, Jin-Sun; Park, Yung-Hoon; Park, Seong-Cheol; Jang, Mi-Kyeong
2015-07-31
An antimicrobial peptide (AMP), Hn-Mc, was designed by combining the N-terminus of HPA3NT3 and the C-terminus of melittin. This chimeric AMP exhibited potent antibacterial activity with low minimal inhibitory concentrations (MICs), ranging from 1 to 2 μM against four drug-susceptible bacteria and ten drug-resistant bacteria. Moreover, the hemolysis and cytotoxicity was reduced significantly compared to those of the parent peptides, highlighting its high cell selectivity. The morphological changes in the giant unilamellar vesicles and bacterial cell surfaces caused by the Hn-Mc peptide suggested that it killed the microbial cells by damaging the membrane envelope. An in vivo study also demonstrated the antibacterial activity of the Hn-Mc peptide in a mouse model infected with drug-resistant bacteria. In addition, the chimeric peptide inhibited the expression of lipopolysaccharide (LPS)-induced cytokines in RAW 264.7 cells by preventing the interaction between LPS and Toll-like receptors. These results suggest that this chimeric peptide is an antimicrobial and anti-inflammatory candidate as a pharmaceutic agent. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Interspecies Chimerism with Mammalian Pluripotent Stem Cells.
Wu, Jun; Platero-Luengo, Aida; Sakurai, Masahiro; Sugawara, Atsushi; Gil, Maria Antonia; Yamauchi, Takayoshi; Suzuki, Keiichiro; Bogliotti, Yanina Soledad; Cuello, Cristina; Morales Valencia, Mariana; Okumura, Daiji; Luo, Jingping; Vilariño, Marcela; Parrilla, Inmaculada; Soto, Delia Alba; Martinez, Cristina A; Hishida, Tomoaki; Sánchez-Bautista, Sonia; Martinez-Martinez, M Llanos; Wang, Huili; Nohalez, Alicia; Aizawa, Emi; Martinez-Redondo, Paloma; Ocampo, Alejandro; Reddy, Pradeep; Roca, Jordi; Maga, Elizabeth A; Esteban, Concepcion Rodriguez; Berggren, W Travis; Nuñez Delicado, Estrella; Lajara, Jeronimo; Guillen, Isabel; Guillen, Pedro; Campistol, Josep M; Martinez, Emilio A; Ross, Pablo Juan; Izpisua Belmonte, Juan Carlos
2017-01-26
Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a versatile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis-disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, interspecies blastocyst complementation might allow human organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent species remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the ungulates. We find that naïve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type exhibits higher degree of chimerism and is able to generate differentiated progenies in post-implantation pig embryos. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Chimeric Filoviruses for Identification and Characterization of Monoclonal Antibodies.
Ilinykh, Philipp A; Shen, Xiaoli; Flyak, Andrew I; Kuzmina, Natalia; Ksiazek, Thomas G; Crowe, James E; Bukreyev, Alexander
2016-04-01
Recent experiments suggest that some glycoprotein (GP)-specific monoclonal antibodies (MAbs) can protect experimental animals against the filovirus Ebola virus (EBOV). There is a need for isolation of MAbs capable of neutralizing multiple filoviruses. Antibody neutralization assays for filoviruses frequently use surrogate systems such as the rhabdovirus vesicular stomatitis Indiana virus (VSV), lentiviruses or gammaretroviruses with their envelope proteins replaced with EBOV GP or pseudotyped with EBOV GP. It is optimal for both screening and in-depth characterization of newly identified neutralizing MAbs to generate recombinant filoviruses that express a reporter fluorescent protein in order to more easily monitor and quantify the infection. Our study showed that unlike neutralization-sensitive chimeric VSV, authentic filoviruses are highly resistant to neutralization by MAbs. We used reverse genetics techniques to replace EBOV GP with its counterpart from the heterologous filoviruses Bundibugyo virus (BDBV), Sudan virus, and even Marburg virus and Lloviu virus, which belong to the heterologous genera in the filovirus family. This work resulted in generation of multiple chimeric filoviruses, demonstrating the ability of filoviruses to tolerate swapping of the envelope protein. The sensitivity of chimeric filoviruses to neutralizing MAbs was similar to that of authentic biologically derived filoviruses with the same GP. Moreover, disabling the expression of the secreted GP (sGP) resulted in an increased susceptibility of an engineered virus to the BDBV52 MAb isolated from a BDBV survivor, suggesting a role for sGP in evasion of antibody neutralization in the context of a human filovirus infection. The study demonstrated that chimeric rhabdoviruses in which G protein is replaced with filovirus GP, widely used as surrogate targets for characterization of filovirus neutralizing antibodies, do not accurately predict the ability of antibodies to neutralize authentic
-
Chimeric Filoviruses for Identification and Characterization of Monoclonal Antibodies
Ilinykh, Philipp A.; Shen, Xiaoli; Flyak, Andrew I.; Kuzmina, Natalia; Ksiazek, Thomas G.; Crowe, James E.
2016-01-01
ABSTRACT Recent experiments suggest that some glycoprotein (GP)-specific monoclonal antibodies (MAbs) can protect experimental animals against the filovirus Ebola virus (EBOV). There is a need for isolation of MAbs capable of neutralizing multiple filoviruses. Antibody neutralization assays for filoviruses frequently use surrogate systems such as the rhabdovirus vesicular stomatitis Indiana virus (VSV), lentiviruses or gammaretroviruses with their envelope proteins replaced with EBOV GP or pseudotyped with EBOV GP. It is optimal for both screening and in-depth characterization of newly identified neutralizing MAbs to generate recombinant filoviruses that express a reporter fluorescent protein in order to more easily monitor and quantify the infection. Our study showed that unlike neutralization-sensitive chimeric VSV, authentic filoviruses are highly resistant to neutralization by MAbs. We used reverse genetics techniques to replace EBOV GP with its counterpart from the heterologous filoviruses Bundibugyo virus (BDBV), Sudan virus, and even Marburg virus and Lloviu virus, which belong to the heterologous genera in the filovirus family. This work resulted in generation of multiple chimeric filoviruses, demonstrating the ability of filoviruses to tolerate swapping of the envelope protein. The sensitivity of chimeric filoviruses to neutralizing MAbs was similar to that of authentic biologically derived filoviruses with the same GP. Moreover, disabling the expression of the secreted GP (sGP) resulted in an increased susceptibility of an engineered virus to the BDBV52 MAb isolated from a BDBV survivor, suggesting a role for sGP in evasion of antibody neutralization in the context of a human filovirus infection. IMPORTANCE The study demonstrated that chimeric rhabdoviruses in which G protein is replaced with filovirus GP, widely used as surrogate targets for characterization of filovirus neutralizing antibodies, do not accurately predict the ability of antibodies to
-
Abe, Jun; Tomigahara, Yoshitaka; Tarui, Hirokazu; Omori, Rie; Kawamura, Satoshi
2018-02-28
A metabolite of procymidone, hydroxylated-PCM, causes rat-specific developmental toxicity due to higher exposure to it in rats than in rabbits or monkeys. When procymidone was administered to chimeric mice with rat or human hepatocytes, the plasma level of hydroxylated-PCM was higher than that of procymidone in rat chimeric mice, and the metabolic profile of procymidone in intact rats was well reproduced in rat chimeric mice. In human chimeric mice, the plasma level of hydroxylated-PCM was less, resulting in a much lower exposure. The main excretion route of hydroxylated-PCM-glucuronide was bile (the point that hydroxylated-PCM enters the enterohepatic circulation) in rat chimeric mice, and urine in human chimeric mice. These data suggest that humans, in contrast to rats, extensively form the glucuronide and excrete it in urine, as do rabbits and monkeys. Overall, procymidone's potential for causing teratogenicity in humans must be low compared to that in rats.
-
The impact of chimerism in DNA-based forensic sex determination analysis.
George, Renjith; Donald, Preethy Mary; Nagraj, Sumanth Kumbargere; Idiculla, Jose Joy; Hj Ismail, Rashid
2013-01-01
Sex determination is the most important step in personal identification in forensic investigations. DNA-based sex determination analysis is comparatively more reliable than the other conventional methods of sex determination analysis. Advanced technology like real-time polymerase chain reaction (PCR) offers accurate and reproducible results and is at the level of legal acceptance. But still there are situations like chimerism where an individual possess both male and female specific factors together in their body. Sex determination analysis in such cases can give erroneous results. This paper discusses the phenomenon of chimerism and its impact on sex determination analysis in forensic investigations.
-
Ashizuka, Shuichi; Peranteau, William H; Hayashi, Satoshi; Flake, Alan W
2006-03-01
In utero hematopoietic cell transplantation (IUHCT) is a non-ablative approach that achieves mixed allogeneic chimerism and donor-specific tolerance. However, clinical application of IUHCT has been limited by minimal engraftment. We have previously demonstrated in the murine model that low-level allogeneic chimerism achieved by IUHCT can be enhanced to near-complete donor chimerism by postnatal minimally myeloablative total body irradiation (TBI) followed by same-donor bone marrow transplantation. Because of concerns of toxicity related to even low-dose TBI in early life, we wondered if a potentially less toxic strategy utilizing a single myelosuppressive agent, Busulfan (BU), would provide similar enhancement of engraftment. In this study, mixed chimerism was created by IUHCT in a fully allogeneic strain combination. After birth, chimeric mice were conditioned with BU followed by transplantation of bone marrow cells congenic to the prenatal donor. We demonstrate that: 1) low-level chimerism after IUHCT can be converted to high-level chimerism by this protocol; 2) enhancement of chimerism is BU dose-dependent; and 3) BU reduces the proliferative potential of hematopoietic progenitor cells thus conferring a competitive advantage to the non-BU-treated postnatal donor cells. This study confirms the potential of IUHCT for facilitation of minimally toxic postnatal regimens to achieve therapeutic levels of allogeneic engraftment.
-
Kitamura, Shigeyuki; Sugihara, Kazumi
2014-01-01
1. Human-chimeric mice with humanized liver have been constructed by transplantation of human hepatocytes into several types of mice having genetic modifications that injure endogenous liver cells. Here, we focus on liver urokinase-type plasminogen activator-transgenic severe combined immunodeficiency (uPA/SCID) mice, which are the most widely used human-chimeric mice. Studies so far indicate that drug metabolism, drug transport, pharmacological effects and toxicological action in these mice are broadly similar to those in humans. 2. Expression of various drug-metabolizing enzymes is known to be different between humans and rodents. However, the expression pattern of cytochrome P450, aldehyde oxidase and phase II enzymes in the liver of human-chimeric mice resembles that in humans, not that in the host mice. 3. Metabolism of various drugs, including S-warfarin, zaleplon, ibuprofen, naproxen, coumarin, troglitazone and midazolam, in human-chimeric mice is mediated by human drug-metabolizing enzymes, not by host mouse enzymes, and thus resembles that in humans. 4. Pharmacological and toxicological effects of various drugs in human-chimeric mice are also similar to those in humans. 5. The current consensus is that chimeric mice with humanized liver are useful to predict drug metabolism catalyzed by cytochrome P450, aldehyde oxidase and phase II enzymes in humans in vivo and in vitro. Some remaining issues are discussed in this review.
-
Alphaviral equine encephalomyelitis (Eastern, Western and Venezuelan).
Aréchiga-Ceballos, N; Aguilar-Setién, A
2015-08-01
Summary Alphaviral equine encephalomyelitis is a mosquito-borne infection that causes severe neurological disease and fatalities in horses and humans in the Americas. Consequently, the equine alphaviruses (Eastern, Western and Venezuelan) are of considerable concern worldwide and are notifiable to the World Organisation for Animal Health. In addition, these diseases are considered a potent potential biological weapon, emphasising the need to develop an effective vaccine. Alphaviral equine encephalomyelitis is caused by Eastern equine encephalomyelitis virus (EEEV), Western equine encephalomyelitis virus (WEEV) or Venezuelan equine encephalomyelitis virus (VEEV), which are related members of the Alphavirus genus in the Togaviridae family. Although related, the three viruses are genetically and antigenically distinct. The disease is characterised by fever, anorexia, depression and clinical signs of encephalomyelitis, and may be fatal in up to 90% of cases, for both humans and horses, particularly in the case of EEE. Surviving horses develop lifelong immunity but may have permanent neuropathology. The aim of this paper is to analyse the scientific information available on the evolution of EEE, WEE and VEE, and any potential vaccines.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamshchikov, Vladimir, E-mail: yaximik@gmail.com
ABSTRACT: For the development of a human West Nile (WN) infectious DNA (iDNA) vaccine, we created highly attenuated chimeric virus W1806 with the serological identity of highly virulent WN-NY99. Earlier, we attempted to utilize mutations found in the E protein of the SA14-14-2 vaccine to bring safety of W1806 to the level acceptable for human use (). Here, we analyzed effects of the SA14-14-2 changes on growth properties and neurovirulence of W1806. A set including the E138K, K279M, K439R and G447D changes was identified as the perspective subset for satisfying the target safety profile without compromising immunogenicity of the vaccinemore » candidate. The genetic stability of the attenuated phenotype was found to be unsatisfactory being dependent on a subset of attenuating changes incorporated in W1806. Elucidation of underlying mechanisms influencing selection of pathways for restoration of the envelope protein functionality will facilitate resolution of the emerged genetic stability issue. - Highlights: •Effect of mutations in E on properties of WN1806 is determined. •A subset of attenuating mutations suitable for a human vaccine is defined. •Mechanism of attenuation is proposed and illustrated. •Underlying mechanisms of neurovirulence reversion are suggested.« less
-
Fouts, Timothy R; Bagley, Kenneth; Prado, Ilia J; Bobb, Kathryn L; Schwartz, Jennifer A; Xu, Rong; Zagursky, Robert J; Egan, Michael A; Eldridge, John H; LaBranche, Celia C; Montefiori, David C; Le Buanec, Hélène; Zagury, Daniel; Pal, Ranajit; Pavlakis, George N; Felber, Barbara K; Franchini, Genoveffa; Gordon, Shari; Vaccari, Monica; Lewis, George K; DeVico, Anthony L; Gallo, Robert C
2015-03-03
A guiding principle for HIV vaccine design has been that cellular and humoral immunity work together to provide the strongest degree of efficacy. However, three efficacy trials of Ad5-vectored HIV vaccines showed no protection. Transmission was increased in two of the trials, suggesting that this vaccine strategy elicited CD4+ T-cell responses that provide more targets for infection, attenuating protection or increasing transmission. The degree to which this problem extends to other HIV vaccine candidates is not known. Here, we show that a gp120-CD4 chimeric subunit protein vaccine (full-length single chain) elicits heterologous protection against simian-human immunodeficiency virus (SHIV) or simian immunodeficiency virus (SIV) acquisition in three independent rhesus macaque repeated low-dose rectal challenge studies with SHIV162P3 or SIVmac251. Protection against acquisition was observed with multiple formulations and challenges. In each study, protection correlated with antibody-dependent cellular cytotoxicity specific for CD4-induced epitopes, provided that the concurrent antivaccine T-cell responses were minimal. Protection was lost in instances when T-cell responses were high or when the requisite antibody titers had declined. Our studies suggest that balance between a protective antibody response and antigen-specific T-cell activation is the critical element to vaccine-mediated protection against HIV. Achieving and sustaining such a balance, while enhancing antibody durability, is the major challenge for HIV vaccine development, regardless of the immunogen or vaccine formulation.
-
Fouts, Timothy R.; Bagley, Kenneth; Prado, Ilia J.; Bobb, Kathryn L.; Schwartz, Jennifer A.; Xu, Rong; Zagursky, Robert J.; Egan, Michael A.; Eldridge, John H.; LaBranche, Celia C.; Montefiori, David C.; Le Buanec, Hélène; Zagury, Daniel; Pal, Ranajit; Pavlakis, George N.; Felber, Barbara K.; Franchini, Genoveffa; Gordon, Shari; Vaccari, Monica; Lewis, George K.; DeVico, Anthony L.; Gallo, Robert C.
2015-01-01
A guiding principle for HIV vaccine design has been that cellular and humoral immunity work together to provide the strongest degree of efficacy. However, three efficacy trials of Ad5-vectored HIV vaccines showed no protection. Transmission was increased in two of the trials, suggesting that this vaccine strategy elicited CD4+ T-cell responses that provide more targets for infection, attenuating protection or increasing transmission. The degree to which this problem extends to other HIV vaccine candidates is not known. Here, we show that a gp120-CD4 chimeric subunit protein vaccine (full-length single chain) elicits heterologous protection against simian-human immunodeficiency virus (SHIV) or simian immunodeficiency virus (SIV) acquisition in three independent rhesus macaque repeated low-dose rectal challenge studies with SHIV162P3 or SIVmac251. Protection against acquisition was observed with multiple formulations and challenges. In each study, protection correlated with antibody-dependent cellular cytotoxicity specific for CD4-induced epitopes, provided that the concurrent antivaccine T-cell responses were minimal. Protection was lost in instances when T-cell responses were high or when the requisite antibody titers had declined. Our studies suggest that balance between a protective antibody response and antigen-specific T-cell activation is the critical element to vaccine-mediated protection against HIV. Achieving and sustaining such a balance, while enhancing antibody durability, is the major challenge for HIV vaccine development, regardless of the immunogen or vaccine formulation. PMID:25681373
-
[Immune response in cervical cancer. Strategies for the development of therapeutic vaccines].
Mora-García, María Lourdes; Monroy-García, Alberto
2015-01-01
High-risk human papillomaviruses (HR-HPV), as HPV-16, evade immune recognition through the inactivation of cells of the innate immune response. HPV-16 E6 and E7 genes down-regulate type I interferon response. They do not produce viremia or cell death; therefore, they do not cause inflammation or damage signal that alerts the immune system. Virus-like particles (VLPs), consisting of structural proteins (L1 and L2) of the main HR-HPV types that infect the genitourinary tract, are the most effective prophylactic vaccines against HR-HPV infection. While for the high grade neoplastic lesions, therapeutic vaccines based on viral vectors, peptides, DNA or complete HR-HPV E6 and E7 proteins as antigens, have had limited effectiveness. Chimeric virus-like particles (cVLPs) that carry immunogenic peptides derived from E6 and E7 viral proteins, capable to induce activation of specific cytotoxic T lymphocytes, emerge as an important alternative to provide prophylactic and therapeutic activity against HR-HPV infection and cervical cancer.
-
Engineered Chimeric Peptides as Antimicrobial Surface Coating Agents toward Infection-Free Implants
Yazici, Hilal; O'Neill, Mary B.; Kacar, Turgay; Wilson, Brandon R.; Oren, E. Emre; Sarikaya, Mehmet; Tamerler, Candan
2016-01-01
Prevention of bacterial colonization and consequent biofilm formation remains a major challenge in implantable medical devices. Implant-associated infections are not only a major cause of implant failures but also their conventional treatment with antibiotics brings further complications due to the escalation in multidrug resistance to a variety of bacterial species. Owing to their unique properties, antimicrobial peptides (AMPs) have gained significant attention as effective agents to combat colonization of microorganisms. These peptides have been shown to exhibit a wide spectrum of activities with specificity to a target cell while having a low tendency for developing bacterial resistance. Engineering biomaterial surfaces that feature AMP properties, therefore, offer a promising approach to prevent implant infections. Here, we engineered a chimeric peptide with bifunctionality that both forms a robust solid-surface coating while presenting antimicrobial property. The individual domains of the chimeric peptides were evaluated for their solid-binding kinetics to titanium substrate as well as for their antimicrobial properties in solution. The antimicrobial efficacy of the chimeric peptide on the implant material was evaluated in vitro against infection by a variety of bacteria, including Streptococcus mutans, Staphylococcus. epidermidis, and Escherichia coli, which are commonly found in oral and orthopedic implant related surgeries. Our results demonstrate significant improvement in reducing bacterial colonization onto titanium surfaces below the detectable limit. Engineered chimeric peptides with freely displayed antimicrobial domains could be a potential solution for developing infection-free surfaces by engineering implant interfaces with highly reduced bacterial colonization property. PMID:26795060
-
Engineered Chimeric Peptides as Antimicrobial Surface Coating Agents toward Infection-Free Implants.
Yazici, Hilal; O'Neill, Mary B; Kacar, Turgay; Wilson, Brandon R; Oren, E Emre; Sarikaya, Mehmet; Tamerler, Candan
2016-03-02
Prevention of bacterial colonization and consequent biofilm formation remains a major challenge in implantable medical devices. Implant-associated infections are not only a major cause of implant failures but also their conventional treatment with antibiotics brings further complications due to the escalation in multidrug resistance to a variety of bacterial species. Owing to their unique properties, antimicrobial peptides (AMPs) have gained significant attention as effective agents to combat colonization of microorganisms. These peptides have been shown to exhibit a wide spectrum of activities with specificity to a target cell while having a low tendency for developing bacterial resistance. Engineering biomaterial surfaces that feature AMP properties, therefore, offer a promising approach to prevent implant infections. Here, we engineered a chimeric peptide with bifunctionality that both forms a robust solid-surface coating while presenting antimicrobial property. The individual domains of the chimeric peptides were evaluated for their solid-binding kinetics to titanium substrate as well as for their antimicrobial properties in solution. The antimicrobial efficacy of the chimeric peptide on the implant material was evaluated in vitro against infection by a variety of bacteria, including Streptococcus mutans, Staphylococcus. epidermidis, and Escherichia coli, which are commonly found in oral and orthopedic implant related surgeries. Our results demonstrate significant improvement in reducing bacterial colonization onto titanium surfaces below the detectable limit. Engineered chimeric peptides with freely displayed antimicrobial domains could be a potential solution for developing infection-free surfaces by engineering implant interfaces with highly reduced bacterial colonization property.
-
USDA-ARS?s Scientific Manuscript database
The development of a spider silk manufacturing process is of great interest. piggyBac vectors were used to create transgenic silkworms encoding chimeric silkworm/spider silk proteins. The silk fibers produced by these animals were composite materials that included chimeric silkworm/spider silk prote...
-
Santurtún, Ana; Riancho, José A; Arozamena, Jana; López-Duarte, Mónica; Zarrabeitia, María T
2017-01-01
Several methods have been developed to determinate genetic profiles from a mixed samples and chimerism analysis in transplanted patients. The aim of this study was to explore the effectiveness of using the droplet digital PCR (ddPCR) for mixed chimerism detection (a mixture of genetic profiles resulting after allogeneic hematopoietic stem cell transplantation (HSCT)). We analyzed 25 DNA samples from patients who had undergone HSCT and compared the performance of ddPCR and two established methods for chimerism detection, based upon the Indel and STRs analysis, respectively. Additionally, eight artificial mixture DNA samples were created to evaluate the sensibility of ddPCR. Our results show that the chimerism percentages estimated by the analysis of a single Indel using ddPCR were very similar to those calculated by the amplification of 15 STRs (r 2 = 0.970) and with the results obtained by the amplification of 38 Indels (r 2 = 0.975). Moreover, the amplification of a single Indel by ddPCR was sensitive enough to detect a minor DNA contributor comprising down to 0.5 % of the sample. We conclude that ddPCR can be a powerful tool for the determination of a genetic profile of forensic mixtures and clinical chimerism analysis when traditional techniques are not sensitive enough.
-
Han, Kai; Zhang, Wei-Yun; Ma, Zhao-Yu; Wang, Shi-Bo; Xu, Lu-Ming; Liu, Jia; Zhang, Xian-Zheng; Han, He-You
2017-05-17
Photodynamic therapy (PDT) holds great promise in tumor treatment. Nevertheless, it remains highly desirable to develop easy-to-fabricated PDT systems with improved tumor accumulation/internalization and timely therapeutic feedback. Here, we report a tumor-acidity-responsive chimeric peptide for enhanced PDT and noninvasive real-time apoptosis imaging. Both in vitro and in vivo studies revealed that a tumor mildly acidic microenvironment could trigger rapid protonation of carboxylate anions in chimeric peptide, which led to increased ζ potential, improved hydrophobicity, controlled size enlargement, and precise morphology switching from sphere to spherocylinder shape of the chimeric peptide. All of these factors realized superfast accumulation and prolonged retention in the tumor region, selective cellular internalization, and enhanced PDT against the tumor. Meanwhile, this chimeric peptide could further generate reactive oxygen species and initiate cell apoptosis during PDT. The subsequent formation of caspase-3 enzyme hydrolyzed the chimeric peptide, achieving a high signal/noise ratio and timely fluorescence feedback. Importantly, direct utilization of the acidity responsiveness of a biofunctional Asp-Glu-Val-Asp-Gly (DEVDG, caspase-3 enzyme substrate) peptide sequence dramatically simplified the preparation and increased the performance of the chimeric peptide furthest.
-
Patterson, Michael; Poussard, Allison; Taylor, Katherine; Seregin, Alexey; Smith, Jeanon; Peng, Bi-Hung; Walker, Aida; Linde, Jenna; Smith, Jennifer; Salazar, Milagros; Paessler, Slobodan
2011-11-21
Rapid and accurate identification of disease progression are key factors in testing novel vaccines and antivirals against encephalitic alphaviruses. Typical efficacy studies utilize a large number of animals and severe morbidity or mortality as an endpoint. New technologies provide a means to reduce and refine the animal use as proposed in Hume's 3Rs (replacement, reduction, refinement) described by Russel and Burch. In vivo imaging systems (IVIS) and bioluminescent enzyme technologies accomplish the reduction of animal requirements while shortening the experimental time and improving the accuracy in localizing active virus replication. In the case of murine models of viral encephalitis in which central nervous system (CNS) viral invasion occurs rapidly but the disease development is relatively slow, we visualized the initial brain infection and enhance the data collection process required for efficacy studies on antivirals or vaccines that are aimed at preventing brain infection. Accordingly, we infected mice through intranasal inoculation with the genetically modified pathogen, Venezuelan equine encephalitis, which expresses a luciferase gene. In this study, we were able to identify the invasion of the CNS at least 3 days before any clinical signs of disease, allowing for reduction of animal morbidity providing a humane means of disease and vaccine research while obtaining scientific data accurately and more rapidly. Based on our data from the imaging model, we confirmed the usefulness of this technology in preclinical research by demonstrating the efficacy of Ampligen, a TLR-3 agonist, in preventing CNS invasion. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Chimeric microbial rhodopsins for optical activation of Gs-proteins
Yoshida, Kazuho; Yamashita, Takahiro; Sasaki, Kengo; Inoue, Keiichi; Shichida, Yoshinori; Kandori, Hideki
2017-01-01
We previously showed that the chimeric proteins of microbial rhodopsins, such as light-driven proton pump bacteriorhodopsin (BR) and Gloeobacter rhodopsin (GR) that contain cytoplasmic loops of bovine rhodopsin, are able to activate Gt protein upon light absorption. These facts suggest similar protein structural changes in both the light-driven proton pump and animal rhodopsin. Here we report two trials to engineer chimeric rhodopsins, one for the inserted loop, and another for the microbial rhodopsin template. For the former, we successfully activated Gs protein by light through the incorporation of the cytoplasmic loop of β2-adrenergic receptor (β2AR). For the latter, we did not observe any G-protein activation for the light-driven sodium pump from Indibacter alkaliphilus (IndiR2) or a light-driven chloride pump halorhodopsin from Natronomonas pharaonis (NpHR), whereas the light-driven proton pump GR showed light-dependent G-protein activation. This fact suggests that a helix opening motion is common to G protein coupled receptor (GPCR) and GR, but not to IndiR2 and NpHR. Light-induced difference FTIR spectroscopy revealed similar structural changes between WT and the third loop chimera for each light-driven pump. A helical structural perturbation, which was largest for GR, was further enhanced in the chimera. We conclude that similar structural dynamics that occur on the cytoplasmic side of GPCR are needed to design chimeric microbial rhodopsins. PMID:29362703
-
NASA Astrophysics Data System (ADS)
Yucesoy, Deniz T.; Hnilova, Marketa; Boone, Kyle; Arnold, Paul M.; Snead, Malcolm L.; Tamerler, Candan
2015-04-01
Implant-associated infections can have severe effects on the longevity of implant devices and they also represent a major cause of implant failures. Treating these infections associated with implants by antibiotics is not always an effective strategy due to poor penetration rates of antibiotics into biofilms. Additionally, emerging antibiotic resistance poses serious concerns. There is an urge to develop effective antibacterial surfaces that prevent bacterial adhesion and proliferation. A novel class of bacterial therapeutic agents, known as antimicrobial peptides (AMPs), are receiving increasing attention as an unconventional option to treat septic infection, partly due to their capacity to stimulate innate immune responses and for the difficulty of microorganisms to develop resistance towards them. While host and bacterial cells compete in determining the ultimate fate of the implant, functionalization of implant surfaces with AMPs can shift the balance and prevent implant infections. In the present study, we developed a novel chimeric peptide to functionalize the implant material surface. The chimeric peptide simultaneously presents two functionalities, with one domain binding to a titanium alloy implant surface through a titanium-binding domain while the other domain displays an antimicrobial property. This approach gains strength through control over the bio-material interfaces, a property built upon molecular recognition and self-assembly through a titanium alloy binding domain in the chimeric peptide. The efficiency of chimeric peptide both in-solution and absorbed onto titanium alloy surface was evaluated in vitro against three common human host infectious bacteria, Streptococcus mutans, Staphylococcus epidermidis, and Escherichia coli. In biological interactions such as occur on implants, it is the surface and the interface that dictate the ultimate outcome. Controlling the implant surface by creating an interface composed chimeric peptides may therefore
-
Yucesoy, Deniz T; Hnilova, Marketa; Boone, Kyle; Arnold, Paul M; Snead, Malcolm L; Tamerler, Candan
2015-04-01
Implant-associated infections can have severe effects on the longevity of implant devices and they also represent a major cause of implant failures. Treating these infections associated with implants by antibiotics is not always an effective strategy due to poor penetration rates of antibiotics into biofilms. Additionally, emerging antibiotic resistance poses serious concerns. There is an urge to develop effective antibacterial surfaces that prevent bacterial adhesion and proliferation. A novel class of bacterial therapeutic agents, known as antimicrobial peptides (AMP's), are receiving increasing attention as an unconventional option to treat septic infection, partly due to their capacity to stimulate innate immune responses and for the difficulty of microorganisms to develop resistance towards them. While host- and bacterial- cells compete in determining the ultimate fate of the implant, functionalization of implant surfaces with antimicrobial peptides can shift the balance and prevent implant infections. In the present study, we developed a novel chimeric peptide to functionalize the implant material surface. The chimeric peptide simultaneously presents two functionalities, with one domain binding to a titanium alloy implant surface through a titanium-binding domain while the other domain displays an antimicrobial property. This approach gains strength through control over the bio-material interfaces, a property built upon molecular recognition and self-assembly through a titanium alloy binding domain in the chimeric peptide. The efficiency of chimeric peptide both in-solution and absorbed onto titanium alloy surface was evaluated in vitro against three common human host infectious bacteria, S. mutans, S. epidermidis , and E. coli . In biological interactions such as occurs on implants, it is the surface and the interface that dictate the ultimate outcome. Controlling the implant surface by creating an interface composed chimeric peptides may therefore open up
-
Junghanss, Christian; Takatu, Alessandra; Little, Marie-Terese; Maciej Zaucha, J; Zellmer, Eustacia; Yunusov, Murad; Sale, George; Georges, George E; Storb, Rainer
2003-02-15
Stable mixed-donor-host-hematopoietic chimerism can serve as a platform for adoptive immunotherapy. Infusions of donor lymphocytes (DLI) sensitized against hematopoietic cells converted mixed hematopoietic into full-donor chimerism in dog-leukocyte antigen (DLA)-identical littermates. Whether sensitization against tissue of solid organs leads to organ-specific immunity that can be transferred by DLI was unknown and was investigated in these experiments using the kidney as target. DLA-identical recipients with established stable mixed-donor-host-hematopoietic chimerism were used. In five pairs, hematopoietic stem-cell transplant (HSCT) donors were sensitized by kidney transplantation from the respective chimeras. In a second group, five HSCT donors received vaccinations that were generated from kidney cells of the respective mixed chimeras. Twenty-eight days after sensitization, DLI were administered to the mixed-hematopoietic chimeras. All HSCT donors rejected their kidney grafts from their mixed-chimeric recipients within 22 to 45 days. DLI caused no sustained graft-versus-kidney effects in the mixed-chimeric recipients. However, DLI donors sensitized by kidney transplantation converted 4 of 5 mixed chimeras into virtually complete (>95%) donor-type chimeras, compared with 1 of 5 mixed chimeras given DLI by vaccination from sensitized donors. Although DLA-identical kidney grafts from mixed-hematopoietic chimeras were readily rejected by their HSCT donors, subsequent transfusions of sensitized-donor lymphocytes into mixed chimeras converted mixed to all-donor chimerism but failed to induce graft-versus-kidney effects. Vaccination strategies in lieu of kidney grafts failed to convert mixed chimerism.
-
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
-
Bredell, Helba; Smith, Jacques J; Görgens, Johann F; van Zyl, Willem H
2018-04-30
Cervical cancer is ranked the fourth most common cancer in women worldwide. Despite two commercially available prophylactic vaccines, it is unaffordable for most women in developing countries. We compared the optimized expression of monomers of the unique HPV type 16 L1-L2 chimeric protein (SAF) in two yeast strains of Pichia pastoris, KM71 (Mut s ) and GS115 (Mut + ), with Hansenula polymorpha NCYC 495 to determine the preferred host in bioreactors. SAF was uniquely created by replacing the h4 helix of the HPV-16 capsid L1 protein with a L2 peptide. Two different feeding strategies in fed-batch cultures of P. pastoris Mut s were evaluated: a predetermined feed rate versus feeding based on the oxygen consumption by maintaining constant dissolved oxygen levels (DO stat). All cultures showed a significant increase in biomass when methanol was fed using the DO stat method. In P. pastoris the SAF concentrations were higher in the Mut s strains than in the Mut + strains. However, H. polymorpha produced the highest level of SAF at 132.10 mg.L -1 culture while P. pastoris Mut s only produced 23.61 mg.L -1 . H. polymorpha showed greater potential for the expression of HPV-16 L1/L2 chimeric proteins despite the track record of P. pastoris as a high level producer of heterologous proteins. This article is protected by copyright. All rights reserved.
-
Roberts, Carla; Kean, Leslie; Archer, David; Balkan, Can; Hsu, Lewis L
2005-01-01
Stable mixed chimeric stem cell transplantation in hemoglobinopathies exploits shorter erythroid survival in hemolytic anemias, providing normal donor red blood cells with a competitive survival advantage. This study examined the level of stable mixed chimerism necessary for complete hematological cure of the thalassemic phenotype, using a nonmyeloablative busulfan chemotherapeutic preparation. Thalassemic mice transplanted from congenic wild-type donors developed partial mixed chimerism. Hematologic cure required >80% donor red blood cells and only >13% donor white blood cells. Murine and human transplant results were compared with a math model for survival advantage of donor peripheral blood cells produced by steady-state chimeric marrow.
-
Ray Owen and the history of naturally acquired chimerism
Martin, Aryn
2015-01-01
abstract This article interweaves a history of Ray Owen's early work with a broader account of the conceptual landscape of immunology in the mid 1950's. In particular, Owen's openness to the very possibility of chimeric phenomena is recognized. PMID:27093621
-
Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease.
Irion, Camila Iansen; Paredes, Bruno Diaz; Brasil, Guilherme Visconde; Cunha, Sandro Torrentes da; Paula, Luis Felipe; Carvalho, Alysson Roncally; Carvalho, Antonio Carlos Campos de; Carvalho, Adriana Bastos; Goldenberg, Regina Coeli Dos Santos
2017-08-01
Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. To obtain chimerical mice, wild-type (WT) C57BL6 mice were exposed to full body irradiation (7 Gy), causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP)-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i) infected chimeric (iChim) mice; (ii) infected WT (iWT) mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii) non-infected chimeric (Chim) mice; and (iv) non-infected WT mice. At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice.
-
Ebrahimi, Firouz; Rasaee, Mohammad Javad; Mousavi, Seyed Latif; Babaeipour, Valiollah
2010-02-01
Botulinum neurotoxins (BoNTs) are potent toxicant proteins composed of a heavy chain (100 kDa) and a light chain (50 kDa) of seven (A-G) serotypes that is responsible for botulism syndrome. In this study, polypeptides from C-terminal heavy chain of BoNTs serotypes A, B and E to the length of 54, 45 and 48 amino acid respectively were selected, linked together using a hydrophobic linker and expressed in E. coli. The expression efficiency of the chimeric protein was found to be 51%. The chimeric protein was produced in the form of inclusion body (IB) both at two studied temperatures, 30 degrees C and 37 degrees C. This IB was extracted by ultracentrifugation and followed for chimeric protein solubilization and purification using of ultrafiltration and preparative electrophoresis. The purified chimeric protein was characterized using blotting and ELISA. To evaluate the protection ability of this chimeric antigen against their active toxins, it was injected to mice and the antibody titer as well as the extent of protectivity were determined. Mice given three injections (10 microg/mice) of the antigen were protected against an intra-peritoneal administration of 10 LD(50 )of serotypes A and E, but 100 LD(50) of serotype B. We conclude that a significant correlation exists between the antigenic characteristics and protection capability of the chimeric protein prepared in this study.
-
Gorohovski, Alessandro; Tagore, Somnath; Palande, Vikrant; Malka, Assaf; Raviv-Shay, Dorith; Frenkel-Morgenstern, Milana
2017-01-04
Discovery of chimeric RNAs, which are produced by chromosomal translocations as well as the joining of exons from different genes by trans-splicing, has added a new level of complexity to our study and understanding of the transcriptome. The enhanced ChiTaRS-3.1 database (http://chitars.md.biu.ac.il) is designed to make widely accessible a wealth of mined data on chimeric RNAs, with easy-to-use analytical tools built-in. The database comprises 34 922: chimeric transcripts along with 11 714: cancer breakpoints. In this latest version, we have included multiple cross-references to GeneCards, iHop, PubMed, NCBI, Ensembl, OMIM, RefSeq and the Mitelman collection for every entry in the 'Full Collection'. In addition, for every chimera, we have added a predicted Chimeric Protein-Protein Interaction (ChiPPI) network, which allows for easy visualization of protein partners of both parental and fusion proteins for all human chimeras. The database contains a comprehensive annotation for 34 922: chimeric transcripts from eight organisms, and includes the manual annotation of 200 sense-antiSense (SaS) chimeras. The current improvements in the content and functionality to the ChiTaRS database make it a central resource for the study of chimeric transcripts and fusion proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Risk groups for yellow fever vaccine-associated viscerotropic disease (YEL-AVD).
Seligman, Stephen J
2014-10-07
Although previously considered as the safest of the live virus vaccines, reports published since 2001 indicate that live yellow fever virus vaccine can cause a severe, often fatal, multisystemic illness, yellow fever vaccine-associated viscerotropic disease (YEL-AVD), that resembles the disease it was designed to prevent. This review was prompted by the availability of a listing of the cumulative cases of YEL-AVD, insights from a statistical method for analyzing risk factors and re-evaluation of previously published data. The purpose of this review is to identify and analyze risk groups based on gender, age, outcome and predisposing illnesses. Using a passive surveillance system in the US, the incidence was reported as 0.3 to 0.4 cases per 100,000. However, other estimates range from 0 to 12 per 100,000. Identified and potential risk groups for YEL-AVD include elderly males, women between the ages of 19 and 34, people with a variety of autoimmune diseases, individuals who have been thymectomized because of thymoma, and infants and children ≤11 years old. All but the last group are supported by statistical analysis. The confirmed risk groups account for 77% (49/64) of known cases and 76% (32/42) of the deaths. The overall case fatality rate is 66% (42/64) with a rate of 80% (12/15) in young women, in contrast to 50% (13/26) in men ≥56 years old. Recognition of YEL-AVD raises the possibility that similar reactions to live chimeric flavivirus vaccines that contain a yellow fever virus vaccine backbone could occur in susceptible individuals. Delineation of risk groups focuses the search for genetic mutations resulting in immune defects associated with a given risk group. Lastly, identification of risk groups encourages concentration on measures to decrease both the incidence and the severity of YEL-AVD. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Kim, Shin-Hee; Xiao, Sa; Collins, Peter L; Samal, Siba K
2016-06-01
The cleavage site sequence of the fusion (F) protein contributes to a wide range of virulence of Newcastle disease virus (NDV). In this study, we identified other important amino acid sequences of the F protein that affect cleavage and modulation of fusion. We generated chimeric Beaudette C (BC) viruses containing the cleavage site sequence of avirulent strain LaSota (Las-Fc) together with various regions of the F protein of another virulent strain AKO. We found that the F1 subunit is important for cleavage inhibition. Further dissection of the F1 subunit showed that replacement of four amino acids in the BC/Las-Fc protein with their AKO counterparts (T341S, M384I, T385A and I386L) resulted in an increase in fusion and replication in vitro. In contrast, the mutation N403D greatly reduced cleavage and viral replication, and affected protein conformation. These findings will be useful in developing improved live NDV vaccines and vaccine vectors.
-
Venturing in coral larval chimerism: a compact functional domain with fostered genotypic diversity
NASA Astrophysics Data System (ADS)
Rinkevich, Baruch; Shaish, Lee; Douek, Jacob; Ben-Shlomo, Rachel
2016-01-01
The globally distributed coral species Pocillopora damicornis is known to release either sexual or asexual derived planula-larvae in various reef locations. Using microsatellite loci as markers, we documented the release of asexually derived chimeric larvae (CL), originating from mosaicked maternal colonies that were also chimeras, at Thai and Philippines reefs. The CL, each presenting different combinations of maternal genotypic constituents, create genetically-complex sets of asexual propagules. This novel mode of inheritance in corals challenges classical postulations of sexual/asexual reproduction traits, as asexual derived CL represent an alliance between genotypes that significantly sways the recruits’ absolute fitness. This type of inherited chimerism, while enhancing intra-entity genetic heterogeneity, is an evolutionary tactic used to increase genetic-heterogeneity, primarily in new areas colonized by a limited number of larvae. Chimerism may also facilitate combat global change impacts by exhibiting adjustable genomic combinations of within-chimera traits that could withstand alterable environmental pressures, helping Pocillopora become a successful cosmopolitan species.
-
Chen, Chien-Chia; Pouliquen, Eric; Broisat, Alexis; Andreata, Francesco; Racapé, Maud; Bruneval, Patrick; Kessler, Laurence; Ahmadi, Mitra; Bacot, Sandrine; Saison-Delaplace, Carole; Marcaud, Marina; Van Huyen, Jean-Paul Duong; Loupy, Alexandre; Villard, Jean; Demuylder-Mischler, Sandrine; Morelon, Emmanuel; Tsai, Meng-Kun; Kolopp-Sarda, Marie-Nathalie; Koenig, Alice; Mathias, Virginie; Ghezzi, Catherine; Dubois, Valerie; Defrance, Thierry
2017-01-01
Humoral rejection is the most common cause of solid organ transplant failure. Here, we evaluated a cohort of 49 patients who were successfully grafted with allogenic islets and determined that the appearance of donor-specific anti-HLA antibodies (DSAs) did not accelerate the rate of islet graft attrition, suggesting resistance to humoral rejection. Murine DSAs bound to allogeneic targets expressed by islet cells and induced their destruction in vitro; however, passive transfer of the same DSAs did not affect islet graft survival in murine models. Live imaging revealed that DSAs were sequestrated in the circulation of the recipients and failed to reach the endocrine cells of grafted islets. We used murine heart transplantation models to confirm that endothelial cells were the only accessible targets for DSAs, which induced the development of typical microvascular lesions in allogeneic transplants. In contrast, the vasculature of DSA-exposed allogeneic islet grafts was devoid of lesions because sprouting of recipient capillaries reestablished blood flow in grafted islets. Thus, we conclude that endothelial chimerism combined with vascular sequestration of DSAs protects islet grafts from humoral rejection. The reduced immunoglobulin concentrations in the interstitial tissue, confirmed in patients, may have important implications for biotherapies such as vaccines and monoclonal antibodies. PMID:29202467
-
Liu, Chunhai; Khazanehdari, Kamal A; Baskar, Vijaya; Saleem, Shazia; Kinne, Joerg; Wernery, Ulrich; Chang, Il-Kuk
2012-04-01
The present study aimed to investigate the differentiation of chicken (Gallus gallus domesticus) primordial germ cells (PGCs) in duck (Anas domesticus) gonads. Chimeric ducks were produced by transferring chicken PGCs into duck embryos. Transfer of 200 and 400 PGCs resulted in the detection of a total number of 63.0 ± 54.3 and 116.8 ± 47.1 chicken PGCs in the gonads of 7-day-old duck embryos, respectively. The chimeric rate of ducks prior to hatching was 52.9% and 90.9%, respectively. Chicken germ cells were assessed in the gonad of chimeric ducks with chicken-specific DNA probes. Chicken spermatogonia were detected in the seminiferous tubules of duck testis. Chicken oogonia, primitive and primary follicles, and chicken-derived oocytes were also found in the ovaries of chimeric ducks, indicating that chicken PGCs are able to migrate, proliferate, and differentiate in duck ovaries and participate in the progression of duck ovarian folliculogenesis. Chicken DNA was detected using PCR from the semen of chimeric ducks. A total number of 1057 chicken eggs were laid by Barred Rock hens after they were inseminated with chimeric duck semen, of which four chicken offspring hatched and one chicken embryo did not hatch. Female chimeric ducks were inseminated with chicken semen; however, no fertile eggs were obtained. In conclusion, these results demonstrated that chicken PGCs could interact with duck germinal epithelium and complete spermatogenesis and eventually give rise to functional sperm. The PGC-mediated germline chimera technology may provide a novel system for conserving endangered avian species.
-
Chimeric creatures in Greek mythology and reflections in science.
Bazopoulou-Kyrkanidou, E
2001-04-15
"The Chimaera" in Homer's Iliad, "was of divine stock, not of men, in the forepart a lion, in the hinder a serpent, and in the midst a goat, ellipsis Bellerophon slew her, trusting in the signs of the gods." In Hesiod's Theogony it is emphasized that "Chimaera ellipsis had three heads, one of a grim-eyed lion, another of a goat, and another of a snakeellipsis". In addition to this interspecies animal chimera, human/animal chimeras are referred to in Greek mythology, preeminent among them the Centaurs and the Minotaur. The Centaurs, as horse/men, first appear in Geometric and early Archaic art, but in the literature not until early in the fifth century B.C. The bullheaded-man Minotaur, who is not certainly attested in the literary evidence until circa 500 B.C., first appears in art about 650 B.C. Attempts, in the fourth century B.C. and thereafter, to rationalize their mythical appearance were in vain; their chimeric nature retained its fascinating and archetypal form over the centuries. Early in the 1980s, experimental sheep/goat chimeras were produced removing the reproductive barrier between these two animal species. Late in the 1990s, legal, political, ethical, and moral fights loomed over a patent bid on human/animal chimeras. Chimeric technology is recently developed; however, the concept of chimerism has existed in literary and artistic form in ancient mythology. This is yet another example where art and literature precede scientific research and development. Copyright 2001 Wiley-Liss. Inc.
-
Chimeric Antigen Receptor-Redirected T cells return to the bench
Geldres, Claudia; Savoldo, Barbara; Dotti, Gianpietro
2016-01-01
While the clinical progress of chimeric antigen receptor T cell (CAR-T) immunotherapy has garnered attention to the field, our understanding of the biology of these chimeric molecules is still emerging. Our aim within this review is to bring to light the mechanistic understanding of these multi-modular receptors and how these individual components confer particular properties to CAR-Ts. In addition, we will discuss extrinsic factors that can be manipulated to influence CAR-T performance such as choice of cellular population, culturing conditions and additional modifications that enhance their activity particularly in solid tumors. Finally, we will also consider the emerging toxicity associated with CAR-Ts. By breaking apart the CAR and examining the role of each piece, we can build a better functioning cellular vehicle for optimized treatment of cancer patients. PMID:26797495
-
Zhang, Mingfeng; Racine, Jeremy J.; Lin, Qing; Liu, Yuqing; Tang, Shanshan; Qin, Qi; Qi, Tong; Riggs, Arthur D.; Zeng, Defu
2018-01-01
Autoimmune type 1 diabetes (T1D) and other autoimmune diseases are associated with particular MHC haplotypes and expansion of autoreactive T cells. Induction of MHC-mismatched but not -matched mixed chimerism by hematopoietic cell transplantation effectively reverses autoimmunity in diabetic nonobese diabetic (NOD) mice, even those with established diabetes. As expected, MHC-mismatched mixed chimerism mediates deletion in the thymus of host-type autoreactive T cells that have T-cell receptor (TCR) recognizing (cross-reacting with) donor-type antigen presenting cells (APCs), which have come to reside in the thymus. However, how MHC-mismatched mixed chimerism tolerizes host autoreactive T cells that recognize only self-MHC–peptide complexes remains unknown. Here, using NOD.Rag1−/−.BDC2.5 or NOD.Rag1−/−.BDC12-4.1 mice that have only noncross-reactive transgenic autoreactive T cells, we show that induction of MHC-mismatched but not -matched mixed chimerism restores immune tolerance of peripheral noncross-reactive autoreactive T cells. MHC-mismatched mixed chimerism results in increased percentages of both donor- and host-type Foxp3+ Treg cells and up-regulated expression of programmed death-ligand 1 (PD-L1) by host-type plasmacytoid dendritic cells (pDCs). Furthermore, adoptive transfer experiments showed that engraftment of donor-type dendritic cells (DCs) and expansion of donor-type Treg cells are required for tolerizing the noncross-reactive autoreactive T cells in the periphery, which are in association with up-regulation of host-type DC expression of PD-L1 and increased percentage of host-type Treg cells. Thus, induction of MHC-mismatched mixed chimerism may establish a peripheral tolerogenic DC and Treg network that actively tolerizes autoreactive T cells, even those with no TCR recognition of the donor APCs. PMID:29463744
-
Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease
Irion, Camila Iansen; Paredes, Bruno Diaz; Brasil, Guilherme Visconde; da Cunha, Sandro Torrentes; Paula, Luis Felipe; Carvalho, Alysson Roncally; de Carvalho, Antonio Carlos Campos; Carvalho, Adriana Bastos; Goldenberg, Regina Coeli dos Santos
2017-01-01
BACKGROUND Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. OBJECTIVES The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. METHODS To obtain chimerical mice, wild-type (WT) C57BL6 mice were exposed to full body irradiation (7 Gy), causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP)-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i) infected chimeric (iChim) mice; (ii) infected WT (iWT) mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii) non-infected chimeric (Chim) mice; and (iv) non-infected WT mice. FINDINGS At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. MAIN CONCLUSIONS iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice. PMID:28767980
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
-
Linker-based GnRH-PE chimeric proteins inhibit cancer growth in nude mice.
Ben-Yehudah, A; Yarkoni, S; Nechushtan, A; Belostotsky, R; Lorberboum-Galski, H
1999-04-01
Since the number of cancer-related deaths has not decreased in recent years, major efforts are being made to find new drugs for cancer treatment. In this report we introduce the gonadotropin releasing hormone-Pseudomonas exotoxin (GnRH-PE) based chimeric proteins L-GnRH-PE66 and L-GnRH-PE40. These proteins are composed of a GnRH moiety attached to modified forms of Pseudomonas exotoxin via a polylinker (gly4ser)2. The chimeric proteins L-GnRH-PE66 and L-GnRH-PE40 have the ability to target and kill adenocarcinoma cell lines in vitro, whereas non-adenocarcinoma cell lines are not affected. We demonstrate that L-GnRH-PE66 and L-GnRH-PE40 efficiently inhibit cancer growth. Nude mice were injected subcutaneously with the SW-48 adenocarcinoma cell line to produce xenograft tumours. When the tumours were established and visible, the animals were injected with chimeric proteins for 10 days. At the end of this period, a reduction of up to 3-fold in tumor size was obtained in the treated mice, as compared with the control group, which received equivalent amounts of GnRH; the difference was even greater 13 days after termination of treatment. Thus, the chimeric proteins L-GnRH-PE66 and L-GnRH-PE40 are promising candidates for treatment of a variety of adenocarcinomas and their use in humans should be considered.
-
Mannose Binding Lectin Is Required for Alphavirus-Induced Arthritis/Myositis
Whitmore, Alan C.; Blevins, Lance K.; Hueston, Linda; Fraser, Robert J.; Herrero, Lara J.; Ramirez, Ruben; Smith, Paul N.; Mahalingam, Suresh; Heise, Mark T.
2012-01-01
Mosquito-borne alphaviruses such as chikungunya virus and Ross River virus (RRV) are emerging pathogens capable of causing large-scale epidemics of virus-induced arthritis and myositis. The pathology of RRV-induced disease in both humans and mice is associated with induction of the host inflammatory response within the muscle and joints, and prior studies have demonstrated that the host complement system contributes to development of disease. In this study, we have used a mouse model of RRV-induced disease to identify and characterize which complement activation pathways mediate disease progression after infection, and we have identified the mannose binding lectin (MBL) pathway, but not the classical or alternative complement activation pathways, as essential for development of RRV-induced disease. MBL deposition was enhanced in RRV infected muscle tissue from wild type mice and RRV infected MBL deficient mice exhibited reduced disease, tissue damage, and complement deposition compared to wild-type mice. In contrast, mice deficient for key components of the classical or alternative complement activation pathways still developed severe RRV-induced disease. Further characterization of MBL deficient mice demonstrated that similar to C3−/− mice, viral replication and inflammatory cell recruitment were equivalent to wild type animals, suggesting that RRV-mediated induction of complement dependent immune pathology is largely MBL dependent. Consistent with these findings, human patients diagnosed with RRV disease had elevated serum MBL levels compared to healthy controls, and MBL levels in the serum and synovial fluid correlated with severity of disease. These findings demonstrate a role for MBL in promoting RRV-induced disease in both mice and humans and suggest that the MBL pathway of complement activation may be an effective target for therapeutic intervention for humans suffering from RRV-induced arthritis and myositis. PMID:22457620
-
Stevenson, S C; Rollence, M; Marshall-Neff, J; McClelland, A
1997-01-01
The adenovirus fiber protein is responsible for attachment of the virion to unidentified cell surface receptors. There are at least two distinct adenovirus fiber receptors which interact with the group B (Ad3) and group C (Ad5) adenoviruses. We have previously shown by using expressed adenovirus fiber proteins that it is possible to change the specificity of the fiber protein by exchanging the head domain with another serotype which recognizes a different receptor (S. C. Stevenson et al., J. Virol. 69:2850-2857, 1995). A chimeric fiber cDNA containing the Ad3 fiber head domain fused to the Ad5 fiber tail and shaft was incorporated into the genome of an adenovirus vector with E1 and E3 deleted encoding beta-galactosidase to generate Av9LacZ4, an adenovirus particle which contains a chimeric fiber protein. Western blot analysis of the chimeric fiber vector confirmed expression of the chimeric fiber protein and its association with the adenovirus capsid. Transduction experiments with fiber protein competitors demonstrated the altered receptor tropism of the chimeric fiber vector compared to that of the parental Av1LacZ4 vector. Transduction of a panel of human cell lines with the chimeric and parental vectors provided evidence for a different cellular distribution of the Ad5 and Ad3 receptors. Three cell lines (THP-1, MRC-5, and FaDu) were more efficiently transduced by the vector containing the Ad3 fiber head than by the Ad5 fiber vector. In contrast, human coronary artery endothelial cells were transduced more readily with the vector containing the Ad5 fiber than with the chimeric fiber vector. HeLa and human umbilical vein endothelial cells were transduced at equivalent levels compared with human diploid fibroblasts, which were refractory to transduction with both vectors. These results provide evidence for the differential expression of the Ad5 and Ad3 receptors on human cell lines derived from clinically relevant target tissues. Furthermore, we show that exchange
-
Eilat virus host range restriction is present at multiple levels of the virus life cycle.
Nasar, Farooq; Gorchakov, Rodion V; Tesh, Robert B; Weaver, Scott C
2015-01-15
RNA replication levels in vertebrate cells. These findings have important implications for arbovirus evolution and will help elucidate the viral factors responsible for the broad host range of pathogenic mosquito-borne alphaviruses, facilitate vaccine development, and inform potential strategies to reduce/prevent alphavirus transmission. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Tu, Jing; Lu, Na; Duan, Mengqin; Huang, Mengting; Chen, Liang; Li, Junji; Guo, Jing; Lu, Zuhong
2017-02-24
Multiple displacement amplification (MDA) is considered to be a conventional approach to comprehensive amplification from low input DNA. The chimeric reads generated in MDA lead to severe disruption in some studies, including those focusing on heterogeneity, structural variation, and genetic recombination. Meanwhile, the generation of by-products gives a new approach to gain insights into the reaction process of φ29 polymerase. Here, we analyzed 36.7 million chimeras and screened 196 billion chimeric hotspots in the human genome, as well as evaluating the hotspot selective preference of chimeras. No significant preference was captured in the distributions of chimeras and hotspots among chromosomes. Hotspots with overlaps for 12-13 nucleotides (nt) were most likely to be selected as templates in chimera generation. Meanwhile, a regularly selective preference was noticed in overlap GC content. The preferences in overlap length and GC content was shown to be pertinent to the sequence denaturation temperature, which pointed out the optimization direction for reducing chimeras. Distance preference between two segments of chimeras was 80-280 nt. The analysis is beneficial for reducing the chimeras in MDA, and the characterization of MDA chimeras is helpful in distinguishing MDA chimeras from chimeric sequences caused by disease.
-
Suemizu, Hiroshi; Sota, Shigeto; Kuronuma, Miyuki; Shimizu, Makiko; Yamazaki, Hiroshi
2014-11-01
Organophosphorus pesticides acephate and chlorpyrifos in foods have potential to impact human health. The aim of the current study was to investigate the pharmacokinetics of acephate and chlorpyrifos orally administered at lowest-observed-adverse-effect-level doses in chimeric mice transplanted with human hepatocytes. Absorbed acephate and its metabolite methamidophos were detected in serum from wild type mice and chimeric mice orally administered 150mg/kg. Approximately 70% inhibition of cholinesterase was evident in plasma of chimeric mice with humanized liver (which have higher serum cholinesterase activities than wild type mice) 1day after oral administrations of acephate. Adjusted animal biomonitoring equivalents from chimeric mice studies were scaled to human biomonitoring equivalents using known species allometric scaling factors and in vitro metabolic clearance data with a simple physiologically based pharmacokinetic (PBPK) model. Estimated plasma concentrations of acephate and chlorpyrifos in humans were consistent with reported concentrations. Acephate cleared similarly in humans and chimeric mice but accidental/incidental overdose levels of chlorpyrifos cleared (dependent on liver metabolism) more slowly from plasma in humans than it did in mice. The data presented here illustrate how chimeric mice transplanted with human hepatocytes in combination with a simple PBPK model can assist evaluations of toxicological potential of organophosphorus pesticides. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol
Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori
2015-01-01
We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900
-
The Epstein-Barr virus lytic protein BZLF1 as a candidate target antigen for vaccine development1
Hartlage, Alex S.; Liu, Tom; Patton, John T.; Garman, Sabrina L.; Zhang, Xiaoli; Kurt, Habibe; Lozanski, Gerard; Lustberg, Mark E.; Caligiuri, Michael A.; Baiocchi, Robert A.
2015-01-01
The Epstein-Barr virus (EBV) is an oncogenic, γ-herpesvirus associated with a broad spectrum of disease. While most immune-competent individuals can effectivley develop efficient adaptive immune responses to EBV, immunocompromised individuals are at serious risk for developing life threatening diseases such as Hodgkin’s lymphoma and post-transplant lymphoproliferative disorder (PTLD). Given the significant morbidity associated with EBV infection in high-risk populations, there is a need to develop vaccine strategies that restore or enhance EBV-specific immune responses. Here, we identify the EBV immediate-early protein BZLF1 as a potential target antigen for vaccine development. Primary tumors from patients with PTLD and a chimeric human-murine model of EBV-driven lymphoproliferative disorder (EBV-LPD) express BZLF1 protein. Pulsing human dendritic cells (DC) with recombinant BZLF1 followed by incubation with autologous mononuclear cells led to expansion of BZLF1-specific CD8(+) T cells in vitro and primed BZLF1-specific T-cell responses in vivo. In addition, vaccination of hu-PBL-SCID mice with BZLF1-transduced DCs induced specific cellular immunity and significantly prolonged survival from fatal EBV-LPD. These findings identify BZLF1 as a candidate target protein in the immunosurveillance of EBV and provide rationale for considering BZLF1 in vaccine strategies to enhance primary and recall immune responses and potentially prevent EBV-associated diseases. PMID:25735952
-
Jiang, Ying; Wan, Liping; Qin, Youwen; Wang, Xiaorui; Yan, Shike; Xie, Kuangcheng; Wang, Chun
2015-01-01
In this study we investigated the correlation between donor chimerism status and disease relapse following allogeneic hematopoietic stem cell transplantation (allo-HSCT). The chimerism of Fluorescence-activated cell sorter (FACS) sorted CD3+T lymphocytes of 153 cases, CD56+CD16+NK lymphocytes of 153 cases and CD19+B lymphocytes of 31 cases with acute B lymphoblastic leukemia (B-ALL) was analyzed post-transplant utilizing polymerase chain reaction amplification of short tandem repeats (PCR-STR). A total of 33 patients (33/153, 21.6%) had recurrent disease. The positive predictive values of declining donor chimerism for hematologic and isolated extramedullary relapse were 58.8% and 10% (P=0.018, Chi-Square). The positive predictive values of declining donor chimerism in BMB, BMT, BMNK and PBB for hematologic relapse were 11.6%, 0%, 0% and 0% under close monitoring in patients with B-ALL. Only the donor chimerism in BMB significantly decreased in the group with hematologic relapse as compared with the group without hematologic relapse (P=0.00, Independent-samples T test) in patients with B-ALL. The median drop of donor chimerism in PBT, BMT, PBNK and BMNK were 0%, 0%, 5.9% and 2.8% one or two weeks prior to hematologic relapse in patients with non-B-ALL. The donor chimerism in PBNK significantly decreased prior to hematologic relapse in the group with hematologic relapse as compared with the group without hematologic relapse (P=0.022, Independent-samples T test).These data suggest donor chimerism of BMB can be used to predict the occurrence of hematologic relapse in patients with B-ALL. Donor chimerism decrease in PBNK was associated with a somewhat increased risk of hematologic relapse in patients with non-B-ALL. Therefore, our results reveal a more effective path to individually predict for hematologic relapse by dynamic monitoring different cell lineages in different disease.
-
Sawai, Tsutomu; Hatta, Taichi; Fujita, Misao
2017-04-01
To understand the steps and objectives for which Japanese people are willing to accept human-animal chimeric embryo research using human induced pluripotent stem cells. An internet-based survey was conducted for the general public and researchers in Japan in 2016. Over 60% of the public and 83.8% of researchers supported the creation of human-swine chimeras and 81.0% of the public and 92.4% of researchers supported the creation of human-swine chimeric embryos. When presented with a graded view of human-swine chimeric embryo research with concomitant, specific objectives, a large majority of the general public as well as researchers are willing to accept this research with the aims of disease study, novel drug and treatment development, and transplantation.
-
Rasmussen, Cathy A; Allen-Hoffmann, B Lynn
2012-04-01
For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.
-
Propagation of Human Hepatocytes in uPA/SCID Mice: Producing Chimeric Mice with Humanized Liver.
Ohshita, Hiroki; Tateno, Chise
2017-01-01
Primary or cryopreserved human hepatocytes (h-heps) have been used as the gold standard for in vitro metabolism and hepatotoxicity studies; however, the supply of h-heps is limited and they cannot grow in vitro. We achieved approximately 1000-fold propagation of h-heps in the liver of albumin promoter/enhancer-driven urokinase-type plasminogen activator transgenic/severe combined immunodeficiency disease (uPA/SCID) mice with genetically induced liver disease and immunodeficiency. When h-heps are transplanted into the uPA/SCID mouse liver via the spleen, the h-heps engraft in the mouse liver, resulting in its repopulation with h-heps. We have named this model "chimeric mouse with humanized liver, PXB-mouse ® ." Fresh h-heps can be isolated from the chimeric mice (PXB-cells ® ) and have been used for in vitro studies.The efficacy and safety of chemical entities for use in humans are estimated using experimental animals such as rats and mice. The drug development of many chemical entities has been halted because of metabolic differences between humans and animals during clinical studies. Therefore, chimeric mice with humanized liver have been used to predict human-type metabolism and safety conditions for h-heps. In addition, until recently there were no suitable hepatitis B or C virus (HBV or HCV) susceptible animal models aside from chimpanzees. Chimeric mice are the sole persistent infectious small animal model for HBV and HCV and they have been used to investigate the efficacy of new anti-HBV or HCV agents.In this chapter, we describe a method for producing chimeric mice with humanized liver using uPA/SCID mice.
-
Lecouturier, Valerie; Berry, Catherine; Saulnier, Aure; Naville, Sophie; Manin, Catherine; Girerd-Chambaz, Yves; Crowe, James E; Jackson, Nicholas; Guy, Bruno
2018-04-26
The recombinant yellow fever-17D-dengue virus, live, attenuated, tetravalent dengue vaccine (CYD-TDV) is licensed in several dengue-endemic countries. Although the vaccine provides protection against dengue, the level of protection differs by serotype and warrants further investigation. We characterized the antigenic properties of each vaccine virus serotype using highly neutralizing human monoclonal antibodies (hmAbs) that bind quaternary structure-dependent epitopes. Specifically, we monitored the binding of dengue virus-1 (DENV-1; 1F4), DENV-2 (2D22) or DENV-3 (5J7) serotype-specific or DENV-1-4 cross-reactive (1C19) hmAbs to the four chimeric yellow fever-dengue vaccine viruses (CYD-1-4) included in phase III vaccine formulations using a range of biochemical and functional assays (dot blot, ELISA, surface plasmon resonance and plaque reduction neutralization assays). In addition, we used the "classic" live, attenuated DENV-2 vaccine serotype, immature CYD-2 viruses and DENV-2 virus-like particles as control antigens for anti-serotype-2 reactivity. The CYD vaccine serotypes were recognized by each hmAbs with the expected specificity, moreover, surface plasmon resonance indicated a high functional affinity interaction with the CYD serotypes. In addition, the hmAbs provided similar protection against CYD and wild-type dengue viruses in the in vitro neutralization assay. Overall, these findings demonstrate that the four CYD viruses used in clinical trials display key conformational and functional epitopes targeted by serotype-specific and/or cross-reactive neutralizing human antibodies. More specifically, we showed that CYD-2 displays serotype- specific epitopes present only on the mature virus. This indicates that the CYD-TDV has the ability to elicit antibody specificities which are similar to those induced by the wild type DENV. Future investigations will be needed to address the nature of CYD-TDV-induced responses after vaccine administration, and how these
-
Perruche, Sylvain; Marandin, Aliette; Kleinclauss, François; Angonin, Régis; Fresnay, Stéphanie; Baron, Marie Hélène; Tiberghien, Pierre; Saas, Philippe
2006-02-27
Use of a reduced-intensity conditioning regimen before an allogeneic hematopoietic cell transplantation is frequently associated with an early state of mixed hematopoietic chimerism. Such a coexistence of both host and donor hematopoietic cells may influence posttransplant alloreactivity and may affect the occurrence and severity of acute and chronic graft-versus-host disease (GVHD) as well as the intensity of the graft-versus-leukemia effect. Here we evaluated the relation between chimerism state after reduced-intensity conditioning transplantation (RICT), autoantibody production, and chronic GVHD (cGVHD)-related pathology. Chimerism state, circulating anticardiolipin, and antidouble stranded DNA autoantibody (Ab) titers as well as occurrence of cGVHD-like lesions were investigated in a murine RICT model. We observed a novel association between mixed chimerism state, high levels of pathogenic IgG autoantibodies, and subsequent development of cGVHD-like lesions. Furthermore, we found that the persistence of host B cells, but not dendritic cell origin or subset, was a factor associated with the appearance of cGVHD-like lesions. The implication of host B cells was confirmed by a host origin of autoantibodies. Recipient B cell persistence may contribute to the frequency and/or severity of cGVHD after RICT.
-
Bleve, G; Lezzi, C; Spagnolo, S; Rampino, P; Perrotta, C; Mita, G; Grieco, Francesco
2014-03-01
The ERY4 laccase gene from Pleurotus eryngii was expressed in Saccharomyces cerevisiae and the recombinant laccase resulted to be not biologically active. This gene was thus modified to obtain chimerical enzymes derived from the substitution of N-, C- and both N- and C-terminal regions with the corresponding regions of Ery3 laccase, another laccase isoform of P. eryngii. The chimerical isoform named 4NC3, derived from the substitution of both N- and C-terminal regions, showed the best performances in terms of enzymatic activities, affinities for different substrates and stability at a broad range of temperatures and pHs. The chimerical 4NC3 laccase isoform was displayed on the cell surface of S. cerevisiae using the N-terminal fusion with either the Pir2 or the Flo1 S. cerevisiae proteins as anchor attachment sequence. Immunofluorescence microscopy and Western blot analyses confirmed the localization of 4NC3 on the yeast cell surface. The enzyme activity on specific laccase substrates revealed that 4NC3 laccase was immobilized in active form on the cell surface. To our knowledge, this is the first example of expression of a chimerical fungal laccase by yeast cell display.
-
Gómara, María José; Pérez-Pomeda, Ignacio; Gatell, José María; Sánchez-Merino, Victor; Yuste, Eloisa; Haro, Isabel
2017-02-01
The work reports the design and synthesis of a chimeric peptide that is composed of the peptide sequences of two entry inhibitors which target different sites of HIV-1 gp41. The chimeric peptide offers the advantage of targeting two gp41 regions simultaneously: the fusion peptide and the loop both of which are membrane active and participate in the membrane fusion process. We therefore use lipid raft-like liposomes as a tool to specifically direct the chimeric inhibitor peptide to the membrane domains where the HIV-1 envelope protein is located. Moreover, the liposomes that mimic the viral membrane composition protect the chimeric peptide against proteolytic digestion thereby increasing the stability of the peptide. The described liposome preparations are suitable nanosystems for managing hydrophobic entry-inhibitor peptides as putative therapeutics. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Adoptive therapy with chimeric antigen receptor-modified T cells of defined subset composition.
Riddell, Stanley R; Sommermeyer, Daniel; Berger, Carolina; Liu, Lingfeng Steven; Balakrishnan, Ashwini; Salter, Alex; Hudecek, Michael; Maloney, David G; Turtle, Cameron J
2014-01-01
The ability to engineer T cells to recognize tumor cells through genetic modification with a synthetic chimeric antigen receptor has ushered in a new era in cancer immunotherapy. The most advanced clinical applications are in targeting CD19 on B-cell malignancies. The clinical trials of CD19 chimeric antigen receptor therapy have thus far not attempted to select defined subsets before transduction or imposed uniformity of the CD4 and CD8 cell composition of the cell products. This review will discuss the rationale for and challenges to using adoptive therapy with genetically modified T cells of defined subset and phenotypic composition.
-
Chimeric antigen receptor T cells: power tools to wipe out leukemia and lymphoma.
Riet, Tobias; Abken, Hinrich
2015-08-01
Adoptive cell therapy for malignant diseases is showing promise in recent early-phase trials in the treatment of B cell leukemia/lymphoma. Genetically engineered with a tumor-specific chimeric antigen receptor, patient's T cells produce lasting and complete leukemia regression. However, treatment is associated with some toxicity which needs our attention and the field still faces some hurdles at the scientific, technologic and clinical levels. Surmounting these obstacles will establish chimeric antigen receptor T cell therapy as a powerful approach to cure hematologic malignancies, paving the way for the treatment of other common types of cancer in the future.
-
Greenberg, D; Istrail, S
1994-09-01
The Human Genome Project requires better software for the creation of physical maps of chromosomes. Current mapping techniques involve breaking large segments of DNA into smaller, more-manageable pieces, gathering information on all the small pieces, and then constructing a map of the original large piece from the information about the small pieces. Unfortunately, in the process of breaking up the DNA some information is lost and noise of various types is introduced; in particular, the order of the pieces is not preserved. Thus, the map maker must solve a combinatorial problem in order to reconstruct the map. Good software is indispensable for quick, accurate reconstruction. The reconstruction is complicated by various experimental errors. A major source of difficulty--which seems to be inherent to the recombination technology--is the presence of chimeric DNA clones. It is fairly common for two disjoint DNA pieces to form a chimera, i.e., a fusion of two pieces which appears as a single piece. Attempts to order chimera will fail unless they are algorithmically divided into their constituent pieces. Despite consensus within the genomic mapping community of the critical importance of correcting chimerism, algorithms for solving the chimeric clone problem have received only passing attention in the literature. Based on a model proposed by Lander (1992a, b) this paper presents the first algorithms for analyzing chimerism. We construct physical maps in the presence of chimerism by creating optimization functions which have minimizations which correlate with map quality. Despite the fact that these optimization functions are invariably NP-complete our algorithms are guaranteed to produce solutions which are close to the optimum. The practical import of using these algorithms depends on the strength of the correlation of the function to the map quality as well as on the accuracy of the approximations. We employ two fundamentally different optimization functions as a means
-
Slawin, Kevin M.; Levitt, Jonathan M.; Spencer, David M.
2016-01-01
Therapeutic DNA-based vaccines aim to prime an adaptive host immune response against tumor-associated antigens, eliminating cancer cells primarily through CD8+ cytotoxic T cell-mediated destruction. To be optimally effective, immunological adjuvants are required for the activation of tumor-specific CD8+ T cells responses by DNA vaccination. Here, we describe enhanced anti-tumor efficacy of an in vivo electroporation-delivered DNA vaccine by inclusion of a genetically encoded chimeric MyD88/CD40 (MC) adjuvant, which integrates both innate and adaptive immune signaling pathways. When incorporated into a DNA vaccine, signaling by the MC adjuvant increased antigen-specific CD8+ T cells and promoted elimination of pre-established tumors. Interestingly, MC-enhanced vaccine efficacy did not require direct-expression of either antigen or adjuvant by local antigen-presenting cells, but rather our data supports a key role for MC function in “atypical” antigen-presenting cells of skin. In particular, MC adjuvant-modified keratinocytes increased inflammatory cytokine secretion, upregulated surface MHC class I, and were able to increase in vitro and in vivo priming of antigen-specific CD8+ T cells. Furthermore, in the absence of critical CD8α+/CD103+ cross-priming dendritic cells, MC was still able to promote immune priming in vivo, albeit at a reduced level. Altogether, our data support a mechanism by which MC signaling activates an inflammatory phenotype in atypical antigen-presenting cells within the cutaneous vaccination site, leading to an enhanced CD8+ T cell response against DNA vaccine-encoded antigens, through both CD8α+/CD103+ dendritic cell-dependent and independent pathways. PMID:27741278
-
Mahr, Benedikt; Granofszky, Nicolas; Muckenhuber, Moritz; Wekerle, Thomas
2017-01-01
The perception that transplantation of hematopoietic stem cells can confer tolerance to any tissue or organ from the same donor is widely accepted but it has not yet become a treatment option in clinical routine. The reasons for this are multifaceted but can generally be classified into safety and efficacy concerns that also became evident from the results of the first clinical pilot trials. In comparison to standard immunosuppressive therapies, the infection risk associated with the cytotoxic pre-conditioning necessary to allow allogeneic bone marrow engraftment and the risk of developing graft-vs.-host disease (GVHD) constitute the most prohibitive hurdles. However, several approaches have recently been developed at the experimental level to reduce or even overcome the necessity for cytoreductive conditioning, such as costimulation blockade, pro-apoptotic drugs, or Treg therapy. But even in the absence of any hazardous pretreatment, the recipients are exposed to the risk of developing GVHD as long as non-tolerant donor T cells are present. Total lymphoid irradiation and enriching the stem cell graft with facilitating cells emerged as potential strategies to reduce this peril. On the other hand, the long-lasting survival of kidney allografts, seen with transient chimerism in some clinical series, questions the need for durable chimerism for robust tolerance. From a safety point of view, loss of chimerism would indeed be favorable as it eliminates the risk of GVHD, but also complicates the assessment of tolerance. Therefore, other biomarkers are warranted to monitor tolerance and to identify those patients who can safely be weaned off immunosuppression. In addition to these safety concerns, the limited efficacy of the current pilot trials with approximately 40–60% patients becoming tolerant remains an important issue that needs to be resolved. Overall, the road ahead to clinical routine may still be rocky but the first successful long-term patients and progress
-
Probing receptor structure/function with chimeric G-protein-coupled receptors.
Yin, Dezhong; Gavi, Shai; Wang, Hsien-yu; Malbon, Craig C
2004-06-01
Owing its name to an image borrowed from Greek mythology, a chimera is seen to represent a new entity created as a composite from existing creatures or, in this case, molecules. Making use of various combinations of three basic domains of the receptors (i.e., exofacial, transmembrane, and cytoplasmic segments) that couple agonist binding into activation of effectors through heterotrimeric G-proteins, molecular pharmacology has probed the basic organization, structure/function relationships of this superfamily of heptahelical receptors. Chimeric G-protein-coupled receptors obviate the need for a particular agonist ligand when the ligand is resistant to purification or, in the case of orphan receptors, is not known. Chimeric receptors created from distant members of the heptahelical receptors enable new strategies in understanding how these receptors transduce agonist binding into receptor activation and may be able to offer insights into the evolution of G-protein-coupled receptors from yeast to humans.
-
Drent, Esther; Groen, Richard W J; Noort, Willy A; Themeli, Maria; Lammerts van Bueren, Jeroen J; Parren, Paul W H I; Kuball, Jürgen; Sebestyen, Zsolt; Yuan, Huipin; de Bruijn, Joost; van de Donk, Niels W C J; Martens, Anton C M; Lokhorst, Henk M; Mutis, Tuna
2016-05-01
Adoptive transfer of chimeric antigen receptor-transduced T cells is a promising strategy for cancer immunotherapy. The CD38 molecule, with its high expression on multiple myeloma cells, appears a suitable target for antibody therapy. Prompted by this, we used three different CD38 antibody sequences to generate second-generation retroviral CD38-chimeric antigen receptor constructs with which we transduced T cells from healthy donors and multiple myeloma patients. We then evaluated the preclinical efficacy and safety of the transduced T cells. Irrespective of the donor and antibody sequence, CD38-chimeric antigen receptor-transduced T cells proliferated, produced inflammatory cytokines and effectively lysed malignant cell lines and primary malignant cells from patients with acute myeloid leukemia and multi-drug resistant multiple myeloma in a cell-dose, and CD38-dependent manner, despite becoming CD38-negative during culture. CD38-chimeric antigen receptor-transduced T cells also displayed significant anti-tumor effects in a xenotransplant model, in which multiple myeloma tumors were grown in a human bone marrow-like microenvironment. CD38-chimeric antigen receptor-transduced T cells also appeared to lyse the CD38(+) fractions of CD34(+) hematopoietic progenitor cells, monocytes, natural killer cells, and to a lesser extent T and B cells but did not inhibit the outgrowth of progenitor cells into various myeloid lineages and, furthermore, were effectively controllable with a caspase-9-based suicide gene. These results signify the potential importance of CD38-chimeric antigen receptor-transduced T cells as therapeutic tools for CD38(+) malignancies and warrant further efforts to diminish the undesired effects of this immunotherapy using appropriate strategies. Copyright© Ferrata Storti Foundation.
-
Rathinam, Maniraj; Singh, Shweta; Pattanayak, Debasis; Sreevathsa, Rohini
2017-08-02
Development of chimeric Cry toxins by protein engineering of known and validated proteins is imperative for enhancing the efficacy and broadening the insecticidal spectrum of these genes. Expression of novel Cry proteins in food crops has however created apprehensions with respect to the safety aspects. To clarify this, premarket evaluation consisting of an array of analyses to evaluate the unintended effects is a prerequisite to provide safety assurance to the consumers. Additionally, series of bioinformatic tools as in silico aids are being used to evaluate the likely allergenic reaction of the proteins based on sequence and epitope similarity with known allergens. In the present study, chimeric Cry toxins developed through protein engineering were evaluated for allergenic potential using various in silico algorithms. Major emphasis was on the validation of allergenic potential on three aspects of paramount significance viz., sequence-based homology between allergenic proteins, validation of conformational epitopes towards identification of food allergens and physico-chemical properties of amino acids. Additionally, in vitro analysis pertaining to heat stability of two of the eight chimeric proteins and pepsin digestibility further demonstrated the non-allergenic potential of these chimeric toxins. The study revealed for the first time an all-encompassing evaluation that the recombinant Cry proteins did not show any potential similarity with any known allergens with respect to the parameters generally considered for a protein to be designated as an allergen. These novel chimeric proteins hence can be considered safe to be introgressed into plants.
-
Hotspot Selective Preference of the Chimeric Sequences Formed in Multiple Displacement Amplification
Tu, Jing; Lu, Na; Duan, Mengqin; Huang, Mengting; Chen, Liang; Li, Junji; Guo, Jing; Lu, Zuhong
2017-01-01
Multiple displacement amplification (MDA) is considered to be a conventional approach to comprehensive amplification from low input DNA. The chimeric reads generated in MDA lead to severe disruption in some studies, including those focusing on heterogeneity, structural variation, and genetic recombination. Meanwhile, the generation of by-products gives a new approach to gain insights into the reaction process of φ29 polymerase. Here, we analyzed 36.7 million chimeras and screened 196 billion chimeric hotspots in the human genome, as well as evaluating the hotspot selective preference of chimeras. No significant preference was captured in the distributions of chimeras and hotspots among chromosomes. Hotspots with overlaps for 12–13 nucleotides (nt) were most likely to be selected as templates in chimera generation. Meanwhile, a regularly selective preference was noticed in overlap GC content. The preferences in overlap length and GC content was shown to be pertinent to the sequence denaturation temperature, which pointed out the optimization direction for reducing chimeras. Distance preference between two segments of chimeras was 80–280 nt. The analysis is beneficial for reducing the chimeras in MDA, and the characterization of MDA chimeras is helpful in distinguishing MDA chimeras from chimeric sequences caused by disease. PMID:28245591
-
Functional rescue of dystrophin-deficient mdx mice by a chimeric peptide-PMO.
Yin, Haifang; Moulton, Hong M; Betts, Corinne; Merritt, Thomas; Seow, Yiqi; Ashraf, Shirin; Wang, Qingsong; Boutilier, Jordan; Wood, Matthew Ja
2010-10-01
Splice modulation using antisense oligonucleotides (AOs) has been shown to yield targeted exon exclusion to restore the open reading frame and generate truncated but partially functional dystrophin protein. This has been successfully demonstrated in dystrophin-deficient mdx mice and in Duchenne muscular dystrophy (DMD) patients. However, DMD is a systemic disease; successful therapeutic exploitation of this approach will therefore depend on effective systemic delivery of AOs to all affected tissues. We have previously shown the potential of a muscle-specific/arginine-rich chimeric peptide-phosphorodiamidate morpholino (PMO) conjugate, but its long-term activity, optimized dosing regimen, capacity for functional correction and safety profile remain to be established. Here, we report the results of this chimeric peptide-PMO conjugate in the mdx mouse using low doses (3 and 6 mg/kg) administered via a 6 biweekly systemic intravenous injection protocol. We show 100% dystrophin-positive fibers and near complete correction of the dystrophin transcript defect in all peripheral muscle groups, with restoration of 50% dystrophin protein over 12 weeks, leading to correction of the DMD pathological phenotype and restoration of muscle function in the absence of detectable toxicity or immune response. Chimeric muscle-specific/cell-penetrating peptides therefore represent highly promising agents for systemic delivery of splice-correcting PMO oligomers for DMD therapy.
-
Wang, Joshua W.; Jagu, Subhashini; Wu, Wai-Hong; Viscidi, Raphael P.; Macgregor-Das, Anne; Fogel, Jessica M.; Kwak, Kihyuck; Daayana, Sai; Kitchener, Henry; Stern, Peter L.; Gravitt, Patti E.; Trimble, Cornelia L.
2015-01-01
Presently, the seroprevalence of human papillomavirus (HPV) minor capsid antigen L2-reactive antibody is not well understood, and no serologic standard exists for L2-specific neutralizing antibodies. Therefore, we screened a total of 1,078 serum samples for HPV16 L2 reactivity, and these were obtained from four prior clinical studies: a population-based (n = 880) surveillance study with a high-risk HPV DNA prevalence of 10.8%, a cohort study of women (n = 160) with high-grade cervical intraepithelial neoplasia (CIN), and two phase II trials in women with high-grade vulvar intraepithelial neoplasia (VIN) receiving imiquimod therapy combined with either photodynamic therapy (PDT) (n = 19) or vaccination with a fusion protein comprising HPV16 L2, E7, and E6 (TA-CIN) (n = 19). Sera were screened sequentially by HPV16 L2 enzyme-linked immunosorbent assay (ELISA) and then Western blot. Seven of the 1,078 serum samples tested had L2-specific antibodies, but none were detectably neutralizing for HPV16. To develop a standard, we substituted human IgG1 sequences into conserved regions of two rodent monoclonal antibodies (MAbs) specific for neutralizing epitopes at HPV16 L2 residues 17 to 36 and 58 to 64, creating JWW-1 and JWW-2, respectively. These chimeric MAbs retained neutralizing activity and together reacted with 33/34 clinically relevant HPV types tested. In conclusion, our inability to identify an HPV16 L2-specific neutralizing antibody response even in the sera of patients with active genital HPV disease suggests the subdominance of L2 protective epitopes and the value of the chimeric MAbs JWW-1 and JWW-2 as standards for immunoassays to measure L2-specific human antibodies. PMID:25972404
-
Pessoa, Carina Carraro; Ferreira, Éden Ramalho; Bayer-Santos, Ethel; Rabinovitch, Michel; Mortara, Renato Arruda
2016-01-01
The trypanosomatids Leishmania amazonensis and Trypanosoma cruzi are excellent models for the study of the cell biology of intracellular protozoan infections. After their uptake by mammalian cells, the parasitic protozoan flagellates L. amazonensis and T. cruzi lodge within acidified parasitophorous vacuoles (PVs). However, whereas L. amazonensis develops in spacious, phagolysosome-like PVs that may enclose numerous parasites, T. cruzi is transiently hosted within smaller vacuoles from which it soon escapes to the host cell cytosol. To investigate if parasite-specific vacuoles are required for the survival and differentiation of T. cruzi, we constructed chimeric vacuoles by infection of L. amazonensis amastigote-infected macrophages with T. cruzi epimastigotes (EPIs) or metacyclic trypomastigotes (MTs). These chimeric vacuoles, easily observed by microscopy, allowed the entry and fate of T. cruzi in L. amazonensis PVs to be dynamically recorded by multidimensional imaging of coinfected cells. We found that although T. cruzi EPIs remained motile and conserved their morphology in chimeric vacuoles, T. cruzi MTs differentiated into amastigote-like forms capable of multiplying. These results demonstrate that the large adaptive vacuoles of L. amazonensis are permissive to T. cruzi survival and differentiation and that noninfective EPIs are spared from destruction within the chimeric PVs. We conclude that T. cruzi differentiation can take place in Leishmania-containing vacuoles, suggesting this occurs prior to their escape into the host cell cytosol. PMID:26975994
-
Tokunaga, Hiroko; Arakawa, Tsutomu; Tokunaga, Masao
2013-07-01
One of the hallmarks of halophilic properties is reversibility of thermal unfolding. A nucleoside diphosphate kinase (NDK) from a moderate halophile Halomonas sp. 593 (HaNDK) follows this behavior. His-tagged chimeric NDK (HisPaHaNDK) consisting of an N-terminal half of a non-halophilic Pseuodomonas aeruginosa NDK (PaNDK) and a Cterminal half of HaNDK loses this reversible property, indicating a critical role of the N-terminal portion of PaNDK in determining the reversibility of the chimeric protein. Various mutations were introduced at Arg45 and Lys61, based on the model NDK structure. It appears that having Glu at position 45 is critical in conferring the thermal reversibility to HisPa- HaNDK chimeric protein.
-
Perruche, Sylvain; Marandin, Aliette; Kleinclauss, François M.; Angonin, Régis; Fresnay, Stéphanie; Baron, Marie Hélène; Tiberghien, Pierre; Saas, Philippe
2006-01-01
Background Use of a reduced intensity conditioning regimen before an allogeneic hematopoietic cell transplantation is frequently associated with an early state of mixed hematopoietic chimerism. Such a co-existence of both host and donor hematopoietic cells may influence post-transplant alloreactivity and may affect the occurrence and severity of acute and chronic graft-versus-host disease (GVHD) as well as the intensity of the graft-versus-leukemia effect. Here we evaluated the relation between chimerism state after reduced intensity conditioning transplantation (RICT), auto-antibody production and chronic GVHD (cGVHD)-related pathology. Methods Chimerism state, circulating anti-cardiolipin and anti-double stranded DNA auto-antibody (Ab) titers as well as occurrence of cGVHD-like lesions were investigated in a murine RICT model. Results We observed a novel association between mixed chimerism state, high levels of pathogenic IgG auto-Abs and subsequent development of cGVHD-like lesions. Furthermore, we found that the persistence of host B cells, but not dendritic cell origin or subset, was a factor associated with the appearance of cGVHD-like lesions. The implication of host B cells was confirmed by a host origin of auto-Abs. Conclusions Recipient B cell persistence may therefore contribute to the frequency and/or severity of cGVHD after RICT. PMID:16495806
-
Peng, Feng; Chen, Lin; Han, Dong; Xiao, Chenwei; Bao, Qiyuan; Wang, Tao
2013-11-01
We presented our experience on the use of anterolateral thigh (ALT) chimeric flap to reconstruct two separate defects in upper extremity. From December 2009 to August 2012, we used this ALT chimeric flap to reconstruct two separate defects in upper extremity on five patients (mean age: 36.6 years; range: 15 ∼ 47 years). The locations of defect were palm and fingers in four patients and forearm in the other patient. The sizes of defect ranged from 4.5 × 1.5 cm to 20 × 10 cm. A minimum of two separate perforator vessels in the flap were identified. The skin paddle was then split between the two perforators to shape two separate paddles with a common vascular supply. There were no cases of flap failure or re-exploration. Four donor sites were directly closed and one was covered by a skin graft. Donor-site morbidity was negligible. The ALT chimeric flap provides customized cover for two separate defects in upper extremity. Copyright © 2013 Wiley Periodicals, Inc.
-
Generation of Chimeric RNAs by cis-splicing of adjacent genes (cis-SAGe) in mammals.
Zhuo, Jian-Shu; Jing, Xiao-Yan; Du, Xin; Yang, Xiu-Qin
2018-02-20
Chimeric RNA molecules, possessing exons from two or more independent genes, are traditionally believed to be produced by chromosome rearrangement. However, recent studies revealed that cis-splicing of adjacent genes (cis- SAGe) is one of the major mechanisms underlying the formation of chimeric RNAs. cis-SAGe refers to intergenic splicing of directly adjacent genes with the same transcriptional orientation, resulting in read-through transcripts, termed chimeric RNAs, which contain sequences from two or more parental genes. cis-SAGe was first identified in tumor cells, since then its potential in carcinogenesis has attracted extensive attention. More and more scientists are focusing on it. With the development of research, cis-SAGe was found to be ubiquitous in various normal tissues, and might make a crucial contribution to the formation of novel genes in the evolution of genomes. In this review, we summarize the splicing pattern, expression characteristics, possible mechanisms, and significance of cis-SAGe in mammals. This review will be helpful for general understanding of the current status and development tendency of cis-SAGe.
-
Shchelkunov, Sergei N; Salyaev, Rurik K; Pozdnyakov, Sergei G; Rekoslavskaya, Natalia I; Nesterov, Andrei E; Ryzhova, Tatiana S; Sumtsova, Valentina M; Pakova, Natalia V; Mishutina, Uliana O; Kopytina, Tatiana V; Hammond, Rosemarie W
2006-07-01
A synthetic chimeric gene, TBI-HBS, encoding the immunogenic ENV and GAG epitopes of human immunodeficiency virus (HIV-1) and the surface protein antigen (HBsAg) of hepatitis B virus (HBV), was expressed in tomato plants. Tomato fruits containing the TBI-HBS antigen were fed to experimental mice and, on days 14 and 28 post-feeding, high levels of HIV- and HBV-specific antibodies were present in the serum and feces of the test animals. Intraperitoneal injection of a DNA vaccine directing synthesis of the same TBI-HBsAg antigen boosted the antibody response to HIV in the blood serum; however, it had no effect on the high level of antibodies produced to HBV.
-
Chimeric antigen receptor engineered stem cells: a novel HIV therapy.
Zhen, Anjie; Carrillo, Mayra A; Kitchen, Scott G
2017-03-01
Despite the success of combination antiretroviral therapy (cART) for suppressing HIV and improving patients' quality of life, HIV persists in cART-treated patients and remains an incurable disease. Financial burdens and health consequences of lifelong cART treatment call for novel HIV therapies that result in a permanent cure. Cellular immunity is central in controlling HIV replication. However, HIV adopts numerous strategies to evade immune surveillance. Engineered immunity via genetic manipulation could offer a functional cure by generating cells that have enhanced antiviral activity and are resistant to HIV infection. Recently, encouraging reports from several human clinical trials using an anti-CD19 chimeric antigen receptor (CAR) modified T-cell therapy for treating B-cell malignancies have provided valuable insights and generated remarkable enthusiasm in engineered T-cell therapy. In this review, we discuss the development of HIV-specific chimeric antigen receptors and the use of stem cell based therapies to generate lifelong anti-HIV immunity.
-
Chimeric antigen receptor engineered stem cells: a novel HIV therapy
Zhen, Anjie; Carrillo, Mayra A; Kitchen, Scott G
2017-01-01
Despite the success of combination antiretroviral therapy (cART) for suppressing HIV and improving patients’ quality of life, HIV persists in cART-treated patients and remains an incurable disease. Financial burdens and health consequences of lifelong cART treatment call for novel HIV therapies that result in a permanent cure. Cellular immunity is central in controlling HIV replication. However, HIV adopts numerous strategies to evade immune surveillance. Engineered immunity via genetic manipulation could offer a functional cure by generating cells that have enhanced antiviral activity and are resistant to HIV infection. Recently, encouraging reports from several human clinical trials using an anti-CD19 chimeric antigen receptor (CAR) modified T-cell therapy for treating B-cell malignancies have provided valuable insights and generated remarkable enthusiasm in engineered T-cell therapy. In this review, we discuss the development of HIV-specific chimeric antigen receptors and the use of stem cell based therapies to generate lifelong anti-HIV immunity. PMID:28357916
-
Iannino, Florencia; Herrmann, Claudia K; Roset, Mara S; Briones, Gabriel
2015-05-05
Zoonoses that affect human and animal health have an important economic impact. In the study now presented, a bivalent vaccine has been developed that has the potential for preventing the transmission from cattle to humans of two bacterial pathogens: Brucella abortus and Shiga toxin-producing Escherichia coli (STEC). A 66kDa chimeric antigen, composed by EspA, Intimin, Tir, and H7 flagellin (EITH7) from STEC, was constructed and expressed in B. abortus Δpgm vaccine strain (BabΔpgm). Mice orally immunized with BabΔpgm(EITH7) elicited an immune response with the induction of anti-EITH7 antibodies (IgA) that clears an intestinal infection of E. coli O157:H7 three times faster (t=4 days) than mice immunized with BabΔpgm carrier strain (t=12 days). As expected, mice immunized with BabΔpgm(EITH7) strain also elicited a protective immune response against B. abortus infection. A Brucella-based vaccine platform is described capable of eliciting a combined protective immune response against two bacterial pathogens with diverse lifestyles-the intracellular pathogen B. abortus and the intestinal extracellular pathogen STEC. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Xu, Dan; Nishimura, Toshi; Nishimura, Sachiko; Zhang, Haili; Zheng, Ming; Guo, Ying-Ying; Masek, Marylin; Michie, Sara A; Glenn, Jeffrey; Peltz, Gary
2014-04-01
Seven of 15 clinical trial participants treated with a nucleoside analogue (fialuridine [FIAU]) developed acute liver failure. Five treated participants died, and two required a liver transplant. Preclinical toxicology studies in mice, rats, dogs, and primates did not provide any indication that FIAU would be hepatotoxic in humans. Therefore, we investigated whether FIAU-induced liver toxicity could be detected in chimeric TK-NOG mice with humanized livers. Control and chimeric TK-NOG mice with humanized livers were treated orally with FIAU 400, 100, 25, or 2.5 mg/kg/d. The response to drug treatment was evaluated by measuring plasma lactate and liver enzymes, by assessing liver histology, and by electron microscopy. After treatment with FIAU 400 mg/kg/d for 4 d, chimeric mice developed clinical and serologic evidence of liver failure and lactic acidosis. Analysis of liver tissue revealed steatosis in regions with human, but not mouse, hepatocytes. Electron micrographs revealed lipid and mitochondrial abnormalities in the human hepatocytes in FIAU-treated chimeric mice. Dose-dependent liver toxicity was detected in chimeric mice treated with FIAU 100, 25, or 2.5 mg/kg/d for 14 d. Liver toxicity did not develop in control mice that were treated with the same FIAU doses for 14 d. In contrast, treatment with another nucleotide analogue (sofosbuvir 440 or 44 mg/kg/d po) for 14 d, which did not cause liver toxicity in human trial participants, did not cause liver toxicity in mice with humanized livers. FIAU-induced liver toxicity could be readily detected using chimeric TK-NOG mice with humanized livers, even when the mice were treated with a FIAU dose that was only 10-fold above the dose used in human participants. The clinical features, laboratory abnormalities, liver histology, and ultra-structural changes observed in FIAU-treated chimeric mice mirrored those of FIAU-treated human participants. The use of chimeric mice in preclinical toxicology studies could improve
-
Zhu, Shaomei; Liu, Bochao; Xu, Yuxia; Sun, Yachun; Wang, Yilin; Wang, Yuanzhan; Shuai, Lifang; Chen, Zixuan; Allain, Jean-Pierre
2016-01-01
ABSTRACT A lack of immunocompetent-small-primate models has been an obstacle for developing hepatitis C virus (HCV) vaccines and affordable antiviral drugs. In this study, HCV/GB virus B (GBV-B) chimeric virus carrying the major nonstructural proteins NS2 to NS4A (HCV NS2 to -4A chimera) was produced and used to infect common marmosets, since HCV NS2 to NS4A proteins are critical proteases and major antigens. Seven marmosets were inoculated intrahepatically with HCV NS2 to -4A chimera RNA for primary infection or intravenously injected with chimera-containing serum for passage infection. Three animals used as controls were injected with phosphate-buffered saline (PBS) or GBV-B, respectively. Six of seven HCV NS2 to -4A chimera-infected marmosets exhibited consistent viremia and one showed transient viremia during the course of follow-up detection. All six infected animals with persistent circulating viremia presented characteristics typical of viral hepatitis, including viral RNA and proteins in hepatocytes and histopathological changes in liver tissue. Viremia was consistently detected for 5 to 54 weeks of follow-up. FK506 immunosuppression facilitated the establishment of persistent chimera infection in marmosets. An animal with chimera infection spontaneously cleared the virus in blood 7 weeks following the first inoculation, but viral-RNA persistence, low-level viral protein, and mild necroinflammation remained in liver tissue. The specific antibody and T-cell response to HCV NS3 in this viremia-resolved marmoset was boosted by rechallenging, but no viremia was detected during 57 weeks of follow-up. The chimera-infected marmosets described can be used as a suitable small-primate animal model for studying novel antiviral drugs and T-cell-based vaccines against HCV infection. IMPORTANCE HCV infection causes approximately 70% of chronic hepatitis and is frequently associated with primary liver cancer globally. Chimpanzees have been used as a reliable primate model
-
Zhu, Shaomei; Li, Tingting; Liu, Bochao; Xu, Yuxia; Sun, Yachun; Wang, Yilin; Wang, Yuanzhan; Shuai, Lifang; Chen, Zixuan; Allain, Jean-Pierre; Li, Chengyao
2016-09-15
A lack of immunocompetent-small-primate models has been an obstacle for developing hepatitis C virus (HCV) vaccines and affordable antiviral drugs. In this study, HCV/GB virus B (GBV-B) chimeric virus carrying the major nonstructural proteins NS2 to NS4A (HCV NS2 to -4A chimera) was produced and used to infect common marmosets, since HCV NS2 to NS4A proteins are critical proteases and major antigens. Seven marmosets were inoculated intrahepatically with HCV NS2 to -4A chimera RNA for primary infection or intravenously injected with chimera-containing serum for passage infection. Three animals used as controls were injected with phosphate-buffered saline (PBS) or GBV-B, respectively. Six of seven HCV NS2 to -4A chimera-infected marmosets exhibited consistent viremia and one showed transient viremia during the course of follow-up detection. All six infected animals with persistent circulating viremia presented characteristics typical of viral hepatitis, including viral RNA and proteins in hepatocytes and histopathological changes in liver tissue. Viremia was consistently detected for 5 to 54 weeks of follow-up. FK506 immunosuppression facilitated the establishment of persistent chimera infection in marmosets. An animal with chimera infection spontaneously cleared the virus in blood 7 weeks following the first inoculation, but viral-RNA persistence, low-level viral protein, and mild necroinflammation remained in liver tissue. The specific antibody and T-cell response to HCV NS3 in this viremia-resolved marmoset was boosted by rechallenging, but no viremia was detected during 57 weeks of follow-up. The chimera-infected marmosets described can be used as a suitable small-primate animal model for studying novel antiviral drugs and T-cell-based vaccines against HCV infection. HCV infection causes approximately 70% of chronic hepatitis and is frequently associated with primary liver cancer globally. Chimpanzees have been used as a reliable primate model for HCV infection
-
Therapeutic use of chimeric bacteriophage (phage) lysins in staphylococcal endophthalmitis
USDA-ARS?s Scientific Manuscript database
Purpose: Phage endolysins are peptidoglycan hydrolases that are produced at the end of the phage lytic cycle to digest the host bacterial cell wall, facilitating the release of mature phage progeny. The aim of this study is to determine the antimicrobial activity of chimeric phage lysins against cli...
-
Mizuno, Hiroshi; Akutsu, Hidenori; Kato, Kazuto
2015-01-01
Human-animal chimeric embryos are embryos obtained by introducing human cells into a non-human animal embryo. It is envisaged that the application of human-animal chimeric embryos may make possible many useful research projects including producing three-dimensional human organs in animals and verification of the pluripotency of human ES cells or iPS cells in vivo. The use of human-animal chimeric embryos, however, raises several ethical and moral concerns. The most fundamental one is that human-animal chimeric embryos possess the potential to develop into organisms containing human-derived tissue, which may lead to infringing upon the identity of the human species, and thus impairing human dignity. The Japanese Expert Panel on Bioethics in the Cabinet Office carefully considered the scientific significance and ethical acceptability of the issue and released its "Opinions regarding the handling of research using human-animal chimeric embryos". The Panel proposed a framework of case-by-case review, and suggested that the following points must be carefully reviewed from the perspective of ethical acceptability: (a) Types of animal embryos and types of animals receiving embryo transfers, particularly in dealing with non-human primates; (b) Types of human cells and organs intended for production, particularly in dealing with human nerve or germ cells; and (c) Extent of the period required for post-transfer studies. The scientific knowledge that can be gained from transfer into an animal uterus and from the production of an individual must be clarified to avoid unnecessary generation of chimeric animals. The time is ripe for the scientific community and governments to start discussing the ethical issues for establishing a global consensus.
-
Ji, Huili; Long, Chuan; Feng, Chong; Shi, Ningning; Jiang, Yingdi; Zeng, Guomin; Li, Xirui; Wu, Jingjing; Lu, Lin; Lu, Shengsheng; Pan, Dengke
2017-05-01
Blastocyst complementation is an important technique for generating chimeric organs in organ-deficient pigs, which holds great promise for solving the problem of a shortage of organs for human transplantation procedures. Porcine chimeras have been generated using embryonic germ cells, embryonic stem cells, and induced pluripotent stem cells; however, there are no authentic pluripotent stem cells for pigs. In previous studies, blastomeres from 4- to 8-cell-stage parthenogenetic embryos were able to generate chimeric fetuses efficiently, but the resulting fetuses did not produce live-born young. Here, we used early-stage embryos from somatic cell nuclear transfer (SCNT) to generate chimeric piglets by the aggregation method. Then, the distribution of chimerism in various tissues and organs was observed through the expression of enhanced green fluorescent protein (EGFP). Initially, we determined whether 4- to 8- or 8- to 16-cell-stage embryos were more suitable to generate chimeric piglets. Chimeras were produced by aggregating two EGFP-tagged Wuzhishan minipig (WZSP) SCNT embryos and two Bama minipig (BMP) SCNT embryos. The chimeric piglets were identified by coat color and microsatellite and swine leukocyte antigen analyses. Moreover, the distribution of chimerism in various tissues and organs of the piglets was evaluated by EGFP expression. We found that more aggregated embryos were produced using 4- to 8-cell-stage embryos (157/657, 23.9%) than 8- to 16-cell-stage embryos (100/499, 20.0%). Thus, 4- to 8-cell-stage embryos were used for the generation of chimeras. The rate of blastocysts development after aggregating WZSP with BMP embryos was 50.6%. Transfer of 391 blastocysts developed from 4- to 8-cell-stage embryos to five recipients gave rise to 18 piglets, of which two (11.1%) were confirmed to be chimeric by their coat color and microsatellite examination of the skin. One of the chimeric piglets died at 35 days and was subsequently autopsied, whereas the
-
Duque-Afonso, Jesus; Waterhouse, Miguel; Pfeifer, Dietmar; Follo, Marie; Duyster, Justus; Bertz, Hartmut; Finke, Jürgen
2018-02-01
Cell-free DNA (cfDNA) isolated from plasma or serum has received increasing interest for diagnostic applications in pregnancy, solid tumors and solid organ transplantation. The reported clinical usefulness of cfDNA obtained from plasma or serum in patients undergoing allogeneic cell transplantation (alloHSCT) is scarce. To analyze the potential clinical utility of cfDNA chimerism analysis after alloHSCT. A total of 196 samples obtained from 110 patients were investigated for their chimeric status both in peripheral blood and plasma using standard PCR for microsatellite amplification. Plasma DNA size distribution was analyzed using capillary electrophoresis. The mean cfDNA concentration in the transplanted patients was 469ng/ml (range: 50-10,700ng/ml). The size range of almost 80% of the analyzed fragments was between 80 and 200bp. In 41 out of the 110 patients included in the study a mixture of donor and recipient plasma cfDNA was detected. There was a statistically significant difference in the percentage of plasma mixed chimerism between the patients without transplant related complications and the patients with either GvHD (p<0.05) or relapse (p<0.01). In those patients who showed improvement of GvHD also displayed a decrease in the observable percentage of recipient cfDNA during GvHD treatment. In patients without improvement or even with worsening of acute GvHD, stable or increasing levels of recipient cfDNA were detected. cfDNA in combination with peripheral blood and bone marrow cell chimerism analysis might improve its utility in the clinic in particular in those patients with clinical complications after alloHSCT. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
-
Lin, Jiaxin; Chan, William F N; Boon, Louis; Anderson, Colin C
2018-01-01
Stable mixed hematopoietic chimerism is a robust method for inducing donor-specific tolerance with the potential to prevent rejection of donor islets in recipients with autoimmune type-1 diabetes. However, with reduced intensity conditioning, fully allogeneic chimerism in a tolerance resistant autoimmune-prone non-obese diabetic (NOD) recipient has rarely been successful. In this setting, successful multilineage chimerism has required either partial major histocompatability complex matching, mega doses of bone marrow, or conditioning approaches that are not currently clinically feasible. Irradiation free protocols with moderate bone marrow doses have not generated full tolerance; donor skin grafts were rejected. We tested whether more efficient recipient T cell depletion would generate a more robust tolerance. We show that a combination of donor-specific transfusion-cyclophosphamide and multiple T cell depleting antibodies could induce stable high levels of fully allogeneic chimerism in NOD recipients. Less effective T cell depletion was associated with instability of chimerism. Stable chimeras appeared fully donor-specific tolerant, with clonal deletion of allospecific T cells and acceptance of donor skin grafts, while recovering substantial immunocompetence. The loss of chimerism months after transplant was significantly associated with a lower level of chimerism and donor T cells within the first 2 weeks after transplant. Thus, rapid and robust recipient T cell depletion allows for stable high levels of fully allogeneic chimerism and robust donor-specific tolerance in the stringent NOD model while using a clinically feasible protocol. In addition, these findings open the possibility of identifying recipients whose chimerism will later fail, stratifying patients for early intervention.
-
Metildi, Cristina A; Kaushal, Sharmeela; Luiken, George A; Talamini, Mark A; Hoffman, Robert M; Bouvet, Michael
2014-04-01
The aim of this study was to evaluate a new fluorescently labeled chimeric anti-CEA antibody for improved detection and resection of colon cancer. Frozen tumor and normal human tissue samples were stained with chimeric and mouse antibody-fluorophore conjugates for comparison. Mice with patient-derived orthotopic xenografts (PDOX) of colon cancer underwent fluorescence-guided surgery (FGS) or bright-light surgery (BLS) 24 hr after tail vein injection of fluorophore-conjugated chimeric anti-CEA antibody. Resection completeness was assessed using postoperative images. Mice were followed for 6 months for recurrence. The fluorophore conjugation efficiency (dye/mole ratio) improved from 3-4 to >5.5 with the chimeric CEA antibody compared to mouse anti-CEA antibody. CEA-expressing tumors labeled with chimeric CEA antibody provided a brighter fluorescence signal on frozen human tumor tissues (P = 0.046) and demonstrated consistently lower fluorescence signals in normal human tissues compared to mouse antibody. Chimeric CEA antibody accurately labeled PDOX colon cancer in nude mice, enabling improved detection of tumor margins for more effective FGS. The R0 resection rate increased from 86% to 96% with FGS compared to BLS. Improved conjugating efficiency and labeling with chimeric fluorophore-conjugated antibody resulted in better detection and resection of human colon cancer in an orthotopic mouse model. © 2013 Wiley Periodicals, Inc.
-
Encapsidated Host Factors in Alphavirus Particles Influence Midgut Infection of Aedes aegypti.
Mackenzie-Liu, David; Sokoloski, Kevin J; Purdy, Sarah; Hardy, Richard W
2018-05-16
Transmission of mosquito-borne viruses requires the efficient infection of both a permissive vertebrate host and a competent mosquito vector. The infectivity of Sindbis virus (SINV), the type species of the Alphavirus genus, is influenced by both the original and new host cell. We have shown that infection of vertebrate cells by SINV, chikungunya virus (CHIKV), and Ross River virus (RRV) produces two subpopulations of virus particles separable based on density. In contrast, a single population of viral particles is produced by mosquito cells. Previous studies demonstrated that the denser vertebrate-derived particles and the mosquito-derived particles contain components of the small subunit of the host cell ribosome, whereas the less dense vertebrate-derived particles do not. Infection of mice with RRV showed that both particle subpopulations are produced in an infected vertebrate, but in a tissue specific manner with serum containing only the less dense version of the virus particles. Previous infectivity studies using SINV particles have shown that the denser particles (SINV Heavy ) and mosquito derived particles SINV C6/36 are significantly more infectious in vertebrate cells than the less dense vertebrate derived particles (SINV Light ). The current study shows that SINV Light particles, initiate the infection of the mosquito midgut more efficiently than SINV Heavy particles and that this enhanced infectivity is associated with an exacerbated immune response to SINV Light infection in midgut tissues. The enhanced infection of SINV Light is specific to the midgut as intrathoracically injected virus do not exhibit the same fitness advantage. Together, our data indicate a biologically significant role for the SINV Light subpopulation in the efficient transmission from infected vertebrates to the mosquito vector.
-
Singh, Vivek; Jaini, Ritika; Torricelli, André A M; Tuohy, Vincent K; Wilson, Steven E
2013-11-01
GFP-chimeric mice are important tools to study the role of bone marrow-derived cells in eye physiology. A method is described to generate GFP-chimeric mice using whole-body, sub-lethal radiation (600 rad) of wild-type C57BL/6 recipients followed by tail vein injection of bone marrow cells derived from GFP+ (GFP-transgenic C57/BL/6-Tg(UBC-GFP)30 Scha/J) mice. This method yields stable GFP+ chimeras with greater than 95% chimerism (range 95-99%), achieved within one month of bone marrow transfer confirmed by microscopy and fluorescence-assisted cell sorting (FACS) analysis, with lower mortality after irradiation than prior methods. To demonstrate the efficacy of GFP+ bone marrow chimeric mice, the role of circulating GFP+ bone marrow-derived cells in myofibroblast generation after irregular photo-therapeutic keratectomy (PTK) was analyzed. Many SMA+ myofibroblasts that were generated at one month after PTK were derived from GFP+ bone marrow-derived cells. The GFP+ bone marrow chimeric mouse provides an excellent model for studying the role of bone marrow-derived cells in corneal wound healing, glaucoma surgery, optic nerve head pathology and retinal pathophysiology and wound healing. Copyright © 2013 Elsevier Ltd. All rights reserved.
-
Gong, Xin; Yin, He; Shi, Yuhua; He, Xiaoqiu; Yu, Yongjiao; Guan, Shanshan; Kuai, Ziyu; Haji, Nasteha M; Haji, Nafisa M; Kong, Wei; Shan, Yaming
2016-01-01
The ectodomain of the influenza A virus (IAV) hemagglutinin (HA) stem is highly conserved across strains and has shown promise as a universal influenza vaccine in a mouse model. In this study, potential B-cell epitopes were found through sequence alignment and epitope prediction in a stem fragment, HA2:90-105, which is highly conserved among virus subtypes H1, H3 and B. A norovirus (NoV) P particle platform was used to express the HA2:90-105 sequences from subtypes H1, H3 and B in loops 1, 2 and 3 of the protrusion (P) domain, respectively. Through mouse immunization and microneutralization assays, the immunogenicity and protective efficacy of the chimeric NoV P particle (trivalent HA2-PP) were tested against infection with three subtypes (H1N1, H3N2 and B) of IAV in Madin–Darby canine kidney cells. The protective efficacy of the trivalent HA2-PP was also evaluated preliminarily in vivo by virus challenge in the mouse model. The trivalent HA2-PP immunogen induced significant IgG antibody responses, which could be enhanced by a virus booster vaccination. Moreover, the trivalent HA2-PP immunogen also demonstrated in vitro neutralization of the H3 and B viruses, and in vivo protection against the H3 virus. Our results support the notion that a broadly protective vaccine approach using an HA2-based NoV P particle platform can provide cross-protection against challenge viruses of different IAV subtypes. The efficacy of the immunogen should be further enhanced for practicality, and a better understanding of the protective immune mechanism will be critical for the development of HA2-based multivalent vaccines. PMID:27222326
-
Gong, Xin; Yin, He; Shi, Yuhua; He, Xiaoqiu; Yu, Yongjiao; Guan, Shanshan; Kuai, Ziyu; Haji, Nasteha M; Haji, Nafisa M; Kong, Wei; Shan, Yaming
2016-05-25
The ectodomain of the influenza A virus (IAV) hemagglutinin (HA) stem is highly conserved across strains and has shown promise as a universal influenza vaccine in a mouse model. In this study, potential B-cell epitopes were found through sequence alignment and epitope prediction in a stem fragment, HA2:90-105, which is highly conserved among virus subtypes H1, H3 and B. A norovirus (NoV) P particle platform was used to express the HA2:90-105 sequences from subtypes H1, H3 and B in loops 1, 2 and 3 of the protrusion (P) domain, respectively. Through mouse immunization and microneutralization assays, the immunogenicity and protective efficacy of the chimeric NoV P particle (trivalent HA2-PP) were tested against infection with three subtypes (H1N1, H3N2 and B) of IAV in Madin-Darby canine kidney cells. The protective efficacy of the trivalent HA2-PP was also evaluated preliminarily in vivo by virus challenge in the mouse model. The trivalent HA2-PP immunogen induced significant IgG antibody responses, which could be enhanced by a virus booster vaccination. Moreover, the trivalent HA2-PP immunogen also demonstrated in vitro neutralization of the H3 and B viruses, and in vivo protection against the H3 virus. Our results support the notion that a broadly protective vaccine approach using an HA2-based NoV P particle platform can provide cross-protection against challenge viruses of different IAV subtypes. The efficacy of the immunogen should be further enhanced for practicality, and a better understanding of the protective immune mechanism will be critical for the development of HA2-based multivalent vaccines.
-
Application of chimeric mice with humanized liver for study of human-specific drug metabolism.
Bateman, Thomas J; Reddy, Vijay G B; Kakuni, Masakazu; Morikawa, Yoshio; Kumar, Sanjeev
2014-06-01
Human-specific or disproportionately abundant human metabolites of drug candidates that are not adequately formed and qualified in preclinical safety assessment species pose an important drug development challenge. Furthermore, the overall metabolic profile of drug candidates in humans is an important determinant of their drug-drug interaction susceptibility. These risks can be effectively assessed and/or mitigated if human metabolic profile of the drug candidate could reliably be determined in early development. However, currently available in vitro human models (e.g., liver microsomes, hepatocytes) are often inadequate in this regard. Furthermore, the conduct of definitive radiolabeled human ADME studies is an expensive and time-consuming endeavor that is more suited for later in development when the risk of failure has been reduced. We evaluated a recently developed chimeric mouse model with humanized liver on uPA/SCID background for its ability to predict human disposition of four model drugs (lamotrigine, diclofenac, MRK-A, and propafenone) that are known to exhibit human-specific metabolism. The results from these studies demonstrate that chimeric mice were able to reproduce the human-specific metabolite profile for lamotrigine, diclofenac, and MRK-A. In the case of propafenone, however, the human-specific metabolism was not detected as a predominant pathway, and the metabolite profiles in native and humanized mice were similar; this was attributed to the presence of residual highly active propafenone-metabolizing mouse enzymes in chimeric mice. Overall, the data indicate that the chimeric mice with humanized liver have the potential to be a useful tool for the prediction of human-specific metabolism of xenobiotics and warrant further investigation.
-
Shape-specific nanostructured protein mimics from de novo designed chimeric peptides.
Jiang, Linhai; Yang, Su; Lund, Reidar; Dong, He
2018-01-30
Natural proteins self-assemble into highly-ordered nanoscaled architectures to perform specific functions. The intricate functions of proteins have provided great impetus for researchers to develop strategies for designing and engineering synthetic nanostructures as protein mimics. Compared to the success in engineering fibrous protein mimetics, the design of discrete globular protein-like nanostructures has been challenging mainly due to the lack of precise control over geometric packing and intermolecular interactions among synthetic building blocks. In this contribution, we report an effective strategy to construct shape-specific nanostructures based on the self-assembly of chimeric peptides consisting of a coiled coil dimer and a collagen triple helix folding motif. Under salt-free conditions, we showed spontaneous self-assembly of the chimeric peptides into monodisperse, trigonal bipyramidal-like nanoparticles with precise control over the stoichiometry of two folding motifs and the geometrical arrangements relative to one another. Three coiled coil dimers are interdigitated on the equatorial plane while the two collagen triple helices are located in the axial position, perpendicular to the coiled coil plane. A detailed molecular model was proposed and further validated by small angle X-ray scattering experiments and molecular dynamics (MD) simulation. The results from this study indicated that the molecular folding of each motif within the chimeric peptides and their geometric packing played important roles in the formation of discrete protein-like nanoparticles. The peptide design and self-assembly mechanism may open up new routes for the construction of highly organized, discrete self-assembling protein-like nanostructures with greater levels of control over assembly accuracy.
-
Hunting in the Rainforest and Mayaro Virus Infection: An emerging Alphavirus in Ecuador.
Izurieta, Ricardo O; Macaluso, Maurizio; Watts, Douglas M; Tesh, Robert B; Guerra, Bolivar; Cruz, Ligia M; Galwankar, Sagar; Vermund, Sten H
2011-10-01
The objectives of this report were to document the potential presence of Mayaro virus infection in Ecuador and to examine potential risk factors for Mayaro virus infection among the personnel of a military garrison in the Amazonian rainforest. The study population consisted of the personnel of a garrison located in the Ecuadorian Amazonian rainforest. The cross-sectional study employed interviews and seroepidemiological methods. Humoral immune response to Mayaro virus infection was assessed by evaluating IgM- and IgG-specific antibodies using ELISA. Of 338 subjects studied, 174 were from the Coastal zone of Ecuador, 73 from Andean zone, and 91 were native to the Amazonian rainforest. Seroprevalence of Mayaro virus infection was more than 20 times higher among Amazonian natives (46%) than among subjects born in other areas (2%). Age and hunting in the rainforest were significant predictors of Mayaro virus infection overall and among Amazonian natives. The results provide the first demonstration of the potential presence of Mayaro virus infection in Ecuador and a systematic evaluation of risk factors for the transmission of this alphavirus. The large difference in prevalence rates between Amazonian natives and other groups and between older and younger natives suggest that Mayaro virus is endemic and enzootic in the rainforest, with sporadic outbreaks that determine differences in risk between birth cohorts of natives. Deep forest hunting may selectively expose native men, descendants of the Shuar and Huaronai ethnic groups, to the arthropod vectors of Mayaro virus in areas close to primate reservoirs.
-
Hunting in the Rainforest and Mayaro Virus Infection: An emerging Alphavirus in Ecuador
Izurieta, Ricardo O; Macaluso, Maurizio; Watts, Douglas M; Tesh, Robert B; Guerra, Bolivar; Cruz, Ligia M; Galwankar, Sagar; Vermund, Sten H
2011-01-01
Objectives: The objectives of this report were to document the potential presence of Mayaro virus infection in Ecuador and to examine potential risk factors for Mayaro virus infection among the personnel of a military garrison in the Amazonian rainforest. Materials and Methods: The study population consisted of the personnel of a garrison located in the Ecuadorian Amazonian rainforest. The cross-sectional study employed interviews and seroepidemiological methods. Humoral immune response to Mayaro virus infection was assessed by evaluating IgM- and IgG-specific antibodies using ELISA. Results: Of 338 subjects studied, 174 were from the Coastal zone of Ecuador, 73 from Andean zone, and 91 were native to the Amazonian rainforest. Seroprevalence of Mayaro virus infection was more than 20 times higher among Amazonian natives (46%) than among subjects born in other areas (2%). Conclusions: Age and hunting in the rainforest were significant predictors of Mayaro virus infection overall and among Amazonian natives. The results provide the first demonstration of the potential presence of Mayaro virus infection in Ecuador and a systematic evaluation of risk factors for the transmission of this alphavirus. The large difference in prevalence rates between Amazonian natives and other groups and between older and younger natives suggest that Mayaro virus is endemic and enzootic in the rainforest, with sporadic outbreaks that determine differences in risk between birth cohorts of natives. Deep forest hunting may selectively expose native men, descendants of the Shuar and Huaronai ethnic groups, to the arthropod vectors of Mayaro virus in areas close to primate reservoirs. PMID:22223990
-
Yamazaki, Hiroshi; Suemizu, Hiroshi; Mitsui, Marina; Shimizu, Makiko; Guengerich, F Peter
2016-12-19
Species differences exist in terms of drug oxidation activities, which are mediated mainly by cytochrome P450 (P450) enzymes. To overcome the problem of species extrapolation, transchromosomic mice containing a human P450 3A cluster or chimeric mice transplanted with human hepatocytes have been introduced into the human toxicology research area. In this review, drug metabolism and disposition mediated by humanized livers in chimeric mice are summarized in terms of biliary/urinary excretions of phthalate and bisphenol A and plasma clearances of the human cocktail probe drugs caffeine, warfarin, omeprazole, metoprolol, and midazolam. Simulation of human plasma concentrations of the teratogen thalidomide and its human metabolites is possible with a simplified physiologically based pharmacokinetic model based on data obtained in chimeric mice, in accordance with reported clinical thalidomide concentrations. In addition, in vivo nonspecific hepatic protein binding parameters of metabolically activated 14 C-drug candidate and hepatotoxic medicines in humanized liver mice can be analyzed by accelerator mass spectrometry and are useful for predictions in humans.
-
Bennett, Jason W; Yadava, Anjali; Tosh, Donna; Sattabongkot, Jetsumon; Komisar, Jack; Ware, Lisa A; McCarthy, William F; Cowden, Jessica J; Regules, Jason; Spring, Michele D; Paolino, Kristopher; Hartzell, Joshua D; Cummings, James F; Richie, Thomas L; Lumsden, Joanne; Kamau, Edwin; Murphy, Jittawadee; Lee, Cynthia; Parekh, Falgunee; Birkett, Ashley; Cohen, Joe; Ballou, W Ripley; Polhemus, Mark E; Vanloubbeeck, Yannick F; Vekemans, Johan; Ockenhouse, Christian F
2016-02-01
A vaccine to prevent infection and disease caused by Plasmodium vivax is needed both to reduce the morbidity caused by this parasite and as a key component in efforts to eradicate malaria worldwide. Vivax malaria protein 1 (VMP001), a novel chimeric protein that incorporates the amino- and carboxy- terminal regions of the circumsporozoite protein (CSP) and a truncated repeat region that contains repeat sequences from both the VK210 (type 1) and the VK247 (type 2) parasites, was developed as a vaccine candidate for global use. We conducted a first-in-human Phase 1 dose escalation vaccine study with controlled human malaria infection (CHMI) of VMP001 formulated in the GSK Adjuvant System AS01B. A total of 30 volunteers divided into 3 groups (10 per group) were given 3 intramuscular injections of 15 μg, 30 μg, or 60 μg respectively of VMP001, all formulated in 500 μL of AS01B at each immunization. All vaccinated volunteers participated in a P. vivax CHMI 14 days following the third immunization. Six non-vaccinated subjects served as infectivity controls. The vaccine was shown to be well tolerated and immunogenic. All volunteers generated robust humoral and cellular immune responses to the vaccine antigen. Vaccination did not induce sterile protection; however, a small but significant delay in time to parasitemia was seen in 59% of vaccinated subjects compared to the control group. An association was identified between levels of anti-type 1 repeat antibodies and prepatent period. This trial was the first to assess the efficacy of a P. vivax CSP vaccine candidate by CHMI. The association of type 1 repeat-specific antibody responses with delay in the prepatency period suggests that augmenting the immune responses to this domain may improve strain-specific vaccine efficacy. The availability of a P. vivax CHMI model will accelerate the process of P. vivax vaccine development, allowing better selection of candidate vaccines for advancement to field trials.
-
Bennett, Jason W.; Yadava, Anjali; Tosh, Donna; Sattabongkot, Jetsumon; Komisar, Jack; Ware, Lisa A.; McCarthy, William F.; Cowden, Jessica J.; Regules, Jason; Spring, Michele D.; Paolino, Kristopher; Hartzell, Joshua D.; Cummings, James F.; Richie, Thomas L.; Lumsden, Joanne; Kamau, Edwin; Murphy, Jittawadee; Lee, Cynthia; Parekh, Falgunee; Birkett, Ashley; Cohen, Joe; Ballou, W. Ripley; Polhemus, Mark E.; Vanloubbeeck, Yannick F.; Vekemans, Johan; Ockenhouse, Christian F.
2016-01-01
Background A vaccine to prevent infection and disease caused by Plasmodium vivax is needed both to reduce the morbidity caused by this parasite and as a key component in efforts to eradicate malaria worldwide. Vivax malaria protein 1 (VMP001), a novel chimeric protein that incorporates the amino- and carboxy- terminal regions of the circumsporozoite protein (CSP) and a truncated repeat region that contains repeat sequences from both the VK210 (type 1) and the VK247 (type 2) parasites, was developed as a vaccine candidate for global use. Methods We conducted a first-in-human Phase 1 dose escalation vaccine study with controlled human malaria infection (CHMI) of VMP001 formulated in the GSK Adjuvant System AS01B. A total of 30 volunteers divided into 3 groups (10 per group) were given 3 intramuscular injections of 15μg, 30μg, or 60μg respectively of VMP001, all formulated in 500μL of AS01B at each immunization. All vaccinated volunteers participated in a P. vivax CHMI 14 days following the third immunization. Six non-vaccinated subjects served as infectivity controls. Results The vaccine was shown to be well tolerated and immunogenic. All volunteers generated robust humoral and cellular immune responses to the vaccine antigen. Vaccination did not induce sterile protection; however, a small but significant delay in time to parasitemia was seen in 59% of vaccinated subjects compared to the control group. An association was identified between levels of anti-type 1 repeat antibodies and prepatent period. Significance This trial was the first to assess the efficacy of a P. vivax CSP vaccine candidate by CHMI. The association of type 1 repeat-specific antibody responses with delay in the prepatency period suggests that augmenting the immune responses to this domain may improve strain-specific vaccine efficacy. The availability of a P. vivax CHMI model will accelerate the process of P. vivax vaccine development, allowing better selection of candidate vaccines for
-
Saadi, Mahdiye; Karkhah, Ahmad; Nouri, Hamid Reza
2017-07-01
Current investigations have demonstrated that a multi-epitope peptide vaccine targeting multiple antigens could be considered as an ideal approach for prevention and treatment of brucellosis. According to the latest findings, the most effective immunogenic antigens of brucella to induce immune responses are included Omp31, BP26, BLS, DnaK and L7-L12. Therefore, in the present study, an in silico approach was used to design a novel multi-epitope vaccine to elicit a desirable immune response against brucellosis. First, five novel T-cell epitopes were selected from Omp31, BP26, BLS, DnaK and L7-L12 proteins using different servers. In addition, helper epitopes selected from Tetanus toxin fragment C (TTFrC) were applied to induce CD4+ helper T lymphocytes (HTLs) responses. Selected epitopes were fused together by GPGPG linkers to facilitate the immune processing and epitope presentation. Moreover, cholera toxin B (CTB) was linked to N terminal of vaccine construct as an adjuvant by using EAAAK linker. A multi-epitope vaccine was designed based on predicted epitopes which was 377 amino acid residues in length. Then, the physico-chemical properties, secondary and tertiary structures, stability, intrinsic protein disorder, solubility and allergenicity of this multi-epitope vaccine were assessed using immunoinformatics tools and servers. Based on obtained results, a soluble, and non-allergic protein with 40.59kDa molecular weight was constructed. Expasy ProtParam classified this chimeric protein as a stable protein and also 89.8% residues of constructed vaccine were located in favored regions of the Ramachandran plot. Furthermore, this multi-epitope peptide vaccine was able to strongly induce T cell and B-cell mediated immune responses. In conclusion, immunoinformatics analysis indicated that this multi-epitope peptide vaccine can be effectively expressed and potentially be used for prophylactic or therapeutic usages against brucellosis. Copyright © 2017 Elsevier B.V. All
-
Liu, Zihao; Ma, Shiqing; Duan, Shun; Xuliang, Deng; Sun, Yingchun; Zhang, Xi; Xu, Xinhua; Guan, Binbin; Wang, Chao; Hu, Meilin; Qi, Xingying; Zhang, Xu; Gao, Ping
2016-03-02
Bacterial adhesion and biofilm formation are the primary causes of implant-associated infection, which is difficult to eliminate and may induce failure in dental implants. Chimeric peptides with both binding and antimicrobial motifs may provide a promising alternative to inhibit biofilm formation on titanium surfaces. In this study, chimeric peptides were designed by connecting an antimicrobial motif (JH8194: KRLFRRWQWRMKKY) with a binding motif (minTBP-1: RKLPDA) directly or via flexible/rigid linkers to modify Ti surfaces. We evaluated the binding behavior of peptides using quartz crystal microbalance (QCM) and atomic force microscopy (AFM) techniques and investigated the effect of the modification of titanium surfaces with these peptides on the bioactivity of Streptococcus gordonii (S. gordonii) and Streptococcus sanguis (S. sanguis). Compared with the flexible linker (GGGGS), the rigid linker (PAPAP) significantly increased the adsorption of the chimeric peptide on titanium surfaces (p < 0.05). Concentration-dependent adsorption is consistent with a single Langmuir model, whereas time-dependent adsorption is in line with a two-domain Langmuir model. Additionally, the chimeric peptide with the rigid linker exhibited more effective antimicrobial ability than the peptide with the flexible linker. This finding was ascribed to the ability of the rigid linker to separate functional domains and reduce their interference to the maximum extent. Consequently, the performance of chimeric peptides with specific titanium-binding motifs and antimicrobial motifs against bacteria can be optimized by the proper selection of linkers. This rational design of chimeric peptides provides a promising alternative to inhibit the formation of biofilms on titanium surfaces with the potential to prevent peri-implantitis and peri-implant mucositis.
-
Improved Anti-Treg Vaccination Targeting Foxp3 Efficiently Decreases Regulatory T Cells in Mice.
Mousavi Niri, Neda; Memarnejadian, Arash; Pilehvar-Soltanahmadi, Younes; Agha Sadeghi, Mohammadreza; Mahdavi, Mehdi; Kheshtchin, Nasim; Arab, Samaneh; Namdar, Afshin; Jadidi, Farhad; Zarghami, Nosratollah; Hajati, Jamshid
2016-09-01
The critical role of regulatory T (Treg) cells in dampening immune responses against tumor cells is apparent. Therefore, several methods have been introduced for eliminating Treg. Among them, inducing immune responses against Treg cells expressing Foxp3 transcription factor is a hopeful approach to decrease the frequency of Tregs. In current study, we used the chimeric FoxP3-Fc(IgG) fusion construct/protein to effectively stimulate the immune responses against Treg cells. Previously constructed FoxP3-Fc(IgG) DNA vaccine and its protein counterpart were injected into C57BL/6 mice in a prime/boost regimen. After 2 weeks, the mice were killed to measure the frequency of Tregs in their spleens, as well as analyze their specific cytokine production, T-cell proliferation, and CD8 T-cell cytotoxicity against FoxP3 protein. FACS analysis of FoxP3 CD4 cells in splenocytes revealed the efficiency of FoxP3 DNA-prime protein-boost strategy to decrease the Treg cells and further showed considerable superiority of Fc(IgG) fusion strategy. This significant reduction in Treg frequency was also concomitant with higher FoxP3-specific CTL and Th1 responses in FoxP3-Fc vaccinated animals. Prime/boost vaccination against FoxP3 in addition to enhanced antigen presentation by means of Fc fusion strategy could be successfully considered for Treg depletion studies. Validity of this approach should be experimentally tested in preclinical tumor models.
-
Wu, Jun; Izpisua Belmonte, Juan Carlos
2016-06-01
The past decade's rapid progress in human pluripotent stem cell (hPSC) research has generated hope for meeting the rising demand of organ donation, which remains the only effective cure for end-stage organ failure, a major cause of death worldwide. Despite the potential, generation of transplantable organs from hPSCs using in vitro differentiation is far-fetched. An in vivo interspecies chimeric complementation strategy relying on chimeric-competent hPSCs and zygote genome editing provides an auspicious alternative for providing unlimited organ source for transplantation.
-
Zheng, Haixue; Lian, Kaiqi; Yang, Fan; Jin, Ye; Zhu, Zixiang; Guo, Jianhong; Cao, Weijun; Liu, Huanan; He, Jijun; Zhang, Keshan; Li, Dan; Liu, Xiangtao
2015-10-26
Foot-and-mouth disease (FMD) is a highly contagious vesicular disease that affects domestic and wild cloven-hoofed animals worldwide. Recently, a series of outbreaks of type A FMDV occurred in Southeast Asian countries, China, the Russia Federation, Mongolia, Kazakhstan and South Korea. The FMD virus (A/GDMM/CHA/2013) from China's Guangdong province (2013) is representative of those responsible for the latest epidemic, and has low amino acid identity (93.9%) in VP1 protein with the epidemic strain A/WH/CHA/09 from Wuhan, China in 2009. Both of isolates belong to the Sea-97 genotype of ASIA topotype. Therefore, the application of a new vaccine strain with cross-protective efficacy is of fundamental importance to control the spread of the two described pandemic strains. A chimeric strain rA/P1-FMDV constructed by our lab previously through replacing the P1 gene in the vaccine strain O/CHA/99 with that from the epidemic stain A/WH/CHA/09, has been demonstrated to exhibit good growth characteristics in culture, and the rA/P1-FMDV inactivated vaccine can provide protection against epidemic strain A/WH/CHA/09 in cattle. However, it is still unclear whether the vaccine produces efficient protection against the new pandemic strain (A/GDMM/CHA/2013). Here, vaccine matching and pig 50% protective dose (PD50) tests were performed to assess the vaccine potency. The vaccine matching test showed cross-reactivity of sera from full dose vaccine vaccinated pigs with A/WH/CHA/09 and A/GDMM/CHA/2013 isolates, with average r1 values of 0.94±0.12 and 0.68±0.06 (r1≥0.3), which indicates that the rA/P1-FMDV vaccine is likely to confer good cross-protection against the two isolates. When challenged with two pandemic isolates A/WH/CHA/09 and A/GDMM/CHA/2013 strain, the vaccine achieved 12.51 PD50 and 10.05 PD50 per dose (2.8μg), respectively. The results indicated that the rA/P1-FMDV inactivated vaccine could protect pigs against both A/WH/CHA/09 and A/GDMM/CHA/2013 pandemic isolates
-
Bellerophon: A program to detect chimeric sequences in multiple sequence alignments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2003-12-23
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.
-
Human-animal chimeras: ethical issues about farming chimeric animals bearing human organs.
Bourret, Rodolphe; Martinez, Eric; Vialla, François; Giquel, Chloé; Thonnat-Marin, Aurélie; De Vos, John
2016-06-29
Recent advances in stem cells and gene engineering have paved the way for the generation of interspecies chimeras, such as animals bearing an organ from another species. The production of a rat pancreas by a mouse has demonstrated the feasibility of this approach. The next step will be the generation of larger chimeric animals, such as pigs bearing human organs. Because of the dramatic organ shortage for transplantation, the medical needs for such a transgressive practice are indisputable. However, there are serious technical barriers and complex ethical issues that must be discussed and solved before producing human organs in animals. The main ethical issues are the risks of consciousness and of human features in the chimeric animal due to a too high contribution of human cells to the brain, in the first case, or for instance to limbs, in the second. Another critical point concerns the production of human gametes by such chimeric animals. These worst-case scenarios are obviously unacceptable and must be strictly monitored by careful risk assessment, and, if necessary, technically prevented. The public must be associated with this ethical debate. Scientists and physicians have a critical role in explaining the medical needs, the advantages and limits of this potential medical procedure, and the ethical boundaries that must not be trespassed. If these prerequisites are met, acceptance of such a new, borderline medical procedure may prevail, as happened before for in-vitro fertilization or preimplantation genetic diagnosis.
-
Incorporation of chimeric gag protein into retroviral particles.
Weldon, R A; Erdie, C R; Oliver, M G; Wills, J W
1990-01-01
The product of the Rous sarcoma virus (RSV) gag gene, Pr76gag, is a polyprotein precursor which is cleaved by the viral protease to yield the major structural proteins of the virion during particle assembly in avian host cells. We have recently shown that myristylated forms of the RSV Gag protein can induce particle formation with very high efficiency when expressed in mammalian cells (J. W. Wills, R. C. Craven, and J. A. Achacoso, J. Virol. 63:4331-4343, 1989). We made use of this mammalian system to examine the abilities of foreign antigens to be incorporated into particles when fused directly to the myristylated Gag protein. Our initial experiments showed that removal of various portions of the viral protease located at the carboxy terminus of the RSV Gag protein did not disrupt particle formation. We therefore chose this region for coupling of iso-1-cytochrome c from Saccharomyces cerevisiae to Gag. This was accomplished by constructing an in-frame fusion of the CYC1 and gag coding sequences at a common restriction endonuclease site. Expression of the chimeric gene resulted in synthesis of the Gag-cytochrome fusion protein and its release into the cell culture medium. The chimeric particles were readily purified by simple centrifugation, and transmission electron microscopy of cells that produced them revealed a morphology similar to that of immature type C retrovirions. Images PMID:2166812
-
Papazyan, Romeo; Liu, Xueqing; Liu, Jingwen; Dong, Bin; Plummer, Emily M; Lewis, Ronald D; Roth, Jonathan D; Young, Mark A
2018-06-01
Obeticholic acid (OCA) is a selective farnesoid X receptor (FXR) agonist that regulates bile acid and lipid metabolism. FXR activation induces distinct changes in circulating cholesterol among animal models and humans. The mechanistic basis of these effects has been elusive because of difficulties in studying lipoprotein homeostasis in mice, which predominantly package circulating cholesterol in HDLs. Here, we tested the effects of OCA in chimeric mice whose livers are mostly composed (≥80%) of human hepatocytes. Chimeric mice exhibited a human-like ratio of serum LDL cholesterol (LDL-C) to HDL cholesterol (HDL-C) at baseline. OCA treatment in chimeric mice increased circulating LDL-C and decreased circulating HDL-C levels, demonstrating that these mice closely model the cholesterol effects of FXR activation in humans. Mechanistically, OCA treatment increased hepatic cholesterol in chimeric mice but not in control mice. This increase correlated with decreased SREBP-2 activity and target gene expression, including a significant reduction in LDL receptor protein. Cotreatment with atorvastatin reduced total cholesterol, rescued LDL receptor protein levels, and normalized serum LDL-C. Treatment with two clinically relevant nonsteroidal FXR agonists elicited similar lipoprotein and hepatic changes in chimeric mice, suggesting that the increase in circulating LDL-C is a class effect of FXR activation.