Sample records for codon usage comparison

  1. Synonymous Codon Usage in TTSuV2: Analysis and Comparison with TTSuV1

    PubMed Central

    Dai, Dingzhen

    2013-01-01

    Two species of the DNA virus Torque teno sus virus (TTSuV), TTSuV1 and TTSuV2, have become widely distributed in pig-farming countries in recent years. In this study, we performed a comprehensive analysis of synonymous codon usage bias in 41 available TTSuV2 coding sequences (CDS), and compared the codon usage patterns of TTSuV2 and TTSuV1. TTSuV codon usage patterns were found to be phylogenetically conserved. Values for the effective number of codons (ENC) indicated that the overall extent of codon usage bias in both TTSuV2 and TTSuV1 was not significant, the most frequently occurring codons had an A or C at the third codon position. Correspondence analysis (COA) was performed and TTSuV2 and TTSuV1 sequences were located in different quadrants of the first two major axes. A plot of the ENC revealed that compositional constraint was the major factor determining the codon usage bias for TTSuV2. In addition, hierarchical cluster analysis of 41 TTSuV2 isolates based on relative synonymous codon usage (RSCU) values suggested that there was no association between geographic distribution and codon bias of TTSuV2 sequences. Finally, the comparison of RSCU for TTSuV2, TTSuV1 and the corresponding host sequence indicated that the codon usage pattern of TTSuV2 was similar to that of TTSuV1. However the similarity was low for each virus and its host. These conclusions provide important insight into the synonymous codon usage pattern of TTSuV2, as well as better understangding of the molecular evolution of TTSuV2 genomes. PMID:24303050

  2. Studying Codon Usage: From sequence to function

    NASA Astrophysics Data System (ADS)

    Hwa, Terry; Klumpp, Stefan; Dong, Jiajia

    2007-03-01

    Protein coding sequences exhibit strong variances in the use of codons. Highly expressed genes such as those encoding ribosomal proteins use codons corresponding to the highly abundant tRNAs (``optimized codons''). High expression of heterologous genes also requires codon optimization, but even the codon usage of very weakly expressed genes tends to be far from random. To understand this biased choice of codon usage, we develop a theory based on the concept of ``ribosomal load.'' Ribosome is the key limiting commodity for rapidly growing organisms so that the use of ``non-optimal'' codons in any gene prolongs the translational elongation time, thus reducing the effective ribosome concentration. This presents a fitness cost, the magnitude of which depends on the amount of that protein being translated. We formulated and solved an evolution equation based on the above ingredients. This provides a quantitative relation between codon usage and protein abundance, which is found to be in good agreement with the available data for E.coli. This result suggests a convenient way to quantitatively predict protein abundances based on genome sequence data.

  3. Characterization of Codon usage bias in the newly identified DEV UL18 gene

    NASA Astrophysics Data System (ADS)

    Chen, Xiwen; Cheng, Anchun; Wang, Mingshu; Xiang, Jun

    2011-10-01

    In this study, Codon usage bias (CUB) of DEV UL18 gene was analyzed, the results showed that codon usage bias in the DEV UL18 gene was strong bias towards the synonymous codons with A and T at the third codon position. Phylogenetic tree based on the amino acid sequences of the DEV UL18 gene and the 27 other herpesviruses revealed that UL18 gene of the DEV CHv strain and some fowl herpesviruses such as MeHV-1, GaHV-2 and GaHV-3 were clustered within a monophyletic clade and grouped within alphaherpesvirinae. The ENC-GC3S plot indicated that codon usage bias has strong species-specificity between DEV and 27 reference herpesviruses, and suggests that factors other than gene composition, such as translational selection leading to the codon usage variation among genes in different organisms, contribute to the codon usage among the different herpesviruses. Comparison of codon preferences of DEV UL18 gene with those of E. coli , yeast and humans showed that there were 20 codons showing distinct usage differences between DEV UL18 and yeast, 22 between DEV UL18 and humans, 23 between DEV UL18 and E.coli, which indicated the codon usage bias pattern in the DEV UL18 gene was similar to that of yeast. It is infered that the yeast expression system may be more suitable for the DEV UL18 expression.

  4. Analysis of codon usage in bovine viral diarrhea virus

    Microsoft Academic Search

    Meng WangJie; Jie Zhang; Jian-hua Zhou; Hao-tai Chen; Li-na Ma; Yao-zhong Ding; Wen-qian Liu; Yong-sheng Liu

    2011-01-01

    Bovine viral diarrhea virus (BVDV) is a widespread virus in beef and dairy herds. BVDV has been grouped into two genotypes,\\u000a genotype 1 and genotype 2. In this study, the relative synonymous codon usage (RSCU) values, effective number of codon (ENC)\\u000a values and nucleotide content were investigated, and a comparative analysis of codon usage patterns for open reading frames\\u000a (ORFs)

  5. Selective pressure dominates the synonymous codon usage in parvoviridae.

    PubMed

    Shi, Sheng-Lin; Jiang, Yi-Ren; Liu, Yan-Qun; Xia, Run-Xi; Qin, Li

    2013-02-01

    Parvoviridae is a family of small non-enveloped viruses and divided into two subfamilies. The family members infect a wide range of organisms from insects to humans and some of the members (e.g., nonpathogenic adeno-associated viruses) are effective gene therapy delivery vectors. We detailed the synonymous codon usage pattern of Parvoviridae family from the available 58 sequenced genomes through multivariate statistical methods. Our results revealed that nine viruses showed some degree of strong codon bias, and the others possessed a general weak trend of codon bias. ENc-plot and neutrality plot results showed that selective pressure dominated over mutation in shapes coding sequence's composition. The overall GC content and GC content at the third synonymous codon position were the principal determinants behind the variations within the codon usage patterns, as they both significantly correlated with the first axis of correspondence analysis. In addition, gene length had no direct influence on the codon usage pattern. Densovirinae subfamily and Parvovirinae subfamily possessed nine identical preferred codons, though most of the two subfamilies codon usage frequencies were significantly different. The result of cluster analysis based on synonymous codon usage was discordant with that of taxonomic classification. Adeno-associated viruses formed a separated clade far from other Parvoviridae members in the dendrogram. Thus, we concluded that natural selection rather than mutation pressure accounts for the main factor that affects the codon bias in Parvoviridae family. PMID:22996735

  6. Comprehensive analysis of the overall codon usage patterns in equine infectious anemia virus

    PubMed Central

    2013-01-01

    Background Equine infectious anemia virus (EIAV) is an important animal model for understanding the relationship between viral persistence and the host immune response during lentiviral infections. Comparison and analysis of the codon usage model between EIAV and its hosts is important for the comprehension of viral evolution. In our study, the codon usage pattern of EIAV was analyzed from the available 29 full-length EIAV genomes through multivariate statistical methods. Finding Effective number of codons (ENC) suggests that the codon usage among EIAV strains is slightly biased. The ENC-plot analysis demonstrates that mutation pressure plays a substantial role in the codon usage pattern of EIAV, whereas other factors such as geographic distribution and host translation selection also take part in the process of EIAV evolution. Comparative analysis of codon adaptation index (CAI) values among EIAV and its hosts suggests that EIAV utilize the translational resources of horse more efficiently than that of donkey. Conclusion The codon usage bias in EIAV is slight and mutation pressure is the main factor that affects codon usage variation in EIAV. These results suggest that EIAV genomic biases are the result of the co-evolution of genome composition and the ability to evade the host’s immune response. PMID:24359511

  7. A Comprehensive Analysis of Codon Usage Patterns in Blunt Snout Bream (Megalobrama amblycephala) Based on RNA-Seq Data

    PubMed Central

    Duan, Xiaoke; Yi, Shaokui; Guo, Xianwu; Wang, Weimin

    2015-01-01

    Blunt snout bream (Megalobrama amblycephala) is an important fish species for its delicacy and high economic value in China. Codon usage analysis could be helpful to understand its codon biology, mRNA translation and vertebrate evolution. Based on RNA-Seq data for M. amblycephala, high-frequency codons (CUG, AGA, GUG, CAG and GAG), as well as low-frequency ones (NUA and NCG codons) were identified. A total of 724 high-frequency codon pairs were observed. Meanwhile, 14 preferred and 199 avoided neighboring codon pairs were also identified, but bias was almost not shown with one or more intervening codons inserted between the same pairs. Codon usage bias in the regions close to start and stop codons indicated apparent heterogeneity, which even occurs in the flanking nucleotide sequence. Codon usage bias (RSCU and SCUO) was related to GC3 (GC content of 3rd nucleotide in codon) bias. Six GO (Gene ontology) categories and the number of methylation targets were influenced by GC3. Codon usage patterns comparison among 23 vertebrates showed species specificities by using GC contents, codon usage and codon context analysis. This work provided new insights into fish biology and new information for breeding projects. PMID:26016504

  8. Analysis of synonymous codon usage bias in Chlamydia.

    PubMed

    Lü, Hui; Zhao, Wei-Ming; Zheng, Yan; Wang, Hong; Qi, Mei; Yu, Xiu-Ping

    2005-01-01

    Chlamydiae are obligate intracellular bacterial pathogens that cause ocular and sexually transmitted diseases, and are associated with cardiovascular diseases. The analysis of codon usage may improve our understanding of the evolution and pathogenesis of Chlamydia and allow reengineering of target genes to improve their expression for gene therapy. Here, we analyzed the codon usage of C. muridarum, C. trachomatis (here indicating biovar trachoma and LGV), C. pneumoniae, and C. psittaci using the codon usage database and the CUSP (Create a codon usage table) program of EMBOSS (The European Molecular Biology Open Software Suite). The results show that the four genomes have similar codon usage patterns, with a strong bias towards the codons with A and T at the third codon position. Compared with Homo sapiens, the four chlamydial species show discordant seven or eight preferred codons. The ENC (effective number of codons used in a gene)-plot reveals that the genetic heterogeneity in Chlamydia is constrained by the G+C content, while translational selection and gene length exert relatively weaker influences. Moreover, mutational pressure appears to be the major determinant of the codon usage variation among the chlamydial genes. In addition, we compared the codon preferences of C. trachomatis with those of E. coli, yeast, adenovirus and Homo sapiens. There are 23 codons showing distinct usage differences between C. trachomatis and E. coli, 24 between C. trachomatis and adenovirus, 21 between C. trachomatis and Homo sapiens, but only six codons between C. trachomatis and yeast. Therefore, the yeast system may be more suitable for the expression of chlamydial genes. Finally, we compared the codon preferences of C. trachomatis with those of six eukaryotes, eight prokaryotes and 23 viruses. There is a strong positive correlation between the differences in coding GC content and the variations in codon bias (r=0.905, P<0.001). We conclude that the variation of codon bias between C. trachomatis and other organisms is much less influenced by phylogenetic lineage and primarily determined by the extent of disparities in GC content. PMID:15645075

  9. The Effect of Multiple Evolutionary Selections on Synonymous Codon Usage of Genes in the Mycoplasma bovis Genome

    PubMed Central

    Zhou, Jian-hua; Ding, Yao-zhong; He, Ying; Chu, Yue-feng; Zhao, Ping; Ma, Li-ya; Wang, Xin-jun; Li, Xue-rui; Liu, Yong-sheng

    2014-01-01

    Mycoplasma bovis is a major pathogen causing arthritis, respiratory disease and mastitis in cattle. A better understanding of its genetic features and evolution might represent evidences of surviving host environments. In this study, multiple factors influencing synonymous codon usage patterns in M. bovis (three strains’ genomes) were analyzed. The overall nucleotide content of genes in the M. bovis genome is AT-rich. Although the G and C contents at the third codon position of genes in the leading strand differ from those in the lagging strand (p<0.05), the 59 synonymous codon usage patterns of genes in the leading strand are highly similar to those in the lagging strand. The over-represented codons and the under-represented codons were identified. A comparison of the synonymous codon usage pattern of M. bovis and cattle (susceptible host) indicated the independent formation of synonymous codon usage of M. bovis. Principal component analysis revealed that (i) strand-specific mutational bias fails to affect the synonymous codon usage pattern in the leading and lagging strands, (ii) mutation pressure from nucleotide content plays a role in shaping the overall codon usage, and (iii) the major trend of synonymous codon usage has a significant correlation with the gene expression level that is estimated by the codon adaptation index. The plot of the effective number of codons against the G+C content at the third codon position also reveals that mutation pressure undoubtedly contributes to the synonymous codon usage pattern of M. bovis. Additionally, the formation of the overall codon usage is determined by certain evolutionary selections for gene function classification (30S protein, 50S protein, transposase, membrane protein, and lipoprotein) and translation elongation region of genes in M. bovis. The information could be helpful in further investigations of evolutionary mechanisms of the Mycoplasma family and heterologous expression of its functionally important proteins. PMID:25350396

  10. [Codon usage bias in the straw mushroom Volvariella volvacea].

    PubMed

    Jiang, Wei; Lü, Beibei; He, Jianhua; Wang, Jinbin; Wu, Xiao; Wu, Guogan; Bao, Dapeng; Chen, Mingjie; Zhang, Jinsong; Tan, Qi; Tang, Xueming

    2014-09-01

    We analyzed the whole genome coding sequence of Volvariella volvacea to study the pattern utilization of codons by Codon W 1.4.2. As results, 24 optimal codons were identified. Moreover, the frequency of codons usage was calculated by CUSP program. We compared the frequency of codons usage of V. volvacea with other organisms including 6 modal value species (Homo sapiens, Saccharomys cerevisiae, Arabidopsis thalian, Mus musculus, Danio rerio and Drosophila melanogaster) and 4 edible fungi (Coprinopsis cinerea, Agaricus bisporus, Lentinula edodes and Pleurotus ostreatus). We found that there were less differences in 3 edible fungi (excluding Pleurotus ostreatus) than 6 modal value species, comparing with the frequency of codons usage of V. volvacea. With software SPSS16.0, cluster analysis which showed differences in the size of codon bias, reflects the evolutionary relationships between species, which can be used as a reference of evolutionary relationships of species. This was the first time for analysis the codon preference among the whole coding sequences of edible fungi, serving as theoretical basis to apply genetic engineering of V. volvacea. PMID:25720157

  11. Use and misuse of correspondence analysis in codon usage studies

    E-print Network

    Thioulouse, Jean

    different examples taken from the genomes of B.subtilis, E.coli, B.burgdorferi and M) and in rodents (22), for analysing trends in amino acid composition in E.coli (23) and for detecting sequencing still is) very popular for analysing codon usage biases in microbial genomes: it has been applied

  12. Patterns of codon usage bias in Silene latifolia.

    PubMed

    Qiu, Suo; Bergero, Roberta; Zeng, Kai; Charlesworth, Deborah

    2011-01-01

    Patterns of codon usage bias (CUB) convey useful information about the selection on synonymous codons induced by gene expression and contribute to an understanding of substitution patterns observed at synonymous sites. They can also be informative about the distinctive evolutionary properties of sex chromosomes such as genetic degeneration of the Y chromosome, dosage compensation, and hemizygosity of the X chromosome in males, which can affect the selection on codon usage. Here, we study CUB in Silene latifolia, a species of interest for studying the early stages of sex chromosome evolution. We have obtained a large expressed sequence tag data set containing more than 1,608 sequence fragments by 454 sequencing. Using three different methods, we conservatively define 21 preferred codons. Interestingly, the preferred codons in S. latifolia are almost identical to those in Arabidopsis thaliana, despite their long divergence time (we estimate average nonsynonymous site divergence to be 0.216, and synonymous sites are saturated). The agreement suggests that the nature of selection on codon usage has not changed significantly during the long evolutionary time separating the two species. As in many other organisms, the frequency of preferred codons is negatively correlated with protein length. For the 43 genes with both exon and intron sequences, we find a positive correlation between gene expression levels and GC content at third codon positions, but a strong negative correlation between expression and intron GC content, suggesting that the CUB we detect in S. latifolia is more likely to be due to natural selection than to mutational bias. Using polymorphism data, we detect evidence of ongoing natural selection on CUB, but we find little support for effects of biased gene conversion. An analysis of ten sex-linked genes reveals that the X chromosome has experienced significantly more unpreferred to preferred than preferred to unpreferred substitutions, suggesting that it may be evolving higher CUB. In contrast, numbers of substitutions between preferred and unpreferred codons are similar in both directions in the Y-linked genes, contrary to the expectation of genetic degeneration. PMID:20855431

  13. Intragenic spatial patterns of codon usage bias in prokaryotic and eukaryotic Hong Qin*,1

    E-print Network

    Wu, Wei-Biao

    1 Intragenic spatial patterns of codon usage bias in prokaryotic and eukaryotic genomes Hong Qin*,1 distribution of synonymous codon usage bias in four prokaryotic (Escherichia coli, Bacillus subtilis pattern using isotonic regression, we show that in yeast and prokaryotic genomes, codon usage bias

  14. Analysis of synonymous codon usage patterns in different plant mitochondrial genomes.

    PubMed

    Zhou, Meng; Li, Xia

    2009-11-01

    Codon usage in mitochondrial genome of the six different plants was analyzed to find general patterns of codon usage in plant mitochondrial genomes. The neutrality analysis indicated that the codon usage patterns of mitochondrial genes were more conserved in GC content and no correlation between GC12 and GC3. T and A ending codons were detected as the preferred codons in plant mitochondrial genomes. The Parity Rule 2 plot analysis showed that T was used more frequently than A. The EN(C)-plot showed that although a majority of the points with low EN(C) values were lying below the expected curve, a few genes lied on the expected curve. Correspondence analysis of relative synonymous codon usage yielded a first axis that explained only a partial amount of variation of codon usage. These findings suggest that natural selection is likely to be playing a large role in codon usage bias in plant mitochondrial genomes, but not only natural selection but also other several factors are likely to be involved in determining the selective constraints on codon bias in plant mitochondrial genomes. Meantime, 1 codon (P. patens), 6 codons (Z. mays), 9 codons (T. aestivum), 15 codons (A. thaliana), 15 codons (M. polymorpha) and 15 codons (N. tabacum) were defined as the preferred codons of the six plant mitochondrial genomes. PMID:19005776

  15. Genome-Wide Analysis of Codon Usage and Influencing Factors in Chikungunya Viruses

    PubMed Central

    Tong, Yigang

    2014-01-01

    Chikungunya virus (CHIKV) is an arthropod-borne virus of the family Togaviridae that is transmitted to humans by Aedes spp. mosquitoes. Its genome comprises a 12 kb single-strand positive-sense RNA. In the present study, we report the patterns of synonymous codon usage in 141 CHIKV genomes by calculating several codon usage indices and applying multivariate statistical methods. Relative synonymous codon usage (RSCU) analysis showed that the preferred synonymous codons were G/C and A-ended. A comparative analysis of RSCU between CHIKV and its hosts showed that codon usage patterns of CHIKV are a mixture of coincidence and antagonism. Similarity index analysis showed that the overall codon usage patterns of CHIKV have been strongly influenced by Pan troglodytes and Aedes albopictus during evolution. The overall codon usage bias was low in CHIKV genomes, as inferred from the analysis of effective number of codons (ENC) and codon adaptation index (CAI). Our data suggested that although mutation pressure dominates codon usage in CHIKV, patterns of codon usage in CHIKV are also under the influence of natural selection from its hosts and geography. To the best of our knowledge, this is first report describing codon usage analysis in CHIKV genomes. The findings from this study are expected to increase our understanding of factors involved in viral evolution, and fitness towards hosts and the environment. PMID:24595095

  16. Synonymous codon usage bias in 16 Staphylococcus aureus phages: Implication in phage therapy

    Microsoft Academic Search

    K. Sau; S. K. Gupta; S. Sau; T. C. Ghosh

    2005-01-01

    To reveal the factors influencing architecture of protein-coding genes in staphylococcal phages, relative synonymous codon usage variation has been investigated in 920 protein-coding genes of 16 staphylococcal phages. As expected for AT rich genomes, there are predominantly A and T ending codons in all 16 phages. Both Nc plot and correspondence analysis on relative synonymous codon usage indicates that mutation

  17. A PECULIAR CODON USAGE PATTERN REVEALED AFTER REMOVING THE EFFECT OF DNA METHYLATION

    Microsoft Academic Search

    Xuhua Xia

    Summary DNA methylation and deamination increases the C?T mutation rate in CpG dinucleotides, especially in vertebrate genomes. This has profound effect on codon usage in heavily vertebrate genomes, and may obscure the effect of other factors on codon usage bias. We have classified the sense codons into three groups: those decreased by DNA methylation (i.e., CpG-containing codons), those increased by

  18. Pandemic influenza A virus codon usage revisited: biases, adaptation and implications for vaccine strain development

    PubMed Central

    2012-01-01

    Background Influenza A virus (IAV) is a member of the family Orthomyxoviridae and contains eight segments of a single-stranded RNA genome with negative polarity. The first influenza pandemic of this century was declared in April of 2009, with the emergence of a novel H1N1 IAV strain (H1N1pdm) in Mexico and USA. Understanding the extent and causes of biases in codon usage is essential to the understanding of viral evolution. A comprehensive study to investigate the effect of selection pressure imposed by the human host on the codon usage of an emerging, pandemic IAV strain and the trends in viral codon usage involved over the pandemic time period is much needed. Results We performed a comprehensive codon usage analysis of 310 IAV strains from the pandemic of 2009. Highly biased codon usage for Ala, Arg, Pro, Thr and Ser were found. Codon usage is strongly influenced by underlying biases in base composition. When correspondence analysis (COA) on relative synonymous codon usage (RSCU) is applied, the distribution of IAV ORFs in the plane defined by the first two major dimensional factors showed that different strains are located at different places, suggesting that IAV codon usage also reflects an evolutionary process. Conclusions A general association between codon usage bias, base composition and poor adaptation of the virus to the respective host tRNA pool, suggests that mutational pressure is the main force shaping H1N1 pdm IAV codon usage. A dynamic process is observed in the variation of codon usage of the strains enrolled in these studies. These results suggest a balance of mutational bias and natural selection, which allow the virus to explore and re-adapt its codon usage to different environments. Recoding of IAV taking into account codon bias, base composition and adaptation to host tRNA may provide important clues to develop new and appropriate vaccines. PMID:23134595

  19. Patterns of Synonymous Codon Usage on Human Metapneumovirus and Its Influencing Factors

    PubMed Central

    Zhong, Qiao; Xu, Weidong; Wu, Yuanjian; Xu, Hongxing

    2012-01-01

    Human metapneumovirus (HMPV) is an important agent of acute respiratory tract infection in children, while its pathogenicity and molecular evolution are lacking. Herein, we firstly report the synonymous codon usage patterns of HMPV genome. The relative synonymous codon usage (RSCU) values, effective number of codon (ENC) values, nucleotide contents, and correlation analysis were performed among 17 available whole genome of HMPV, including different genotypes. All preferred codons in HMPV are ended with A/U nucleotide and exhibited a great association with its high proportion of these two nucleotides in their genomes. Mutation pressure rather than natural selection is the main influence factor that determines the bias of synonymous codon usage in HMPV. The complementary pattern of codon usage bias between HMPV and human cell was observed, and this phenomenon suggests that host cells might be also act as an important factor to affect the codon usage bias. Moreover, the codon usage biases in each HMPV genotypes are separated into different clades, which suggest that phylogenetic distance might involve in codon usage bias formation as well. These analyses of synonymous codon usage bias in HMPV provide more information for better understanding its evolution and pathogenicity. PMID:23193361

  20. Mapping codon usage in sequence regions flanking cleavage positions in the hepatitis A virus polyprotein.

    PubMed

    Ma, X-X; Feng, Y-P; Chen, L; Zhao, Y-Q; Liu, J-L; Guo, J-Z; Guo, P-H; Yang, J-T; Lu, J-X; Chen, S-E; Ma, Z-R

    2013-01-01

    To analyze the synonymous codon usage patterns of sequence regions flanking cleavage sites in the hepatitis A virus (HAV) polyprotein, the codon usage bias at codon positions and the synonymous codon usage in the target contexts of 30 virus strains were estimated by two simple methods that were based on the values for relative synonymous codon usage. In addition, the pattern of synonymous codon usage was compared between the genomic sequences in HAV and those of its human host. Our results indicated that HAV adopts a combination of coincidence and antagonism with the synonymous codon usage in humans. This characteristic may help HAV to efficiently use the translational machinery in its human host. We also observed that codon usage exhibited a strong bias in some specific positions in these contexts, and that the underrepresented synonymous codons, CUA for Leu, ACG for Thr, GUA for Val, and UCG for Ser, are preferentially used in these positions. These underrepresented synonymous codons likely play roles in regulating the rate of protein translation and influencing the secondary structure of the sequence regions flanking the cleavage sites. PMID:23884773

  1. Codon usage patterns in Chinese bayberry (Myrica rubra) based on RNA-Seq data

    PubMed Central

    2013-01-01

    Background Codon usage analysis has been a classical topic for decades and has significances for studies of evolution, mRNA translation, and new gene discovery, etc. While the codon usage varies among different members of the plant kingdom, indicating the necessity for species-specific study, this work has mostly been limited to model organisms. Recently, the development of deep sequencing, especial RNA-Seq, has made it possible to carry out studies in non-model species. Result RNA-Seq data of Chinese bayberry was analyzed to investigate the bias of codon usage and codon pairs. High frequency codons (AGG, GCU, AAG and GAU), as well as low frequency ones (NCG and NUA codons) were identified, and 397 high frequency codon pairs were observed. Meanwhile, 26 preferred and 141 avoided neighboring codon pairs were also identified, which showed more significant bias than the same pairs with one or more intervening codons. Codon patterns were also analyzed at the plant kingdom, organism and gene levels. Changes during plant evolution were evident using RSCU (relative synonymous codon usage), which was even more significant than GC3s (GC content of 3rd synonymous codons). Nine GO categories were differentially and independently influenced by CAI (codon adaptation index) or GC3s, especially in 'Molecular function’ category. Within a gene, the average CAI increased from 0.720 to 0.785 in the first 50 codons, and then more slowly thereafter. Furthermore, the preferred as well as avoided codons at the position just following the start codon AUG were identified and discussed in relation to the key positions in Kozak sequences. Conclusion A comprehensive codon usage Table and number of high-frequency codon pairs were established. Bias in codon usage as well as in neighboring codon pairs was observed, and the significance of this in avoiding DNA mutation, increasing protein production and regulating protein synthesis rate was proposed. Codon usage patterns at three levels were revealed and the significance in plant evolution analysis, gene function classification, and protein translation start site predication were discussed. This work promotes the study of codon biology, and provides some reference for analysis and comprehensive application of RNA-Seq data from other non-model species. PMID:24160180

  2. Genomic adaptation of the ISA virus to Salmo salar codon usage

    PubMed Central

    2013-01-01

    Background The ISA virus (ISAV) is an Orthomyxovirus whose genome encodes for at least 10 proteins. Low protein identity and lack of genetic tools have hampered the study of the molecular mechanism behind its virulence. It has been shown that viral codon usage controls several processes such as translational efficiency, folding, tuning of protein expression, antigenicity and virulence. Despite this, the possible role that adaptation to host codon usage plays in virulence and viral evolution has not been studied in ISAV. Methods Intergenomic adaptation between viral and host genomes was calculated using the codon adaptation index score with EMBOSS software and the Kazusa database. Classification of host genes according to GeneOnthology was performed using Blast2go. A non parametric test was applied to determine the presence of significant correlations among CAI, mortality and time. Results Using the codon adaptation index (CAI) score, we found that the encoding genes for nucleoprotein, matrix protein M1 and antagonist of Interferon I signaling (NS1) are the ISAV genes that are more adapted to host codon usage, in agreement with their requirement for production of viral particles and inactivation of antiviral responses. Comparison to host genes showed that ISAV shares CAI values with less than 0.45% of Salmo salar genes. GeneOntology classification of host genes showed that ISAV genes share CAI values with genes from less than 3% of the host biological process, far from the 14% shown by Influenza A viruses and closer to the 5% shown by Influenza B and C. As well, we identified a positive correlation (p<0.05) between CAI values of a virus and the duration of the outbreak disease in given salmon farms, as well as a weak relationship between codon adaptation values of PB1 and the mortality rates of a set of ISA viruses. Conclusions Our analysis shows that ISAV is the least adapted viral Salmo salar pathogen and Orthomyxovirus family member less adapted to host codon usage, avoiding the general behavior of host genes. This is probably due to its recent emergence among farmed Salmon populations. PMID:23829271

  3. Comparative Analysis of Codon Usage Bias Patterns in Microsporidian Genomes

    PubMed Central

    Xiang, Heng; Zhang, Ruizhi; Butler, Robert R.; Liu, Tie; Zhang, Li; Pombert, Jean-François; Zhou, Zeyang

    2015-01-01

    The sub-3 Mbp genomes from microsporidian species of the Encephalitozoon genus are the smallest known among eukaryotes and paragons of genomic reduction and compaction in parasites. However, their diminutive stature is not characteristic of all Microsporidia, whose genome sizes vary by an order of magnitude. This large variability suggests that different evolutionary forces are applied on the group as a whole. In this study, we have compared the codon usage bias (CUB) between eight taxonomically distinct microsporidian genomes: Encephalitozoon intestinalis, Encephalitozoon cuniculi, Spraguea lophii, Trachipleistophora hominis, Enterocytozoon bieneusi, Nematocida parisii, Nosema bombycis and Nosema ceranae. While the CUB was found to be weak in all eight Microsporidia, nearly all (98%) of the optimal codons in S. lophii, T. hominis, E. bieneusi, N. parisii, N. bombycis and N. ceranae are fond of A/U in third position whereas most (64.6%) optimal codons in the Encephalitozoon species E. intestinalis and E. cuniculi are biased towards G/C. Although nucleotide composition biases are likely the main factor driving the CUB in Microsporidia according to correlation analyses, directed mutational pressure also likely affects the CUB as suggested by ENc-plots, correspondence and neutrality analyses. Overall, the Encephalitozoon genomes were found to be markedly different from the other microsporidians and, despite being the first sequenced representatives of this lineage, are uncharacteristic of the group as a whole. The disparities observed cannot be attributed solely to differences in host specificity and we hypothesize that other forces are at play in the lineage leading to Encephalitozoon species. PMID:26057384

  4. A Comparative Analysis of Synonymous Codon Usage Bias Pattern in Human Albumin Superfamily

    PubMed Central

    Mirsafian, Hoda; Mat Ripen, Adiratna; Singh, Aarti; Teo, Phaik Hwan; Merican, Amir Feisal; Mohamad, Saharuddin Bin

    2014-01-01

    Synonymous codon usage bias is an inevitable phenomenon in organismic taxa across the three domains of life. Though the frequency of codon usage is not equal across species and within genome in the same species, the phenomenon is non random and is tissue-specific. Several factors such as GC content, nucleotide distribution, protein hydropathy, protein secondary structure, and translational selection are reported to contribute to codon usage preference. The synonymous codon usage patterns can be helpful in revealing the expression pattern of genes as well as the evolutionary relationship between the sequences. In this study, synonymous codon usage bias patterns were determined for the evolutionarily close proteins of albumin superfamily, namely, albumin, ?-fetoprotein, afamin, and vitamin D-binding protein. Our study demonstrated that the genes of the four albumin superfamily members have low GC content and high values of effective number of codons (ENC) suggesting high expressivity of these genes and less bias in codon usage preferences. This study also provided evidence that the albumin superfamily members are not subjected to mutational selection pressure. PMID:24707212

  5. Codon usage in Caenorhabditis elegans: delineation of translational selection and mutational biases.

    PubMed Central

    Stenico, M; Lloyd, A T; Sharp, P M

    1994-01-01

    Synonymous codon usage varies considerably among Caenorhabditis elegans genes. Multivariate statistical analyses reveal a single major trend among genes. At one end of the trend lie genes with relatively unbiased codon usage. These genes appear to be lowly expressed, and their patterns of codon usage are consistent with mutational biases influenced by the neighbouring nucleotide. At the other extreme lie genes with extremely biased codon usage. These genes appear to be highly expressed, and their codon usage seems to have been shaped by selection favouring a limited number of translationally optimal codons. Thus, the frequency of these optimal codons in a gene appears to be correlated with the level of gene expression, and may be a useful indicator in the case of genes (or open reading frames) whose expression levels (or even function) are unknown. A second, relatively minor trend among genes is correlated with the frequency of G at synonymously variable sites. It is not yet clear whether this trend reflects variation in base composition (or mutational biases) among regions of the C.elegans genome, or some other factor. Sequence divergence between C.elegans and C.briggsae has also been studied. PMID:8041603

  6. Characterization of codon usage bias in the gI gene of duck enteritis virus

    Microsoft Academic Search

    Lijuan Li; Anchun Cheng; Mingshu Wang; Shunchuan Zhang; Dekang Zhu; Renyong Jia; Qihui Luo; Yi Zhou; Zhengli Chen; Xiaoyue Chen

    2010-01-01

    The analysis on codon usage bias of gI gene of duck enteritis virus (DEV) may provide a basis for understanding the evolution and molecular characteristic of DEV, and for selecting appropriate host expression systems to improve the expression of target gene. A comparative analysis of the codon usage bias of the DEV gI gene and 22 other refrence herpesviruses gI-like

  7. Decoding properties of tRNA leave a detectable signal in codon usage bias

    PubMed Central

    Roth, Alexander C.

    2012-01-01

    Motivation: The standard genetic code translates 61 codons into 20 amino acids using fewer than 61 transfer RNAs (tRNAs). This is possible because of the tRNA's ability to ‘wobble’ at the third base to decode more than one codon. Although the anticodon–codon mapping of tRNA to mRNA is a prerequisite for certain codon usage indices and can contribute to the understanding of the evolution of alternative genetic codes, it is usually not determined experimentally because such assays are prohibitively expensive and elaborate. Instead, the codon reading is approximated from theoretical inferences of nucleotide binding, the wobble rules. Unfortunately, these rules fail to capture all of the nuances of codon reading. This study addresses the codon reading properties of tRNAs and their evolutionary impact on codon usage bias. Results: Using three different computational methods, the signal of tRNA decoding in codon usage bias is identified. The predictions by the methods generally agree with each other and compare well with experimental evidence of codon reading. This analysis suggests a revised codon reading for cytosolic tRNA in the yeast genome (Saccharomyces cerevisiae) that is more accurate than the common assignment by wobble rules. The results confirm the earlier observation that the wobble rules are not sufficient for a complete description of codon reading, because they depend on genome-specific factors. The computational methods presented here are applicable to any fully sequenced genome. Availability: By request from the author. Contact: alexander.roth@isb-sib.ch PMID:22962450

  8. [Analysis of codon usage in potato and its application in the modification of t-PA gene].

    PubMed

    Bai, Xi; Xu, Jian-Zhen; Li, Lin; Guo, Zheng; Li, Jie; Zhu, Yan-Ming

    2004-01-01

    Bioperl-1.0 was used under Hongqi LINUX system to program the codon analysis software. According to the analysis of 98 codon DNA sequences with this software, the codon usage in potato was calculated and 4 codons have been inferred to the optimal codons. The codons of tissue plasminogen activator (t-PA) gene sequence have been reconstructed according to the results. The t-PA gene sequence containing the optimal codons of potato will be used for t-PA production by potato bioreactor. PMID:15626672

  9. Evidence for stabilizing selection on codon usage in chromosomal rearrangements of Drosophila pseudoobscura.

    PubMed

    Fuller, Zachary L; Haynes, Gwilym D; Zhu, Dianhui; Batterton, Matthew; Chao, Hsu; Dugan, Shannon; Javaid, Mehwish; Jayaseelan, Joy C; Lee, Sandra; Li, Mingmei; Ongeri, Fiona; Qi, Sulan; Han, Yi; Doddapaneni, Harshavardhan; Richards, Stephen; Schaeffer, Stephen W

    2014-12-01

    There has been a renewed interest in investigating the role of stabilizing selection acting on genome-wide traits such as codon usage bias. Codon bias, when synonymous codons are used at unequal frequencies, occurs in a wide variety of taxa. Standard evolutionary models explain the maintenance of codon bias through a balance of genetic drift, mutation and weak purifying selection. The efficacy of selection is expected to be reduced in regions of suppressed recombination. Contrary to observations in Drosophila melanogaster, some recent studies have failed to detect a relationship between the recombination rate, intensity of selection acting at synonymous sites, and the magnitude of codon bias as predicted under these standard models. Here, we examined codon bias in 2798 protein coding loci on the third chromosome of D. pseudoobscura using whole-genome sequences of 47 individuals, representing five common third chromosome gene arrangements. Fine-scale recombination maps were constructed using more than 1 million segregating sites. As expected, recombination was demonstrated to be significantly suppressed between chromosome arrangements, allowing for a direct examination of the relationship between recombination, selection, and codon bias. As with other Drosophila species, we observe a strong mutational bias away from the most frequently used codons. We find the rate of synonymous and nonsynonymous polymorphism is variable between different amino acids. However, we do not observe a reduction in codon bias or the strength of selection in regions of suppressed recombination as expected. Instead, we find that the interaction between weak stabilizing selection and mutational bias likely plays a role in shaping the composition of synonymous codons across the third chromosome in D. pseudoobscura. PMID:25326424

  10. Evidence for Stabilizing Selection on Codon Usage in Chromosomal Rearrangements of Drosophila pseudoobscura

    PubMed Central

    Fuller, Zachary L.; Haynes, Gwilym D.; Zhu, Dianhui; Batterton, Matthew; Chao, Hsu; Dugan, Shannon; Javaid, Mehwish; Jayaseelan, Joy C.; Lee, Sandra; Li, Mingmei; Ongeri, Fiona; Qi, Sulan; Han, Yi; Doddapaneni, Harshavardhan; Richards, Stephen; Schaeffer, Stephen W.

    2014-01-01

    There has been a renewed interest in investigating the role of stabilizing selection acting on genome-wide traits such as codon usage bias. Codon bias, when synonymous codons are used at unequal frequencies, occurs in a wide variety of taxa. Standard evolutionary models explain the maintenance of codon bias through a balance of genetic drift, mutation and weak purifying selection. The efficacy of selection is expected to be reduced in regions of suppressed recombination. Contrary to observations in Drosophila melanogaster, some recent studies have failed to detect a relationship between the recombination rate, intensity of selection acting at synonymous sites, and the magnitude of codon bias as predicted under these standard models. Here, we examined codon bias in 2798 protein coding loci on the third chromosome of D. pseudoobscura using whole-genome sequences of 47 individuals, representing five common third chromosome gene arrangements. Fine-scale recombination maps were constructed using more than 1 million segregating sites. As expected, recombination was demonstrated to be significantly suppressed between chromosome arrangements, allowing for a direct examination of the relationship between recombination, selection, and codon bias. As with other Drosophila species, we observe a strong mutational bias away from the most frequently used codons. We find the rate of synonymous and nonsynonymous polymorphism is variable between different amino acids. However, we do not observe a reduction in codon bias or the strength of selection in regions of suppressed recombination as expected. Instead, we find that the interaction between weak stabilizing selection and mutational bias likely plays a role in shaping the composition of synonymous codons across the third chromosome in D. pseudoobscura. PMID:25326424

  11. Unexpected correlations between gene expression and codon usage bias from microarray data for the whole Escherichia coli K-12 genome

    Microsoft Academic Search

    Mario dos Reis; Lorenz Wernisch; Renos Savva

    2003-01-01

    Escherichia coli has long been regarded as a model organism in the study of codon usage bias (CUB). However, most studies in this organism regarding this topic have been computational or, when experi- mental, restricted to small datasets; particularly poor attention has been given to genes with low CUB. In this work, correspondence analysis on codon usage is used to

  12. Viral adaptation to host: a proteome-based analysis of codon usage and amino acid preferences

    Microsoft Academic Search

    Iris Bahir; Menachem Fromer; Yosef Prat; Michal Linial

    2009-01-01

    Viruses differ markedly in their specificity toward host organisms. Here, we test the level of general sequence adaptation that viruses display toward their hosts. We compiled a representative data set of viruses that infect hosts ranging from bacteria to humans. We consider their respective amino acid and codon usages and compare them among the viruses and their hosts. We show

  13. Protein elemental sparing and codon usage bias are correlated among bacteria

    E-print Network

    Wagner, Andreas

    , in terms of the quantities of carbon (C), nitrogen (N) or sulphur (S) atoms they contain. This `elemental that are relatively poor in elements that can be growth limiting (carbon, nitrogen or sulphur). As evidenceProtein elemental sparing and codon usage bias are correlated among bacteria JASON G. BRAGG

  14. Is DNA Code Periodicity Only Due to CUF - Codons Usage Frequency?

    Microsoft Academic Search

    Mariusz Zoltowski; Nicolaus Copernicus

    2007-01-01

    The triplet code for proteins and functional RNA has been either from the universal pattern of ancient RNA (- HI) [1], with a key role of an uneven codon usage frequency (CUF) in the periodic patterns origination, or a reading frame monitoring device (RFMD -H2) [2- 4]. HI has lately been upheld [1] but in a single sequence sensitive way

  15. Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes

    NASA Astrophysics Data System (ADS)

    Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.

    2012-02-01

    Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.

  16. Codon-usage bias versus gene conversion in the evolution of yeast duplicate genes

    PubMed Central

    Lin, Yeong-Shin; Byrnes, Jake K.; Hwang, Jenn-Kang; Li, Wen-Hsiung

    2006-01-01

    Many Saccharomyces cerevisiae duplicate genes that were derived from an ancient whole-genome duplication (WGD) unexpectedly show a small synonymous divergence (KS), a higher sequence similarity to each other than to orthologues in Saccharomyces bayanus, or slow evolution compared with the orthologue in Kluyveromyces waltii, a non-WGD species. This decelerated evolution was attributed to gene conversion between duplicates. Using ?300 WGD gene pairs in four species and their orthologues in non-WGD species, we show that codon-usage bias and protein-sequence conservation are two important causes for decelerated evolution of duplicate genes, whereas gene conversion is effective only in the presence of strong codon-usage bias or protein-sequence conservation. Furthermore, we find that change in mutation pattern or in tDNA copy number changed codon-usage bias and increased the KS distance between K. waltii and S. cerevisiae. Intriguingly, some proteins showed fast evolution before the radiation of WGD species but little or no sequence divergence between orthologues and paralogues thereafter, indicating that functional conservation after the radiation may also be responsible for decelerated evolution in duplicates. PMID:16971485

  17. Mutational and Selective Pressures on Codon and Amino Acid Usage in Buchnera, Endosymbiotic Bacteria of Aphids

    PubMed Central

    Rispe, Claude; Delmotte, François; van Ham, Roeland C.H.J.; Moya, Andres

    2004-01-01

    We have explored compositional variation at synonymous (codon usage) and nonsynonymous (amino acid usage) positions in three complete genomes of Buchnera, endosymbiotic bacteria of aphids, and also in their orthologs in Escherichia coli, a close free-living relative. We sought to discriminate genes of variable expression levels in order to weigh the relative contributions of mutational bias and selection in the genomic changes following symbiosis. We identified clear strand asymmetries, distribution biases (putative high-expression genes were found more often on the leading strand), and a residual slight codon bias within each strand. Amino acid usage was strongly biased in putative high-expression genes, characterized by avoidance of aromatic amino acids, but above all by greater conservation and resistance to AT enrichment. Despite the almost complete loss of codon bias and heavy mutational pressure, selective forces are still strong at nonsynonymous sites of a fraction of the genome. However, Buchnera from Baizongia pistaciae appears to have suffered a stronger symbiotic syndrome than the two other species. PMID:14672975

  18. Analysis of Synonymous Codon Usage Bias in Pseudomonas Syringae Phages: Implication in Phage Therapy for Halo Blight Disease

    Microsoft Academic Search

    Shashank Sharma; Ambrish Sharan Vidyarthi; Raju Poddar

    2008-01-01

    Halo blight disease caused due Pseudomonas syringae results extensive losses in dry Beans. Phage therapy can be tried as an alternative treatment. For evaluation of synonymous codon usage and codon variation, 20 phages of Pseudomonas has been taken for testing. The effect of GC concentration in the phages can be consid- ered for analyzing virulence in these phages. Mutational biasing

  19. On the Limitations of Using Ribosomal Genes as References for the Study of Codon Usage: A Rebuttal

    E-print Network

    Petrov, Dmitri

    , used ribosomal genes as a reference set for the study of patterns of codon usage. We discuss here Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided codon bias (reviewed in [1,2]). The nucleotide content of the genome at large is explained by background

  20. Codon Usage Bias Covaries With Expression Breadth and the Rate of Synonymous Evolution in Humans, but This Is Not Evidence for Selection

    Microsoft Academic Search

    Araxi O. Urrutia; Laurence D. Hurst

    In numerous species, from bacteria to Drosophila, evidence suggests that selection acts even on synony- mous codon usage: codon bias is greater in more abundantly expressed genes, the rate of synonymous evolution is lower in genes with greater codon bias, and there is consistency between genes in the same species in which codons are preferred. In contrast, in mammals, while

  1. Predicting Gene Expression Level from Relative Codon Usage Bias: An Application to Escherichia coli Genome

    PubMed Central

    Roymondal, Uttam; Das, Shibsankar; Sahoo, Satyabrata

    2009-01-01

    We present an expression measure of a gene, devised to predict the level of gene expression from relative codon bias (RCB). There are a number of measures currently in use that quantify codon usage in genes. Based on the hypothesis that gene expressivity and codon composition is strongly correlated, RCB has been defined to provide an intuitively meaningful measure of an extent of the codon preference in a gene. We outline a simple approach to assess the strength of RCB (RCBS) in genes as a guide to their likely expression levels and illustrate this with an analysis of Escherichia coli (E. coli) genome. Our efforts to quantitatively predict gene expression levels in E. coli met with a high level of success. Surprisingly, we observe a strong correlation between RCBS and protein length indicating natural selection in favour of the shorter genes to be expressed at higher level. The agreement of our result with high protein abundances, microarray data and radioactive data demonstrates that the genomic expression profile available in our method can be applied in a meaningful way to the study of cell physiology and also for more detailed studies of particular genes of interest. PMID:19131380

  2. Viral Proteins Originated De Novo by Overprinting Can Be Identified by Codon Usage: Application to the “Gene Nursery” of Deltaretroviruses

    PubMed Central

    Pavesi, Angelo; Magiorkinis, Gkikas; Karlin, David G.

    2013-01-01

    A well-known mechanism through which new protein-coding genes originate is by modification of pre-existing genes, e.g. by duplication or horizontal transfer. In contrast, many viruses generate protein-coding genes de novo, via the overprinting of a new reading frame onto an existing (“ancestral”) frame. This mechanism is thought to play an important role in viral pathogenicity, but has been poorly explored, perhaps because identifying the de novo frames is very challenging. Therefore, a new approach to detect them was needed. We assembled a reference set of overlapping genes for which we could reliably determine the ancestral frames, and found that their codon usage was significantly closer to that of the rest of the viral genome than the codon usage of de novo frames. Based on this observation, we designed a method that allowed the identification of de novo frames based on their codon usage with a very good specificity, but intermediate sensitivity. Using our method, we predicted that the Rex gene of deltaretroviruses has originated de novo by overprinting the Tax gene. Intriguingly, several genes in the same genomic region have also originated de novo and encode proteins that regulate the functions of Tax. Such “gene nurseries” may be common in viral genomes. Finally, our results confirm that the genomic GC content is not the only determinant of codon usage in viruses and suggest that a constraint linked to translation must influence codon usage. PMID:23966842

  3. A simple model based on mutation and selection explains trends in codon and amino-acid usage and GC composition within and across genomes

    Microsoft Academic Search

    Robin D Knight; Stephen J Freeland; Laura F Landweber

    2001-01-01

    BACKGROUND: Correlations between genome composition (in terms of GC content) and usage of particular codons and amino acids have been widely reported, but poorly explained. We show here that a simple model of processes acting at the nucleotide level explains codon usage across a large sample of species (311 bacteria, 28 archaea and 257 eukaryotes). The model quantitatively predicts responses

  4. Tackling codon usage bias for heterologous expression in Rhodobacter sphaeroides by supplementation of rare tRNAs.

    PubMed

    Cheng, Danhui; Wang, Ri; Prather, Kristala Jones; Chow, King Lau; Hsing, I-Ming

    2015-05-01

    The photosynthetic Rhodobacter species are promising alternative expression hosts in bioproduction and biorefinery due to their unique metabolic capacities. With prominent inner membrane areas and efficient endogenous translocation machineries, they are especially attractive for membrane protein expression. However, codon usage bias could be a limitation in the engineering of Rhodobacter species and has seldom been investigated. In this study, we tackled the codon bias of Rhodobacter by functionally expressing 8 rare tRNAs of Rhodobacter sphaeroides with a multi-copy vector. The impact of tRNA supplementation was evaluated through monitoring expression levels of two heterologous proteins with different phylogenetic origins, a membrane subunit of the riboflavin transporter, RibU, from Lactobacillus acidophilus La-14 and a decaheme cytochrome, MtrA, from Shewanella oneidensis. Our results showed that the performances were closely related to medium composition and rare codon percentages of raw DNA sequences. Provision of rare tRNAs has increased RibU production by 7.7-folds and 2.86-fold in minimal medium and rich medium, respectively, while MtrA levels were increased by 1-fold in minimal medium. The present study confirms the presence of codon bias in R. sphaeroides and offers a facile tool for improving heterologous expression of rare-codon containing genes. We anticipate that this tRNA supplementation system can be further extended to other species of Rhodobacter, and thus will facilitate the engineering of purple bacteria for interesting applications in microbial technology. PMID:25837504

  5. Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum

    Microsoft Academic Search

    Hubert Charles; Federica Calevro; J. Vinuelas; J.-M. Fayard; Y. Rahbe

    2006-01-01

    Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidi- cola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codon usage in Buchnera has been overcome by the high mutational

  6. Synonymous Codon Usage Bias in Plant Mitochondrial Genes Is Associated with Intron Number and Mirrors Species Evolution

    PubMed Central

    Zhao, Mingming; Yin, Xunhao; Xia, Guangmin; Wang, Mengcheng

    2015-01-01

    Synonymous codon usage bias (SCUB) is a common event that a non-uniform usage of codons often occurs in nearly all organisms. We previously found that SCUB is correlated with both intron number and exon position in the plant nuclear genome but not in the plastid genome; SCUB in both nuclear and plastid genome can mirror the evolutionary specialization. However, how about the rules in the mitochondrial genome has not been addressed. Here, we present an analysis of SCUB in the mitochondrial genome, based on 24 plant species ranging from algae to land plants. The frequencies of NNA and NNT (A- and T-ending codons) are higher than those of NNG and NNC, with the strongest preference in bryophytes and the weakest in land plants, suggesting an association between SCUB and plant evolution. The preference for NNA and NNT is more evident in genes harboring a greater number of introns in land plants, but the bias to NNA and NNT exhibits even among exons. The pattern of SCUB in the mitochondrial genome differs in some respects to that present in both the nuclear and plastid genomes. PMID:26110418

  7. Analysis of codon usage diversity of bacterial genes with a self-organizing map (SOM): characterization of horizontally transferred genes with emphasis on the E. coli O157 genome

    Microsoft Academic Search

    Shigehiko Kanaya; Makoto Kinouchia; Takashi Abea; Yoshihiro Kudoe; Yuko Yamadae; Tatsuya Nishid; Hirotada Morib; Toshimichi Ikemuraf

    2001-01-01

    With increases in the amounts of available DNA sequence data, it has become increasingly important to develop tools for comprehensive systematic analysis and comparison of species-specific characteristics of protein-coding sequences for a wide variety of genomes. In the present study, we used a novel neural-network algorithm, a self-organizing map (SOM), to efficiently and comprehensively analyze codon usage in approximately 60,000

  8. Regularities of context-dependent codon bias in eukaryotic genes

    PubMed Central

    Fedorov, Alexei; Saxonov, Serge; Gilbert, Walter

    2002-01-01

    Nucleotides surrounding a codon influence the choice of this particular codon from among the group of possible synonymous codons. The strongest influence on codon usage arises from the nucleotide immediately following the codon and is known as the N1 context. We studied the relative abundance of codons with N1 contexts in genes from four eukaryotes for which the entire genomes have been sequenced: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana. For all the studied organisms it was found that 90% of the codons have a statistically significant N1 context-dependent codon bias. The relative abundance of each codon with an N1 context was compared with the relative abundance of the same 4mer oligonucleotide in the whole genome. This comparison showed that in about half of all cases the context-dependent codon bias could not be explained by the sequence composition of the genome. Ranking statistics were applied to compare context-dependent codon biases for codons from different synonymous groups. We found regularities in N1 context-dependent codon bias with respect to the codon nucleotide composition. Codons with the same nucleotides in the second and third positions and the same N1 context have a statistically significant correlation of their relative abundances. PMID:11861911

  9. Regularities of context-dependent codon bias in eukaryotic genes.

    PubMed

    Fedorov, Alexei; Saxonov, Serge; Gilbert, Walter

    2002-03-01

    Nucleotides surrounding a codon influence the choice of this particular codon from among the group of possible synonymous codons. The strongest influence on codon usage arises from the nucleotide immediately following the codon and is known as the N1 context. We studied the relative abundance of codons with N1 contexts in genes from four eukaryotes for which the entire genomes have been sequenced: Homo sapiens, Drosophila melanogaster, Caenorhabditis elegans and Arabidopsis thaliana. For all the studied organisms it was found that 90% of the codons have a statistically significant N1 context-dependent codon bias. The relative abundance of each codon with an N1 context was compared with the relative abundance of the same 4mer oligonucleotide in the whole genome. This comparison showed that in about half of all cases the context-dependent codon bias could not be explained by the sequence composition of the genome. Ranking statistics were applied to compare context-dependent codon biases for codons from different synonymous groups. We found regularities in N1 context-dependent codon bias with respect to the codon nucleotide composition. Codons with the same nucleotides in the second and third positions and the same N1 context have a statistically significant correlation of their relative abundances. PMID:11861911

  10. Hepatitis A Virus Adaptation to Cellular Shutoff Is Driven by Dynamic Adjustments of Codon Usage and Results in the Selection of Populations with Altered Capsids

    PubMed Central

    Costafreda, M. Isabel; Pérez-Rodriguez, Francisco J.; D'Andrea, Lucía; Guix, Susana; Ribes, Enric; Bosch, Albert

    2014-01-01

    ABSTRACT Hepatitis A virus (HAV) has a highly biased and deoptimized codon usage compared to the host cell and fails to inhibit host protein synthesis. It has been proposed that an optimal combination of abundant and rare codons controls the translation speed required for the correct capsid folding. The artificial shutoff host protein synthesis results in the selection of variants containing mutations in the HAV capsid coding region critical for folding, stability, and function. Here, we show that these capsid mutations resulted in changes in their antigenicity; in a reduced stability to high temperature, low pH, and biliary salts; and in an increased efficacy of cell entry. In conclusion, the adaptation to cellular shutoff resulted in the selection of large-plaque-producing virus populations. IMPORTANCE HAV has a naturally deoptimized codon usage with respect to that of its cell host and is unable to shut down the cellular translation. This fact contributes to the low replication rate of the virus, in addition to other factors such as the highly inefficient internal ribosome entry site (IRES), and explains the outstanding physical stability of this pathogen in the environment mediated by a folding-dependent highly cohesive capsid. Adaptation to artificially induced cellular transcription shutoff resulted in a redeoptimization of its capsid codon usage, instead of an optimization. These genomic changes are related to an overall change of capsid folding, which in turn induces changes in the cell entry process. Remarkably, the adaptation to cellular shutoff allowed the virus to significantly increase its RNA uncoating efficiency, resulting in the selection of large-plaque-producing populations. However, these populations produced much-debilitated virions. PMID:24554668

  11. Evident diversity of codon usage patterns of human genes with respect to chromosome banding patterns and chromosome numbers; relation between nucleotide sequence data and cytogenetic data.

    PubMed Central

    Ikemura, T; Wada, K

    1991-01-01

    The sequences of the human genome compiled in DNA databases are now about 10 megabase pairs (Mb), and thus the size of the sequences is several times the average size of chromosome bands at high resolution. By surveying this large quantity of data, it may be possible to clarify the global characteristics of the human genome, that is, correlation of gene sequence data (kb-level) to cytogenetic data (Mb-level). By extensively searching the GenBank database, we calculated codon usages in about 2000 human sequences. The highest G + C percentage at the third codon position was 97%, and that of about 250 sequences was 80% or more. The lowest G + C% was 27%, and that in about 150 sequences was 40% or less. A major portion of the GC-rich genes was found to be on special subsets of R-bands (T-bands and/or terminal R-bands). AT-rich genes, however, were mainly on G-bands or non-T-type internal R-bands. Average G + C% at the third position for individual chromosomes differed among chromosomes, and were related to T-band density, quinacrine dullness, and mitotic chiasmata density in the respective chromosomes. PMID:1886761

  12. High-level accumulation of recombinant miraculin protein in transgenic tomatoes expressing a synthetic miraculin gene with optimized codon usage terminated by the native miraculin terminator.

    PubMed

    Hiwasa-Tanase, Kyoko; Nyarubona, Mpanja; Hirai, Tadayoshi; Kato, Kazuhisa; Ichikawa, Takanari; Ezura, Hiroshi

    2011-01-01

    In our previous study, a transgenic tomato line that expressed the MIR gene under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (tNOS) produced the taste-modifying protein miraculin (MIR). However, the concentration of MIR in the tomatoes was lower than that in the MIR gene's native miracle fruit. To increase MIR production, the native MIR terminator (tMIR) was used and a synthetic gene encoding MIR protein (sMIR) was designed to optimize its codon usage for tomato. Four different combinations of these genes and terminators (MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR) were constructed and used for transformation. The average MIR concentrations in MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR fruits were 131, 197, 128 and 287 ?g/g fresh weight, respectively. The MIR concentrations using tMIR were higher than those using tNOS. The highest MIR accumulation was detected in sMIR-tMIR fruits. On the other hand, the MIR concentration was largely unaffected by sMIR-tNOS. The expression levels of both MIR and sMIR mRNAs terminated by tMIR tended to be higher than those terminated by tNOS. Read-through mRNA transcripts terminated by tNOS were much longer than those terminated by tMIR. These results suggest that tMIR enhances mRNA expression and permits the multiplier effect of optimized codon usage. PMID:21076835

  13. New insights into the fructosyltransferase activity of Schwanniomyces occidentalis ß-fructofuranosidase, emerging from nonconventional codon usage and directed mutation.

    PubMed

    Alvaro-Benito, Miguel; de Abreu, Miguel; Portillo, Francisco; Sanz-Aparicio, Julia; Fernández-Lobato, María

    2010-11-01

    Schwanniomyces occidentalis ?-fructofuranosidase (Ffase) releases ?-fructose from the nonreducing ends of ?-fructans and synthesizes 6-kestose and 1-kestose, both considered prebiotic fructooligosaccharides. Analyzing the amino acid sequence of this protein revealed that it includes a serine instead of a leucine at position 196, caused by a nonuniversal decoding of the unique mRNA leucine codon CUG. Substitution of leucine for Ser196 dramatically lowers the apparent catalytic efficiency (k(cat)/K(m)) of the enzyme (approximately 1,000-fold), but surprisingly, its transferase activity is enhanced by almost 3-fold, as is the enzymes' specificity for 6-kestose synthesis. The influence of 6 Ffase residues on enzyme activity was analyzed on both the Leu196/Ser196 backgrounds (Trp47, Asn49, Asn52, Ser111, Lys181, and Pro232). Only N52S and P232V mutations improved the transferase activity of the wild-type enzyme (about 1.6-fold). Modeling the transfructosylation products into the active site, in combination with an analysis of the kinetics and transfructosylation reactions, defined a new region responsible for the transferase specificity of the enzyme. PMID:20851958

  14. Comparison of two codon optimization strategies enhancing recombinant Sus scrofa lysozyme production in Pichia pastoris.

    PubMed

    Zhu, D; Cai, G; Wu, D; Lu, J

    2015-01-01

    Lysozyme has played an important role in animal feed additive industry, food additive industry and biological engineering. For improving expression efficiency of recombinant lysozyme from Sus scrofa, two genes respectively designed by the most used codon optimization strategies, "one amino acid one codon" and "codon randomization", were synthesized and expressed in Pichia pastoris X—33. At shaking flask level, Sus scrofa lysozyme (SSL) under two conditions had a highest activity of 153.33±10.41 and 538.33±15.18 U/mL after a 5 days induction of 1% methanol, with secreted protein concentration 80.03±1.94 and 239.60±4.16 mg/L, respectively. Compared with the original SSL gene, the expression of optimized SSL gene by the second strategy showed a 2.6 fold higher level, while the first method had no obvious improvement in production. In total secreted protein, the proportions of recombinant SSL encoded by the original gene, first method optimized gene and the second—strategy optimized one were 75.06±0.25%, 74.56±0.14% and 79.00±0.14%, respectively, with the same molecular weight about 18 kDa, optimum acidity pH 6.0 and optimum temperature 35degC. PMID:26025401

  15. Comparison of citation and usage indicators: the case of oncology journals

    Microsoft Academic Search

    Christian Schloegl; Juan Gorraiz

    2010-01-01

    It is the objective of this article to examine in which aspects journal usage data differ from citation data. This comparison\\u000a is conducted both at journal level and on a paper by paper basis. At journal level, we define a so-called usage impact factor\\u000a and a usage half-life in analogy to the corresponding Thomson’s citation indicators. The usage data were

  16. A Comparison of Information Usage Between Business and Leisure Travelers

    Microsoft Academic Search

    Joseph S. Chen

    2000-01-01

    This study explores the difference in information usage between business and leisure travelers. Data collected from a series of in-flight surveys of Japanese, South Korean, and Australian outbound travelers to the U.S. in 1997 were analyzed by logit analysis to determine if there were differences in information usage between business and leisure travelers. This research found significant differences in the

  17. Variation in synonymous codon use and DNA polymorphism within the Drosophila genome

    Microsoft Academic Search

    N. BIERNE; A. EYRE-WALKER

    2006-01-01

    A strong negative correlation between the rate of amino-acid substitution and codon usage bias in Drosophila has been attributed to interference between positive selection at nonsynonymous sites and weak selection on codon usage. To further explore this possibility we have investigated polymorphism and divergence at three kinds of sites: synonymous, nonsynonymous and intronic in relation to codon bias in D.

  18. Site-specific codon bias in bacteria.

    PubMed

    Smith, J M; Smith, N H

    1996-03-01

    Sequences of the gapA and ompA genes from 10 genera of enterobacteria have been analyzed. There is strong bias in codon usage, but different synonymous codons are preferred at different sites in the same gene. Site-specific preference for unfavored codons is not confined to the first 100 codons and is usually manifest between two codons utilizing the same tRNA. Statistical analyses, based on conclusions reached in an accompanying paper, show that the use of an unfavored codon at a given site in different genera is not due to common descent and must therefore be caused either by sequence-specific mutation or sequence-specific selection. Reasons are given for thinking that sequence-specific mutation cannot be responsible. We are unable to explain the preference between synonymous codons ending in C or T, but synonymous choice between A and G at third sites is largely explained by avoidance of AG-G (where the hyphen indicates the boundary between codons). We also observed that the preferred codon for proline in Enterobacter cloacea has changed from CCG to CCA. PMID:8849909

  19. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics.

    PubMed

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S; Kolatkar, Prasanna R

    2002-06-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein genes from all other genes of known function in Saccharomyces cerevisiae, Escherichia coli and Mycobacterium tuberculosis using an implementation of support vector machines, SVM(light). Analysis of these codon composition signals is instructive in determining features that confer individuality to ribosomal protein genes. Each of the sets of positively charged, negatively charged and small hydrophobic residues, as well as codon bias, contribute to their distinctive codon composition profile. The representation of all these signals is sensitively detected, combined and augmented by the SVMs to perform an accurate classification. Of special mention is an obvious outlier, yeast gene RPL22B, highly homologous to RPL22A but employing very different codon usage, perhaps indicating a non-ribosomal function. Finally, we propose that codon composition be used in combination with other attributes in gene/protein classification by supervised machine learning algorithms. PMID:12034849

  20. Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics

    PubMed Central

    Lin, Kui; Kuang, Yuyu; Joseph, Jeremiah S.; Kolatkar, Prasanna R.

    2002-01-01

    Genomics projects have resulted in a flood of sequence data. Functional annotation currently relies almost exclusively on inter-species sequence comparison and is restricted in cases of limited data from related species and widely divergent sequences with no known homologs. Here, we demonstrate that codon composition, a fusion of codon usage bias and amino acid composition signals, can accurately discriminate, in the absence of sequence homology information, cytoplasmic ribosomal protein genes from all other genes of known function in Saccharomyces cerevisiae, Escherichia coli and Mycobacterium tuberculosis using an implementation of support vector machines, SVMlight. Analysis of these codon composition signals is instructive in determining features that confer individuality to ribosomal protein genes. Each of the sets of positively charged, negatively charged and small hydrophobic residues, as well as codon bias, contribute to their distinctive codon composition profile. The representation of all these signals is sensitively detected, combined and augmented by the SVMs to perform an accurate classification. Of special mention is an obvious outlier, yeast gene RPL22B, highly homologous to RPL22A but employing very different codon usage, perhaps indicating a non-ribosomal function. Finally, we propose that codon composition be used in combination with other attributes in gene/protein classification by supervised machine learning algorithms. PMID:12034849

  1. ICT Usage of Pre-service Teachers: Cultural Comparison for Turkey and Bosnia and Herzegovina

    ERIC Educational Resources Information Center

    Demirli, Cihad

    2013-01-01

    The importance of ICTs has become the undisputed in the present century. Studies have been conducted to investigate the use of ICTs with the goal of increase in quality of teacher education for a long time. This study is a cross-cultural comparison in terms of pre-service teachers' level of ICT usage, ICT knowledge and attitudes. The study…

  2. Clinical comparison of Alzheimer's disease in pedigrees with the codon 717 Val-->Ile mutation in the amyloid precursor protein gene.

    PubMed

    Mullan, M; Tsuji, S; Miki, T; Katsuya, T; Naruse, S; Kaneko, K; Shimizu, T; Kojima, T; Nakano, I; Ogihara, T

    1993-01-01

    Alzheimer's disease (AD) is the most common cause of dementia (32). Although the majority of cases of AD are sporadic, the most consistent risk factor detected in several epidemiological studies has been a positive family history of the disease (14,21). In addition, many large pedigrees have been described in which AD appears to be inherited as an autosomal dominant disorder. In one such pedigree (F23) a point mutation within the beta-amyloid precursor protein (APP) gene at codon 717 was identified and hypothesized to be pathogenic (10). The mutation results in a valine to isoleucine change in APP (APP717 Val-->Ile). Subsequent screening has revealed four other pedigrees, detailed in this study, in which this mutation co-segregates with AD (13,26,37). In addition, one other pedigree (Tor3) with this mutation has been described (15) and detailed clinical, neuropsychological, and neuropathological data are reported. Tor3 is discussed below in comparison to the findings in the families in this study. The five families we report with the mutation were identified in Britain (1 family), the United States (1 family), and Japan (3 families). The mutation has not been reported in the general population of any of these countries (3,13,26,33). On this basis alone it seems this mutation is pathogenic. Other APP codon 717 mutations have been identified which co-segregate with the disease (4,25). Also, a double mutation in APP at codons 670/671 has been shown to cosegregate with the disease in two large Swedish pedigrees (22). In all cases, there is complete co-segregation of the APP mutation with early onset AD, providing overwhelming statistical evidence that these mutations are pathogenic. We present the clinical features and limited neuropathology of AD in these families with the APP 717 Val-->Ile mutation. PMID:8247223

  3. GC constituents and relative codon expressed amino acid composition in cyanobacterial phycobiliproteins.

    PubMed

    Kannaujiya, Vinod K; Rastogi, Rajesh P; Sinha, Rajeshwar P

    2014-08-10

    The genomic as well as structural relationship of phycobiliproteins (PBPs) in different cyanobacterial species are determined by nucleotides as well as amino acid composition. The genomic GC constituents influence the amino acid variability and codon usage of particular subunit of PBPs. We have analyzed 11 cyanobacterial species to explore the variation of amino acids and causal relationship between GC constituents and codon usage. The study at the first, second and third levels of GC content showed relatively more amino acid variability on the levels of G3+C3 position in comparison to the first and second positions. The amino acid encoded GC rich level including G rich and C rich or both correlate the codon variability and amino acid availability. The fluctuation in amino acids such as Arg, Ala, His, Asp, Gly, Leu and Glu in ? and ? subunits was observed at G1C1 position; however, fluctuation in other amino acids such as Ser, Thr, Cys and Trp was observed at G2C2 position. The coding selection pressure of amino acids such as Ala, Thr, Tyr, Asp, Gly, Ile, Leu, Asn, and Ser in ? and ? subunits of PBPs was more elaborated at G3C3 position. In this study, we observed that each subunit of PBPs is codon specific for particular amino acid. These results suggest that genomic constraint linked with GC constituents selects the codon for particular amino acids and furthermore, the codon level study may be a novel approach to explore many problems associated with genomics and proteomics of cyanobacteria. PMID:24933001

  4. The Mechanisms of Codon Reassignments in Mitochondrial Genetic Codes

    PubMed Central

    Sengupta, Supratim; Yang, Xiaoguang

    2007-01-01

    Many cases of nonstandard genetic codes are known in mitochondrial genomes. We carry out analysis of phylogeny and codon usage of organisms for which the complete mitochondrial genome is available, and we determine the most likely mechanism for codon reassignment in each case. Reassignment events can be classified according to the gain-loss framework. The “gain” represents the appearance of a new tRNA for the reassigned codon or the change of an existing tRNA such that it gains the ability to pair with the codon. The “loss” represents the deletion of a tRNA or the change in a tRNA so that it no longer translates the codon. One possible mechanism is codon disappearance (CD), where the codon disappears from the genome prior to the gain and loss events. In the alternative mechanisms the codon does not disappear. In the unassigned codon mechanism, the loss occurs first, whereas in the ambiguous intermediate mechanism, the gain occurs first. Codon usage analysis gives clear evidence of cases where the codon disappeared at the point of the reassignment and also cases where it did not disappear. CD is the probable explanation for stop to sense reassignments and a small number of reassignments of sense codons. However, the majority of sense-to-sense reassignments cannot be explained by CD. In the latter cases, by analysis of the presence or absence of tRNAs in the genome and of the changes in tRNA sequences, it is sometimes possible to distinguish between the unassigned codon and the ambiguous intermediate mechanisms. We emphasize that not all reassignments follow the same scenario and that it is necessary to consider the details of each case carefully. Electronic supplementary material The online version of this article (doi:10.1007/s00239-006-0284-7) contains supplementary material, which is available to authorized users. PMID:17541678

  5. Differential Codon Adaptation between dsDNA and ssDNA Phages in Escherichia coli

    PubMed Central

    Chithambaram, Shivapriya; Prabhakaran, Ramanandan; Xia, Xuhua

    2014-01-01

    Because phages use their host translation machinery, their codon usage should evolve toward that of highly expressed host genes. We used two indices to measure codon adaptation of phages to their host, rRSCU (the correlation in relative synonymous codon usage [RSCU] between phages and their host) and Codon Adaptation Index (CAI) computed with highly expressed host genes as the reference set (because phage translation depends on host translation machinery). These indices used for this purpose are appropriate only when hosts exhibit little mutation bias, so only phages parasitizing Escherichia coli were included in the analysis. For double-stranded DNA (dsDNA) phages, both rRSCU and CAI decrease with increasing number of transfer RNA genes encoded by the phage genome. rRSCU is greater for dsDNA phages than for single-stranded DNA (ssDNA) phages, and the low rRSCU values are mainly due to poor concordance in RSCU values for Y-ending codons between ssDNA phages and the E. coli host, consistent with the predicted effect of C?T mutation bias in the ssDNA phages. Strong C?T mutation bias would improve codon adaptation in codon families (e.g., Gly) where U-ending codons are favored over C-ending codons (“U-friendly” codon families) by highly expressed host genes but decrease codon adaptation in other codon families where highly expressed host genes favor C-ending codons against U-ending codons (“U-hostile” codon families). It is remarkable that ssDNA phages with increasing C?T mutation bias also increased the usage of codons in the “U-friendly” codon families, thereby achieving CAI values almost as large as those of dsDNA phages. This represents a new type of codon adaptation. PMID:24586046

  6. Genome-Wide Patterns of Codon Bias Are Shaped by Natural Selection in the Purple Sea Urchin, Strongylocentrotus purpuratus

    PubMed Central

    Kober, Kord M.; Pogson, Grant H.

    2013-01-01

    Codon usage bias has been documented in a wide diversity of species, but the relative contributions of mutational bias and various forms of natural selection remain unclear. Here, we describe for the first time genome-wide patterns of codon bias at 4623 genes in the purple sea urchin, Strongylocentrotus purpuratus. Preferred codons were identified at 18 amino acids that exclusively used G or C at third positions, which contrasted with the strong AT bias of the genome (overall GC content is 36.9%). The GC content of third positions and coding regions exhibited significant correlations with the magnitude of codon bias. In contrast, the GC content of introns and flanking regions was indistinguishable from the genome-wide background, which suggested a limited contribution of mutational bias to synonymous codon usage. Five distinct clusters of genes were identified that had significantly different synonymous codon usage patterns. A significant correlation was observed between codon bias and mRNA expression supporting translational selection, but this relationship was driven by only one highly biased cluster that represented only 8.6% of all genes. In all five clusters preferred codons were evolutionarily conserved to a similar degree despite differences in their synonymous codon usage distributions and magnitude of codon bias. The third positions of preferred codons in two codon usage groups also paired significantly more often in stems than in loops of mRNA secondary structure predictions, which suggested that codon bias might also affect mRNA stability. Our results suggest that mutational bias has played a minor role in determining codon bias in S. purpuratus and that preferred codon usage may be heterogeneous across different genes and subject to different forms of natural selection. PMID:23637123

  7. High codon adaptation in citrus tristeza virus to its citrus host

    PubMed Central

    2012-01-01

    Background Citrus tristeza virus (CTV), a member of the genus Closterovirus within the family Closteroviridae, is the causal agent of citrus tristeza disease. Previous studies revealed that the negative selection, RNA recombination and gene flow were the most important forces that drove CTV evolution. However, the CTV codon usage was not studied and thus its role in CTV evolution remains unknown. Results A detailed comparative analysis of CTV codon usage pattern was done in this study. Results of the study show that although in general CTV does not have a high degree of codon usage bias, the codon usage of CTV has a high level of resemblance to its host codon usage. In addition, our data indicate that the codon usage resemblance is only observed for the woody plant-infecting closteroviruses but not the closteroviruses infecting the herbaceous host plants, suggesting the existence of different virus-host interactions between the herbaceous plant-infecting and woody plant-infecting closteroviruses. Conclusion Based on the results, we suggest that in addition to RNA recombination, negative selection and gene flow, host plant codon usage selection can also affect CTV evolution. PMID:22698086

  8. Local slowdown of translation by nonoptimal codons promotes nascent-chain recognition by SRP in vivo

    PubMed Central

    Pechmann, Sebastian; Chartron, Justin W; Frydman, Judith

    2015-01-01

    The genetic code allows most amino acids a choice of optimal and nonoptimal codons. We report that synonymous codon choice is tuned to promote interaction of nascent polypeptides with the signal recognition particle (SRP), which assists in protein translocation across membranes. Cotranslational recognition by the SRP in vivo is enhanced when mRNAs contain nonoptimal codon clusters 35–40 codons downstream of the SRP-binding site, the distance that spans the ribosomal polypeptide exit tunnel. A local translation slowdown upon ribosomal exit of SRP-binding elements in mRNAs containing these nonoptimal codon clusters is supported experimentally by ribosome profiling analyses in yeast. Modulation of local elongation rates through codon choice appears to kinetically enhance recognition by ribosome-associated factors. We propose that cotranslational regulation of nascent-chain fate may be a general constraint shaping codon usage in the genome. PMID:25420103

  9. The Effect of Mutation and Selection on Codon Adaptation in Escherichia coli Bacteriophage

    PubMed Central

    Chithambaram, Shivapriya; Prabhakaran, Ramanandan; Xia, Xuhua

    2014-01-01

    Studying phage codon adaptation is important not only for understanding the process of translation elongation, but also for reengineering phages for medical and industrial purposes. To evaluate the effect of mutation and selection on phage codon usage, we developed an index to measure selection imposed by host translation machinery, based on the difference in codon usage between all host genes and highly expressed host genes. We developed linear and nonlinear models to estimate the C?T mutation bias in different phage lineages and to evaluate the relative effect of mutation and host selection on phage codon usage. C?T-biased mutations occur more frequently in single-stranded DNA (ssDNA) phages than in double-stranded DNA (dsDNA) phages and affect not only synonymous codon usage, but also nonsynonymous substitutions at second codon positions, especially in ssDNA phages. The host translation machinery affects codon adaptation in both dsDNA and ssDNA phages, with a stronger effect on dsDNA phages than on ssDNA phages. Strand asymmetry with the associated local variation in mutation bias can significantly interfere with codon adaptation in both dsDNA and ssDNA phages. PMID:24583580

  10. Analysis of codon use features of stearoyl-acyl carrier protein desaturase gene in Camellia sinensis.

    PubMed

    Pan, Lu-Lu; Wang, Yu; Hu, Jian-Hui; Ding, Zhao-Tang; Li, Chen

    2013-10-01

    The stearoyl-acyl carrier protein desaturase (SAD) gene widely exists in all kinds of plants. In this paper, the Camellia sinensis SAD gene (CsSAD) sequence was firstly analyzed by Codon W, CHIPS, and CUSP programs online, and then compared with genomes of the tea plant, other species and SAD genes from 11 plant species. The results show that the CsSAD gene and the selected 73 of C. sinensis genes have similar codon usage bias. The CsSAD gene has a bias toward the synonymous codons with A and T at the third codon position, the same as the 73 of C. sinensis genes. Compared with monocotyledons such as Triticum aestivum and Zea mays, the differences in codon usage frequency between the CsSAD gene and dicotyledons such as Arabidopsis thaliana and Nicotiana tobacum are less. Therefore, A. thaliana and N. tobacum expression systems may be more suitable for the expression of the CsSAD gene. The analysis result of SAD genes from 12 plant species also shows that most of the SAD genes are biased toward the synonymous codons with G and C at the third codon position. We believe that the codon usage bias analysis presented in this study will be essential for providing a theoretical basis for discussing the structure and function of the CsSAD gene. PMID:23774066

  11. First impression versus extended usage: a comparison of product testing methodologies for perfume.

    PubMed

    Shalofsky, I

    1993-04-01

    Synopsis In the fine fragrance industry, unlike many other fast moving consumer goods (fmcg) industries, systematic consumer product-testing has usually been conspicuous by its absence. The reasons are varied, including perfume's own traditions rooted in fashion rather than in marketing, the reluctance of perfumers to see their creations tested, the frequently (and perhaps, surprisingly) short lead times accorded for new product development and, of course, costs. When consumer product-testing is carried out, it is often limited for these same reasons, to 'sniff-testing', which, in the perfume industry, is equivalent to 'first impression' testing. This paper suggests that such sniff-testing may not only be unreliable, but perhaps more unreliable for the perfume category than has been realized hitherto. Reference is made to two consumer research studies on perfume, a qualitative project in France, followed by a quantitative exercise in the UK. A comparison is made between in-home test and sniff-test results for the same set of perfumes, which illustrates the limitations of sniff-testing in general, and the misleading results that it may produce, in particular. A major implication is that perfume is one product category which should be tested in extended usage, and not just for 'first impressions'. Résumé Dans l'industrie de la parfumerie fine, contrairement aux autres industries de produits de grande consommation, les tests consommateurs systématiques sont rarement utilisés. Les raisons sont diverses; les traditions propres du parfum tournées vers la mode plutôt que vers le marketing, le refus des parfumeurs de voir leurs créations subir des tests, les délais étonnamment courts pour le développement d'un nouveau produit et, bien sûr, le coût. Lorsqu'un test consommateurs est effectué, il se résume généralement pour ces mêmes raisons, en un test 'sniff', ce qui, dans l'industrie du parfum équivaut à un test de 'première impression'. Cet article montre que ces tests 'sniff' sont encore moins fiables pour le parfum que l'on avait pensé jusqu'à maintenant. Il est fait référence à deux tests consommateurs sur le parfum, un projet qualitatif en France, suivi par un exercice quantitatif effectué en Grande Bretagne. La comparaison entre les tests réalisés à domicile d'une part, et en sale d'autre part, montre que, pour les mêmes parfums, les résultats obtenus peuvent être erronés. Une des conclusions principales est que le parfum est un produit qui devrait être testé sur une longue période et non pas sur une première impression. PMID:19272121

  12. Usage Data for Electronic Resources: A Comparison between Locally Collected and Vendor-Provided Statistics.

    ERIC Educational Resources Information Center

    Duy, Joanna; Vaughan, Liwen

    2003-01-01

    Vendor-provided electronic resource usage statistics are not currently standardized across vendors. This study investigates the feasibility of using locally collected data to check the reliability of vendor-provided data. Vendor-provided data were compared with local data collected from North Carolina State University (NCSU) Libraries' Web…

  13. The Comparison of Usage and Availability Measurements for Evaluating Resource Douglas H. Johnson

    E-print Network

    Steury, Todd D.

    of habitat types or food items to the availability of those resources to the animal. Widely used methods-term preservation and access to leading academic journals and scholarly literature from around the world. This paper proposes a new method. based on ranks of components by usage and by availability. A virtue

  14. Determinants of computer usage among educators: A comparison between the UTAUT and TAM models

    Microsoft Academic Search

    Loh Wai Ling; Alan G. Downe; Wan Fatimah Wan Ahmad; Teh Thian Lai

    2011-01-01

    Vast researches on the determinants of computer usage based on different types of technologies models have been carried out individually but not comparatively. Hence, in this paper, the researchers aim at reviewing and comparing the Unified Theory of Acceptance and Use of Technology model (UTAUT) and Technology Acceptance Model (TAM) to determine which is the model is most suitable to

  15. Hill-Robertson Interference is a Minor Determinant of Variations in Codon Bias Across Drosophila melanogaster and Caenorhabditis elegans Genomes

    Microsoft Academic Search

    Gabriel Marais; Gwenael Piganeau

    According to population genetics models, genomic regions with lower crossing-over rates are expected to experience less effective selection because of Hill-Robertson interference (HRi). The effect of genetic linkage is thought to be particularly important for a selection of weak intensity such as selection affecting codon usage. Consistent with this model, codon bias correlates positively with recombination rate in Drosophila melanogaster

  16. Control of ribosome traffic by position-dependent choice of synonymous codons

    E-print Network

    Namiko Mitarai; Steen Pedersen

    2013-09-04

    Messenger RNA encodes a sequence of amino acids by using codons. For most amino acids there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the messenger RNA (mRNA) but also might have an effect on nearby ribosomes by affecting the appearance of "traffic jams" where multiple ribosomes collide and form queues. To test this "context effect" further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild type sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the wild type sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species.

  17. Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

    PubMed

    Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

    2015-01-01

    Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. PMID:26047917

  18. The Effect of an Alternate Start Codon on Heterologous Expression of a PhoA Fusion Protein in Mycoplasma gallisepticum

    PubMed Central

    Panicker, Indu S.; Browning, Glenn F.; Markham, Philip F.

    2015-01-01

    While the genomes of many Mycoplasma species have been sequenced, there are no collated data on translational start codon usage, and the effects of alternate start codons on gene expression have not been studied. Analysis of the annotated genomes found that ATG was the most prevalent translational start codon among Mycoplasma spp. However in Mycoplasma gallisepticum a GTG start codon is commonly used in the vlhA multigene family, which encodes a highly abundant, phase variable lipoprotein adhesin. Therefore, the effect of this alternate start codon on expression of a reporter PhoA lipoprotein was examined in M. gallisepticum. Mutation of the start codon from ATG to GTG resulted in a 2.5 fold reduction in the level of transcription of the phoA reporter, but the level of PhoA activity in the transformants containing phoA with a GTG start codon was only 63% of that of the transformants with a phoA with an ATG start codon, suggesting that GTG was a more efficient translational initiation codon. The effect of swapping the translational start codon in phoA reporter gene expression was less in M. gallisepticum than has been seen previously in Escherichia coli or Bacillus subtilis, suggesting the process of translational initiation in mycoplasmas may have some significant differences from those used in other bacteria. This is the first study of translational start codon usage in mycoplasmas and the impact of the use of an alternate start codon on expression in these bacteria. PMID:26010086

  19. Selection on synonymous codons in mammalian rhodopsins: a possible role in optimizing translational processes

    PubMed Central

    2014-01-01

    Background Synonymous codon usage can affect many cellular processes, particularly those associated with translation such as polypeptide elongation and folding, mRNA degradation/stability, and splicing. Highly expressed genes are thought to experience stronger selection pressures on synonymous codons. This should result in codon usage bias even in species with relatively low effective population sizes, like mammals, where synonymous site selection is thought to be weak. Here we use phylogenetic codon-based likelihood models to explore patterns of codon usage bias in a dataset of 18 mammalian rhodopsin sequences, the protein mediating the first step in vision in the eye, and one of the most highly expressed genes in vertebrates. We use these patterns to infer selection pressures on key translational mechanisms including polypeptide elongation, protein folding, mRNA stability, and splicing. Results Overall, patterns of selection in mammalian rhodopsin appear to be correlated with post-transcriptional and translational processes. We found significant evidence for selection at synonymous sites using phylogenetic mutation-selection likelihood models, with C-ending codons found to have the highest relative fitness, and to be significantly more abundant at conserved sites. In general, these codons corresponded with the most abundant tRNAs in mammals. We found significant differences in codon usage bias between rhodopsin loops versus helices, though there was no significant difference in mean synonymous substitution rate between these motifs. We also found a significantly higher proportion of GC-ending codons at paired sites in rhodopsin mRNA secondary structure, and significantly lower synonymous mutation rates in putative exonic splicing enhancer (ESE) regions than in non-ESE regions. Conclusions By focusing on a single highly expressed gene we both distinguish synonymous codon selection from mutational effects and analytically explore underlying functional mechanisms. Our results suggest that codon bias in mammalian rhodopsin arises from selection to optimally balance high overall translational speed, accuracy, and proper protein folding, especially in structurally complicated regions. Selection at synonymous sites may also be contributing to mRNA stability and splicing efficiency at exonic-splicing-enhancer (ESE) regions. Our results highlight the importance of investigating highly expressed genes in a broader phylogenetic context in order to better understand the evolution of synonymous substitutions. PMID:24884412

  20. Inducible suppression of global translation by overuse of rare codons.

    PubMed

    Kobayashi, Hideki

    2015-04-01

    Recently, artificial gene networks have been developed in synthetic biology to control gene expression and make organisms as controllable as robots. Here, I present an artificial posttranslational gene-silencing system based on the codon usage bias and low tRNA content corresponding to minor codons. I engineered the green fluorescent protein (GFP) gene to inhibit translation indirectly with the lowest-usage codons to monopolize various minor tRNAs (lgfp). The expression of lgfp interfered nonspecifically with the growth of Escherichia coli, Saccharomyces cerevisiae, human HeLa cervical cancer cells, MCF7 breast cancer cells, and HEK293 kidney cells, as well as phage and adenovirus expansion. Furthermore, insertion of lgfp downstream of a phage response promoter conferred phage resistance on E. coli. Such engineered gene silencers could act as components of biological networks capable of functioning with suitable promoters in E. coli, S. cerevisiae, and human cells to control gene expression. The results presented here show general suppressor artificial genes for live cells and viruses. This robust system provides a gene expression or cell growth control device for artificially synthesized gene networks. PMID:25636849

  1. Computational codon optimization of synthetic gene for protein expression

    PubMed Central

    2012-01-01

    Background The construction of customized nucleic acid sequences allows us to have greater flexibility in gene design for recombinant protein expression. Among the various parameters considered for such DNA sequence design, individual codon usage (ICU) has been implicated as one of the most crucial factors affecting mRNA translational efficiency. However, previous works have also reported the significant influence of codon pair usage, also known as codon context (CC), on the level of protein expression. Results In this study, we have developed novel computational procedures for evaluating the relative importance of optimizing ICU and CC for enhancing protein expression. By formulating appropriate mathematical expressions to quantify the ICU and CC fitness of a coding sequence, optimization procedures based on genetic algorithm were employed to maximize its ICU and/or CC fitness. Surprisingly, the in silico validation of the resultant optimized DNA sequences for Escherichia coli, Lactococcus lactis, Pichia pastoris and Saccharomyces cerevisiae suggests that CC is a more relevant design criterion than the commonly considered ICU. Conclusions The proposed CC optimization framework can complement and enhance the capabilities of current gene design tools, with potential applications to heterologous protein production and even vaccine development in synthetic biotechnology. PMID:23083100

  2. Kenyan medicinal plants used as antivenin: a comparison of plant usage

    PubMed Central

    Owuor, Bethwell O; Kisangau, Daniel P

    2006-01-01

    The success of snake bite healers is vaguely understood in Kenya, partly due to their unknown materia medica and occult-mystical nature of their practice. A comparison is made of plants used in snake bite treatments by two culturally distinct African groups (the Kamba and Luo). Thirty two plants used for snakebite treatment are documented. The majority of the antidotes are prepared from freshly collected plant material – frequently leaves. Though knowledge of snake bite conditions etiological perceptions of the ethnic groups is similar, field ethnobotanical data suggests that plant species used by the two ethnic groups are independently derived. Antivenin medicinal plants effectively illustrate the cultural context of medicine. Randomness or the use of a variety of species in different families appears to be a feature of traditional snake bite treatments. A high degree of informant consensus for the species was observed. The study indicates rural Kenya inhabitants rely on medicinal plants for healthcare. PMID:16451723

  3. CUE USAGE IN VOLLEYBALL: A TIME COURSE COMPARISON OF ELITE, INTERMEDIATE AND NOVICE FEMALE PLAYERS

    PubMed Central

    Vaeyens, R; Zeuwts, L; Philippaerts, R; Lenoir, M

    2014-01-01

    This study compared visual search strategies in adult female volleyball players of three levels. Video clips of the attack of the opponent team were presented on a large screen and participants reacted to the final pass before the spike. Reaction time, response accuracy and eye movement patterns were measured. Elite players had the highest response accuracy (97.50 ± 3.5%) compared to the intermediate (91.50 ± 4.7%) and novice players (83.50 ± 17.6%; p<0.05). Novices had a remarkably high range of reaction time but no significant differences were found in comparison to the reaction time of elite and intermediate players. In general, the three groups showed similar gaze behaviour with the apparent use of visual pivots at moments of reception and final pass. This confirms the holistic model of image perception for volleyball and suggests that expert players extract more information from parafoveal regions. PMID:25609887

  4. Systeme, norme, usage: Etudes contrastives (System, Norm, Usage: Contrastive Studies).

    ERIC Educational Resources Information Center

    Gak, Victor

    1989-01-01

    The comparison of languages can be an effective instructional technique if used well. The comparison of isolated elements is less effective than the examination of languages at several levels: system, norm, and usage. (MSE)

  5. A study of the purine/pyrimidine codon occurrence with a reduced centered variable and an evaluation compared to the frequency statistic.

    PubMed

    Michel, C J

    1989-12-01

    With the three-letter alphabet [R,Y,N] (R = purine, Y = pyrimidine, N = R or Y), there are 26 codons (NNN being excluded): RNN,...,NNY (six codons at two unspecified bases N), RRN,...,NYY (12 codons at one unspecified base N), RRR,...,YYY (eight specified codons). A statistical methodology that uses the codon frequency and a reduced centered variable leads to similar results for a codon occurrence study, regardless of gene function and regardless of a particular protein coding gene taxonomic population. Therefore, this variable can be considered a new codon usage index, whose use removes certain nonsignificant results found with the frequency statistic. This methodology identifies the common and rare codons (i.e., the codons having the highest and lowest occurrence) and leads to a model of codon evolution at three successive states: RNN, then RNY, and finally RYY. Some biological relations between this model and the YRY(N)6YRY preferential occurrence are also presented. PMID:2520209

  6. A Comparison of the Usage of Tablet PC, Lecture Capture, and Online Homework in an Introductory Chemistry Course

    ERIC Educational Resources Information Center

    Revell, Kevin D.

    2014-01-01

    Three emerging technologies were used in a large introductory chemistry class: a tablet PC, a lecture capture and replay software program, and an online homework program. At the end of the semester, student usage of the lecture replay and online homework systems was compared to course performance as measured by course grade and by a standardized…

  7. A Cross-Cultural Study on the Value Structure of Mobile Internet Usage: Comparison Between Korea and Japan

    Microsoft Academic Search

    Yeonsoo Lee; Jinwoo Kim; Inseong Lee; Hoyoung Kim

    2002-01-01

    As the mobile Internet has been used explosively worldwide, the effects of cultural factors on mobile Internet have been an interesting issue. The objectives of this study are to examine the usage patterns of the mobile Internet in different countries and to interpret these differences from a cross-cultural perspective. We propose a value structure in order to investigate the cross-cultural

  8. Evaluation of codon biology in citrus and Poncirus trifoliata based on genomic features and frame corrected expressed sequence tags.

    PubMed

    Ahmad, Touqeer; Sablok, Gaurav; Tatarinova, Tatiana V; Xu, Qiang; Deng, Xiu-Xin; Guo, Wen-Wu

    2013-04-01

    Citrus, as one of the globally important fruit trees, has been an object of interest for understanding genetics and evolutionary process in fruit crops. Meta-analyses of 19 Citrus species, including 4 globally and economically important Citrus sinensis, Citrus clementina, Citrus reticulata, and 1 Citrus relative Poncirus trifoliata, were performed. We observed that codons ending with A- or T- at the wobble position were preferred in contrast to C- or G- ending codons, indicating a close association with AT richness of Citrus species and P. trifoliata. The present study postulates a large repertoire of a set of optimal codons for the Citrus genus and P. trifoliata and demonstrates that GCT and GGT are evolutionary conserved optimal codons. Our observation suggested that mutational bias is the dominating force in shaping the codon usage bias (CUB) in Citrus and P. trifoliata. Correspondence analysis (COA) revealed that the principal axis [axis 1; COA/relative synonymous codon usage (RSCU)] contributes only a minor portion (?10.96%) of the recorded variance. In all analysed species, except P. trifoliata, Gravy and aromaticity played minor roles in resolving CUB. Compositional constraints were found to be strongly associated with the amino acid signatures in Citrus species and P. trifoliata. Our present analysis postulates compositional constraints in Citrus species and P. trifoliata and plausible role of the stress with GC3 and coevolution pattern of amino acid. PMID:23315666

  9. Codon choice in genes depends on flanking sequence information—implications for theoretical reverse translation

    PubMed Central

    Sivaraman, Karthikeyan; Seshasayee, AswinSaiNarain; Tarwater, Patrick M.; Cole, Alexander M.

    2008-01-01

    Algorithms for theoretical reverse translation have direct applications in degenerate PCR. The conventional practice is to create several degenerate primers each of which variably encode the peptide region of interest. In the current work, for each codon we have analyzed the flanking residues in proteins and determined their influence on codon choice. From this, we created a method for theoretical reverse translation that includes information from flanking residues of the protein in question. Our method, named the neighbor correlation method (NCM) and its enhancement, the consensus-NCM (c-NCM) performed significantly better than the conventional codon-usage statistic method (CSM). Using the methods NCM and c-NCM, we were able to increase the average sequence identity from 77% up to 81%. Furthermore, we revealed a significant increase in coverage, at 80% identity, from < 20% (CSM) to > 75% (c-NCM). The algorithms, their applications and implications are discussed herein. PMID:18203741

  10. Conservation of CFTR codon frequency through primates suggests synonymous mutations could have a functional effect.

    PubMed

    Pizzo, Lucilla; Iriarte, Andrés; Alvarez-Valin, Fernando; Marín, Mónica

    2015-05-01

    Cystic fibrosis is an inherited chronic disease that affects the lungs and digestive system, with a prevalence of about 1:3000 people. Cystic fibrosis is caused by mutations in CFTR gene, which lead to a defective function of the chloride channel, the cystic fibrosis transmembrane conductance regulator (CFTR). Up-to-date, more than 1900 mutations have been reported in CFTR. However for an important proportion of them, their functional effects and the relation to disease are still not understood. Many of these mutations are silent (or synonymous), namely they do not alter the encoded amino acid. These synonymous mutations have been considered as neutral to protein function. However, more recent evidence in bacterial and human proteins has put this concept under revision. With the aim of understanding possible functional effects of synonymous mutations in CFTR, we analyzed human and primates CFTR codon usage and divergence patterns. We report the presence of regions enriched in rare and frequent codons. This spatial pattern of codon preferences is conserved in primates, but this cannot be explained by sequence conservation alone. In sum, the results presented herein suggest a functional implication of these regions of the gene that may be maintained by purifying selection acting to preserve a particular codon usage pattern along the sequence. Overall these results support the idea that several synonymous mutations in CFTR may have functional importance, and could be involved in the disease. PMID:25839760

  11. Understanding continued information technology usage behavior: A comparison of three models in the context of mobile internet

    Microsoft Academic Search

    Se-joon Hong; James Y. L. Thong; Kar Yan Tam

    2006-01-01

    This study examines the utility of three prospective models for understanding the continued IT usage behavior. The three models include: Expectation-Confirmation Model in IT Domain (ECM-IT), Technology Acceptance Model (TAM), and a hybrid model integrating TAM and ECM-IT (extended ECM-IT). Based on a survey of 1826 mobile Internet users, the LISREL analysis shows that all three models meet the various

  12. Context specific misreading of phenylalanine codons

    Microsoft Academic Search

    James Precup; Amy K. Ulrich; Osha Roopnarine; Jack Parker

    1989-01-01

    It has previously been shown that the phenylalanine codon UUC encoding residue 8 of the Escherichia coli argI gene product, ornithine transcarbamylase, is misread as leucine at a high frequency during phenylalanine starvation. However, no misreading of the UUU encoding residue 3 was observed under these conditions. Using oligonucleotide-directed, site-specific mutagenesis, we have constructed mutants where these codons have been

  13. Codon Bias Signatures, Organization of Microorganisms in Codon Space, and Lifestyle

    E-print Network

    Carbone, Alessandra

    Codon Bias Signatures, Organization of Microorganisms in Codon Space, and Lifestyle A. Carbone,* F, Bd de l'Ho^pital, 75013 Paris, France; ATelier de Ge´nomique Cognitive, CNRS ESA 8071/Genopole, 523 tendencies toward content bias, translational bias, and strand bias. These criteria can be applied to all

  14. Estrogen receptor codon 594 and HER2 codon 655 polymorphisms and breast cancer risk

    Microsoft Academic Search

    Elif Akisik; Nejat Dalay

    2004-01-01

    The estrogen receptor (ER) and the human epithelial growth factor receptor 2 (HER2) genes have been implicated in the development and prognosis of breast cancer. Several genetic polymorphic sites in these genes have been identified and associated with the risk of breast cancer. We have investigated the association between the estrogen receptor codon 594 (ACA to ACG) and HER2 codon

  15. Ancestral Inference and the Study of Codon Bias Evolution: Implications for Molecular Evolutionary Analyses of the Drosophila melanogaster Subgroup

    PubMed Central

    Akashi, Hiroshi; Goel, Piyush; John, Anoop

    2007-01-01

    Reliable inference of ancestral sequences can be critical to identifying both patterns and causes of molecular evolution. Robustness of ancestral inference is often assumed among closely related species, but tests of this assumption have been limited. Here, we examine the performance of inference methods for data simulated under scenarios of codon bias evolution within the Drosophila melanogaster subgroup. Genome sequence data for multiple, closely related species within this subgroup make it an important system for studying molecular evolutionary genetics. The effects of asymmetric and lineage-specific substitution rates (i.e., varying levels of codon usage bias and departures from equilibrium) on the reliability of ancestral codon usage was investigated. Maximum parsimony inference, which has been widely employed in analyses of Drosophila codon bias evolution, was compared to an approach that attempts to account for uncertainty in ancestral inference by weighting ancestral reconstructions by their posterior probabilities. The latter approach employs maximum likelihood estimation of rate and base composition parameters. For equilibrium and most non-equilibrium scenarios that were investigated, the probabilistic method appears to generate reliable ancestral codon bias inferences for molecular evolutionary studies within the D. melanogaster subgroup. These reconstructions are more reliable than parsimony inference, especially when codon usage is strongly skewed. However, inference biases are considerable for both methods under particular departures from stationarity (i.e., when adaptive evolution is prevalent). Reliability of inference can be sensitive to branch lengths, asymmetry in substitution rates, and the locations and nature of lineage-specific processes within a gene tree. Inference reliability, even among closely related species, can be strongly affected by (potentially unknown) patterns of molecular evolution in lineages ancestral to those of interest. PMID:17957249

  16. Estimating Gene Expression and Codon-Specific Translational Efficiencies, Mutation Biases, and Selection Coefficients from Genomic Data Alone.

    PubMed

    Gilchrist, Michael A; Chen, Wei-Chen; Shah, Premal; Landerer, Cedric L; Zaretzki, Russell

    2015-01-01

    Extracting biologically meaningful information from the continuing flood of genomic data is a major challenge in the life sciences. Codon usage bias (CUB) is a general feature of most genomes and is thought to reflect the effects of both natural selection for efficient translation and mutation bias. Here we present a mechanistically interpretable, Bayesian model (ribosome overhead costs Stochastic Evolutionary Model of Protein Production Rate [ROC SEMPPR]) to extract meaningful information from patterns of CUB within a genome. ROC SEMPPR is grounded in population genetics and allows us to separate the contributions of mutational biases and natural selection against translational inefficiency on a gene-by-gene and codon-by-codon basis. Until now, the primary disadvantage of similar approaches was the need for genome scale measurements of gene expression. Here, we demonstrate that it is possible to both extract accurate estimates of codon-specific mutation biases and translational efficiencies while simultaneously generating accurate estimates of gene expression, rather than requiring such information. We demonstrate the utility of ROC SEMPPR using the Saccharomyces cerevisiae S288c genome. When we compare our model fits with previous approaches we observe an exceptionally high agreement between estimates of both codon-specific parameters and gene expression levels ([Formula: see text] in all cases). We also observe strong agreement between our parameter estimates and those derived from alternative data sets. For example, our estimates of mutation bias and those from mutational accumulation experiments are highly correlated ([Formula: see text]). Our estimates of codon-specific translational inefficiencies and tRNA copy number-based estimates of ribosome pausing time ([Formula: see text]), and mRNA and ribosome profiling footprint-based estimates of gene expression ([Formula: see text]) are also highly correlated, thus supporting the hypothesis that selection against translational inefficiency is an important force driving the evolution of CUB. Surprisingly, we find that for particular amino acids, codon usage in highly expressed genes can still be largely driven by mutation bias and that failing to take mutation bias into account can lead to the misidentification of an amino acid's "optimal" codon. In conclusion, our method demonstrates that an enormous amount of biologically important information is encoded within genome scale patterns of codon usage, accessing this information does not require gene expression measurements, but instead carefully formulated biologically interpretable models. PMID:25977456

  17. Comparison of Amino Acids Physico-Chemical Properties and Usage of Late Embryogenesis Abundant Proteins, Hydrophilins and WHy Domain

    PubMed Central

    Jaspard, Emmanuel; Hunault, Gilles

    2014-01-01

    Late Embryogenesis Abundant proteins (LEAPs) comprise several diverse protein families and are mostly involved in stress tolerance. Most of LEAPs are intrinsically disordered and thus poorly functionally characterized. LEAPs have been classified and a large number of their physico-chemical properties have been statistically analyzed. LEAPs were previously proposed to be a subset of a very wide family of proteins called hydrophilins, while a domain called WHy (Water stress and Hypersensitive response) was found in LEAP class 8 (according to our previous classification). Since little is known about hydrophilins and WHy domain, the cross-analysis of their amino acids physico-chemical properties and amino acids usage together with those of LEAPs helps to describe some of their structural features and to make hypothesis about their function. Physico-chemical properties of hydrophilins and WHy domain strongly suggest their role in dehydration tolerance, probably by interacting with water and small polar molecules. The computational analysis reveals that LEAP class 8 and hydrophilins are distinct protein families and that not all LEAPs are a protein subset of hydrophilins family as proposed earlier. Hydrophilins seem related to LEAP class 2 (also called dehydrins) and to Heat Shock Proteins 12 (HSP12). Hydrophilins are likely unstructured proteins while WHy domain is structured. LEAP class 2, hydrophilins and WHy domain are thus proposed to share a common physiological role by interacting with water or other polar/charged small molecules, hence contributing to dehydration tolerance. PMID:25296175

  18. Selection on GGU and CGU codons in the high expression genes in bacteria.

    PubMed

    Satapathy, Siddhartha Sankar; Powdel, Bhesh Raj; Dutta, Malay; Buragohain, Alak Kumar; Ray, Suvendra Kumar

    2014-01-01

    The fourfold degenerate site (FDS) in coding sequences is important for studying the effect of any selection pressure on codon usage bias (CUB) because nucleotide substitution per se is not under any such pressure at the site due to the unaltered amino acid sequence in a protein. We estimated the frequency variation of nucleotides at the FDS across the eight family boxes (FBs) defined as Um(g), the unevenness measure of a gene g. The study was made in 545 species of bacteria. In many bacteria, the Um(g) correlated strongly with Nc'-a measure of the CUB. Analysis of the strongly correlated bacteria revealed that the U-ending codons (GGU, CGU) were preferred to the G-ending codons (GGG, CGG) in Gly and Arg FBs even in the genomes with G+C % higher than 65.0. Further evidence suggested that these codons can be used as a good indicator of selection pressure on CUB in genomes with higher G+C %. PMID:24271854

  19. Hand gesture recognition by analysis of codons

    NASA Astrophysics Data System (ADS)

    Ramachandra, Poornima; Shrikhande, Neelima

    2007-09-01

    The problem of recognizing gestures from images using computers can be approached by closely understanding how the human brain tackles it. A full fledged gesture recognition system will substitute mouse and keyboards completely. Humans can recognize most gestures by looking at the characteristic external shape or the silhouette of the fingers. Many previous techniques to recognize gestures dealt with motion and geometric features of hands. In this thesis gestures are recognized by the Codon-list pattern extracted from the object contour. All edges of an image are described in terms of sequence of Codons. The Codons are defined in terms of the relationship between maxima, minima and zeros of curvature encountered as one traverses the boundary of the object. We have concentrated on a catalog of 24 gesture images from the American Sign Language alphabet (Letter J and Z are ignored as they are represented using motion) [2]. The query image given as an input to the system is analyzed and tested against the Codon-lists, which are shape descriptors for external parts of a hand gesture. We have used the Weighted Frequency Indexing Transform (WFIT) approach which is used in DNA sequence matching for matching the Codon-lists. The matching algorithm consists of two steps: 1) the query sequences are converted to short sequences and are assigned weights and, 2) all the sequences of query gestures are pruned into match and mismatch subsequences by the frequency indexing tree based on the weights of the subsequences. The Codon sequences with the most weight are used to determine the most precise match. Once a match is found, the identified gesture and corresponding interpretation are shown as output.

  20. Enhanced expression of codon optimized Mycobacterium avium subsp. paratuberculosis antigens in Lactobacillus salivarius

    PubMed Central

    Johnston, Christopher D.; Bannantine, John P.; Govender, Rodney; Endersen, Lorraine; Pletzer, Daniel; Weingart, Helge; Coffey, Aidan; O'Mahony, Jim; Sleator, Roy D.

    2014-01-01

    It is well documented that open reading frames containing high GC content show poor expression in A+T rich hosts. Specifically, G+C-rich codon usage is a limiting factor in heterologous expression of Mycobacterium avium subsp. paratuberculosis (MAP) proteins using Lactobacillus salivarius. However, re-engineering opening reading frames through synonymous substitutions can offset codon bias and greatly enhance MAP protein production in this host. In this report, we demonstrate that codon-usage manipulation of MAP2121c can enhance the heterologous expression of the major membrane protein (MMP), analogous to the form in which it is produced natively by MAP bacilli. When heterologously over-expressed, antigenic determinants were preserved in synthetic MMP proteins as shown by monoclonal antibody mediated ELISA. Moreover, MMP is a membrane protein in MAP, which is also targeted to the cellular surface of recombinant L. salivarius at levels comparable to MAP. Additionally, we previously engineered MAP3733c (encoding MptD) and show herein that MptD displays the tendency to associate with the cytoplasmic membrane boundary under confocal microscopy and the intracellularly accumulated protein selectively adheres to the MptD-specific bacteriophage fMptD. This work demonstrates there is potential for L. salivarius as a viable antigen delivery vehicle for MAP, which may provide an effective mucosal vaccine against Johne's disease. PMID:25237653

  1. Two-codon T-box riboswitch binding two tRNAs

    PubMed Central

    Saad, Nizar Y.; Stamatopoulou, Vassiliki; Brayé, Mélanie; Drainas, Denis; Stathopoulos, Constantinos; Becker, Hubert Dominique

    2013-01-01

    T-box riboswitches control transcription of downstream genes through the tRNA-binding formation of terminator or antiterminator structures. Previously reported T-boxes were described as single-specificity riboswitches that can bind specific tRNA anticodons through codon–anticodon interactions with the nucleotide triplet of their specifier loop (SL). However, the possibility that T-boxes might exhibit specificity beyond a single tRNA had been overlooked. In Clostridium acetobutylicum, the T-box that regulates the operon for the essential tRNA-dependent transamidation pathway harbors a SL with two potential overlapping codon positions for tRNAAsn and tRNAGlu. To test its specificity, we performed extensive mutagenic, biochemical, and chemical probing analyses. Surprisingly, both tRNAs can efficiently bind the SL in vitro and in vivo. The dual specificity of the T-box is allowed by a single base shift on the SL from one overlapping codon to the next. This feature allows the riboswitch to sense two tRNAs and balance the biosynthesis of two amino acids. Detailed genomic comparisons support our observations and suggest that “flexible” T-box riboswitches are widespread among bacteria, and, moreover, their specificity is dictated by the metabolic interconnection of the pathways under control. Taken together, our results support the notion of a genome-dependent codon ambiguity of the SLs. Furthermore, the existence of two overlapping codons imposes a unique example of tRNA-dependent regulation at the transcriptional level. PMID:23858450

  2. The Codon-Degeneracy Model of Molecular Evolution

    Microsoft Academic Search

    David A. McClellan

    2000-01-01

    .   Mitochondrial genetic codons can be categorized by four patterns of nucleotide-site degeneracy based on varying combinations\\u000a of twofold- or nondegenerate sites at first codon positions and twofold- or fourfold-degenerate sites at third codon positions.\\u000a Herein, a model of molecular evolution is introduced that uses these patterns to calculate expected substitution frequencies\\u000a for each codon position and substitution type relative

  3. Efficient expression of gene variants that harbour AGA codons next to the initiation codon

    PubMed Central

    Zamora-Romo, Efraín; Cruz-Vera, Luis Rogelio; Vivanco-Domínguez, Serafín; Magos-Castro, Marco Antonio; Guarneros, Gabriel

    2007-01-01

    In an effort to improve the knowledge about the rules which direct the effect of the early ORF sequences on translation efficiency, we have analyzed the effect of pairs of the six arginine codons at the second and third positions on the expression of lacZ variants. Whereas the pairs of identical AGA or AGG codons were favorable for the gene expression, identical pairs of each of the four CGN codons were very inefficient. This result was unexpected because tandems of AGA or AGG codons located in more internal gene positions provoke deficient expression whilst internally located CGU and CGC are the most abundant and efficiently translated arginine codons. The mixed combinations of AGA and each of the CGN codons usually resulted in efficient rates of lacZ expression independently of the peptidyl-tRNA propensity to dissociate from the ribosome. Thus, the variant harboring the pair of AGA codons was expressed as efficiently as the variant carrying a pair of AAA codons in the same positions, a configuration reported as one of the most common and efficient for gene expression. We explain these results assuming that the presence of adenines in these early positions enhance gene expression. As expected, specific mRNA levels correlated with the intensity of lacZ expression for each variant. However, the induction of lacZ AGA AGA gene in pth cells accumulated peptidyl-tRNAArg4 as well as a short 5?-proximal lacZ mRNA fragment suggesting ribosome stalling due to depletion of aminoacylated-tRNAArg4. PMID:17726048

  4. Comparison of ticlopidine vs. clopidogrel in addition to aspirin after paclitaxel-eluting stent implantation: insights from the TRUE (Taxusin Real-life Usage Evaluation) Study.

    PubMed

    Biondi-Zoccai, Giuseppe G L; Agostoni, Pierfrancesco; Sangiorgi, Giuseppe M; Iakovou, Ioannis; Antoniucci, David; Grube, Eberhard; Tamburino, Corrado; Di Mario, Carlo; Reimers, Bernhard; Michev, Iassen; Goktekin, Omer; Airoldi, Flavio; Chieffo, Alaide; Cosgrave, John; Tassanawiwat, Worawut; Colombo, Antonio

    2006-04-14

    Thienopyridines and aspirin are beneficial in patients undergoing bare-metal stent implantation, and aspirin and clopidogrel treatment have also been proved effective after drug-eluting stent (DES) implantation. However, despite the common substitution of clopidogrel with ticlopidine because of cost or patient intolerance, there are no data on the comparison of ticlopidine vs. clopidogrel after DES implantation. We hereby compare ticlopidine vs. clopidogrel after paclitaxel-eluting stent implantation in subjects enrolled in the prospective multicenter Taxus in Real-life Usage Evaluation (TRUE) Study. Across the 505 analyzed patients (112 treated with ticlopidine and 393 with clopidogrel), similar rates of early and mid-term (7 months) adverse thrombotic events were found with either antiplatelet regimen, with the notable exception of 2 cases of late stent thrombosis in patients who had prematurely withdrawn ticlopidine treatment just 3 months after the procedure. These findings thus support the overall safety and effectiveness of ticlopidine after DES implantation, and also confirm the increased risk of late thrombosis when premature withdrawal of thienopyridines occurs. PMID:16520130

  5. TP53 codon 72 polymorphism and glioma risk: A meta-analysis

    PubMed Central

    SHI, MINGHAN; HUANG, RUISHAN; PEI, CHUNYING; JIA, XIUZHI; JIANG, CHUANLU; REN, HUAN

    2011-01-01

    TP53 codon 72 polymorphism has been reported to affect regulatory networks central to glioma development. Although a number of published studies noted the association between TP53 codon 72 polymorphism and glioma risk, their conclusions were inconsistent. A meta-analysis was used to assess the possible association between TP53 codon 72 polymorphism and glioma risk. The PubMed databases were searched, relevant articles were identified and data were retrieved based on the inclusion criteria. The odds ratio (OR) and 95% confidence interval (95% CI) were determined on the pooled dataset. We retrieved eight different studies including 2,260 glioma cases and 3,506 controls. However, no association was found between the TP53 codon 72 polymorphism and glioma risk regarding the comparison between glioma cases and the controls. By further stratification based on criteria such as tumor grade, and the geographical location of the patients and the relevant controls, we found a significant association in the subgroup of patients with high-grade glioma in Europeans compared to controls in two models of TP53 codon 72 polymorphism, which include the dominant model [C/C + G/C vs. G/G: OR=1.35, 95% CI (1.14, 1.59), P=0.0005, Ph=0.13] and the additive model [C allele vs. G allele: OR=1.16, 95% CI (1.02, 1.33), P=0.03, Ph=0.37]. Our analysis suggests that TP53 codon 72 polymorphism is associated with an increased risk of high-grade glioma development in Europeans. PMID:22740959

  6. Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons.

    PubMed

    Inouye, Satoshi; Sahara-Miura, Yuiko; Sato, Jun-ichi; Suzuki, Takahiro

    2015-05-01

    A simple design method for codon optimization of genes to express a heterologous protein in mammalian cells is described. Codon optimization was performed by choosing only codons preferentially used in humans and with over 60% GC content, and the method was named the "preferred human codon-optimized method." To test our simple rule for codon optimization, the preferred human codon-optimized genes for six proteins containing photoproteins (aequorin and clytin II) and luciferases (Gaussia luciferase, Renilla luciferase, and firefly luciferases from Photinus pyralis and Luciola cruciata) were chemically synthesized and transiently expressed in Chinese hamster ovary-K1 cells. All preferred human codon-optimized genes showed higher luminescence activity than the corresponding wild-type genes. Our simple design method could be used to improve protein expression in mammalian cells efficiently. PMID:25665506

  7. Serine tRNA complementary to the nonuniversal serine codon CUG in Candida cylindracea: evolutionary implications.

    PubMed Central

    Yokogawa, T; Suzuki, T; Ueda, T; Mori, M; Ohama, T; Kuchino, Y; Yoshinari, S; Motoki, I; Nishikawa, K; Osawa, S

    1992-01-01

    In the asporogenic yeast Candida cylindracea, the codon CUG is read as serine instead of leucine. This is an unusual instance in which the amino acid assignment of a codon deviates from the universal code. To infer the evolutionary process of this change, the tRNA with the anticodon sequence CAG, which is complementary to and thus responsible for translation of the codon CUG, has been identified. Indeed, this tRNA translates an in-frame CUG codon in a synthetic mRNA as serine in an in vitro translation system. The gene for the tRNA is interrupted by an intron in the anticodon loop. Sequence comparisons of the tRNA and its gene suggest that a single cytidine was inserted into the anticodon loop of the gene for tRNA(Ser)IGA during evolution to produce tRNA(Ser)CAG. The tRNA(Ser)CAG may be produced from its precursor molecule containing the cytidine insertion by splicing. PMID:1502151

  8. CpG Usage in RNA Viruses: Data and Hypotheses

    PubMed Central

    Cheng, Xiaofei; Virk, Nasar; Chen, Wei; Ji, Shuqin; Ji, Shuxian; Sun, Yuqiang; Wu, Xiaoyun

    2013-01-01

    CpG repression in RNA viruses has been known for decades, but a reasonable explanation has not yet been proposed to explain this phenomenon. In this study, we calculated the CpG odds ratio of all RNA viruses that have available genome sequences and analyzed the correlation with their genome polarity, base composition, synonymous codon usage, phylogenetic relationship, and host. The results indicated that the viral base composition, synonymous codon usage and host selection were the dominant factors that determined the CpG bias in RNA viruses. CpG usage variation between the different viral groups was caused by different combinations of these pressures, which also differed from each other in strength. The consistent under-representation of CpG usage in ?ssRNA viruses is determined predominantly by base composition, which may be a consequence of the U/A preferred mutation bias of ?ssRNA viruses, whereas the CpG usage of +ssRNA viruses is affected greatly by their hosts. As a result, most +ssRNA viruses mimic their hosts' CpG usage. Unbiased CpG usage in dsRNA viruses is most likely a result of their dsRNA genome, which allows the viruses to escape from the host-driven CpG elimination pressure. CpG was under-represented in all reverse-transcribing viruses (RT viruses), suggesting that DNA methylation is an important factor affecting the CpG usage of retroviruses. However, vertebrate-infecting RT viruses may also suffer host' CpG elimination pressure that also acts on +ssRNA viruses, which results in further under-representation of CpG in the vertebrate-infecting RT viruses. PMID:24086312

  9. The importance of codon-anticodon interactions in translation elongation.

    PubMed

    Saint-Léger, Adélaïde; Ribas de Pouplana, Lluís

    2015-07-01

    Translation is the process by which genetic information is turned into amino acid sequence, following the instructions of the genetic code. The formation of a correct codon-anticodon pair is essential to ensure efficiency and fidelity during translation. Here we review the influence that codon-anticodon interactions play over the elongation phase of translation; including the role of this interaction in cognate tRNA selection by ribosomes, the importance of relative codon frequencies in the cell, and the roles of tRNA modifications in the process of codon-anticodon recognition. PMID:25921436

  10. Codon usage limitation in the expression of HIV1 envelope glycoprotein

    Microsoft Academic Search

    Jürgen Haas; Eun-Chung Park; Brian Seed

    1996-01-01

    Background: The expression of both the env and gag gene products of human immunodeficiency virus type 1 (HIV-1) is known to be limited by cis elements in the viral RNA that impede egress from the nucleus and reduce the efficiency of translation. Identifying these elements has proven difficult, as they appear to be disseminated throughout the viral genome.Results Here, we

  11. A codon-optimized green fluorescent protein for live cell imaging in Zymoseptoria tritici?

    PubMed Central

    Kilaru, S.; Schuster, M.; Studholme, D.; Soanes, D.; Lin, C.; Talbot, N.J.; Steinberg, G.

    2015-01-01

    Fluorescent proteins (FPs) are powerful tools to investigate intracellular dynamics and protein localization. Cytoplasmic expression of FPs in fungal pathogens allows greater insight into invasion strategies and the host-pathogen interaction. Detection of their fluorescent signal depends on the right combination of microscopic setup and signal brightness. Slow rates of photo-bleaching are pivotal for in vivo observation of FPs over longer periods of time. Here, we test green-fluorescent proteins, including Aequorea coerulescens GFP (AcGFP), enhanced GFP (eGFP) from Aequorea victoria and a novel Zymoseptoria tritici codon-optimized eGFP (ZtGFP), for their usage in conventional and laser-enhanced epi-fluorescence, and confocal laser-scanning microscopy. We show that eGFP, expressed cytoplasmically in Z. tritici, is significantly brighter and more photo-stable than AcGFP. The codon-optimized ZtGFP performed even better than eGFP, showing significantly slower bleaching and a 20–30% further increase in signal intensity. Heterologous expression of all GFP variants did not affect pathogenicity of Z. tritici. Our data establish ZtGFP as the GFP of choice to investigate intracellular protein dynamics in Z. tritici, but also infection stages of this wheat pathogen inside host tissue. PMID:26092799

  12. Codon Optimization Significantly Improves the Expression Level of ?-Amylase Gene from Bacillus licheniformis in Pichia pastoris

    PubMed Central

    Wang, Jian-Rong; Li, Yang-Yuan; Liu, Dan-Ni; Liu, Jing-Shan; Li, Peng; Chen, Li-Zhi; Xu, Shu-De

    2015-01-01

    ?-Amylase as an important industrial enzyme has been widely used in starch processing, detergent, and paper industries. To improve expression efficiency of recombinant ?-amylase from Bacillus licheniformis (B. licheniformis), the ?-amylase gene from B. licheniformis was optimized according to the codon usage of Pichia pastoris (P. pastoris) and expressed in P. pastoris. Totally, the codons encoding 305 amino acids were optimized in which a total of 328 nucleotides were changed and the G+C content was increased from 47.6 to 49.2%. The recombinants were cultured in 96-deep-well microplates and screened by a new plate assay method. Compared with the wild-type gene, the optimized gene is expressed at a significantly higher level in P. pastoris after methanol induction for 168?h in 5- and 50-L bioreactor with the maximum activity of 8100 and 11000?U/mL, which was 2.31- and 2.62-fold higher than that by wild-type gene. The improved expression level makes the enzyme a good candidate for ?-amylase production in industrial use. PMID:26171389

  13. Evidence of efficient stop codon readthrough in four mammalian genes

    E-print Network

    Loughran, Gary

    Stop codon readthrough is used extensively by viruses to expand their gene expression. Until recent discoveries in Drosophila, only a very limited number of readthrough cases in chromosomal genes had been reported. Analysis ...

  14. Heterologous Stop Codon Readthrough of Metazoan Readthrough Candidates in Yeast

    E-print Network

    Jungreis, Irwin

    Recent analysis of genomic signatures in mammals, flies, and worms indicates that functional translational stop codon readthrough is considerably more abundant in metazoa than previously recognized, but this analysis ...

  15. AGRICULTURAL CHEMICAL USAGE DATA

    EPA Science Inventory

    This report, which summarizes the use of agricultural chemicals is issued by the National Agricultural Statistics Service (NASS) as part of its series on Agricultural Chemical Usage. Other publications in the series present statistics for on-farm agricultural chemical usage for f...

  16. Exploring Codon Optimization and Response Surface Methodology to Express Biologically Active Transmembrane RANKL in E. coli

    PubMed Central

    Bok, Jin-Duck; Kim, Jeong-In; Jiang, Tao; Cho, Chong-Su; Kang, Sang-Kee; Choi, Yun-Jaie

    2014-01-01

    Receptor activator of nuclear factor (NF)-?B ligand (RANKL), a master cytokine that drives osteoclast differentiation, activation and survival, exists in both transmembrane and extracellular forms. To date, studies on physiological role of RANKL have been mainly carried out with extracellular RANKL probably due to difficulties in achieving high level expression of functional transmembrane RANKL (mRANKL). In the present study, we took advantage of codon optimization and response surface methodology to optimize the soluble expression of mRANKL in E. coli. We optimized the codon usage of mRANKL sequence to a preferred set of codons for E. coli changing its codon adaptation index from 0.64 to 0.76, tending to increase its expression level in E. coli. Further, we utilized central composite design to predict the optimum combination of variables (cell density before induction, lactose concentration, post-induction temperature and post-induction time) for the expression of mRANKL. Finally, we investigated the effects of various experimental parameters using response surface methodology. The best combination of response variables was 0.6 OD600, 7.5 mM lactose, 26°C post-induction temperature and 5 h post-induction time that produced 52.4 mg/L of fusion mRANKL. Prior to functional analysis of the protein, we purified mRANKL to homogeneity and confirmed the existence of trimeric form of mRANKL by native gel electrophoresis and gel filtration chromatography. Further, the biological activity of mRANKL to induce osteoclast formation on RAW264.7 cells was confirmed by tartrate resistant acid phosphatase assay and quantitative real-time polymerase chain reaction assays. Importantly, a new finding from this study was that the biological activity of mRANKL is higher than its extracellular counterpart. To the best of our knowledge, this is the first time to report heterologous expression of mRANKL in soluble form and to perform a comparative study of functional properties of both forms of RANKL. PMID:24809485

  17. RNA virus attenuation by codon pair deoptimisation is an artefact of increases in CpG/UpA dinucleotide frequencies.

    PubMed

    Tulloch, Fiona; Atkinson, Nicky J; Evans, David J; Ryan, Martin D; Simmonds, Peter

    2014-01-01

    Mutating RNA virus genomes to alter codon pair (CP) frequencies and reduce translation efficiency has been advocated as a method to generate safe, attenuated virus vaccines. However, selection for disfavoured CPs leads to unintended increases in CpG and UpA dinucleotide frequencies that also attenuate replication. We designed and phenotypically characterised mutants of the picornavirus, echovirus 7, in which these parameters were independently varied to determine which most influenced virus replication. CpG and UpA dinucleotide frequencies primarily influenced virus replication ability while no fitness differences were observed between mutants with different CP usage where dinucleotide frequencies were kept constant. Contrastingly, translation efficiency was unaffected by either CP usage or dinucleotide frequencies. This mechanistic insight is critical for future rational design of live virus vaccines and their safety evaluation; attenuation is mediated through enhanced innate immune responses to viruses with elevated CpG/UpA dinucleotide frequencies rather the viruses themselves being intrinsically defective. PMID:25490153

  18. Reduced Amino Acid Specificity of Mammalian Tyrosyl-tRNA Synthetase Is Associated with Elevated Mistranslation of Tyr Codons*

    PubMed Central

    Raina, Medha; Moghal, Adil; Kano, Amanda; Jerums, Mathew; Schnier, Paul D.; Luo, Shun; Deshpande, Rohini; Bondarenko, Pavel V.; Lin, Henry; Ibba, Michael

    2014-01-01

    Quality control operates at different steps in translation to limit errors to approximately one mistranslated codon per 10,000 codons during mRNA-directed protein synthesis. Recent studies have suggested that error rates may actually vary considerably during translation under different growth conditions. Here we examined the misincorporation of Phe at Tyr codons during synthesis of a recombinant antibody produced in tyrosine-limited Chinese hamster ovary (CHO) cells. Tyr to Phe replacements were previously found to occur throughout the antibody at a rate of up to 0.7% irrespective of the identity or context of the Tyr codon translated. Despite this comparatively high mistranslation rate, no significant change in cellular viability was observed. Monitoring of Phe and Tyr levels revealed that changes in error rates correlated with changes in amino acid pools, suggesting that mischarging of tRNATyr with noncognate Phe by tyrosyl-tRNA synthetase was responsible for mistranslation. Steady-state kinetic analyses of CHO cytoplasmic tyrosyl-tRNA synthetase revealed a 25-fold lower specificity for Tyr over Phe as compared with previously characterized bacterial enzymes, consistent with the observed increase in translation error rates during tyrosine limitation. Functional comparisons of mammalian and bacterial tyrosyl-tRNA synthetase revealed key differences at residues responsible for amino acid recognition, highlighting differences in evolutionary constraints for translation quality control. PMID:24828507

  19. The association of p53 mutations and p53 codon 72, Her 2 codon 655 and MTHFR C677T polymorphisms with breast cancer in Northern Greece

    Microsoft Academic Search

    Theodora G. Kalemi; Alexandros F. Lambropoulos; Maria Gueorguiev; Sofia Chrisafi; Konstantinos T. Papazisis; Alexandros Kotsis

    2005-01-01

    The aim of this study was to explore a possible association between p53 codon 72, Her 2 codon 655 and MTHFR C677T polymorphisms and breast cancer in Northern Greece. We examined 42 women with breast cancer and 51 controls. A total of 42 women with breast cancer as well as healthy controls were investigated and results showed that p53 codon

  20. Translation initiation at non-AUG codons mediated by weakened association of eukaryotic initiation factor (eIF) 2 subunits.

    PubMed Central

    Hashimoto, Nilce N; Carnevalli, Larissa S; Castilho, Beatriz A

    2002-01-01

    The heterotrimeric eukaryotic initiation factor (eIF) 2 binds the initiator methionyl-tRNA in a GTP-dependent mode and delivers it to the 40 S ribosomal subunit. In the present study, we have identified amino acid residues in eIF2beta required for binding to eIF2gamma in yeast. Alteration of six residues in the central region of eIF2beta abolished this interaction, as determined by GST-pull down and two-hybrid assays, and leads to cell lethality. Substitution of (131)Tyr and (132)Ser by alanine residues ((131)YS), although abolishing the binding to eIF2gamma in these assays, resulted in a functional but defective protein in vivo, imparting a temperature-sensitive growth phenotype to cells. A dramatically weakened association of this mutant protein with eIF2gamma in vivo was shown by co-immunoprecipitation. The (131)YS mutation in eIF2beta allows translation to initiate at non-AUG codons, as defined by the ability of cells carrying an initiator codon mutation in the HIS4 mRNA to grow in the absence of histidine. The combination of this mutation with the (264)Ser-->Tyr alteration, a previously isolated suppressor of initiator codon mutations which has been shown to increase the spontaneous GTP hydrolysis in the ternary complex, caused a recessive lethality, suggesting additive defects. Thus the impaired interaction of these two subunits represents a novel type of defect in eIF2 function, providing in vivo evidence that the strength of interaction between eIF2beta and eIF2gamma defines the correct usage of the AUG codon for translation initiation. PMID:12137565

  1. Dual Accelerometer Usage Strategy for Onboard Space Navigation

    NASA Technical Reports Server (NTRS)

    Zanetti, Renato; D'Souza, Chris

    2012-01-01

    This work introduces a dual accelerometer usage strategy for onboard space navigation. In the proposed algorithm the accelerometer is used to propagate the state when its value exceeds a threshold and it is used to estimate its errors otherwise. Numerical examples and comparison to other accelerometer usage schemes are presented to validate the proposed approach.

  2. Robotics and Energy Usage 

    E-print Network

    Hershey, R. L.; Fenton, S. E.; Letzt, A. M.

    1983-01-01

    It is commonly assumed that the use of robots in an industrial plant will cut energy usage, because robots require no heat, light, or air conditioning in their work space. However, in analyzing industrial installations, we have found that...

  3. Adaptation studied with the self-consistent codon index: genomic spaces, metabolic network

    E-print Network

    Carbone, Alessandra

    are formed out of 20 amino-acids which are coded in triplets of nucleotides, called codons. The four or CAI for short, which expresses its synonymous codon bias (see appendix for the definition). The idea

  4. All-codon scanning identifies p53 cancer rescue mutations

    E-print Network

    Lathrop, Richard H.

    strategies are valuable tools to identify critical residues in proteins and to generate proteins of Microbiology and Molecular Genetics, 4 Department of Chemical Engineering and Materials Science, 5 Department with modified properties. We describe the fast and simple All- Codon Scanning (ACS) strategy that creates

  5. ABC50 mutants modify translation start codon selection.

    PubMed

    Stewart, Joanna D; Cowan, Joanne L; Perry, Lisa S; Coldwell, Mark J; Proud, Christopher G

    2015-04-15

    ATP-binding cassette 50 (ABC50; also known as ABCF1) binds to eukaryotic initiation factor 2 (eIF2) and is required for efficient translation initiation. An essential step of this process is accurate recognition and selection of the initiation codon. It is widely accepted that the presence and movement of eIF1, eIF1A and eIF5 are key factors in modulating the stringency of start-site selection, which normally requires an AUG codon in an appropriate sequence context. In the present study, we show that expression of ABC50 mutants, which cannot hydrolyse ATP, decreases general translation and relaxes the discrimination against the use of non-AUG codons at translation start sites. These mutants do not appear to alter the association of key initiation factors to 40S subunits. The stringency of start-site selection can be restored through overexpression of eIF1, consistent with the role of that factor in enhancing stringency. The present study indicates that interfering with the function of ABC50 influences the accuracy of initiation codon selection. PMID:25597744

  6. Transcription, Translation and Mutation Given this list of codons

    E-print Network

    Prestwich, Ken

    Transcription, Translation and Mutation GenBio1 Fall 2011 Given this list of codons: Consider the sequence below as if you were the ribosome. 5' ACUCUUAAUGAAUUGGAGGUGCAGUCCCUGAGUGAU 3' 1. Translate the m, if any, would this mutation have on the protein? 3. Once again make reference to the mRNA at the top

  7. Selection of an avian retrovirus mutant with extended receptor usage.

    PubMed Central

    Taplitz, R A; Coffin, J M

    1997-01-01

    Receptor recognition by avian retroviruses is thought to involve the interaction of two regions of the SU protein, hr1 and hr2, with the host cell surface receptor. These regions exhibit considerable variation, concordant with differences in receptor usage among the many avian leukosis virus subgroups. We hypothesize that some retroviruses have altered receptor usage in response to selective pressures imposed by receptor polymorphisms in their hosts. To test this hypothesis, we passaged td-Pr-RSV-B on cocultured permissive chicken (C/E) and nonpermissive quail (QT6/BD) cells. A variant virus with an expanded host range was identified at passage 29 and ultimately shown to be identical in sequence to td-Pr-RSV-B, except for changes at codons 155 and 156 of SU amino acid corresponding to two amino acid changes within hr1. Superinfection resistance studies suggest that the variant virus recognizes the subgroup B receptor on chicken cells and the subgroup E receptor on quail cells. These findings indicate that altered receptor usage can be conferred by small changes in env and may point to a key region for receptor interaction. Further, they demonstrate the evolutionary potential of retroviral env genes to alter receptor usage in response to appropriate selective pressure. PMID:9311868

  8. Animal products and K-ras codon 12 and 13 mutations in colon carcinomas

    Microsoft Academic Search

    E. Kampman; D. W. Voskuil; Kraats van A. A; H. F. Balder; Muijen van G. N. P; R. S. Goldbohm; Veer van't P

    2000-01-01

    K-ras gene mutations (codons 12 and 13) were determined by PCR-based mutant allele-specific amplification (MASA) in tumour tissue of 185 colon cancer patients: 36?arboured mutations, of which 82 ere located in codon 12. High intakes of animal protein, calcium and poultry were differently associated with codon 12 and 13 mutations: odds ratios (OR) and 95?onfidence intervals (95?I) for codon 12

  9. Codon-optimized Human Sodium Iodide Symporter (opt-hNIS) as a Sensitive Reporter and Efficient Therapeutic Gene

    PubMed Central

    Kim, Young-Hwa; Youn, Hyewon; Na, Juri; Hong, Kee-Jong; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key

    2015-01-01

    To generate a more efficient in vivo reporter and therapeutic gene, we optimized the coding sequence of the human sodium/iodide symporter (NIS) gene by replacing NIS DNA codons from wild type to new codons having the highest usage in human gene translation. The Codon Adaptation Index (CAI), representing the number of codons effective for human expression, was much improved (0.79 for hNIS, 0.97 for opt-hNIS). Both wild-type (hNIS) and optimized human NIS (opt-hNIS) were cloned into pcDNA3.1 and pMSCV vectors for transfection. Various cancer cell lines such as thyroid (TPC-1, FRO, B-CPAP), breast (MDA-MB-231), liver (Hep3B), cervical (HeLa), and glioma (U87MG) were transfected with pcDNA3.1/hNIS or pcDNA3.1/opt-hNIS. 125I uptake by opt-hNIS-expressing cells was 1.6 ~ 2.1 times higher than uptake by wild-type hNIS-expressing cells. Stable cell lines were also established by retroviral transduction using pMSCV/hNIS or pMSCV/opt-hNIS, revealing higher NIS protein levels and 125I uptake in opt-hNIS-expressing cells than in hNIS-expressing cells. Moreover, scintigraphic images from cell plates and mouse xenografts showed stronger signals from opt-hNIS-expressing cells than hNIS-expressing cells, and radioactivity uptake by opt-hNIS-expressing tumors was 2.3-fold greater than that by hNIS-expressing tumors. To test the efficacy of radioiodine therapy, mouse xenograft models were established with cancer cells expressing hNIS or opt-hNIS. 131I treatment reduced tumor sizes of hNIS- and opt-hNIS-expressing tumors to 0.57- and 0.27- fold, respectively, compared to their sizes before therapy, suggesting an improved therapeutic effect of opt-hNIS. In summary, this study shows that codon optimization strongly increases hNIS protein levels and radioiodine uptake, thus supporting opt-hNIS as a more sensitive reporter and efficient therapeutic gene. PMID:25553100

  10. Codon-optimized human sodium iodide symporter (opt-hNIS) as a sensitive reporter and efficient therapeutic gene.

    PubMed

    Kim, Young-Hwa; Youn, Hyewon; Na, Juri; Hong, Kee-Jong; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key

    2015-01-01

    To generate a more efficient in vivo reporter and therapeutic gene, we optimized the coding sequence of the human sodium/iodide symporter (NIS) gene by replacing NIS DNA codons from wild type to new codons having the highest usage in human gene translation. The Codon Adaptation Index (CAI), representing the number of codons effective for human expression, was much improved (0.79 for hNIS, 0.97 for opt-hNIS). Both wild-type (hNIS) and optimized human NIS (opt-hNIS) were cloned into pcDNA3.1 and pMSCV vectors for transfection. Various cancer cell lines such as thyroid (TPC-1, FRO, B-CPAP), breast (MDA-MB-231), liver (Hep3B), cervical (HeLa), and glioma (U87MG) were transfected with pcDNA3.1/hNIS or pcDNA3.1/opt-hNIS. 125I uptake by opt-hNIS-expressing cells was 1.6~2.1 times higher than uptake by wild-type hNIS-expressing cells. Stable cell lines were also established by retroviral transduction using pMSCV/hNIS or pMSCV/opt-hNIS, revealing higher NIS protein levels and 125I uptake in opt-hNIS-expressing cells than in hNIS-expressing cells. Moreover, scintigraphic images from cell plates and mouse xenografts showed stronger signals from opt-hNIS-expressing cells than hNIS-expressing cells, and radioactivity uptake by opt-hNIS-expressing tumors was 2.3-fold greater than that by hNIS-expressing tumors. To test the efficacy of radioiodine therapy, mouse xenograft models were established with cancer cells expressing hNIS or opt-hNIS. 131I treatment reduced tumor sizes of hNIS- and opt-hNIS-expressing tumors to 0.57- and 0.27- fold, respectively, compared to their sizes before therapy, suggesting an improved therapeutic effect of opt-hNIS. In summary, this study shows that codon optimization strongly increases hNIS protein levels and radioiodine uptake, thus supporting opt-hNIS as a more sensitive reporter and efficient therapeutic gene. PMID:25553100

  11. Prokaryotic Gene Finding Based on Physicochemical Characteristics of Codons Calculated from Molecular Dynamics Simulations

    E-print Network

    Jayaram, Bhyravabotla

    Prokaryotic Gene Finding Based on Physicochemical Characteristics of Codons Calculated from An ab initio model for gene prediction in prokaryotic genomes is proposed based on physicochemical prediction in prokaryotic genomes based on a set of three physicochemical characteristics of codons--by codon

  12. Usage as Rhetoric.

    ERIC Educational Resources Information Center

    Gorrell, Robert M.

    Even though linguistics has freed us from misconceptions, we have continued to seek answers to usage problems primarily by looking to linguistics. The myth of the verbal authority of standard speakers has given way to the evaluation of statistical frequency of forms. No matter how extensive or accurate the statistics, they must still be followed…

  13. Usage and Safety Activities

    NSDL National Science Digital Library

    This page presents activities related to usage and safety from the Science & Engineering in the Lives of Students project. Activities include Battery and Bulb, Examine GFCI Outlet, Grounding and Protecting, Insulators, and Waste. Each activity includes a detailed description, list of the materials needed, science concepts covered, and reflection questions.

  14. Mutation-Specific RAS Oncogenicity Explains N-RAS Codon 61 Selection in Melanoma

    PubMed Central

    Burd, Christin E.; Liu, Wenjin; Huynh, Minh V.; Waqas, Meriam A.; Gillahan, James E.; Clark, Kelly S.; Fu, Kailing; Martin, Brit L.; Jeck, William R.; Souroullas, George P.; Darr, David B.; Zedek, Daniel C.; Miley, Michael J.; Baguley, Bruce C.; Campbell, Sharon L.

    2014-01-01

    N-RAS mutation at codon 12, 13 or 61 is associated with transformation; yet, in melanoma, such alterations are nearly exclusive to codon 61. Here, we compared the melanoma susceptibility of an N-RasQ61R knock-in allele to similarly designed K-RasG12D and N-RasG12D alleles. With concomitant p16INK4a inactivation, K-RasG12D or N-RasQ61R expression efficiently promoted melanoma in vivo, whereas N-RasG12D did not. Additionally, N-RasQ61R mutation potently cooperated with Lkb1/Stk11 loss to induce highly metastatic disease. Functional comparisons of N-RasQ61R and N-RasG12D revealed little difference in the ability of these proteins to engage PI3K or RAF. Instead, N-RasQ61R showed enhanced nucleotide binding, decreased intrinsic GTPase activity and increased stability when compared to N-RasG12D. This work identifies a faithful model of human N-RAS mutant melanoma, and suggests that the increased melanomagenecity of N-RasQ61R over N-RasG12D is due to heightened abundance of the active, GTP-bound form rather than differences in the engagement of downstream effector pathways. PMID:25252692

  15. Resolving Discrepancy between Nucleotides and Amino Acids in Deep-Level Arthropod Phylogenomics: Differentiating Serine Codons in 21-Amino-Acid Models

    PubMed Central

    Zwick, Andreas; Regier, Jerome C.; Zwickl, Derrick J.

    2012-01-01

    Background In a previous study of higher-level arthropod phylogeny, analyses of nucleotide sequences from 62 protein-coding nuclear genes for 80 panarthopod species yielded significantly higher bootstrap support for selected nodes than did amino acids. This study investigates the cause of that discrepancy. Methodology/Principal Findings The hypothesis is tested that failure to distinguish the serine residues encoded by two disjunct clusters of codons (TCN, AGY) in amino acid analyses leads to this discrepancy. In one test, the two clusters of serine codons (Ser1, Ser2) are conceptually translated as separate amino acids. Analysis of the resulting 21-amino-acid data matrix shows striking increases in bootstrap support, in some cases matching that in nucleotide analyses. In a second approach, nucleotide and 20-amino-acid data sets are artificially altered through targeted deletions, modifications, and replacements, revealing the pivotal contributions of distinct Ser1 and Ser2 codons. We confirm that previous methods of coding nonsynonymous nucleotide change are robust and computationally efficient by introducing two new degeneracy coding methods. We demonstrate for degeneracy coding that neither compositional heterogeneity at the level of nucleotides nor codon usage bias between Ser1 and Ser2 clusters of codons (or their separately coded amino acids) is a major source of non-phylogenetic signal. Conclusions The incongruity in support between amino-acid and nucleotide analyses of the forementioned arthropod data set is resolved by showing that “standard” 20-amino-acid analyses yield lower node support specifically when serine provides crucial signal. Separate coding of Ser1 and Ser2 residues yields support commensurate with that found by degenerated nucleotides, without introducing phylogenetic artifacts. While exclusion of all serine data leads to reduced support for serine-sensitive nodes, these nodes are still recovered in the ML topology, indicating that the enhanced signal from Ser1 and Ser2 is not qualitatively different from that of the other amino acids. PMID:23185239

  16. An evaluation of data-driven motion estimation in comparison to the usage of external-surrogates in cardiac SPECT imaging

    PubMed Central

    Mukherjee, Joyeeta Mitra; Hutton, Brian F; Johnson, Karen L; Pretorius, P Hendrik; King, Michael A

    2014-01-01

    Motion estimation methods in single photon emission computed tomography (SPECT) can be classified into methods which depend on just the emission data (data-driven), or those that use some other source of information such as an external surrogate. The surrogate-based methods estimate the motion exhibited externally which may not correlate exactly with the movement of organs inside the body. The accuracy of data-driven strategies on the other hand is affected by the type and timing of motion occurrence during acquisition, the source distribution, and various degrading factors such as attenuation, scatter, and system spatial resolution. The goal of this paper is to investigate the performance of two data-driven motion estimation schemes based on the rigid-body registration of projections of motion-transformed source distributions to the acquired projection data for cardiac SPECT studies. Comparison is also made of six intensity based registration metrics to an external surrogate-based method. In the data-driven schemes, a partially reconstructed heart is used as the initial source distribution. The partially-reconstructed heart has inaccuracies due to limited angle artifacts resulting from using only a part of the SPECT projections acquired while the patient maintained the same pose. The performance of different cost functions in quantifying consistency with the SPECT projection data in the data-driven schemes was compared for clinically realistic patient motion occurring as discrete pose changes, one or two times during acquisition. The six intensity-based metrics studied were mean-squared difference (MSD), mutual information (MI), normalized mutual information (NMI), pattern intensity (PI), normalized cross-correlation (NCC) and entropy of the difference (EDI). Quantitative and qualitative analysis of the performance is reported using Monte-Carlo simulations of a realistic heart phantom including degradation factors such as attenuation, scatter and system spatial resolution. Further the visual appearance of motion-corrected images using data-driven motion estimates was compared to that obtained using the external motion-tracking system in patient studies. Pattern intensity and normalized mutual information cost functions were observed to have the best performance in terms of lowest average position error and stability with degradation of image quality of the partial reconstruction in simulations. In all patients, the visual quality of PI-based estimation was either significantly better or comparable to NMI-based estimation. Best visual quality was obtained with PI-based estimation in 1 of the 5 patient studies, and with external-surrogate based correction in 3 out of 5 patients. In the remaining patient study there was little motion and all methods yielded similar visual image quality. PMID:24107647

  17. SPRING 2005 Brand usage guidelines

    E-print Network

    Wirosoetisno, Djoko

    , it is crucial that all external communication from Durham University is branded consistently. This helpsISSUE 1 SPRING 2005 Brand usage guidelines #12;#12;DURHAM UNIVERSITY BRAND USAGE GUIDELINES As you with confidence and modernity. Introducing the new marque THE NEW MARQUE #12;DURHAM UNIVERSITY BRAND USAGE

  18. Codon Optimisation Is Key for Pernisine Expression in Escherichia coli

    PubMed Central

    Šnajder, Marko; Miheli?, Marko; Turk, Dušan; Ulrih, Nataša Poklar

    2015-01-01

    Background Pernisine is an extracellular serine protease from the hyperthermophilic Archaeon Aeropyrum pernix K1. Low yields from the natural host and expression problems in heterologous hosts have limited the potential applications of pernisine in industry. Methodology/ Principal Findings The challenges of pernisine overexpression in Escherichia coli were overcome by codon preference optimisation and de-novo DNA synthesis. The following forms of the pernisine gene were cloned into the pMCSGx series of vectors and expressed in E. coli cells: wild-type (pernisinewt), codon-optimised (pernisineco), and codon-optimised with a S355A mutation of a predicted active site (pernisineS355Aco). The fusion-tagged pernisines were purified using fast protein liquid chromatography equipped with Ni2+ chelate and gel filtration chromatography columns. The identities of the resultant proteins were confirmed with N-terminal sequencing, tandem mass spectrometry analysis, and immunodetection. Pernisinewt was not expressed in E. coli at detectable levels, while pernisineco and pernisineS355Aco were expressed and purified as 55-kDa proforms with yields of around 10 mg per litre E. coli culture. After heat activation of purified pernisine, the proteolytic activity of the mature pernisineco was confirmed using zymography, at a molecular weight of 36 kDa, while the mutant pernisineS355Aco remained inactive. Enzymatic performances of pernisine evaluated under different temperatures and pHs demonstrate that the optimal enzymatic activity of the recombinant pernisine is ca. 100°C and pH 7.0, respectively. Conclusions/ Significance These data demonstrate that codon optimisation is crucial for pernisine overexpression in E. coli, and that the proposed catalytic Ser355 has an important role in pernisine activity, but not in its activation process. Pernisine is activated by autoproteolytical cleavage of its N-terminal proregion. We have also confirmed that the recombinant pernisine retains the characteristics of native pernisine, as a calcium modulated thermostable serine protease. PMID:25856104

  19. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 ?M/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 ?M/min and Km (NADH) 51.3 ?M, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  20. Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

    Microsoft Academic Search

    R. Medori; H. J. Tritschler

    1993-01-01

    Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of

  1. Control of translation efficiency in yeast by codon-anticodon interactions.

    PubMed

    Letzring, Daniel P; Dean, Kimberly M; Grayhack, Elizabeth J

    2010-12-01

    The choice of synonymous codons used to encode a polypeptide contributes to substantial differences in translation efficiency between genes. However, both the magnitude and the mechanisms of codon-mediated effects are unknown, as neither the effects of individual codons nor the parameters that modulate codon-mediated regulation are understood, particularly in eukaryotes. To explore this problem in Saccharomyces cerevisiae, we performed the first systematic analysis of codon effects on expression. We find that the arginine codon CGA is strongly inhibitory, resulting in progressively and sharply reduced expression with increased CGA codon dosage. CGA-mediated inhibition of expression is primarily due to wobble decoding of CGA, since it is nearly completely suppressed by coexpression of an exact match anticodon-mutated tRNA(Arg(UCG)), and is associated with generation of a smaller RNA fragment, likely due to endonucleolytic cleavage at a stalled ribosome. Moreover, CGA codon pairs are more effective inhibitors of expression than individual CGA codons. These results directly implicate decoding by the ribosome and interactions at neighboring sites within the ribosome as mediators of codon-specific translation efficiency. PMID:20971810

  2. Feasibility Study of a Rotorcraft Health and Usage Monitoring System (HUMS): Usage and Structural Life Monitoring Evaluation

    NASA Technical Reports Server (NTRS)

    Dickson, B.; Cronkhite, J.; Bielefeld, S.; Killian, L.; Hayden, R.

    1996-01-01

    The objective of this study was to evaluate two techniques, Flight Condition Recognition (FCR) and Flight Load Synthesis (FIS), for usage monitoring and assess the potential benefits of extending the retirement intervals of life-limited components, thus reducing the operator's maintenance and replacement costs. Both techniques involve indirect determination of loads using measured flight parameters and subsequent fatigue analysis to calculate the life expended on the life-limited components. To assess the potential benefit of usage monitoring, the two usage techniques were compared to current methods of component retirement. In addition, comparisons were made with direct load measurements to assess the accuracy of the two techniques.

  3. Partial Optimization of the 5-Terminal Codon Increased a Recombination Porcine Pancreatic Lipase (opPPL) Expression in Pichia pastoris

    PubMed Central

    Zhao, Hua; Chen, Dan; Tang, Jiayong; Jia, Gang; Long, Dingbiao; Liu, Guangmang; Chen, Xiaoling; Shang, Haiying

    2014-01-01

    Pancreatic lipase plays a key role in intestinal digestion of feed fat, and is often deficient in young animals such as weaning piglets. The objective of this study was to express and characterize a partial codon optimized porcine pancreatic lipase (opPPL). A 537 bp cDNA fragment encoding N-terminus amino acid residue of the mature porcine pancreatic lipase was synthesized according to the codon bias of Pichia pastoris and ligated to the full-length porcine pancreatic lipase cDNA fragment. The codon optimized PPL was cloned into the pPICZ?A (Invitrogen, Beijing, China) vector. After the resultant opPPL/pPICZ?? plasmid was transformed into P.pastoris, the over-expressed extracellular opPPL containing a His-tag to the C terminus was purified using Ni Sepharose affinity column (GE Healthcare, Piscataway, NJ, USA), and was characterized against the native enzyme (commercial PPL from porcine pancreas, Sigma). The opPPL exhibited a molecular mass of approximately 52 kDa, and showed optimal temperature (40°C), optimal pH (8.0), Km (0.041 mM), and Vmax (2.008 µmol.mg protein ?1.min?1) similar to those of the commercial enzyme with p-NPP as the substrate. The recombinant enzyme was stable at 60°C, but lost 80% (P<0.05) of its activity after exposure to heat ?60°C for 20 min. The codon optimization increased opPPL yield for ca 4 folds (146 mg.L?1 vs 36 mg.L?1) and total enzyme activity increased about 5 folds (1900 IU.L?1 vs 367 IU.L?1) compared with those native naPPL/pPICZ?? tranformant. Comparison of gene copies and mRNA profiles between the two strains indicated the increased rePPL yields may partly be ascribed to the increased protein translational efficiency after codon optimization. In conclusion, we successfully optimized 5-terminal of porcine pancreatic lipase encoding gene and over-expressed the gene in P. pastoris as an extracellular, functional enzyme. The recombination enzyme demonstrates a potential for future use as an animal feed additive for animal improvement. PMID:25544987

  4. Why Are Translationally SubOptimal Synonymous Codons Used in Escherichia coli ?

    Microsoft Academic Search

    Nick G. C. Smith; Adam Eyre-Walker

    2001-01-01

    .   Natural selection favors certain synonymous codons which aid translation in Escherichia coli, yet codons not favored by translational selection persist. We use the frequency distributions of synonymous polymorphisms\\u000a to test three hypotheses for the existence of translationally sub-optimal codons: (1) selection is a relatively weak force,\\u000a so there is a balance between mutation, selection, and drift; (2) at some

  5. Do anticodons of misacylated tRNAs preferentially mismatch codons coding for the misloaded amino acid?

    Microsoft Academic Search

    Hervé Seligmann

    2010-01-01

    BACKGROUND: Accurate amino acid insertion during peptide elongation requires tRNAs loaded by cognate amino acids and that anticodons match codons. However, tRNA misloading does not necessarily cause misinsertions: misinsertion is avoided when anticodons mismatch codons coding for misloaded amino acids. PRESENTATION OF THE HYPOTHESIS: Occasional compensation of misacylation by codon-anticodon mismatch necessarily occurs. Putatively, occasional error compensation may be enhanced

  6. Features of Recent Codon Evolution: A Comparative Polymorphism-Fixation Study

    PubMed Central

    Zhao, Zhongming; Jiang, Cizhong

    2010-01-01

    Features of amino-acid and codon changes can provide us important insights on protein evolution. So far, investigators have often examined mutation patterns at either interspecies fixed substitution or intraspecies nucleotide polymorphism level, but not both. Here, we performed a unique analysis of a combined set of intra-species polymorphisms and inter-species substitutions in human codons. Strong difference in mutational pattern was found at codon positions 1, 2, and 3 between the polymorphism and fixation data. Fixation had strong bias towards increasing the rarest codons but decreasing the most frequently used codons, suggesting that codon equilibrium has not been reached yet. We detected strong CpG effect on CG-containing codons and subsequent suppression by fixation. Finally, we detected the signature of purifying selection against A?U dinucleotides at synonymous dicodon boundaries. Overall, fixation process could effectively and quickly correct the volatile changes introduced by polymorphisms so that codon changes could be gradual and directional and that codon composition could be kept relatively stable during evolution. PMID:20622912

  7. Features of recent codon evolution: a comparative polymorphism-fixation study.

    PubMed

    Zhao, Zhongming; Jiang, Cizhong

    2010-01-01

    Features of amino-acid and codon changes can provide us important insights on protein evolution. So far, investigators have often examined mutation patterns at either interspecies fixed substitution or intraspecies nucleotide polymorphism level, but not both. Here, we performed a unique analysis of a combined set of intra-species polymorphisms and inter-species substitutions in human codons. Strong difference in mutational pattern was found at codon positions 1, 2, and 3 between the polymorphism and fixation data. Fixation had strong bias towards increasing the rarest codons but decreasing the most frequently used codons, suggesting that codon equilibrium has not been reached yet. We detected strong CpG effect on CG-containing codons and subsequent suppression by fixation. Finally, we detected the signature of purifying selection against Amid R:U dinucleotides at synonymous dicodon boundaries. Overall, fixation process could effectively and quickly correct the volatile changes introduced by polymorphisms so that codon changes could be gradual and directional and that codon composition could be kept relatively stable during evolution. PMID:20622912

  8. A Study of the purine\\/pyrimidine codon occurrence with a reduced centered variable and an evaluation compared to the frequency statistic

    Microsoft Academic Search

    CHRISTIAN J. MICHEL

    1989-01-01

    With the three-letter alphabet {R,Y,N} (R = purine, Y = pyrimidine, N= R or Y), there are 26 codons (NNN being excluded): RNN, . ,NNY (six codons at two unspecified bases N), RRN,. ,NYY (12 codons at one unspecified base N), RRR ,.._, YYY (eight specified codons). A statistical methodology that uses the codon frequency and a reduced centered variable

  9. Photograph Usage in History Education

    ERIC Educational Resources Information Center

    Akbaba, Bulent

    2009-01-01

    In this study, the effect of photograph usage in history education to the students' achievement was tried to be identified. In the study which was done with a pre-test post-test control group design, a frame was tried to be established between the experimental group and the analytical usage of the photograph, the control group's courses were done…

  10. Usage Management in Cloud Computing

    Microsoft Academic Search

    Pramod A. Jamkhedkar; Christopher C. Lamb; Gregory L. Heileman

    2011-01-01

    User concerns regarding data handling within the cloud will gain increasing importance as cloud computing becomes more pervasive. Existing service level agreement (SLA) frameworks are not designed for flexibly handling even relatively straightforward usage policies. This paper introduces the notion and importance of usage management in cloud computing. It provides an analysis of features and challenges involved in deploying a

  11. Hepatitis A Virus Mutant Spectra under the Selective Pressure of Monoclonal Antibodies: Codon Usage Constraints Limit Capsid Variability

    Microsoft Academic Search

    Lluõ ´ s Aragones; Albert Bosch; R. M. Pinto

    2008-01-01

    Severe structural constraints in the hepatitis A virus (HAV) capsid have been suggested as the reason for the lack of emergence of new serotypes in spite of the occurrence of complex distributions of mutants or quasi- species. Analysis of the HAV mutant spectra under immune pressure by the monoclonal antibodies (MAbs) K34C8 (immunodominant site) and H7C27 (glycophorin binding site) has

  12. Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

    SciTech Connect

    Medori, R.; Tritschler, H.J. (Universita di Bologna (Italy))

    1993-10-01

    Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologic findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.

  13. tRNA 1 Ser(G 34) with the anticodon GGA can recognize not only UCC and UCU codons but also UCA and UCG codons

    Microsoft Academic Search

    Yuko Yamada; Jitsuhiro Matsugi; Hisayuki Ishikura

    2003-01-01

    The tRNA1Ser (anticodon VGA, V=uridin-5-oxyacetic acid) is essential for translation of the UCA codon in Escherichia coli. Here, we studied the translational abilities of serine tRNA derivatives, which have different bases from wild type at the first positions of their anticodons, using synthetic mRNAs containing the UCN (N=A, G, C, or U) codon. The tRNA1Ser(G34) having the anticodon GGA was

  14. Translational Termination Efficiency in Mammals is Influenced by the Base Following the Stop Codon

    Microsoft Academic Search

    Kim K. McCaughan; Chris M. Brown; Mark E. Dalphin; Marla J. Berry; Warren P. Tate

    1995-01-01

    The base following stop codons in mammalian genes is strongly biased, suggesting that it might be important for the termination event. This proposal has been tested experimentally both in vivo by using the human type I iodothyronine deiodinase mRNA and the recoding event at the internal UGA codon and in vitro by measuring the ability of each of the 12

  15. Why Are Translationally Sub-Optimal Synonymous Codons Used in Escherichia coli?

    E-print Network

    Eyre-Walker, Adam

    Why Are Translationally Sub-Optimal Synonymous Codons Used in Escherichia coli? Nick G.C. Smith, Adam Eyre-Walker Centre for the Study of Evolution and School of Biological Sciences, University still be referred to as a sub-optimal codon.Correspondence to: N.G.C. Smith; email: n.g.c.smith

  16. Compositional Correlation Studies among the Three Different Codon Positions in 12 Bacterial Genomes

    Microsoft Academic Search

    S. Majumdar; S. K. Gupta; V. S. Sundararajan; T. C. Ghosh

    1999-01-01

    Compositional distributions in the three codon positions of the coding sequences of 12 fully sequenced prokaryotic genomes, which are publicly available, were investigated. A universal compositional correlation was observed in most of the genomes under investigation irrespective of their overall genomic GC contents. In all the genomes, the GC contents at the first codon positions are always greater than the

  17. Lie superalgebras and the multiplet structure of the genetic code. I. Codon representations

    E-print Network

    Forger, Frank Michael

    a table connecting codons base triplets with the amino acids they represent, but a complete understand that the degeneracy of the genetic code, i.e., the phenomenon that different codons base triplets of DNA are transcribed into the same amino acid, may be interpreted as the result of a symmetry breaking process

  18. Toward the experimental codon reassignment in vivo: protein building with an expanded amino acid repertoire

    Microsoft Academic Search

    NEDILJKO BUDISA; CAROLINE MINKS; STEFAN ALEFELDER; WALTRAUD WENGER; FUMIN DONG; LUIS MORODER; ROBERT HUBER

    The high precision and fidelity of the genetic message transmission are ensured by numer- ous proofreading steps, from DNA replication and transcription to protein translation. The key event for translational fidelity is the proper codon assignment for 20 canonical amino acids. An experimental codon reassignment is possible for noncanonical amino ac- ids in vivo using artificially constructed expression hosts under

  19. A General Model of Codon Bias Due to GC Mutational Gareth A. Palidwor1

    E-print Network

    Xia, Xuhua

    A General Model of Codon Bias Due to GC Mutational Bias Gareth A. Palidwor1 *, Theodore J. Perkins1 synonymous GC content changing substitutions in the third codon position, the overall GC bias of a genome or genomic region is highly correlated with GC3, a measure of third position GC content. For individual amino

  20. Probable relationship between partitions of the set of codons and the origin of the genetic code.

    PubMed

    Salinas, Dino G; Gallardo, Mauricio O; Osorio, Manuel I

    2014-03-01

    Here we study the distribution of randomly generated partitions of the set of amino acid-coding codons. Some results are an application from a previous work, about the Stirling numbers of the second kind and triplet codes, both to the cases of triplet codes having four stop codons, as in mammalian mitochondrial genetic code, and hypothetical doublet codes. Extending previous results, in this work it is found that the most probable number of blocks of synonymous codons, in a genetic code, is similar to the number of amino acids when there are four stop codons, as well as it could be for a primigenious doublet code. Also it is studied the integer partitions associated to patterns of synonymous codons and it is shown, for the canonical code, that the standard deviation inside an integer partition is one of the most probable. We think that, in some early epoch, the genetic code might have had a maximum of the disorder or entropy, independent of the assignment between codons and amino acids, reaching a state similar to "code freeze" proposed by Francis Crick. In later stages, maybe deterministic rules have reassigned codons to amino acids, forming the natural codes, such as the canonical code, but keeping the numerical features describing the set partitions and the integer partitions, like a "fossil numbers"; both kinds of partitions about the set of amino acid-coding codons. PMID:24495914

  1. Characterization and expression of codon optimized soybean phytase gene in E. coli.

    PubMed

    Singh, Pritee; Punjabi, Mansi; Jolly, Monica; Rai, R D; Sachdev, Archana

    2013-12-01

    Phytic acid, the major storage form of phosphorus in plant seeds is degraded by the phytases to yield inositol and free phosphate, contributing thereby to the improved bioavailability of phytate phosphorus and essential minerals in plant foods and simultaneous reduction in phosphorus pollution of the terrestrial and aquatic ecosystems. As a possible strategy for altering seed phytate levels, the approach involving reduction of phytate content by ectopically expressing endogenous phytase gene during seed development of soybean (Glycine max L. cv. Pusa-20) was attempted in the present study. Semi-quantitative RT-PCR revealed the maximum expression of phytase gene transcripts in germinating cotyledons (approximately 10 days after germinations), compared to other vegetative tissues. A full-length phytase cDNA was amplified from the germinating seedlings by splicing by overlap extension (SOE)-PCR and its sequence analysis revealed an open-reading-frame of 1644 bp, including an N terminal signal peptide of 28 amino acids. Predicted amino acid sequence (547-aa) of molecular mass 62 kDa on alignment with related purple acid phosphatases in other plants shared five conserved domains and seven invariant amino acids involved in coordination of the metals in the binuclear center of purple acid phosphatases. Owing to a large number of E. coli low-usage codons in soybean phytase gene, the modified gene was cloned into a prokaryotic expression vector pET-28a (+) and its expression in E. coli was confirmed by SDS-PAGE and Western blot analysis. Bioassay of the crude expression product in E. coli revealed a functional phytase gene, showing a great potential for developing low phytate transgenic soybean through its seed-specific overexpression in the early stages of seed development. PMID:24772979

  2. ModelOMatic: fast and automated model selection between RY, nucleotide, amino acid, and codon substitution models.

    PubMed

    Whelan, Simon; Allen, James E; Blackburne, Benjamin P; Talavera, David

    2015-01-01

    Molecular phylogenetics is a powerful tool for inferring both the process and pattern of evolution from genomic sequence data. Statistical approaches, such as maximum likelihood and Bayesian inference, are now established as the preferred methods of inference. The choice of models that a researcher uses for inference is of critical importance, and there are established methods for model selection conditioned on a particular type of data, such as nucleotides, amino acids, or codons. A major limitation of existing model selection approaches is that they can only compare models acting upon a single type of data. Here, we extend model selection to allow comparisons between models describing different types of data by introducing the idea of adapter functions, which project aggregated models onto the originally observed sequence data. These projections are implemented in the program ModelOMatic and used to perform model selection on 3722 families from the PANDIT database, 68 genes from an arthropod phylogenomic data set, and 248 genes from a vertebrate phylogenomic data set. For the PANDIT and arthropod data, we find that amino acid models are selected for the overwhelming majority of alignments; with progressively smaller numbers of alignments selecting codon and nucleotide models, and no families selecting RY-based models. In contrast, nearly all alignments from the vertebrate data set select codon-based models. The sequence divergence, the number of sequences, and the degree of selection acting upon the protein sequences may contribute to explaining this variation in model selection. Our ModelOMatic program is fast, with most families from PANDIT taking fewer than 150 s to complete, and should therefore be easily incorporated into existing phylogenetic pipelines. ModelOMatic is available at https://code.google.com/p/modelomatic/. PMID:25209223

  3. Marijuana Usage and Hypnotic Susceptibility

    ERIC Educational Resources Information Center

    Franzini, Louis R.; McDonald, Roy D.

    1973-01-01

    Anonymous self-reported drug usage data and hypnotic susceptibility scores were obtained from 282 college students. Frequent marijuana users (more than 10 times) showed greater susceptibility to hypnosis than nonusers. (Author)

  4. Sensitive allele-specific real-time PCR test for mutations in BRAF codon V600 in skin melanoma.

    PubMed

    Pisareva, Ekaterina; Gutkina, Nadezhda; Kovalenko, Sergei; Kuehnapfel, Sarah; Hartmann, Arndt; Heinzerling, Lucie; Schneider-Stock, Regine; Lyubchenko, Lyudmila; Shamanin, Vladimir A

    2014-08-01

    Mutations at BRAF codon V600 are used as predictive biomarkers for targeted therapy of skin melanoma. Here, a simple sensitive test to detect mutations of BRAF-V600 was developed using real-time PCR with allele-specific primers and TaqMan probes. Two versions of the test using sense and antisense allele-specific primers were designed and evaluated. The test detected 1% mutant allele V600E/K in 10?ng DNA standard made from wild-type human DNA spiked with BRAF-V600E or the V600K plasmid. The test was validated on clinical formalin-fixed paraffin-embedded samples of skin melanoma using pyrosequencing as a reference method. In the clinical samples, we detected the common mutation V600E, as well as the rare mutations V600K, V600E2 (codon GAA), V600E2 K601del, V600D-K601del, and V600R. In comparison with pyrosequencing, both versions of the test had 100% specificity with sensitivities of 97 and 86% for sense and antisense allele-specific primers, respectively. Using the PCR test with sense allele-specific primers, mutations in V600 were found in 33 of 51 Russian patients (64.7%) with cutaneous melanoma. This closed-tube real-time PCR test can be used as a simple and sensitive assay for mutations of BRAF-V600 in cutaneous melanoma. PMID:24922189

  5. Feasibility Study of a Rotorcraft Health and Usage Monitoring System ( HUMS): Usage and Structural Life Monitoring Evaluation

    NASA Technical Reports Server (NTRS)

    Dickson, B.; Cronkhite, J.; Bielefeld, S.; Killian, L.; Hayden, R.

    1996-01-01

    The objective of this study was to evaluate two techniques, Flight Condition Recognition (FCR) and Flight Load Synthesis (FLS), for usage monitoring and assess the potential benefits of extending the retirement intervals of life-limited components, thus reducing the operator's maintenance and replacement costs. Both techniques involve indirect determination of loads using measured flight parameters and subsequent fatigue analysis to calculate the life expended on the life-limited components. To assess the potential benefit of usage monitoring, the two usage techniques were compared to current methods of component retirement. In addition, comparisons were made with direct load measurements to assess the accuracy of the two techniques. The data that was used for the evaluation of the usage monitoring techniques was collected under an independent HUMS Flight trial program, using a commercially available HUMS and data recording system. The usage data collect from the HUMS trial aircraft was analyzed off-line using PC-based software that included the FCR and FLS techniques. In the future, if the technique prove feasible, usage monitoring would be incorporated into the onboard HUMS.

  6. Versatile Dual Reporter Gene Systems for Investigating Stop Codon Readthrough in Plants

    PubMed Central

    Lao, Nga T.; Maloney, Alan P.; Atkins, John F.; Kavanagh, Tony A.

    2009-01-01

    Background Translation is most often terminated when a ribosome encounters the first in-frame stop codon (UAA, UAG or UGA) in an mRNA. However, many viruses (and some cellular mRNAs) contain “stop” codons that cause a proportion of ribosomes to terminate and others to incorporate an amino acid and continue to synthesize a “readthrough”, or C-terminally extended, protein. This dynamic redefinition of codon meaning is dependent on specific sequence context. Methodology We describe two versatile dual reporter systems which facilitate investigation of stop codon readthrough in vivo in intact plants, and identification of the amino acid incorporated at the decoded stop codon. The first is based on the reporter enzymes NAN and GUS for which sensitive fluorogenic and histochemical substrates are available; the second on GST and GFP. Conclusions We show that the NAN-GUS system can be used for direct in planta measurements of readthrough efficiency following transient expression of reporter constructs in leaves, and moreover, that the system is sufficiently sensitive to permit measurement of readthrough in stably transformed plants. We further show that the GST-GFP system can be used to affinity purify readthrough products for mass spectrometric analysis and provide the first definitive evidence that tyrosine alone is specified in vivo by a ‘leaky’ UAG codon, and tyrosine and tryptophan, respectively, at decoded UAA, and UGA codons in the Tobacco mosaic virus (TMV) readthrough context. PMID:19816579

  7. Suppression of Premature Termination Codons as a Therapeutic Approach

    PubMed Central

    Keeling, Kim M.; Wang, Dan; Conard, Sara E.; Bedwell, David M.

    2012-01-01

    In this review, we describe our current understanding of translation termination and pharmacological agents that influence the accuracy of this process. A number of drugs have been identified that induce suppression of translation termination at in-frame premature termination codons (PTCs; also known as nonsense mutations) in mammalian cells. We discuss efforts to utilize these drugs to suppress disease-causing PTCs that result in the loss of protein expression and function. In-frame PTCs represent a genotypic subset of mutations that make up ~11% of all known mutations that cause genetic diseases, and millions of patients have diseases attributable to PTCs. Current approaches aimed at reducing the efficiency of translation termination at PTCs (referred to as PTC suppression therapy) have the goal of alleviating the phenotypic consequences of a wide range of genetic diseases. Suppression therapy is currently in clinical trials for treatment of several genetic diseases caused by PTCs, and preliminary results suggest that some patients have shown clinical improvements. While current progress is promising, we discuss various approaches that may further enhance the efficiency of this novel therapeutic approach. PMID:22672057

  8. Pyrrolysine is not hardwired for cotranslational insertion at UAG codons

    PubMed Central

    Ambrogelly, Alexandre; Gundllapalli, Sarath; Herring, Stephanie; Polycarpo, Carla; Frauer, Carina; Söll, Dieter

    2007-01-01

    Pyrrolysine (Pyl), the 22nd naturally encoded amino acid, gets acylated to its distinctive UAG suppressor tRNAPyl by the cognate pyrrolysyl-tRNA synthetase (PylRS). Here we determine the RNA elements required for recognition and aminoacylation of tRNAPyl in vivo by using the Pyl analog N-?-cyclopentyloxycarbonyl-l-lysine. Forty-two Methanosarcina barkeri tRNAPyl variants were tested in Escherichia coli for suppression of the lac amber A24 mutation; then relevant tRNAPyl mutants were selected to determine in vivo binding to M. barkeri PylRS in a yeast three-hybrid system and to measure in vitro tRNAPyl aminoacylation. tRNAPyl identity elements include the discriminator base, the first base pair of the acceptor stem, the T-stem base pair G51:C63, and the anticodon flanking nucleotides U33 and A37. Transplantation of the tRNAPyl identity elements into the mitochondrial bovine tRNASer scaffold yielded chimeric tRNAs active both in vitro and in vivo. Because the anticodon is not important for PylRS recognition, a tRNAPyl variant could be constructed that efficiently suppressed the lac opal U4 mutation in E. coli. These data suggest that tRNAPyl variants may decode numerous codons and that tRNAPyl:PylRS is a fine orthogonal tRNA:synthetase pair that facilitated the late addition of Pyl to the genetic code. PMID:17360621

  9. Genetic evidence for an androgen-regulated epididymal secretory glutathione peroxidase whose transcript does not contain a selenocysteine codon.

    PubMed Central

    Perry, A C; Jones, R; Niang, L S; Jackson, R M; Hall, L

    1992-01-01

    Epididymal glutathione peroxidase (GPX) has been suggested as a major factor in combating loss of fertility of spermatozoa due to lipid peroxidation. We report here the isolation and sequence of putative GPX cDNAs from rat (Rattus rattus) and cynomolgus-monkey (Macaca fascicularis) epididymis, which exhibit marked sequence identity with known GPXs. In both species the cDNAs encode predicted preproteins containing 221 amino acid residues. Unlike other characterized GPX sequences, epididymal GPX mRNA does not contain a selenocysteine codon (UGA). However, sequence comparison and molecular-modelling studies suggest a high degree of structural conservation between epididymal and other GPXs. Transcripts corresponding to epididymal GPX are not detected in a variety of other tissues (liver, spleen, kidney and testis) and appear to be androgen-regulated in the epididymis. Images Fig. 1. Fig. 2. PMID:1386734

  10. Complete mitochondrial genome sequences of three bats species and whole genome mitochondrial analyses reveal patterns of codon bias and lend support to a basal split in Chiroptera.

    PubMed

    Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A

    2012-01-15

    Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. PMID:22041054

  11. Evidence of abundant stop codon readthrough in Drosophila and other Metazoa

    E-print Network

    Jungreis, Irwin

    While translational stop codon readthrough is often used by viral genomes, it has been observed for only a handful of eukaryotic genes. We previously used comparative genomics evidence to recognize protein-coding regions ...

  12. RESEARCH ARTICLE Open Access Increased incidence of rare codon clusters at 5'

    E-print Network

    Clark, Patricia L.

    that rare codons are enriched at the 5' and 3' termini of genes from E. coli and other prokaryotes. GenesRNA secondary structure, especially within the first 40 nucleotides at the 5' end of an open reading frame

  13. OmniChange: The Sequence Independent Method for Simultaneous Site-Saturation of Five Codons

    PubMed Central

    Marienhagen, Jan; Schwaneberg, Ulrich

    2011-01-01

    Focused mutant library generation methods have been developed to improve mainly “localizable” enzyme properties such as activity and selectivity. Current multi-site saturation methods are restricted by the gene sequence, require subsequent PCR steps and/or additional enzymatic modifications. Here we report, a multiple site saturation mutagenesis method, OmniChange, which simultaneously and efficiently saturates five independent codons. As proof of principle, five chemically cleaved DNA fragments, each carrying one NNK-degenerated codon, were generated and assembled to full gene length in a one-pot-reaction without additional PCR-amplification or use of restriction enzymes or ligases. Sequencing revealed the presence of up to 27 different codons at individual positions, corresponding to 84.4% of the theoretical diversity offered by NNK-degeneration. OmniChange is absolutely sequence independent, does not require a minimal distance between mutated codons and can be accomplished within a day. PMID:22039444

  14. Precise manipulation of chromosomes in vivo enables genome-wide codon replacement.

    PubMed

    Isaacs, Farren J; Carr, Peter A; Wang, Harris H; Lajoie, Marc J; Sterling, Bram; Kraal, Laurens; Tolonen, Andrew C; Gianoulis, Tara A; Goodman, Daniel B; Reppas, Nikos B; Emig, Christopher J; Bang, Duhee; Hwang, Samuel J; Jewett, Michael C; Jacobson, Joseph M; Church, George M

    2011-07-15

    We present genome engineering technologies that are capable of fundamentally reengineering genomes from the nucleotide to the megabase scale. We used multiplex automated genome engineering (MAGE) to site-specifically replace all 314 TAG stop codons with synonymous TAA codons in parallel across 32 Escherichia coli strains. This approach allowed us to measure individual recombination frequencies, confirm viability for each modification, and identify associated phenotypes. We developed hierarchical conjugative assembly genome engineering (CAGE) to merge these sets of codon modifications into genomes with 80 precise changes, which demonstrate that these synonymous codon substitutions can be combined into higher-order strains without synthetic lethal effects. Our methods treat the chromosome as both an editable and an evolvable template, permitting the exploration of vast genetic landscapes. PMID:21764749

  15. GUG is an efficient initiation codon to translate the human mitochondrial ATP6 gene

    Microsoft Academic Search

    A Dubot; C Godinot; V Dumur; B Sablonnière; T Stojkovic; J. M Cuisset; A Vojtiskova; P Pecina; P Jesina; J Houstek

    2004-01-01

    A maternally inherited and practically homoplasmic mitochondrial (mtDNA) mutation, 8527A>G, changing the initiation codon AUG into GUG, normally coding for a valine, was observed in the ATP6 gene encoding the ATPase subunit a. No alternate Met codon could replace the normal translational initiator. The patient harboring this mutation exhibited clinical symptoms suggesting a mitochondrial disease but his mother who carried

  16. tRNA slippage at the tmRNA resume codon

    Microsoft Academic Search

    MICHAEL J. TRIMBLE; AMY MINNICUS; KELLY P. WILLIAMS

    2004-01-01

    The bacterial ribosome does not initiate translation on the mRNA portion of tmRNA; instead translation that had begun on a separate mRNA molecule resumes at a particular triplet on tmRNA (the resume codon). For at least two tRNAs that could pair with both the resume and ?2 triplets on mutant tmRNAs, UAA (stop) as the second codon induced high-frequency ?2

  17. Translation initiation factor eIF3 promotes programmed stop codon readthrough

    PubMed Central

    Beznosková, Petra; Wagner, Susan; Jansen, Myrte Esmeralda; von der Haar, Tobias; Valášek, Leoš Shivaya

    2015-01-01

    Programmed stop codon readthrough is a post-transcription regulatory mechanism specifically increasing proteome diversity by creating a pool of C-terminally extended proteins. During this process, the stop codon is decoded as a sense codon by a near-cognate tRNA, which programs the ribosome to continue elongation. The efficiency of competition for the stop codon between release factors (eRFs) and near-cognate tRNAs is largely dependent on its nucleotide context; however, the molecular mechanism underlying this process is unknown. Here, we show that it is the translation initiation (not termination) factor, namely eIF3, which critically promotes programmed readthrough on all three stop codons. In order to do so, eIF3 must associate with pre-termination complexes where it interferes with the eRF1 decoding of the third/wobble position of the stop codon set in the unfavorable termination context, thus allowing incorporation of near-cognate tRNAs with a mismatch at the same position. We clearly demonstrate that efficient readthrough is enabled by near-cognate tRNAs with a mismatch only at the third/wobble position. Importantly, the eIF3 role in programmed readthrough is conserved between yeast and humans. PMID:25925566

  18. Translation initiation factor eIF3 promotes programmed stop codon readthrough.

    PubMed

    Beznosková, Petra; Wagner, Susan; Jansen, Myrte Esmeralda; von der Haar, Tobias; Valášek, Leoš Shivaya

    2015-05-26

    Programmed stop codon readthrough is a post-transcription regulatory mechanism specifically increasing proteome diversity by creating a pool of C-terminally extended proteins. During this process, the stop codon is decoded as a sense codon by a near-cognate tRNA, which programs the ribosome to continue elongation. The efficiency of competition for the stop codon between release factors (eRFs) and near-cognate tRNAs is largely dependent on its nucleotide context; however, the molecular mechanism underlying this process is unknown. Here, we show that it is the translation initiation (not termination) factor, namely eIF3, which critically promotes programmed readthrough on all three stop codons. In order to do so, eIF3 must associate with pre-termination complexes where it interferes with the eRF1 decoding of the third/wobble position of the stop codon set in the unfavorable termination context, thus allowing incorporation of near-cognate tRNAs with a mismatch at the same position. We clearly demonstrate that efficient readthrough is enabled by near-cognate tRNAs with a mismatch only at the third/wobble position. Importantly, the eIF3 role in programmed readthrough is conserved between yeast and humans. PMID:25925566

  19. Modeling educational usage of Facebook

    Microsoft Academic Search

    Sacide Güzin Mazman; Yasemin Koçak Usluel

    2010-01-01

    The purpose of this study is to design a structural model explaining how users could utilize Facebook for educational purposes. In order to shed light on the educational usage of Facebook, in constructing the model, the relationship between users' Facebook adoption processes and their educational use of Facebook were included indirectly while the relationship between users' purposes in using Facebook

  20. Usage in Contemporary American Dictionaries

    ERIC Educational Resources Information Center

    Creswell, Thomas J.

    1977-01-01

    An editorialized report of data accumulated in a study of current American practice in the treatment of problems of usage in general purpose dictionaries. Their descriptive objectivity is characterized as "that of the blind men examining the elephant." Such practices reveal little change from that of Samuel Johnson's 1755 English Dictionary. (AMH)

  1. The characteristics of rare codon clusters in the genome and proteins of hepatitis C virus; a bioinformatics look.

    PubMed

    Fattahi, Mohammadreza; Malekpour, Abdorrasoul; Mortazavi, Mojtaba; Safarpour, Alireza; Naseri, Nasrin

    2014-10-01

    BACKGROUND Recent studies suggest that rare codon clusters are functionally important for protein activity. METHODS Here, for the first time we analyzed and reported rare codon clusters in Hepatitis C Virus (HCV) genome and then identified the location of these rare codon clusters in the structure of HCV protein. This analysis was performed using the Sherlocc program that detects statistically relevant conserved rare codon clusters. RESULTS By this program, we identified the rare codon cluster in three regions of HCV genome; NS2, NS3, and NS5A coding sequence of HCV genome. For further understanding of the role of these rare codon clusters, we studied the location of these rare codon clusters and critical residues in the structure of NS2, NS3 and NS5A proteins. We identified some critical residues near or within rare codon clusters. It should be mentioned that characteristics of these critical residues such as location and situation of side chains are important in assurance of the HCV life cycle. CONCLUSION The characteristics of these residues and their relative status showed that these rare codon clusters play an important role in proper folding of these proteins. Thus, it is likely that these rare codon clusters may have an important role in the function of HCV proteins. This information is helpful in development of new avenues for vaccine and treatment protocols. PMID:25349685

  2. New insights into the incorporation of natural suppressor tRNAs at stop codons in Saccharomyces cerevisiae

    PubMed Central

    Blanchet, Sandra; Cornu, David; Argentini, Manuela; Namy, Olivier

    2014-01-01

    Stop codon readthrough may be promoted by the nucleotide environment or drugs. In such cases, ribosomes incorporate a natural suppressor tRNA at the stop codon, leading to the continuation of translation in the same reading frame until the next stop codon and resulting in the expression of a protein with a new potential function. However, the identity of the natural suppressor tRNAs involved in stop codon readthrough remains unclear, precluding identification of the amino acids incorporated at the stop position. We established an in vivo reporter system for identifying the amino acids incorporated at the stop codon, by mass spectrometry in the yeast Saccharomyces cerevisiae. We found that glutamine, tyrosine and lysine were inserted at UAA and UAG codons, whereas tryptophan, cysteine and arginine were inserted at UGA codon. The 5? nucleotide context of the stop codon had no impact on the identity or proportion of amino acids incorporated by readthrough. We also found that two different glutamine tRNAGln were used to insert glutamine at UAA and UAG codons. This work constitutes the first systematic analysis of the amino acids incorporated at stop codons, providing important new insights into the decoding rules used by the ribosome to read the genetic code. PMID:25056309

  3. Molecular Comparisons of Full Length Metapneumovirus (MPV) Genomes, Including Newly Determined French AMPV-C and –D Isolates, Further Supports Possible Subclassification within the MPV Genus

    PubMed Central

    Brown, Paul A.; Lemaitre, Evelyne; Briand, François-Xavier; Courtillon, Céline; Guionie, Olivier; Allée, Chantal; Toquin, Didier; Bayon-Auboyer, Marie-Hélène; Jestin, Véronique; Eterradossi, Nicolas

    2014-01-01

    Four avian metapneumovirus (AMPV) subgroups (A–D) have been reported previously based on genetic and antigenic differences. However, until now full length sequences of the only known isolates of European subgroup C and subgroup D viruses (duck and turkey origin, respectively) have been unavailable. These full length sequences were determined and compared with other full length AMPV and human metapneumoviruses (HMPV) sequences reported previously, using phylogenetics, comparisons of nucleic and amino acid sequences and study of codon usage bias. Results confirmed that subgroup C viruses were more closely related to HMPV than they were to the other AMPV subgroups in the study. This was consistent with previous findings using partial genome sequences. Closer relationships between AMPV-A, B and D were also evident throughout the majority of results. Three metapneumovirus “clusters” HMPV, AMPV-C and AMPV-A, B and D were further supported by codon bias and phylogenetics. The data presented here together with those of previous studies describing antigenic relationships also between AMPV-A, B and D and between AMPV-C and HMPV may call for a subclassification of metapneumoviruses similar to that used for avian paramyxoviruses, grouping AMPV-A, B and D as type I metapneumoviruses and AMPV-C and HMPV as type II. PMID:25036224

  4. The Role of eIF1 in Translation Initiation Codon Selection in Caenorhabditis elegans

    PubMed Central

    Maduzia, Lisa L.; Moreau, Anais; Poullet, Nausicaa; Chaffre, Sebastien; Zhang, Yinhua

    2010-01-01

    The selection of a proper AUG start codon requires the base-pairing interactions between the codon on the mRNA and the anticodon of the initiator tRNA. This selection process occurs in a pre-initiation complex that includes multiple translation initiation factors and the small ribosomal subunit. To study how these initiation factors are involved in start codon recognition in multicellular organisms, we isolated mutants that allow the expression of a GFP reporter containing a non-AUG start codon. Here we describe the characterization of mutations in eif-1, which encodes the Caenorhabditis elegans translation initiation factor 1 (eIF1). Two mutations were identified, both of which are substitutions of amino acid residues that are identical in all eukaryotic eIF1 proteins. These residues are located in a structural region where the amino acid residues affected by the Saccharomyces cerevisiae eIF1 mutations are also localized. Both C. elegans mutations are dominant in conferring a non-AUG translation initiation phenotype and lead to growth arrest defects in homozygous animals. By assaying reporter constructs that have base changes at the AUG start codon, these mutants are found to allow expression from most reporters that carry single base changes within the AUG codon. This trend of non-AUG mediated initiation was also observed previously for C. elegans eIF2? mutants, indicating that these two factors play a similar role. These results support that eIF1 functions in ensuring the fidelity of AUG start codon recognition in a multicellular organism. PMID:20855569

  5. Advantages of a Mechanistic Codon Substitution Model for Evolutionary Analysis of Protein-Coding Sequences

    PubMed Central

    Miyazawa, Sanzo

    2011-01-01

    Background A mechanistic codon substitution model, in which each codon substitution rate is proportional to the product of a codon mutation rate and the average fixation probability depending on the type of amino acid replacement, has advantages over nucleotide, amino acid, and empirical codon substitution models in evolutionary analysis of protein-coding sequences. It can approximate a wide range of codon substitution processes. If no selection pressure on amino acids is taken into account, it will become equivalent to a nucleotide substitution model. If mutation rates are assumed not to depend on the codon type, then it will become essentially equivalent to an amino acid substitution model. Mutation at the nucleotide level and selection at the amino acid level can be separately evaluated. Results The present scheme for single nucleotide mutations is equivalent to the general time-reversible model, but multiple nucleotide changes in infinitesimal time are allowed. Selective constraints on the respective types of amino acid replacements are tailored to each gene in a linear function of a given estimate of selective constraints. Their good estimates are those calculated by maximizing the respective likelihoods of empirical amino acid or codon substitution frequency matrices. Akaike and Bayesian information criteria indicate that the present model performs far better than the other substitution models for all five phylogenetic trees of highly-divergent to highly-homologous sequences of chloroplast, mitochondrial, and nuclear genes. It is also shown that multiple nucleotide changes in infinitesimal time are significant in long branches, although they may be caused by compensatory substitutions or other mechanisms. The variation of selective constraint over sites fits the datasets significantly better than variable mutation rates, except for 10 slow-evolving nuclear genes of 10 mammals. An critical finding for phylogenetic analysis is that assuming variable mutation rates over sites lead to the overestimation of branch lengths. PMID:22220197

  6. Opportunistic Resource Usage in CMS

    NASA Astrophysics Data System (ADS)

    Kreuzer, Peter; Hufnagel, Dirk; Dykstra, D.; Gutsche, O.; Tadel, M.; Sfiligoi, I.; Letts, J.; Wuerthwein, F.; McCrea, A.; Bockelman, B.; Fajardo, E.; Linares, L.; Wagner, R.; Konstantinov, P.; Blumenfeld, B.; Bradley, D.; Cms Collaboration

    2014-06-01

    CMS is using a tiered setup of dedicated computing resources provided by sites distributed over the world and organized in WLCG. These sites pledge resources to CMS and are preparing them especially for CMS to run the experiment's applications. But there are more resources available opportunistically both on the GRID and in local university and research clusters which can be used for CMS applications. We will present CMS' strategy to use opportunistic resources and prepare them dynamically to run CMS applications. CMS is able to run its applications on resources that can be reached through the GRID, through EC2 compliant cloud interfaces. Even resources that can be used through ssh login nodes can be harnessed. All of these usage modes are integrated transparently into the GlideIn WMS submission infrastructure, which is the basis of CMS' opportunistic resource usage strategy. Technologies like Parrot to mount the software distribution via CVMFS and xrootd for access to data and simulation samples via the WAN are used and will be described. We will summarize the experience with opportunistic resource usage and give an outlook for the restart of LHC data taking in 2015.

  7. Connection between stop codon reassignment and frequent use of shifty stop frameshifting

    PubMed Central

    Vallabhaneni, Haritha; Fan-Minogue, Hua; Bedwell, David M.; Farabaugh, Philip J.

    2009-01-01

    Ciliated protozoa of the genus Euplotes have undergone genetic code reassignment, redefining the termination codon UGA to encode cysteine. In addition, Euplotes spp. genes very frequently employ shifty stop frameshifting. Both of these phenomena involve noncanonical events at a termination codon, suggesting they might have a common cause. We recently demonstrated that Euplotes octocarinatus peptide release factor eRF1 ignores UGA termination codons while continuing to recognize UAA and UAG. Here we show that both the Tetrahymena thermophila and E. octocarinatus eRF1 factors allow efficient frameshifting at all three termination codons, suggesting that UGA redefinition also impaired UAA/UAG recognition. Mutations of the Euplotes factor restoring a phylogenetically conserved motif in eRF1 (TASNIKS) reduced programmed frameshifting at all three termination codons. Mutation of another conserved residue, Cys124, strongly reduces frameshifting at UGA while actually increasing frameshifting at UAA/UAG. We will discuss these results in light of recent biochemical characterization of these mutations. PMID:19329535

  8. Influence of modification next to the anticodon in tRNA on codon context sensitivity of translational suppression and accuracy.

    PubMed Central

    Bouadloun, F; Srichaiyo, T; Isaksson, L A; Björk, G R

    1986-01-01

    Effects on translation in vivo by modification deficiencies for 2-methylthio-N6-isopentenyladenosine (ms2i6A) (Escherichia coli) or 2-methylthio-N6-(4-hydroxyisopentenyl)adenosine (ms2io6A) (Salmonella typhimurium) in tRNA were studied in mutant strains. These hypermodified nucleosides are present on the 3' side of the anticodon (position 37) in tRNA reading codons starting with uridine. In E. coli, translational error caused by tRNA was strongly reduced in the case of third-position misreading of a tryptophan codon (UGG) in a particular codon context but was not affected in the case of first-position misreading of an arginine codon (CGU) in another codon context. Misreading of UGA nonsense codons at two different positions was codon context dependent. The efficiencies of some tRNA nonsense suppressors were decreased in a tRNA-dependent manner. Suppressor tRNA which lacks ms2i6A-ms2io6A becomes more sensitive to codon context. Our results therefore indicate that, besides improving translational efficiency, ms2i6A37 and ms2io6A37 modifications in tRNA are also involved in decreasing the intrinsic codon reading context sensitivity of tRNA. Possible consequences for regulation of gene expression are discussed. PMID:3086285

  9. Comparison of levonorgestrel-releasing intrauterine device with oral progestins in heavy menstrual bleeding (HMB) cases with uterine leiomyoma (LNG-IUD and oral progestin usage in myoma uteri)

    PubMed Central

    Tosun, Ayse Kavasoglu; Tosun, Ismet; Suer, Necdet

    2014-01-01

    Objective: To compare the effectiveness and acceptability of LNG-IUD with oral progesterone (norethisterone acetate; NETA) in achieving a reduction in volume of the myomas, hemoglobin levels, satisfaction of the women. Methods: This study includes randomized 30 women treated by LNG-IUD and randomized 30 women treated by oral norethisterone (NETA). All these participants in the study have received medical treatment and had been registered as patients in Istanbul Medeniyet University Göztepe Education and Research Hospital. Leiomyoma volumes and hemoglobin levels have been determined. In the third and sixth months, these measurements have been done again. We examined the adverse effects and the treatment continuity. For the statistical analysis of the findings NCSS [Number Cruncher Statistical System] 2007 & PASS 2008 program; student t, Mann Whitney U, Paired Samples t, Wilcoxon Signed Ranks, Ki-Kare, Fisher's Exact Ki-Kare tests have been used. Results: After six months treatment, the reduction of bleeding determined by Visual Bleeding Score (VBS) in LNG-IUD group is 80% and in oral norethisteron group is 56%; in both groups leiomyoma volumes and hemoglobin levels were significantly high. Conclusion: LNG-IUD is a good alternative treatment to the oral progesterone in long term minimizing the hysterectomy for myoma uteri because of the good patient tolerance and easy usage. PMID:25097527

  10. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    ERIC Educational Resources Information Center

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  11. Nonsense ?-thalassemia mutation at codon 37 (TGG>TGA), detected for the first time in three Turkish cases.

    PubMed

    Bozdogan, Sevcan Tug; Unsal, Cagatay; Erkman, Hakan; Genc, Ahmet; Yuregir, Ozge Ozalp; Muslumanoglu, Muhammed Hamza; Aslan, Huseyin

    2012-01-01

    Thalassemias are genetically heterogeneous group of disorders with reduced or absent production of globin. ?-Thalassemia major can be caused by homozygosity or compound heterozygosity for ?-globin gene mutation. Here we report, for the first time in Turkey, three cases who carry the nonsense ?-thalassemia (?-thal) mutation at codon 37 (TGG>TGA; Trp?Stop) causing premature stop codon. PMID:22385009

  12. Strong short-range correlations and dichotomic codon classes in coding DNA sequences

    NASA Astrophysics Data System (ADS)

    Gonzalez, Diego Luis; Giannerini, Simone; Rosa, Rodolfo

    2008-11-01

    The study of correlation structures in DNA sequences is of great interest because it allows us to obtain structural and functional information about underlying genetic mechanisms. In this paper we present a study of the correlation structure of protein coding sequences of DNA based on a recently developed mathematical representation of the genetic code. A fundamental consequence of such representation is that codons can be assigned a parity class (odd-even). Such parity can be obtained by means of a nonlinear algorithm acting on the chemical character of the codon bases. In the same setting the Rumer’s class can be naturally described and a new dichotomic class, the hidden class, can be defined. Moreover, we show that the set of DNA’s base transformations associated to the three dichotomic classes can be put in a compact group-theoretic framework. We use the dichotomic classes as a coding scheme for DNA sequences and study the mutual dependence between such classes. The same analysis is carried out also on the chemical dichotomies of DNA bases. In both cases, the statistical analysis is performed by using an entropy-based dependence metric possessing many desirable properties. We obtain meaningful tests for mutual dependence by using suitable resampling techniques. We find strong short-range correlations between certain combinations of dichotomic codon classes. These results support our previous hypothesis that codon classes might play an active role in the organization of genetic information.

  13. Strong short-range correlations and dichotomic codon classes in coding DNA sequences.

    PubMed

    Gonzalez, Diego Luis; Giannerini, Simone; Rosa, Rodolfo

    2008-11-01

    The study of correlation structures in DNA sequences is of great interest because it allows us to obtain structural and functional information about underlying genetic mechanisms. In this paper we present a study of the correlation structure of protein coding sequences of DNA based on a recently developed mathematical representation of the genetic code. A fundamental consequence of such representation is that codons can be assigned a parity class (odd-even). Such parity can be obtained by means of a nonlinear algorithm acting on the chemical character of the codon bases. In the same setting the Rumer's class can be naturally described and a new dichotomic class, the hidden class, can be defined. Moreover, we show that the set of DNA's base transformations associated to the three dichotomic classes can be put in a compact group-theoretic framework. We use the dichotomic classes as a coding scheme for DNA sequences and study the mutual dependence between such classes. The same analysis is carried out also on the chemical dichotomies of DNA bases. In both cases, the statistical analysis is performed by using an entropy-based dependence metric possessing many desirable properties. We obtain meaningful tests for mutual dependence by using suitable resampling techniques. We find strong short-range correlations between certain combinations of dichotomic codon classes. These results support our previous hypothesis that codon classes might play an active role in the organization of genetic information. PMID:19113166

  14. HER2 Codon 655 Polymorphism and Risk of Breast Cancer in African Americans and Whites

    Microsoft Academic Search

    Robert Millikan; Allison Eaton; Kendra Worley; Lorna Biscocho; Elizabeth Hodgson; Wen-Yi Huang; Joseph Geradts; Mary Iacocca; David Cowan; Kathleen Conway; Lynn Dressler

    2003-01-01

    Background. Several recent epidemiologic studies examined the association between breast cancer risk and an inherited, single-nucleotide polymorphism in the HER2 gene, codon 655 G to A, which leads to an amino acid substitution of Ile to Val. Results of previous studies have been mixed, with most studies showing no association but some suggesting an association in younger women or women

  15. Translation efficiency is determined by both codon bias and folding energy

    E-print Network

    Ruppin, Eytan

    . There is a significant association between codon bias and translation efficiency across all endoge- nous genes in E. coli a genome-scale study aiming at dissecting the determi- nants of translation efficiency the genomic profiles of ribosomal density and genomic profiles of folding energy across mRNA, suggesting

  16. Unusual base pairing during the decoding of a stop codon by the ribosome.

    PubMed

    Fernández, Israel S; Ng, Chyan Leong; Kelley, Ann C; Wu, Guowei; Yu, Yi-Tao; Ramakrishnan, V

    2013-08-01

    During normal translation, the binding of a release factor to one of the three stop codons (UGA, UAA or UAG) results in the termination of protein synthesis. However, modification of the initial uridine to a pseudouridine (?) allows efficient recognition and read-through of these stop codons by a transfer RNA (tRNA), although it requires the formation of two normally forbidden purine-purine base pairs. Here we determined the crystal structure at 3.1?Å resolution of the 30S ribosomal subunit in complex with the anticodon stem loop of tRNA(Ser) bound to the ?AG stop codon in the A site. The ?A base pair at the first position is accompanied by the formation of purine-purine base pairs at the second and third positions of the codon, which show an unusual Watson-Crick/Hoogsteen geometry. The structure shows a previously unsuspected ability of the ribosomal decoding centre to accommodate non-canonical base pairs. PMID:23812587

  17. Analysis of leaky viral translation termination codons in vivo by transient expression of improved ?-glucuronidase vectors

    Microsoft Academic Search

    James M. Skuzeski; Lindy M. Nichols; Raymond F. Gesteland

    1990-01-01

    Plant RNA viruses commonly exploit leaky translation termination signals in order to express internal protein coding regions. As a first step to elucidate the mechanism(s) by which ribosomes bypass leaky stop codons in vivo, we have devised a system in which readthrough is coupled to the transient expression of ß-glucuronidase (GUS) in tobacco protoplasts. GUS vectors that contain the stop

  18. PAL2NAL: robust conversion of protein sequence alignments into the corresponding codon alignments

    Microsoft Academic Search

    Mikita Suyama; David Torrents; Peer Bork

    2006-01-01

    PAL2NAL is a web server that constructs a multiple codonalignmentfromthecorrespondingalignedpro- tein sequences. Such codon alignments can be used to evaluate the type and rate of nucleotide substitu- tions in coding DNA for a wide range of evolutionary analyses, such as the identification of levels of selective constraint acting on genes, or to perform DNA-based phylogenetic studies. The server takes a

  19. Codon conservation in the influenza A virus genome defines RNA packaging signals

    Microsoft Academic Search

    Julia R. Gog; Emmanuel Dos Santos Afonso; Rosa M. Dalton; India Leclercq; Laurence Tiley; Debra Elton; Johann C. von Kirchbach; Nadia Naffakh; Nicolas Escriou; Paul Digard

    2007-01-01

    Genome segmentation facilitates reassortment and rapid evolution of influenza A virus. However, segmentation complicates particle assembly as virions must contain all eight vRNA species to be infectious. Specific packaging signals exist that extend into the coding regions of most if not all segments, but these RNA motifs are poorly defined. We measured codon variability in a large dataset of sequences

  20. An Analysis of Anonymizer Technology Usage

    Microsoft Academic Search

    Bingdong Li; Esra Erdin; Mehmet Hadi Gunes; George Bebis; Todd Shipley

    2011-01-01

    Anonymity techniques provide legitimate usage such as privacy and freedom of speech, but are also used by cyber criminals to hide themselves. In this paper, we provide usage and geo-location analysis of major anonymization systems, i.e., anonymous proxy servers, remailers, JAP, I2P and Tor. Among these systems, remailers and JAP seem to have minimal usage. We then provide a detailed

  1. Analysis of Low Frequency Protein Truncating Stop-Codon Variants and Fasting Concentration of Growth Hormone

    PubMed Central

    Hallengren, Erik; Almgren, Peter; Engström, Gunnar; Persson, Margaretha; Melander, Olle

    2015-01-01

    Background The genetic background of Growth Hormone (GH) secretion is not well understood. Mutations giving rise to a stop codon have a high likelihood of affecting protein function. Objectives To analyze likely functional stop codon mutations that are associated with fasting plasma concentration of Growth Hormone. Methods We analyzed stop codon mutations in 5451 individuals in the Malmö Diet and Cancer study by genotyping the Illumina Exome Chip. To enrich for stop codon mutations with likely functional effects on protein function, we focused on those disrupting >80% of the predicted amino acid sequence, which were carried by ?10 individuals. Such mutations were related to GH concentration, measured with a high sensitivity assay (hs-GH) and, if nominally significant, to GH related phenotypes, using linear regression analysis. Results Two stop codon mutations were associated with the fasting concentration of hs-GH. rs121909305 (NP_005370.1:p.R93*) [Minor Allele Frequency (MAF) = 0.8%] in the Myosin 1A gene (MYO1A) was associated with a 0.36 (95%CI, 0.04 to 0.54; p=0.02) increment of the standardized value of the natural logarithm of hs-GH per 1 minor allele and rs35699176 (NP_067040.1:p.Q100*) in the Zink Finger protein 77 gene (ZNF77) (MAF = 4.8%) was associated with a 0.12 (95%CI, 0.02 to 0.22; p = 0.02) increase of hs-GH. The mutated high hs-GH associated allele of MYO1A was related to lower BMI (?-coefficient, -0.22; p = 0.05), waist (?-coefficient, -0.22; p = 0.04), body fat percentage (?-coefficient, -0.23; p = 0.03) and with higher HDL (?-coefficient, 0.23; p = 0.04). The ZNF77 stop codon was associated with height (?-coefficient, 0.11; p = 0.02) but not with cardiometabolic risk factors. Conclusion We here suggest that a stop codon of MYO1A, disrupting 91% of the predicted amino acid sequence, is associated with higher hs-GH and GH-related traits suggesting that MYO1A is involved in GH metabolism and possibly body fat distribution. However, our results are preliminary and need replication in independent populations. PMID:26086970

  2. Clustering Dynamic Web Usage Data

    E-print Network

    Da Silva, Alzennyr; Rossi, Fabrice; De Carvahlo, Francisco De A T; 10.1007/978-3-540-88045-5

    2012-01-01

    Most classification methods are based on the assumption that data conforms to a stationary distribution. The machine learning domain currently suffers from a lack of classification techniques that are able to detect the occurrence of a change in the underlying data distribution. Ignoring possible changes in the underlying concept, also known as concept drift, may degrade the performance of the classification model. Often these changes make the model inconsistent and regular updatings become necessary. Taking the temporal dimension into account during the analysis of Web usage data is a necessity, since the way a site is visited may indeed evolve due to modifications in the structure and content of the site, or even due to changes in the behavior of certain user groups. One solution to this problem, proposed in this article, is to update models using summaries obtained by means of an evolutionary approach based on an intelligent clustering approach. We carry out various clustering strategies that are applied o...

  3. Codon optimization enhances the expression of porcine ?-defensin-2 in Escherichia coli.

    PubMed

    Gao, C Y; Xu, T T; Zhao, Q J; Li, C L

    2015-01-01

    Porcine ?-defensin-2 (pBD2) is a cationic antimicrobial peptide that has therapeutic potential. The amount of pBD2 in nature is limited, and the expression of pBD2 in Escherichia coli is low, probably because a different gene codon is used by prokaryotic organisms to that used by eukaryotes. Codon preference optimization is one of the ways to increase heterologous expression of pBD2. To achieve high expression of pBD2, the pBD2 gene was redesigned according to the preferred codon in E. coli without altering the amino acid sequence. The optimized gene was inserted into expression vector pET-30a and transformed into E. coli BL21 (DE3) plysS. Our results showed that pBD2 was expressed as His-Tag fusion protein at a level that was approximately 4-6 times greater than from the native gene, based on total protein expression. Expressed fusion pBD2 showed antimicrobial activity against both E. coli and Staphylococcus aureus. Moreover, pBD2 showed weak hemolytic activity and strong heat resistance. These results indicate that fusion pBD2 is functional and has similar properties to those of pBD2 from the native gene. Our current study demonstrated that codon optimization could enhance pBD2 expression in E. coli without altering its function. Therefore, the expression of pBD2 after codon optimization in heterologous host cells might be useful and is worthy of further research. PMID:25966273

  4. TrimerDimer: an oligonucleotide-based saturation mutagenesis approach that removes redundant and stop codons

    PubMed Central

    Gaytán, Paul; Contreras-Zambrano, Casandra; Ortiz-Alvarado, Mónica; Morales-Pablos, Alfredo; Yáñez, Jorge

    2009-01-01

    9-fluorenylmethoxycarbonyl (Fmoc) and 4,4?-dimethoxytrityl (DMTr) are orthogonal hydroxyl protecting groups that have been used in conjunction to assemble oligonucleotide libraries whose variants contain wild-type and mutant codons randomly interspersed throughout a focused DNA region. Fmoc is labile to organic bases and stable to weak acids, whereas DMTr behaves oppositely. Based on these chemical characteristics, we have now devised TrimerDimer, a novel codon-based saturation mutagenesis approach that removes redundant and stop codons during the assembly of degenerate oligonucleotides. In this approach, five DMTr-protected trinucleotide phosphoramidites (dTGG, dATG, dTTT, dTAT and dTGC) and five Fmoc-protected dinucleotide phosphoramidites (dAA, dTT, dAT, dGC and dCG) react simultaneously with a starting oligonucleotide growing on a solid support. The Fmoc group is then removed and the incorporated dimers react with a mixture of three DMTr-protected monomer phosphoramidites (dC, dA and dG) to produce 15 trinucleotides: dCAA, dAAA, dGAA, dCTT, dATT, dGTT, dCAT, dAAT, dGAT, dCGC, dAGC, dGGC, dCCG, dACG and dGCG. After one mutagenic cycle, 20 codons are generated encoding the 20 natural amino acids. TrimerDimer was tested by randomizing the four contiguous codons that encode amino acids L64–G67 of an engineered, nonfluorescent GFP protein. Sequencing of 89 nonfluorescent mutant clones and isolation of two fluorescent mutants confirmed the principle. PMID:19783828

  5. Methods for selecting fixed-effect models for heterogeneous codon evolution, with comments on their application to gene and genome data

    Microsoft Academic Search

    Le Bao; Hong Gu; Katherine A Dunn; Joseph P Bielawski

    2007-01-01

    BACKGROUND: Models of codon evolution have proven useful for investigating the strength and direction of natural selection. In some cases, a priori biological knowledge has been used successfully to model heterogeneous evolutionary dynamics among codon sites. These are called fixed-effect models, and they require that all codon sites are assigned to one of several partitions which are permitted to have

  6. Patterns of Drug Usage Among Vietnam Veterans.

    ERIC Educational Resources Information Center

    Fisher, Allan H., Jr.; And Others

    A factor analysis was performed on an intercorrelation matrix of reported drug usage frequencies for seven drug categories at two consecutive periods of time. Subjects were 1,010 Army Vietnam veterans in pay grade E6 or below, aged 26 years or less. Retrospective reporting identified drug usage prior to a tour of Vietnam and during the tour. Four…

  7. Abnormal Web Usage Control by Proxy Strategies.

    ERIC Educational Resources Information Center

    Yu, Hsiang-Fu; Tseng, Li-Ming

    2002-01-01

    Approaches to designing a proxy server with Web usage control and to making the proxy server effective on local area networks are proposed to prevent abnormal Web access and to prioritize Web usage. A system is implemented to demonstrate the approaches. The implementation reveals that the proposed approaches are effective, such that the abnormal…

  8. Definite Article Usage across Varieties of English

    ERIC Educational Resources Information Center

    Wahid, Ridwan

    2013-01-01

    This paper seeks to explore the extent of definite article usage variation in several varieties of English based on a classification of its usage types. An annotation scheme based on Hawkins and Prince was developed for this purpose. Using matching corpus data representing Inner Circle varieties and Outer Circle varieties, analysis was made on…

  9. Computer Science MAPO: Mining API Usages from

    E-print Network

    Xie, Tao

    Computer Science MAPO: Mining API Usages from Open Source Repositories Tao Xie Department of Computer Science North Carolina State University, USA Jian Pei Department of Computer Science Simon Fraser University, Canada ·http://ase.csc.ncsu.edu/ #12;Computer Science Learning API Usages is Challenging ·org

  10. A survey on usage of SQL

    Microsoft Academic Search

    Hongjun Lu; Hock Chuan Chan; Kwok Kee Wei

    1993-01-01

    Relational database systems have been on market for more than a decade. SQL has been accepted as the standard query language of relational systems. To further understand the usage of relational systems and relational query language SQL, we conducted a survey recently that covers various aspects of the usage of SQL in industrial organizations. In this paper, we present those

  11. University of Florida Cell Phone Usage Log

    E-print Network

    Sin, Peter

    University of Florida Cell Phone Usage Log Information below must be compared to the monthly statement provided by the cell phone service provider. It is required that this log be completed when of the last page of the usage log. Employee's Name:Business Device - Cell Phone Number: Printed Name

  12. Physical Educators' Technology Competencies and Usage

    ERIC Educational Resources Information Center

    Woods, Marianne L.; Goc Karp, Grace; Miao, Hui; Perlman, Dana

    2008-01-01

    The purpose of this study was to examine K-12 physical education teachers' perceptions of ability and usage of technology. Physical educators (n = 114) completed the Physical Education Technology Usage Survey assessing their perceived technology competency, how and why they utilize technology, challenges they face in implementing technology, and…

  13. The UCON ABC usage control model

    Microsoft Academic Search

    Jaehong Park; Ravi S. Sandhu

    2004-01-01

    In this paper, we introduce the family of UCONABC models for usage control (UCON), which integrate Authorizations (A), oBligations (B), and Conditions (C). We call these core models because they address the essence of UCON, leaving administration, delegation, and other important but second-order issues for later work. The term usage control is a generalization of access control to cover authorizations,

  14. FPGA curved track fitter with very low resource usage

    SciTech Connect

    Wu, Jin-Yuan; Wang, M.; Gottschalk, E.; Shi, Z.; /Fermilab

    2006-11-01

    Standard least-squares curved track fitting process is tailored for FPGA implementation. The coefficients in the fitting matrices are carefully chosen so that only shift and accumulation operations are used in the process. The divisions and full multiplications are eliminated. Comparison in an application example shows that the fitting errors of the low resource usage implementation are less than 4% bigger than the fitting errors of the exact least-squares algorithm. The implementation is suitable for low-cost, low-power applications such as high energy physics detector trigger systems.

  15. Amino-acid substitutions at codon 13 of the N-ras oncogene in human acute myeloid leukaemia

    NASA Astrophysics Data System (ADS)

    Bos, Johannes L.; Toksoz, Deniz; Marshall, Christopher J.; Verlaan-de Vries, Matty; Veeneman, Gerrit H.; van der Eb, Alex J.; van Boom, Jacques H.; Janssen, Johannes W. G.; Steenvoorden, Ada C. M.

    1985-06-01

    DNAs from four out of five patients with acute myeloid leukaemia (AML) tested by an in vivo selection assay in nude mice using transfected mouse NIH 3T3 cells were found to contain an activated N-ras oncogene. Using a set of synthetic oligonucleotide probes, we have detected a mutation at codon 13 in all four genes. The same codon is mutated in an additional AML DNA that is positive in the focus-formation assay on 3T3 cells. DNA from the peripheral blood of one patient in remission does not contain a codon 13 mutation.

  16. Amino Termini of Many Yeast Proteins Map to Downstream Start Codons

    PubMed Central

    Fournier, Claire T.; Cherny, Justin J.; Truncali, Kris; Robbins-Pianka, Adam; Lin, Miin S.; Krizanc, Danny; Weir, Michael P.

    2012-01-01

    Comprehensive knowledge of proteome complexity is crucial to understanding cell function. Amino termini of yeast proteins were identified through peptide mass spectrometry on glutaraldehyde-treated cell lysates as well as a parallel assessment of publicly-deposited spectra. An unexpectedly large fraction of detected amino-terminal peptides (35%) mapped to translation initiation at AUG codons downstream of the annotated start codon. Many of the implicated genes have suboptimal sequence contexts for translation initiation near their annotated AUG, and their ribosome profiles show elevated tag densities consistent with translation initiation at downstream AUGs as well as their annotated AUGs. These data suggest that a significant fraction of the yeast proteome derives from initiation at downstream AUGs, increasing significantly the repertoire of encoded proteins and their potential functions and cellular localizations. PMID:23140384

  17. Ethnic variation in the HER2 codon 655 genetic polymorphism previously associated with breast cancer

    Microsoft Academic Search

    Margaret-Mary Ameyaw; Mohammed Tayeb; Nadia Thornton; Gbolahan Folayan; Mohammed Tariq; Abeer Mobarek; David A. Price Evans; David Ofori-Adjei; Howard L. McLeod

    2002-01-01

    HER-2, a protooncogene located on chromosome 17q21, encodes a transmembrane glycoprotein (p185) with tyrosine kinase activity.\\u000a Alterations of the HER-2 gene have been implicated in the carcinogenesis and prognosis of breast cancer and other solid tumors. It is also a cancer-therapeutic\\u000a target for antibody-based therapy against the HER-2 protein. A single-nucleotide polymorphism (SNP) at codon 655, resulting in a G-to-A

  18. SHORT REPORT: CODON 125 POLYMORPHISM OF CD31 AND SUSCEPTIBILITY TO MALARIA

    Microsoft Academic Search

    CLIMENT CASALS-PASCUAL; STEVEN ALLEN; ANGELA ALLEN; OSCAR KAI; BRETT LOWE; ARNAB PAIN; DAVID J. ROBERTS

    Platelet-endothelial cell adhesion molecule 1 (PECAM-1\\/CD31) has been identified as an endothelial cell receptor of Plasmodium falciparum -infected erythrocytes. The significance of adhesion of infected erythrocytes to this receptor in malaria infection has not been determined. We have therefore studied the association of the functional mutation CTG? GTG (Leu? Val) in codon 125 of the Cd31 gene with severe disease

  19. Mining prokaryotic genomes for unknown amino acids: a stop-codon-based approach

    PubMed Central

    Fujita, Masashi; Mihara, Hisaaki; Goto, Susumu; Esaki, Nobuyoshi; Kanehisa, Minoru

    2007-01-01

    Background Selenocysteine and pyrrolysine are the 21st and 22nd amino acids, which are genetically encoded by stop codons. Since a number of microbial genomes have been completely sequenced to date, it is tempting to ask whether the 23rd amino acid is left undiscovered in these genomes. Recently, a computational study addressed this question and reported that no tRNA gene for unknown amino acid was found in genome sequences available. However, performance of the tRNA prediction program on an unknown tRNA family, which may have atypical sequence and structure, is unclear, thereby rendering their result inconclusive. A protein-level study will provide independent insight into the novel amino acid. Results Assuming that the 23rd amino acid is also encoded by a stop codon, we systematically predicted proteins that contain stop-codon-encoded amino acids from 191 prokaryotic genomes. Since our prediction method relies only on the conservation patterns of primary sequences, it also provides an opportunity to search novel selenoproteins and other readthrough proteins. It successfully recovered many of currently known selenoproteins and pyrrolysine proteins. However, no promising candidate for the 23rd amino acid was detected, and only one novel selenoprotein was predicted. Conclusion Our result suggests that the unknown amino acid encoded by stop codons does not exist, or its phylogenetic distribution is rather limited, which is in agreement with the previous study on tRNA. The method described here can be used in future studies to explore novel readthrough events from complete genomes, which are rapidly growing. PMID:17597547

  20. Self-catalytic DNA Depurination Underlies Human ?-Globin Gene Mutations at Codon 6 That Cause Anemias and Thalassemias*

    PubMed Central

    Alvarez-Dominguez, Juan R.; Amosova, Olga; Fresco, Jacques R.

    2013-01-01

    The human ?-globin gene contains an 18-nucleotide coding strand sequence centered at codon 6 and capable of forming a stem-loop structure that can self-catalyze depurination of the 5?G residue of that codon. The resultant apurinic lesion is subject to error-prone repair, consistent with the occurrence about this codon of mutations responsible for 6 anemias and ?-thalassemias and additional substitutions without clinical consequences. The 4-residue loop of this stem-loop-forming sequence shows the highest incidence of mutation across the gene. The loop and first stem base pair-forming residues appeared early in the mammalian clade. The other stem-forming segments evolved more recently among primates, thereby conferring self-depurination capacity at codon 6. These observations indicate a conserved molecular mechanism leading to ?-globin variants underlying phenotypic diversity and disease. PMID:23457306

  1. Does the clinical phenotype of fatal familial insomnia depend on PRNP codon 129 methionine-valine polymorphism?

    PubMed

    Rupprecht, Sven; Grimm, Alexander; Schultze, Torsten; Zinke, Jan; Karvouniari, Panagiota; Axer, Hubertus; Witte, Otto W; Schwab, Matthias

    2013-01-01

    Fatal familial insomnia (FFI) is a rare, hereditary prion-protein disease. Methionine-valine polymorphism at codon 129 of the prion-protein gene (PRNP) determines the phenotype in other hereditary prion-protein diseases, but association with the clinical phenotype in FFI remains uncertain. Early clinical findings in FFI comprise disturbances of the sleep-wake cycle and mild neuropsychiatric changes which typically emerge during middle to late adulthood. Here we describe an unusually early onset and rapid progression of FFI associated with dorsal midbrain involvement in a female patient with PRNP mutation at codon 178 and homozygote methionine polymorphism at codon 129. Early dorsal midbrain involvement became apparent by total loss of REM sleep and isolated bilateral trochlear nerve palsy. Early onset and rapid progression disease type associated with dorsal midbrain involvement may indicate a different spatiotemporal distribution of the neurodegenerative process in FFI patients with PRNP mutation and codon 129 methionine homozygosity compared to methioninevaline heterozygosity. PMID:24340298

  2. amino acid. In bacteria, the reassignment occurs with the opal UGA stop codon, whereas in the eukaryotes, it is the

    E-print Network

    Huang, Jing

    . The largest number of recoding events appeared in a sulfidic groundwater sample and in the human oral microbiome. In an artful use of reassignment, it appears that some phages use codon reassignment to hijack

  3. Codon Optimization Significantly Improves the Expression Level of a Keratinase Gene in Pichia pastoris

    PubMed Central

    Hu, Hong; Gao, Jie; He, Jun; Yu, Bing; Zheng, Ping; Huang, Zhiqing; Mao, Xiangbing; Yu, Jie; Han, Guoquan; Chen, Daiwen

    2013-01-01

    The main keratinase (kerA) gene from the Bacillus licheniformis S90 was optimized by two codon optimization strategies and expressed in Pichia pastoris in order to improve the enzyme production compared to the preparations with the native kerA gene. The results showed that the corresponding mutations (synonymous codons) according to the codon bias in Pichia pastoris were successfully introduced into keratinase gene. The highest keratinase activity produced by P. pastoris pPICZ?A-kerAwt, pPICZ?A-kerAopti1 and pPICZ?A-kerAopti2 was 195 U/ml, 324 U/ml and 293 U/ml respectively. In addition, there was no significant difference in biomass concentration, target gene copy numbers and relative mRNA expression levels of every positive strain. The molecular weight of keratinase secreted by recombinant P. pastori was approx. 39 kDa. It was optimally active at pH 7.5 and 50°C. The recombinant keratinase could efficiently degrade both ?-keratin (keratin azure) and ?-keratin (chicken feather meal). These properties make the P. pastoris pPICZ?A-kerAopti1 a suitable candidate for industrial production of keratinases. PMID:23472192

  4. Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon.

    PubMed

    Mukai, Takahito; Hoshi, Hiroko; Ohtake, Kazumasa; Takahashi, Mihoko; Yamaguchi, Atsushi; Hayashi, Akiko; Yokoyama, Shigeyuki; Sakamoto, Kensaku

    2015-01-01

    Escherichia coli is a widely used host organism for recombinant technology, and the bacterial incorporation of non-natural amino acids promises the efficient synthesis of proteins with novel structures and properties. In the present study, we developed E. coli strains in which the UAG codon was reserved for non-natural amino acids, without compromising the reproductive strength of the host cells. Ninety-five of the 273 UAG stop codons were replaced synonymously in the genome of E. coli BL21(DE3), by exploiting the oligonucleotide-mediated base-mismatch-repair mechanism. This genomic modification allowed the safe elimination of the UAG-recognizing cellular component (RF-1), thus leaving the remaining 178 UAG codons with no specific molecule recognizing them. The resulting strain B-95.?A grew as vigorously as BL21(DE3)?in rich medium at 25-42°C, and its derivative B-95.?A?fabR was better adapted to low temperatures and minimal media than B-95.?A. UAG was reassigned to synthetic amino acids by expressing the specific pairs of UAG-reading tRNA and aminoacyl-tRNA synthetase. Due to the preserved growth vigor, the B-95.?A strains showed superior productivities for hirudin molecules sulfonated on a particular tyrosine residue, and the Fab fragments of Herceptin containing multiple azido groups. PMID:25982672

  5. Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon

    PubMed Central

    Mukai, Takahito; Hoshi, Hiroko; Ohtake, Kazumasa; Takahashi, Mihoko; Yamaguchi, Atsushi; Hayashi, Akiko; Yokoyama, Shigeyuki; Sakamoto, Kensaku

    2015-01-01

    Escherichia coli is a widely used host organism for recombinant technology, and the bacterial incorporation of non-natural amino acids promises the efficient synthesis of proteins with novel structures and properties. In the present study, we developed E. coli strains in which the UAG codon was reserved for non-natural amino acids, without compromising the reproductive strength of the host cells. Ninety-five of the 273 UAG stop codons were replaced synonymously in the genome of E. coli BL21(DE3), by exploiting the oligonucleotide-mediated base-mismatch-repair mechanism. This genomic modification allowed the safe elimination of the UAG-recognizing cellular component (RF-1), thus leaving the remaining 178 UAG codons with no specific molecule recognizing them. The resulting strain B-95.?A grew as vigorously as BL21(DE3)?in rich medium at 25–42°C, and its derivative B-95.?A?fabR was better adapted to low temperatures and minimal media than B-95.?A. UAG was reassigned to synthetic amino acids by expressing the specific pairs of UAG-reading tRNA and aminoacyl-tRNA synthetase. Due to the preserved growth vigor, the B-95.?A strains showed superior productivities for hirudin molecules sulfonated on a particular tyrosine residue, and the Fab fragments of Herceptin containing multiple azido groups. PMID:25982672

  6. Optimization of Codon Translation Rates via tRNA Modifications Maintains Proteome Integrity

    PubMed Central

    Nedialkova, Danny D.; Leidel, Sebastian A.

    2015-01-01

    Summary Proteins begin to fold as they emerge from translating ribosomes. The kinetics of ribosome transit along a given mRNA can influence nascent chain folding, but the extent to which individual codon translation rates impact proteome integrity remains unknown. Here, we show that slower decoding of discrete codons elicits widespread protein aggregation in vivo. Using ribosome profiling, we find that loss of anticodon wobble uridine (U34) modifications in a subset of tRNAs leads to ribosome pausing at their cognate codons in S. cerevisiae and C. elegans. Cells lacking U34 modifications exhibit gene expression hallmarks of proteotoxic stress, accumulate aggregates of endogenous proteins, and are severely compromised in clearing stress-induced protein aggregates. Overexpression of hypomodified tRNAs alleviates ribosome pausing, concomitantly restoring protein homeostasis. Our findings demonstrate that modified U34 is an evolutionarily conserved accelerator of decoding and reveal an unanticipated role for tRNA modifications in maintaining proteome integrity. PMID:26052047

  7. 50 CFR 600.910 - Definitions and word usage.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Definitions and word usage. 600.910 Section... Definitions and word usage. (a) Definitions...biological alterations of the waters or substrate and...815(a)(8). State action means any action...agency. (b) Word usage. The terms...

  8. 50 CFR 600.910 - Definitions and word usage.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... Definitions and word usage. 600.910 Section... Definitions and word usage. (a) Definitions...biological alterations of the waters or substrate and...815(a)(8). State action means any action...agency. (b) Word usage. The terms...

  9. 50 CFR 600.910 - Definitions and word usage.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Definitions and word usage. 600.910 Section... Definitions and word usage. (a) Definitions...biological alterations of the waters or substrate and...815(a)(8). State action means any action...agency. (b) Word usage. The terms...

  10. 50 CFR 600.910 - Definitions and word usage.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Definitions and word usage. 600.910 Section... Definitions and word usage. (a) Definitions...biological alterations of the waters or substrate and...815(a)(8). State action means any action...agency. (b) Word usage. The terms...

  11. The Pumapaint Project: Long Term Usage Trends And The Move To Three Dimensions

    Microsoft Academic Search

    Matthew R. Stein; Christopher P. Madden

    2005-01-01

    Online since the summer of 1998, the PumaPaint project can be considered an elder statesman of networked robotics. Although never a profound technical achievement to attach a PUMA robot to a network, the extended period of operation permits interesting observations of long-term usage trends, comparison of operation through several generations of user interface and a voluminous body of artwork to

  12. MISSED CALL? A REEXAMINATION OF SPORT FANS' AND NONFANS' ALCOHOL USAGE AND ALCOHOL-RELATED EXPERIENCES

    Microsoft Academic Search

    Christian M. End; Michael C. Davis; Jeff M. Kretschmar; Jamonn Campbell; David G. Mueller; Shaye S. Worthman

    2009-01-01

    The current investigation attempted to replicate and extend Nelson and Weschler's (2003) research that indicated that college student sport fans were more likely to report problematic alcohol usage and more negative alcohol-related experiences in comparison to nonfans. In addition to utilizing the original study's operational definition of fan (spectator-based), 323 college students were categorized according to more traditional measures of

  13. Print and Electronic Resources: Usage Statistics at Guru Gobind Singh Indraprastha University Library

    ERIC Educational Resources Information Center

    Kapoor, Kanta

    2010-01-01

    Purpose: The purpose of this paper is to quantify the use of electronic journals in comparison with the print collections in the Guru Gobind Singh Indraprastha University Library. Design/methodology/approach: A detailed analysis was made of the use of lending services, the Xerox facility and usage of electronic journals such as Science Direct,…

  14. E-Book Usage and the "Choice" Outstanding Academic Book List: Is There a Correlation?

    ERIC Educational Resources Information Center

    Carter Williams, Karen; Best, Rickey

    2006-01-01

    In this study, the staff of the library at Auburn University at Montgomery analyzed circulation patterns for electronic books in the fields of Political Science, Public Administration and Law to see if favorable "Choice" reviews can be used to predict usage of electronic books. A comparison of the circulations between print and electronic books…

  15. HER2 codon 655 polymorphism and breast cancer: results from kin-cohort and case–control analyses

    Microsoft Academic Search

    Robert C. Millikan; Amanda J. Hummer; Mary S. Wolff; Asahi Hishida; Colin B. Begg

    2005-01-01

    Summary  Several published epidemiologic studies show increased breast cancer risk for carriers of the Val-allele at codon 655 of the HER2 gene. We conducted additional analyses using data from three studies, including case–control analyses stratified on age and kin-cohort analyses using relatives of cases and controls. The results provide additional evidence that HER2 codon 655 genotype may predispose to early-onset breast

  16. Codon and amino-acid specificities of a transfer RNA are both converted by a single post-transcriptional modification

    Microsoft Academic Search

    Tomonari Muramatsu; Kazuya Nishikawa; Fumiko Nemoto; Yoshiyuki Kuchino; Susumu Nishimura; Tatsuo Miyazawa; Shigeyuki Yokoyama

    1988-01-01

    An Escherichia coli isoleucine transfer RNA specific for the codon AUA (tRNA2Ile or tRNAminorIle (ref. 1) has a novel modified nucleo-side, lysidine (L; ref. 2) (Fig. la) in the first position of the anticodon (position 34), which is essential for the specific recognition of the codon AUA (ref. 1). We isolated the gene for tRNA2Ile (ileX) and found that the

  17. Apolipoprotein B48 is the Product of a Messenger RNA with an Organ-Specific In-Frame Stop Codon

    Microsoft Academic Search

    San-Hwan Chen; Geetha Habib; Chao-Yuh Yang; Zi-Wei Gu; Bo Rong Lee; Shi-Ai Weng; Steven R. Silberman; Sheng-Jian Cai; J. P. Deslypere; Maryvonne Rosseneu; Antonio M. Gotto; Wen-Hsiung Li; Lawrence Chan

    1987-01-01

    The primary structure of human apolipoprotein (apo) B-48 has been deduced and shown by a combination of DNA excess hybridization, sequencing of tryptic peptides, cloned complementary DNAs, and intestinal messenger RNAs (mRNAs) to be the product of an intestinal mRNA with an in-frame UAA stop codon resulting from a C to U change in the codon CAA encoding Gln2153 in

  18. Synonymous codon bias and functional constraint on GC3-related DNA backbone dynamics in the prokaryotic nucleoid

    PubMed Central

    Babbitt, Gregory A.; Alawad, Mohammed A.; Schulze, Katharina V.; Hudson, André O.

    2014-01-01

    While mRNA stability has been demonstrated to control rates of translation, generating both global and local synonymous codon biases in many unicellular organisms, this explanation cannot adequately explain why codon bias strongly tracks neighboring intergene GC content; suggesting that structural dynamics of DNA might also influence codon choice. Because minor groove width is highly governed by 3-base periodicity in GC, the existence of triplet-based codons might imply a functional role for the optimization of local DNA molecular dynamics via GC content at synonymous sites (?GC3). We confirm a strong association between GC3-related intrinsic DNA flexibility and codon bias across 24 different prokaryotic multiple whole-genome alignments. We develop a novel test of natural selection targeting synonymous sites and demonstrate that GC3-related DNA backbone dynamics have been subject to moderate selective pressure, perhaps contributing to our observation that many genes possess extreme DNA backbone dynamics for their given protein space. This dual function of codons may impose universal functional constraints affecting the evolution of synonymous and non-synonymous sites. We propose that synonymous sites may have evolved as an ‘accessory’ during an early expansion of a primordial genetic code, allowing for multiplexed protein coding and structural dynamic information within the same molecular context. PMID:25200075

  19. Codon-modifications and an endoplasmic reticulum-targeting sequence additively enhance expression of an Aspergillus phytase gene in transgenic canola.

    PubMed

    Peng, Ri-He; Yao, Quan-Hong; Xiong, Ai-Sheng; Cheng, Zong-Ming; Li, Yi

    2006-03-01

    Transgenic plants offer advantages for biomolecule production because plants can be grown on a large scale and the recombinant macromolecules can be easily harvested and extracted. We introduced an Aspergillus phytase gene into canola (Brassica napus) (line 9412 with low erucic acid and low glucosinolates) by Agrobacterium-mediated transformation. Phytase expression in transgenic plant was enhanced with a synthetic phytase gene according to the Brassica codon usage and an endoplasmic reticulum (ER) retention signal KDEL that confers an ER accumulation of the recombinant phytase. Secretion of the phytase to the extracellular fluid was also established by the use of the tobacco PR-S signal peptide. Phytase accumulation in mature seed accounted for 2.6% of the total soluble proteins. The enzyme can be glycosylated in the seeds of transgenic plants and retain a high stability during storage. These results suggest a commercial feasibility of producing a stable recombinant phytase in canola at a high level for animal feed supplement and for reducing phosphorus eutrophication problems. PMID:16249870

  20. Material impacts on operational energy usage

    E-print Network

    Love, Andrea, S.M. Massachusetts Institute of Technology

    2011-01-01

    Decisions regarding materials and construction of a building are made all the time in the architectural process, but thought is not always given to how those choices may affect the buildings ultimate energy usage and the ...

  1. Central serous chorioretinopathy associated with rowatinex usage.

    PubMed

    Akyol-Salman, ?lknur; Leçe-Sertöz, Deniz; Mumcu, U?ur; Ate?, Orhan; Baykal, Orhan

    2009-12-01

    Central serous chorioretinopathy (CSC) is an idiopathic disorder characterized by serous detachment of the neurosensory retina. This report describes a case of CSC associated with rowatinex usage. PMID:25610102

  2. Central Serous Chorioretinopathy Associated with Rowatinex Usage

    PubMed Central

    Akyol-Salman, ?lknur; Leçe-Sertöz, Deniz; Mumcu, U?ur; Ate?, Orhan; Baykal, Orhan

    2009-01-01

    Central serous chorioretinopathy (CSC) is an idiopathic disorder characterized by serous detachment of the neurosensory retina. This report describes a case of CSC associated with rowatinex usage. PMID:25610102

  3. Context-dependent codon partition models provide significant increases in model fit in atpB and rbcL protein-coding genes

    PubMed Central

    2011-01-01

    Background Accurate modelling of substitution processes in protein-coding sequences is often hampered by the computational burdens associated with full codon models. Lately, codon partition models have been proposed as a viable alternative, mimicking the substitution behaviour of codon models at a low computational cost. Such codon partition models however impose independent evolution of the different codon positions, which is overly restrictive from a biological point of view. Given that empirical research has provided indications of context-dependent substitution patterns at four-fold degenerate sites, we take those indications into account in this paper. Results We present so-called context-dependent codon partition models to assess previous empirical claims that the evolution of four-fold degenerate sites is strongly dependent on the composition of its two flanking bases. To this end, we have estimated and compared various existing independent models, codon models, codon partition models and context-dependent codon partition models for the atpB and rbcL genes of the chloroplast genome, which are frequently used in plant systematics. Such context-dependent codon partition models employ a full dependency scheme for four-fold degenerate sites, whilst maintaining the independence assumption for the first and second codon positions. Conclusions We show that, both in the atpB and rbcL alignments of a collection of land plants, these context-dependent codon partition models significantly improve model fit over existing codon partition models. Using Bayes factors based on thermodynamic integration, we show that in both datasets the same context-dependent codon partition model yields the largest increase in model fit compared to an independent evolutionary model. Context-dependent codon partition models hence perform closer to codon models, which remain the best performing models at a drastically increased computational cost, compared to codon partition models, but remain computationally interesting alternatives to codon models. Finally, we observe that the substitution patterns in both datasets are drastically different, leading to the conclusion that combined analysis of these two genes using a single model may not be advisable from a context-dependent point of view. PMID:21619569

  4. Identification of TTA codon containing genes in Frankia and exploration of the role of tRNA in regulating these genes.

    PubMed

    Sen, Arnab; Thakur, Subarna; Bothra, Asim K; Sur, Saubashya; Tisa, Louis S

    2012-01-01

    The TTA codon, one of the six available codons for the amino acid leucine, is the rarest codon among the high GC genomes of Actinobacteria including Frankia. This codon has been implicated in various regulatory mechanisms involving secondary metabolism and morphological development. TTA-mediated gene regulation is well documented in Streptomyces coelicolor, but that role has not been investigated in other Actinobacteria including Frankia. Among the various Actinomycetes with a GC content of more than 70%, Frankia genomes had the highest percentages of TTA-containing genes ranging from 5.2 to 10.68% of the genome. In contrast, TTA-bearing genes comprised 1.7, 3.4 and 4.1% of the Streptomyces coelicolor, S. avermitilis and Nocardia farcinia genomes, respectively. We analyzed their functional role, evolutionary significance, horizontal acquisition and the codon-anticodon interaction. The TTA-bearing genes were found to be well represented in metabolic genes involved in amino acid transport and secondary metabolism. A reciprocal Blast search reveal that many of the TTA-bearing genes have orthologs in the other Frankia genomes, and some of these orthologous genes also have a TTA codon in them. The gene expression level of TTA-containing genes was estimated by the use of the codon adaption index (CAI), and the CAI values were found to have a positive correlation with the GC3 (GC content at the 3rd codon position). A full-atomic 3D model of the leucine tRNA recognizing the TTA (UUA) codon was generated and utilized for in silico docking to determine binding affinity in codon-anticodon interaction. We found a proficient codon-anticodon interaction for this codon which is perhaps why so many genes hold on to this rare codon without compromising their translational efficiency. PMID:21773800

  5. High-level accumulation of recombinant miraculin protein in transgenic tomatoes expressing a synthetic miraculin gene with optimized codon usage terminated by the native miraculin terminator

    Microsoft Academic Search

    Kyoko Hiwasa-Tanase; Mpanja Nyarubona; Tadayoshi Hirai; Kazuhisa Kato; Takanari Ichikawa; Hiroshi Ezura

    2011-01-01

    In our previous study, a transgenic tomato line that expressed the MIR gene under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (tNOS) produced the taste-modifying protein miraculin (MIR). However, the concentration of MIR in the tomatoes was lower than that\\u000a in the MIR gene’s native miracle fruit. To increase MIR production, the native MIR

  6. Function of 3? non-coding sequences and stop codon usage in expression of the chloroplast psaB gene in Chlamydomonas reinhardtii

    Microsoft Academic Search

    Hyeonmoo Lee; Scott E. Bingham; Andrew N. Webber

    1996-01-01

    The rate of mRNA decay is an important step in the control of gene expression in prokaryotes, eukaryotes and cellular organelles. Factors that determine the rate of mRNA decay in chloroplasts are not well understood. Chloroplast mRNAs typically contain an inverted repeat sequence within the 3' untranslated region that can potentially fold into a stem-loop structure. These stem-loop structures have

  7. Limitations of the 'ambush hypothesis' at the single-gene scale: what codon biases are to blame?

    PubMed

    Bertrand, Robert L; Abdel-Hameed, Mona; Sorensen, John L

    2015-04-01

    Ribosomal frameshifting, a translational error, catastrophically alters the amino acid composition of the nascent protein by shifting the reading frame from the intended contiguous trinucleotide reading. Frameshift events waste energy and resources, and peptide products have unpredictable cytotoxic effects. The 'Ambush Hypothesis' (Seligmann and Pollock 2004, DNA Cell Biol 23:701-5) suggests there is a selective pressure favouring the evolution of out-of-frame ('hidden') stop codons. Although this hypothesis has gained empirical support through whole-genome studies, it is presently unknown whether it can be applied at a single-gene scale. Herein, we report such an investigation using the gene, polyketide synthase (PKS), among species of fungi. Contrary to expectation, genes presented with significantly lower number of hidden stop codons than expected in a selection-neutral model (p < 0.0005), suggesting both non-adherence to the ambush hypothesis as well as suppression of hidden stop codon evolution. It is known that there are multiple adaptive considerations determining codon selection during evolution, and that the information-holding potential of the genetic code is finite. We hypothesize that the reason for low hidden stops in PKS genes is due to competing 'codon biases' that are prioritized over the selective pressure favouring the emergence of hidden stops. Future studies of the ambush hypothesis in the context of other drivers of codon bias may allow this hypothesis to be molded into a comprehensive genetic theory that can be integrated within the broader genetic theory of codon bias and applied to the genetic code at any scale of analysis. PMID:25307067

  8. Another Motivation for Usage Models: Generation of User Documentation

    Microsoft Academic Search

    Stefan Jungmayr

    The reliability of a software product depends on the number of residual faults as well as on its usage. Trustable reliability testing techniques therefore rely on a formal usage model that allows to test soft- ware under conditions similar to its intended usage. The effort to define a usage model is significant, but it pays off not only in terms

  9. Yeast mitochondrial threonyl-tRNA synthetase recognizes tRNA isoacceptors by distinct mechanisms and promotes CUN codon reassignment

    PubMed Central

    Ling, Jiqiang; Peterson, Kaitlyn M.; Simonovi?, Ivana; Cho, Chris; Söll, Dieter; Simonovi?, Miljan

    2012-01-01

    Aminoacyl-tRNA synthetases (aaRSs) ensure faithful translation of mRNA into protein by coupling an amino acid to a set of tRNAs with conserved anticodon sequences. Here, we show that in mitochondria of Saccharomyces cerevisiae, a single aaRS (MST1) recognizes and aminoacylates two natural tRNAs that contain anticodon loops of different size and sequence. Besides a regular with a threonine (Thr) anticodon, MST1 also recognizes an unusual , which contains an enlarged anticodon loop and an anticodon triplet that reassigns the CUN codons from leucine to threonine. Our data show that MST1 recognizes the anticodon loop in both tRNAs, but employs distinct recognition mechanisms. The size but not the sequence of the anticodon loop is critical for recognition, whereas the anticodon sequence is essential for aminoacylation of . The crystal structure of MST1 reveals that, while lacking the N-terminal editing domain, the enzyme closely resembles the bacterial threonyl-tRNA synthetase (ThrRS). A detailed structural comparison with Escherichia coli ThrRS, which is unable to aminoacylate , reveals differences in the anticodon-binding domain that probably allow recognition of the distinct anticodon loops. Finally, our mutational and modeling analyses identify the structural elements in MST1 (e.g., helix ?11) that define tRNA selectivity. Thus, MTS1 exemplifies that a single aaRS can recognize completely divergent anticodon loops of natural isoacceptor tRNAs and that in doing so it facilitates the reassignment of the genetic code in yeast mitochondria. PMID:22343532

  10. Attenuation of human respiratory syncytial virus by genome-scale codon-pair deoptimization.

    PubMed

    Le Nouën, Cyril; Brock, Linda G; Luongo, Cindy; McCarty, Thomas; Yang, Lijuan; Mehedi, Masfique; Wimmer, Eckard; Mueller, Steffen; Collins, Peter L; Buchholz, Ursula J; DiNapoli, Joshua M

    2014-09-01

    Human respiratory syncytial virus (RSV) is the most important viral agent of serious pediatric respiratory-tract disease worldwide. A vaccine or generally effective antiviral drug is not yet available. We designed new live attenuated RSV vaccine candidates by codon-pair deoptimization (CPD). Specifically, viral ORFs were recoded by rearranging existing synonymous codons to increase the content of underrepresented codon pairs. Amino acid coding was completely unchanged. Four CPD RSV genomes were designed in which the indicated ORFs were recoded: Min A (NS1, NS2, N, P, M, and SH), Min B (G and F), Min L (L), and Min FLC (all ORFs except M2-1 and M2-2). Surprisingly, the recombinant CPD viruses were temperature-sensitive for replication in vitro (level of sensitivity: Min FLC > Min L > Min B > Min A). All of the CPD mutants grew less efficiently in vitro than recombinant wild-type (WT) RSV, even at the typically permissive temperature of 32 °C (growth efficiency: WT > Min L > Min A > Min FLC > Min B). CPD of the ORFs for the G and F surface glycoproteins provided the greatest restrictive effect. The CPD viruses exhibited a range of restriction in mice and African green monkeys comparable with that of two attenuated RSV strains presently in clinical trials. This study provided a new type of attenuated RSV and showed that CPD can rapidly generate vaccine candidates against nonsegmented negative-strand RNA viruses, a large and expanding group that includes numerous pathogens of humans and animals. PMID:25157129

  11. HER2 codon 655 polymorphism and breast cancer risk: a meta-analysis

    Microsoft Academic Search

    Weiyang Tao; Chunyang Wang; Ruifa Han; Hongchi Jiang

    2009-01-01

    To evaluate the association between HER2 codon 655 polymorphism and breast cancer risk in this meta-analysis. A comprehensive search was performed to identify all\\u000a case–control studies investigating such association. Statistical analyses were conducted with software MIX 1.54. Twenty eligible\\u000a reports, including 10,642 cases\\/11,259 controls, were identified. In overall analysis, the Val allele frequency in cases was\\u000a significantly higher than that

  12. Adenine-containing codons enhance protein synthesis by promoting mRNA binding to ribosomal 30S subunits provided that specific tRNAs are not exhausted

    Microsoft Academic Search

    M. A. Castillo-Méndez; E. Jacinto-Loeza; J. J. Olivares-Trejo; G. Guarneros-Peña; J. Hernández-Sánchez

    Adenines downstream of the initiation codon promote protein synthesis; however, some adenine-containing codons (AGA, AGG and AUA) at early positions inhibit protein synthesis when cognate tRNA is exhausted. It has also been reported, although not convincingly, the presence of adenines enhancing mRNA binding to the ribosome. To understand these apparent inconsistencies we analyzed the effect of these codons in mRNA-ribosome binding

  13. Genetic risk factors associated with Creutzfeld-Jakob disease in Slovenians and a rapid typing for PRNP codon 129 single nucleotide polymorphism.

    PubMed

    Galvani, V; Rupreht, R R; Serbec, V C; Vidan-Jeras, B

    2005-06-01

    PRNP has been the most informative marker for the predisposition to variant Creutzfeld-Jakob disease (vCJD). All victims of the vCJD carried methionine (M) at the position 129 of the PrP. Prions could travel through the immune system to get from the gut to the brain, and human leucocyte antigens (HLAs) could be involved in this carriage, with HLA-DQ7 being less efficient. Contradictory reports have raised the question of the influence of sampling in population studies. We developed a fast and reliable real-time polymerase chain reaction for codon 129 single nucleotide polymorphism (SNP) using TaqMan technology, which overcomes the main drawbacks of other methods and analysed Slovenian population (n = 97). The comparison with other populations served for the estimation of the genetic risk for the development of vCJD in Slovenians. The frequencies at the codon 129 SNP in the Slovenian population were 43.3% M, 45.4% M/V 11.3% V. Considerable differences between the DQ7 frequencies in diverse samples from the same population can be seen, especially when compared to Slovenian population. This could be because of the diverse criteria for including subjects into the study and the sampling of geographically distinct subpopulations. Analysing the adequacy of HLA-DQ7 as a possible predictive factor for developing Creutzfeld-Jakob disease (CJD) by case - control studies could be improved with exact and equal sampling of groups of patients and controls. CJD genetic risk factors in the Slovenians were not found significantly different than those in British. PMID:15943704

  14. Association of TP53 codon 72 polymorphism and the outcome of adjuvant therapy in breast cancer patients

    PubMed Central

    Toyama, Tatsuya; Zhang, Zhenhuan; Nishio, Mariko; Hamaguchi, Maho; Kondo, Naoto; Iwase, Hirotaka; Iwata, Hiroji; Takahashi, Satoru; Yamashita, Hiroko; Fujii, Yoshitaka

    2007-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) in codon 72 of the TP53 (also known as p53) gene (rs1042522) and in the promoter region of the MDM2 gene (SNP309; rs2279744) have been suggested to play roles in many cancers. We investigated whether these SNPs were associated with patient outcome and the effect of adjuvant systemic therapy. Methods The genotypes of TP53 codon 72 and MDM2 SNP309 were defined among 557 primary Japanese breast cancer patients (median follow-up, 61.7 months). The effects of several variables on survival were tested by Cox's proportional hazards regression analysis. Results We showed that the Pro/Pro genotype of TP53 codon 72 was associated with poorer disease-free survival (DFS) than other genotypes by Kaplan-Meier analysis (P = 0.049) and multivariate Cox's proportional hazards regression analysis (P = 0.047, risk ratio of recurrence = 1.67), whereas MDM2 SNP309 status was not associated with DFS. The association of the Pro/Pro TP53 genotype with poorer DFS was especially significant in patients who received adjuvant chemotherapy (P = 0.009). In contrast, among the patients who had received adjuvant hormonal therapy or no adjuvant systemic therapy, TP53 codon 72 genotype was not associated with DFS. Conclusion The Pro/Pro genotype of TP53 codon 72 appears to be an independent prognostic marker in breast cancer patients. PMID:17537232

  15. A premature termination codon within an alternative exon affecting only the metabolism of transcripts that retain this exon.

    PubMed

    Maillet, P; Dalla Venezia, N; Lorenzo, F; Morinière, M; Bozon, M; Noël, B; Delaunay, J; Baklouti, F

    1999-01-01

    Protein 4.1 pre-mRNA splicing is regulated in tissue- and development-specific manners. Exon 16, which encodes the N-terminal region of the spectrin/actin-binding domain, is one of the alternatively spliced sequence motifs. It is present in late differentiated erythroid cells but absent from early erythroblasts and from lymphoid cells. We describe a single nucleotide deletion of the erythroid protein 4.1 gene associated with hereditary elliptocytosis. The deletion located in exon 16 leads to a frameshift and a premature termination codon within the same exon. In an effort to examine the premature stop codon effect in relationship with exon 16 alternative splicing, we analyzed erythroid and lymphoid protein 4.1 mRNAs using the mutation and a linked downstream polymorphism as markers. We found that the premature stop codon does not affect the tissue-specific alternative splicing among the two cell types analyzed and that the resulting alteration of mRNA metabolism correlates with the retention of exon 16 in reticulocytes. Conversely, skipping of exon 16 in lymphoid cells converts the mutant mRNA to a normal lymphoid-specific mRNA isoform, hence bypassing the nonsense codon. Consistent with data obtained on constitutive nonsense exons, our observations argue in favor of a stop codon recognition mechanism that occurs after the regulated splicing status of the nonsense exon has been achieved. PMID:10425037

  16. Motivations and usage patterns of Weibo.

    PubMed

    Zhang, Lixuan; Pentina, Iryna

    2012-06-01

    Referred to as "Weibo," microblogging in China has witnessed an exponential growth. In addition to the Twitter-like functionality, Weibo allows rich media uploads into user feeds, provides threaded comments, and offers applications, games, and Weibo medals. This expanded functionality, as well as the observed differences in trending content, suggests potentially different user motivations to join Weibo and their usage patterns compared to Twitter. This pioneering study identifies dominant Weibo user motivations and their effects on usage patterns. We discuss the findings of an online survey of 234 Weibo users and suggest managerial implications and future research directions. PMID:22703037

  17. NAT Usage in Residential Broadband Networks

    NASA Astrophysics Data System (ADS)

    Maier, Gregor; Schneider, Fabian; Feldmann, Anja

    Many Internet customers use network address translation (NAT) when connecting to the Internet. To understand the extend of NAT usage and its implications, we explore NAT usage in residential broadband networks based on observations from more than 20,000 DSL lines. We present a unique approach for detecting the presence of NAT and for estimating the number of hosts connected behind a NAT gateway using IP TTLs and HTTP user-agent strings. Furthermore, we study when each of the multiple hosts behind a single NAT gateway is active. This enables us to detect simultaneous use. In addition, we evaluate the accuracy of NAT analysis techniques when fewer information is available.

  18. Codon optimisation improves the expression of Trichoderma viride sp. endochitinase in Pichia pastoris

    PubMed Central

    Yu, Ping; Yan, Yuan; Gu, Qing; Wang, Xiangyang

    2013-01-01

    The mature cDNA of endochitinase from Trichoderma viride sp. was optimised based on the codon bias of Pichia pastoris GS115 and synthesised by successive PCR; the sequence was then transformed into P. pastoris GS115 via electroporation. The transformant with the fastest growth rate on YPD plates containing 4?mg/mL G418 was screened and identified. This transformant produced 23.09?U/mL of the recombinant endochitinase, a 35% increase compared to the original strain bearing the wild-type endochitinase cDNA. The recombinant endochitinase was sequentially purified by ammonia sulphate precipitation, DE-52 anion-exchange chromatography and Sephadex G-100 size-exclusion chromatography. Thin-layer chromatography indicated that the purified endochitinase could hydrolyse chito-oligomers or colloidal chitin to generate diacetyl-chitobiose (GlcNAc)2 as the main product. This study demonstrates (1) a means for high expression of Trichoderma viride sp. endochitinase in P. pastoris using codon optimisation and (2) the preparation of chito-oligomers using endochitinase. PMID:24154717

  19. Impact of the MLL1 morphemes on codon utilization and preservation in CpG Islands.

    PubMed

    Bina, Minou; Wyss, Phillip

    2015-09-01

    Previous studies have shown that Mixed Lineage Leukemia 1 (MLL1 or MLL) binds a group of CpG-rich motifs known as morphemes. To examine whether occurrences of MLL1 morphemes in genomic DNA may influence codon utilization, we analyzed the frequency of various 9-mers in human cDNAs and in total human genomic DNA. We uncovered preferential utilization of GGC for Gly, GCG for Ala, CCG for Pro, and TCG for Ser, in coding sequences (CDSs) that included MLL1 morphemes. We also examined weighted occurrences of CDS 9-mers in a 30-base window that moved along each human chromosome. In plots, we observed peaks with fluctuating intensities. High intensity peaks appeared within promoter and exons localized in CpG islands, encompassing sequences that included MLL1 morphemes. High intensity peaks included CCG/GGC repeats, whose expansion may cause neurological disorders and congenital malformations. Such repeats are generated from overlap of a morpheme (CGCCG/CGGCG), which depending on reading frame and orientation would produce runs of Ala, Gly, or Pro in proteins. Overall, our results point to a role for morpheme occurrences on synonymous codon utilization in human genomic DNA and indicate that regulatory instructions are dispersed not only in promoters but also in exons of human genes. © 2015 Wiley Periodicals, Inc. Biopolymers 103: 480-490, 2015. PMID:25991579

  20. Codon optimization for high level expression of human bone morphogenetic protein-2 in Escherichia coli.

    PubMed

    Retnoningrum, Debbie S; Pramesti, H T; Santika, P Y; Valerius, O; Asjarie, S; Suciati, T

    2012-08-01

    Codons in the open reading frame (ORF) encoding for human bone morphogenetic protein-2 (hBMP-2) were optimized to reach high level expression in Escherichia coli. The optimization was done by the computer programs DNA works and DNA Star according to Thermodynamically Balanced Inside Out (TBIO) approach. The ORF consisting of 342 base pairs (bp) was assembled using two-steps Polymerase Chain Reaction, cloned into a pGEM-T vector with a mutation rate of 6.38 bp per kb and transformed into E. coli JM109. After a DNA sequence confirmation, mutation-free ORF was subcloned into pET32b and transformed into E. coli BL21(DE3). The rhBMP-2 was produced as a thioredoxin-his-tag fusion protein at relatively high level, approximately 60% of total intracellular proteins as inclusion bodies (IB), with a yield of 1.39 g per liter culture. Solubilization of IB gave soluble monomer rhBMP-2 with a recovery of 13.6% and refolding of soluble rhBMP-2 produced dimeric forms with a yield of 8.7%. The size and identity of the purified rhBMP-2 was confirmed by nano-LC-MS/MS2 analysis. Our work demonstrates for the first time that by using TBIO approach, a codon-optimized ORF encoding for rhBMP-2 protein can be expressed at high level in E. coli expression system. PMID:22691543

  1. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster

    PubMed Central

    Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S

    2013-01-01

    Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569

  2. Kras gene codon 12 mutation detection enabled by gold nanoparticles conducted in a nanobioarray chip.

    PubMed

    Sedighi, Abootaleb; Li, Paul C H

    2014-03-01

    This study employs a nanobioarray (NBA) chip for multiple biodetection of single base pair mutations at the Kras gene codon 12. To distinguish between the mutant and wild-type target DNAs, current bioarray methods use high-temperature hybridization of the targets to the allele-specific probes. However, these techniques need prior temperature optimization and become harder to implement in the case of the detection of multiple mutations. We aimed to detect these mutations at a single temperature (room temperature), enabled by the use of gold nanoparticles (AuNPs) on the bioarray created within nanofluidic channels. In this method, a low amount of target oligonucleotides (5fmol) and polymerase chain reaction (PCR) products (300pg) were first loaded on the AuNP surface, and then these AuNP-bound targets were introduced into the channels of a polydimethylsiloxane (PDMS) glass chip. The targets hybridized to their complementary probes at the intersection of the target channels to the pre-printed oligonucleotide probe lines on the glass surface, creating a bioarray. Using this technique, fast and high-throughput multiple discrimination of the Kras gene codon 12 were achieved at room temperature using the NBA chip, and the specificity of the method was proved to be as high as that with the temperature stringency method. PMID:24291640

  3. p53 Codon 72 arginine/proline polymorphism and cancer in Sudan.

    PubMed

    Eltahir, Huda A; Adam, Ameera A M; Yahia, Zeinab A; Ali, Noon F; Mursi, Dalia M; Higazi, Ashraaf M; Eid, Nahid A; Elhassan, Ahmed M; Mohammed, Hiba S; Ibrahim, Muntaser E

    2012-12-01

    The aim of this report is to determine frequencies and associations of p53 codon 72 arg/pro polymorphism with different types of cancer in Sudan. p53 codon72 arg/pro polymorphism distribution and allele frequencies in 264 samples of different types of cancers were investigated using PCR. The results were compared to 235 normal controls. The results indicated significant differences in frequency and genotype association between different types of cancers. Breast carcinoma patients most prominently showed excess of homozygous arg genotype as compared to controls with an Odd ratio (OR) of 19.44, 95 %CI: 6.6-78.3, P < 0.0001. Less prominently cervical cancer showed genotype effect of 2.4 OR, 95 %CI: 1.12-5.33, P = 0.015, while esophageal cancer had an OR of 0.57, 95 %CI: 0.23-1.42, P = 0.1. In Burkitt's lymphoma, however, in contrast the homozygous arg accounted for only 6.9 %, (OR 0.18, 95 %CI: 0.02-0.89, P = 0.018). We concluded that p53 arg/pro polymorphism has different pattern of frequency in different types of cancer among Sudanese patients, indicating perhaps different etiology and biology of these tumours. PMID:23053979

  4. Codon optimization enhances protein expression of Bombyx mori nucleopolyhedrovirus DNA polymerase in E. coli.

    PubMed

    Song, Huifang; Li, Guohui; Mai, Weijun; Huang, Guoping; Chen, Keping; Zhou, Yajing; Chen, Huiqing

    2014-03-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is a major viral agent that causes deadly grasserie disease in silkworms, while BmNPV DNA polymerase (BmNPV-pol), encoded by ORF53 gene, plays a central role in viral DNA replication. Efficacy studies of BmNPV-POL are limited because of poor heterologous protein expression in E. coli. Here, we redesigned the BmNPV-pol to preferentially match codon frequencies of E. coli without altering the amino acid sequence. Following de novo synthesis, codon-optimized BmNPV-pol (co-BmNPV-pol) gene was cloned into pET32a and pGEX-4T-2 vector. The expression of co-BmNPV-POL in E. coli was significantly increased when BmNPV-POL was fused with GST protein rather than a His-tag. The co-BmNPV-POL fusion proteins were isolated using GST affinity chromatography and Mono Q iron exchange chromatography. Protein purity and identity were confirmed by western blot and MALDI-TOF analyses. The biological activity of purified proteins was measured on a poly(dA)/oligo(dT) primer/template. The specific polymerasing activity of the recombinant BmNPV-POL was 6,329 units/mg at optimal conditions. Thus, a large amount of purified protein as a soluble form with high activity would provide many benefits for the functional research and application of BmNPV-POL. PMID:24129839

  5. Real-time tRNA transit on single translating ribosomes at codon resolution

    PubMed Central

    Uemura, Sotaro; Aitken, Colin Echeverría; Korlach, Jonas; Flusberg, Benjamin A.; Turner, Stephen W.; Puglisi, Joseph D.

    2015-01-01

    Translation by the ribosome occurs by a complex mechanism involving the coordinated interaction of multiple nucleic acid and protein ligands. Here we have used zero-mode waveguides (ZMWs) and sophisticated detection instrumentation to allow real-time observation of translation at physiologically-relevant (?M) ligand concentrations. Translation at each codon is monitored by stable binding of tRNAs – labeled with distinct fluorophores – to translating ribosomes, allowing direct detection of the identity of tRNA molecules bound to the ribosome, and therefore, the underlying mRNA sequence. We observe the transit of tRNAs on single translating ribosomes and have determined the number of tRNA molecules simultaneously bound to the ribosome, at each codon of an mRNA. Our results show that ribosomes are only briefly occupied by two tRNAs and that release of deacylated tRNA from the E site is uncoupled from binding of A-site tRNA and occurs rapidly after translocation. The methods outlined here have broad application to the study of mRNA sequences, and the mechanism and regulation of translation. PMID:20393556

  6. Expression of codon optimized genes in microbial systems: current industrial applications and perspectives

    PubMed Central

    Elena, Claudia; Ravasi, Pablo; Castelli, María E.; Peirú, Salvador; Menzella, Hugo G.

    2014-01-01

    The efficient production of functional proteins in heterologous hosts is one of the major bases of modern biotechnology. Unfortunately, many genes are difficult to express outside their original context. Due to their apparent “silent” nature, synonymous codon substitutions have long been thought to be trivial. In recent years, this dogma has been refuted by evidence that codon replacement can have a significant impact on gene expression levels and protein folding. In the past decade, considerable advances in the speed and cost of gene synthesis have facilitated the complete redesign of entire gene sequences, dramatically improving the likelihood of high protein expression. This technology significantly impacts the economic feasibility of microbial-based biotechnological processes by, for example, increasing the volumetric productivities of recombinant proteins or facilitating the redesign of novel biosynthetic routes for the production of metabolites. This review discusses the current applications of this technology, particularly those regarding the production of small molecules and industrially relevant recombinant enzymes. Suggestions for future research and potential uses are provided as well. PMID:24550894

  7. Natural reassignment of CUU and CUA sense codons to alanine in Ashbya mitochondria

    PubMed Central

    Ling, Jiqiang; Daoud, Rachid; Lajoie, Marc J.; Church, George M.; Söll, Dieter; Lang, B. Franz

    2014-01-01

    The discovery of diverse codon reassignment events has demonstrated that the canonical genetic code is not universal. Studying coding reassignment at the molecular level is critical for understanding genetic code evolution, and provides clues to genetic code manipulation in synthetic biology. Here we report a novel reassignment event in the mitochondria of Ashbya (Eremothecium) gossypii, a filamentous-growing plant pathogen related to yeast (Saccharomycetaceae). Bioinformatics studies of conserved positions in mitochondrial DNA-encoded proteins suggest that CUU and CUA codons correspond to alanine in A. gossypii, instead of leucine in the standard code or threonine in yeast mitochondria. Reassignment of CUA to Ala was confirmed at the protein level by mass spectrometry. We further demonstrate that a predicted is transcribed and accurately processed in vivo, and is responsible for Ala reassignment. Enzymatic studies reveal that is efficiently recognized by A. gossypii mitochondrial alanyl-tRNA synthetase (AgAlaRS). AlaRS typically recognizes the G3:U70 base pair of tRNAAla; a G3A change in Ashbya abolishes its recognition by AgAlaRS. Conversely, an A3G mutation in Saccharomyces cerevisiae confers tRNA recognition by AgAlaRS. Our work highlights the dynamic feature of natural genetic codes in mitochondria, and the relative simplicity by which tRNA identity may be switched. PMID:24049072

  8. Detection of codon 12 point mutations of K-ras gene from mouse lung adenocarcinoma by "enriched" PCR.

    SciTech Connect

    Zhang, Y.; Woloschak, G. E.; Center for Mechanistic Biology and Biotechnology

    1998-07-01

    PURPOSE: Recent studies have shown that chemical carcinogens induce a high frequency of point mutations in the K-ras oncogene from mouse lung tumors at codons 12, 13 and 61. These experiments were performed to identify K-ras mutations in tissues from control and radiation-exposed mice. MATERIALS AND METHODS: By modifying the technique of the 'enriched' polymerase chain reaction (PCR), it was possible to detect point mutations at codon 12 of the K-ras oncogene from 25-year-old paraffin-embedded normal lungs and lung adenocarcinomas from mice exposed to radiation. Together, a total of 120 lung tissues were screened for point mutations at codon 12 of the K-ras oncogene in this study. RESULTS: A significant increase in K-ras codon 12 point mutations was observed in the normal lungs from mice exposed to 24 once-weekly neutron irradiations (100%), compared with normal lungs from mice with sham-irradiation (50%) (p<0.05). Lung adenocarcinomas from mice receiving 24 once-weekly neutron irradiations also had a significantly higher frequency of K-ras codon 12 point mutations (100%) than the lung adenocarcinomas of mice receiving 24 or 60 once-weekly gamma-ray irradiations (50%), but the higher frequency was not significantly different from that in spontaneous lung adenocarcinomas from mice (75%; p > 0.05). The validity of the technique was confirmed by sequencing two of the mutants. In doing so, a K-ras 13(Asp) point mutation was observed. CONCLUSIONS: The data suggest that high-linear energy transfer (LET) neutron radiation was more effective than low-LET gamma-rays in inducing K-ras point mutations at codon 12 in the lungs of B6CF1 mice.

  9. The surprising negative correlation of gene length and optimal codon use - disentangling translational selection from GC-biased gene conversion in yeast

    PubMed Central

    2011-01-01

    Background Surprisingly, in several multi-cellular eukaryotes optimal codon use correlates negatively with gene length. This contrasts with the expectation under selection for translational accuracy. While suggested explanations focus on variation in strength and efficiency of translational selection, it has rarely been noticed that the negative correlation is reported only in organisms whose optimal codons are biased towards codons that end with G or C (-GC). This raises the question whether forces that affect base composition - such as GC-biased gene conversion - contribute to the negative correlation between optimal codon use and gene length. Results Yeast is a good organism to study this as equal numbers of optimal codons end in -GC and -AT and one may hence compare frequencies of optimal GC- with optimal AT-ending codons to disentangle the forces. Results of this study demonstrate in yeast frequencies of GC-ending (optimal AND non-optimal) codons decrease with gene length and increase with recombination. A decrease of GC-ending codons along genes contributes to the negative correlation with gene length. Correlations with recombination and gene expression differentiate between GC-ending and optimal codons, and also substitution patterns support effects of GC-biased gene conversion. Conclusion While the general effect of GC-biased gene conversion is well known, the negative correlation of optimal codon use with gene length has not been considered in this context before. Initiation of gene conversion events in promoter regions and the presence of a gene conversion gradient most likely explain the observed decrease of GC-ending codons with gene length and gene position. PMID:21481245

  10. Discursive Usage of Six Chinese Punctuation Marks

    Microsoft Academic Search

    YUE Ming

    2006-01-01

    Both rhetorical structure and punctuation have been helpful in discourse processing. Based on a corpus annotation project, this paper reports the discursive usage of 6 Chinese punctuation marks in news commentary texts: Colon, Dash, Ellipsis, Exclamation Mark, Question Mark, and Semicolon. The rhetorical patterns of these marks are compared against patterns around cue phrases in general. Results show that these

  11. Rhetoric and Usage in Technical Writing.

    ERIC Educational Resources Information Center

    Young, Art

    Selecting criteria for usage is done in basically the same way for both technical writing and other forms of composition. Similarly, the same rhetorical theory applies to the teaching of both, and proves especially helpful in the teaching of formal report-writing skills in required freshman composition courses. Focusing on the appropriate voice,…

  12. Task and Activity Models in Hypertext Usage

    Microsoft Academic Search

    Jean-François Rouet; André Tricot

    In this chapter we examine hypertext usage from the point of view of the information processing tasks performed by hypertext users. Our main purpose is to provide a general framework to identify the tasks which may be effectively supported by hypertext environments. First we present different approaches to the analysis of information processing tasks, as they appear in hypertext and

  13. Nonacademic Professionals' Perception of Usage Errors.

    ERIC Educational Resources Information Center

    Gray, Loretta S.; Heuser, Paula

    2003-01-01

    Conducts a small-scale survey similar to one conducted by Maxine Hairston in 1979 to test whether nonacademic professionals' attitudes towards usage errors have changed in 20 years. Indicates a trend for respondents to find errors less bothersome than the respondents did 20 years ago. Supports the claim made by Hairston and other researchers that…

  14. [Dental welding titanium and its clinical usage].

    PubMed

    Li, H; Xiao, M; Zhao, Y

    1998-09-01

    Due to its excellent biocompatibility, desirable chemical and mechanical properties, Titanium has been used for implant denture, RPD and FPD, where welding techniques were indispensable. This paper introduces 5 useful modern ways to weld Titanium and their clinical usage. They are: laser, plasma welding, TIG, infraned brazing and Hruska electrowelding. PMID:12553259

  15. Fossil fuel usage and the environment

    Microsoft Academic Search

    Klass

    1990-01-01

    The Greenhouse Effect and global warming, ozone formation in the troposphere, ozone destruction in the stratosphere, and acid rain are important environmental issues. The relationship of fossil fuel usage to some of these issues is discussed. Data on fossil fuel consumption and the sources and sinks of carbon dioxide, carbon monoxide, methane, nitrogen and sulfur oxides, and ozone indicate that

  16. Style and Usage Software: Mentor, not Judge.

    ERIC Educational Resources Information Center

    Smye, Randy

    Computer software style and usage checkers can encourage students' recursive revision strategies. For example, HOMER is based on the revision pedagogy presented in Richard Lanham's "Revising Prose," while Grammatik II focuses on readability, passive voice, and possibly misused words or phrases. Writer's Workbench "Style" (a UNIX program) provides…

  17. The Bioperl project: motivation and usage

    Microsoft Academic Search

    Jason Stajich; Ewan Birney

    2000-01-01

    This paper describes motivation, basic structure, and usage of the Bioperl project. As an open source project, all Bioperl modules are freely available for use and contribution from the bioinformatics community. The project's goal is to produce high quality software for managing and manipulating biological information. The bioperl web site (http:\\/\\/bio.perl.org) provides news and information as well as access to

  18. The Bioperl project: motivation and usage

    Microsoft Academic Search

    Jason Stajich; Ewan Birney

    2000-01-01

    This paper describes motivation, basic structure, and usage of the Bioperl project. As an open source project, all Bioperl modules are freely available for use and contribution from the bioinformatics community. The project's goal is to produce high quality software for managing and manipulating biological information. The bioperl web site () provides news and information as well as access to

  19. MEASUREMENTBASED USAGE CHARGES IN COMMUNICATIONS NETWORKS

    E-print Network

    to exercise control. The congestion that has plagued the Internet because it lacks any mechanism for charging and pricing highlights the fact that without charges it is difficult to control congestion or divide networkMEASUREMENT­BASED USAGE CHARGES IN COMMUNICATIONS NETWORKS COSTAS COURCOUBETIS ICS

  20. Usage Patterns of Open Genomic Data

    ERIC Educational Resources Information Center

    Xia, Jingfeng; Liu, Ying

    2013-01-01

    This paper uses Genome Expression Omnibus (GEO), a data repository in biomedical sciences, to examine the usage patterns of open data repositories. It attempts to identify the degree of recognition of data reuse value and understand how e-science has impacted a large-scale scholarship. By analyzing a list of 1,211 publications that cite GEO data…

  1. Technical Specifications Usage Procedures and Policies

    E-print Network

    Hutcheon, James M.

    Technical Specifications and Usage Procedures and Policies Specifications Last Modified: Sept. 2014 Please contact Technical Director at 912.478.7920 with questions regarding these technical specifications and technical policies and procedures. 1 #12;Table of Contents Current Procedures and Policies

  2. Occupational Stress and VDU Usage : A Review

    Microsoft Academic Search

    Noel OMara

    1988-01-01

    This article presents a definition and model of occupational stress. Key articles are reviewed to examine the relationship between occu pational stress and VDU usage. The task characteristics of VDU work and the organisational and social environmental factors are identified as poten tial stressors. Recommendations incorporating management and ergonomic principles are provided to prevent occupational stress among VDU users.

  3. An Approach to Teaching English Usage.

    ERIC Educational Resources Information Center

    Chandler, William J., Comp.; And Others

    GRADES OR AGES: K-12. SUBJECT MATTER: English Usage. ORGANIZATION AND PHYSICAL APPEARANCE: There are four major sections: Prekindergarten-grade 3; grade 4-grade 6; grade 7-grade 9; grade 10-grade 12. Learning experiences are listed for each grade. The guide is offset printed and bound with a soft cover. OBJECTIVES AND ACTIVITIES: The program is…

  4. Consumer Activity Data: Usages and Challenges

    E-print Network

    of the Data Protection Act, which is providing a legal framework to enforce transparency and user control overConsumer Activity Data: Usages and Challenges A study from the UCIAD project Mathieu d be collected and consumed by the organisation, outside the individual's control. The rational here is of course

  5. Language Arts: Mechanics and Usage K-12.

    ERIC Educational Resources Information Center

    Instructional Objectives Exchange, Los Angeles, CA.

    This revised collection is presented in a new format. Each objective consists of stating the general objective, giving directions, sample items, and answers. Objectives covering a wide range of writing problems are included emphasizing the improvement of clarity in expression. The text is divided into two categories: Mechanics and Usage. There are…

  6. Predicate Adjective Usage in Standard Russian.

    ERIC Educational Resources Information Center

    Benson, Morton

    1959-01-01

    This paper describes predicate adjective usage in modern standard Russian using a corpus of written Russian derived from "Pravda" (neutral literary style) and "Krokodil" (conversational material). The short, long nominative, and instrumental forms are examined in relation to the type of adjective, copulative verb, sentence subject, and other…

  7. Collaborative Portfolio's Effect on Library Usage

    ERIC Educational Resources Information Center

    Bryan, Valerie

    2011-01-01

    Library resources are expensive and it is the library media specialist's responsibility to ensure that use of the library's resources is maximized to support the School Strategic Plan (SSP). This library usage study examined data on the scheduling of high school classes for research-based assignments, related to content area curriculum standards,…

  8. Twitter Usage of Universities in Turkey

    ERIC Educational Resources Information Center

    Yolcu, Ozgu

    2013-01-01

    Universities are among the users of the most popular social media networks. Usage of social media by especially students and many other people and institutions, which constitutes the target audience for universities, encourages the universities to effectively use this environment. Twitter is among these social media networks which facilitate the…

  9. Google Scholar Usage: An Academic Library's Experience

    ERIC Educational Resources Information Center

    Wang, Ya; Howard, Pamela

    2012-01-01

    Google Scholar is a free service that provides a simple way to broadly search for scholarly works and to connect patrons with the resources libraries provide. The researchers in this study analyzed Google Scholar usage data from 2006 for three library tools at San Francisco State University: SFX link resolver, Web Access Management proxy server,…

  10. Statistical Measures for Usage-Based Linguistics

    ERIC Educational Resources Information Center

    Gries, Stefan Th.; Ellis, Nick C.

    2015-01-01

    The advent of usage-/exemplar-based approaches has resulted in a major change in the theoretical landscape of linguistics, but also in the range of methodologies that are brought to bear on the study of language acquisition/learning, structure, and use. In particular, methods from corpus linguistics are now frequently used to study distributional…

  11. Usage Patterns of an Online Search System.

    ERIC Educational Resources Information Center

    Cooper, Michael D.

    1983-01-01

    Examines usage patterns of ELHILL retrieval program of National Library of Medicine's MEDLARS system. Based on sample of 6,759 searches, the study analyzes frequency of various commands, classifies messages issued by system, and investigates searcher error rates. Suggestions for redesigning program and query language are noted. Seven references…

  12. Production, Usage, and Comprehension in Animal Vocalizations

    ERIC Educational Resources Information Center

    Seyfarth, Robert M.; Cheney, Dorothy L.

    2010-01-01

    In this review, we place equal emphasis on production, usage, and comprehension because these components of communication may exhibit different developmental trajectories and be affected by different neural mechanisms. In the animal kingdom generally, learned, flexible vocal production is rare, appearing in only a few orders of birds and few…

  13. Water Usage in Finishing Facilities: Wet\\/Dry Feeders Versus Dry Feeders with Nipple Waterers

    Microsoft Academic Search

    Jay D. Harmon

    1998-01-01

    Water usage was measured in swine finishing facilities containing wet\\/dry tube feeders and more traditional dry feeders with nipple waterers. Comparisons of groups finished with the two systems show a trend toward a reduction in water wastage of 17.2%. A water efficiency is introduced that shows a reduction of 0.27 gal\\/lb gain. Pigs finished using wet\\/dry feeders also had a

  14. Eight new mtDNA sequences of glass sponges reveal an extensive usage of +1 frameshifting in mitochondrial translation.

    PubMed

    Haen, Karri M; Pett, Walker; Lavrov, Dennis V

    2014-02-10

    Three previously studied mitochondrial genomes of glass sponges (phylum Porifera, class Hexactinellida) contained single nucleotide insertions in protein coding genes inferred as sites of +1 translational frameshifting. To investigate the distribution and evolution of these sites and to help elucidate the mechanism of frameshifting, we determined eight new complete or nearly complete mtDNA sequences from glass sponges and examined individual mitochondrial genes from three others. We found nine new instances of single nucleotide insertions in these sequences and analyzed them both comparatively and phylogenetically. The base insertions appear to have been gained and lost repeatedly in hexactinellid mt protein genes, suggesting no functional significance for the frameshifting sites. A high degree of sequence conservation, the presence of unusual tRNAs, and a distinct pattern of codon usage suggest the "out-of-frame pairing" model of translational frameshifting. Additionally, we provide evidence that relaxed selection pressure on glass sponge mtDNA - possibly a result of their low growth rates and deep-water lifestyle - has allowed frameshift insertions to be tolerated for hundreds of millions of years. Our study provides the first example of a phylogenetically diverse and extensive usage of translational frameshifting in animal mitochondrial coding sequences. PMID:24177232

  15. Attitudes towards Debatable Usages among English Language Teachers and Students.

    ERIC Educational Resources Information Center

    Lee, Jackie F. K

    2001-01-01

    Compares the attitudes towards divided or debatable usages between Hong Kong teachers and their students. Data were collected via elicitation tests. Findings showed significant differences between teachers' and students' attitudes towards debatable usages. (Author/VWL)

  16. Consequences of germline variation disrupting the constitutional translational initiation codon start sites of MLH1 and BRCA2: Use of potential alternative start sites and implications for predicting variant pathogenicity.

    PubMed

    Parsons, Michael T; Whiley, Phillip J; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A; Marquart, Louise; Hopper, John L; Jenkins, Mark A; Brown, Melissa A; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D; Spurdle, Amanda B

    2015-07-01

    Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However, few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. © 2013 Wiley Periodicals, Inc. PMID:24302565

  17. A specific KRAS codon 13 mutation is an independent predictor for colorectal cancer metachronous distant metastases

    PubMed Central

    Feng, Qingyang; Liang, Li; Ren, Li; Chen, Jingwen; Wei, Ye; Chang, Wenju; Zhu, Dexiang; Lin, Qi; Zheng, Peng; Xu, Jianmin

    2015-01-01

    Background: In colorectal cancer, there are significant differences between synchronous and metachronous distant metastases. However in recent studies, synchronous and metachronous metastases were always lumped together, neglecting their clinical and molecular differences. The mechanism of the latency of metachronous metastases is still unclear. We conducted this study to reveal the relationship between EGFR pathways and metachronous metastases, and try to find efficient predictors. Methods: PCRs and pyrosequencing were used to detect KRAS, BRAF, PIK3CA and PTEN mutations in primary tumor tissues in a total of 281 patients from 2002 to 2008. Patients were identified into three groups: no-metastases group, synchronous-metastases group and metachronous-metastases group. Clinical and survival data were collected from a prospective database. Results: KRAS codon 13 mutation was an independent predictor only for metachronous distant metastases (OR = 11.857, P < 0.001), but not for synchronous metastases. Male gender (OR = 2.233, P = 0.024), primary tumor located at rectum (OR = 0.404, P = 0.041), and primary pN2 stage (OR = 3.361, P = 0.01) were also independent predictors for metachronous distant metastases. Different SNPs in KRAS worked significantly different in determining synchronous or metachronous metastases. BRAF mutation (Univariate, OR = 11.5, P = 0.039) and > 200 ng/ml preoperative CEA (Univariate, OR = 41, P = 0.011) potentially predicted metastases within 6 months after primary tumor resection. After metachronous metastases, radical resection (HR = 0.280, P = 0.002) was the most important protective factor for long-term survival. Conclusion: There were significant clinical and molecular differences between synchronous and metachronous metastases. As an independent predictor, KRAS codon 13 mutation might be the key to explain the mechanism of colorectal cancer metachronous distant metastases. Together with clinical characteristics, it could aid in the early detection of metachronous metastases. PMID:25973306

  18. Replicating reoviruses with a transgene replacing the codons for the head domain of the viral spike.

    PubMed

    van den Wollenberg, D J M; Dautzenberg, I J C; Ros, W; Lipi?ska, A D; van den Hengel, S K; Hoeben, R C

    2015-03-01

    The capacity to modify the reovirus genome facilitates generation of new therapeutic reoviruses. We describe a method for generating replication-competent reoviruses carrying a heterologous transgene. The strategy is based on the expanded-tropism reovirus mutant jin-3, which can infect cells independent of the reovirus receptor junction-adhesion molecule A (JAM-A). Jin-3 harbors a mutation in the S1 segment, resulting in a G196R substitution in the tail of the spike protein ?1. The use of the jin-3 tail-encoding S1 segment allows replacing the codons for the JAM-A-binding head domain by up to 522? nucleotides of foreign sequences, without exceeding the size of the wild-type S1 segment. We inserted the codons for the porcine teschovirus-1 2A element fused with those encoding the fluorescent protein iLOV. Replicating rS1His-2A-iLOV reoviruses were generated by co-transfection of expression plasmids for all reovirus segments. These reoviruses contain the S1His-2A-iLOV segment in the absence of the wild-type S1 segment. Density-gradient centrifugation confirmed the association of the ?1-tail fragment with the capsid. Both JAM-A-positive and -negative cells exposed to the rS1His-2A-iLOV reoviruses exhibited iLOV fluorescence, confirming the jin-3-derived expanded-tropism phenotype. These data demonstrated the feasibility of generating decapitated replication-competent T3D reoviruses carrying a heterologous transgene. PMID:25588743

  19. Attenuation of Tick-Borne Encephalitis Virus Using Large-Scale Random Codon Re-encoding

    PubMed Central

    de Fabritus, Lauriane; Nougairède, Antoine; Aubry, Fabien; Gould, Ernest A; de Lamballerie, Xavier

    2015-01-01

    Large-scale codon re-encoding (i.e. introduction of a large number of synonymous mutations) is a novel method of generating attenuated viruses. Here, it was applied to the pathogenic flavivirus, tick-borne encephalitis virus (TBEV) which causes febrile illness and encephalitis in humans in forested regions of Europe and Asia. Using an infectious clone of the Oshima 5–10 strain ("wild-type virus"), a cassette of 1.4kb located in the NS5 coding region, was modified by randomly introducing 273 synonymous mutations ("re-encoded virus"). Whilst the in cellulo replicative fitness of the re-encoded virus was only slightly reduced, the re-encoded virus displayed an attenuated phenotype in a laboratory mouse model of non-lethal encephalitis. Following intra-peritoneal inoculation of either 2.105 or 2.106 TCID50 of virus, the frequency of viraemia, neurovirulence (measured using weight loss and appearance of symptoms) and neuroinvasiveness (detection of virus in the brain) were significantly decreased when compared with the wild-type virus. Mice infected by wild-type or re-encoded viruses produced comparable amounts of neutralising antibodies and results of challenge experiments demonstrated that mice previously infected with the re-encoded virus were protected against subsequent infection by the wild-type virus. This constitutes evidence that a mammalian species can be protected against infection by a virulent wild-type positive-stranded RNA virus following immunisation with a derived randomly re-encoded strain. Our results demonstrate that random codon re-encoding is potentially a simple and effective method of generating live-attenuated vaccine candidates against pathogenic flaviviruses. PMID:25734338

  20. The other codons: Nirenberg and the genetic code, 2D animationSite: DNA Interactive (www.dnai.org)

    NSDL National Science Digital Library

    2008-10-06

    After the easy codons, exact triplets had to be made in order to finish deciphering the rest. Marshall Nirenberg and a group of scientists including Maxine Singer, Marianne Grunberg-Manago, Phil Leder were involved in this process. Har Gobind Khorana also worked on this problem.

  1. Orthogonal combinatorial mutagenesis: a codon-level combinatorial mutagenesis method useful for low multiplicity and amino acid-scanning protocols

    Microsoft Academic Search

    Paul Gaytán; Jorge Yáñez; Filiberto Sánchez; Xavier Soberón

    We describe here a method to generate combinatorial libraries of oligonucleotides mutated at the codon- level, with control of the mutagenesis rate so as to create predictable binomial distributions of mutants. The method allows enrichment of the libraries with single, double or larger multiplicity of amino acid replacements by appropriate choice of the mutagenesis rate, depending on the concentration of

  2. Ile to Val polymorphism at codon 655 of HER2 gene and breast cancer risk in Iranian women

    Microsoft Academic Search

    Eskandar Kamali-Sarvestani; Abdol-Rasoul Talei; Ahmad Merat

    2004-01-01

    The earlier reports on the association between the Ile to Val polymorphism at codon 655 of HER-2 and susceptibility to breast cancer has not been found to hold true for all ethnic populations. Two hundred and four cases and 138 controls were collected to investigate the association of HER-2 Ile655Val polymorphism with the risk of breast cancer development and progression

  3. CODON-BASED DETECTION OF POSITIVE SELECTION CAN BE BIASED BY HETEROGENEOUS DISTRIBUTION OF POLAR AMINO ACIDS ALONG PROTEIN

    E-print Network

    Xia, Xuhua

    1 CODON-BASED DETECTION OF POSITIVE SELECTION CAN BE BIASED BY HETEROGENEOUS DISTRIBUTION OF POLAR AMINO ACIDS ALONG PROTEIN SEQUENCES Xuhua Xia Department of Biology, University of Ottawa 30 Marie Curie selection, are associated with a high frequency of polar amino acids with a high mutability

  4. Development of a Premature Stop Codon-detection method based on a bacterial two-hybrid system

    Microsoft Academic Search

    Sebastián M Real; Diego M Marzese; Laura C Gomez; Luis S Mayorga; María Roqué

    2006-01-01

    BACKGROUND: The detection of Premature Stop Codons (PSCs) in human genes is very useful for the genetic diagnosis of different hereditary cancers, e.g. Familial Breast Cancer and Hereditary Non-Polyposis Colorectal Cancer (HNPCC). The products of these PSCs are truncated proteins, detectable in vitro by the Protein Truncation Test and in vivo by using the living translation machinery of yeast or

  5. Reduction of photoresist usage during spin coating

    NASA Astrophysics Data System (ADS)

    Chou, Fu-Chu; Wang, Min-Wen; Gong, Shih-Ching; Yang, Zen-Gi

    2001-04-01

    To reduce the photoresist usage and understand the film spreading process, this study performs flow visualization experiments and numerical simulations. This paper is the first work to show that in the early stage of the spin coating process, the spreading of photoresist is mainly governed by the photoresist injection. Then, instability fingers are formed due to the centrifugal forece. Accompanied by the growing of fingers in length, the Coriolis force broadens the width of the fingers. The numerical results agree with the measured liquid front history at very short times. The difference between the numerical results and experiment data gradually arises due to the formation of instability fingers. The critical injection rate for fully coating a wafer increases with decreasing injection volume. Under a fixed wafer rotating speed, increasing the injection rate can significantly reduce the photoresist usage. To assist in the design and operation of the spin coating process, a regime map for injection rate and injection volume is provided.

  6. Historical review of medicinal plants’ usage

    PubMed Central

    Petrovska, Biljana Bauer

    2012-01-01

    Healing with medicinal plants is as old as mankind itself. The connection between man and his search for drugs in nature dates from the far past, of which there is ample evidence from various sources: written documents, preserved monuments, and even original plant medicines. Awareness of medicinal plants usage is a result of the many years of struggles against illnesses due to which man learned to pursue drugs in barks, seeds, fruit bodies, and other parts of the plants. Contemporary science has acknowledged their active action, and it has included in modern pharmacotherapy a range of drugs of plant origin, known by ancient civilizations and used throughout the millennia. The knowledge of the development of ideas related to the usage of medicinal plants as well as the evolution of awareness has increased the ability of pharmacists and physicians to respond to the challenges that have emerged with the spreading of professional services in facilitation of man's life. PMID:22654398

  7. Space Shuttle Usage of z/OS

    NASA Technical Reports Server (NTRS)

    Green, Jan

    2009-01-01

    This viewgraph presentation gives a detailed description of the avionics associated with the Space Shuttle's data processing system and its usage of z/OS. The contents include: 1) Mission, Products, and Customers; 2) Facility Overview; 3) Shuttle Data Processing System; 4) Languages and Compilers; 5) Application Tools; 6) Shuttle Flight Software Simulator; 7) Software Development and Build Tools; and 8) Fun Facts and Acronyms.

  8. Internet Usage Status among Chinese College Students

    Microsoft Academic Search

    Yan Li

    2008-01-01

    The study was carried out to determine Internet usage status among Chinese college students and how personal differences impact\\u000a students’ online activities. Quantitative research was employed and the findings were descriptive in nature. Results showed\\u000a that the majority (80%) of participating Zhejiang University (ZJU) students (N=596) currently owned PCs. Averagely, they spent\\u000a 3.11 hrs per day using computer, within which

  9. Visualizing Real-Time Network Resource Usage

    Microsoft Academic Search

    Ryan Blue; Cody Dunne; Adam Fuchs; Kyle King; Aaron Schulman

    2008-01-01

    We present NetGrok, a tool for visualizing computer network usage in real-time. NetGrok combines well-known information visualiza- tion techniques—overview, zoom & filter, details on demand—with net- work graph and treemap visualizations. NetGrok integrates these tools with a shared data store that can read PCAP-formatted network traces, capture traces from a live interface, and filter the data set dynamically by bandwidth,

  10. White Paper on Electronic Journal Usage Statistics

    Microsoft Academic Search

    Judy Luther

    2000-01-01

    This paper provides a snapshot of developments in the industry.It identifies issues that concern both publishers and librarians andsuggests a context for further discussion between the providers andconsumers of electronic journals.Since libraries that host electronic journal content locally face thesame challenges in collecting usage statistics as do publishers, theauthor chose to interview librarians at OhioLINK, Los Alamos NationalLabs, and the

  11. A usage coverage based approach for assessing product family design

    E-print Network

    Paris-Sud XI, Université de

    1 A usage coverage based approach for assessing product family design Jiliang WANG1 , Bernard analyzed the relations between usage context information and the design of products. A usage coverage model scenarios to be covered. The original method is demonstrated on a scale-based product family of jigsaws

  12. A Structural Equation Model for ICT Usage in Higher Education

    ERIC Educational Resources Information Center

    Usluel, Yasemin Kocak; Askar, Petek; Bas, Turgay

    2008-01-01

    This study focuses on Information and Communication Technologies (ICT) usage, which is the indicator of diffusion. A model composed of the variables which can explain ICT usage in Turkish higher education is established and tested within the study. The two dimensions of ICT usage are considered: instructional and managerial. The data collected…

  13. Computer Usage Monitoring for Design and Reliability Tests

    Microsoft Academic Search

    Jie Gu; Nikhil M. Vichare; Ed C. Tinsley; Michael G. Pecht

    2009-01-01

    The usage conditions of a product or system can be monitored and analyzed to provide information to improve the design and qualification of future products. This paper discusses a method to collect and analyze product usage conditions and use this data for product design and testing. A case study of the usage monitoring of commercial computers is presented. Three parameters

  14. File system usage in Windows NT 4.0

    Microsoft Academic Search

    Werner Vogels

    1999-01-01

    We have performed a study of the usage of the Windows NT File System through long-term kernel tracing. Our goal was to provide a new data point with respect to the 1985 and 1991 trace-based File System studies, to investigate the usage details of the Windows NT file system architecture, and to study the overall statistical behavior of the usage

  15. Contrast in Usage of FCAT-Approved Anatomical Terminology Between Members of Two Anatomy Associations in North America

    NSDL National Science Digital Library

    Bradford Martin (Loma Linda University Physical Therapy)

    2009-11-04

    This article describes the outcomes of a AAA survey comparing the frequency of FCAT term usage among HAPS instructors. The survey had already been conducted among AAA members and comparisons between societies were made. An initial reporting of the differences and similarities among societies and anatomy teaching backgrounds are discussed.

  16. Functional Analysis of the Interplay between Translation Termination, Selenocysteine Codon Context, and Selenocysteine Insertion Sequence-binding Protein 2*

    PubMed Central

    Gupta, Malavika; Copeland, Paul R.

    2010-01-01

    A selenocysteine insertion sequence (SECIS) element in the 3?-untranslated region and an in-frame UGA codon are the requisite cis-acting elements for the incorporation of selenocysteine into selenoproteins. Equally important are the trans-acting factors SBP2, Sec-tRNA[Ser]Sec, and eEFSec. Multiple in-frame UGAs and two SECIS elements make the mRNA encoding selenoprotein P (Sel P) unique. To study the role of codon context in determining the efficiency of UGA readthrough at each of the 10 rat Sel P Sec codons, we individually cloned 27-nucleotide-long fragments representing each UGA codon context into a luciferase reporter construct harboring both Sel P SECIS elements. Significant differences, spanning an 8-fold range of UGA readthrough efficiency, were observed, but these differences were dramatically reduced in the presence of excess SBP2. Mutational analysis of the “fourth base” of contexts 1 and 5 revealed that only the latter followed the established rules for hierarchy of translation termination. In addition, mutations in either or both of the Sel P SECIS elements resulted in differential effects on UGA readthrough. Interestingly, even when both SECIS elements harbored a mutation of the core region required for Sec incorporation, context 5 retained a significantly higher level of readthrough than context 1. We also show that SBP2-dependent Sec incorporation is able to repress G418-induced UGA readthrough as well as eRF1-induced stimulation of termination. We conclude that a large codon context forms a cis-element that works together with Sec incorporation factors to determine readthrough efficiency. PMID:17954931

  17. Directional next-generation RNA sequencing and examination of premature termination codon mutations in endoglin/hereditary haemorrhagic telangiectasia.

    PubMed

    Govani, F S; Giess, A; Mollet, I G; Begbie, M E; Jones, M D; Game, L; Shovlin, C L

    2013-04-01

    Hereditary haemorrhagic telangiectasia (HHT) is a disease characterised by abnormal vascular structures, and most commonly caused by mutations in ENG, ACVRL1 or SMAD4 encoding endothelial cell-expressed proteins involved in TGF-? superfamily signalling. The majority of mutations reported on the HHT mutation database are predicted to lead to stop codons, either due to frameshifts or direct nonsense substitutions. The proportion is higher for ENG (67%) and SMAD4 (65%) than for ACVRL1 (42%), p < 0.0001. Here, by focussing on ENG, we report why conventional views of these mutations may need to be revised. Of the 111 stop codon-generating ENG mutations, on ExPASy translation, all except one were premature termination codons (PTCs), sited at least 50-55 bp upstream of the final exon-exon boundary of the main endoglin isoform, L-endoglin. This strongly suggests that the mutated RNA species will undergo nonsense-mediated decay. We provide new in vitro expression data to support dominant negative activity of stable truncated endoglin proteins but suggest these will not generate HHT: the single natural stop codon mutation in L-endoglin (sited within 50-55 nucleotides of the final exon-exon boundary) is unlikely to generate functional protein since it replaces the entire transmembrane domain, as would 8 further natural stop codon mutations, if the minor S-endoglin isoform were implicated in HHT pathogenesis. Finally, next-generation RNA sequencing data of 7 different RNA libraries from primary human endothelial cells demonstrate that multiple intronic regions of ENG are transcribed. The potential consequences of heterozygous deletions or duplications of such regions are discussed. These data support the haploinsufficiency model for HHT pathogenesis, explain why final exon mutations have not been detected to date in HHT, emphasise the potential need for functional examination of non-PTC-generating mutations, and lead to proposals for an alternate stratification system of mutational types for HHT genotype-phenotype correlations. PMID:23801935

  18. Adolescents’ Attitudes toward Anti-marijuana Ads, Usage Intentions, and Actual Marijuana Usage

    PubMed Central

    Alvaro, Eusebio M.; Crano, William D.; Siegel, Jason T.; Hohman, Zachary; Johnson, Ian; Nakawaki, Brandon

    2015-01-01

    The association of adolescents’ appraisals of the anti-marijuana television ads used in the National Youth Anti-drug Media Campaign with future marijuana use was investigated. The 12 to 18 year old respondents (N = 2993) were first classified as users, resolute nonusers, or vulnerable nonusers (Crano, Siegel, Alvaro, Lac, & Hemovich, 2008). Usage status and the covariates of gender, age, and attitudes toward marijuana were used to predict attitudes toward the ads (Aad) in the first phase of a multi-level linear analysis. All covariates were significantly associated with Aad, as was usage status: resolute nonusers evaluated the ads significantly more positively than vulnerable nonusers and users (all p < .001), who did not differ. In the second phase, the covariates along with Aad and respondents’ usage status predicted intentions and actual usage one year after initial measurement. The lagged analysis disclosed negative associations between Aad and usage intentions, and between Aad and actual marijuana use (both p < .05); however, this association held only for users (p < .01), not vulnerable or resolute nonusers. Users reporting more positive attitudes towards the ads were less likely to report intention to use marijuana and to continue marijuana use at 1-year follow-up. These findings may inform designers of persuasion-based prevention campaigns, guiding pre-implementation efforts in the design of ads that targeted groups find appealing and thus, influential. PMID:23528197

  19. The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

    PubMed Central

    Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

    2015-01-01

    ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of ?-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

  20. Enhanced purification and characterization of the PfeIF4A (PfH45) helicase from Plasmodium falciparum using a codon-optimised clone.

    PubMed

    Evans, Luke; Gowers, Darren; Firman, Keith; Youell, James

    2012-09-01

    With the intention of investigating the DNA strand displacement properties of Plasmodium falciparum helicase PfeIF4A (formerly known as PfH45) a codon-optimized gene for expression in Escherichia coli has been produced. Several histidine-containing proteins with intrinsic helicase activity were captured from the bacterial sonicate by initial Ni(2+)-chromatography. Heparin and size-exclusion steps were subsequently required for unambiguous PfeIF4A purification. This strategy generated an active recombinant protein of significantly improved yield in comparison to previously published studies (~4.2 mg/g wet weight of cells). Helicase unwinding assays confirmed a bipolar activity, but revealed a preference for unwinding a free 3'-end, with a rate of displacement in the 3'-5' direction 2-fold higher than that in the 5'-3' direction. DNA constructs with two, three or four blunt ends were not unwound. Studies confirmed the enzyme to be Mg(2+)-dependent, optimally active at 37°C and had a background ATP turnover rate of 23.16±1.74 pmol/min, which in the presence of single- or double-stranded DNA doubled to 42.92±3.21 pmol/min. PMID:22750398

  1. An assessment of worldwide supercomputer usage

    SciTech Connect

    Wasserman, H.J.; Simmons, M.L.; Hayes, A.H.

    1995-01-01

    This report provides a comparative study of advanced supercomputing usage in Japan and the United States as of Spring 1994. It is based on the findings of a group of US scientists whose careers have centered on programming, evaluating, and designing high-performance supercomputers for over ten years. The report is a follow-on to an assessment of supercomputing technology in Europe and Japan that was published in 1993. Whereas the previous study focused on supercomputer manufacturing capabilities, the primary focus of the current work was to compare where and how supercomputers are used. Research for this report was conducted through both literature studies and field research in Japan.

  2. Better Living Through Metadata: Examining Archive Usage

    NASA Astrophysics Data System (ADS)

    Becker, G.; Winkelman, S.; Rots, A.

    2013-10-01

    The primary purpose of an observatory's archive is to provide access to the data through various interfaces. User interactions with the archive are recorded in server logs, which can be used to answer basic questions like: Who has downloaded dataset X? When did she do this? Which tools did she use? The answers to questions like these fill in patterns of data access (e.g., how many times dataset X has been downloaded in the past three years). Analysis of server logs provides metrics of archive usage and provides feedback on interface use which can be used to guide future interface development. The Chandra X-ray Observatory is fortunate in that a database to track data access and downloads has been continuously recording such transactions for years; however, it is overdue for an update. We will detail changes we hope to effect and the differences the changes may make to our usage metadata picture. We plan to gather more information about the geographic location of users without compromising privacy; create improved archive statistics; and track and assess the impact of web “crawlers” and other scripted access methods on the archive. With the improvements to our download tracking we hope to gain a better understanding of the dissemination of Chandra's data; how effectively it is being done; and perhaps discover ideas for new services.

  3. Usage analysis of user files in UNIX

    NASA Technical Reports Server (NTRS)

    Devarakonda, Murthy V.; Iyer, Ravishankar K.

    1987-01-01

    Presented is a user-oriented analysis of short term file usage in a 4.2 BSD UNIX environment. The key aspect of this analysis is a characterization of users and files, which is a departure from the traditional approach of analyzing file references. Two characterization measures are employed: accesses-per-byte (combining fraction of a file referenced and number of references) and file size. This new approach is shown to distinguish differences in files as well as users, which cam be used in efficient file system design, and in creating realistic test workloads for simulations. A multi-stage gamma distribution is shown to closely model the file usage measures. Even though overall file sharing is small, some files belonging to a bulletin board system are accessed by many users, simultaneously and otherwise. Over 50% of users referenced files owned by other users, and over 80% of all files were involved in such references. Based on the differences in files and users, suggestions to improve the system performance were also made.

  4. Maternal Control Strategies, Maternal Language Usage and Children's Language Usage at Two Years

    ERIC Educational Resources Information Center

    Taylor, Nicole; Donovan, Wilberta; Miles, Sally; Leavitt, Lewis

    2009-01-01

    The present study determined whether parenting style, defined by control strategies varying in power-assertion mediated the established relation between maternal language usage (grammar and semantics) and child language (grammar, semantics and pragmatics) during toddlerhood (n = 60). Based upon their use of control strategies mothers were…

  5. Codon-optimized glucoamylase sGAI of Aspergillus awamori improves starch utilization in an industrial yeast.

    PubMed

    Favaro, Lorenzo; Jooste, Tania; Basaglia, Marina; Rose, Shaunita H; Saayman, Maryna; Görgens, Johann F; Casella, Sergio; van Zyl, Willem H

    2012-08-01

    The development of a yeast that converts raw starch to ethanol in one step (called consolidated bioprocessing) could yield large cost reductions in the bioethanol industry. The aim of this study was to develop an efficient amylolytic Saccharomyces cerevisiae strain suitable for industrial bioethanol production. A native and codon-optimized variant of the Aspergillus awamori glucoamylase gene were expressed in the S. cerevisiae Y294 laboratory strain. Codon optimization resulted to be effective and the synthetic sequence sGAI was then ?-integrated into a S. cerevisiae strain with promising industrial fermentative traits. The mitotically stable recombinant strains showed high enzymatic capabilities both on soluble and raw starch (2425 and 1140 nkat/g dry cell weight, respectively). On raw corn starch, the engineered yeasts exhibited improved fermentative performance with an ethanol yield of 0.42 (g/g), corresponding to 75 % of the theoretical maximum yield. PMID:22450569

  6. SwiftLib: rapid degenerate-codon-library optimization through dynamic programming.

    PubMed

    Jacobs, Timothy M; Yumerefendi, Hayretin; Kuhlman, Brian; Leaver-Fay, Andrew

    2015-03-11

    Degenerate codon (DC) libraries efficiently address the experimental library-size limitations of directed evolution by focusing diversity toward the positions and toward the amino acids (AAs) that are most likely to generate hits; however, manually constructing DC libraries is challenging, error prone and time consuming. This paper provides a dynamic programming solution to the task of finding the best DCs while keeping the size of the library beneath some given limit, improving on the existing integer-linear programming formulation. It then extends the algorithm to consider multiple DCs at each position, a heretofore unsolved problem, while adhering to a constraint on the number of primers needed to synthesize the library. In the two library-design problems examined here, the use of multiple DCs produces libraries that very nearly cover the set of desired AAs while still staying within the experimental size limits. Surprisingly, the algorithm is able to find near-perfect libraries where the ratio of amino-acid sequences to nucleic-acid sequences approaches 1; it effectively side-steps the degeneracy of the genetic code. Our algorithm is freely available through our web server and solves most design problems in about a second. PMID:25539925

  7. Therapeutic suppression of premature termination codons: Mechanisms and clinical considerations (Review)

    PubMed Central

    KARIJOLICH, JOHN; YU, YI-TAO

    2014-01-01

    An estimated one-third of genetic disorders are the result of mutations that generate premature termination codons (PTCs) within protein coding genes. These disorders are phenotypically diverse and consist of diseases that affect both young and old individuals. Various small molecules have been identified that are capable of modulating the efficiency of translation termination, including select antibiotics of the aminoglycoside family and multiple novel synthetic molecules, including PTC124. Several of these agents have proved their effectiveness at promoting nonsense suppression in preclinical animal models, as well as in clinical trials. In addition, it has recently been shown that box H/ACA RNA-guided peudouridylation, when directed to modify PTCs, can also promote nonsense suppression. In this review, we summarize our current understanding of eukaryotic translation termination and discuss various methods for promoting the read-through of disease-causing PTCs, as well as the current obstacles that stand in the way of using the discussed agents broadly in clinical practice. PMID:24939317

  8. Correction of Methylmalonic Aciduria In Vivo Using a Codon-Optimized Lentiviral Vector

    PubMed Central

    Wong, Edward S.Y.; McIntyre, Chantelle; Peters, Heidi L.; Ranieri, Enzo; Anson, Donald S.

    2014-01-01

    Abstract Methylmalonic aciduria is a rare disorder of organic acid metabolism with limited therapeutic options, resulting in high morbidity and mortality. Positive results from combined liver/kidney transplantation suggest, however, that metabolic sink therapy may be efficacious. Gene therapy offers a more accessible approach for the treatment of methylmalonic aciduria than organ transplantation. Accordingly, we have evaluated a lentiviral vector–mediated gene transfer approach in an in vivo mouse model of methylmalonic aciduria. A mouse model of methylmalonic aciduria (Mut?/?MUTh2) was injected intravenously at 8 weeks of age with a lentiviral vector that expressed a codon-optimized human methylmalonyl coenzyme A mutase transgene, HIV-1SDmEF1?murSigHutMCM. Untreated Mut?/?MUTh2 and normal mice were used as controls. HIV-1SDmEF1?murSigHutMCM-treated mice achieved near-normal weight for age, and Western blot analysis demonstrated significant methylmalonyl coenzyme A enzyme expression in their livers. Normalization of liver methylmalonyl coenzyme A enzyme activity in the treated group was associated with a reduction in plasma and urine methylmalonic acid levels, and a reduction in the hepatic methylmalonic acid concentration. Administration of the HIV-1SDmEF1?murSigHutMCM vector provided significant, although incomplete, biochemical correction of methylmalonic aciduria in a mouse model, suggesting that gene therapy is a potential treatment for this disorder. PMID:24568291

  9. Correction of methylmalonic aciduria in vivo using a codon-optimized lentiviral vector.

    PubMed

    Wong, Edward S Y; McIntyre, Chantelle; Peters, Heidi L; Ranieri, Enzo; Anson, Donald S; Fletcher, Janice M

    2014-06-01

    Methylmalonic aciduria is a rare disorder of organic acid metabolism with limited therapeutic options, resulting in high morbidity and mortality. Positive results from combined liver/kidney transplantation suggest, however, that metabolic sink therapy may be efficacious. Gene therapy offers a more accessible approach for the treatment of methylmalonic aciduria than organ transplantation. Accordingly, we have evaluated a lentiviral vector-mediated gene transfer approach in an in vivo mouse model of methylmalonic aciduria. A mouse model of methylmalonic aciduria (Mut(-/-)MUT(h2)) was injected intravenously at 8 weeks of age with a lentiviral vector that expressed a codon-optimized human methylmalonyl coenzyme A mutase transgene, HIV-1SDmEF1?murSigHutMCM. Untreated Mut(-/-)MUT(h2) and normal mice were used as controls. HIV-1SDmEF1?murSigHutMCM-treated mice achieved near-normal weight for age, and Western blot analysis demonstrated significant methylmalonyl coenzyme A enzyme expression in their livers. Normalization of liver methylmalonyl coenzyme A enzyme activity in the treated group was associated with a reduction in plasma and urine methylmalonic acid levels, and a reduction in the hepatic methylmalonic acid concentration. Administration of the HIV-1SDmEF1?murSigHutMCM vector provided significant, although incomplete, biochemical correction of methylmalonic aciduria in a mouse model, suggesting that gene therapy is a potential treatment for this disorder. PMID:24568291

  10. Mechanisms of the tRNA wobble cytidine modification essential for AUA codon decoding in prokaryotes.

    PubMed

    Numata, Tomoyuki

    2015-01-01

    Bacteria and archaea have 2-lysylcytidine (L or lysidine) and 2-agmatinylcytidine (agm(2)C or agmatidine), respectively, at the first (wobble) position of the anticodon of the AUA codon-specific tRNA(Ile). These lysine- or agmatine-conjugated cytidine derivatives are crucial for the precise decoding of the genetic code. L is synthesized by tRNA(Ile)-lysidine synthetase (TilS), which uses l-lysine and ATP as substrates. Agm(2)C formation is catalyzed by tRNA(Ile)-agm(2)C synthetase (TiaS), which uses agmatine and ATP for the reaction. Despite the fact that TilS and TiaS synthesize structurally similar cytidine derivatives, these enzymes belong to non-related protein families. Therefore, these enzymes modify the wobble cytidine by distinct catalytic mechanisms, in which TilS activates the C2 carbon of the wobble cytidine by adenylation, while TiaS activates it by phosphorylation. In contrast, TilS and TiaS share similar tRNA recognition mechanisms, in which the enzymes recognize the tRNA acceptor stem to discriminate tRNA(Ile) and tRNA(Met). PMID:25348586

  11. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences. PMID:25491390

  12. SwiftLib: rapid degenerate-codon-library optimization through dynamic programming

    PubMed Central

    Jacobs, Timothy M.; Yumerefendi, Hayretin; Kuhlman, Brian; Leaver-Fay, Andrew

    2015-01-01

    Degenerate codon (DC) libraries efficiently address the experimental library-size limitations of directed evolution by focusing diversity toward the positions and toward the amino acids (AAs) that are most likely to generate hits; however, manually constructing DC libraries is challenging, error prone and time consuming. This paper provides a dynamic programming solution to the task of finding the best DCs while keeping the size of the library beneath some given limit, improving on the existing integer-linear programming formulation. It then extends the algorithm to consider multiple DCs at each position, a heretofore unsolved problem, while adhering to a constraint on the number of primers needed to synthesize the library. In the two library-design problems examined here, the use of multiple DCs produces libraries that very nearly cover the set of desired AAs while still staying within the experimental size limits. Surprisingly, the algorithm is able to find near-perfect libraries where the ratio of amino-acid sequences to nucleic-acid sequences approaches 1; it effectively side-steps the degeneracy of the genetic code. Our algorithm is freely available through our web server and solves most design problems in about a second. PMID:25539925

  13. Synonymous Codon Bias Is Not Caused by Mutation Bias in G1C-Rich Genes in Humans

    Microsoft Academic Search

    Nick G. C. Smith; Adam Eyre-Walker

    It is has been suggested that synonymous codon bias is a consequence of mutation bias in mammals. We tested this hypothesis in humans using single-nucleotide polymorphism data. We found a pattern of polymorphism which was inconsistent with the mutation bias hypothesis in G1C-rich genes. However, the data were consistent with the action of natural selection or biased gene conversion. Similar

  14. Chloroplast ribosomal S14 protein transcript is edited to create a translation initiation codon in the moss Physcomitrella patens

    Microsoft Academic Search

    Yuki Miyata; Chika Sugiura; Yuki Kobayashi; Mitsuru Hagiwara; Mamoru Sugita

    2002-01-01

    The rps14 transcript is edited in the moss Physcomitrella patens chloroplast by a C-to-U transition, to create a translation initiation codon, AUG. The efficiency of RNA editing was low, with ?20% of rps14 transcripts edited. This suggests that the translation of rps14 mRNA is strictly regulated by RNA editing. This is the first report of RNA editing in P. patens

  15. Four-base codon mediated mRNA display to construct peptide libraries that contain multiple nonnatural amino acids

    Microsoft Academic Search

    Norihito Muranaka; Takahiro Hohsaka; Masahiko Sisido

    2006-01-01

    In vitro selection and directed evolution of peptides from mRNA display are powerful strategies to find novel peptide ligands that bind to target bio- molecules. In this study, we expanded the mRNA display method to include multiple nonnatural amino acids by introducing three different four- base codons at a randomly selected single position on the mRNA. Another nonnatural amino acid

  16. Severe nemaline myopathy caused by mutations of the stop codon of the skeletal muscle alpha actin gene ( ACTA1)

    Microsoft Academic Search

    William Wallefeld; Sabine Krause; Kristen J. Nowak; Danielle Dye; Rita Horváth; Zoltán Molnár; Miklós Szabó; Kazuhiro Hashimoto; Cristina Reina; Jose De Carlos; Jordi Rosell; Ana Cabello; Carmen Navarro; Ichizo Nishino; Hanns Lochmüller; Nigel G. Laing

    2006-01-01

    Most nemaline myopathy patients have mutations in the nebulin (NEB) or skeletal muscle ?-actin (ACTA1) genes. Here we report for the first time three patients with severe nemaline myopathy and mutations of the ACTA1 stop codon: TAG>TAT (tyrosine), TAG>CAG (glutamine) and TAG>TGG (tryptophan). All three mutations will cause inclusion of an additional 47 amino acids, translated from the 3? UTR

  17. Discrimination of 5?-terminal start codons by translation initiation factor 3 is mediated by ribosomal protein S1

    Microsoft Academic Search

    Isabella Moll; Armin Resch; Udo Bläsi

    1998-01-01

    The interrelation between ribosomal protein S1 and IF3 in recognition\\/discrimination of 5?-terminal start codons by 30S ribosomes has been studied using in vitro toeprinting. The study has been performed with two naturally occurring leaderless mRNAs, ? cI and phage r1t rro mRNA, as well as with an artificial leaderless mRNA derived from the E. coli ompA gene. We show that

  18. Use of genotypic selection to detect P53 codon 273 CGT>CTT transversion: Application to an occupationally exposed population

    Microsoft Academic Search

    T. Carton; X. D. Tan; P. Hartemann; M. Joyeux

    2007-01-01

    CGT>CTT transversion in codon 273 of the P53 tumor-suppressor gene is one of the major mutations detected in human tumors. Within an epidemiological framework, we investigated the use of a genotypic selection method to measure this point mutation. The allele-specific polymerase chain reaction (AS-PCR) that was developed was able to detect 10 mutant copies of the gene among a total

  19. Leaky termination at premature stop codons antagonizes nonsense-mediated mRNA decay in S. cerevisiae

    E-print Network

    Bedwell, David M.

    constructs. The [PSI+ ] state is caused by a prion form of the polypeptide chain release factor eRF3 of a single class I release factor (eRF1) that recognizes all three stop codons (UAG, UAA, and UGA; Bertram et al. 2001; Kisselev et al. 2003). A class II release factor (eRF3) forms a complex with eRF1

  20. Apolipoprotein A-I deficiency due to a codon 84 nonsense mutation of the apolipoprotein A-I gene

    SciTech Connect

    Matsunaga, Tomoyuki; Yanagi, Hisako; Hattori, Naoko; Yamakawa, Kimiko; Yamanouchi, Yasuko; Hamaguchi, Hideo (Univ. of Tsukuba (Japan)); Hiasa, Yoshikazu; Maeda, Toshihiro (Komatsushima Red Cross Hospital (Japan)); Tanaka, Isao; Obara, Takashi (Eisai Co., Ltd., Tsukuba (Japan))

    1991-04-01

    The molecular genetic defect of a female patient with apolipoprotein A-I (apoA-I) deficiency and premature atherosclerosis was examined. Her parents were first cousins. Her plasma density fraction from 1.063 to 1.21 g/ml contained no apoA-I on SDS/PAGE and no measurable high density lipoprotein cholesterol. Southern blot hybridization showed no gross abnormality to be present in the patient's apoA-I gene and homozygosity for a haplotype of restriction fragment length polymorphisms in the apoA-I gene region. Sequencing after amplification by PCR revealed a codon 84 nonsense mutation (CAG {r arrow} TAG, Gln {r arrow} stop) of exon 4 and a codon 37 missense mutation (GCC{r arrow} ACC, Ala {r arrow} Thr) of exon 3 in the patient's apoA-I gene. The data from dot-blot hybridization with allele-specific oligonucleotide probes indicated that she was homozygous for the apoA-I gene with regard to the two mutations. The codon 37 missense mutation was also detected in the apoA-I gene of 6 out of 60 controls, who all had normal levels of apoA-I and high density lipoprotein cholesterol, suggesting that the missense mutation is polymorphic and not associated with apoA-I deficiency. These finding indicate that homozygosity for the apoA-I gene with codon 84 nonsense mutation causes the deficiency of apoA-I and of high density lipoprotein cholesterol in the patient.

  1. A start codon CMT1X mutation associated with transient encephalomyelitis causes complete loss of Cx32.

    PubMed

    Sargiannidou, Irene; Kim, Gun-Ha; Kyriakoudi, Styliana; Eun, Baik-Lin; Kleopa, Kleopas A

    2015-07-01

    X-linked Charcot-Marie-Tooth disease (CMTX1) results from numerous mutations in the GJB1 gene encoding the gap junction protein connexin32 (Cx32) and is one of the commonest forms of inherited neuropathy. Owing to the expression of Cx32 not only in Schwann cells but also in oligodendrocytes, a subset of CMT1X patients develops central nervous system (CNS) clinical manifestations in addition to peripheral neuropathy. While most GJB1 mutations appear to cause peripheral neuropathy through loss of Cx32 function, the cellular mechanisms underlying the CNS manifestations remain controversial. A novel start codon GJB1 mutation (p.Met1Ile) has been found in a CMT1X patient presenting with recurrent episodes of transient encephalomyelitis without apparent signs of peripheral neuropathy. In order to clarify the functional consequences of this mutation, we examined the cellular expression of two different constructs cloned from genomic DNA including the mutated start codon. None of the cloned constructs resulted in detectable expression of Cx32 by immunocytochemistry or immunoblot, although mRNA was produced at normal levels. Furthermore, co-expression with the other major oligodendrocyte connexin, Cx47, had no negative effect on GJ formation by Cx47. Finally, lysosomal and proteasomal inhibition in cells expressing the start codon mutant constructs failed to recover any detection of Cx32 as a result of impaired protein degradation. Our results indicate that the Cx32 start codon mutation is equivalent to a complete loss of the protein with failure of translation, although transcription is not impaired. Thus, complete loss of Cx32 function is sufficient to produce CNS dysfunction with clinical manifestations. PMID:25771809

  2. tRNA(2Gln) mutants that translate the CGA arginine codon as glutamine in Escherichia coli.

    PubMed

    Tsai, F; Curran, J F

    1998-12-01

    We present a novel missense suppression system for the selection of tRNA(2GIn) mutants that can efficiently translate the CGA (arginine) codon as glutamine. tRNA(2Gln) mutants were cloned from a partially randomized synthetic gene pool using a plasmid vector that simultaneously expresses the tRNA gene and, to ensure efficient aminoacylation, the glutamine aminoacyl-tRNA synthetase gene (glnS). tRNA mutants that insert glutamine at CGA were selected as missense suppressors of a lacZ mutant (lacZ625(CGA)) that contains CGA substituted for an essential glutamine codon. Preliminary characterizations of four suppressors is presented. All of them contain two anticodon mutations: C-->U at position 34 and U-->C at position 35, which allow for cognate translation of CGA. U35 was previously shown to be an important determinant for glutaminylation of tRNA(2Gln) in vitro; suppression in vivo requires overexpression of the glutaminyl-tRNA synthetase gene (glnS). One tRNA variant contains no further mutations and has the highest missense suppression activity (8%). Three other isolates each contain an additional point mutation that alters suppression efficiency. This system will be useful for further studies of tRNA structure and function. In addition, because relatively efficient translation of the rare CGA codon as glutamine is not toxic for Escherichia coli, it may be possible to translate this sense codon with other alternate meanings, a property which could greatly facilitate protein engineering. PMID:9848650

  3. The cloning and sequence analysis of the aspC and tyrB genes from Escherichia coli K12. Comparison of the primary structures of the aspartate aminotransferase and aromatic aminotransferase of E. coli with those of the pig aspartate aminotransferase isoenzymes.

    PubMed Central

    Fotheringham, I G; Dacey, S A; Taylor, P P; Smith, T J; Hunter, M G; Finlay, M E; Primrose, S B; Parker, D M; Edwards, R M

    1986-01-01

    In this paper we describe the cloning and sequence analysis of the tyrB and aspC genes from Escherichia coli K12, which encode the aromatic aminotransferase and aspartate aminotransferase respectively. The tyrB gene was isolated from a cosmid carrying the nearby dnaB gene, identified by its ability to complement a dnaB lesion. Deletion and linker insertion analysis located the tyrB gene to a 1.7-kilobase NruI-HindIII-digest fragment. Sequence analysis revealed a gene encoding a 43 000 Da polypeptide. The gene starts with a GTG codon and is closely followed by a structure resembling a rho independent terminator. The aspC gene was cloned by screening gene banks, prepared from a prototrophic E. coli K12 strain, for plasmids able to complement the aspC tyrB lesions in the aminotransferase-deficient strain HW225. Sub-cloning and deletion analysis located the aspC gene on a 1.8-kilobase HincII-StuI-digest fragment. Sequence analysis revealed the presence of a gene encoding a 43 000 Da protein, the sequence of which is identical with that previously obtained for the aspartate aminotransferase from E. coli B. Considerable overproduction of the two enzymes was demonstrated. We compared the deduced protein sequences with those of the pig mitochondrial and cytoplasmic aspartate aminotransferases. From the extensive homology observed we are able to propose that the two E. coli enzymes possess subunit structures, subunit interactions and coenzyme-binding and substrate-binding sites that are very similar both to each other and to those of the mammalian enzymes and therefore must also have very similar catalytic mechanisms. Comparison of the aspC and tyrB gene sequences reveals that they appear to have diverged as much as is possible within the constraints of functionality and codon usage. PMID:3521591

  4. Transforming growth factor-beta1 polymorphisms in patients with brucellosis: an association between codon 10 and 25 polymorphisms and brucellosis.

    PubMed

    Rafiei, A; Hajilooi, M; Shakib, R J; Alavi, S A

    2007-01-01

    This study examined the association between transforming growth factor (TGF)-beta1 polymorphisms and brucellosis. The TGF-beta1 genotypes at codons 10 and 25 were determined by an amplification refractory mutation system-PCR among 425 brucellosis patients and 213 healthy volunteers. The frequencies of TGF-beta1 codons 10 C and 25 G were significantly higher among patients than among controls, as was that of TGF-beta1 codon 10 C/C. The high-producer haplotype (CG/TG) was more frequent among patients than among controls. The findings suggest that genetic polymorphism in codons 10 and 25 of the TGF-beta1 gene might contribute to the development of brucellosis. PMID:17184296

  5. Codon 249 mutation in exon 7 of p53 gene in plasma DNA: maybe a new early diagnostic marker of hepatocellular carcinoma in Qidong risk area, China

    Microsoft Academic Search

    Xing-Hua Huang; Lu-Hong Sun; Dong-Dong Lu; Yan Sun; Li-Jie Ma; Xi-Ran Zhang; Jian Huang; Long Yu; Qidong Liver Cancer

    2003-01-01

    AIM: One of the characteristics of hepatocellular carcinoma (HCC) in Qidong area is the selective mutation resulting in a serine substitution at codon 249 of the p53 gene (1, 20), and it has been identified as a \\

  6. Identification of the initiation codon for the atpB gene in Chlamydomonas chloroplasts excludes translation of a precursor form of the beta subunit of the ATP synthase.

    PubMed

    Rimbault, B; Esposito, D; Drapier, D; Choquet, Y; Stern, D; Wollman, F A

    2000-11-01

    The chloroplast atpB gene of Chlamydomonas reinhardtii, which encodes the beta subunit of the ATP synthase, contains three in-frame ATGs that are candidate translation initiation codons. An earlier study revealed that the N terminus of the assembled beta subunit maps at the +2 position with respect to the second in-frame methionine codon (Fiedler et al. 1995). Using chloroplast transformation, we have examined the possibility that either of the two additional in-frame ATG codons is competent for translation initiation. We provide evidence that translation of atpB is initiated exclusively at the second ATG codon. We conclude that the beta subunit is not synthesized with an N-terminal leader before its assembly into a functional ATP synthase complex. PMID:11129053

  7. The highly conserved codon following the slippery sequence supports -1 frameshift efficiency at the HIV-1 frameshift site.

    PubMed

    Mathew, Suneeth F; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S; McKinney, Cushla; Poole, Elizabeth S; Tate, Warren P

    2015-01-01

    HIV-1 utilises -1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating -1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the 'intercodon') contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules-eRF1 protein or a cognate suppressor tRNA-were able to access and decode the intercodon prior to -1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  8. Translational Initiation at a Non-AUG Start Codon for Human and Mouse Negative Elongation Factor-B

    PubMed Central

    Pan, Haihui; Zhao, Xiayan; Zhang, Xiaowen; Abouelsoud, Mohamed; Sun, Jianlong; April, Craig; Amleh, Asma; Fan, Jian-Bing; Hu, Yanfen; Li, Rong

    2015-01-01

    Negative elongation factor (NELF), a four-subunit protein complex in metazoan, plays an important role in regulating promoter-proximal pausing of RNA polymerase II (RNAPII). Genetic studies demonstrate that the B subunit of mouse NELF (NELF-B) is critical for embryonic development and homeostasis in adult tissue. We report here that both human and mouse NELF-B proteins are translated from a non-AUG codon upstream of the annotated AUG. This non-AUG codon sequence is conserved in mammalian NELF-B but not NELF-B orthologs of lower metazoan. The full-length and a truncated NELF-B that starts at the first AUG codon both interact with the other three NELF subunits. Furthermore, these two forms of NELF-B have a similar impact on the transcriptomics and proliferation of mouse embryonic fibroblasts. These results strongly suggest that additional amino acid sequence upstream of the annotated AUG is dispensable for the essential NELF function in supporting cell growth in vitro. The majority of mouse adult tissues surveyed express the full-length NELF-B protein, and some contain a truncated NELF-B protein with the same apparent size as the AUG-initiated version. This result raises the distinct possibility that translational initiation of mouse NELF-B is regulated in a tissue-dependent manner. PMID:26010750

  9. XPC codon 939 polymorphism is associated with susceptibility to DNA damage induced by aflatoxin B1 exposure.

    PubMed

    Long, Xi-Dai; Huang, Hong-Dong; Huang, Xiao-Ying; Yao, Jin-Guang; Xia, Qiang

    2015-01-01

    Aflatoxin B1 (AFB1), resulting in the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-repairing genotypes may experience an increased risk of genotoxicity. This study was aimed to investigate whether DNA repair gene xerodermapigmentosum complementation group C codon 939 polymorphism (rs2228001) affected the levels of AFB1-DNA adducts in Guangxi Population (n = 2558), from an AFB1-exposure area. AFB1-DNA adducts were measured by ELISA, and XPC codon 939 genotypes were identified by TaqMan-PCR. We found that longer AFB1-exposure years significantly increased XPC genotypes with codon 939 Gln alleles (namely, XPC-LG and -GG, odds ratios [95% confidence intervals] were 1.37 (1.15-1.63) and 1.99 (1.55-2.55), respectively) was significantly associated with higher levels of AFB1-DNA adducts. Furthermore, there was a positive joint effect between XPC genotypes and long-year AFB1 exposure in the formation of AFB1-DNA adducts. These results suggest that individuals with susceptible genotypes XPC-LG and -GG may experience an increased risk of DNA damage elicited by AFB1 exposure. PMID:25785113

  10. XPC codon 939 polymorphism is associated with susceptibility to DNA damage induced by aflatoxin B1 exposure

    PubMed Central

    Long, Xi-Dai; Huang, Hong-Dong; Huang, Xiao-Ying; Yao, Jin-Guang; Xia, Qiang

    2015-01-01

    Aflatoxin B1 (AFB1), resulting in the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-repairing genotypes may experience an increased risk of genotoxicity. This study was aimed to investigate whether DNA repair gene xerodermapigmentosum complementation group C codon 939 polymorphism (rs2228001) affected the levels of AFB1-DNA adducts in Guangxi Population (n = 2558), from an AFB1-exposure area. AFB1-DNA adducts were measured by ELISA, and XPC codon 939 genotypes were identified by TaqMan-PCR. We found that longer AFB1-exposure years significantly increased XPC genotypes with codon 939 Gln alleles (namely, XPC-LG and -GG, odds ratios [95% confidence intervals] were 1.37 (1.15-1.63) and 1.99 (1.55-2.55), respectively) was significantly associated with higher levels of AFB1-DNA adducts. Furthermore, there was a positive joint effect between XPC genotypes and long-year AFB1 exposure in the formation of AFB1-DNA adducts. These results suggest that individuals with susceptible genotypes XPC-LG and -GG may experience an increased risk of DNA damage elicited by AFB1 exposure. PMID:25785113

  11. Detection of a germline mutation at codon 918 of the RET proto-oncogene in French MEN 2B families.

    PubMed

    Rossel, M; Schuffenecker, I; Schlumberger, M; Bonnardel, C; Modigliani, E; Gardet, P; Navarro, J; Luo, Y; Romeo, G; Lenoir, G

    1995-04-01

    Multiple endocrine neoplasia type 2A (MEN 2A), type 2B (MEN 2B), and familial medullary thyroid carcinoma (FMTC) are three dominantly inherited disorders linked to the same disease locus on chromosome 10. Two types of germline mutation of the RET proto-onco-gene, which codes for a transmembrane tyrosine kinase, are associated with MEN 2. Missense mutations at cysteine residues in the extra-cytoplasmic domain are exclusively associated with MEN 2A and FMTC. In MEN 2B patients, a single point mutation at codon 918 has recently been characterized, leading to the replacement of a methionine by a threonine within the RET tyrosine kinase domain. We now report the identification of a mutation at codon 918 in the germline of 16 patients out of 18 unrelated MEN 2B families analyzed. In these families we have been able to demonstrate that, in five cases, the mutation arose de novo, and that, in one kindred, it was coinherited with the disease. These results indicate that a unique mutation at codon 918 of the RET gene is the most prevalent genetic defect causing MEN 2B, but also that rare MEN 2B cases are associated with different mutations yet to be defined. PMID:7705835

  12. The Highly Conserved Codon following the Slippery Sequence Supports ?1 Frameshift Efficiency at the HIV-1 Frameshift Site

    PubMed Central

    Mathew, Suneeth F.; Crowe-McAuliffe, Caillan; Graves, Ryan; Cardno, Tony S.; McKinney, Cushla; Poole, Elizabeth S.; Tate, Warren P.

    2015-01-01

    HIV-1 utilises ?1 programmed ribosomal frameshifting to translate structural and enzymatic domains in a defined proportion required for replication. A slippery sequence, U UUU UUA, and a stem-loop are well-defined RNA features modulating ?1 frameshifting in HIV-1. The GGG glycine codon immediately following the slippery sequence (the ‘intercodon’) contributes structurally to the start of the stem-loop but has no defined role in current models of the frameshift mechanism, as slippage is inferred to occur before the intercodon has reached the ribosomal decoding site. This GGG codon is highly conserved in natural isolates of HIV. When the natural intercodon was replaced with a stop codon two different decoding molecules—eRF1 protein or a cognate suppressor tRNA—were able to access and decode the intercodon prior to ?1 frameshifting. This implies significant slippage occurs when the intercodon is in the (perhaps distorted) ribosomal A site. We accommodate the influence of the intercodon in a model of frame maintenance versus frameshifting in HIV-1. PMID:25807539

  13. Codon modification for the DNA sequence of a single-chain Fv antibody against clenbuterol and expression in Pichia pastoris.

    PubMed

    Dong, Jie-Xian; Xie, Xi; Hu, Da-Wei; Chen, Shu-Chi; He, Yong-Sheng; Beier, Ross C; Shen, Yu-Dong; Sun, Yuan-Ming; Xu, Zhen-Lin; Wang, Hong; Yang, Jin-Yi

    2014-04-01

    The expression efficiency was improved for the recombinant single-chain variable fragment (scFv) against clenbuterol (CBL) obtained from mouse and expressed in the methylotrophic yeast Pichia pastoris GS115, by redesigning and synthesizing the DNA sequence encoding for CBL-scFv based on the codon bias of P. pastoris. The codons encoding 124 amino acids were optimized, in which a total of 156 nucleotides were changed, and the G+C ratio was simultaneously decreased from 53 to 47.2 %. Under the optimized expression conditions, the yield of the recombinant CBL-scFv (41 kDa) antibodies was 0.223 g L?¹ in shake culture. Compared to the non-optimized control, the expression level of the optimized recombinant CBL-scFv based on preferred codons in P. pastoris demonstrated a 2.35-fold higher yield. Furthermore, the recombinant CBL-scFv was purified by Ni-NTA column chromatography, and the purity was 95 %. The purified CBL-scFv showed good CBL recognition by a competitive indirect enzyme-linked immunoassay. The average concentration required for 50 % inhibition of binding and the limit of detection for the assay were 5.82 and 0.77 ng mL?¹, respectively. PMID:24190495

  14. Use of a High-Resolution Melt Assay To Characterize Codon 54 of the cyp51A Gene of Aspergillus fumigatus on a Rotor-Gene 6000 Instrument?

    PubMed Central

    Tuohy, M. J.; Reja, V.; Park, S.; Perlin, D. S.; Wnek, M.; Procop, G. W.; Yen-Lieberman, B.

    2010-01-01

    A high-resolution melt (HRM) assay using a Rotor-Gene 6000 instrument was developed to characterize the codon for glycine 54 in the cyp51A genes from 13 reference isolates and 12 clinical isolates of Aspergillus fumigatus. Mutations in this codon confer reduced susceptibility to itraconazole and posaconazole. The assay is simple to perform, and a result of “wild type” or “mutant” is available after approximately 1 h following DNA extraction using commercially available reagents and conventional primers. PMID:20194699

  15. Life without tRNAArg–adenosine deaminase TadA: evolutionary consequences of decoding the four CGN codons as arginine in Mycoplasmas and other Mollicutes

    PubMed Central

    Yokobori, Shin-ichi; Kitamura, Aya; Grosjean, Henri; Bessho, Yoshitaka

    2013-01-01

    In most bacteria, two tRNAs decode the four arginine CGN codons. One tRNA harboring a wobble inosine (tRNAArgICG) reads the CGU, CGC and CGA codons, whereas a second tRNA harboring a wobble cytidine (tRNAArgCCG) reads the remaining CGG codon. The reduced genomes of Mycoplasmas and other Mollicutes lack the gene encoding tRNAArgCCG. This raises the question of how these organisms decode CGG codons. Examination of 36 Mollicute genomes for genes encoding tRNAArg and the TadA enzyme, responsible for wobble inosine formation, suggested an evolutionary scenario where tadA gene mutations first occurred. This allowed the temporary accumulation of non-deaminated tRNAArgACG, capable of reading all CGN codons. This hypothesis was verified in Mycoplasma capricolum, which contains a small fraction of tRNAArgACG with a non-deaminated wobble adenosine. Subsets of Mollicutes continued to evolve by losing both the mutated tRNAArgCCG and tadA, and then acquired a new tRNAArgUCG. This permitted further tRNAArgACG mutations with tRNAArgGCG or its disappearance, leaving a single tRNAArgUCG to decode the four CGN codons. The key point of our model is that the A-to-I deamination activity had to be controlled before the loss of the tadA gene, allowing the stepwise evolution of Mollicutes toward an alternative decoding strategy. PMID:23658230

  16. Proteomics-based Refinement of Deinococcus deserti Genome Annotation Reveals an Unwonted Use of Non-canonical Translation Initiation Codons*

    PubMed Central

    Baudet, Mathieu; Ortet, Philippe; Gaillard, Jean-Charles; Fernandez, Bernard; Guérin, Philippe; Enjalbal, Christine; Subra, Gilles; de Groot, Arjan; Barakat, Mohamed; Dedieu, Alain; Armengaud, Jean

    2010-01-01

    Deinococcaceae are a family of extremely radiation-tolerant bacteria that are currently subjected to numerous studies aimed at understanding the molecular mechanisms for such radiotolerance. To achieve a comprehensive and accurate annotation of the Deinococcus deserti genome, we performed an N terminus-oriented characterization of its proteome. For this, we used a labeling reagent, N-tris(2,4,6-trimethoxyphenyl)phosphonium acetyl succinimide, to selectively derivatize protein N termini. The large scale identification of N-tris(2,4,6-trimethoxyphenyl)phosphonium acetyl succinimide-modified N-terminal-most peptides by shotgun liquid chromatography-tandem mass spectrometry analysis led to the validation of 278 and the correction of 73 translation initiation codons in the D. deserti genome. In addition, four new genes were detected, three located on the main chromosome and one on plasmid P3. We also analyzed signal peptide cleavages on a genome-wide scale. Based on comparative proteogenomics analysis, we propose a set of 137 corrections to improve Deinococcus radiodurans and Deinococcus geothermalis gene annotations. Some of these corrections affect important genes involved in DNA repair mechanisms such as polA, ligA, and ddrB. Surprisingly, experimental evidences were obtained indicating that DnaA (the protein involved in the DNA replication initiation process) and RpsL (the S12 ribosomal conserved protein) translation is initiated in Deinococcaceae from non-canonical codons (ATC and CTG, respectively). Such use may be the basis of specific regulation mechanisms affecting replication and translation. We also report the use of non-conventional translation initiation codons for two other genes: Deide_03051 and infC. Whether such use of non-canonical translation initiation codons is much more frequent than for other previously reported bacterial phyla or restricted to Deinococcaceae remains to be investigated. Our results demonstrate that predicting translation initiation codons is still difficult for some bacteria and that proteomics-based refinement of genome annotations may be helpful in such cases. PMID:19875382

  17. Usage-Oriented Topic Maps Building Approach

    NASA Astrophysics Data System (ADS)

    Ellouze, Nebrasse; Lammari, Nadira; Métais, Elisabeth; Ben Ahmed, Mohamed

    In this paper, we present a collaborative and incremental construction approach of multilingual Topic Maps based on enrichment and merging techniques. In recent years, several Topic Map building approaches have been proposed endowed with different characteristics. Generally, they are dedicated to particular data types like text, semi-structured data, relational data, etc. We note also that most of these approaches take as input monolingual documents to build the Topic Map. The problem is that the large majority of resources available today are written in various languages, and these resources could be relevant even to non-native speakers. Thus, our work is driven towards a collaborative and incremental method for Topic Map construction from textual documents available in different languages. To enrich the Topic Map, we take as input a domain thesaurus and we propose also to explore the Topic Map usage which means available potential questions related to the source documents.

  18. Analytical expression of the purine/pyrimidine codon probability after and before random mutations.

    PubMed

    Arquès, D G; Michel, C J

    1993-11-01

    Recently, we proposed a new model of DNA sequence evolution (Arquès and Michel. 1990b. Bull. math. Biol. 52, 741-772) according to which actual genes on the purine/pyrimidine (R/Y) alphabet (R = purine = adenine or guanine, Y = pyrimidine = cytosine or thymine) are the result of two successive evolutionary genetic processes: (i) a mixing (independent) process of non-random oligonucleotides (words of base length less than 10: YRY(N)6, YRYRYR and YRYYRY are so far identified; N = R or Y) leading to primitive genes (words of several hundreds of base length) and followed by (ii) a random mutation process, i.e., transformations of a base R (respectively Y) into the base Y (respectively R) at random sites in these primitive genes. Following this model the problem investigated here is the study of the variation of the 8 R/Y codon probabilities RRR, ..., YYY under random mutations. Two analytical expressions solved here allow analysis of this variation in the classical evolutionary sense (from the past to the present, i.e., after random mutations), but also in the inverted evolutionary sense (from the present to the past, i.e., before random mutations). Different properties are also derived from these formulae. Finally, a few applications of these formulae are presented. They prove the proposition in Arquès and Michel (1990b. Bull. math. Biol. 52, 741-772), Section 3.3.2, with the existence of a maximal mean number of random mutations per base of the order 0.3 in the protein coding genes. They also confirm the mixing process of oligonucleotides by excluding the purine/pyrimidine contiguous and alternating tracts from the formation process of primitive genes. PMID:8281128

  19. Gene polymorphism in transforming growth factor-beta codon 10 is associated with susceptibility to Giardiasis.

    PubMed

    Taherkhani, H; Hajilooi, M; Fallah, M; Khyabanchi, O; Haidari, M

    2009-12-01

    Secretory immunoglobulin A (S-IgA) antibodies have a central role in anti-Giardial defence. It has been demonstrated that transforming growth factor-beta1 (TGF-beta1) stimulates B lymphocytes to produce and secrete S-IgA. We sought to determine the association between TGF-beta1 polymorphism (T+869C) with susceptibility to Giardiasis. The TGF-beta1 genotypes and levels of salivary (S-IgA) were analysed in individuals with Giardiasis (97 symptomatic and 57 asymptomatic) and controls (n = 92). Individuals with symptomatic Giardiasis had the lowest levels of S-IgA compared to individuals in asymptomatic Giardiasis and control groups (97%, 73% and 43%, <1 g L(-1), respectively, P = 0.002). The frequency of allele C and CC genotypes of TGF-beta1 polymorphism was significantly higher among symptomatic patients than asymptomatic and control groups. Logistic regression analysis demonstrated that the individuals homozygous for allele C of TGF-beta1 had a significantly higher risk for symptomatic Giardiasis with odds ratio of 2.76 (95% CI: 3.88, 1.71, P = 0.007). Among the participants with TT genotype per cent of individuals with S-IgA level of more than 1 g L(-1) was almost twice the percentage in CC genotype individuals (14% versus 7% respectively P = 0.01). Our data suggest that CC genotype of TGF-beta1 polymorphism at codon 10 is associated with occurrence of Giardiasis. PMID:19703231

  20. Successful expression and purification of DPPD using a codon optimized synthetic gene*

    PubMed Central

    Kashino, Suely S.; Campos-Neto, Antonio

    2012-01-01

    DPPD (Rv0061) is a difficult to express protein of Mycobacterium tuberculosis that elicits strong and specific delayed type hypersensitivity reactions in humans infected with M. tuberculosis. Therefore e DPPD is a molecule that can improve the specificity of the tuberculin skin test, which is widely used as an aid for the diagnosis of tuberculosis. However, a pitfall of our initial studies was that the DPPD molecule used to perform the skin tests was engineered as fusion molecule with another Mycobacterium protein. This approach was used because no expression of DPPD could be achieved either as a single molecule or as a fusion protein using a variety of commercially available expression systems. Here, we report the production and purification of rDPPD using a synthetic gene engineered to contain E. coli codon bias. The gene was cloned into pET14b expression vector, which was subsequently used to transform Rosetta 2(DE3) pLysS or BL-21(DE3)pLysS host cells. The recombinant protein was over-expressed after induction with IPTG and its purification was easily achieved at levels of 5 – 10 mg/l of bacterial broth cultures. The purified protein was confirmed to be DPPD by Mass Spectroscopy sequencing analysis. Moreover, purified rDPPD stimulated peripheral blood mononuclear cells of PPD positive blood donors to produce high levels of IFN-?, thus confirming that this molecule is biologically active. Because of the DPPD gene is restricted to the tuberculosis-complex organisms of Mycobacterium genus, this highly purified molecule should be useful for the identification of individuals sensitized with tubercle bacilli. PMID:23264930

  1. Selective pressures at a codon-level predict deleterious mutations in human disease genes.

    PubMed

    Arbiza, Leonardo; Duchi, Serena; Montaner, David; Burguet, Jordi; Pantoja-Uceda, David; Pineda-Lucena, Antonio; Dopazo, Joaquín; Dopazo, Hernán

    2006-05-19

    Deleterious mutations affecting biological function of proteins are constantly being rejected by purifying selection from the gene pool. The non-synonymous/synonymous substitution rate ratio (omega) is a measure of selective pressure on amino acid replacement mutations for protein-coding genes. Different methods have been developed in order to predict non-synonymous changes affecting gene function. However, none has considered the estimation of selective constraints acting on protein residues. Here, we have used codon-based maximum likelihood models in order to estimate the selective pressures on the individual amino acid residues of a well-known model protein: p53. We demonstrate that the number of residues under strong purifying selection in p53 is much higher than those that are strictly conserved during the evolution of the species. In agreement with theoretical expectations, residues that have been noted to be of structural relevance, or in direct association with DNA, were among those showing the highest signals of purifying selection. Conversely, those changing according to a neutral, or nearly neutral mode of evolution, were observed to be irrelevant for protein function. Finally, using more than 40 human disease genes, we demonstrate that residues evolving under strong selective pressures (omega<0.1) are significantly associated (p<0.01) with human disease. We hypothesize that non-synonymous change on amino acids showing omega<0.1 will most likely affect protein function. The application of this evolutionary prediction at a genomic scale will provide an a priori hypothesis of the phenotypic effect of non-synonymous coding single nucleotide polymorphisms (SNPs) in the human genome. PMID:16584746

  2. Codon optimization of cry1Ab gene for hyper expression in plant organelles.

    PubMed

    Jabeen, Rasheda; Khan, Muhammad Sarwar; Zafar, Yusuf; Anjum, Tehmina

    2010-02-01

    With the advent of genetic manipulation techniques, it has become possible to clone and insert gene into the genome of crop plants to confer resistance to insects and pests. Resistance to insects has been demonstrating in transgenic plants either by triggering defense system of plants or by expressing heterologous cry genes for delta-endotoxins from Bacillus thuringiensis. In the present study, synthetic cry1Ab gene was developed with optimized chloroplast preferred codons and is expressed in tobacco plastid genome called plastome, following chloroplast transformation strategy, which is environment friendly technique to minimize out-crossing of transgenes to related weeds and crops. In addition, due to high polyploidy of plastid genome transformation of chloroplast permits the introduction of thousands of copies of foreign genes per plant cell, leading to extraordinarily high levels of foreign protein expression. The chloroplast transformation technology aims to insert stably into the plastome through homologous recombination into pre-decided position. To characterize the synthetic cry1Ab gene, chloroplast transformation vectors were developed and bombarded to the leaf cells of tobacco plants maintained under aseptic conditions. After bombardment, the drug resistant shoots were selected and regenerated on drug containing regeneration medium. Homoplasmic shoots were recovered after successive rounds of selection and regeneration. Proliferated plants were subjected to genomic DNA analysis by using polymerase chain reaction (PCR) technique where cry1Ab gene-specific primers were used. PCR positive plants were subjected to protein analysis, and functionally expressed proteins were detected using Immuno-Strips specific for cry1Ab/Ac gene products. Transgenic plants carrying cry1Ab gene were found expressing Bt toxins confirming that engineered gene could be expressed in other plants as well. PMID:19757171

  3. File Usage Analysis and Resource Usage Prediction: a Measurement-Based Study. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Devarakonda, Murthy V.-S.

    1987-01-01

    A probabilistic scheme was developed to predict process resource usage in UNIX. Given the identity of the program being run, the scheme predicts CPU time, file I/O, and memory requirements of a process at the beginning of its life. The scheme uses a state-transition model of the program's resource usage in its past executions for prediction. The states of the model are the resource regions obtained from an off-line cluster analysis of processes run on the system. The proposed method is shown to work on data collected from a VAX 11/780 running 4.3 BSD UNIX. The results show that the predicted values correlate well with the actual. The coefficient of correlation between the predicted and actual values of CPU time is 0.84. Errors in prediction are mostly small. Some 82% of errors in CPU time prediction are less than 0.5 standard deviations of process CPU time.

  4. A MOOS MODULE FOR MONITORING ENERGY USAGE OF AUTONOMOUS VEHICLES

    E-print Network

    Idaho, University of

    A MOOS MODULE FOR MONITORING ENERGY USAGE OF AUTONOMOUS VEHICLES Anthony Kanago, Kevin Roos, James--Tracking the energy usage of an autonomous underwater vehicle (AUV) and making accurate data available provides make better decisions regarding resource allocation. I. INTRODUCTION The adoption of autonomous vehicle

  5. A usage control policy specification with Petri nets

    Microsoft Academic Search

    Basel Katt; Michael Hafner; Xinwen Zhang

    2009-01-01

    In this paper we propose a novel usage control policy specification based on Coloured Petri Nets formalism. Recently, usage control has been proposed in order to overcome the shortcomings of transitional access control that fails to meet new security requirements of today's highly dynamic and distributed systems. These new environments require for example (i) a continuity of control, (ii) fulfillment

  6. Query suggestions for mobile search: understanding usage patterns

    Microsoft Academic Search

    Maryam Kamvar; Shumeet Baluja

    2008-01-01

    Entering search terms on mobile phones is a time consuming and cumbersome task. In this paper, we explore the usage patterns of query entry interfaces that display suggestions. Our primary goal is to build a usage model of query suggestions in order to provide user interface guidelines for mobile text prediction interfaces. We find that users who were asked to

  7. Distributed Usage Control Alexander Pretschner, Manuel Hilty, David Basin

    E-print Network

    Basin, David

    in different contexts. For example, healthcare providers, insurance companies, and tax offices collect personal technical challenges here are controlling data access and usage. While the fundamentals of access control, September 2006. 1 #12;In the following, we first describe the fundamentals of usage control; in particular

  8. The Effect of Social Influence on The Bloggers' Usage Intention

    Microsoft Academic Search

    Shu-ming Wang; Judy Chuan-Chuan Lin

    2011-01-01

    Purpose – The objective of this paper is to further explore relationships among social influence, blog platform qualities and usage intention for improving the understanding of the effect that social influence exerts on bloggers' usage intention. Design\\/methodology\\/approach – Based on the IS success model, the authors propose a conceptual framework incorporating information quality, system quality, blog function quality and social

  9. Transportation & Work: Exploring Car Usage and Employment Outcomes

    E-print Network

    Bertini, Robert L.

    Transportation & Work: Exploring Car Usage and Employment Outcomes in the LSAL Data Field Area information on car ownership as well as employment history, literacy proficiency, and measures of social networks. This analysis addresses the role of car usage in employment outcomes such as employment status

  10. A Genetic Algorithm Approach to Focused Software Usage Testing

    E-print Network

    Wu, Annie S.

    A Genetic Algorithm Approach to Focused Software Usage Testing Robert M. Patton, Annie S. Wu Orlando, FL, U.S.A. ABSTRACT Because software system testing typically consists of only a very small the test results from a limited amount of testing based on high-level usage models. It can also be very

  11. KOINOTITES: A Web Usage Mining Tool for Personalization

    E-print Network

    Paliouras, George

    KOINOTITES: A Web Usage Mining Tool for Personalization Dimitrios Pierrakos Inst. of Informatics@iit.demokritos.gr SUMMARY This paper presents the Web Usage Mining system KOINOTITES, which uses data mining techniques for the construction of user communities on the Web. User communities model groups of visitors in a Web site, who have

  12. A Cognitive Radio Approach for Usage of Virtual Unlicensed Spectrum

    Microsoft Academic Search

    Shridhar Mubaraq Mishra; Daniel Willkomm; Robert Brodersen; Adam Wolisz

    2005-01-01

    While essentially all of the frequency spectrum is allocated to different applications, observations provide evidence that usage of the spectrum is actually quite limited, particularly in bands above 3 GHz. In this paper we present a Cognitive Radio approach for usage of Virtual Unlicensed Spectrum (CORVUS), a vision of a Cognitive Radio (CR) based approach that uses allocated spectrum in

  13. Software Dependability Evaluation Based on Markov Usage Models

    E-print Network

    Gutjahr, Walter

    Software Dependability Evaluation Based on Markov Usage Models Walter J. Gutjahr Department for computing optimal state transition probabilities for software tests, based on a Markov usage model; this distribution may also be used in the more general context of structural statistical testing of software

  14. Student Usage of Instructional Technologies: Differences in Online Learning Styles

    Microsoft Academic Search

    Robert M. Ballenger; Dennis M. Garvis

    We contribute to the MIS education literature by empirically examining Web log server data generated by undergraduate students enrolled in multiple sections of a MIS course where an online Learning Management System (LMS) was used to complement a traditional classroom environment. We identify online learning styles by investigating differences in LMS usage pat- terns, finding four distinct usage patterns as

  15. The Increased Bandwidth Fallacy: Performance and Usage in Rural Zambia

    E-print Network

    Belding-Royer, Elizabeth M.

    is in Africa, where the increased fiber- optic capacity [1], coupled with higher-bandwidth, lower- latencyThe Increased Bandwidth Fallacy: Performance and Usage in Rural Zambia Mariya Zheleva, Paul Schmitt and at times unusable. In this paper we study the performance and usage implications of an Internet access

  16. Have you met your organization's computer usage policy?

    Microsoft Academic Search

    Charles B. Foltz; Timothy Paul Cronan; Thomas W. Jones

    2005-01-01

    Purpose – This paper aims to examine the effectiveness of computer usage policies in university settings. Design\\/methodology\\/approach – Students enrolled in business courses at three midwestern universities were divided, by class, into control and experimental groups. All subjects were asked to complete a survey regarding their awareness of university computer usage policies, consequences of misuse, and methods of policy distribution.

  17. Benchmarking Usage Statistics in Collection Management Decisions for Serials

    ERIC Educational Resources Information Center

    Tucker, Cory

    2009-01-01

    Usage statistics are an important metric for making decisions on serials. Although the University of Nevada, Las Vegas (UNLV) Libraries have been collecting usage statistics, the statistics had not frequently been used to make decisions and had not been included in collection development policy. After undergoing a collection assessment, the…

  18. (Not) Hearing Optional Subjects: The Effects of Pragmatic Usage Preferences

    ERIC Educational Resources Information Center

    Mack, Jennifer E.; Clifton, Charles, Jr.; Frazier, Lyn; Taylor, Patrick V.

    2012-01-01

    Previous research has shown that usage preferences (non-categorical constraints on the distribution of syntactic structures) shape many grammatical alternations. In the present study, we show that usage preferences also influence which alternate listeners report hearing when presented with acoustically degraded input. We investigated the English…

  19. Furman University Justification of Business Usage of Cell Phone

    E-print Network

    Furman University Justification of Business Usage of Cell Phone 1 Name Justification of Business Usage of Cell Phone 2 The type of cell phone coverage must be reasonably workday? Yes_____ No_____ Other business reason that may necessitate use of cell phone, describe

  20. An Exploratory Study of Internet Addiction, Usage and Communication Pleasure.

    ERIC Educational Resources Information Center

    Chou, Chien; Chou, Jung; Tyan, Nay-Ching Nancy

    This study examined the correlation between Internet addiction, usage, and communication pleasure. Research questions were: (1) What is computer network addiction? (2) How can one measure the degree of computer network addiction? (3) What is the correlation between the degree of users' network addiction and their network usage? (4) What is the…

  1. Policy #3300 University Telephone System Usage 1 OLD DOMINION UNIVERSITY

    E-print Network

    Policy #3300 ­ University Telephone System Usage 1 OLD DOMINION UNIVERSITY University Policy Policy #3300 UNIVERSITY TELEPHONE SYSTEM USAGE Responsible Oversight Executive: Vice President of this policy is to provide guidelines and procedures for the proper use of University-owned telephones

  2. Accountable Anonymous Service Usage in Mobile Communication Systems \\Lambda

    E-print Network

    Bencsáth, Boldizsár

    Accountable Anonymous Service Usage in Mobile Communication Systems \\Lambda Levente Butty Abstract We introduce a model that allows of anonymous yet accountable service usage in mo­ bile revocable anonymity for users, which means that the identity of misbehaving users can be revealed. 1

  3. Web-based pathology practice examination usage

    PubMed Central

    Klatt, Edward C.

    2014-01-01

    Context: General and subject specific practice examinations for students in health sciences studying pathology were placed onto a free public internet web site entitled web path and were accessed four clicks from the home web site menu. Subjects and Methods: Multiple choice questions were coded into. html files with JavaScript functions for web browser viewing in a timed format. A Perl programming language script with common gateway interface for web page forms scored examinations and placed results into a log file on an internet computer server. The four general review examinations of 30 questions each could be completed in up to 30 min. The 17 subject specific examinations of 10 questions each with accompanying images could be completed in up to 15 min each. The results of scores and user educational field of study from log files were compiled from June 2006 to January 2014. Results: The four general review examinations had 31,639 accesses with completion of all questions, for a completion rate of 54% and average score of 75%. A score of 100% was achieved by 7% of users, ?90% by 21%, and ?50% score by 95% of users. In top to bottom web page menu order, review examination usage was 44%, 24%, 17%, and 15% of all accessions. The 17 subject specific examinations had 103,028 completions, with completion rate 73% and average score 74%. Scoring at 100% was 20% overall, ?90% by 37%, and ?50% score by 90% of users. The first three menu items on the web page accounted for 12.6%, 10.0%, and 8.2% of all completions, and the bottom three accounted for no more than 2.2% each. Conclusions: Completion rates were higher for shorter 10 questions subject examinations. Users identifying themselves as MD/DO scored higher than other users, averaging 75%. Usage was higher for examinations at the top of the web page menu. Scores achieved suggest that a cohort of serious users fully completing the examinations had sufficient preparation to use them to support their pathology education. PMID:25337431

  4. Bacterial toxin RelE mediates frequent codon-independent mRNA cleavage from the 5' end of coding regions in vivo.

    PubMed

    Hurley, Jennifer M; Cruz, Jonathan W; Ouyang, Ming; Woychik, Nancy A

    2011-04-29

    The enzymatic activity of the RelE bacterial toxin component of the Escherichia coli RelBE toxin-antitoxin system has been extensively studied in vitro and to a lesser extent in vivo. These earlier reports revealed that 1) RelE alone does not exhibit mRNA cleavage activity, 2) RelE mediates mRNA cleavage through its association with the ribosome, 3) RelE-mediated mRNA cleavage occurs at the ribosomal A site and, 4) Cleavage of mRNA by RelE exhibits high codon specificity. More specifically, RelE exhibits a preference for the stop codons UAG and UGA and sense codons CAG and UCG in vitro. In this study, we used a comprehensive primer extension approach to map the frequency and codon specificity of RelE cleavage activity in vivo. We found extensive cleavage at the beginning of the coding region of five transcripts, ompA, lpp, ompF, rpsA, and tufA. We then mapped RelE cleavage sites across one short transcript (lpp) and two long transcripts (ompF and ompA). RelE cut all of these transcripts frequently and efficiently within the first ?100 codons, only occasionally cut beyond this point, and rarely cut at sites in proximity to the 3' end. Among 196 RelE sites in these five transcripts, there was no preference for CAG or UCG sense codons. In fact, bioinformatic analysis of the RelE cleavage sites failed to identify any sequence preferences. These results suggest a model of RelE function distinct from those proposed previously, because RelE directed frequent codon-independent mRNA cleavage coincident with the commencement of translation elongation. PMID:21324908

  5. Association Between HIV-1 Coreceptor Usage and Resistance to Broadly Neutralizing Antibodies

    PubMed Central

    Walter, Hauke; Lengauer, Thomas

    2014-01-01

    Background: Recently discovered broadly neutralizing antibodies have revitalized hopes of developing a universal vaccine against HIV-1. Mainly responsible for new infections are variants only using CCR5 for cell entry, whereas CXCR4-using variants can become dominant in later infection stages. Methods: We performed a statistical analysis on two different previously published data sets. The first data set was a panel of 199 diverse HIV-1 isolates for which IC50 neutralization titers were determined for the broadly neutralizing antibodies VRC01, VRC-PG04, PG9, and PG16. The second data set contained env sequences of viral variants extracted from HIV-1–infected humanized mice treated with the antibody PGT128 and from untreated control mice. Results: For the panel of 199 diverse HIV-1 isolates, we found a statistically significant association between viral resistance to PG9 and PG16 and CXCR4 coreceptor usage (P = 0.0011 and P = 0.0010, respectively). Our analysis of viral variants from HIV-1–infected humanized mice under treatment with the broadly neutralizing antibody PGT128 indicated that certain antibodies might drive a viral population toward developing CXCR4 coreceptor usage capability (P = 0.0011 for the comparison between PGT128 and control measurement). Conclusions: These analyses highlight the importance of accounting for a possible coreceptor usage bias pertaining to the effectiveness of an HIV vaccine and to passive antibody transfer as therapeutic approach. PMID:25072615

  6. Student Drug Usage and Self-Alienation.

    ERIC Educational Resources Information Center

    Fischler, Michael L.

    Utilizing responses (a self administered, 15 item questionnaire) of a rural northeastern New England sample of junior high, senior high, and college students, correlation between legal and illegal drug use and perceived self-alienation was examined. Comparison was also made between users and nonusers. Legal users were defined as those who made at…

  7. LE BULLETIN DE L'EPI N 60 USAGE PDAGOGIQUE DES CDROM SUR L'USAGE PDAGOGIQUE DES CDROM

    E-print Network

    Paris-Sud XI, Université de

    175 LE BULLETIN DE L'EPI N° 60 USAGE PÉDAGOGIQUE DES CDROM SUR L'USAGE PÉDAGOGIQUE DES CDROM Benoît HUFSCHMITT INTRODUCTION Les CDROM ont fait leur entrée dans l'Education Nationale en décembre 88, chaque des CDROM dans l'Académie de Besançon a demandé d'abord une familiarisation, des manipulations de

  8. Effect of ATG initiation codon context motifs on the efficiency of translation of mRNA derived from exogenous genes in the transgenic silkworm, Bombyx mori.

    PubMed

    Tatematsu, Ken-Ichiro; Uchino, Keiro; Sezutsu, Hideki; Tamura, Toshiki

    2014-01-01

    The context sequence motif surrounding the ATG initiation codon influences mRNA translation efficiency and affects protein production; however, the optimal sequence differs among species. To determine the optimal sequence for production of recombinant proteins in a transgenic silkworm, we compared 14-nucleotide context motifs around the ATG (ATG-context) in 50 silkworm genes and found the following consensus: (A/T)AN(A/T)ATCAAAatgN. We were also able to define the least-common motif: CCN(C/G)CGN(C/T/G)(G/C/T)(T/G)atgC, which served as a negative control. To examine the regulatory role of these motifs in protein expression, we constructed reporter plasmids containing different ATG-context motifs together with either the luciferase gene or an enhanced green fluorescent protein (EGFP) gene. These constructs were then used for comparison of luciferase reporter activity and EGFP production in BmN4 cells in vitro as well as in transgenic silkworms in vivo. We detected 10-fold higher luciferase activity in BmN4 cells transfected with the consensus ATG-context motif construct, compared to the negative control plasmid. ELISA measurements of EGFP translation products with the corresponding constructs in BmN4 cells showed consistently similar results. Interestingly, the translation efficiency of the novel consensus ATG-context motif did not show the highest activity in the transgenic silkworms in vivo, except for the fat body. The highest efficiency in the middle and posterior silk glands was produced by the sericin 1 context. Our results show that the ATG-context motifs differ among silkworm tissues. This result is important for the further improvement of the transgenic silkworm system for the production of recombinant proteins. PMID:25674439

  9. Differential receptor usage by measles virus strains.

    PubMed

    Bartz, R; Firsching, R; Rima, B; ter Meulen, V; Schneider-Schaulies, J

    1998-05-01

    Recently, we demonstrated that infection of cells with all measles virus (MV) strains tested was inhibited by antibodies against CD46, although not all strains caused downregulation of the MV receptor CD46 from the surface of human cells. We now show that infection of cells with MV strain WTFb, a variant of wild-type isolate WTF which has been isolated and propagated on human BJAB cells, is not inhibited by antibodies against CD46. In contrast, infection of cells with the closely related strain WTFv, a Vero cell-adapted variant of WTF, is inhibited by antibodies against CD46. This observation led us to investigate the interaction of these viruses and the vaccine strain Edmonston (Edm) with CD46 and target cells. Cellular receptors with high affinity binding for WTFb are present on BJAB cells, but not on transfected CD46-expressing CHO cells. In contrast to the Edm strain, virus particles and solubilized envelope glycoproteins of WTFb have a very limited binding capacity to CD46. Furthermore, we show that recombinant soluble CD46 either does not bind, or binds very weakly, to WTFb glycoproteins expressed on the cell surface. Our findings indicate that wild-type MV strain WTFb and vaccine strain Edm use different binding sites on human cells. In addition, the results suggest that MV strains may alternatively use CD46 and an unknown molecule as receptors, and that the degree of usage of both receptors may be MV strain-specific. PMID:9603316

  10. Simplifying tool usage in teleoperative tasks

    NASA Astrophysics Data System (ADS)

    Lindsay, Thomas; Paul, Richard P.

    1993-03-01

    Modern robotic research has presented the opportunity for enhanced teleoperative systems. Teleprogramming has been developed for teleoperation in time-delayed environments, but can also lead to increased productivity in non-delayed teleoperation. Powered tools are used to increase the abilities of the remote manipulator. However, tools add to the complexity of the system, both in terms of control and sensing. Teleprogramming can be used to simplify the operators interaction with the manipulator/tool system. Further, the adaptive sensing algorithm of the remote site system (using an instrumented compliant wrist for feedback) simplifies the sensory requirements of the system. Current remote-site implementation of a teleprogramming tool-usage strategy that simplifies tool use is described in this document. The use of powered tools in teleoperation tasks is illustrated by two examples, one using an air-powered impact wrench, and the other using an electric winch. Both of these tools are implemented at our remote site workcell, consisting of a Puma 560 robot working on the task of removing the top of a large box.

  11. Transfer RNA structural change is a key element in the reassignment of the CUG codon in Candida albicans.

    PubMed Central

    Santos, M A; Perreau, V M; Tuite, M F

    1996-01-01

    The human pathogenic yeast Candida albicans and a number of other Candida species translate the standard leucine CUG codon as serine. This is the latest addition to an increasing number of alterations to the standard genetic code which invalidate the theory that the code is frozen and universal. The unexpected finding that some organisms evolved alternative genetic codes raises two important questions: how have these alternative codes evolved and what evolutionary advantages could they create to allow for their selection? To address these questions in the context of serine CUG translation in C.albicans, we have searched for unique structural features in seryl-tRNA(CAG), which translates the leucine CUG codon as serine, and attempted to reconstruct the early stages of this genetic code switch in the closely related yeast species Saccharomyces cerevisiae. We show that a purine at position 33 (G33) in the C.albicans Ser-tRNA(CAG) anticodon loop, which replaces a conserved pyrimidine found in all other tRNAs, is a key structural element in the reassignment of the CUG codon from leucine to serine in that it decreases the decoding efficiency of the tRNA, thereby allowing cells to survive low level serine CUG translation. Expression of this tRNA in S.cerevisiae induces the stress response which allows cells to acquire thermotolerance. We argue that acquisition of thermotolerance may represent a positive selection for this genetic code change by allowing yeasts to adapt to sudden changes in environmental conditions and therefore colonize new ecological niches. Images PMID:8890179

  12. Role of p53 codon 72 polymorphism in chromosomal aberrations and mitotic index in patients with chronic hepatitis B

    PubMed Central

    Akba?, H.; Yalcin, K.; Isi, H.; Tekes, S.; Atay, A.E.; Akkus, Z.; Budak, T.

    2012-01-01

    Polymorphisms of the p53 gene, which participates in DNA repair, can affect the functioning of the p53 protein. The Arg and Pro variants in p53 codon 72 were shown to have different regulation properties of p53-dependent DNA repair target genes that can affect various levels of cytogenetic aberrations in chronic hepatitis B patients. The present study aimed to examine the frequency of chromosomal aberrations and the mitotic index in patients with chronic hepatitis B and their possible association with p53 gene exon 4 codon 72 Arg72Pro (Ex4+119 G>C; rs1042522) polymorphism. Fifty-eight patients with chronic hepatitis B and 30 healthy individuals were genotyped in terms of the p53 gene codon 72 Arg72Pro polymorphism by PCR-RFLP. A 72-h cell culture was performed on the same individuals and evaluated in terms of chromosomal aberrations and mitotic index. A high frequency of chromosomal aberrations and low mitotic index were detected in the patient group compared to the control group. A higher frequency of chromosomal aberrations was detected in both the patient and the control groups with a homozygous proline genotype (13 patients, 3 control subjects) compared to patients and controls with other genotypes [Arg/Pro (38 patients, 20 control subjects) and Arg/Arg (7 patients, 7 control subjects)]. We observed an increased frequency of cytogenetic aberrations in patients with chronic hepatitis B. In addition, a higher frequency of cytogenetic aberrations was observed in p53 variants having the homozygous proline genotype compared to variants having other genotypes both in patients and healthy individuals. PMID:22892830

  13. The Influenza A PB1-F2 and N40 Start Codons Are Contained within an RNA Pseudoknot.

    PubMed

    Priore, Salvatore F; Kauffmann, Andrew D; Baman, Jayson R; Turner, Douglas H

    2015-06-01

    Influenza A is a negative-sense RNA virus with an eight-segment genome. Some segments encode more than one polypeptide product, but how the virus accesses alternate internal open reading frames (ORFs) is not completely understood. In segment 2, ribosomal scanning produces two internal ORFs, PB1-F2 and N40. Here, chemical mapping reveals a Mg(2+)-dependent pseudoknot structure that includes the PB1-F2 and N40 start codons. The results suggest that interactions of the ribosome with the pseudoknot may affect the level of translation for PB1-F2 and N40. PMID:25996464

  14. Introduction of translation stop codons into the viral glycoprotein gene in a fish DNA vaccine eliminates induction of protective immunity

    USGS Publications Warehouse

    Garver, K.A.; Conway, C.M.; Kurath, G.

    2006-01-01

    A highly efficacious DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was mutated to introduce two stop codons to prevent glycoprotein translation while maintaining the plasmid DNA integrity and RNA transcription ability. The mutated plasmid vaccine, denoted pIHNw-G2stop, when injected intramuscularly into fish at high doses, lacked detectable glycoprotein expression in the injection site muscle, and did not provide protection against lethal virus challenge 7 days post-vaccination. These results suggest that the G-protein itself is required to stimulate the early protective antiviral response observed after vaccination with the nonmutated parental DNA vaccine. ?? Springer Science+Business Media, Inc. 2006.

  15. Simultaneous identification of 36 mutations in KRAS codons 61and 146, BRAF, NRAS, and PIK3CA in a single reaction by multiplex assay kit

    PubMed Central

    2013-01-01

    Background Retrospective analyses in the West suggest that mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA are negative predictive factors for cetuximab treatment in colorectal cancer patients. We developed a novel multiplex kit detecting 36 mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA using Luminex (xMAP) assay in a single reaction. Methods Tumor samples and clinical data from Asian colorectal cancer patients treated with cetuximab were collected. We investigated KRAS, BRAF, NRAS, and PIK3CA mutations using both the multiplex kit and direct sequencing methods, and evaluated the concordance between the 2 methods. Objective response, progression-free survival (PFS), and overall survival (OS) were also evaluated according to mutational status. Results In total, 82 of 83 samples (78 surgically resected specimens and 5 biopsy specimens) were analyzed using both methods. All multiplex assays were performed using 50 ng of template DNA. The concordance rate between the methods was 100%. Overall, 49 (59.8%) patients had all wild-type tumors, 21 (25.6%) had tumors harboring KRAS codon 12 or 13 mutations, and 12 (14.6%) had tumors harboring KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations. The response rates in these patient groups were 38.8%, 4.8%, and 0%, respectively. Median PFS in these groups was 6.1 months (95% confidence interval (CI): 3.1–9.2), 2.7 months (1.2–4.2), and 1.6 months (1.5–1.7); median OS was 13.8 months (9.2–18.4), 8.2 months (5.7–10.7), and 6.3 months (1.3–11.3), respectively. Statistically significant differences in both PFS and OS were found between patients with all wild-type tumors and those with KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations (PFS: 95% CI, 0.11–0.44; P?codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA detected in Asian patients were not predictive of clinical benefits from cetuximab treatment, similar to the result obtained in European studies. PMID:24006859

  16. Severe upper gastrointestinal polyposis associated with sparse colonic polyposis in a familial adenomatous polyposis family with an APC mutation at codon 1520

    PubMed Central

    Leggett, B; Young, J; Biden, K; Buttenshaw, R; Knight, N; Cowen, A

    1997-01-01

    Background—Familial adenomatous polyposis usually results in colonic polyposis with hundreds to thousands of polyps, congenital hypertrophy of the retinal pigment epithelium (CHRPE), and variable extracolonic features. Recent reports indicate that patients with distal mutations between codons 1445 and 1578 do not express CHRPE and have a high incidence of desmoid tumours. ?Patients—The family studied has an unusual phenotype of sparse colonic polyposis but profuse upper gastrointestinal polyposis. Affected subjects do not have CHRPE. ?Methods—The protein truncation test followed by sequencing identified a 2 base pair deletion at codon 1520 in the APC gene. This results in a frameshift creating a stop codon 13 codons downstream. ?Results—This family demonstrates that sparse colonic polyposis but severe upper tract polyposis may be associated with mutations between codons 1445 and 1578. ?Conclusions—Study of duodenal and colonic polyps in further cases with mutations in this region is warranted. Such mutations may preferentially cause duodenal adenomas and desmoid tumours as somatic mutations in these tumours also occur in this region, unlike colorectal tumours where somatic mutations occur more proximally. This study emphasises the importance of screening the upper gastrointestinal tract even when the colonic disease is mild. ?? Keywords: familial adenomatous polyposis; duodenal polyps; APC mutations; colorectal polyps PMID:9391252

  17. Prevalence of K-RAS Codons 12 and 13 Mutations in Locally Advanced Head and Neck Squamous Cell Carcinoma and Impact on Clinical Outcomes.

    PubMed

    Bissada, Eric; Abboud, Olivier; Abou Chacra, Zahi; Guertin, Louis; Weng, Xiaoduan; Nguyen-Tan, Phuc Félix; Tabet, Jean-Claude; Thibaudeau, Eve; Lambert, Louise; Audet, Marie-Lise; Fortin, Bernard; Soulières, Denis

    2013-01-01

    Background. RAS gene mutations have an impact on treatment response and overall prognosis for certain types of cancer. Objectives. To determine the prevalence and impact of K-RAS codons 12 and 13 mutations in patients with locally advanced HNSCC treated with primary or adjuvant chemo-radiation. Methods. 428 consecutive patients were treated with chemo-radiation therapy and followed for a median of 37 months. From these, 199 paraffin embedded biopsy or surgical specimens were retrieved. DNA was isolated and analyzed for K-RAS mutational status. Results. DNA extraction was successful in 197 samples. Of the 197 specimens, 3.5% presented K-RAS codon 12 mutations. For mutated cases and non-mutated cases, complete initial response to chemoradiation therapy was 71 and 73% (P = 0.32). LRC was respectively 32 and 83% (P = 0.03), DFS was 27 and 68% (P = 0.12), distant metastasis-free survival was 100 and 81% (P = 0.30) and OS was 57 and 65% (P = 0.14) at three years. K-Ras codon 13 analysis revealed no mutation. Conclusion. K-RAS codon 12 mutational status, although not associated with a difference in response rate, may influence the failure pattern and the type of therapy offered to patients with HNSCC. Our study did not reveal any mutation of K-RAS codon 13. PMID:23737793

  18. Prevalence of K-RAS Codons 12 and 13 Mutations in Locally Advanced Head and Neck Squamous Cell Carcinoma and Impact on Clinical Outcomes

    PubMed Central

    Bissada, Eric; Abou Chacra, Zahi; Guertin, Louis; Weng, Xiaoduan; Nguyen-Tan, Phuc Félix; Tabet, Jean-Claude; Thibaudeau, Ève; Lambert, Louise; Audet, Marie-Lise; Soulières, Denis

    2013-01-01

    Background. RAS gene mutations have an impact on treatment response and overall prognosis for certain types of cancer. Objectives. To determine the prevalence and impact of K-RAS codons 12 and 13 mutations in patients with locally advanced HNSCC treated with primary or adjuvant chemo-radiation. Methods. 428 consecutive patients were treated with chemo-radiation therapy and followed for a median of 37 months. From these, 199 paraffin embedded biopsy or surgical specimens were retrieved. DNA was isolated and analyzed for K-RAS mutational status. Results. DNA extraction was successful in 197 samples. Of the 197 specimens, 3.5% presented K-RAS codon 12 mutations. For mutated cases and non-mutated cases, complete initial response to chemoradiation therapy was 71 and 73% (P = 0.32). LRC was respectively 32 and 83% (P = 0.03), DFS was 27 and 68% (P = 0.12), distant metastasis-free survival was 100 and 81% (P = 0.30) and OS was 57 and 65% (P = 0.14) at three years. K-Ras codon 13 analysis revealed no mutation. Conclusion. K-RAS codon 12 mutational status, although not associated with a difference in response rate, may influence the failure pattern and the type of therapy offered to patients with HNSCC. Our study did not reveal any mutation of K-RAS codon 13. PMID:23737793

  19. Genetic analysis of L123 of the tRNA-mimicking eukaryote release factor eRF1, an amino acid residue critical for discrimination of stop codons

    PubMed Central

    Saito, Kazuki; Ito, Koichi

    2015-01-01

    In eukaryotes, the tRNA-mimicking polypeptide-chain release factor, eRF1, decodes stop codons on the ribosome in a complex with eRF3; this complex exhibits striking structural similarity to the tRNA–eEF1A–GTP complex. Although amino acid residues or motifs of eRF1 that are critical for stop codon discrimination have been identified, the details of the molecular mechanisms involved in the function of the ribosomal decoding site remain obscure. Here, we report analyses of the position-123 amino acid of eRF1 (L123 in Saccharomyces cerevisiae eRF1), a residue that is phylogenetically conserved among species with canonical and variant genetic codes. In vivo readthrough efficiency analysis and genetic growth complementation analysis of the residue-123 systematic mutants suggested that this amino acid functions in stop codon discrimination in a manner coupled with eRF3 binding, and distinctive from previously reported adjacent residues. Furthermore, aminoglycoside antibiotic sensitivity analysis and ribosomal docking modeling of eRF1 in a quasi-A/T state suggested a functional interaction between the side chain of L123 and ribosomal residues critical for codon recognition in the decoding site, as a molecular explanation for coupling with eRF3. Our results provide insights into the molecular mechanisms underlying stop codon discrimination by a tRNA-mimicking protein on the ribosome. PMID:25897120

  20. Predicting energy usage in a supermarket

    E-print Network

    Schrock, Derek Wayne

    1989-01-01

    performed in the past concentrated on energy use in the residential sector and office buildings within the commercial sector. By comparison, little is known about the energy using systems in the mercantile services category (cominercial and retail stores... ? the Manger of Facility Engineering in Houston, Larry Maderas and Bob Powell ? two of the store Managers, and Gary Miles ? who is the contract maintenance person for the store. I also wish to thank Bruce Albright, the Office Manager for the College Station...

  1. Application Examples for Handle System Usage

    NASA Astrophysics Data System (ADS)

    Toussaint, F.; Weigel, T.; Thiemann, H.; Höck, H.; Stockhause, M.; Lautenschlager, M.

    2012-12-01

    Besides the well-known DOI (Digital Object Identifiers) as a special form of Handles that resolve to scientific publications there are various other applications in use. Others perhaps are just not yet. We present some examples for the existing ones and some ideas for the future. The national German project C3-Grid provides a framework to implement a first solution for provenance tracing and explore unforeseen implications. Though project-specific, the high-level architecture is generic and represents well a common notion of data derivation. Users select one or many input datasets and a workflow software module (an agent in this context) to execute on the data. The output data is deposited in a repository to be delivered to the user. All data is accompanied by an XML metadata document. All input and output data, metadata and the workflow module receive Handles and are linked together to establish a directed acyclic graph of derived data objects and involved agents. Data that has been modified by a workflow module is linked to its predecessor data and the workflow module involved. Version control systems such as svn or git provide Internet access to software repositories using URLs. To refer to a specific state of the source code of for instance a C3 workflow module, it is sufficient to reference the URL to the svn revision or git hash. In consequence, individual revisions and the repository as a whole receive PIDs. Moreover, the revision specific PIDs are linked to their respective predecessors and become part of the provenance graph. Another example for usage of PIDs in a current major project is given in EUDAT (European Data Infrastructure) which will link scientific data of several research communities together. In many fields it is necessary to provide data objects at multiple locations for a variety of applications. To ensure consistency, not only the master of a data object but also its copies shall be provided with a PID. To verify transaction safety and to keep all copies consistent requires that the chain from master to copy and vice versa has to be resolvable, preferably through PIDs directly. As part of EUDAT necessary services are created on the basis of iRODS. These form the core structure of the data infrastructure developed within EUDAT. Though many implementations of PID systems already exist, many valuable web accessible data sources come with unresolvable identifiers like UUIDs, with instable recognition patterns like URLs, or even with proprietary implementations. However, other data collections would like to link to them in the data descriptions of their metadata. In addition, by usage of PIDs one can decouple the responsibilities for data and MD in projects where necessary. For some metadata entities like persons or even institutes it makes sense to give them single PIDs that point to contact and/or location information. ORCID (Open Researcher & Contributor ID), e.g., keeps track of persons working in scholarly fields, independent of name changes and linguistic variances. The ISO 27729 based International Standard Name Identifier (ISNI) also identifies legal entities and fictional characters besides natural persons. Other systems exist that, e.g., reference geographic localities. IDs of this kind may resolve to a URL where detailed information is given.

  2. Energy Usage Optimisation in South African Mines

    NASA Astrophysics Data System (ADS)

    Hasan, Ali; Twala, Bhekisipho; Ouahada, Khmaies; Marwala, Tshilidzi

    2014-03-01

    In recent years, South Africa has encountered a critical electricity supply which necessitated the implementation of demand-side management (DSM) projects. Load shifting and energy (EE) efficiency projects were introduced in mining sector to reduce the electricity usage during day peak time. As the compressed air networks and the water pumping systems are using large amounts of the mines' electricity, possible ways were investigated and implemented to improve and optimise the energy consumption and to reduce the costs. Implementing DSM and EE in four different mines resulted in achieving the desired energy savings and load-shifting. W ostatnich latach w Po?udniowej Afryce zanotowano pewne trudno?ci z dostawami energii elektrycznej, co wymusi?o wdro?enie dzia?a? maj?cych na celu skuteczne zarz?dzanie zagadnieniami energetycznymi. Wprowadzono dzia?ania maj?ce na celu zmian? systemu obci??e? roboczych i bardziej efektywne wykorzystanie energii tak, by obni?y? zapotrzebowanie na energi? w trakcie szczytowych godzin w ci?gu dnia. Sieci dostarczaj?ce spr??one powietrze oraz stacje pomp zu?ywaj? znaczne ilo?ci energii w kopalni, przeanalizowano wi?c mo?liwe sposoby redukcji i optymalizacji zapotrzebowania na energi? i tym samym obni?enia kosztów produkcji. Wdro?enie odpowiednich projektów nakierowanych na oszcz?dno?ci i optymalizacj? w czterech kopalniach doprowadzi?o do oczekiwanych oszcz?dno?ci energii i umo?liwi?o zmian? systemu obci??e? roboczych w trakcie procesu produkcji.

  3. Modelling of word usage frequency dynamics using artificial neural network

    NASA Astrophysics Data System (ADS)

    Maslennikova, Yu S.; Bochkarev, V. V.; Voloskov, D. S.

    2014-03-01

    In this paper the method for modelling of word usage frequency time series is proposed. An artificial feedforward neural network was used to predict word usage frequencies. The neural network was trained using the maximum likelihood criterion. The Google Books Ngram corpus was used for the analysis. This database provides a large amount of data on frequency of specific word forms for 7 languages. Statistical modelling of word usage frequency time series allows finding optimal fitting and filtering algorithm for subsequent lexicographic analysis and verification of frequency trend models.

  4. Expression, purification and identification of Pla a1 in a codon-optimized Platanus pollen allergen.

    PubMed

    Liu, Yun; Sun, Xiuzhen; Wang, Guizuo; Tao, Ailin; Wu, Yuanyuan; Li, Manxiang; Shi, Hongyang; Xie, Mei

    2015-08-01

    The present study aimed to express, purify and identify the major allergen gene, Pla a1, in Platanus pollen. According to previous studies, the major gene sequences of the Pla a1 allergen were obtained and codon optimization and synthesis of the genome were performed using DNAStar software. Following binding of the target gene fragment and the pET?44a vector, the JM109 cells were transfected to produce positive clones. The vectors were then transformed into Escherichia coli Rosetta cells to induce the expression of the target protein. The exogenous protein was purified using affinity chromatography and was identified by western blot analysis. Pla a1, the major allergen protein in Platanus pollen, was successfully isolated and this exogenous protein was purified using affinity chromatography. The present study was the first, to the best of our knowledge, to obtain expression of the allergen recombinant protein, Pla a1, fused with a Strep?TagII via codon optimization and provided the basis for the preparation of allergens with high purity, recombinant hypoallergenic allergens and allergen nucleic acid vaccines. PMID:25902014

  5. Modeling the effect of codon translation rates on co-translational protein folding mechanisms of arbitrary complexity

    NASA Astrophysics Data System (ADS)

    Caniparoli, Luca; O'Brien, Edward P.

    2015-04-01

    In a cell, the folding of a protein molecule into tertiary structure can begin while it is synthesized by the ribosome. The rate at which individual amino acids are incorporated into the elongating nascent chain has been shown to affect the likelihood that proteins will populate their folded state, indicating that co-translational protein folding is a far from equilibrium process. Developing a theoretical framework to accurately describe this process is, therefore, crucial for advancing our understanding of how proteins acquire their functional conformation in living cells. Current state-of-the-art computational approaches, such as molecular dynamics simulations, are very demanding in terms of the required computer resources, making the simulation of co-translational protein folding difficult. Here, we overcome this limitation by introducing an efficient approach that predicts the effects that variable codon translation rates have on co-translational folding pathways. Our approach is based on Markov chains. By using as an input a relatively small number of molecular dynamics simulations, it allows for the computation of the probability that a nascent protein is in any state as a function of the translation rate of individual codons along a mRNA's open reading frame. Due to its computational efficiency and favorable scalability with the complexity of the folding mechanism, this approach could enable proteome-wide computational studies of the influence of translation dynamics on co-translational folding.

  6. A L2HGDH initiator methionine codon mutation in a Yorkshire terrier with L-2-hydroxyglutaric aciduria

    PubMed Central

    2012-01-01

    Background L-2-hydroxyglutaric aciduria is a metabolic repair deficiency characterized by elevated levels of L-2-hydroxyglutaric acid in urine, blood and cerebrospinal fluid. Neurological signs associated with the disease in humans and dogs include seizures, ataxia and dementia. Case presentation Here we describe an 8?month old Yorkshire terrier that presented with episodes of hyperactivity and aggressive behavior. Between episodes, the dog’s behavior and neurologic examinations were normal. A T2 weighted MRI of the brain showed diffuse grey matter hyperintensity and a urine metabolite screen showed elevated 2-hydroxyglutaric acid. We sequenced all 10 exons and intron-exon borders of L2HGDH from the affected dog and identified a homozygous A to G transition in the initiator methionine codon. The first inframe methionine is at p.M183 which is past the mitochondrial targeting domain of the protein. Initiation of translation at p.M183 would encode an N-terminal truncated protein unlikely to be functional. Conclusions We have identified a mutation in the initiation codon of L2HGDH that is likely to result in a non-functional gene. The Yorkshire terrier could serve as an animal model to understand the pathogenesis of L-2-hydroxyglutaric aciduria and to evaluate potential therapies. PMID:22834903

  7. Sequence-specific DNA alkylation targeting for Kras codon 13 mutation by pyrrole-imidazole polyamide seco-CBI conjugates.

    PubMed

    Taylor, Rhys Dylan; Asamitsu, Sefan; Takenaka, Tomohiro; Yamamoto, Makoto; Hashiya, Kaori; Kawamoto, Yusuke; Bando, Toshikazu; Nagase, Hiroki; Sugiyama, Hiroshi

    2014-01-27

    Hairpin N-methylpyrrole-N-methylimidazole polyamide seco-CBI conjugates 2-6 were designed for synthesis by Fmoc solid-phase synthesis, and their DNA-alkylating activities against the Kras codon?13 mutation were compared by high-resolution denaturing gel electrophoresis with 225 base pair (bp) DNA fragments. Conjugate 5 had high reactivity towards the Kras codon?13 mutation site, with alkylation occurring at the A of the sequence 5'-ACGTCACCA-3' (site?2), including minor 1?bp-mismatch alkylation against wild type 5'-ACGCCACCA-3' (site?3). Conjugate 6, which differs from conjugate 5 by exchanging one Py unit with a ? unit, showed high selectivity but only weakly alkylated the A of 5'-ACGTCACCA-3' (site?2). The hairpin polyamide seco-CBI conjugate 5 thus alkylates according to Dervan's pairing rule with the pairing recognition which ?/? pair targets T-A and A-T pairs. SPR and a computer-minimized model suggest that 5 binds to the target sequence with high affinity in a hairpin conformation, allowing for efficient DNA alkylation. PMID:24382626

  8. An unusual tRNAThr derived from tRNAHis reassigns in yeast mitochondria the CUN codons to threonine

    PubMed Central

    Su, Dan; Lieberman, Allyson; Lang, B. Franz; Simonovi?, Miljan; Söll, Dieter; Ling, Jiqiang

    2011-01-01

    The standard genetic code is used by most living organisms, yet deviations have been observed in many genomes, suggesting that the genetic code has been evolving. In certain yeast mitochondria, CUN codons are reassigned from leucine to threonine, which requires an unusual tRNAThr with an enlarged 8-nt anticodon loop (). To trace its evolutionary origin we performed a comprehensive phylogenetic analysis which revealed that evolved from yeast mitochondrial tRNAHis. To understand this tRNA identity change, we performed mutational and biochemical experiments. We show that Saccharomyces cerevisiae mitochondrial threonyl-tRNA synthetase (MST1) could attach threonine to both and the regular , but not to the wild-type tRNAHis. A loss of the first nucleotide (G?1) in tRNAHis converts it to a substrate for MST1 with a Km value (0.7??M) comparable to that of (0.3??M), and addition of G?1 to allows efficient histidylation by histidyl-tRNA synthetase. We also show that MST1 from Candida albicans, a yeast in which CUN codons remain assigned to leucine, could not threonylate , suggesting that MST1 has coevolved with . Our work provides the first clear example of a recent recoding event caused by alloacceptor tRNA gene recruitment. PMID:21321019

  9. Codon optimization, promoter and expression system selection that achieved high-level production of Yarrowia lipolytica lipase in Pichia pastoris.

    PubMed

    Zhou, Wen-Jing; Yang, Jiang-Ke; Mao, Lin; Miao, Li-Hong

    2015-04-01

    Lipase (EC 3.1.1.3) stands amongst the most important and promising biocatalysts for industrial applications. In this study, in order to realize a high-level expression of the Yarrowia lipolytica lipase gene in Pichia pastoris, we optimized the codon of LIP2 by de novo gene design and synthesis, which significantly improved the lipase expression when compared to the native lip2 gene. We also comparatively analyzed the effects of the promoter types (PAOX1 and PFLD1) and the Pichia expression systems, including the newly developed PichiaPink system, on lipase production and obtained the optimal recombinants. Bench-top scale fermentation studies indicated that the recombinant carrying the codon-optimized lipase gene syn-lip under the control of promoter PAOX1 has a significantly higher lipase production capacity in the fermenter than other types of recombinants. After undergoing methanol inducible expression for 96h, the wet cell weight of Pichia, the lipase activity and the protein content in the fermentation broth reached their highest values of 262g/L, 38,500U/mL and 2.82g/L, respectively. This study has not only greatly facilitated the bioapplication of lipase in industrial fields but the strategies utilized, such as de novo gene design and synthesis, the comparative analysis among promoters and different generations of Pichia expression systems will also be useful as references for future work in this field. PMID:25765312

  10. Codon optimization of the human papillomavirus type 58 L1 gene enhances the expression of soluble L1 protein in Saccharomyces cerevisiae.

    PubMed

    Kim, Hyoung Jin; Kwag, Hye-Lim; Kim, Hong-Jin

    2013-03-01

    The effect of codon optimization of L1 gene on the production of the L1 protein of human papillomavirus (HPV) was investigated in a yeast expression system. Saccharomyces cerevisiae was transformed with a plasmid containing either the wild type (WS)-HPV type 58 L1 (HPV58 L1) gene or a codon-optimized (MO)-HPV58 L1 gene. The proportion of soluble L1 protein expressed from MO-HPV58 L1 was significantly higher than that expressed from WS-HPV58 L1. Moreover, the amount of purified MO-HPV58 L1 protein recovered was 2.5-fold higher than the amount of WS-HPV58 L1 protein. Codon optimization of HPV58 L1 gene thus increases the proportion of soluble L1 protein and the amount of purified product that can be used as antigen to generate vaccines. PMID:23183918

  11. Large-scale codon de-optimisation of the p29 replicase gene by synonymous substitutions causes a loss of infectivity of melon necrotic spot virus.

    PubMed

    Usami, Atsushi; Mochizuki, Tomofumi; Tsuda, Shinya; Ohki, Satoshi T

    2013-09-01

    The effect of synonymous substitutions in the melon necrotic spot virus p29 replicase gene on viral pathogenicity was investigated. The codons in the p29 gene were replaced by the least frequently used synonymous codons in Arabidopsis thaliana or melons. Mechanical inoculation of melon with p29 variants resulted in a loss of viral infectivity when all, one-half, or one-quarter of the gene was de-optimised. The effect of the de-optimisation in one-sixth of the gene was different depending on the de-optimised region. These results demonstrate that large-scale codon bias de-optimisation without amino acid substitutions of the p29 gene alter viral infectivity. PMID:23553455

  12. Reduction of Utility Usage in a Glyphosate Intermediate (GI) Unit 

    E-print Network

    Sander, M. L.

    2006-01-01

    Reduction of Utility Usage in a Glyphosate Intermediate (GI) Unit Michael L. Sander Manufacturing Technologist Monsanto Company Luling, Louisiana Plant ABSTRACT The Monsanto Company Luling Plant produces glyphosate intermediate (GI...

  13. Commercial Building HVAC Energy Usage in Semi-Tropical Climates

    E-print Network

    Worbs, H. E.

    1987-01-01

    requirements for commercial buildings. It is then suggested that this computer program would be valuable in determining the changes one could expect in annual energy usage by varying certain building design parameters. Secondly, a small office building actually...

  14. Life without tRNAArg-adenosine deaminase TadA: evolutionary consequences of decoding the four CGN codons as arginine in Mycoplasmas and other Mollicutes.

    PubMed

    Yokobori, Shin-ichi; Kitamura, Aya; Grosjean, Henri; Bessho, Yoshitaka

    2013-07-01

    In most bacteria, two tRNAs decode the four arginine CGN codons. One tRNA harboring a wobble inosine (tRNA(Arg)ICG) reads the CGU, CGC and CGA codons, whereas a second tRNA harboring a wobble cytidine (tRNA(Arg)CCG) reads the remaining CGG codon. The reduced genomes of Mycoplasmas and other Mollicutes lack the gene encoding tRNA(Arg)CCG. This raises the question of how these organisms decode CGG codons. Examination of 36 Mollicute genomes for genes encoding tRNA(Arg) and the TadA enzyme, responsible for wobble inosine formation, suggested an evolutionary scenario where tadA gene mutations first occurred. This allowed the temporary accumulation of non-deaminated tRNA(Arg)ACG, capable of reading all CGN codons. This hypothesis was verified in Mycoplasma capricolum, which contains a small fraction of tRNA(Arg)ACG with a non-deaminated wobble adenosine. Subsets of Mollicutes continued to evolve by losing both the mutated tRNA(Arg)CCG and tadA, and then acquired a new tRNA(Arg)UCG. This permitted further tRNA(Arg)ACG mutations with tRNA(Arg)GCG or its disappearance, leaving a single tRNA(Arg)UCG to decode the four CGN codons. The key point of our model is that the A-to-I deamination activity had to be controlled before the loss of the tadA gene, allowing the stepwise evolution of Mollicutes toward an alternative decoding strategy. PMID:23658230

  15. Proper Usage of Drugs and Chemicals in Food Animals

    E-print Network

    Faries Jr., Floron C.

    2002-02-15

    . Extra-label usage must be in accordance with a veterinarian/client/patient rela- tionship; a careful medical diagnosis; and a determi- nation by the attending veterinarian that available labeled products have been found clinically ineffec- tive...Federal regulations exist to ensure the proper distribution and usage of veterinary drugs and to prevent adulteration of the food supply with illegal drug residues through drug misuse in food produc- ing animals. The Food and Drug Administration...

  16. Seatbelt usage: is there an association with obesity?

    PubMed

    Behzad, B; King, D M; Jacobson, S H

    2014-09-01

    Wearing a seatbelt can prevent motor vehicle crash deaths. While primary seatbelt laws are designed to encourage vehicle passengers to wear seatbelts by allowing law enforcement officers to issue tickets when passengers do not wear seatbelts, discomfort may discourage obese individuals from wearing a seatbelt. The objective of this study is to assess the association between state-level obesity and seatbelt usage rates in the US, and to examine the possible role played by seatbelt laws in these associations. The strength of the association between obesity rates, seatbelt usage, and primary seatbelt laws at the state level is investigated using data from 2006 to 2011. Linear regression analysis is employed. This model estimates that increasing the obesity rate by 1% in a state where a primary seatbelt law (by which law enforcement officers can issue a ticket when seatbelts are not worn) is in effect is associated with a 0.06% decrease in seatbelt usage. However the same percentage of increase in the obesity rate in a state where no primary seatbelt law is in effect is associated with a 0.55% decrease in seatbelt usage. The magnitude of the statistical association between state obesity rates and state-level seatbelt usage is related to the existence of a primary seatbelt law, such that obesity has less impact on seatbelt usage in states where primary seatbelt laws are in effect. PMID:25183564

  17. A machine learning approach for detecting cell phone usage

    NASA Astrophysics Data System (ADS)

    Xu, Beilei; Loce, Robert P.

    2015-03-01

    Cell phone usage while driving is common, but widely considered dangerous due to distraction to the driver. Because of the high number of accidents related to cell phone usage while driving, several states have enacted regulations that prohibit driver cell phone usage while driving. However, to enforce the regulation, current practice requires dispatching law enforcement officers at road side to visually examine incoming cars or having human operators manually examine image/video records to identify violators. Both of these practices are expensive, difficult, and ultimately ineffective. Therefore, there is a need for a semi-automatic or automatic solution to detect driver cell phone usage. In this paper, we propose a machine-learning-based method for detecting driver cell phone usage using a camera system directed at the vehicle's front windshield. The developed method consists of two stages: first, the frontal windshield region localization using the deformable part model (DPM), next, we utilize Fisher vectors (FV) representation to classify the driver's side of the windshield into cell phone usage violation and non-violation classes. The proposed method achieved about 95% accuracy with a data set of more than 100 images with drivers in a variety of challenging poses with or without cell phones.

  18. Sex differences in the prognostic significance of KRAS codons 12 and 13, and BRAF mutations in colorectal cancer: a cohort study

    PubMed Central

    2013-01-01

    Background Activating KRAS and BRAF mutations predict unresponsiveness to EGFR-targeting therapies in colorectal cancer (CRC), but their prognostic value needs further validation. In this study, we investigated the impact of KRAS codons 12 and 13, and BRAF mutations on survival from CRC, overall and stratified by sex, in a large prospective cohort study. Methods KRAS codons 12 and 13, and BRAF mutations were analysed by pyrosequencing of tumours from 525 and 524 incident CRC cases in The Malmö Diet and Cancer Study. Associations with cancer-specific survival (CSS) were explored by Cox proportional hazards regression, unadjusted and adjusted for age, TNM stage, differentiation grade, vascular invasion and microsatellite instability (MSI) status. Results KRAS and BRAF mutations were mutually exclusive. KRAS mutations were found in 191/ 525 (36.4%) cases, 82.2% of these mutations were in codon 12, 17.3% were in codon 13, and 0.5% cases had mutations in both codons. BRAF mutations were found in 78/524 (14.9%) cases. Overall, mutation in KRAS codon 13, but not codon 12, was associated with a significantly reduced CSS in unadjusted, but not in adjusted analysis, and BRAF mutation did not significantly affect survival. However, in microsatellite stable (MSS), but not in MSI tumours, an adverse prognostic impact of BRAF mutation was observed in unadjusted, but not in adjusted analysis. While KRAS mutation status was not significantly associated with sex, BRAF mutations were more common in women. BRAF mutation was not prognostic in women; but in men, BRAF mutation was associated with a significantly reduced CSS in overall adjusted analysis (HR = 3.50; 95% CI = 1.41–8.70), but not in unadjusted analysis. In men with MSS tumours, BRAF mutation was an independent factor of poor prognosis (HR = 4.91; 95% CI = 1.99–12.12). KRAS codon 13 mutation was associated with a significantly reduced CSS in women, but not in men in unadjusted, but not in adjusted analysis. Conclusions Results from this cohort study demonstrate sex-related differences in the prognostic value of BRAF mutations in colorectal cancer, being particularly evident in men. These findings are novel and merit further validation. PMID:24020794

  19. Structural comparisons of heme binding proteins.

    PubMed

    Argos, P; Rossmann, M G

    1979-10-30

    Of the 82 three dimensionally characterized residues of cytochrome c551, 49 are found to be structurally and topologically equivalent to the globin fold and 41 are equivalent to the cytochrome b5 fold, with a respective root mean square separation of 3.5 and 4.9 A between equivalenced Calpha atoms. The common fold represents a central heme binding core, corresponding to the middle exon of certain globin genes. After superposition of the protein folds, the heme irons are found to be separated by 5.4 and 1.6 A, while their heme normals are inclined by 6 degrees and 32 degrees, respectively. Furthermore, the heme "face", determined by the asymmetric attachment of the vinyl and propionyl side chains, is directed similarly in all three heme proteins. The heme itself is rotated by 72 degrees and 116 degrees about its normal, respectively. The minimum base change per codon for the three pairwise comparisons corresponds to the expected value of random sequence comparisons. While all three heme proteins may have diverged from a common ancestor, their similarity may have arisen from the requirements of heme binding or the utilization of a particularly stable fold. Known structures within commonly accepted divergent families were superimposed in order to discriminate better between convergence and divergence. Minimum base changes per codon, number of deletions and insertions, percentage of equivalenced residues, precision of heme superposition, and root mean square separation of equivalenced Calpha atoms were tested as measures of evolutionary relationships. PMID:228705

  20. Chemistry & Biology, Vol. 9, 237244, February, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S1074-5521(02)00094-7 Exploring the Limits of Codon and Anticodon Size

    E-print Network

    Magliery, Thomas J.

    RNA slippage past an in-frame UGA codon. This slippage of tRNALeu at the sequence CUU UGA is also dependent inframe maintenance. decoding with slippage by a normal near-cognate tRNA at CCCC codons [12

  1. A Framework for Personal Web Usage Mining Yongjian Fu MingYi Shih

    E-print Network

    Fu, Yongjian

    A Framework for Personal Web Usage Mining Yongjian Fu Ming­Yi Shih Department of Computer Science­0350 Rolla, MO 65409­0350 yongjian@umr.edu mingyi@umr.edu Abstract In this paper, we propose to mine Web usage data on client side, or personal Web usage mining, as a complement to the server side Web usage

  2. A Framework for Personal Web Usage Mining Yongjian Fu Ming-Yi Shih

    E-print Network

    Fu, Yongjian

    A Framework for Personal Web Usage Mining Yongjian Fu Ming-Yi Shih Department of Computer Science-0350 Rolla, MO 65409-0350 yongjian@umr.edu mingyi@umr.edu Abstract In this paper, we propose to mine Web usage data on client side, or personal Web usage mining, as a complement to the server side Web usage

  3. An Interpretation of the Ancestral Codon from Miller’s Amino Acids and Nucleotide Correlations in Modern Coding Sequences

    PubMed Central

    Carels, Nicolas; de Leon, Miguel Ponce

    2015-01-01

    Purine bias, which is usually referred to as an “ancestral codon”, is known to result in short-range correlations between nucleotides in coding sequences, and it is common in all species. We demonstrate that RWY is a more appropriate pattern than the classical RNY, and purine bias (Rrr) is the product of a network of nucleotide compensations induced by functional constraints on the physicochemical properties of proteins. Through deductions from universal correlation properties, we also demonstrate that amino acids from Miller’s spark discharge experiment are compatible with functional primeval proteins at the dawn of living cell radiation on earth. These amino acids match the hydropathy and secondary structures of modern proteins. PMID:25922573

  4. High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

    PubMed

    Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

    2012-03-01

    The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry. PMID:22052258

  5. Detection of c-Ki-ras gene codon 12 mutations from pancreatic duct brushings in the diagnosis of pancreatic tumours.

    PubMed Central

    Van Laethem, J L; Vertongen, P; Deviere, J; Van Rampelbergh, J; Rickaert, F; Cremer, M; Robberecht, P

    1995-01-01

    Differential diagnosis of pancreatic cancer and chronic pancreatitis is sometimes difficult and cytological examination of brushings or aspirated material collected during endoscopic retrograde cholangiopancreatography (ERCP) remains disappointing. As point mutations in codon 12 of the c-Ki-ras 2 gene are found in most pancreatic adenocarcinoma and not in chronic pancreatitis, this study analysed prospectively the presence of these mutations in brushing samples collected during ERCP in 45 patients (26 males, 19 females) showing a dominant stricture of the main pancreatic duct at pancreatography: 24 with pancreatic adenocarcinoma, 16 with chronic pancreatitis, and five intraductal mucin hypersecreting neoplasms. Twenty of 45 patients presented equivocal ERCP findings that did not permit a definite diagnosis. Ki-ras mutations at codon 12 were detected using a rapid and sensitive method based on polymerase chain reaction mediated restriction fragment length polymorphism analysis and confirmed by direct sequencing of polymerase chain reaction products. Results were compared with those provided by routine brush cytology. A definitive diagnosis was established for each patient. Mutations were detected in 20 of 24 patients with pancreatic adenocarcinoma (83%), but in none of the chronic pancreatitis patients and intraductal mucin hypersecreting neoplasms, irrespective of their location. By contrast, only 13 of 24 pancreatic adenocarcinoma (54%) were detected by conventional cytological examination, which yielded four false negative and seven non-contributive results. Sensitivity, specificity, and accuracy of molecular biological and cytological methods were 83%-76%, 100-83%, and 90%-58%, respectively. Notably the mutations could be detected in six patients with small tumour size (< or = 2 cm). In conclusion, Ki-ras analysis performed on pancreatic brushing samples is an efficient procedure, more accurate than cytology in the diagnosis of pancreatic adenocarcinoma, and highly specific in the differentiation between neoplastic and chronic inflammatory ductal changes, especially in patients showing inconclusive ERCP findings. Images Figure 1 Figure 2 PMID:7797131

  6. A large number of nuclear genes in the human parasite blastocystis require mRNA polyadenylation to create functional termination codons.

    PubMed

    Klimeš, Vladimír; Gentekaki, Eleni; Roger, Andrew J; Eliáš, Marek

    2014-08-01

    Termination codons in mRNA molecules are typically specified directly by the sequence of the corresponding gene. However, in mitochondria of a few eukaryotic groups, some mRNAs contain the termination codon UAA deriving one or both adenosines from transcript polyadenylation. Here, we show that a similar phenomenon occurs for a substantial number of nuclear genes in Blastocystis spp., divergent unicellular eukaryote gut parasites. Our analyses of published genomic data from Blastocystis sp. subtype 7 revealed that polyadenylation-mediated creation of termination codons occurs in approximately 15% of all nuclear genes. As this phenomenon has not been noticed before, the procedure previously employed to annotate the Blastocystis nuclear genome sequence failed to correctly define the structure of the 3'-ends of hundreds of genes. From sequence data we have obtained from the distantly related Blastocystis sp. subtype 1 strain, we show that this phenomenon is widespread within the Blastocystis genus. Polyadenylation in Blastocystis appears to be directed by a conserved GU-rich element located four nucleotides downstream of the polyadenylation site. Thus, the highly precise positioning of the polyadenylation in Blastocystis has allowed reduction of the 3'-untranslated regions to the point that, in many genes, only one or two nucleotides of the termination codon are left. PMID:25015079

  7. A Large Number of Nuclear Genes in the Human Parasite Blastocystis Require mRNA Polyadenylation to Create Functional Termination Codons

    PubMed Central

    Klimeš, Vladimír; Gentekaki, Eleni; Roger, Andrew J.; Eliáš, Marek

    2014-01-01

    Termination codons in mRNA molecules are typically specified directly by the sequence of the corresponding gene. However, in mitochondria of a few eukaryotic groups, some mRNAs contain the termination codon UAA deriving one or both adenosines from transcript polyadenylation. Here, we show that a similar phenomenon occurs for a substantial number of nuclear genes in Blastocystis spp., divergent unicellular eukaryote gut parasites. Our analyses of published genomic data from Blastocystis sp. subtype 7 revealed that polyadenylation-mediated creation of termination codons occurs in approximately 15% of all nuclear genes. As this phenomenon has not been noticed before, the procedure previously employed to annotate the Blastocystis nuclear genome sequence failed to correctly define the structure of the 3?-ends of hundreds of genes. From sequence data we have obtained from the distantly related Blastocystis sp. subtype 1 strain, we show that this phenomenon is widespread within the Blastocystis genus. Polyadenylation in Blastocystis appears to be directed by a conserved GU-rich element located four nucleotides downstream of the polyadenylation site. Thus, the highly precise positioning of the polyadenylation in Blastocystis has allowed reduction of the 3?-untranslated regions to the point that, in many genes, only one or two nucleotides of the termination codon are left. PMID:25015079

  8. Interspecific adaptation by binary choice at de novo polyomavirus T antigen site through accelerated codon-constrained Val-Ala toggling within an intrinsically disordered region

    PubMed Central

    Lauber, Chris; Kazem, Siamaque; Kravchenko, Alexander A.; Feltkamp, Mariet C.W.; Gorbalenya, Alexander E.

    2015-01-01

    It is common knowledge that conserved residues evolve slowly. We challenge generality of this central tenet of molecular biology by describing the fast evolution of a conserved nucleotide position that is located in the overlap of two open reading frames (ORFs) of polyomaviruses. The de novo ORF is expressed through either the ALTO protein or the Middle T antigen (MT/ALTO), while the ancestral ORF encodes the N-terminal domain of helicase-containing Large T (LT) antigen. In the latter domain the conserved Cys codon of the LXCXE pRB-binding motif constrains codon evolution in the overlapping MT/ALTO ORF to a binary choice between Val and Ala codons, termed here as codon-constrained Val-Ala (COCO-VA) toggling. We found the rate of COCO-VA toggling to approach the speciation rate and to be significantly accelerated compared to the baseline rate of chance substitution in a large monophyletic lineage including all viruses encoding MT/ALTO and three others. Importantly, the COCO-VA site is located in a short linear motif (SLiM) of an intrinsically disordered region, a typical characteristic of adaptive responders. These findings provide evidence that the COCO-VA toggling is under positive selection in many polyomaviruses, implying its critical role in interspecific adaptation, which is unprecedented for conserved residues. PMID:25904630

  9. Investigation of HER2 codon 655 single nucleotide polymorphism frequency and c-ErbB-2 protein expression alterations in gastric cancer patients

    Microsoft Academic Search

    Ferda Bir; Nese Calli-Demirkan; N Lale Satiroglu-Tufan

    2006-01-01

    AIM: To investigate both whether the risk of gastric cancer is associated with the Ile\\/Val single nucleotide polymorphism (SNP) of human epidermal growth factor receptor-2 (HER-2 ) transmembrane domain-coding re- gion at codon 655 and the suggested existence of HER-2 expression in gastric cancer cases in a Turkish patient group.

  10. Interspecific adaptation by binary choice at de novo polyomavirus T antigen site through accelerated codon-constrained Val-Ala toggling within an intrinsically disordered region.

    PubMed

    Lauber, Chris; Kazem, Siamaque; Kravchenko, Alexander A; Feltkamp, Mariet C W; Gorbalenya, Alexander E

    2015-05-26

    It is common knowledge that conserved residues evolve slowly. We challenge generality of this central tenet of molecular biology by describing the fast evolution of a conserved nucleotide position that is located in the overlap of two open reading frames (ORFs) of polyomaviruses. The de novo ORF is expressed through either the ALTO protein or the Middle T antigen (MT/ALTO), while the ancestral ORF encodes the N-terminal domain of helicase-containing Large T (LT) antigen. In the latter domain the conserved Cys codon of the LXCXE pRB-binding motif constrains codon evolution in the overlapping MT/ALTO ORF to a binary choice between Val and Ala codons, termed here as codon-constrained Val-Ala (COCO-VA) toggling. We found the rate of COCO-VA toggling to approach the speciation rate and to be significantly accelerated compared to the baseline rate of chance substitution in a large monophyletic lineage including all viruses encoding MT/ALTO and three others. Importantly, the COCO-VA site is located in a short linear motif (SLiM) of an intrinsically disordered region, a typical characteristic of adaptive responders. These findings provide evidence that the COCO-VA toggling is under positive selection in many polyomaviruses, implying its critical role in interspecific adaptation, which is unprecedented for conserved residues. PMID:25904630

  11. Genome-Wide Analysis Reveals Diverged Patterns of Codon Bias, Gene Expression, and Rates of Sequence Evolution in Picea Gene Families

    PubMed Central

    De La Torre, Amanda R.; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K.

    2015-01-01

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms. PMID:25747252

  12. The C-terminal domain of eukaryotic initiation factor 5 promotes start codon recognition by its dynamic interplay with eIF1 and eIF2?.

    PubMed

    Luna, Rafael E; Arthanari, Haribabu; Hiraishi, Hiroyuki; Nanda, Jagpreet; Martin-Marcos, Pilar; Markus, Michelle A; Akabayov, Barak; Milbradt, Alexander G; Luna, Lunet E; Seo, Hee-Chan; Hyberts, Sven G; Fahmy, Amr; Reibarkh, Mikhail; Miles, David; Hagner, Patrick R; O'Day, Elizabeth M; Yi, Tingfang; Marintchev, Assen; Hinnebusch, Alan G; Lorsch, Jon R; Asano, Katsura; Wagner, Gerhard

    2012-06-28

    Recognition of the proper start codon on mRNAs is essential for protein synthesis, which requires scanning and involves eukaryotic initiation factors (eIFs) eIF1, eIF1A, eIF2, and eIF5. The carboxyl terminal domain (CTD) of eIF5 stimulates 43S preinitiation complex (PIC) assembly; however, its precise role in scanning and start codon selection has remained unknown. Using nuclear magnetic resonance (NMR) spectroscopy, we identified the binding sites of eIF1 and eIF2? on eIF5-CTD and found that they partially overlapped. Mutating select eIF5 residues in the common interface specifically disrupts interaction with both factors. Genetic and biochemical evidence indicates that these eIF5-CTD mutations impair start codon recognition and impede eIF1 release from the PIC by abrogating eIF5-CTD binding to eIF2?. This study provides mechanistic insight into the role of eIF5-CTD's dynamic interplay with eIF1 and eIF2? in switching PICs from an open to a closed state at start codons. PMID:22813744

  13. MESUR: USAGE-BASED METRICS OF SCHOLARLY IMPACT

    SciTech Connect

    BOLLEN, JOHAN [Los Alamos National Laboratory; RODRIGUEZ, MARKO A. [Los Alamos National Laboratory; VAN DE SOMPEL, HERBERT [Los Alamos National Laboratory

    2007-01-30

    The evaluation of scholarly communication items is now largely a matter of expert opinion or metrics derived from citation data. Both approaches can fail to take into account the myriad of factors that shape scholarly impact. Usage data has emerged as a promising complement to existing methods o fassessment but the formal groundwork to reliably and validly apply usage-based metrics of schlolarly impact is lacking. The Andrew W. Mellon Foundation funded MESUR project constitutes a systematic effort to define, validate and cross-validate a range of usage-based metrics of schlolarly impact by creating a semantic model of the scholarly communication process. The constructed model will serve as the basis of a creating a large-scale semantic network that seamlessly relates citation, bibliographic and usage data from a variety of sources. A subsequent program that uses the established semantic network as a reference data set will determine the characteristics and semantics of a variety of usage-based metrics of schlolarly impact. This paper outlines the architecture and methodology adopted by the MESUR project and its future direction.

  14. Standard for Inert Cryogenic Liquid Usage in the Laboratory Page 1 of 4 Standard for Inert Cryogenic Liquid Usage in the Laboratory

    E-print Network

    Chan, Hue Sun

    safety precautions to be taken when working with inert cryogenics, and is based on standard industry_______________________________________________________________________ Standard for Inert Cryogenic Liquid Usage in the Laboratory Page 1 of 4 March 2009 Standard for Inert Cryogenic Liquid Usage

  15. No association of TP53 codon 72 SNP with male infertility: a study in a Chinese population and a meta-analysis.

    PubMed

    Chan, Ying; Jiang, Hongguo; Ma, Lan; Chen, Jinbao; Li, Dongya; Meng, Yushi; Luo, Ying; Tang, Wenru

    2015-08-01

    Genetic polymorphisms may affect human male fertility. Even though TP53 plays a role in spermatogenesis we know little about the association of the functional polymorphism at codon 72 of TP53 with respect to susceptibility to male infertility. We conducted a case-control study to investigate this association in a Chinese population and performed a meta-analysis in different populations to clarify this association. The single nucleotide polymorphism (SNP) of TP53 codon 72 (rs1042522 G>C) was genotyped by PCR-RFLP in 83 Chinese male infertility patients and 401 healthy controls. Meta-analysis was performed using the data from four currently available studies. The data from our study were overlayed using the v.9.0 STATA software package. We observed no association between the TP53 codon 72 polymorphism and male infertility (p?=?0.84, OR?=?1.04, 95% CI, 0.74-1.45). Meta-analysis confirmed the case-control result that there was no significant association between the codon 72 polymorphism of TP53 and male infertility (Pro vs. Arg; p?=?0.31, OR?=?0.86, 95% CI, 0.65-1.15; Pro/Pro vs. Arg-carriers; p?=?0.65, OR?=?0.91, 95% CI, 0.61-1.36; Pro-carriers vs. Arg/Arg: p?=?0.15, OR?=?0.75, 95% CI, 0.51-1.11). The data presented in this communication supports the view that the codon 72 polymorphism of TP53 may not contribute to male infertility susceptibility in the Chinese population. PMID:25747431

  16. Commercial Building Tenant Energy Usage Aggregation and Privacy

    SciTech Connect

    Livingston, Olga V.; Pulsipher, Trenton C.; Anderson, David M.; Wang, Na

    2014-10-31

    A growing number of building owners are benchmarking their building energy use. This requires the building owner to acquire monthly whole-building energy usage information, which can be challenging for buildings in which individual tenants have their own utility meters and accounts with the utility. Some utilities and utility regulators have turned to aggregation of customer energy use data (CEUD) as a way to give building owners whole-building energy usage data while protecting customer privacy. Meter profile aggregation adds a layer of protection that decreases the risk of revealing CEUD as the number of meters aggregated increases. The report statistically characterizes the similarity between individual energy usage patterns and whole-building totals at various levels of meter aggregation.

  17. 1. Cooling water is one-third of US water usage Basic approach: (a) estimate power consumption, from which you estimate cooling water usage

    E-print Network

    Nimmo, Francis

    water bill, water costs around 0.1 cents per gallon (or 103 times the cost of bottled water!). But we1. Cooling water is one-third of US water usage Basic approach: (a) estimate power consumption, from which you estimate cooling water usage and compare with (b) estimate of other water usage. (a

  18. Usage of an Internet smoking cessation resource: the Australian QuitCoach

    PubMed Central

    Balmford, James; Borland, Ron; Li, Lin; Ferretter, Ian

    2015-01-01

    Introduction and Aims The QuitCoach (www.quitcoach.org.au) is a tailored, Internet-delivered smoking cessation advice program. This paper compares QuitCoach users both with smokers in general, and with callers to a telephone-based smoking cessation service (the Victorian Quitline). It also explores patterns of QuitCoach usage by time of year and day of the week. Design and Methods Data are from responses to the QuitCoach online assessment collected between 2003–2007 (n=28,247). Comparison data are from the Victorian Quitline service, from the first five waves of the International Tobacco Control Four Country Survey, the 2004–05 National Health Survey, and from anti-smoking TARPS for Australia. Results QuitCoach users were more likely to be female and younger than both smokers in general, and Quitline users. They were intermediate in nicotine dependence. QuitCoach users are less likely to have just quit than Quitline callers. Half of QuitCoach users first use after setting a quit date. Usage is related to anti-smoking advertising and to day of week, being highest earlier in the week. Conclusions The QuitCoach successfully targets the moderately addicted. Use is sensitive to anti-smoking campaigns. There is a need for greater promotion of the QuitCoach as a resource with the capacity to meet the needs of those already quit and those still uncertain as to whether to try. PMID:19320678

  19. Bioinformatics survey of the metal usage by psychrophilic yeast Glaciozyma antarctica PI12.

    PubMed

    Foong, Pik Mun; Abedi Karjiban, Roghayeh; Normi, Yahaya M; Salleh, Abu Bakar; Abdul Rahman, Mohd Basyaruddin

    2015-01-01

    Metal ions are one of the essential elements which are extensively involved in many cellular activities. With rapid advancements in genome sequencing techniques, bioinformatics approaches have provided a promising way to extract functional information of a protein directly from its primary structure. Recent findings have suggested that the metal content of an organism can be predicted from its complete genome sequences. Characterizing the biological metal usage of cold-adapted organisms may help to outline a comprehensive understanding of the metal-partnerships between the psychrophile and its adjacent environment. The focus of this study is targeted towards the analysis of the metal composition of a psychrophilic yeast Glaciozyma antarctica PI12 isolated from sea ice of Antarctica. Since the cellular metal content of an organism is usually reflected in the expressed metal-binding proteins, the putative metal-binding sequences from G. antarctica PI12 were identified with respect to their sequence homologies, domain compositions, protein families and cellular distribution. Most of the analyses revealed that the proteome was enriched with zinc, and the content of metal decreased in the order of Zn > Fe > Mg > Mn, Ca > Cu. Upon comparison, it was found that the metal compositions among yeasts were almost identical. These observations suggested that G. antarctica PI12 could have inherited a conserved trend of metal usage similar to modern eukaryotes, despite its geographically isolated habitat. PMID:25412156

  20. 1997 RECS data on consumer usage of appliances

    SciTech Connect

    Latta, R.B.

    1998-07-01

    The 1997 Residential Energy Consumption Survey (RECS) conducted by the Energy Information Administration contained questions on how households use various appliances. This includes the following appliance usage (1) personnel computers, (2) cooking appliances, (3) conventional ovens, (4) microwave ovens, (5) clothes washers, and (6) clothes dryer. Many of these items were first collected in the 1997 RECS. In this paper, appliance usage by household demographic characteristics (household income, age of householder, and number of household members) are examined with an emphasis on results for data items that were first collected in the 1997 RECS.

  1. Consumer Issues: Credit Usage, Money Management, and Bankruptcy.

    ERIC Educational Resources Information Center

    Allen, Judy L.

    During the past 10 years, consumers have experienced a substantial growth in credit and an unprecedented increase in the rate of inflation. As increases in credit usage continue to outpace increases in real income and as savings rates decline, consumers are increasingly likely to suffer financial problems and are increasingly in need of money…

  2. Assessing Usage and Maximizing Finance Lab Impact: A Case Exploration

    ERIC Educational Resources Information Center

    Noguera, Magdy; Budden, Michael Craig; Silva, Alberto

    2011-01-01

    This paper reports the results of a survey conducted to assess students' usage and perceptions of a finance lab. Finance labs differ from simple computer labs as they typically contain data boards, streaming market quotes, terminals and software that allow for real-time financial analyses. Despite the fact that such labs represent significant and…

  3. Power Usage and Electrical Circuit Analysis for Electric Arc Furnaces

    Microsoft Academic Search

    J. J. Trageser

    1980-01-01

    Power usage in ultrahigh-powered electric arc furnaces requires considerably more investigation into system parameters, furnace secondary circuit analysis, and operating characteristics than previously given to normal powered electric arc furnaces. The power input must be analyzed from the infinite electric utility bus to the arc at the electrode. All interested parties must participate in the analysis to assure a mutual

  4. LOGML: Log Markup Language for Web Usage Mining

    Microsoft Academic Search

    John R. Punin; Mukkai S. Krishnamoorthy; Mohammed Javeed Zaki

    2001-01-01

    Web Usage Mining refers to the discovery of interesting in- formation from user navigational behavior as stored in web access logs. While extracting simple information from web logs is easy, mining complex structural information is very challenging. Data cleaning and preparation constitute a very signiÞcant eort before mining can even be applied. We propose two new XML applications, XGMML and

  5. An Autonomic Approach to Integrated HPC Grid and Cloud Usage

    Microsoft Academic Search

    Hyunjoo Kim; Y. el-Khamra; S. Jha; M. Parashar

    2009-01-01

    Clouds are rapidly joining high-performance Grids as viable computational platforms for scientific exploration and discovery, and it is clear that production computational infrastructures will integrate both these paradigms in the near future. As a result, understanding usage modes that are meaningful in such a hybrid infrastructure is critical. For example, there are interesting application workflows that can benefit from such

  6. Usage Patterns to Provision for Scientific Experimentation in Clouds

    Microsoft Academic Search

    Eran Chinthaka Withana; Beth Plale

    2010-01-01

    Driven by the need to provision resources on demand, scientists are turning to commercial and research test-bed Cloud computing resources to run their scientific experiments. Job scheduling on cloud computing resources, unlike earlier platforms, is a balance between throughput and cost of executions. Within this context, we posit that usage patterns can improve the job execution, because these patterns allow

  7. PATRICK TORT ET L'USAGE DIALECTIQUE DE Grald FOURNIER

    E-print Network

    Paris-Sud XI, Université de

    natural selection. We shall show, on the contrary, that Darwin's view remains biology-centered even when and criticize a particular reading (that we may call `dialectic') of Charles Darwin's anthropological view. We1 PATRICK TORT ET L'USAGE DIALECTIQUE DE DARWIN Gérald FOURNIER Doctorant à l'Université de Lyon

  8. Use of Astronomical Literature - A Report on Usage Patterns

    Microsoft Academic Search

    Edwin A. Henneken; Michael J. Kurtz; Alberto Accomazzi; Carolyn Stern-grant; Donna M. Thompson; Elizabeth Bohlen; Stephen S. Murray

    2008-01-01

    In this paper we present a number of metrics for usage of the SAO\\/NASA Astrophysics Data System (ADS). Since the ADS is used by the entire astronomical community, these are indica- tive of how the astronomical literature is used. We will show how the use of the ADS has changed both quantitatively and qualitatively. We will also show that different

  9. Quantifying Wikipedia Usage Patterns Before Stock Market Moves

    E-print Network

    Stanley, H. Eugene

    of the final execution of a chosen action, such as a trade recorded at a stock exchange. Instead, within , unemployment rates24,25 , tourist numbers25 , and trading volumes in the US stock markets26,27 . A recent studyQuantifying Wikipedia Usage Patterns Before Stock Market Moves Helen Susannah Moat1,2,3 , Chester

  10. MEASUREMENT-BASED USAGE CHARGES IN COMMUNICATIONS NETWORKS

    E-print Network

    Weber, Richard

    to exercise control. The congestion that has plagued the Internet because it lacks any mechanism for charging and pricing highlights the fact that without charges it is di cult to control congestion or divide networkMEASUREMENT-BASED USAGE CHARGES IN COMMUNICATIONS NETWORKS COSTAS COURCOUBETIS ICS

  11. Usage of photovoltaics in an automated irrigation system

    Microsoft Academic Search

    A. R. Al-Ali; S. Rehman; S. Al-Agili; M. H. Al-Omari; M. Al-Fayezi

    2001-01-01

    This study presents the usage of photovoltaic electricity in an automated irrigation system. The experimental setup consists of the controller, control valves, photovoltaic (PV) panels, back up batteries, and sensors. The system is capable of irrigating the fields at a pre-specified time, day\\/s of the week, and duration. It can also automatically irrigate the field if the soil is dried

  12. Electronic Book Usage: A Survey at the University of Denver

    ERIC Educational Resources Information Center

    Levine-Clark, Michael

    2006-01-01

    In the spring of 2005, the University of Denver's Penrose Library conducted a survey of its users to determine their degree of awareness of electronic books, how and why they use them, and their level of satisfaction with the format. It is clear from vendor-supplied usage statistics that electronic books are used, but it is not clear how or why…

  13. Improving Home Automation by Discovering Regularly Occurring Device Usage Patterns

    E-print Network

    Cook, Diane J.

    Improving Home Automation by Discovering Regularly Occurring Device Usage Patterns Edwin O in an environment can be mined to discover significant patterns, which an intelligent agent could use to automate of two prediction algorithms, thus demonstrating multiple uses for a home automation system. Finally, we

  14. Energy Usage Attitudes of Urban India IBM Research India

    E-print Network

    Toronto, University of

    Energy Usage Attitudes of Urban India Mohit Jain IBM Research India mohitjain@in.ibm.com Deepika@cs.cmu.edu Amarjeet Singh IIIT Delhi, India amarjeet@iiitd.ac.in Abstract-- Though rapid increase in energy factors affecting energy consumption in urban India. However, the small numbers of participants in those

  15. Agriculture and Life Sciences Complex Usage Request Form

    E-print Network

    : __________________________________________________________________ Departmental Affiliation (if applicable): _____________________________________________________ Date(s Phone: Cell Phone: Email: I agree to limit the extent of this usage to the area(s), date(s), time and completely wipe up any spills and to immediately report any damages or disturbances to the building manager

  16. Personalizing Web Directories with the Aid of Web Usage Data

    E-print Network

    Paliouras, George

    Personalizing Web Directories with the Aid of Web Usage Data Dimitrios Pierrakos, Member, IEEE of Community Web Directories, a concept that we introduced in our recent work, applying personalization to Web directories. In this context, the Web directory is viewed as a thematic hierarchy and personalization

  17. A Web Usage Mining Framework for Web Directories Personalization

    E-print Network

    Kouroupetroglou, Georgios

    A Web Usage Mining Framework for Web Directories Personalization Dimitrios Pierrakos Department framework that combines Web personalization and Web directories, which results in the concept of Community Web Directories. Community Web directories is a novel form of personalization performed on Web

  18. Personality and Patterns of Facebook Usage Yoram Bachrach

    E-print Network

    Rajamani, Sriram K.

    Personality and Patterns of Facebook Usage Yoram Bachrach Microsoft Research yobach.ac.uk ABSTRACT We show how users' activity on Facebook relates to their per- sonality, as measured by the standard Five Factor Model. Our dataset consists of the personality profiles and Facebook pro- file data

  19. MINING SPECTRUM USAGE DATA: A LARGE-SCALE SPECTRUM MEASUREMENT

    E-print Network

    Liu, Mingyan

    1 MINING SPECTRUM USAGE DATA: A LARGE-SCALE SPECTRUM MEASUREMENT STUDY Sixing Yin , Dawei Chen,qianzh}@cse.ust.hk University of Michigan mingyan@eecs.umich.edu November 19, 2009 DRAFT #12;Abstract Dynamic spectrum access calls for a deeper understanding of the characteristics of current spectrum utilization. In this paper

  20. Patterns of Emoticon Usage in ESL Students' Discussion Forum Writing

    ERIC Educational Resources Information Center

    Halvorsen, Andy

    2012-01-01

    This mixed-methods study looks at patterns of emoticon usage in adult, ESL student writing. Data are drawn from 13 students and their participation in online discussion forums designed to supplement a traditional ESL writing course. The study conceptualizes computer mediated communication as a hybridized and emergent form which utilizes features…

  1. Characterization and usage of sexed semen from US field data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives were to characterize sexed semen available and its usage from US field data. This included investigating active Holstein proven bulls with sexed semen available, as well as percentages and frequencies of sexed semen matings for heifers and cows. Herds were also characterized for the...

  2. Clustering Dynamic Web Usage Data Alzennyr da Silva1

    E-print Network

    Rossi, Fabrice

    techniques in order to develop methods that allow relevant information to be extracted from Web data (such management. In the e-commerce domain, for example, one of the most important motivations for the analysis of usage is the need to build up consumer loyalty and to make the site more appealing to new visitors. Ac

  3. Clustering Dynamic Web Usage Data Alzennyr da Silva1

    E-print Network

    Paris-Sud XI, Université de

    visitors. Ac- curate Web usage information could help to attract new customers, retain current customers techniques in order to develop methods that allow relevant information to be extracted from Web data (such website management. In the e-commerce domain, for example, one of the most important motivations

  4. Usage-Based Collection Evaluation with a Curricular Focus

    ERIC Educational Resources Information Center

    Kohn, Karen C.

    2013-01-01

    Systematic evaluation of a library's collection can be a useful tool for collection development. After reviewing three evaluation methods and their usefulness for our small academic library, I undertook a usage-based evaluation, focusing on narrow segments of our collection that served specific undergraduate courses. For each section, I collected…

  5. Advanced American Idioms: A Guide to Everyday Usage.

    ERIC Educational Resources Information Center

    Allan, Edward Jay

    A guide to several hundred common American idioms and slang phrases such as "to get something straight,""to mooch," and "in the bag" provides definitions, examples of usage, variations, and explanations when appropriate. A list of common abbreviations, such as "ASAP," and their referents is also included. (MSE)

  6. Investigating Students' Usage and Acceptance of Electronic Books

    ERIC Educational Resources Information Center

    Sieche, Susan; Krey, Birte; Bastiaens, Theo

    2013-01-01

    The purpose of this study is to investigate students' usage and acceptance of electronic books. Factors correlating with students' attitude towards e-books were examined using the Technology Acceptance Model (Davis, Bagozzi, & Warshaw 1989). A questionnaire was administered online for students at University of Hagen. Results indicate…

  7. The pill: Perceptions and usage among Nigerian students

    Microsoft Academic Search

    J. I. B. Adinma; A. O. Okeke

    1993-01-01

    The knowledge and use of oral contraception were investigated in 498 students from 5 tertiary institutions in south-eastern Nigeria. Awareness of the pill was high (92.2%) but usage was comparatively low (17.5%). Post-coital oral contraception was more often used (11.5%) than the other types.

  8. Identifying Diverse Usage Behaviors of Smartphone Apps University of Michigan

    E-print Network

    Fisher, Kathleen

    of mobile apps is rising dramatically due to the accelerating rate of adoption of smartphones. For exam- ple such as the AppStore on iOS, Market on Android, and MarketPlace on Windows Mobile, popu- lar smartphone platformsIdentifying Diverse Usage Behaviors of Smartphone Apps Qiang Xu University of Michigan Ann Arbor

  9. Identifying Diverse Usage Behaviors of Smartphone Apps University of Michigan

    E-print Network

    Mao, Zhuoqing Morley

    such as the AppStore on iOS, Market on Android, and MarketPlace on Windows Mobile, popu- lar smartphone platformsIdentifying Diverse Usage Behaviors of Smartphone Apps Qiang Xu University of Michigan Ann Arbor are increasingly shifting to using apps as "gate- ways" to Internet services rather than traditional web browsers

  10. A Framework for Educational Computer Usage. K-12.

    ERIC Educational Resources Information Center

    Berry, Julia; And Others

    A framework for educational computer usage in grades K-12 is outlined. For each grade level, objectives are shown for the following knowledge areas: computer-related terminology and use; history and development of computers; the use of the computer as a tool; communicating instructions to the computer; social implications; and robotics. Suggested…

  11. Demographic and motivation variables associated with Internet usage activities

    Microsoft Academic Search

    Thompson S. H. Teo

    2001-01-01

    Examines demographic variables (gender, age, educational level) and motivation variables (perceived ease of use, perceived enjoyment, perceived usefulness) associated with Internet usage activities (defined in terms of messaging, browsing, downloading and purchasing). A total of 1,370 usable responses were obtained using a Web page survey. Results showed that males are more likely to engage in downloading and purchasing activities while

  12. School Counselor Dispositions as Predictors of Data Usage

    ERIC Educational Resources Information Center

    Holcomb-McCoy, Cheryl; Gonzalez, Ileana; Johnston, Georgina

    2009-01-01

    This article examined school counselor dispositions (e.g., general self-efficacy, counselor self-efficacy, openness to change, commitment to counseling improvement/professional development) that predict data usage among K-12 professional school counselors. For the study, 130 professional school counselors from Maryland and Virginia completed the…

  13. On and off-campus computer usage in engineering education

    Microsoft Academic Search

    Stuart Palmer

    2000-01-01

    Computers and information technology play an important role in engineering education at the School of Engineering and Technology, Deakin University, Australia. Experience has shown that there are significant demographic differences between on- and off-campus engineering student groups. It was thought that the differences in the student groups might also lead to differences in computer usage patterns between the groups. A

  14. Developing a Scale on the Usage of Learner Control Strategy

    ERIC Educational Resources Information Center

    Kutlu, M. Oguz

    2012-01-01

    The aim of this study was to develop a Likert-like scale in order to measure teachers' usage level of learner control strategy. This study was carried out with 219 State primary school teachers who were class teachers, Turkish teachers, English teachers, Mathematics teachers, Science teachers, Social Sciences teachers, Religion and Moral teachers…

  15. Dielectric permeability measurements with waveguide Bragg structure usage

    Microsoft Academic Search

    V. Oliynik; D. Makarov; V. Danilov

    2005-01-01

    Usage of waveguide 1D Bragg structures allows proposing the method of the dielectric permeability measurements in 8-mm range of wavelength. Method is based on the phase-sensitive properties of a transmission peak in the band gap of waveguide distributed Bragg structure in K-band

  16. Data-Purpose Algebra: Modeling Data Usage Policies

    Microsoft Academic Search

    Chris Hanson; Tim Berners-lee; Lalana Kagal; Gerald J. Sussman; Daniel J. Weitzner

    2007-01-01

    Data is often encumbered by restrictions on the ways in which it may be used. These restrictions on usage may be determined by statute, by contract, by custom, or by com- mon decency, and they are used to control collection of data, diffusion of data, and the inferences that can be made over the data. In this paper, we present

  17. Geography Teachers' Usage of the Internet for Education Purposes

    ERIC Educational Resources Information Center

    Sezer, Adem

    2010-01-01

    The purpose of this study is to determine geography teachers' use of the Internet for education purposes and the extent to which Turkish Internet sites can fulfill the needs and requirements of geography teachers' Internet usage. Research is carried out using the screening method. Data were collected by means of a measurement tool that was…

  18. Access to and Usage of Offshore Liberty Ship

    E-print Network

    Access to and Usage of Offshore Liberty Ship Reefs in Texas ROBERT B. DITTON, ALAN R. GRAEFE, ANTHONY J. FEDLER, and JOHN D. SCHWARTZ Sinking aLiberty Ship offthe Texas coast. Texas Coastal and Marine for surplus Liberty Ships and to use these ships for establish- ABSTRACT-Allhou[?h arlificial reefs have been

  19. Factors relating to home telehealth acceptance and usage compliance

    PubMed Central

    Wade, Rachael; Cartwright, Colleen; Shaw, Kelly

    2012-01-01

    Aim This paper investigates the acceptance of in-home telehealth by frail older adults and carers of the Transition Care Program (TCP), and evaluates telehealth acceptance as a predictor for usage compliance. Method A stratified random sample of participants was allocated to one of five groups: either a control group or to receive telehealth monitoring of their vital signs for a period of 12 or 24 weeks; with or without a medical alarm pendant. Results Before being trained in and using telehealth, the majority of participants and carers demonstrated acceptance of the technology by reporting that they perceived it would be “useful” and “easy to use.” This acceptance was also reported post-TCP (up to 12 weeks of usage). The “perceived ease of use” of the telehealth equipment increased significantly from pre-telehealth training and usage to post-TCP (up to 12 weeks of usage) (P = 0.001). There was no change, (pre-training and usage to post-TCP) in the “perceived usefulness” of the telehealth equipment. The telehealth acceptance constructs of “ease of use” and “usefulness,” at pre-telehealth training and usage, approached statistical significance as a predictor of future compliance (P = 0.06). “Perceived ease of use,” at pre-training and usage, had a positive relationship with future compliance (P = 0.02). Conclusion There is currently limited knowledge about the influences and determinants of home telehealth compliance in frail older people and their carers, potentially a significant user group for the technology into the future. This study’s finding that frail older people and their carers perceive that home telehealth is useful and easy to use demonstrates their acceptance of home telehealth as a therapeutic tool. Further, perceived ease of use of home telehealth is a significant predictor of compliance with frail older people and their carers’ use of home telehealth. Additional research is required in order to identify other influences and determinants of home telehealth compliance with this group. Knowledge about the influences and determinants of home telehealth compliance may assist the development of targeted interventions aimed at encouraging high compliance with users who are recording lower reading rates. PMID:22570580

  20. Agricultural pesticide usage and prioritization in South Korea.

    PubMed

    Cha, Eun Shil; Jeong, Mihye; Lee, Won Jin

    2014-01-01

    This study aims to review agricultural pesticide usage and trends and to identify hazardous pesticides for regulation, in terms of public health, in South Korea. The authors collected data on usage and trends of agricultural pesticides through agriculture-related databases. Criteria from the US Environmental Protection Agency classification for carcinogenicity, World Health Organization classification for acute toxicity, and European Union prioritization list for endocrine-disrupting chemicals were used for the hazard categorization of identified individual active ingredients. Pesticides to be prioritized among all pesticides used in South Korea between 2007 and 2011 were selected by taking into account the volume of usage, toxicity, and epidemiological evidence. Annual agricultural use of pesticides has increased rapidly from the 1970s to 1990s in South Korea, but has declined since 2001. The quantity of pesticides used in 2011 was reported as 19,131 tons, and was comprised of 34.7% insecticides, 28.0% fungicides, and 27.1% herbicides. The 50 pesticides with the greatest volume of usage accounted for 82.6% of the total volume of pesticides used between 2007 and 2011, with the most-used active ingredient being machine oil, followed by mancozeb and then paraquat. Organophosphates were the most used among the top 50 pesticides. A total of 24 pesticides were selected for recommendation of intensive regulation in South Korea. In conclusion, the authors described the usage and trends of overall agricultural pesticides, which would serve as a fundamental step forward in managing pesticide in terms of public health. Intensive efforts are required for the prevention of potential health effects from the 24 identified pesticides. PMID:24959760

  1. Genomic comparisons of Brucella spp. and closely related bacteria using base compositional and proteome based methods

    PubMed Central

    2010-01-01

    Background Classification of bacteria within the genus Brucella has been difficult due in part to considerable genomic homogeneity between the different species and biovars, in spite of clear differences in phenotypes. Therefore, many different methods have been used to assess Brucella taxonomy. In the current work, we examine 32 sequenced genomes from genus Brucella representing the six classical species, as well as more recently described species, using bioinformatical methods. Comparisons were made at the level of genomic DNA using oligonucleotide based methods (Markov chain based genomic signatures, genomic codon and amino acid frequencies based comparisons) and proteomes (all-against-all BLAST protein comparisons and pan-genomic analyses). Results We found that the oligonucleotide based methods gave different results compared to that of the proteome based methods. Differences were also found between the oligonucleotide based methods used. Whilst the Markov chain based genomic signatures grouped the different species in genus Brucella according to host preference, the codon and amino acid frequencies based methods reflected small differences between the Brucella species. Only minor differences could be detected between all genera included in this study using the codon and amino acid frequencies based methods. Proteome comparisons were found to be in strong accordance with current Brucella taxonomy indicating a remarkable association between gene gain or loss on one hand and mutations in marker genes on the other. The proteome based methods found greater similarity between Brucella species and Ochrobactrum species than between species within genus Agrobacterium compared to each other. In other words, proteome comparisons of species within genus Agrobacterium were found to be more diverse than proteome comparisons between species in genus Brucella and genus Ochrobactrum. Pan-genomic analyses indicated that uptake of DNA from outside genus Brucella appears to be limited. Conclusions While both the proteome based methods and the Markov chain based genomic signatures were able to reflect environmental diversity between the different species and strains of genus Brucella, the genomic codon and amino acid frequencies based comparisons were not found adequate for such comparisons. The proteome comparison based phylogenies of the species in genus Brucella showed a surprising consistency with current Brucella taxonomy. PMID:20707916

  2. Utilization of internal AUG codons for initiation of protein synthesis directed by mRNAs from normal and mutant genes encoding herpes simplex virus-specified thymidine kinase.

    PubMed Central

    Haarr, L; Marsden, H S; Preston, C M; Smiley, J R; Summers, W C; Summers, W P

    1985-01-01

    Previous studies (H.S. Marsden, L. Haarr, and C.M. Preston, J. Virol. 46:434-445, 1983) have shown that at least three polypeptides, with molecular weights of 43,000, 39,000, and 38,000, are encoded by the herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) gene. It has been suggested that the 39,000- and 38,000-molecular-weight polypeptides arise from preinitiation complexes bypassing the first and second AUG codons before commencement of translation since, according to previous work (M. Kozak, Nucleic Acids Res. 9:5233-5252, 1981), these codons are not of the most efficient structure for initiation. This possibility was investigated by using specific herpes simplex virus mutants with alterations in the TK gene. Mutant TK4 has an amber mutation between the first and second AUG codons, whereas mutant delta 1 has a deletion which removes the first AUG codon but leaves other AUG codons, as well as transcriptional promoter sequences, intact. Both mutants synthesized only the 39,000- and 38,000-molecular-weight polypeptides, and the amounts produced were normal in TK4-infected cells but increased in delta 1-infected cells. Furthermore, the levels of TK produced after infection with the mutant viruses correlated with the amounts of the 39,000- and 38,000-molecular-weight polypeptides synthesized. The 43,000-, 39,000-, and 38,000-molecular-weight polypeptides were shown to be related by their positive reaction with anti-TK serum in both immunoprecipitation and immunoblotting experiments. The production of the 39,000- and 38,000-molecular-weight polypeptides through bypassing of the first AUG codon was examined by hybrid arrest experiments with a DNA fragment complementary to only 50 bases at the 5' terminus of TK mRNA. This fragment arrested the synthesis of the 30,000- and 38,000-molecular-weight polypeptides when annealed to mRNA from wild-type HSV-1- or TK4-infected cells, showing that those polypeptides arise from an mRNA initiated upstream from the first AUG codon. mRNA from cells infected with mutant delta 1, which lacks DNA sequences upstream from the first AUG, was not affected by the 50-base-pair fragment. The data therefore confirm that three polypeptides encoded by the HSV-1 TK gene arise by differential use of in-phase AUG codons for the initiation of protein synthesis. This mechanism for the production of related but distinct polypeptides has not previously been demonstrated in a eucaryotic system, and the implications for the regulation of TK enzyme activities are discussed. Images PMID:2997472

  3. Individually Tailored Screening of Susceptibility to Sarcopenia Using p53 Codon 72 Polymorphism, Phenotypes, and Conventional Risk Factors

    PubMed Central

    Di Renzo, Laura; Gratteri, Santo; Sarlo, Francesca; Colica, Carmen

    2014-01-01

    Background and Aim. p53 activity plays a role in muscle homeostasis and skeletal muscle differentiation; all pathways that lead to sarcopenia are related to p53 activities. We investigate the allelic frequency of the TP53 codon 72 in exon 4 polymorphism in the Italian female population and the association with appendicular skeletal muscle mass index in normal weight (NW), normal weight obese (NWO), and preobese-obese (Preob-Ob) subjects. Methods. We evaluated anthropometry, body composition, and p53 polymorphism in 140 women distinguished in NW, NWO, and Preob-Ob. Results. *Arg/*Arg genotype increases sarcopenia risk up to 20% (*Arg/*Arg genotype OR = 1.20; 95% CI = 0.48–2.9; *proallele carriers OR = 0.83; 95% CI = 0.83–2.06). The risk of being sarcopenic for *Arg/*Arg genotype in NWO and Preob-Ob is 31% higher than NW carriers of *proallele (RR = 0,31, 95% CI = 0,15–0,66, P = 0,0079). We developed a model able to predict sarcopenia risk based on age, body fat, and p53 polymorphism. Conclusion. Our study evidences that genotyping TP53 polymorphism could be a useful new genetic approach, in association with body composition evaluations, to assess sarcopenia risk. PMID:25371596

  4. Profoundly different prion diseases in knock-in mice carrying single PrP codon substitutions associated with human diseases

    PubMed Central

    Jackson, Walker S.; Borkowski, Andrew W.; Watson, Nicki E.; King, Oliver D.; Faas, Henryk; Jasanoff, Alan; Lindquist, Susan

    2013-01-01

    In man, mutations in different regions of the prion protein (PrP) are associated with infectious neurodegenerative diseases that have remarkably different clinical signs and neuropathological lesions. To explore the roots of this phenomenon, we created a knock-in mouse model carrying the mutation associated with one of these diseases [Creutzfeldt–Jakob disease (CJD)] that was exactly analogous to a previous knock-in model of a different prion disease [fatal familial insomnia (FFI)]. Together with the WT parent, this created an allelic series of three lines, each expressing the same protein with a single amino acid difference, and with all native regulatory elements intact. The previously described FFI mice develop neuronal loss and intense reactive gliosis in the thalamus, as seen in humans with FFI. In contrast, CJD mice had the hallmark features of CJD, spongiosis and proteinase K-resistant PrP aggregates, initially developing in the hippocampus and cerebellum but absent from the thalamus. A molecular transmission barrier protected the mice from any infectious prion agents that might have been present in our mouse facility and allowed us to conclude that the diseases occurred spontaneously. Importantly, both models created agents that caused a transmissible neurodegenerative disease in WT mice. We conclude that single codon differences in a single gene in an otherwise normal genome can cause remarkably different neurodegenerative diseases and are sufficient to create distinct protein-based infectious elements. PMID:23959875

  5. Multiple Congenital Melanocytic Nevi and Neurocutaneous Melanosis Are Caused by Postzygotic Mutations in Codon 61 of NRAS

    PubMed Central

    Kinsler, Veronica A; Thomas, Anna C; Ishida, Miho; Bulstrode, Neil W; Loughlin, Sam; Hing, Sandra; Chalker, Jane; McKenzie, Kathryn; Abu-Amero, Sayeda; Slater, Olga; Chanudet, Estelle; Palmer, Rodger; Morrogh, Deborah; Stanier, Philip; Healy, Eugene; Sebire, Neil J; Moore, Gudrun E

    2013-01-01

    Congenital melanocytic nevi (CMN) can be associated with neurological abnormalities and an increased risk of melanoma. Mutations in NRAS, BRAF, and Tp53 have been described in individual CMN samples; however, their role in the pathogenesis of multiple CMN within the same subject and development of associated features has not been clear. We hypothesized that a single postzygotic mutation in NRAS could be responsible for multiple CMN in the same individual, as well as for melanocytic and nonmelanocytic central nervous system (CNS) lesions. From 15 patients, 55 samples with multiple CMN were sequenced after site-directed mutagenesis and enzymatic digestion of the wild-type allele. Oncogenic missense mutations in codon 61 of NRAS were found in affected neurological and cutaneous tissues of 12 out of 15 patients, but were absent from unaffected tissues and blood, consistent with NRAS mutation mosaicism. In 10 patients, the mutation was consistently c.181C>A, p.Q61K, and in 2 patients c.182A>G, p.Q61R. All 11 non-melanocytic and melanocytic CNS samples from 5 patients were mutation positive, despite NRAS rarely being reported as mutated in CNS tumors. Loss of heterozygosity was associated with the onset of melanoma in two cases, implying a multistep progression to malignancy. These results suggest that single postzygotic NRAS mutations are responsible for multiple CMN and associated neurological lesions in the majority of cases. PMID:23392294

  6. Identification of residues required for stalled-ribosome rescue in the codon-independent release factor YaeJ

    PubMed Central

    Kogure, Hiroyuki; Handa, Yoshihiro; Nagata, Masahiro; Kanai, Naoto; Güntert, Peter; Kubota, Kenji; Nameki, Nobukazu

    2014-01-01

    The YaeJ protein is a codon-independent release factor with peptidyl-tRNA hydrolysis (PTH) activity, and functions as a stalled-ribosome rescue factor in Escherichia coli. To identify residues required for YaeJ function, we performed mutational analysis for in vitro PTH activity towards rescue of ribosomes stalled on a non-stop mRNA, and for ribosome-binding efficiency. We focused on residues conserved among bacterial YaeJ proteins. Additionally, we determined the solution structure of the GGQ domain of YaeJ from E. coli using nuclear magnetic resonance spectroscopy. YaeJ and a human homolog, ICT1, had similar levels of PTH activity, despite various differences in sequence and structure. While no YaeJ-specific residues important for PTH activity occur in the structured GGQ domain, Arg118, Leu119, Lys122, Lys129 and Arg132 in the following C-terminal extension were required for PTH activity. All of these residues are completely conserved among bacteria. The equivalent residues were also found in the C-terminal extension of ICT1, allowing an appropriate sequence alignment between YaeJ and ICT1 proteins from various species. Single amino acid substitutions for each of these residues significantly decreased ribosome-binding efficiency. These biochemical findings provide clues to understanding how YaeJ enters the A-site of stalled ribosomes. PMID:24322300

  7. EF-G catalyzes tRNA translocation by disrupting interactions between decoding center and codon-anticodon duplex.

    PubMed

    Liu, Guangqiao; Song, Guangtao; Zhang, Danyang; Zhang, Dejiu; Li, Zhikai; Lyu, Zhixin; Dong, Jianshu; Achenbach, John; Gong, Weimin; Zhao, Xin Sheng; Nierhaus, Knud H; Qin, Yan

    2014-09-01

    During translation, elongation factor G (EF-G) catalyzes the translocation of tRNA2-mRNA inside the ribosome. Translocation is coupled to a cycle of conformational rearrangements of the ribosomal machinery, and how EF-G initiates translocation remains unresolved. Here we performed systematic mutagenesis of Escherichia coli EF-G and analyzed inhibitory single-site mutants of EF-G that preserved pretranslocation (Pre)-state ribosomes with tRNAs in A/P and P/E sites (Pre-EF-G). Our results suggest that the interactions between the decoding center and the codon-anticodon duplex constitute the barrier for translocation. Catalysis of translocation by EF-G involves the factor's highly conserved loops I and II at the tip of domain IV, which disrupt the hydrogen bonds between the decoding center and the duplex to release the latter, hence inducing subsequent translocation events, namely 30S head swiveling and tRNA2-mRNA movement on the 30S subunit. PMID:25108354

  8. Novel codon-optimized mini-intronic plasmid for efficient, inexpensive, and xeno-free induction of pluripotency.

    PubMed

    Diecke, Sebastian; Lu, Jiamiao; Lee, Jaecheol; Termglinchan, Vittavat; Kooreman, Nigel G; Burridge, Paul W; Ebert, Antje D; Churko, Jared M; Sharma, Arun; Kay, Mark A; Wu, Joseph C

    2015-01-01

    The development of human induced pluripotent stem cell (iPSC) technology has revolutionized the regenerative medicine field. This technology provides a powerful tool for disease modeling and drug screening approaches. To circumvent the risk of random integration into the host genome caused by retroviruses, non-integrating reprogramming methods have been developed. However, these techniques are relatively inefficient or expensive. The mini-intronic plasmid (MIP) is an alternative, robust transgene expression vector for reprogramming. Here we developed a single plasmid reprogramming system which carries codon-optimized (Co) sequences of the canonical reprogramming factors (Oct4, Klf4, Sox2, and c-Myc) and short hairpin RNA against p53 ("4-in-1 CoMiP"). We have derived human and mouse iPSC lines from fibroblasts by performing a single transfection. Either independently or together with an additional vector encoding for LIN28, NANOG, and GFP, we were also able to reprogram blood-derived peripheral blood mononuclear cells (PBMCs) into iPSCs. Taken together, the CoMiP system offers a new highly efficient, integration-free, easy to use, and inexpensive methodology for reprogramming. Furthermore, the CoMIP construct is color-labeled, free of any antibiotic selection cassettes, and independent of the requirement for expression of the Epstein-Barr Virus nuclear antigen (EBNA), making it particularly beneficial for future applications in regenerative medicine. PMID:25628230

  9. Double muscling in Marchigiana beef breed is caused by a stop codon in the third exon of myostatin gene.

    PubMed

    Marchitelli, Cinzia; Savarese, Maria Carmela; Crisà, Alessandra; Nardone, Alessandro; Marsan, Paolo Ajmone; Valentini, Alessio

    2003-06-01

    Double muscling is a partially recessive trait present in some beef breeds. It shows a high frequency in some breeds, while in others the frequency is low, and double-muscled individuals are rare. The double muscling is caused by an allelic series of mutations that cause a loss of function of the myostatin gene ( GDF8). We describe here a new mutation in the myostatin gene in Marchigiana breed, a typical beef breed of Central Italy, in which rare double-muscling individuals have been described. A PCR product of the third exon was sequenced in subjects phenotypically showing double muscling, and a G > T transversion was discovered that introduces a premature stop codon. The variant found adds to the large series of mutations present in cattle, and particularly to the only two causative of double muscling in the third exon. A PCR-RFLP test is described for the rapid and effective identification of both heterozygous and homozygous subjects. It was applied to a larger survey carried on the same and also in two other beef breeds, Chianina and Romagnola. Further individuals carrying the new variant were found in Marchigiana, but none in the other breeds. The results may be important for a better comprehension of the role of myostatin in muscular development, for commercial use and for the inference of phylogeny of this gene. PMID:12879361

  10. Start codon targeted (SCoT) and target region amplification polymorphism (TRAP) for evaluating the genetic relationship of Dendrobium species.

    PubMed

    Feng, Shangguo; He, Refeng; Yang, Sai; Chen, Zhe; Jiang, Mengying; Lu, Jiangjie; Wang, Huizhong

    2015-08-10

    Two molecular marker systems, start codon targeted (SCoT) and target region amplification polymorphism (TRAP), were used for genetic relationship analysis of 36 Dendrobium species collected from China. Twenty-two selected SCoT primers produced 337 loci, of which 324 (96%) were polymorphic, whereas 13 TRAP primer combinations produced a total of 510 loci, with 500 (97.8%) of them being polymorphic. An average polymorphism information content of 0.953 and 0.983 was detected using the SCoT and TRAP primers, respectively, showing that a high degree of genetic diversity exists among Chinese Dendrobium species. The partition of clusters in the unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis plot based on the SCoT and TRAP markers was similar and clustered the 36 Dendrobium species into four main groups. Our results will provide useful information for resource protection and will also be useful to improve the current Dendrobium breeding programs. Our results also demonstrate that SCoT and TRAP markers are informative and can be used to evaluate genetic relationships between Dendrobium species. PMID:25936992

  11. Transgene excision in pollen using a codon optimized serine resolvase CinH-RS2 site-specific recombination system.

    PubMed

    Moon, Hong S; Abercrombie, Laura L; Eda, Shigetoshi; Blanvillain, Robert; Thomson, James G; Ow, David W; Stewart, C N

    2011-04-01

    Transgene escape, a major environmental and regulatory concern in transgenic crop cultivation, could be alleviated by removing transgenes from pollen, the most frequent vector for transgene flow. A transgene excision vector containing a codon optimized serine resolvase CinH recombinase (CinH) and its recognition sites RS2 were constructed and transformed into tobacco (Nicotiana tabacum cv. Xanthi). CinH recombinase recognized 119 bp of nucleic acid sequences, RS2, in pollen and excised the transgene flanked by the RS2 sites. In this system, the pollen-specific LAT52 promoter from tomato was employed to control the expression of CinH recombinase. Loss of expression of a green fluorescent protein (GFP) gene under the control of the LAT59 promoter from tomato was used as an indicator of transgene excision. Efficiency of transgene excision from pollen was determined by flow cytometry (FCM)-based pollen screening. While a transgenic event in the absence of CinH recombinase contained about 70% of GFP-synthesizing pollen, three single-copy transgene events contained less than 1% of GFP-synthesizing pollen based on 30,000 pollen grains analyzed per event. This suggests that CinH-RS2 recombination system could be effectively utilized for transgene biocontainment. PMID:21359553

  12. PSMB9 Codon 60 Polymorphisms Have No Impact on the Activity of the Immunoproteasome Catalytic Subunit B1i Expressed in Multiple Types of Solid Cancer

    PubMed Central

    Park, Ji Eun; Ao, Lin; Miller, Zachary; Kim, Kyungbo; Wu, Ying; Jang, Eun Ryoung; Lee, Eun Young; Kim, Kyung Bo; Lee, Wooin

    2013-01-01

    The proteasome is a key regulator of cellular protein homeostasis and is a clinically validated anticancer target. The immunoproteasome, a subtype of proteasome expressed mainly in hematopoietic cells, was initially recognized for its role in antigen presentation during the immune response. Recently, the immunoproteasome has been implicated in several disease conditions including cancer and autoimmune disorders, but many of the factors contributing to these pathological processes remain unknown. In particular, the codon 60 polymorphism of the PSMB9 gene encoding the ?1i immunoproteasome catalytic subunit has been investigated in the context of a variety of diseases. Despite this, previous studies have so far reported inconsistent findings regarding the impact of this polymorphism on proteasome activity. Thus, we set out to investigate the impact of the PSMB9 codon 60 polymorphism on the expression and activity of the ?1i immunoproteasome subunit in a panel of human cancer cell lines. The ?1i-selective fluorogenic substrate Acetyl-Pro-Ala-Leu-7-amino-4-methylcoumarin was used to specifically measure ?1i catalytic activity. Our results indicate that the codon 60 Arg/His polymorphism does not significantly alter the expression and activity of ?1i among the cell lines tested. Additionally, we also examined the expression of ?1i in clinical samples from colon and pancreatic cancer patients. Our immunohistochemical analyses showed that ?70% of clinical colon cancer samples and ?53% of pancreatic cancer samples have detectable ?1i expression. Taken together, our results indicate that the ?1i subunit of the immunoproteasome is frequently expressed in colon and pancreatic cancers but that the codon 60 genetic variants of ?1i display similar catalytic activities and are unlikely to contribute to the significant inter-cell-line and inter-individual variabilities in the immunoproteasome activity. PMID:24040045

  13. The TP53 codon 72 Pro/Pro genotype may be associated with an increased lung cancer risk in North China: an updated meta-analysis

    PubMed Central

    Wang, Xin; Hao, Li-Ran; Yue, Kai

    2015-01-01

    Background: The polymorphism of TP53 codon 72, a transversion of G to C (Arg to Pro), has been demonstrated to be associated with the risk for lung cancer. However, individual studies conducted in Chinese have provided conflicting and inconclusive findings. Thus, we performed a meta-analysis by pooling all currently available case-control studies to estimate the effect of TP53 codon 72 Arg/Pro polymorphism on the development of lung cancer in the Chinese population. Material/Methods: Related studies were identified from PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure (CNKI), and Chinese Biology Medicine (CBM) till 10 October 2014. Pooled ORs and 95% CIs were used to assess the strength of the associations. Results: A total of 12 case-control studies including 3681 lung cancer cases and 4358 controls were involved in this meta-analysis. Overall, no significant association was found between TP53 codon 72 variation and lung cancer risk when all studies in the Chinese population pooled into this meta-analysis. However, in the subgroup analysis by geographical locations, significantly increased risk was found in the population from North China under all genetic models (Allele model, OR=1.22, 95% CI: 1.04-1.43; Dominant model, OR=1.13, 95% CI: 1.01-1.25; Recessive model, OR=1.41, 95% CI: 1.07-1.87; Homozygous model, OR=1.47, 95% CI: 1.09-1.99; Heterozygous model, OR=1.40, 95% CI: 1.04-1.89). Conclusions: This meta-analysis provides the evidence that TP53 codon 72 polymorphism may contribute to the lung cancer development in North China and studies with large sample size and gene-gene (gene-environment) interactions are warranted to verify this finding. PMID:26064201

  14. Study on the association of p53 codon 72 polymorphisms with risk of gastric cancer in high incidence Hexi area of Gansu Province in China

    Microsoft Academic Search

    Zhu Ke-XiangLi; Li Yu-Min; Li Xun; Zhou Wen-Ce; Shan Yong; Liu Tao

    To investigate the possible association of P53 codon 72 Arg\\/Pro polymorphisms with risk of gastric cancer in the high incidence\\u000a Hexi area of Gansu province in China. Blood samples from 140 patients with gastric carcinoma and 125 healthy controls were\\u000a collected in Hexi area of Gansu province. Polymorphism of P53Arg72Pro was genotyped by PCR-TaqMan. For detection Helicobacter pylori infection, Warhin–Starry

  15. Four different mutations in codon 28 of alpha spectrin are associated with structurally and functionally abnormal spectrin alpha I/74 in hereditary elliptocytosis.

    PubMed Central

    Coetzer, T L; Sahr, K; Prchal, J; Blacklock, H; Peterson, L; Koler, R; Doyle, J; Manaster, J; Palek, J

    1991-01-01

    Hereditary elliptocytosis (HE) Sp alpha I/74 is a disorder associated with defective spectrin (Sp) heterodimer self-association and an abnormal tryptic cleavage of the 80-kD alpha I domain of Sp resulting in increased amounts of a 74-kD peptide. The molecular basis of this disorder is heterogeneous and mutations in codons 28, 46, 48, and 49 (codons 22, 40, 42, and 43 in the previous nomenclature which did not include the six NH2-terminal amino acids) have been reported. In this study we present data on seven unrelated HE Sp alpha I/74 kindred from diverse racial backgrounds in whom we identified four different mutations all occurring in exon 2 of alpha Sp at codon 28. Utilizing the polymerase chain reaction we established a CGT----CTT; Arg----Leu 28 mutation in one kindred of Arab/Druze origin. In two unrelated white kindred of English/European origin the substitution is CGT----AGT; Arg----Ser 28 and in two apparently unrelated white kindred from New Zealand, the mutation is CGT----TGT; Arg----Cys 28. Finally, in one American black kindred and in a black kindred from Ghana the mutation involves CGT----CAT; Arg----His 28. Allele specific oligonucleotide hybridization confirmed that the probands are heterozygous for the respective mutant alleles. All four point mutations abolished an Aha II restriction enzyme site which allowed verification of linkage of the mutation with HE Sp alpha I/74. Our results imply that codon 28 of alpha Sp is a "hot spot" for mutations and also indicate that Arg 28 is critical for the conformational stability and functional self association of Sp heterodimers. Images PMID:1679439

  16. Minor contribution of mutations at iniA codon 501 and embC-embA intergenic region in ethambutol-resistant clinical Mycobacterium tuberculosis isolates in Kuwait

    Microsoft Academic Search

    Al-Anoud Jaber; Suhail Ahmad; Eiman Mokaddas

    2009-01-01

    BACKGROUND: Ethambutol (EMB) is a first-line drug for the treatment of tuberculosis (TB). Resistance to EMB in Mycobacterium tuberculosis isolates is mediated by mutations in several genes involved in arabinan synthesis notably three emb (arabinosyl transferase) and iniA (isoniazid-inducible) genes. Most epidemiologically unrelated EMB-resistant M. tuberculosis strains contain mutations at embB codons 306, 406 and 497, embC-embA intergenic region (IGR)

  17. Detection of Isoniazid-Resistant Mycobacterium tuberculosis Strains by a Multiplex Allele-Specific PCR Assay Targeting katG Codon 315 Variation

    Microsoft Academic Search

    Igor Mokrousov; Tatiana Otten; Maxim Filipenko; Anna Vyazovaya; Eugeny Chrapov; Elena Limeschenko; Lidia Steklova; Boris Vyshnevskiy; Olga Narvskaya

    2002-01-01

    Inh r strains worldwide, especially in areas with a high incidence of tuberculosis. The 315 ACA allele is characteristic of the New York City multidrug-resistant (MDR) strain W and its progenies in the United States. The mutations in katG315 are revealed depending on the presence or absence of an indicative fragment amplified from the wild-type allele of this codon. Initially

  18. Analysis for a Limited Number of Gene Codons Can Predict Drug Resistance of Mycobacterium tuberculosis in a High-Incidence Community

    Microsoft Academic Search

    ANNELIES VAN RIE; ROBIN WARREN; IDRIS MSHANGA; ANNEMARIE M JORDAAN; GIAN D. VAN DER SPUY; MADALENE RICHARDSON; JOHN SIMPSON; ROBERT P. GIE; DONALD A. ENARSON; PAUL D. VAN HELDEN; THOMAS C. VICTOR

    2001-01-01

    Correct and rapid diagnosis is essential in the management of multidrug-resistant tuberculosis (MDR-TB). In this population-based study of 61 patients with drug-resistant tuberculosis, we evaluated the frequency of mutations and compared the performance of genotypic (mutation analysis by dot blot hybridization) and phenotypic (indirect proportion method) drug resistance tests. Three selected codons (rpoB531, rpoB526, and katG315) allowed identification of 90%

  19. 47 CFR 90.535 - Modulation and spectrum usage efficiency requirements.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...2014-10-01 false Modulation and spectrum usage efficiency requirements. 90...MHz Bands § 90.535 Modulation and spectrum usage efficiency requirements. ...least one voice path per 6.25 kHz of spectrum bandwidth. (2) Licensees...

  20. 47 CFR 90.535 - Modulation and spectrum usage efficiency requirements.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...2013-10-01 false Modulation and spectrum usage efficiency requirements. 90...MHz Bands § 90.535 Modulation and spectrum usage efficiency requirements. ...least one voice path per 6.25 kHz of spectrum bandwidth. (2) Licensees...