Science.gov

Sample records for commercial brazilian coffee

  1. Association of Moderate Coffee Intake with Self-Reported Diabetes among Urban Brazilians

    PubMed Central

    Machado, Liliane M. M.; da Costa, Teresa H. M.; da Silva, Eduardo F.; Dórea, José G.

    2011-01-01

    Coffee has been associated with reductions in the risk of non-communicable chronic diseases (NCCD), including diabetes mellitus. Because differences in food habits are recognizable modifying factors in the epidemiology of diabetes, we studied the association of coffee consumption with type-2 diabetes in a sample of the adult population of the Federal District, Brazil. This cross-sectional study was conducted by telephone interview (n = 1,440). A multivariate analysis was run controlling for socio-behavioural variables, obesity and family antecedents of NCCD. A hierarchical linear regression model and a Poisson regression were used to verify association of type-2 diabetes and coffee intake. The independent variables which remained in the final model, following the hierarchical inclusion levels, were: first level—age and marital status; second level—diabetes and dyslipidaemias in antecedents; third level—cigarette smoking, supplement intake, body mass index; and fourth level—coffee intake (≤100 mL/d, 101 to 400 mL/day, and >400 mL/day). After adjusting hierarchically for the confounding variables, consumers of 100 to 400 mL of coffee/day had a 2.7% higher (p = 0.04) prevalence of not having diabetes than those who drank less than 100 mL of coffee/day. Compared to coffee intake of ≤100 mL/day, adults consuming >400 mL of coffee/day showed no statistically significant difference in the prevalence of diabetes. Thus, moderate coffee intake is favourably associated with self-reported type-2 diabetes in the studied population. This is the first study to show a relationship between coffee drinking and diabetes in a Brazilian population. PMID:21909302

  2. Detection of Corn Adulteration in Brazilian Coffee (Coffea arabica) by Tocopherol Profiling and Near-Infrared (NIR) Spectroscopy.

    PubMed

    Winkler-Moser, Jill K; Singh, Mukti; Rennick, Kathy A; Bakota, Erica L; Jham, Gulab; Liu, Sean X; Vaughn, Steven F

    2015-12-16

    Coffee is a high-value commodity that is a target for adulteration, leading to loss of quality and causing significant loss to consumers. Therefore, there is significant interest in developing methods for detecting coffee adulteration and improving the sensitivity and accuracy of these methods. Corn and other lower value crops are potential adulterants, along with sticks and coffee husks. Fourteen pure Brazilian roasted, ground coffee bean samples were adulterated with 1-20% of roasted, ground corn and were analyzed for their tocopherol content and profile by HPLC. They were also analyzed by near-infrared (NIR) spectroscopy. Both proposed methods of detection of corn adulteration displayed a sensitivity of around 5%, thus representing simple and fast analytical methods for detecting adulteration at likely levels of contamination. Further studies should be conducted to verify the results with a much larger sample size and additional types of adulterants. PMID:26600312

  3. The effect of processing on chlorogenic acid content of commercially available coffee.

    PubMed

    Mills, Charlotte E; Oruna-Concha, Maria Jose; Mottram, Donald S; Gibson, Glenn R; Spencer, Jeremy P E

    2013-12-15

    Chlorogenic acids (CGA) are a class of polyphenols noted for their health benefits. These compounds were identified and quantified, using LC-MS and HPLC, in commercially available coffees which varied in processing conditions. Analysis of ground and instant coffees indicated the presence of caffeoylquinic acids (CQA), feruloylquinic acids (FQA) and dicaffeoylquinic acids (diCQA) in all 18 samples tested. 5-CQA was present at the highest levels, between 25 and 30% of total CGA; subsequent relative quantities were: 4-CQA>3-CQA>5-FQA>4-FQA>diCQA (sum of 3,4, 3,5 and 4,5-diCQA). CGA content varied greatly (27.33-121.25mg/200 ml coffee brew), driven primarily by the degree of coffee bean roasting (a high amount of roasting had a detrimental effect on CGA content). These results highlight the broad range of CGA quantity in commercial coffee and demonstrate that coffee choice is important in delivering optimum CGA intake to consumers. PMID:23993490

  4. Using Real-Time PCR as a tool for monitoring the authenticity of commercial coffees.

    PubMed

    Ferreira, Thiago; Farah, Adriana; Oliveira, Tatiane C; Lima, Ivanilda S; Vitório, Felipe; Oliveira, Edna M M

    2016-05-15

    Coffee is one of the main food products commercialized in the world. Its considerable market value among food products makes it susceptible to adulteration, especially with cereals. Therefore, the objective of this study was to develop a method based on Real-Time Polymerase Chain Reaction (PCR) for detection of cereals in commercial ground roast and soluble coffees. After comparison with standard curves obtained by serial dilution of DNA extracted from barley, corn and rice, the method was sensitive and specific to quantify down to 0.6 pg, 14 pg and 16 pg of barley, corn and rice DNA, respectively. To verify the applicability of the method, 30 commercial samples obtained in different countries were evaluated and those classified as gourmets or superior did not present the tested cereals DNA. However, barley was detected in various traditional (cheaper) samples from South America. In addition, corn and rice were also detected in different samples. Real-Time PCR showed to be suitable for detection of food adulterants in commercial ground roast and soluble coffees. PMID:26775992

  5. Gamma-Tocopherol as a marker of Brazilian coffee (Coffea arabica L.) adulteration by corn

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Percentages of alpha-, beta-, gamma-, and delta-tocopherol determined by high-performance liquid chromatography in six coffee varieties were 29.0, 61.7, 3.3, and 6.0, respectively. Similar values were obtained in six popular coffee brands. The percentages of alpha-, gamma- and delta-tocopherol in ...

  6. Pattern recognition applied to mineral characterization of Brazilian coffees and sugar-cane spirits

    NASA Astrophysics Data System (ADS)

    Fernandes, Andréa P.; Santos, Mirian C.; Lemos, Sherlan G.; Ferreira, Márcia M. C.; Nogueira, Ana Rita A.; Nóbrega, Joaquim A.

    2005-06-01

    Aluminium, Ca, Cu, Fe, K, Mg, Mn, Na, Pb, S, Se, Si, Sn, Sr, and Zn were determined in coffee and sugar-cane spirit (cachaça) samples by axial viewing inductively coupled plasma optical emission spectrometry (ICP OES). Pattern recognition techniques such as principal component analysis and cluster analysis were applied to data sets in order to characterize samples with relation to their geographical origin and production mode (industrial or homemade and organically or conventionally produced). Attempts to correlate metal ion content with the geographical origin of coffee and the production mode (organic or conventional) of cachaça were not successful. Some differentiation was suggested for the geographical origin of cachaça of three regions (Northeast, Central, and South), and for coffee samples, related to the production mode. Clear separations were only obtained for differentiation between industrial and homemade cachaças, and between instant soluble and roasted coffees.

  7. In vitro assessment of potential intestinal absorption of some phenolic families and carboxylic acids from commercial instant coffee samples.

    PubMed

    López-Froilán, R; Ramírez-Moreno, E; Podio, N S; Pérez-Rodríguez, M L; Cámara, M; Baroni, M V; Wunderlin, D A; Sánchez-Mata, M C

    2016-06-15

    Coffee is one of the most consumed beverages in the world, being a source of bioactive compounds as well as flavors. Hydroxycinnamic acids, flavonols, and carboxylic acids have been studied in the samples of instant coffee commercialized in Spain. The studies about contents of food components should be complemented with either in vitro or in vivo bioaccessibility studies to know the amount of food components effectively available for functions in the human body. In this sense, a widely used in vitro model has been applied to assess the potential intestinal absorption of phenolic compounds and organic acids. The contents of hydroxycinnamic acids and flavonols were higher in instant regular coffee samples than in the decaffeinated ones. Bioaccessible phenolic compounds in most analyzed samples account for 20-25% of hydroxycinnamic acids and 17-26% of flavonols. This could mean that a great part of them can remain in the gut, acting as potential in situ antioxidants. Quinic, acetic, pyroglutamic, citric and fumaric acids were identified in commercial instant coffee samples. Succinic acid was found in the coffee blend containing chicory. All carboxylic acids showed a very high bioaccessibility. Particularly, acetic acid and quinic acid were found in higher contents in the samples treated with the in vitro simulation of gastrointestinal processes, compared to the original ones, which can be explained by their cleavage from chlorogenic acid during digestion. This is considered as a positive effect, since quinic acid is considered as an antioxidant inducer. PMID:27191052

  8. Use of headspace gas chromatographic/FTIR for the monitoring of volatiles in commercial brand coffees

    NASA Astrophysics Data System (ADS)

    Compton, Senja V.; Compton, David A.

    1989-12-01

    Recently, the area of food analysis and product safety has become of major concern to consumers. Therefore, companies involved in the quality assurance of theirproducts have been encouraged to perform extensive analyses to guarantee safety and satisfaction. One of the largest consumer products in the beverage marketplace is coffee. Much emphasis has been placed upon the safety of the decaffeination processes used by various manufacturers; these involve extraction of the caffeine by a solvent system that may be aqueous or organic, and is sometimes,super-critical. Additionally, aroma (fragrance) of brewing coffee has been found to be of major concern to the individual by the marketing departments of the coffee companies. The heads ace analysis of coffees can be used to discover the species retained after the decaffeination of coffee, as well as to distinguish the volatile species released upon treatment of the coffee at boiling water temperatures.

  9. Detection of corn adulteration in Brazilian coffee (Coffea arabica) by tocopherol profiling and near-infrared (NIR) spectroscopy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee is a high-value commodity that is a target for adulteration, especially after the beans have been roasted and ground. Countries such as Brazil, the second largest coffee producer, have set limits on the allowable amount of coffee contamination and adulteration. Therefore, there is significant...

  10. Volatile fingerprint of Brazilian defective coffee seeds: corroboration of potential marker compounds and identification of new low quality indicators.

    PubMed

    Toci, Aline T; Farah, Adriana

    2014-06-15

    In the present work, the volatile profiles of green and roasted Brazilian defective coffee seeds and their controls were characterised, totalling 159 compounds. Overall, defective seeds showed higher number and concentration of volatile compounds compared to those of control seeds, especially pyrazines, pyrroles and phenols. Corroborating our previous results, butyrolactone and hexanoic acid, previously considered as potential defective seeds' markers, were observed only in raw and roasted defective seeds, respectively, and not in control seeds. New compounds were suggested as potential defective seeds' markers: hexanoic acid (for raw and roasted defective seeds in general), butyrolactone (for raw defective seeds in general), and 3-ethyl-2-methyl-1,3-hexadiene (for raw black seeds); β-linalool and 2-butyl-3,5-dimethylpyrazine (for roasted defective seeds in general), and 2-pentylfuran (for roasted black seeds). Additional compounds suggested as low quality indicators were 2,3,5,6-tetramethylpyrazine,2,3-butanediol and 4-ethylguaiacol, β-linalool, 2-,3-dimethylbutyl butanoate, 2-phenylethyl acetate, 2,3-butanedione, hexanedioic acid, guaiacol, 2,3-dihydro-2-methyl-1H-benzopyrrol, 3-methylpiperidine, 2-pentylpiperidine, 3-octen-2-one, 2-octenal, 2-pentylfuran and 2-butyl-3-methylpyrazine. PMID:24491734

  11. Stability of ochratoxin A (OTA) during processing and decaffeination in commercial roasted coffee beans.

    PubMed

    Nehad, E A; Farag, M M; Kawther, M S; Abdel-Samed, A K M; Naguib, K

    2005-08-01

    The fate of ochratoxin A (OTA) during the processing of artificially contaminated green coffee beans, the effect of decaffeination on the production of OTA in green and roasted coffee beans, and the effect of caffeine on the growth and OTA production by Aspergillus ochraceus were studied. The data indicated that the roasting, milling and decoction (brewing and Turkish coffee making) processes caused different percentage reductions in OTA. Decaffeinated samples showed a significantly higher concentration of OTA production than the caffeinated ones. A significantly higher percentage of OTA was reduced when the decaffeination process was performed before roasting treatment. Caffeine at 1.0 and 2.0% concentrations completely prevented OTA production and completely inhibited A. ochraceus growth in YES medium after 3-21 days. PMID:16147432

  12. The use of fatty acid profile as a potential marker for Brazilian coffee (Coffea arabica L.) for corn adulteration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fatty acid methyl ester (FAME) compositions of six coffee (Coffea arabica L.) varieties (Catuaí, Catuca, Burbourn, Mundo Novo, Rubí, and Topázio) known to produce good, intermediate and poor quality coffee were determined for the first time. Average area % of the FAMEs of the six varieties was: pa...

  13. Little Adults: Child and Teenage Commercial Sexual Exploitation in Contemporary Brazilian Cinema

    ERIC Educational Resources Information Center

    da Silvia, Antonio Marcio

    2016-01-01

    This current study explores three contemporary Brazilian films' depiction of commercial sexual exploitation of young girls and teenagers. It points out how the young female characters cope with the abuses they suffer and proposes that these filmic representations of the characters' experiences expose a significant social problem of contemporary…

  14. Preference mapping of dulce de leche commercialized in Brazilian markets.

    PubMed

    Gaze, L V; Oliveira, B R; Ferrao, L L; Granato, D; Cavalcanti, R N; Conte Júnior, C A; Cruz, A G; Freitas, M Q

    2015-03-01

    Dulce de leche samples available in the Brazilian market were submitted to sensory profiling by quantitative descriptive analysis and acceptance test, as well sensory evaluation using the just-about-right scale and purchase intent. External preference mapping and the ideal sensory characteristics of dulce de leche were determined. The results were also evaluated by principal component analysis, hierarchical cluster analysis, partial least squares regression, artificial neural networks, and logistic regression. Overall, significant product acceptance was related to intermediate scores of the sensory attributes in the descriptive test, and this trend was observed even after consumer segmentation. The results obtained by sensometric techniques showed that optimizing an ideal dulce de leche from the sensory standpoint is a multidimensional process, with necessary adjustments on the appearance, aroma, taste, and texture attributes of the product for better consumer acceptance and purchase. The optimum dulce de leche was characterized by high scores for the attributes sweet taste, caramel taste, brightness, color, and caramel aroma in accordance with the preference mapping findings. In industrial terms, this means changing the parameters used in the thermal treatment and quantitative changes in the ingredients used in formulations. PMID:25557891

  15. Comparison of Clean-Up Methods for Ochratoxin A on Wine, Beer, Roasted Coffee and Chili Commercialized in Italy

    PubMed Central

    Prelle, Ambra; Spadaro, Davide; Denca, Aleksandra; Garibaldi, Angelo; Gullino, Maria Lodovica

    2013-01-01

    The most common technique used to detect ochratoxin A (OTA) in food matrices is based on extraction, clean-up, and chromatography detection. Different clean-up cartridges, such as immunoaffinity columns (IAC), molecular imprinting polymers (MIP), Mycosep™ 229, Mycospin™, and Oasis® HLB (Hydrophilic Lipophilic balance) as solid phase extraction were tested to optimize the purification for red wine, beer, roasted coffee and chili. Recovery, reproducibility, reproducibility, limit of detection (LOD) and limit of quantification (LOQ) were calculated for each clean-up method. IAC demonstrated to be suitable for OTA analysis in wine and beer with recovery rate >90%, as well as Mycosep™ for wine and chili. On the contrary, MIP columns were the most appropriate to clean up coffee. A total of 120 samples (30 wines, 30 beers, 30 roasted coffee, 30 chili) marketed in Italy were analyzed, by applying the developed clean-up methods. Twenty-seven out of 120 samples analyzed (22.7%: two wines, five beers, eight coffees, and 12 chili) resulted positive to OTA. A higher incidence of OTA was found in chili (40.0%) more than wine (6.6%), beers (16.6%) and coffee (26.6%). Moreover, OTA concentration in chili was the highest detected, reaching 47.8 µg/kg. Furthermore, three samples (2.5%), two wines and one chili, exceeded the European threshold. PMID:24152987

  16. Comparison of clean-up methods for ochratoxin A on wine, beer, roasted coffee and chili commercialized in Italy.

    PubMed

    Prelle, Ambra; Spadaro, Davide; Denca, Aleksandra; Garibaldi, Angelo; Gullino, Maria Lodovica

    2013-10-01

    The most common technique used to detect ochratoxin A (OTA) in food matrices is based on extraction, clean-up, and chromatography detection. Different clean-up cartridges, such as immunoaffinity columns (IAC), molecular imprinting polymers (MIP), Mycosep™ 229, Mycospin™, and Oasis® HLB (Hydrophilic Lipophilic balance) as solid phase extraction were tested to optimize the purification for red wine, beer, roasted coffee and chili. Recovery, reproducibility, reproducibility, limit of detection (LOD) and limit of quantification (LOQ) were calculated for each clean-up method. IAC demonstrated to be suitable for OTA analysis in wine and beer with recovery rate >90%, as well as Mycosep™ for wine and chili. On the contrary, MIP columns were the most appropriate to clean up coffee. A total of 120 samples (30 wines, 30 beers, 30 roasted coffee, 30 chili) marketed in Italy were analyzed, by applying the developed clean-up methods. Twenty-seven out of 120 samples analyzed (22.7%: two wines, five beers, eight coffees, and 12 chili) resulted positive to OTA. A higher incidence of OTA was found in chili (40.0%) more than wine (6.6%), beers (16.6%) and coffee (26.6%). Moreover, OTA concentration in chili was the highest detected, reaching 47.8 µg/kg. Furthermore, three samples (2.5%), two wines and one chili, exceeded the European threshold. PMID:24152987

  17. Hormesis with glyphosate depends on coffee growth stage

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weed management systems in almost all Brazilian coffee plantations allow herbicide spray to drift on crop plants. In order to evaluate if there is any effect of the most commonly used herbicide in coffee production, glyphosate, on coffee plants, a range of glyphosate doses were applied directly on ...

  18. Green Coffee

    MedlinePlus

    ... Talk with your health provider.Medications that slow blood clotting (Anticoagulant / Antiplatelet drugs)Caffeine in green coffee might slow blood clotting. Taking green coffee along with medications that also ...

  19. Ames mutagenicity tests of overheated brewed coffee.

    PubMed

    Blair, C A; Shibamoto, T

    1984-12-01

    Five kinds of coffee samples were prepared from a commercial drip-grind coffee in order to examine the mutagenicity of brewed coffee using the Ames test. The samples prepared were a thick coffee syrup, coffee solid residues, dichloromethane and ethanol extracts of solid residues, a dichloromethane extract of a distillate from normally heated brewed coffee and dichloromethane extracts of distillates from overheated (150-300 degrees C) brewed coffee. The samples were tested for mutagenicity towards Salmonella typhimurium strains TA98 and TA100 both with and without metabolic activation (S-9 mix). Only the extracts of the distillates obtained from coffee heated to 150 degrees or 300 degrees C exhibited mutagenicity towards strain TA98 with S-9 mix. PMID:6392045

  20. 10. THIRD FLOOR COFFEE AND SPICE MILLING ROOM (NOW TIRE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. THIRD FLOOR COFFEE AND SPICE MILLING ROOM (NOW TIRE STORAGE), LOOKING TOWARD ELEVATOR HALL. VIEW TO NORTHWEST. - Commercial & Industrial Buildings, McFadden Coffee & Spice Company, Factory & Warehouse, 145 First Street, Dubuque, Dubuque County, IA

  1. Usual coffee intake in Brazil: results from the National Dietary Survey 2008-9.

    PubMed

    Sousa, Alessandra Gaspar; da Costa, Teresa Helena Macedo

    2015-05-28

    Coffee is central to the economy of many developing countries, as well as to the world economy. However, despite the widespread consumption of coffee, there are very few available data showing the usual intake of this beverage. Surveying usual coffee intake is a way of monitoring one aspect of a population's usual dietary intake. Thus, the present study aimed to characterise the usual daily coffee intake in the Brazilian population. We used data from the National Dietary Survey collected in 2008-9 from a probabilistic sample of 34,003 Brazilians aged 10 years and older. The National Cancer Institute method was applied to obtain the usual intake based on two nonconsecutive food diaries, and descriptive statistical analyses were performed by age and sex for Brazil and its regions. The estimated average usual daily coffee intake of the Brazilian population was 163 (SE 2.8) ml. The comparison by sex showed that males had a 12% greater usual coffee intake than females. In addition, the highest intake was recorded among older males. Among the five regions surveyed, the North-East had the highest usual coffee intake (175 ml). The most common method of brewing coffee was filtered/instant coffee (71%), and the main method of sweetening beverages was with sugar (87%). In Brazil, the mean usual coffee intake corresponds to 163 ml, or 1.5 cups/d. Differences in usual coffee intake according to sex and age differed among the five Brazilian regions. PMID:25851731

  2. Quantification of coffee blends for authentication of Asian palm civet coffee (Kopi Luwak) via metabolomics: A proof of concept.

    PubMed

    Jumhawan, Udi; Putri, Sastia Prama; Yusianto; Bamba, Takeshi; Fukusaki, Eiichiro

    2016-07-01

    Asian palm civet coffee (Kopi Luwak), an animal-digested coffee with an exotic feature, carries a notorious reputation of being the rarest and most expensive coffee beverage in the world. Considering that illegal mixture of cheap coffee into civet coffee is a growing concern among consumers, we evaluated the use of metabolomics approach and orthogonal projection to latent structures (OPLS) prediction technique to quantify the degree of coffee adulteration. Two prediction sets, consisting of certified and commercial coffee, were made from a blend of civet and regular coffee with eleven mixing percentages. The prediction model exhibited accurate estimation of coffee blend percentage thus, successfully validating the prediction and quantification of the mixing composition of known-unknown samples. This work highlighted proof of concept of metabolomics application to predict degree of coffee adulteration by determining the civet coffee fraction in blends. PMID:26777237

  3. Screening Brazilian commercial gasoline quality by hydrogen nuclear magnetic resonance spectroscopic fingerprintings and pattern-recognition multivariate chemometric analysis.

    PubMed

    Flumignan, Danilo Luiz; Boralle, Nivaldo; de Oliveira, José Eduardo

    2010-06-30

    The identification of gasoline adulteration by organic solvents is not an easy task, because compounds that constitute the solvents are already in gasoline composition. In this work, the combination of Hydrogen Nuclear Magnetic Resonance ((1)H NMR) spectroscopic fingerprintings with pattern-recognition multivariate Soft Independent Modeling of Class Analogy (SIMCA) chemometric analysis provides an original and alternative approach to screening Brazilian commercial gasoline quality in a Monitoring Program for Quality Control of Automotive Fuels. SIMCA was performed on spectroscopic fingerprints to classify the quality of representative commercial gasoline samples selected by Hierarchical Cluster Analysis (HCA) and collected over a 6-month period from different gas stations in the São Paulo state, Brazil. Following optimized the (1)H NMR-SIMCA algorithm, it was possible to correctly classify 92.0% of commercial gasoline samples, which is considered acceptable. The chemometric method is recommended for routine applications in Quality-Control Monitoring Programs, since its measurements are fast and can be easily automated. Also, police laboratories could employ this method for rapid screening analysis to discourage adulteration practices. PMID:20685442

  4. Development of an instant coffee enriched with chlorogenic acids.

    PubMed

    Corso, Marinês Paula; Vignoli, Josiane Alessandra; Benassi, Marta de Toledo

    2016-03-01

    The objective of this study was to present possible formulations for an instant coffee product enriched with chlorogenic acids for the Brazilian market. Formulations were prepared with different concentrations of freeze dried extracts of green Coffea canephora beans (G) added to freeze dried extracts of roasted Coffea arabica (A) and Coffea canephora (C). Medium (M) and dark (D) roasting degrees instant coffee were produced (AM, AD, CM and CD) to obtain four formulations with green extract addition (AMG, ADG, CMG and CDG). Chlorogenic acids were determined by HPLC, with average contents of 7.2 %. Roasted extracts and formulations were evaluated for 5-CQA and caffeine contents (by HPLC), browned compounds (absorbance 420 nm), and antioxidant activity (ABTS and Folin). Coffee brews of the four formulations were also assessed in a lab-scale test by 42 consumers for acceptance of the color, aroma, flavor and body, overall acceptance and purchase intent, using a 10 cm hybrid scale. The formulations obtained acceptance scores of 6.6 and 7.7 for all attributes, thus they were equally acceptable. Greater purchase intent was observed for ADG, CDG and CMG (6.9) in comparison to AMG (6.1). The formulations had, on average, 2.5 times more 5-CQA than the average obtained from conventional commercial instant coffees. In addition to being more economically viable, the formulations developed with C. canephora (CDG and CMG) showed greater antioxidant potential (32.5 g of Trolox/100 g and 13.8 g of gallic acid equivalent/100 g) due to a balance in the amount of bioactive compounds. PMID:27570262

  5. Characterization of Organic and Conventional Coffee Using Neutron Activation Analysis

    SciTech Connect

    E. A. De Nadai Fernandes; P. Bode; F. S. Tagliaferro

    2000-11-12

    Countries importing organic coffee are facing the difficulty of assessing the quality of the product to distinguish original organic coffee from other coffees, thereby eliminating possible fraud. Many analytical methods are matrix sensitive and require matrix-matching reference materials for validation, which are currently nonexistent. This work aims to establish the trace element characterization of organic and conventional Brazilian coffees and to establish correlations with the related soil and the type of fertilizer and agrochemicals applied. It was observed that the variability in element concentrations between the various types of coffee is not so large, which emphasizes the need for analytical methods of high accuracy, reproducibility, and a well-known uncertainty. Moreover, the analyses indicate that sometimes the coffee packages may contain some soil remnants.

  6. Recent Advances in the Genetic Transformation of Coffee

    PubMed Central

    Mishra, M. K.; Slater, A.

    2012-01-01

    Coffee is one of the most important plantation crops, grown in about 80 countries across the world. The genus Coffea comprises approximately 100 species of which only two species, that is, Coffea arabica (commonly known as arabica coffee) and Coffea canephora (known as robusta coffee), are commercially cultivated. Genetic improvement of coffee through traditional breeding is slow due to the perennial nature of the plant. Genetic transformation has tremendous potential in developing improved coffee varieties with desired agronomic traits, which are otherwise difficult to achieve through traditional breeding. During the last twenty years, significant progress has been made in coffee biotechnology, particularly in the area of transgenic technology. This paper provides a detailed account of the advances made in the genetic transformation of coffee and their potential applications. PMID:22970380

  7. Application of EPR spectroscopy to the examination of pro-oxidant activity of coffee.

    PubMed

    Krakowian, Daniel; Skiba, Dominik; Kudelski, Adam; Pilawa, Barbara; Ramos, Paweł; Adamczyk, Jakub; Pawłowska-Góral, Katarzyna

    2014-05-15

    Free radicals present in coffee may be responsible for exerting toxic effects on an organism. The objectives of this work were to compare free radicals properties and concentrations in different commercially available coffees, in solid and liquid states, and to determine the effect of roasting on the formation of free radicals in coffee beans of various origins. The free radicals content of 15 commercially available coffees (solid and liquid) was compared and the impact of processing examined using electron paramagnetic resonance (EPR) spectroscopy at X-band (9.3 GHz). First derivative EPR spectra were measured at microwave power in the range of 0.7-70 mW. The following parameters were calculated for EPR spectra: amplitude (A), integral intensity (I), and line-width (ΔBpp); g-Factor was obtained from resonance condition. Our study showed that free radicals exist in green coffee beans (10(16) spin/g), roasted coffee beans (10(18) spin/g), and in commercially available coffee (10(17)-10(18) spin/g). Free radical concentrations were higher in solid ground coffee than in instant or lyophilised coffee. Continuous microwave saturation indicated homogeneous broadening of EPR lines from solid and liquid commercial coffee samples as well as green and roasted coffee beans. Slow spin-lattice relaxation processes were found to be present in all coffee samples tested, solid and liquid commercial coffees as well as green and roasted coffee beans. Higher free radicals concentrations were obtained for both the green and roasted at 240 °C coffee beans from Peru compared with those originating from Ethiopia, Brazil, India, or Colombia. Moreover, more free radicals occurred in Arabica coffee beans roasted at 240 °C than Robusta. EPR spectroscopy is a useful method of examining free radicals in different types of coffee. PMID:24423509

  8. Furan levels in coffee as influenced by species, roast degree, and brewing procedures.

    PubMed

    Arisseto, Adriana Pavesi; Vicente, Eduardo; Ueno, Mariana Soares; Tfouni, Silvia Amélia Verdiani; Toledo, Maria Cecília De Figueiredo

    2011-04-13

    Brazilian green coffee beans of Coffea arabica and Coffea canephora species were roasted to light, medium, and dark roast degrees and analyzed in relation to furan content by using an in-house validated method based on gas chromatography coupled to mass spectrometry preceded by headspace solid-phase microextraction. Furan was not detected in green coffees, whereas levels between 911 and 5852 μg/kg were found in the roasted samples. Higher concentrations were found in Coffea canephora species and darker ground coffees. Some of the potential furan precursors were observed in significant amounts in green coffee, especially sucrose and linoleic acid, but their concentrations could not be correlated to furan formation. Additionally, coffee brews were prepared from roasted ground coffees by using two different procedures, and furan levels in the beverages varied from <10 to 288 μg/kg. The factor that most influenced the furan content in coffee brew was the brewing procedure. PMID:21388135

  9. Plant biochemistry: a naturally decaffeinated arabica coffee.

    PubMed

    Silvarolla, Maria B; Mazzafera, Paulo; Fazuoli, Luiz C

    2004-06-24

    The adverse side effects of caffeine have increased the market for decaffeinated coffee to about 10% of coffee consumption worldwide (http://www.ncausa.org), despite the loss of key flavour compounds in the industrial decaffeinating process. We have discovered a naturally decaffeinated Coffea arabica plant from Ethiopia, a species normally recognized for the high quality of its beans. It should be possible to transfer this trait to commercial varieties of arabica coffee plants by intraspecific hybridization--a process likely to be simpler than an interspecific hybridization strategy, which could require more than 30 years of breeding to fix the decaffeinated trait and would probably result in an inferior cup of coffee. PMID:15215853

  10. Trigonelline in coffee. II. Content of green, roasted and instant coffee.

    PubMed

    Stennert, A; Maier, H G

    1994-09-01

    The results of several determinations of trigonelline in green, roasted and instant coffees are reported. The values in normal coffee species and degrees of roast are in agreement with most literature values. In Coffea dewevrei var. excelsa and C. stenophylla lower values were found than reported in the only other publication. The differences from steamed samples were minimal. Fast roasting may result in higher values with the same organic roasting loss, but this was not observed in commercial blends. During industrial extraction of roasted coffee, trigonelline is not completely extracted. The percentage depends on the extraction yield. PMID:7975906

  11. [Does vegetational diversification reduce coffee leaf miner Leucoptera coffeella (Guérin-Mèneville) (Lepidoptera: Lyonetiidae) attack?].

    PubMed

    Amaral, Dany S; Venzon, Madelaine; Pallini, Angelo; Lima, Paulo C; Desouza, Og

    2010-01-01

    The effects of increasing plant diversity on the population of the coffee leaf-miner Leucoptera coffeella (Guérin-Mèneville) were investigated in two organic coffee production systems. One system consisted of coffee intercropped with banana trees (shaded system) and the other one of coffee intercropped with pigeon pea (unshaded system). The increase in plant diversity on both systems was achieved via introduction of green manures such a perennial pea nut, sunn hemp and Brazilian lucerne. The population of L. coffeella, predation and parasitism of L. coffeella mines were biweekly evaluated during eight months. The increase in plant diversity on both systems did not affect the attack of L. coffeella on coffee leaves and the mine parasitism rate. However, there was a positive and significant relationship between increasing plant diversity and coffee leaf mine predation by wasps on unshaded coffee system and a negative relationship on shaded coffee system. PMID:20877989

  12. [Coffee and health].

    PubMed

    Tuomilehto, Jaakko

    2013-01-01

    The coffee bean contains over 2000 chemical compounds, the health effects of which are known only to a limited extent. Previous coffee researchers and laymen focused solely on caffeine and its positive effect on mental alertness. Other ingredients in coffee, especially its polyphenols, also have an influence on our health. In Finland, coffee is the source of more than half of the so-called antioxidants that are thought to be important for health. Coffee drinkers have lower mortality and morbidity rates than non-drinkers in respect of many common chronic diseases. PMID:23901742

  13. Accelerating Commercial Remote Sensing

    NASA Technical Reports Server (NTRS)

    1995-01-01

    Through the Visiting Investigator Program (VIP) at Stennis Space Center, Community Coffee was able to use satellites to forecast coffee crops in Guatemala. Using satellite imagery, the company can produce detailed maps that separate coffee cropland from wild vegetation and show information on the health of specific crops. The data can control coffee prices and eventually may be used to optimize application of fertilizers, pesticides and irrigation. This would result in maximal crop yields, minimal pollution and lower production costs. VIP is a mechanism involving NASA funding designed to accelerate the growth of commercial remote sensing by promoting general awareness and basic training in the technology.

  14. Coffee and Liver Disease.

    PubMed

    Wadhawan, Manav; Anand, Anil C

    2016-03-01

    Coffee is the most popular beverage in the world. Consumption of coffee has been shown to benefit health in general, and liver health in particular. This article reviews the effects of coffee intake on development and progression of liver disease due to various causes. We also describe the putative mechanisms by which coffee exerts the protective effect. The clinical evidence of benefit of coffee consumption in Hepatitis B and C, as well as nonalcoholic fatty liver disease and alcoholic liver disease, has also been presented. Coffee consumption is associated with improvement in liver enzymes (ALT, AST, and GGTP), especially in individuals with risk for liver disease. Coffee intake more than 2 cups per day in patients with preexisting liver disease has been shown to be associated with lower incidence of fibrosis and cirrhosis, lower hepatocellular carcinoma rates, as well as decreased mortality. PMID:27194895

  15. Development of a multivariate calibration model for the determination of dry extract content in Brazilian commercial bee propolis extracts through UV-Vis spectroscopy

    NASA Astrophysics Data System (ADS)

    Barbeira, Paulo J. S.; Paganotti, Rosilene S. N.; Ássimos, Ariane A.

    2013-10-01

    This study had the objective of determining the content of dry extract of commercial alcoholic extracts of bee propolis through Partial Least Squares (PLS) multivariate calibration and electronic spectroscopy. The PLS model provided a good prediction of dry extract content in commercial alcoholic extracts of bee propolis in the range of 2.7 a 16.8% (m/v), presenting the advantage of being less laborious and faster than the traditional gravimetric methodology. The PLS model was optimized with outlier detection tests according to the ASTM E 1655-05. In this study it was possible to verify that a centrifugation stage is extremely important in order to avoid the presence of waxes, resulting in a more accurate model. Around 50% of the analyzed samples presented content of dry extract lower than the value established by Brazilian legislation, in most cases, the values found were different from the values claimed in the product's label.

  16. 43. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE COMPANY FACTORY AND WAREHOUSE AND DUBUQUE SEED COMPANY WAREHOUSE IN BACKGROUND. VIEW TO SOUTHWEST. - Dubuque Commercial & Industrial Buildings, Dubuque, Dubuque County, IA

  17. 42. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE COMPANY FACTORY AND WAREHOUSE AND DUBUQUE SEED COMPANY WAREHOUSE IN BACKGROUND. VIEW TO SOUTHWEST. - Dubuque Commercial & Industrial Buildings, Dubuque, Dubuque County, IA

  18. 44. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    44. RAILROAD TRACKS, WITH BISHOP'S BLOCK, MCFADDEN COFFEE AND SPICE COMPANY FACTORY AND WAREHOUSE AND DUBUQUE SEED COMPANY WAREHOUSE IN BACKGROUND. VIEW TO SOUTHWEST. - Dubuque Commercial & Industrial Buildings, Dubuque, Dubuque County, IA

  19. Novel identification strategy for ground coffee adulteration based on UPLC-HRMS oligosaccharide profiling.

    PubMed

    Cai, Tie; Ting, Hu; Jin-Lan, Zhang

    2016-01-01

    Coffee is one of the most common and most valuable beverages. According to International Coffee Organization (ICO) reports, the adulteration of coffee for financial reasons is regarded as the most serious threat to the sustainable development of the coffee market. In this work, a novel strategy for adulteration identification in ground coffee was developed based on UPLC-HRMS oligosaccharide profiling. Along with integrated statistical analysis, 17 oligosaccharide composition were identified as markers for the identification of soybeans and rice in ground coffee. This strategy, validated by manual mixtures, optimized both the reliability and authority of adulteration identification. Rice and soybean adulterants present in ground coffee in amounts as low as 5% were identified and evaluated. Some commercial ground coffees were also successfully tested using this strategy. PMID:26213074

  20. Can coffee prevent caries?

    PubMed Central

    Anila Namboodiripad, PC; Kori, Sumathi

    2009-01-01

    Aim: To determine the anti-carious effect of coffee in humans. Coffee represents one of the most consumed products by the population. Materials and Methods: A random sample of 1000 individuals, of both sexes, who consumed only coffee as a beverage and who visited the Out-Patient Department of KLE Society's Institute of Dental Sciences, with a dental complaint and no history of any major illness, were considered as subjects. The patients' histories with regard to the coffee intake, such as, period of consumption, frequency of consumption, whether taken with milk or wihout milk, with sugar or without sugar, and the brand make, was noted. History of the type of diet, consumption of sweets, periodicity of brushing, and whether they had undergone fluoride applications were also noted. A thousand patients who consumed beverages other than coffee were taken as the control. Results: The results showed that coffee most consumed was roasted coffee, and the frequency on an average was about three cups per day, for an average period of 35 years. The Decayed/Missing/Filled Surface (DMFS) scores varied from 2.9, in subjects who drank black coffee, to 5.5 in subjects who consumed coffee together with sweeteners and creaming agents. The DMFS score was 3.4 in subjects who consumed coffee together with milk but no sugar. The DMFS score of the control subjects was 4, indicating that coffee if consumed alone had anticaries action, but in the presence of additives the antibacterial and anticaries action was totally minimized. Conclusion: Thus coffee can help in prevention of dental caries if consumed without additives. PMID:20379435

  1. Oxisterol determination in selected coffees.

    PubMed

    Turchetto, E; Lercker, G; Bortolomeazzi, R

    1993-01-01

    The main aim of green-coffee processing techniques, such as decaffeination and roasting, is always to maintain a very high level of quality in taste and flavor, the beverage's most important characteristics to consumers. Oxidative alterations of coffee lipids, which can occur in roasting, exert a very marked influence on these quality traits. Determining the extent of oxidation thus can provide an indication of the product's potential shelf-life and reveal traces of any newly-formed oxidative products that might prove nutritionally unsafe. Yet, while much attention has recently been focused on certain by-products induced by cholesterol oxidation and their proven toxicity as risk factors in atherosclerosis and cancer, oxidated phytosterols have largely gone unnoticed, being considered along with beta-sitosterol as not very dangerous in that neither is absorbed by the intestinal tract. The present study investigates the substances derived from phytosterol oxidation (oxisterols) in samples of regular and decaffeinated commercial coffees. The findings show that oxisterols were absent in some samples and that the traces of oxidate phytosterols detected in others were well below the threshold considered as toxicologically active. PMID:8367891

  2. ICP-OES and Micronucleus Test to Evaluate Heavy Metal Contamination in Commercially Available Brazilian Herbal Teas.

    PubMed

    Schunk, Priscila Francisca Tschaen; Kalil, Ieda Carneiro; Pimentel-Schmitt, Elisangela Flavia; Lenz, Dominik; de Andrade, Tadeu Uggere; Ribeiro, Juliano Souza; Endringer, Denise Coutinho

    2016-07-01

    Increased tea consumption in combination with intensive pesticide use is generating heavy metal contaminations amongst Brazilian tea consumers, causing health concerns. Inductively coupled plasma optical emission spectrometry (ICP-OES) was applied to quantify minerals and heavy metals such as aluminum, barium, cadmium, lead, cobalt, copper, chromium, tin, manganese, molybdenum, nickel, selenium, silver, thallium, vanadium and zinc in Brazilian chamomile, lemongrass, fennel and yerba mate teas. Teas, purchased in local supermarkets, were prepared using infusion and acid digestion. Higher concentrations of Al were present in all samples. In the digested samples, the Al mean concentration was 2.41 μg g(-1) (sd = 0.72) for fennel and 33.42 μg g(-1) (sd = 17.18) for chamomile, whilst the sample C for chamomile tea presented the highest concentration with 51.62 μg g(-1) (sd = 9.17). The safety relation in decreasing order is fennel, lemongrass, chamomile and yerba mate. Chemometric analyses demonstrated a strong correlation between the elements Cd and Pb in the samples. Yerba mate had the highest amount of metal (100 mg kg(-1)), being the subject of a micronucleus test assay for cytotoxicity. The metals found in Yerba mate did not present cytotoxicity/mutagenicity using the micronucleus test. The inorganic contaminants in teas should have their impact carefully monitored. PMID:26610685

  3. COFFEE GENOMICS AND GERMPLASM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee is the second largest export commodity in the world after petroleum products with an estimated annual retail sales value of US $70 billion. Over 10 million hectares of coffee were harvested in 2005 in more than 50 developing countries, and about 125 million people, equivalent to 17-20 million...

  4. Complementary Coffee Cups

    ERIC Educational Resources Information Center

    Banchoff, Thomas

    2006-01-01

    What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.

  5. Occurrence of furan in coffee from Spanish market: Contribution of brewing and roasting.

    PubMed

    Altaki, M S; Santos, F J; Galceran, M T

    2011-06-15

    In this work, we evaluated the occurrence of furan in brews obtained from regular, decaffeinated, and instant coffee and commercial packed capsules. For this purpose, a previously developed automated headspace solid-phase microextraction method coupled to gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used. Initially, the influence of HS-SPME conditions on furan formation was evaluated. In addition, the effect of roasting conditions (temperature and time) used for coffee beans on furan formation was also studied. We found that low temperature and long roasting time (140°C and 20min) decreases the final furan content. Furan concentrations in regular ground coffee brews from an espresso coffee machine were higher (43-146ng/ml) than those obtained from a home drip coffee maker (20 and 78ng/ml), while decaffeinated coffee brews from a home drip coffee maker (14-65ng/ml) showed a furan concentration similar to that obtained from regular coffee. Relatively low concentrations of this compound (12-35ng/ml) were found in instant coffee brews, while commercial packed coffee capsules showed the highest concentrations (117-244ng/ml). Finally, the daily intake of furan through coffee consumption in Barcelona (Spain) (0.03-0.38μg/kg of body weight) was estimated. PMID:25213922

  6. Coffee and liver health.

    PubMed

    Morisco, Filomena; Lembo, Vincenzo; Mazzone, Giovanna; Camera, Silvia; Caporaso, Nicola

    2014-01-01

    Coffee is one of the most widely used beverages in the world. It includes a wide array of components that can have potential implications for health. Several epidemiological studies associate coffee consumption with a reduced incidence of various chronic diseases such as diabetes, cardiovascular diseases, and neurodegenerative diseases. Over the past 20 years, an increasing number of epidemiological and experimental studies have demonstrated the positive effects of coffee on chronic liver diseases. Coffee consumption has been inversely associated with the activity of liver enzymes in subjects at risk, including heavy drinkers. Coffee favours an improvement in hepatic steatosis and fibrosis, and a reduction in cirrhosis and the risk of hepatocellular carcinoma. The mechanisms of action through which it exerts its beneficial effects are not fully understood. Experimental studies show that coffee consumption reduces fat accumulation and collagen deposition in the liver and promotes antioxidant capacity through an increase in glutathione as well as modulation of the gene and protein expression of several inflammatory mediators. Animal and in vitro studies indicate that cafestol and kahweol, 2 diterpens, can operate by modulating multiple enzymes involved in the detoxification process of carcinogens causing hepatocellular carcinoma. It is unclear whether the benefits are significant enough to "treat" patients with chronic liver disease. While we await clarification, moderate daily unsweetened coffee use is a reasonable adjuvant to therapy for these patients. PMID:25291138

  7. Ion beam analysis of ground coffee and roasted coffee beans

    NASA Astrophysics Data System (ADS)

    Debastiani, R.; dos Santos, C. E. I.; Yoneama, M. L.; Amaral, L.; Dias, J. F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  8. Monitoring Coffee Yield Using Modis Remote Sensing Imagery

    NASA Astrophysics Data System (ADS)

    Bernardes, T.; Rosa, V. G.; Rudorf, B. F.; Adami, M.

    2011-12-01

    Remote sensing studies applied to coffee crop have shown the complexity and difficulty to extract information from satellite imagery. The accuracy of automatic classification for coffee areas was considered only intermediate by several authors. The errors were attributed to topographic effects and low spatial resolution of Landsat images. Besides the difficulties to map coffee crop, there are few cloud cover free Landsat images over the growing season. Despite the low spatial resolution, high temporal coverage of MODIS data makes it possible to obtain cloud free images on several dates over the year providing additional information for monitoring coffee crops. Our hypothesis is that the range of foliar biomass of coffee plots over the growing season, assumed to be estimated through MODIS vegetation indices, is related to coffee yield. We assess the feasibility of monitoring coffee yield by using time-series of MODIS 250m normalized difference vegetation index (NDVI), and enhanced vegetation index (EVI) data. The study area is situated in the south of the Minas Gerais State which produces about thirty percent of the Brazilian coffee production. We used NDVI and EVI products from MODIS spanning from 2006 to 2009 to assess the feasibility of detecting relationships between vegetation indices and coffee yield. Landsat images were used to obtain a reference map of coffee areas and to identify MODIS 250m pure pixels overlapping homogeneous coffee crops. Only MODIS pixels with 100% coffee were included in the analysis. A wavelet-based filter was used to smooth NDVI and EVI time profiles. The next step was the acquisition of coffee yield data directly from farmers on the test site. Those data are being statistically related to vegetation indices and range values per year. The study region presents nearly 452.000 hectares of coffee mapped by on-screen digitalization of Landsat imagery from which about 10.000 hectares match plots likely to be monitored from 250 meters MODIS

  9. Rapid approach to identify the presence of Arabica and Robusta species in coffee using 1H NMR spectroscopy.

    PubMed

    Monakhova, Yulia B; Ruge, Winfried; Kuballa, Thomas; Ilse, Maren; Winkelmann, Ole; Diehl, Bernd; Thomas, Freddy; Lachenmeier, Dirk W

    2015-09-01

    NMR spectroscopy was used to verify the presence of Arabica and Robusta species in coffee. Lipophilic extracts of authentic roasted and green coffees showed the presence of established markers for Robusta (16-O-methylcafestol (16-OMC)) and for Arabica (kahweol). The integration of the 16-OMC signal (δ 3.165 ppm) was used to estimate the amount of Robusta in coffee blends with an approximate limit of detection of 1-3%. The method was successfully applied for the analysis of 77 commercial coffee samples (coffee pods, coffee capsules, and coffee beans). Furthermore, principal component analysis (PCA) was applied to the spectra of lipophilic and aqueous extracts of 20 monovarietal authentic samples. Clusters of the two species were observed. NMR spectroscopy can be used as a rapid prescreening tool to discriminate Arabica and Robusta coffee species before the confirmation applying the official method. PMID:25842325

  10. Modulation of 3',5'-cyclic AMP homeostasis in human platelets by coffee and individual coffee constituents.

    PubMed

    Montoya, Gina A; Bakuradze, Tamara; Eirich, Marion; Erk, Thomas; Baum, Matthias; Habermeyer, Michael; Eisenbrand, Gerhard; Richling, Elke

    2014-11-14

    3',5'-Cyclic AMP (cAMP) is one of the most important second messengers in mammalian cells, mediating a multitude of diverse cellular signalling responses. Its homeostasis is primarily regulated by adenylate cyclases and phosphodiesterases (PDE), the activities of which are partially dependent on the downstream events of adenosine receptor signalling. The present study was conducted to determine whether coffee constituents other than caffeine can influence the homeostasis of intracellular cAMP in vitro and in vivo by evaluating the effects of selected constituents present in coffee, coffee brews and coffee extracts on platelet PDE activity. In addition, to evaluate the potential effects of these constituents on platelet cAMP concentrations and PDE activity in humans, a 7-week pilot intervention study with eight subjects was conducted. The subjects consumed a regular commercial coffee and a low-caffeine coffee at a rate of 750 ml/d for 2 weeks each. The in vivo results revealed a highly significant inhibition of PDE activity (P< 0·001) after coffee intervention that was not directly dependent on the caffeine content of coffee. Although our in vitro and in vivo findings suggest that caffeine plays some role in the modulation of platelet cAMP status, other natural and roasting-associated compounds such as pyrazines and other currently unidentified species also appear to contribute significantly. In conclusion, moderate consumption of coffee can modulate platelet PDE activity and cAMP concentrations in humans, which may contribute to the putative beneficial health effects of coffee. Further detailed mechanistic investigations will be required to substantiate these beneficial effects and to elucidate the underlying mechanisms. PMID:25247601

  11. ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests.

    PubMed

    Bolson, Mônica; Smidt, Eric de Camargo; Brotto, Marcelo Leandro; Silva-Pereira, Viviane

    2015-01-01

    The Araucaria Forests in southern Brazil are part of the Atlantic Rainforest, a key hotspot for global biodiversity. This habitat has experienced extensive losses of vegetation cover due to commercial logging and the intense use of wood resources for construction and furniture manufacturing. The absence of precise taxonomic tools for identifying Araucaria Forest tree species motivated us to test the ability of DNA barcoding to distinguish species exploited for wood resources and its suitability for use as an alternative testing technique for the inspection of illegal timber shipments. We tested three cpDNA regions (matK, trnH-psbA, and rbcL) and nrITS according to criteria determined by The Consortium for the Barcode of Life (CBOL). The efficiency of each marker and selected marker combinations were evaluated for 30 commercially valuable woody species in multiple populations, with a special focus on Lauraceae species. Inter- and intraspecific distances, species discrimination rates, and ability to recover species-specific clusters were evaluated. Among the regions and different combinations, ITS was the most efficient for identifying species based on the 'best close match' test; similarly, the trnH-psbA + ITS combination also demonstrated satisfactory results. When combining trnH-psbA + ITS, Maximum Likelihood analysis demonstrated a more resolved topology for internal branches, with 91% of species-specific clusters. DNA barcoding was found to be a practical and rapid method for identifying major threatened woody angiosperms from Araucaria Forests such as Lauraceae species, presenting a high confidence for recognizing members of Ocotea. These molecular tools can assist in screening those botanical families that are most targeted by the timber industry in southern Brazil and detecting certain species protected by Brazilian legislation and could be a useful tool for monitoring wood exploitation. PMID:26630282

  12. ITS and trnH-psbA as Efficient DNA Barcodes to Identify Threatened Commercial Woody Angiosperms from Southern Brazilian Atlantic Rainforests

    PubMed Central

    Brotto, Marcelo Leandro

    2015-01-01

    The Araucaria Forests in southern Brazil are part of the Atlantic Rainforest, a key hotspot for global biodiversity. This habitat has experienced extensive losses of vegetation cover due to commercial logging and the intense use of wood resources for construction and furniture manufacturing. The absence of precise taxonomic tools for identifying Araucaria Forest tree species motivated us to test the ability of DNA barcoding to distinguish species exploited for wood resources and its suitability for use as an alternative testing technique for the inspection of illegal timber shipments. We tested three cpDNA regions (matK, trnH-psbA, and rbcL) and nrITS according to criteria determined by The Consortium for the Barcode of Life (CBOL). The efficiency of each marker and selected marker combinations were evaluated for 30 commercially valuable woody species in multiple populations, with a special focus on Lauraceae species. Inter- and intraspecific distances, species discrimination rates, and ability to recover species-specific clusters were evaluated. Among the regions and different combinations, ITS was the most efficient for identifying species based on the ‘best close match’ test; similarly, the trnH-psbA + ITS combination also demonstrated satisfactory results. When combining trnH-psbA + ITS, Maximum Likelihood analysis demonstrated a more resolved topology for internal branches, with 91% of species-specific clusters. DNA barcoding was found to be a practical and rapid method for identifying major threatened woody angiosperms from Araucaria Forests such as Lauraceae species, presenting a high confidence for recognizing members of Ocotea. These molecular tools can assist in screening those botanical families that are most targeted by the timber industry in southern Brazil and detecting certain species protected by Brazilian legislation and could be a useful tool for monitoring wood exploitation. PMID:26630282

  13. Identification of Two Metallothioneins as Novel Inhalative Coffee Allergens Cof a 2 and Cof a 3

    PubMed Central

    Peters, Ulrike; Frenzel, Karsten; Brettschneider, Reinhold; Oldenburg, Marcus; Bittner, Cordula

    2015-01-01

    Background Dust of green coffee beans is known to be a relevant cause for occupational allergic disorders in coffee industry workers. Recently, we described the first coffee allergen (Cof a 1) establishing an allergenic potential of green coffee dust. Objective Our aim was to identify allergenic components of green coffee in order to enhance inhalative coffee allergy diagnosis. Methods A Coffea arabica pJuFo cDNA phage display library was created and screened for IgE binding with sera from allergic coffee workers. Two further coffee allergens were identified by sequence analysis, expressed in E. coli, and evaluated by Western blots. The prevalence of sensitization to recombinant Cof a 1, Cof a 2, and Cof a 3 and to commercially available extract was investigated by ELISA (enzyme-linked immunosorbent assay) respectively CAP (capacity test) screening in 18 sera of symptomatic coffee workers. Results In addition to the previously described chitinase Cof a 1, two Coffea arabica cysteine-rich metallothioneins of 9 and 7 kDa were identified and included in the IUIS Allergen Nomenclature as Cof a 2 and Cof a 3. Serum IgE antibodies to at least one of the recombinant allergens were found in 8 out of 18 symptomatic coffee workers (44%). Only 2 of the analysed sera (11%) had reacted previously to the commercial allergy test. Conclusions In addition to the previously described Cof a 1 we have identified two further coffee proteins to be type I coffee allergens (Cof a 2 and Cof a 3) which may have a relevant potential for the specific diagnosis and/or therapy of coffee allergy. PMID:25962169

  14. On cooling tea and coffee

    NASA Astrophysics Data System (ADS)

    Rees, W. G.; Viney, C.

    1988-05-01

    Factors influencing the rate of cooling of hot coffee and tea have been investigated theoretically and studied experimentally using deliberately ``domestic'' apparatus. It is demonstrated that black coffee cools faster than white coffee under the same conditions. Under most (but not all) circumstances, if coffee is required to be as hot as possible several minutes after its preparation, any milk or cream should be added immediately, rather than just before drinking.

  15. Competing for Coffee Space: Development-Induced Displacement in the Central Highlands of Vietnam

    ERIC Educational Resources Information Center

    Doutriaux, Sylvie; Geisler, Charles; Shively, Gerald

    2008-01-01

    Vietnam has emerged as the world's second largest producer of coffee. The benefits of this expanding coffee economy are substantial but not universal; their distribution follows ethnic lines despite government commitment to equalize welfare. Focusing on Dak Lak Province in Vietnam's Central Highlands, we investigate this commercial transformation…

  16. REMPI-TOFMS for on-line monitoring and controlling the coffee roasting process

    NASA Astrophysics Data System (ADS)

    Dorfner, Ralph; Ferge, Thomas; Yeretzian, Chahan; Zimmermann, Ralf; Kettrup, Antonius

    2001-08-01

    REMPI@266nm-TOFMS is used for on-line analysis of the coffee roasting process. Volatile and flavor active compounds of coffee were ionized by REMPI@266nm and monitored on-line and in real-time by TOFMS during the coffee roasting process. The phenol and 4-vinylguaiacol time-intensity profiles, for example, show typical behavior for different roasting temperatures and provide an indicator to the achieved degree of roasting. The impact of the moisture level of the green coffee beans on the time shift of a typical (commercial) roasting time, correlates with REMPI-TOFMS measurements and literature data.

  17. Variations in caffeine and chlorogenic acid contents of coffees: what are we drinking?

    PubMed

    Ludwig, Iziar A; Mena, Pedro; Calani, Luca; Cid, Concepción; Del Rio, Daniele; Lean, Michael E J; Crozier, Alan

    2014-08-01

    The effect of roasting of coffee beans and the extraction of ground coffee with different volumes of hot pressurised water on the caffeine and the total caffeoylquinic acids (CQAs) content of the resultant beverages was investigated. While caffeine was stable higher roasting temperatures resulted in a loss of CQAs so that the caffeine/CQA ratio was a good marker of the degree of roasting. The caffeine and CQA content and volume was determined for 104 espresso coffees obtained from coffee shops in Scotland, Italy and Spain, limited numbers of cappuccino coffees from commercial outlets and several instant coffees. The caffeine content ranged from 48-317 mg per serving and CQAs from 6-188 mg. It is evident that the ingestion of 200 mg of caffeine per day can be readily and unwittingly exceeded by regular coffee drinkers. This is the upper limit of caffeine intake from all sources recommended by US and UK health agencies for pregnant women. In view of the variable volume of serving sizes, it is also clear that the term "one cup of coffee" is not a reproducible measurement for consumption, yet it is the prevailing unit used in epidemiology to assess coffee consumption and to link the potential effects of the beverage and its components on the outcome of diseases. More accurate measurement of the intake of coffee and its potentially bioactive components are required if epidemiological studies are to produce more reliable information. PMID:25014672

  18. Antiadhesive effect of green and roasted coffee on Streptococcus mutans' adhesive properties on saliva-coated hydroxyapatite beads.

    PubMed

    Daglia, M; Tarsi, R; Papetti, A; Grisoli, P; Dacarro, C; Pruzzo, C; Gazzani, Gabriella

    2002-02-27

    Green and roasted coffees of the two most used species, Coffea arabica and Coffea robusta, several commercial coffee samples, and known coffee components were analyzed for their ability to interfere with Streptococcus mutans' sucrose-independent adsorption to saliva-coated hydroxyapatite (HA) beads. All coffee solutions showed high antiadhesive properties. The inhibition of S. mutans' adsorption to HA beads was observed both when coffee was present in the adsorption mixture and when it was used to pretreat the beads, suggesting that coffee active molecules may adsorb to a host surface, preventing the tooth receptor from interacting with any bacterial adhesions. Among the known tested coffee components, trigonelline and nicotinic and chlorogenic acids have been shown to be very active. Dialysis separation of roasted coffee components also showed that a coffee component fraction with 1000 Da < MW < 3500 Da, commonly considered as low MW coffee melanoidins, may sensibly contribute to the roasted coffee's antiadhesive properties. The obtained results showed that all coffee solutions have antiadhesive properties, which are due to both naturally occurring and roasting-induced molecules. PMID:11853508

  19. Coffee (Coffea arabica L.).

    PubMed

    Déchamp, Eveline; Breitler, Jean-Christophe; Leroy, Thierry; Etienne, Hervé

    2015-01-01

    Coffee (Coffea sp.) is a perennial plant widely cultivated in many tropical countries. It is a cash crop for millions of small farmers in these areas. As for other tree species, coffee has long breeding cycles, which makes conventional breeding programs time-consuming. For that matter, genetic transformation can be an effective way to introduce a desired trait in elite varieties or for functional genomics. In this chapter, we describe two highly efficient and reliable Agrobacterium-mediated transformation techniques developed for the C. arabica cultivated species: (1) A. tumefaciens to study and introduce genes conferring resistance/tolerance to biotic (coffee leaf rust, insects) and abiotic stress (drought, heat, seed desiccation) in fully transformed plants and (2) A. rhizogenes to study candidate gene expression for nematode resistance in transformed roots. PMID:25416265

  20. The solar-coffee connection

    SciTech Connect

    Wright, G.

    2000-04-01

    Coffee connoisseurs, when they quaff a cup of coffee or enjoy a jug of joe, don't generally consider the costs to the environment of their favorite beverage. But the fact is that traditional coffee production is hard on the environment, exacting a toll on the native forests and waterways of Central America and on the migratory birds of the western hemisphere. Coffee growing is the second greatest cause of rainforest destruction after cattle ranching, because a lot of trees are cut down to dry the freshly-picked coffee crop. But espresso-sipping environmentalists and an eco-conscious Joe Public can take comfort in a promising new connection between solar energy and rainforest-friendly coffee--solar-dried coffee. And they can take pleasure in it too, because solar-dried coffee, according to virtually everyone who tries it, is the best-tasting coffee made. Considering that coffee is the second most-traded commodity next to oil, and the second most popular beverage in the world next to water, consumed by billions of people, any new process that reduces the environmental damage occasioned by coffee-growing and processing is significant.

  1. Coffee ringspot virus vectored by Brevipalpus phoenicis (Acari: Tenuipalpidae) in coffee.

    PubMed

    Chagas, C M; Kitajima, E W; Rodrigues, J C V

    2003-01-01

    Coffee ringspot is characterized by conspicuous ringspot symptoms on leaves, berries, and less frequently on twigs. It is caused by coffee ringspot virus (CoRSV), a short, bacilliform virus (40 nm x 100-110 nm). The virus is not seed borne and is transmitted by Brevipalpus phoenicis (Geijskes). Transovarial transmission within the mite does not occur. CoRSV has been mechanically transmitted to Chenopodium amaranticolor Coste and Reynaud, C. quinoa Wildenow, Beta vulgaris L., and Alternanthera tenella Colla resulting in local lesions. Systemic infection within both C. amaranticolor and C. quinoa occurs. Virions are found in the nucleus or cytoplasm of infected cells, commonly associated with membranes. Occasionally, membrane bounded particles are found within the cisternae of the endoplasmic reticulum. A characteristic electron lucent, nuclear inclusion is commonly found in many infected cells. These cytopathic effects place CoRSV among the nuclear type of Brevipalpus-borne viruses. The disease has been reported in several Brazilian states (São Paulo, Paraná, Minas Gerais, and Federal District) and recently found in Costa Rica. A similar disease is known in the Philippines, but no information exists about its relationship to CoRSV. Coffee ringspot had no economical significance until recently when a large scale infection was reported in Minas Gerais that resulted in yield loss. PMID:14756417

  2. Beetles, Biofuel, and Coffee

    SciTech Connect

    Ceja-Navarro, Javier

    2015-05-06

    Berkeley Lab scientist Javier Ceja-Navarro discusses his research on the microbial populations found the guts of insects, specifically the coffee berry borer, which may lead to better pest management and the passalid beetle, which could lead to improved biofuel production.

  3. Germination of coffee seeds and its significance for coffee quality.

    PubMed

    Selmar, D; Bytof, G; Knopp, S-E; Breitenstein, B

    2006-03-01

    Besides genotypic characteristics, the crucial factor that determines coffee quality is the mode of post-harvest treatment, i.e., the wet and dry processing. Up to now, the resulting characteristic flavour differences between these differentially processed coffees were attributed exclusively to differences in starting material. However, as these quality differences are still evident, even when identical coffee samples were processed by the two methods in parallel, the differences must be created by metabolic processes in the coffee beans themselves. Based on expression studies of the germination-specific isocitrate lyase and the resumption of cell cycle activity, monitored by the abundance of beta-tubulin, we evidence that germination is initiated in coffee seeds during the course of standard coffee post-harvest treatments. The extent and nature of the germination processes depend on the processing method. The coherence of metabolic events, substantial differences in the chemical composition of the coffee beans, and the generation of specific coffee qualities establishes the basis for a quite novel approach in coffee research. PMID:16547871

  4. Heavy metals in wet method coffee processing wastewater in Soconusco, Chiapas, Mexico.

    PubMed

    Siu, Y; Mejia, G; Mejia-Saavedra, J; Pohlan, J; Sokolov, M

    2007-05-01

    One of the driving forces of the economy in southeast Mexico is agriculture. In Soconusco, Chiapas, coffee is one of the main agricultural products and is traded on the international market. Coffee grown in this region is processed using the wet method in order to be commercialized as green coffee. In the beneficio (coffee processing plant) water is an essential resource which is required in great quantities (Matuk et al., 1997; Sokolov, 2002) as it is used to separate good coffee berries from defective ones, as a method of transporting the coffee berries to the processing machinery, in the elimination of the berry husk from the coffee grains (pulping) and finally in the post-fermentation washing process. This process gives rise to one of the smoothest, high-quality coffees available (Zuluaga, 1989; Herrera, 2002). Currently, many producers in Soconusco are opting for ecological coffee production, which has, among its many criteria, human health and environmental protection (Pohlan, 2005). Furthermore, increasing concern during the past few years regarding the production of food that is free from contaminants such as heavy metals, and recent environmental policies in relation to aquatic ecosystem protection, have given rise to questions concerning the quality of water used in coffee processing, as well as pollutants produced by this agroindustry. Water used in the coffee processing plants originates from the main regional rivers whose hydrological basins stretch from the Sierra Madre mountain range down to the coastal plain. As well as providing water, these rivers also receive the wastewater produced during coffee processing (Sokolov, 2002). PMID:17579799

  5. Recovery and Reutilization of Waste Matter from Coffee Preparation. An Experiment for Environmental Science Courses

    NASA Astrophysics Data System (ADS)

    Orecchio, Santino

    2001-12-01

    This work is designed as an experience for organic and analytical chemistry laboratories in environmental science courses. Coffee grounds were chosen because they are easily available, they are a fine example of a waste product, and the students are familiar with them. The coffee bean is a source of a number of by-products. By comparing the physicochemical characteristics of coffee oil (from the grounds) with those of common oils, it is found that coffee oil shows similarity to palm oil. We hydrolysed the coffee oil and obtained a soap that had good detergent and foaming properties similar to olive oil soap or commercial products. Another beneficial aspect of the coffee bean results from the high content in organic matter (C = 48.9%) of the degreased coffee grounds, which allows their utilization to improve the fertility of soils. The total nitrogen content of the residue is higher than that of many composts and is similar to the nitrogen content of some commercial products employed for house plants. The economical, technical, and environmental advantages that frequently can derive from the recovery of some by-products of foods and beverages, such as the coffee grounds in this example, are evident.

  6. Coffee-induced Hypokalaemia

    PubMed Central

    Tajima, Yutaka

    2010-01-01

    Taking an excess amount of caffeine (e.g. overdrinking caffeinated beverages) sometimes causes hypokalaemia. Although the detailed mechanism has not been clarified yet, an increased loss of potassium via the urine stream caused by the diuretic action of caffeine is proposed as one of the possibilities. We report the case of a 50-year-old female outpatient who rapidly developed severe generalized muscle weakness and fatigue. Her symptoms were considered to be principally due to hypokalaemia. Since her blood urea nitrogen concentration decreased greatly, it was suggested that she had massive polyuria due to overhydration (i.e. dilution of her body fluids). Initially, we considered that a urinary tract infection might have caused her illness. However, we found that she was a heavy coffee drinker and had constantly experienced massive diuresis. After a course of oral antibiotics, potassium replacement and stopping coffee (caffeine) ingestion, her symptoms resolved quickly. In conclusion, it was considered that overdrinking coffee (caffeine) induced her hypokalaemia. Probably, loss of potassium via the urine stream with secondary aldosteronism was the main cause of the hypokalaemia. PMID:21769248

  7. Biotechnological potential of coffee pulp and coffee husk for bioprocesses.

    PubMed

    Pandey; Soccol; Nigam; Brand; Mohan; Roussos

    2000-10-01

    Advances in industrial biotechnology offer potential opportunities for economic utilization of agro-industrial residues such as coffee pulp and coffee husk. Coffee pulp or husk is a fibrous mucilagenous material (sub-product) obtained during the processing of coffee cherries by wet or dry process, respectively. Coffee pulp/husk contains some amount of caffeine and tannins, which makes it toxic in nature, resulting the disposal problem. However, it is rich in organic nature, which makes it an ideal substrate for microbial processes for the production of value-added products. Several solutions and alternative uses of the coffee pulp and husk have been attempted. These include as fertilizers, livestock feed, compost, etc. However, these applications utilize only a fraction of available quantity and are not technically very efficient. Attempts have been made to detoxify it for improved application as feed, and to produce several products such as enzymes, organic acids, flavour and aroma compounds, and mushrooms, etc. from coffee pulp/husk. Solid state fermentation has been mostly employed for bioconversion processes. Factorial design experiments offer useful information for the process optimization. This paper reviews the developments on processes and products developed for the value-addition of coffee pulp/husk through the biotechnological means. PMID:10959086

  8. Study of composition of espresso coffee prepared from various roast degrees of Coffea arabica L. coffee beans.

    PubMed

    Kučera, Lukáš; Papoušek, Roman; Kurka, Ondřej; Barták, Petr; Bednář, Petr

    2016-05-15

    Espresso coffee samples prepared at various roasting degrees defined according to its basic conventional classification (light, medium, medium-dark and dark roasted) were analyzed by ultra-performance liquid chromatography/tandem mass spectrometry. Obtained raw data were processed using multivariate statistical analysis (Principal Component Analysis, PCA) to evaluate chemical differences between each roasting degrees (untargeted part of study). All four roasting degrees were resolved in appropriate Score plot. Orthogonal Projections to Latent Structures provided signals of significant markers describing the differences among particular roasting degrees. Detailed interpretation of those signals by targeted LC/MS(2) analysis revealed four groups of compounds. The first two groups involve chlorogenic acids and related lactones. The signals of other two sets of markers were ascribed to some specific atractylosides and particular melanoidins. Ratios of contents of selected representatives of each group to the sum of all identified markers were proposed as definite parameters for determination of roasting degree of Brazilian coffee Arabica. PMID:26776030

  9. The Coffee and Cream Problem.

    ERIC Educational Resources Information Center

    Greenslade, Thomas B.

    1994-01-01

    Describes how Newton's Law of Cooling and the Method of Mixtures are used to solve the basic dilemma of whether to add the cool cream to the hot coffee or to let the black coffee cool down first and then add the cream. (ZWH)

  10. Changes in headspace volatile concentrations of coffee brews caused by the roasting process and the brewing procedure.

    PubMed

    López-Galilea, Isabel; Fournier, Nicole; Cid, Concepción; Guichard, Elisabeth

    2006-11-01

    Headspace-solid-phase microextraction technique (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) and gas chromatography-olfactometry (GC-O) were used to characterize the aroma compounds of coffee brews from commercial conventional and torrefacto roasted coffee prepared by filter coffeemaker and espresso machine. A total of 47 volatile compounds were identified and quantified. Principal component analysis (PCA) was applied to differentiate coffee brew samples by volatile compounds. Conventional and torrefacto roasted coffee brews were separated successfully by principal component 1 (68.5% of variance), and filter and espresso ones were separated by principal component 2 (19.5% of variance). By GC olfactometry, a total of 34 aroma compounds have been perceived at least in half of the coffee extracts and among them 28 were identified, among which octanal was identified for the first time as a contributor to coffee brew aroma. PMID:17061834

  11. Biotechnological conversion of spent coffee grounds into polyhydroxyalkanoates and carotenoids.

    PubMed

    Obruca, Stanislav; Benesova, Pavla; Kucera, Dan; Petrik, Sinisa; Marova, Ivana

    2015-12-25

    Coffee is one of the world's most popular beverages and has been growing steadily in commercial importance. Nowadays, coffee is the second largest traded commodity in the world, after petroleum. Hence, coffee industry is responsible for the generation of large amounts of waste, especially spent coffee grounds (SCG). Various attempts to valorize this waste stream of coffee industry were made. This article summarizes our research and publications aiming at the conversion of SCG into valuable products - polyhydroxyalkanoates (PHAs) and carotenoids. At first, oil extracted from SCG (approx. 15 wt% oil in SCG) can be efficiently (YP/S=0.82 g/g) converted into PHA employing Cupriavidus necator H16. Further, the solid residues after oil extraction can be hydrolyzed (by the combination of chemical and enzymatic hydrolysis) yielding fermentable sugars, which can be further used as a substrate for the production of PHAs employing Bacillus megaterium (YP/S=0.04 g/g) or Burkholderia cepacia (YP/S=0.24 g/g). Alternatively, SCG hydrolysate can be used as a substrate for biotechnological production of carotenoids by carotenogenic yeast Sporobolomyces roseus. Solid residues after either oil extraction or hydrolysis can be used as fuel in industrial boilers to generate heat and energy. Therefore, entire biomass of SCG can be used for sustainable production of PHAs and/or carotenoids employing bio-refinery approach. PMID:25721970

  12. Occurrence of furan in commercial processed foods in Brazil.

    PubMed

    Arisseto, A P; Vicente, E; Furlani, R P Z; Ueno, M S; Pereira, A L D; Toledo, M C F

    2012-01-01

    Selected commercial processed foods available in the Brazilian market (306 samples) were analysed for furan content using a validated gas chromatography-mass spectrometry method preceded by headspace solid phase micro-extraction (HS-SPME-GC/MS). Canned and jarred foods, including vegetable, meat, fruit and sweet products, showed levels up to 32.8 µg kg⁻¹, with the highest concentrations observed in vegetables and meats. For coffee, furan content ranged from 253.0 to 5021.4 µg kg⁻¹ in the roasted ground coffee and from not detected to 156.6 µg kg⁻¹ in the beverage. For sauces, levels up to 138.1 µg kg⁻¹ were found. In cereal-based products, the highest concentrations (up to 191.3 µg kg⁻¹) were observed in breakfast cereal (corn flakes), cracker (cream crackers) and biscuit (wafer). In general, these results are comparable with those reported in other countries and will be useful for a preliminary estimate of the furan dietary intake in Brazil. PMID:22909188

  13. The Coffee and Cream Dilemma

    NASA Astrophysics Data System (ADS)

    Minor, Brandon; Feldman, Gerald

    2011-10-01

    Many coffee drinkers take cream with their coffee and often wonder whether to add the cream earlier or later. With the objective of keeping their coffee as hot as possible over a moderate time period (10-15 minutes), this is a question that most of them can never answer definitively. We investigated this problem empirically using hot and cold water, with special emphasis on the calorimetry of the mixture. Assuming a coffee:cream (hot:cold) ratio of 3:1, we began with two identical styrofoam coffee cups containing hot water and then added cold water at t = 200 s in one cup and t = 700 s in the other cup. Using two Vernier temperature probes to simultaneously track the temperature change during the cool-down period of the water in both cups over δt = 1000 s, we obtained a real-time graphical account of which process achieved the higher temperature over this time period. In addition, the effect of evaporation was explored by comparing trials with and without a lid on the coffee cup. The application of Newton's Law of Cooling, as compared to the graphical temperature data acquired, will leave no doubt as to the best strategy for adding cool cream to hot coffee.

  14. Caffeine content of decaffeinated coffee.

    PubMed

    McCusker, Rachel R; Fuehrlein, Brian; Goldberger, Bruce A; Gold, Mark S; Cone, Edward J

    2006-10-01

    Caffeine is the most widely consumed drug in the world with coffee representing a major source of intake. Despite widespread availability, various medical conditions necessitate caffeine-restricted diets. Patients on certain prescription medications are advised to discontinue caffeine intake. Such admonition has implications for certain psychiatric patients because of pharmacokinetic interactions between caffeine and certain anti-anxiety drugs. In an effort to abstain from caffeine, patients may substitute decaffeinated for caffeinated coffee. However, decaffeinated beverages are known to contain caffeine in varying amounts. The present study determined the caffeine content in a variety of decaffeinated coffee drinks. In phase 1 of the study, 10 decaffeinated samples were collected from different coffee establishments. In phase 2 of the study, Starbucks espresso decaffeinated (N=6) and Starbucks brewed decaffeinated coffee (N=6) samples were collected from the same outlet to evaluate variability of caffeine content of the same drink. The 10 decaffeinated coffee samples from different outlets contained caffeine in the range of 0-13.9 mg/16-oz serving. The caffeine content for the Starbucks espresso and the Starbucks brewed samples collected from the same outlet were 3.0-15.8 mg/shot and 12.0-13.4 mg/16-oz serving, respectively. Patients vulnerable to caffeine effects should be advised that caffeine may be present in coffees purported to be decaffeinated. Further research is warranted on the potential deleterious effects of consumption of "decaffeinated" coffee that contains caffeine on caffeine-restricted patients. Additionally, further exploration is merited for the possible physical dependence potential of low doses of caffeine such as those concentrations found in decaffeinated coffee. PMID:17132260

  15. Headspace solid-phase microextraction-gas chromatographic-time-of-flight mass spectrometric methodology for geographical origin verification of coffee.

    PubMed

    Risticevic, Sanja; Carasek, Eduardo; Pawliszyn, Janusz

    2008-06-01

    Increasing consumer awareness of food safety issues requires the development of highly sophisticated techniques for the authentication of food commodities. The food products targeted for falsification are either products of high commercial value or those produced in large quantities. For this reason, the present investigation is directed towards the characterization of coffee samples according to the geographical origin. The conducted research involves the development of a rapid headspace solid-phase microextraction (HS-SPME)-gas chromatography-time-of-flight mass spectrometry (GC-TOFMS) method that is utilized for the verification of geographical origin traceability of coffee samples. As opposed to the utilization of traditional univariate optimization methods, the current study employs the application of multivariate experimental designs to the optimization of extraction-influencing parameters. Hence, the two-level full factorial first-order design aided in the identification of two influential variables: extraction time and sample temperature. The optimum set of conditions for the two variables was 12 min and 55 degrees C, respectively, as directed by utilization of Doehlert matrix and response surface methodology. The high-throughput automated SPME procedure was completed by implementing a single divinylbenzene/carboxen/polydimethylsiloxane (DVB/CAR/PDMS) 50/30 microm metal fiber with excellent durability properties ensuring the completion of overall sequence of coffee samples. The utilization of high-speed TOFMS instrument ensured the completion of one GC-MS run of a complex coffee sample in 7.9 min and the complete list of benefits provided by ChromaTOF software including fully automated background subtraction, baseline correction, peak find and mass spectral deconvolution algorithms was exploited during the data evaluation procedure. The combination of the retention index (RI) system using C(8)-C(40) alkanes and the mass spectral library search was utilized

  16. Prokaryotic Diversity in the Rhizosphere of Organic, Intensive, and Transitional Coffee Farms in Brazil.

    PubMed

    Caldwell, Adam Collins; Silva, Lívia Carneiro Fidéles; da Silva, Cynthia Canêdo; Ouverney, Cleber Costa

    2015-01-01

    Despite a continuous rise in consumption of coffee over the past 60 years and recent studies showing positive benefits linked to human health, intensive coffee farming practices have been associated with environmental damage, risks to human health, and reductions in biodiversity. In contrast, organic farming has become an increasingly popular alternative, with both environmental and health benefits. This study aimed to characterize and determine the differences in the prokaryotic soil microbiology of three Brazilian coffee farms: one practicing intensive farming, one practicing organic farming, and one undergoing a transition from intensive to organic practices. Soil samples were collected from 20 coffee plant rhizospheres (soil directly influenced by the plant root exudates) and 10 control sites (soil 5 m away from the coffee plantation) at each of the three farms for a total of 90 samples. Profiling of 16S rRNA gene V4 regions revealed high levels of prokaryotic diversity in all three farms, with thousands of species level operational taxonomic units identified in each farm. Additionally, a statistically significant difference was found between each farm's coffee rhizosphere microbiome, as well as between coffee rhizosphere soils and control soils. Two groups of prokaryotes associated with the nitrogen cycle, the archaeal genus Candidatus Nitrososphaera and the bacterial order Rhizobiales were found to be abundant and statistically different in composition between the three farms and in inverse relationship to each other. Many of the nitrogen-fixing genera known to enhance plant growth were found in low numbers (e.g. Rhizobium, Agrobacter, Acetobacter, Rhodospirillum, Azospirillum), but the families in which they belong had some of the highest relative abundance in the dataset, suggesting many new groups may exist in these samples that can be further studied as potential plant growth-promoting bacteria to improve coffee production while diminishing negative

  17. Prokaryotic Diversity in the Rhizosphere of Organic, Intensive, and Transitional Coffee Farms in Brazil

    PubMed Central

    Caldwell, Adam Collins; Silva, Lívia Carneiro Fidéles; da Silva, Cynthia Canêdo; Ouverney, Cleber Costa

    2015-01-01

    Despite a continuous rise in consumption of coffee over the past 60 years and recent studies showing positive benefits linked to human health, intensive coffee farming practices have been associated with environmental damage, risks to human health, and reductions in biodiversity. In contrast, organic farming has become an increasingly popular alternative, with both environmental and health benefits. This study aimed to characterize and determine the differences in the prokaryotic soil microbiology of three Brazilian coffee farms: one practicing intensive farming, one practicing organic farming, and one undergoing a transition from intensive to organic practices. Soil samples were collected from 20 coffee plant rhizospheres (soil directly influenced by the plant root exudates) and 10 control sites (soil 5 m away from the coffee plantation) at each of the three farms for a total of 90 samples. Profiling of 16S rRNA gene V4 regions revealed high levels of prokaryotic diversity in all three farms, with thousands of species level operational taxonomic units identified in each farm. Additionally, a statistically significant difference was found between each farm’s coffee rhizosphere microbiome, as well as between coffee rhizosphere soils and control soils. Two groups of prokaryotes associated with the nitrogen cycle, the archaeal genus Candidatus Nitrososphaera and the bacterial order Rhizobiales were found to be abundant and statistically different in composition between the three farms and in inverse relationship to each other. Many of the nitrogen-fixing genera known to enhance plant growth were found in low numbers (e.g. Rhizobium, Agrobacter, Acetobacter, Rhodospirillum, Azospirillum), but the families in which they belong had some of the highest relative abundance in the dataset, suggesting many new groups may exist in these samples that can be further studied as potential plant growth-promoting bacteria to improve coffee production while diminishing negative

  18. Antioxidant and Antiradical Activity of Coffee

    PubMed Central

    Yashin, Alexander; Yashin, Yakov; Wang, Jing Yuan; Nemzer, Boris

    2013-01-01

    This review summarizes published information concerning the determination of antioxidant activity (AA) in coffee samples by various methods (ORAC, FRAP, TRAP, TEAC, etc.) in vitro and limited data of antiradical activity of coffee products in vitro and in vivo. Comparison is carried out of the AA of coffee Arabica and coffee Robusta roasted at different temperatures as well as by different roasting methods (microwave, convection, etc.). Data on the antiradical activity of coffee is provided. The antioxidant activity of coffee, tea, cocoa, and red wine is compared. At the end of this review, the total antioxidant content (TAC) of coffee samples from 21 coffee-producing countries as measured by an amperometric method is provided. The TAC of green and roasted coffee beans is also compared. PMID:26784461

  19. Spiroacetals in the Colonization Behaviour of the Coffee Berry Borer: A ‘Push-Pull’ System

    PubMed Central

    Murungi, Lucy; Mwenda, Dickson; Orindi, Benedict; Poehling, Hans-Michael; Torto, Baldwyn

    2014-01-01

    Coffee berries are known to release several volatile organic compounds, among which is the spiroacetal, conophthorin, an attractant for the coffee berry borer Hypothenemus hampei. Elucidating the effects of other spiroacetals released by coffee berries is critical to understanding their chemo-ecological roles in the host discrimination and colonization process of the coffee berry borer, and also for their potential use in the management of this pest. Here, we show that the coffee berry spiroacetals frontalin and 1,6-dioxaspiro [4.5] decane (referred thereafter as brocain), are also used as semiochemicals by the coffee berry borer for host colonization. Bioassays and chemical analyses showed that crowding coffee berry borers from 2 to 6 females per berry, reduced borer fecundity, which appeared to correlate with a decrease in the emission rates of conophthorin and frontalin over time. In contrast, the level of brocain did not vary significantly between borer- uninfested and infested berries. Brocain was attractive at lower doses, but repellent at higher doses while frontalin alone or in a blend was critical for avoidance. Field assays with a commercial attractant comprising a mixture of ethanol and methanol (1∶1), combined with frontalin, confirmed the repellent effect of this compound by disrupting capture rates of H. hampei females by 77% in a coffee plantation. Overall, our results suggest that the levels of frontalin and conophthorin released by coffee berries determine the host colonization behaviour of H. hampei, possibly through a ‘push-pull’ system, whereby frontalin acts as the ‘push’ (repellent) and conophthorin acting as the ‘pull’ (attractant). Furthermore, our results reveal the potential use of frontalin as a repellent for management of this coffee pest. PMID:25380135

  20. Coffee and chocolate in danger.

    PubMed

    Gross, Michael

    2014-06-01

    As a rapidly growing global consumer base appreciates the pleasures of coffee and chocolate and health warnings are being replaced by more encouraging sounds from medical experts, their supply is under threat from climate change, pests and financial problems. Coffee farmers in Central America, in particular, are highly vulnerable to the impact of climate change, made worse by financial insecurity. Michael Gross reports. PMID:24944039

  1. Coffee induces autophagy in vivo

    PubMed Central

    Pietrocola, Federico; Malik, Shoaib Ahmad; Mariño, Guillermo; Vacchelli, Erika; Senovilla, Laura; Chaba, Kariman; Niso-Santano, Mireia; Maiuri, Maria Chiara; Madeo, Frank; Kroemer, Guido

    2014-01-01

    Epidemiological studies and clinical trials revealed that chronic consumption coffee is associated with the inhibition of several metabolic diseases as well as reduction in overall and cause-specific mortality. We show that both natural and decaffeinated brands of coffee similarly rapidly trigger autophagy in mice. One to 4 h after coffee consumption, we observed an increase in autophagic flux in all investigated organs (liver, muscle, heart) in vivo, as indicated by the increased lipidation of LC3B and the reduction of the abundance of the autophagic substrate sequestosome 1 (p62/SQSTM1). These changes were accompanied by the inhibition of the enzymatic activity of mammalian target of rapamycin complex 1 (mTORC1), leading to the reduced phosphorylation of p70S6K, as well as by the global deacetylation of cellular proteins detectable by immunoblot. Immunohistochemical analyses of transgenic mice expressing a GFP–LC3B fusion protein confirmed the coffee-induced relocation of LC3B to autophagosomes, as well as general protein deacetylation. Altogether, these results indicate that coffee triggers 2 phenomena that are also induced by nutrient depletion, namely a reduction of protein acetylation coupled to an increase in autophagy. We speculate that polyphenols contained in coffee promote health by stimulating autophagy. PMID:24769862

  2. Is coffee a functional food?

    PubMed

    Dórea, José G; da Costa, Teresa Helena M

    2005-06-01

    Definitions of functional food vary but are essentially based on foods' ability to enhance the quality of life, or physical and mental performance, of regular consumers. The worldwide use of coffee for social engagement, leisure, enhancement of work performance and well-being is widely recognised. Depending on the quantities consumed, it can affect the intake of some minerals (K, Mg, Mn, Cr), niacin and antioxidant substances. Epidemiological and experimental studies have shown positive effects of regular coffee-drinking on various aspects of health, such as psychoactive responses (alertness, mood change), neurological (infant hyperactivity, Alzheimer's and Parkinson's diseases) and metabolic disorders (diabetes, gallstones, liver cirrhosis), and gonad and liver function. Despite this, most reviews do not mention coffee as fulfilling the criteria for a functional food. Unlike other functional foods that act on a defined population with a special effect, the wide use of coffee-drinking impacts a broad demographic (from children to the elderly), with a wide spectrum of health benefits. The present paper discusses coffee-drinking and health benefits that support the concept of coffee as a functional food. PMID:16022745

  3. Coffee induces autophagy in vivo.

    PubMed

    Pietrocola, Federico; Malik, Shoaib Ahmad; Mariño, Guillermo; Vacchelli, Erika; Senovilla, Laura; Chaba, Kariman; Niso-Santano, Mireia; Maiuri, Maria Chiara; Madeo, Frank; Kroemer, Guido

    2014-01-01

    Epidemiological studies and clinical trials revealed that chronic consumption coffee is associated with the inhibition of several metabolic diseases as well as reduction in overall and cause-specific mortality. We show that both natural and decaffeinated brands of coffee similarly rapidly trigger autophagy in mice. One to 4 h after coffee consumption, we observed an increase in autophagic flux in all investigated organs (liver, muscle, heart) in vivo, as indicated by the increased lipidation of LC3B and the reduction of the abundance of the autophagic substrate sequestosome 1 (p62/SQSTM1). These changes were accompanied by the inhibition of the enzymatic activity of mammalian target of rapamycin complex 1 (mTORC1), leading to the reduced phosphorylation of p70(S6K), as well as by the global deacetylation of cellular proteins detectable by immunoblot. Immunohistochemical analyses of transgenic mice expressing a GFP-LC3B fusion protein confirmed the coffee-induced relocation of LC3B to autophagosomes, as well as general protein deacetylation. Altogether, these results indicate that coffee triggers 2 phenomena that are also induced by nutrient depletion, namely a reduction of protein acetylation coupled to an increase in autophagy. We speculate that polyphenols contained in coffee promote health by stimulating autophagy. PMID:24769862

  4. Immunostimulatory properties of coffee mannans.

    PubMed

    Simões, Joana; Madureira, Pedro; Nunes, Fernando M; Domingues, Maria do Rosário; Vilanova, Manuel; Coimbra, Manuel A

    2009-08-01

    Coffee infusion mannans are acetylated polysaccharides containing single Galp and Araf residues as side chains of a beta-(1 --> 4)-Manp backbone. These mannans are structurally similar to the bioactive acetylated mannans from Aloe vera (AV). In this study, acetylated mannans were obtained from two coffee infusions prepared from light and dark roasted beans. These samples were tested for their immunostimulatory activity and compared with an extract of AV mannan and with locust bean gum (LBG) galactomannans. The coffee samples, as well as the AV extract, stimulated murine B- and T-lymphocytes, as evaluated by the in vitro expression of the surface lymphocyte activation marker CD69, more marked on B- than on T-lymphocytes. In coffee samples, contrarily to the AV, no proliferative effect was noticed. LBG sample did not show any immunostimulatory activity. Because the material that remains in the residue of the hot water extraction was still very rich in mannans, a sequential extraction was performed and a main fraction was recovered with a 4 M NaOH solution. Because this material was insoluble in water, a partial acetylation was performed. These polysaccharides also showed immunostimulatory activity, opening the possibility of exploitation of coffee infusion and coffee residue as sources of bioactive polysaccharides. PMID:19603397

  5. Application of gas chromatography/flame ionization detector-based metabolite fingerprinting for authentication of Asian palm civet coffee (Kopi Luwak).

    PubMed

    Jumhawan, Udi; Putri, Sastia Prama; Yusianto; Bamba, Takeshi; Fukusaki, Eiichiro

    2015-11-01

    Development of authenticity screening for Asian palm civet coffee, the world-renowned priciest coffee, was previously reported using metabolite profiling through gas chromatography/mass spectrometry (GC/MS). However, a major drawback of this approach is the high cost of the instrument and maintenance. Therefore, an alternative method is needed for quality and authenticity evaluation of civet coffee. A rapid, reliable and cost-effective analysis employing a universal detector, GC coupled with flame ionization detector (FID), and metabolite fingerprinting has been established for discrimination analysis of 37 commercial and non-commercial coffee beans extracts. gas chromatography/flame ionization detector (GC/FID) provided higher sensitivity over a similar range of detected compounds than GC/MS. In combination with multivariate analysis, GC/FID could successfully reproduce quality prediction from GC/MS for differentiation of commercial civet coffee, regular coffee and coffee blend with 50 wt % civet coffee content without prior metabolite details. Our study demonstrated that GC/FID-based metabolite fingerprinting can be effectively actualized as an alternative method for coffee authenticity screening in industries. PMID:25912451

  6. Chemical oxygen demand reduction in coffee wastewater through chemical flocculation and advanced oxidation processes.

    PubMed

    Zayas Pérez, Teresa; Geissler, Gunther; Hernandez, Fernando

    2007-01-01

    The removal of the natural organic matter present in coffee processing wastewater through chemical coagulation-flocculation and advanced oxidation processes (AOP) had been studied. The effectiveness of the removal of natural organic matter using commercial flocculants and UV/H2O2, UV/O3 and UV/H2O2/O3 processes was determined under acidic conditions. For each of these processes, different operational conditions were explored to optimize the treatment efficiency of the coffee wastewater. Coffee wastewater is characterized by a high chemical oxygen demand (COD) and low total suspended solids. The outcomes of coffee wastewater treatment using coagulation-flocculation and photodegradation processes were assessed in terms of reduction of COD, color, and turbidity. It was found that a reduction in COD of 67% could be realized when the coffee wastewater was treated by chemical coagulation-flocculation with lime and coagulant T-1. When coffee wastewater was treated by coagulation-flocculation in combination with UV/H2O2, a COD reduction of 86% was achieved, although only after prolonged UV irradiation. Of the three advanced oxidation processes considered, UV/H2O2, UV/O3 and UV/H2O2/O3, we found that the treatment with UV/H2O2/O3 was the most effective, with an efficiency of color, turbidity and further COD removal of 87%, when applied to the flocculated coffee wastewater. PMID:17918591

  7. Use of different extracts of coffee pulp for the production of bioethanol.

    PubMed

    Menezes, Evandro Galvão Tavares; do Carmo, Juliana Ribeiro; Menezes, Aline Galvão Tavares; Alves, José Guilherme Lembi Ferreira; Pimenta, Carlos José; Queiroz, Fabiana

    2013-01-01

    Coffee is one of the most important agricultural products in Brazil. More than 50 % of the coffee fruit is not used for the production of commercial green coffee and is therefore discarded, usually ending up in the environment. The goal of this work was to select an efficient process for obtaining coffee pulp extract and to evaluate the use of this extract in bioethanol production. The effects of heat treatment and trituration on the yield and composition of the extract were investigated by measuring the amounts of reducing sugars, starch, pectin, and phenolic compounds. The extraction process was most efficient at room temperature using grinding followed by pressing. Five different fermentation media were tested: sugarcane juice or molasses diluted with water or with coffee pulp extract and a medium with only coffee pulp extract. Batch fermentations were carried out at 30 °C for 24 h, and samples were taken to obtain measurements of the total reducing sugars, cell count, and ethanol concentration. The addition of coffee pulp extract did not influence the fermentation or yeast viability, and it can thus be mixed with sugarcane juice or molasses for the production of bioethanol, with a yield of approximately 70 g/L. PMID:23269634

  8. A process for reduction in viscosity of coffee extract by enzymatic hydrolysis of mannan.

    PubMed

    Chauhan, Prakram Singh; Sharma, Prince; Puri, Neena; Gupta, Naveen

    2014-07-01

    Mannan is the main polysaccharide component of coffee extract and is responsible for its high viscosity, which in turn negatively affects the technological processing involved in making instant coffee. In our study, we isolated mannan from coffee beans and extract of commercial coffee and it was enzymatically hydrolyzed using alkali-thermostable mannanase obtained from Bacillus nealsonii PN-11. As mannan is found to be more soluble under alkaline conditions, an alkali-thermostable mannanase is well suited for its hydrolysis. The process of enzymatic hydrolysis was optimized by response surface methodology. Under the following optimized conditions viz enzyme dose of 11.50 U mannanase g(-1) coffee extract, temperature of 44.50 °C and time of 35.80 min, significant twofold decrease in viscosity (50 mPas to 26.00 ± 1.56 mPas) was achieved. The application of this process in large-scale industrial production of coffee will help in reduction of energy consumption used during freeze-drying. It will also make technological processing involved in making coffee more economical. PMID:24390577

  9. Coffee Cravings May Spring from Your DNA

    MedlinePlus

    ... page: https://medlineplus.gov/news/fullstory_160628.html Coffee Cravings May Spring From Your DNA Genes appear ... research suggests that your genes influence how much coffee you drink. Researchers analyzed genetic data from more ...

  10. The antioxidant and chlorogenic acid profiles of whole coffee fruits are influenced by the extraction procedures.

    PubMed

    Mullen, W; Nemzer, B; Ou, B; Stalmach, A; Hunter, J; Clifford, M N; Combet, E

    2011-04-27

    Commercial whole coffee fruit extracts and powder samples were analyzed for chlorogenic acids (CGA), caffeine and antioxidant activities. CGA and caffeine were characterized by LC-MS(n) and HPLC accordingly, and quantified by UV absorbance. ORAC, HORAC, NORAC, SORAC and SOAC (antioxidant capacities) were assessed. Three caffeoylquinic acids, three feruloylquinic acids, three dicaffeoylquinic acids, one p-coumaroylquinic acid, two caffeoylferuloylquinic acids and three putative chlorogenic lactones were quantified, along with a methyl ester of 5-caffeoylquinic acid (detected in one sample, the first such report in any coffee material). Multistep whole coffee fruit extracts displayed higher CGA content than single-step extracts, freeze-dried, or air-dried whole raw fruits. Caffeine in multistep extracts was lower than in the single-step extracts and powders. Antioxidant activity in whole coffee fruit extracts was up to 25-fold higher than in powders dependent upon the radical. Total antioxidant activity of samples displayed strong correlation to CGA content. PMID:21401105

  11. COFFEE SEED PHYSIOLOGY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There are more than 70 species of Coffea (Rubiaceae), but only C. arabica and C. canephora are used commercially. Better understanding of seed physiology within Coffea will facilitate the incorporation of genetic traits for resistance to biotic and abiotic stresses from wild relatives into commerci...

  12. Acrylamide, 5-hydroxymethylfurfural and N(ε)-carboxymethyl-lysine in coffee substitutes and instant coffees.

    PubMed

    Loaëc, Grégory; Jacolot, Philippe; Helou, Cynthia; Niquet-Léridon, Céline; Tessier, Frédéric J

    2014-04-01

    Sensitive analytical methods were developed and validated for the quantification of acrylamide, N(ε)-carboxymethyl-lysine (CML) and 5-hydroxymethylfurfural (HMF) in 24 commercial coffee substitutes (CSs) and 12 instant coffees (ICs). Acrylamide levels varied widely from 200 to 4940 µg kg(-1) with higher levels in CSs. Only two out of 24 CSs had a level of acrylamide above the indicative value set for this food category by the European Commission (4000 µg kg(-1)). None of the ICs tested in this study exceeded the indicative value set for this foodstuff (900 µg kg(-1)). CML ranged from 0.17 to 47 mg kg(-1) and it increased in proportion to the protein content of the samples. The highest concentrations were found in IC partly due to the relatively high protein content of this food group. HMF was the most abundant neoformed compound (NFC) found in the tested commercial samples. It was found between 0.59 and 13 g kg(-1). Among other food categories IC and CS could appear to be major contributors to the exposure to NFCs if consumed on a daily basis. Further investigations are needed to elucidate the acrylamide formation during processing and to determine the daily intake level of frequent consumers of these products. PMID:24460803

  13. Tracing coffee tabletop traces.

    PubMed

    Leiterer, Jork; Emmerling, Franziska; Panne, Ulrich; Christen, Wolfgang; Rademann, Klaus

    2008-08-01

    Crystallization processes under different conditions are of fundamental interest in chemistry, pharmacy, and medicine. Therefore, we have studied the formation of micro- and nanosized crystals using water-caffeine (1,3,7-trimethyl-1 H-purine-2,6(3 H,7 H)-dione) solutions under ambient conditions as a relevant model system. When droplets of an aqueous caffeine solution evaporate and eventually dry on surfaces (glass, polystyrene, and polyester), stable "coffee tabletop" rings with a perimeter of typically 3 mm are formed after 20 to 50 min. Using a micro focus X-ray beam available at the BESSY muSpot-beamline, the fine structure of different caffeine needles can be distinguished. Unexpectedly, both crystal modifications (alpha- and beta-caffeine) are present, but locally separated in these rings. Furthermore, AFM studies reveal the presence of even smaller particles on a nanometer length scale. To eliminate influences of surface irregularities from the crystallization process, acoustic levitation of liquid samples was employed. Such levitated droplets are trapped in a stable position and only surrounded by air. The solvent in an ultrasonically levitated drop evaporates completely, and the resulting crystallization of caffeine was followed in situ by synchrotron X-ray diffraction. In this case, the diffraction pattern is in accordance with pure alpha-caffeine and does not indicate the formation of the room temperature polymorph beta-caffeine. Hence, our investigations open new vistas that may lead to a controlled formation of cocrystals and novel polymorphs of micro- and nanocrystalline materials, which are of relevance for fundamental studies as well as for pharmaceutical and medical applications. PMID:18582001

  14. The coffee genome hub: a resource for coffee genomes

    PubMed Central

    Dereeper, Alexis; Bocs, Stéphanie; Rouard, Mathieu; Guignon, Valentin; Ravel, Sébastien; Tranchant-Dubreuil, Christine; Poncet, Valérie; Garsmeur, Olivier; Lashermes, Philippe; Droc, Gaëtan

    2015-01-01

    The whole genome sequence of Coffea canephora, the perennial diploid species known as Robusta, has been recently released. In the context of the C. canephora genome sequencing project and to support post-genomics efforts, we developed the Coffee Genome Hub (http://coffee-genome.org/), an integrative genome information system that allows centralized access to genomics and genetics data and analysis tools to facilitate translational and applied research in coffee. We provide the complete genome sequence of C. canephora along with gene structure, gene product information, metabolism, gene families, transcriptomics, syntenic blocks, genetic markers and genetic maps. The hub relies on generic software (e.g. GMOD tools) for easy querying, visualizing and downloading research data. It includes a Genome Browser enhanced by a Community Annotation System, enabling the improvement of automatic gene annotation through an annotation editor. In addition, the hub aims at developing interoperability among other existing South Green tools managing coffee data (phylogenomics resources, SNPs) and/or supporting data analyses with the Galaxy workflow manager. PMID:25392413

  15. The coffee genome hub: a resource for coffee genomes.

    PubMed

    Dereeper, Alexis; Bocs, Stéphanie; Rouard, Mathieu; Guignon, Valentin; Ravel, Sébastien; Tranchant-Dubreuil, Christine; Poncet, Valérie; Garsmeur, Olivier; Lashermes, Philippe; Droc, Gaëtan

    2015-01-01

    The whole genome sequence of Coffea canephora, the perennial diploid species known as Robusta, has been recently released. In the context of the C. canephora genome sequencing project and to support post-genomics efforts, we developed the Coffee Genome Hub (http://coffee-genome.org/), an integrative genome information system that allows centralized access to genomics and genetics data and analysis tools to facilitate translational and applied research in coffee. We provide the complete genome sequence of C. canephora along with gene structure, gene product information, metabolism, gene families, transcriptomics, syntenic blocks, genetic markers and genetic maps. The hub relies on generic software (e.g. GMOD tools) for easy querying, visualizing and downloading research data. It includes a Genome Browser enhanced by a Community Annotation System, enabling the improvement of automatic gene annotation through an annotation editor. In addition, the hub aims at developing interoperability among other existing South Green tools managing coffee data (phylogenomics resources, SNPs) and/or supporting data analyses with the Galaxy workflow manager. PMID:25392413

  16. Landscape context and scale differentially impact coffee leaf rust, coffee berry borer, and coffee root-knot nematodes.

    PubMed

    Avelino, Jacques; Romero-Gurdián, Alí; Cruz-Cuellar, Héctor F; Declerck, Fabrice A J

    2012-03-01

    Crop pest and disease incidences at plot scale vary as a result of landscape effects. Two main effects can be distinguished. First, landscape context provides habitats of variable quality for pests, pathogens, and beneficial and vector organisms. Second, the movements of these organisms are dependent on the connectivity status of the landscape. Most of the studies focus on indirect effects of landscape context on pest abundance through their predators and parasitoids, and only a few on direct effects on pests and pathogens. Here we studied three coffee pests and pathogens, with limited or no pressure from host-specific natural enemies, and with widely varying life histories, to test their relationships with landscape context: a fungus, Hemileia vastatrix, causal agent of coffee leaf rust; an insect, the coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae); and root-knot nematodes, Meloidogyne spp. Their incidence was assessed in 29 coffee plots from Turrialba, Costa Rica. In addition, we characterized the landscape context around these coffee plots in 12 nested circular sectors ranging from 50 to 1500 m in radius. We then performed correlation analysis between proportions of different land uses at different scales and coffee pest and disease incidences. We obtained significant positive correlations, peaking at the 150 m radius, between coffee berry borer abundance and proportion of coffee in the landscape. We also found significant positive correlations between coffee leaf rust incidence and proportion of pasture, peaking at the 200 m radius. Even after accounting for plot level predictors of coffee leaf rust and coffee berry borer through covariance analysis, the significance of landscape structure was maintained. We hypothesized that connected coffee plots favored coffee berry borer movements and improved its survival. We also hypothesized that wind turbulence, produced by low-wind-resistance land uses such as pasture, favored removal of coffee

  17. Coffee Cup Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ashkenaz, David E.; Hall, W. Paige; Haynes, Christy L.; Hicks, Erin M.; McFarland, Adam D.; Sherry, Leif J.; Stuart, Douglas A.; Wheeler, Korin E.; Yonzon, Chanda R.; Zhao, Jing; Godwin, Hilary A.; Van Duyne, Richard P.

    2010-01-01

    In this activity, students use a model created from a coffee cup or cardstock cutout to explore the working principle of an atomic force microscope (AFM). Students manipulate a model of an AFM, using it to examine various objects to retrieve topographic data and then graph and interpret results. The students observe that movement of the AFM…

  18. Coffee: The Most Teachable Commodity?

    ERIC Educational Resources Information Center

    Kenworthy, Eldon; Schaeffer, Eric

    2000-01-01

    Discusses one result of globalization that more of what people consume comes from distant regions through complex transitions hidden from ordinary view. Outlines the advantages of studying the coffee chain to understand its relationship to consumer choice and environmental issues. (Author/ASK)

  19. Respiratory function in coffee workers.

    PubMed Central

    Zuskin, E; Valić, F; Skurić, Z

    1979-01-01

    Respiratory function was studied in three groups of workers employed in processing coffee. The prevalence of almost all chronic respiratory symptoms was significantly higher in coffee processors than in control workers. In each group during the Monday work shift there was a significant mean acute decrease in the maximum expiratory flow rate at 50% vital capacity (VC), ranging from 4.0% to 8.7%, and at 25% VC, ranging from 6.0% to 18.5%. Acute reductions in FEV1.0 were considerably lower, ranging from 1.3% to 2.8%. On Thursdays the acute ventilatory function changes were somewhat lower than on Mondays. Acute decreases in flow rates at low lung volumes suggest that the bronchoconstrictor effect of the dust acts mostly on smaller airways. Administration of Intal (disodium cromoglycate) before the shift considerably diminished acute reductions in flow rates. A comparison of Monday pre-shift values of ventilatory capacity in coffee workers with those in controls indicates that exposure to dust in green or roasted coffee processing may lead to persistent loss of pulmonary function. PMID:111700

  20. Phenol adsorption by activated carbon produced from spent coffee grounds.

    PubMed

    Castro, Cínthia S; Abreu, Anelise L; Silva, Carmen L T; Guerreiro, Mário C

    2011-01-01

    The present work highlights the preparation of activated carbons (ACs) using spent coffee grounds, an agricultural residue, as carbon precursor and two different activating agents: water vapor (ACW) and K(2)CO(3) (ACK). These ACs presented the microporous nature and high surface area (620-950 m(2) g(-1)). The carbons, as well as a commercial activated carbon (CAC) used as reference, were evaluated as phenol adsorbent showing high adsorption capacity (≈150 mg g(-1)). The investigation of the pH solution in the phenol adsorption was also performed. The different activating agents led to AC with distinct morphological properties, surface area and chemical composition, although similar phenol adsorption capacity was verified for both prepared carbons. The production of activated carbons from spent coffee grounds resulted in promising adsorbents for phenol removal while giving a noble destination to the residue. PMID:22105129

  1. Plasma concentrations of coffee polyphenols and plasma biomarkers of diabetes risk in healthy Japanese women

    PubMed Central

    Lee, A H; Tan, L 'B; Hiramatsu, N; Ishisaka, A; Alfonso, H; Tanaka, A; Uemura, N; Fujiwara, Y; Takechi, R

    2016-01-01

    Coffee consumption has been reported to reduce the risk of type 2 diabetes in experimental and epidemiological studies. This anti-diabetic effect of coffee may be attributed to its high content in polyphenols especially caffeic acid and chlorogenic acid. However, the association between plasma coffee polyphenols and diabetic risks has never been investigated in the literature. In this study, fasting plasma samples were collected from 57 generally healthy females aged 38–73 (mean 52, s.d. 8) years recruited in Himeji, Japan. The concentrations of plasma coffee polyphenols were determined by liquid chromatography coupled with mass tandem spectrometer. Diabetes biomarkers in the plasma/serum samples were analysed by a commercial diagnostic laboratory. Statistical associations were assessed using Spearman's correlation coefficients. The results showed that plasma chlorogenic acid exhibited negative associations with fasting blood glucose, glycated hemoglobin and C-reactive protein, whereas plasma total coffee polyphenol and plasma caffeic acid were weakly associated with these biomarkers. Our preliminary data support previous findings that coffee polyphenols have anti-diabetic effects but further replications with large samples of both genders are recommended. PMID:27270110

  2. Headspace gas chromatographic determination of methylene chloride in decaffeinated tea and coffee, with electrolytic conductivity detection.

    PubMed

    Page, B D; Charbonneau, C F

    1984-01-01

    A headspace gas chromatographic procedure is described for the determination of methylene chloride (MC) in decaffeinated tea and coffee. The tea or coffee sample, with added methylene bromide (MB) internal standard, is equilibrated for 1.5 h at 100 degrees C in aqueous sodium sulfate before manual headspace sampling. MC and MB are separated on a Porasil A column at 160 degrees C and detected by using a Coulson electrolytic conductivity detector. For coffee and tea samples spiked at 1.3 ppm MC, as well as commercially decaffeinated teas and coffees containing up to 8 ppm MC, coefficients of variation were 10% or less. For decaffeinated teas, problems involving sample homogeneity and loss of MC before sealing the headspace vial had to be overcome. Similar problems with decaffeinated instant and ground coffees were minimal. The headspace procedure was superior to a previously reported distillation technique. MC was readily detected at 0.05 ppm. Fourteen decaffeinated teas and 15 decaffeinated coffees were analyzed; MC was detected at levels that ranged up to 15.9 and 4.0 ppm, respectively. PMID:6469909

  3. Solid-phase microextraction-gas chromatography mass spectrometry and multivariate analysis for the characterization of roasted coffees.

    PubMed

    Zambonin, Carlo G; Balest, Lydia; De Benedetto, Giuseppe E; Palmisano, Francesco

    2005-03-31

    HS-SPME-GC-MS in combination with PCA was employed to discriminate different arabica/robusta blends having different geographical origins. HS-SPME confirmed to be an effective and reproducible sampling technique for routine characterization of coffees. In addition, the chemometric approach permitted to find parameters suitable for the differentiation of the different blends and the determination of the real quality of the products. Finally, the proposed methods have been successfully applied to some commercial coffee blends. PMID:18969991

  4. Immunological and respiratory changes in coffee workers.

    PubMed Central

    Zuskin, E; Valić, F; Kanceljak, B

    1981-01-01

    Immunological status and respiratory function were studied in a group of 45 coffee workers. Skin tests with coffee allergens demonstrated the highest percentage of positive reactions to dust collected during emptying bags (40.0%), followed by dust of green (12%) and then roasted coffee (8.9%). Among 34 skin-tested control workers, 14.7% had positive skin reaction to dust collected during emptying bags, but none had positive skin reaction to green or roasted coffee. Serum levels of total IgE were increased in 24.4% of coffee workers and in 5.9% of control subjects. The prevalence of all chronic respiratory symptoms was significantly higher in coffee workers than in control subjects. Coffee workers with positive skin tests to coffee allergen had a significantly higher prevalence of chronic cough (63.6%) and chronic phlegm (72.7%) than those with negative skin tests (32.4% and 23.5% respectively). There was a significant mean decrease over the Monday work shift in the maximum expiratory flow rate at 50% of vital capacity (MEF50: -7.9%) and at 25% vital capacity (MEF25: -17.8%), suggesting an obstructive effect mostly in smaller airways. Coffee workers with positive skin tests to coffee allergens had larger acute reductions in flow rates than those with negative skin tests but the difference was not statistically significant. PMID:7292386

  5. Pharmacological characterisation of extracts of coffee dusts.

    PubMed Central

    Zuskin, E; Duncan, P G; Douglas, J S

    1983-01-01

    The contractile or relaxant activities or both of aqueous extracts of green and roasted coffees were assayed on isolated guinea pig tracheal spirals. Contractile and relaxant activities were compared with histamine and theophylline, respectively. Green coffee extracts induced concentration dependent contraction, but the maximal tension never exceeded 76.3% +/- 5.2 of a maximal histamine contraction (0.69 +/- 0.07 g/mm2 v 0.52 +/- 0.05 g/mm2; p (0.01). One gram of green coffee dust had a biological activity equivalent to 1.23 +/- 0.1 mg of histamine. The pD2 value of histamine was -5.17 +/- 0.05. The potency of green coffee was unaffected by mepyramine maleate (1 micrograms/ml, final bath concentration) while that of histamine was reduced 500 fold. Tissues contracted with histamine were not significantly relaxed by green coffee extracts. By contrast, roasted coffee extracts induced concentration dependent relaxation of uncontracted and histamine contracted tissues. Tissues contracted with green coffee extracts were also completely relaxed by roasted coffee extracts. The pD2 value of theophylline was -4.10 +/- 0.03. The relaxant activity of 1 g of roasted coffee was equivalent to 1.95 +/- 0.16 mg of theophylline. The potency of these extracts was significantly reduced after propranolol (1 micrograms/ml; dose ratio 1.56). Our results show that coffee dust extracts have considerable biological activity which changes from a contractile to a relaxant action as a consequence of processing. The greater incidence of adverse reactions to green coffee dust(s) in coffee workers may be related to the contractile activity present in green coffee dust. PMID:6830717

  6. Coffee fermentation and flavor--An intricate and delicate relationship.

    PubMed

    Lee, Liang Wei; Cheong, Mun Wai; Curran, Philip; Yu, Bin; Liu, Shao Quan

    2015-10-15

    The relationship between coffee fermentation and coffee aroma is intricate and delicate at which the coffee aroma profile is easily impacted by the fermentation process during coffee processing. However, as the fermentation process in coffee processing is conducted mainly for mucilage removal, its impacts on coffee aroma profile are usually neglected. Therefore, this review serves to summarize the available literature on the impacts of fermentation in coffee processing on coffee aroma as well as other unconventional avenues where fermentation is employed for coffee aroma modulation. Studies have noted that proper control over the fermentation process imparts desirable attributes and prevents undesirable fermentation which generates off-flavors. Other unconventional avenues in which fermentation is employed for aroma modulation include digestive bioprocessing and the fermentation of coffee extracts and green coffee beans. The latter is an area that should be explored further with appropriate microorganisms given its potential for coffee aroma modulation. PMID:25952856

  7. Effect of processing on ochratoxin A (OTA) content of coffee.

    PubMed

    Viani, R

    2002-01-01

    Coffee production can be roughly separated into three main steps 1) cherry processing to green coffee beans, 2) storage and transportation of green coffee to the place of consumption, and 3) green coffee processing to roasted and ground coffee and soluble coffee. The mold species which are known to produce ochratoxin A (OTA) in coffee have been identified as Aspergillus ochraceus, A. carbonarius and occasionally, A. niger. The length of time spent at a water activity > 0.80 at any moment until roasting defines the risk of mold growth and OTA production. However, the specific moment and locus of contamination have not yet been clearly identified. Since coffee husks are a significant source of OTA contamination, cleaning and grading of green coffee are effective methods for reducing OTA levels in coffee. During the process of converting green coffee to roasted and soluble coffees, up to 90% reduction in OTA levels can occur. PMID:11922086

  8. Modulation of coffee aroma via the fermentation of green coffee beans with Rhizopus oligosporus: I. Green coffee.

    PubMed

    Lee, Liang Wei; Cheong, Mun Wai; Curran, Philip; Yu, Bin; Liu, Shao Quan

    2016-11-15

    Modulation of coffee aroma via the biotransformation/fermentation of different coffee matrices during post-harvest remains sparingly explored despite some studies showing their positive impacts on coffee aroma. Therefore, this is an unprecedented study aimed at modulating coffee aroma via the fermentation of green coffee beans with a food-grade fungus Rhizopus oligosporus. The objective of part I of this two-part study was to characterize the volatile and non-volatile profiles of green coffee beans after fermentation. Proteolysis during fermentation resulted in 1.5-fold increase in the concentrations of proline and aspartic acid which exhibited high Maillard reactivity. Extensive degradation of ferulic and caffeic acids led to 2-fold increase in the total concentrations of volatile phenolic derivatives. 36% of the total volatiles detected in fermented green coffee beans were generated during fermentation. Hence, the work presented demonstrated that R. oligosporus fermentation of green coffee beans could induce modification of the aroma precursors of green coffees. PMID:27283713

  9. Climate Change Impacts on Worldwide Coffee Production

    NASA Astrophysics Data System (ADS)

    Foreman, T.; Rising, J. A.

    2015-12-01

    Coffee (Coffea arabica and Coffea canephora) plays a vital role in many countries' economies, providing necessary income to 25 million members of tropical countries, and supporting a $81 billion industry, making it one of the most valuable commodities in the world. At the same time, coffee is at the center of many issues of sustainability. It is vulnerable to climate change, with disease outbreaks becoming more common and suitable regions beginning to shift. We develop a statistical production model for coffee which incorporates temperature, precipitation, frost, and humidity effects using a new database of worldwide coffee production. We then use this model to project coffee yields and production into the future based on a variety of climate forecasts. This model can then be used together with a market model to forecast the locations of future coffee production as well as future prices, supply, and demand.

  10. Coffee Berry Borer Joins Bark Beetles in Coffee Klatch

    PubMed Central

    Jaramillo, Juliana; Torto, Baldwyn; Mwenda, Dickson; Troeger, Armin; Borgemeister, Christian; Poehling, Hans-Michael; Francke, Wittko

    2013-01-01

    Unanswered key questions in bark beetle-plant interactions concern host finding in species attacking angiosperms in tropical zones and whether management strategies based on chemical signaling used for their conifer-attacking temperate relatives may also be applied in the tropics. We hypothesized that there should be a common link in chemical signaling mediating host location by these Scolytids. Using laboratory behavioral assays and chemical analysis we demonstrate that the yellow-orange exocarp stage of coffee berries, which attracts the coffee berry borer, releases relatively high amounts of volatiles including conophthorin, chalcogran, frontalin and sulcatone that are typically associated with Scolytinae chemical ecology. The green stage of the berry produces a much less complex bouquet containing small amounts of conophthorin but no other compounds known as bark beetle semiochemicals. In behavioral assays, the coffee berry borer was attracted to the spiroacetals conophthorin and chalcogran, but avoided the monoterpenes verbenone and α-pinene, demonstrating that, as in their conifer-attacking relatives in temperate zones, the use of host and non-host volatiles is also critical in host finding by tropical species. We speculate that microorganisms formed a common basis for the establishment of crucial chemical signals comprising inter- and intraspecific communication systems in both temperate- and tropical-occurring bark beetles attacking gymnosperms and angiosperms. PMID:24073204

  11. What every dentist should know about coffee.

    PubMed

    Seidman, Lara M; Eckenrode, Kelsey N; Bloom, Ira T; Bashirelahi, Nasir

    2016-01-01

    Coffee is one of the most widely consumed beverages throughout the world. Its stimulating nature is responsible for much of its popularity, which paradoxically has resulted in its reputation for negative effects on consumer health. This review will address recent research on the systemic and dental health effects of coffee. Many of its supposed harmful effects have been disproved, while many protective and beneficial roles for coffee are emerging. PMID:27367628

  12. Determination of the alkylpyrazine composition of coffee using stable isotope dilution-gas chromatography-mass spectrometry (SIDA-GC-MS).

    PubMed

    Pickard, Stephanie; Becker, Irina; Merz, Karl-Heinz; Richling, Elke

    2013-07-01

    A stable isotope dilution analysis based on gas chromatography-mass spectrometry analysis (SIDA-GC-MS) was developed for the quantitative analysis of 12 alkylpyrazines found in commercially available coffee samples. These compounds contribute to coffee flavor. The accuracy of this method was tested by analyzing model mixtures of alkylpyrazines. Comparisons of alkylpyrazine-concentrations suggested that water as extraction solvent was superior to dichloromethane. The distribution patterns of alkylpyrazines in different roasted coffees were quite similar. The most abundant alkylpyrazine in each coffee sample was 2-methylpyrazine, followed by 2,6-dimethylpyrazine, 2,5-dimethylpyrazine, 2-ethylpyrazine, 2-ethyl-6-methylpyrazine, 2-ethyl-5-methylpyrazine, and 2,3,5-trimethylpyrazine, respectively. Among the alkylpyrazines tested, 2,3-dimethylpyrazine, 2-ethyl-3-methylpyrazine, 2-ethyl-3,6-dimethylpyrazine, and 2-ethyl-3,5-dimethylpyrazine revealed the lowest concentrations in roasted coffee. By the use of isotope dilution analysis, the total concentrations of alkylpyrazines in commercially available ground coffee ranged between 82.1 and 211.6 mg/kg, respectively. Decaffeinated coffee samples were found to contain lower amounts of alkylpyrazines than regular coffee samples by a factor of 0.3-0.7, which might be a result of the decaffeination procedure. PMID:23745606

  13. Can Coffee Chemical Compounds and Insecticidal Plants Be Harnessed for Control of Major Coffee Pests?

    PubMed

    Green, Paul W C; Davis, Aaron P; Cossé, Allard A; Vega, Fernando E

    2015-11-01

    Pests and pathogens threaten coffee production worldwide and are difficult to control using conventional methods, such as insecticides. We review the literature on the chemistry of coffee, concentrating on compounds most commonly reported from Coffea arabica and Coffea canephora. Differences in chemistry can distinguish coffee species and varieties, and plants grown under different biogeographic conditions exhibit different chemotypes. A number of chemical groups, such as alkaloids and caffeoylquinic acids, are known to be insecticidal, but most studies have investigated their effects on coffee quality and flavor. More research is required to bridge this gap in knowledge, so that coffee can be bred to be more resistant to pests. Furthermore, we report on some pesticidal plants that have been used for control of coffee pests. Locally sourced pesticidal plants have been underutilized and offer a sustainable alternative to conventional insecticides and could be used to augment breeding for resilience of coffee plants. PMID:26458882

  14. Brazilian gemstones

    NASA Astrophysics Data System (ADS)

    Franco, Rui Ribeiro

    1981-04-01

    Brazil counts as a gemmological province because of the variety of gem minerals present in the country. Most Brazilian states and territories produce gemstones, the State of Minas Gerais being the most important producer both in volume and in number of species. Diamonds are chiefly derived by panning from alluvial deposits in Minas Gerais, Mato Grosso and Goiás. Among other gemstones, the most important are aquamarines, beryls, chrysoberyls, topazes, amethysts, tourmalines, emeralds and agates, and their respective varieties. The occurrences of these gemstones, as well as of a great number of others, are described for each state in which they are found.

  15. Determination of caffeine in coffee products by dynamic complexation with 3,4-dimethoxycinnamate and separation by CZE.

    PubMed

    Nogueira, Thiago; do Lago, Claudimir Lucio

    2007-10-01

    A method based on the formation of pi-complexes with chlorogenate-like species was proposed for the determination of caffeine in regular (nondecaffeinated) and decaffeinated coffee. Both caffeate and 3,4-dimethoxycinnamate were able to transform caffeine--a neutral species in aqueous solutions--into an anionic species. The usage of 3,4-dimethoxycinnamate in the running electrolyte is advantageous, because of its greater chemical stability and the improved resolution of the peaks of caffeine, theobromine, and theophylline. Negative peaks were registered with a capacitively coupled contactless conductivity detector when solutions of these alkylxanthines were analyzed with a BGE composed of 20 mmol/L 3,4-dimethoxycinnamic acid and pH adjusted to 8.5 with Tris. This behavior was expected, because the complex is larger and thus should move slower than the free anion. Caffeine was determined in ground and instant coffee with precision and accuracy that meet Brazilian norms about such products. The LOD was estimated as 33 mg/L, which corresponds to 0.8 and 0.3 mg of caffeine per gram of dry instant coffee and ground coffee, respectively. For the case of decaffeinated coffee, ten times preconcentration with dichloromethane was carried out to allow the quantitation of caffeine, which should not exceed the concentration of 1 mg/g in dry matter. PMID:17768736

  16. Detection of roasted and ground coffee adulteration by HPLC and by amperometric and by post-column derivatization UV-Vis detection.

    PubMed

    Domingues, Diego S; Pauli, Elis D; de Abreu, Julia E M; Massura, Francys W; Cristiano, Valderi; Santos, Maria J; Nixdorf, Suzana L

    2014-03-01

    Coffee is one of the most consumed beverages in the world. Due to its commercial importance, the detection of impurities and foreign matters has been a constant concern in fraud verification, especially because it is difficult to percept adulterations with the naked eye in samples of roasted and ground coffee. In Brazil, the most common additions are roasted materials, such as husks, sticks, corn, wheat middling, soybean, and more recently - acai palm seeds. The performance and correlation of two chromatographic methods, HPLC-HPAEC-PAD and post-column derivatization HPLC-UV-Vis, were compared for carbohydrate analysis in coffee samples. To verify the correlation between the two methods, the principal component analysis for the same mix of triticale and acai seeds in different proportions with coffee was employed. The performance for detecting adulterations in roasted and ground coffee of the two methods was compared. PMID:24176354

  17. Botanical and geographical characterization of green coffee (Coffea arabica and Coffea canephora): chemometric evaluation of phenolic and methylxanthine contents.

    PubMed

    Alonso-Salces, Rosa M; Serra, Francesca; Reniero, Fabiano; Héberger, Károly

    2009-05-27

    Green coffee beans of the two main commercial coffee varieties, Coffea arabica (Arabica) and Coffea canephora (Robusta), from the major growing regions of America, Africa, Asia, and Oceania were studied. The contents of chlorogenic acids, cinnamoyl amides, cinnamoyl glycosides, free phenolic acids, and methylxanthines of green coffee beans were analyzed by liquid chromatography coupled with UV spectrophotometry to determine their botanical and geographical origins. The analysis of caffeic acid, 3-feruloylquinic acid, 5-feruloylquinic acid, 4-feruloylquinic acid, 3,4-dicaffeoylquinic acid, 3-caffeoyl-5-feruloylquinic acid, 3-caffeoyl-4-feruloylquinic acid, 3-p-coumaroyl-4-caffeoylquinic acid, 3-caffeoyl-4-dimethoxycinnamoylquinic acid, 3-caffeoyl-5-dimethoxycinnamoylquinic acid, p-coumaroyl-N-tryptophan, feruloyl-N-tryptophan, caffeoyl-N-tryptophan, and caffeine enabled the unequivocal botanical characterization of green coffee beans. Moreover, some free phenolic acids and cinnamate conjugates of green coffee beans showed great potential as means for the geographical characterization of coffee. Thus, p-coumaroyl-N-tyrosine, caffeoyl-N-phenylalanine, caffeoyl-N-tyrosine, 3-dimethoxycinnamoyl-5-feruloylquinic acid, and dimethoxycinnamic acid were found to be characteristic markers for Ugandan Robusta green coffee beans. Multivariate data analysis of the phenolic and methylxanthine profiles provided preliminary results that allowed showing their potential for the determination of the geographical origin of green coffees. Linear discriminant analysis (LDA) and partial least-squares discriminant analysis (PLS-DA) provided classification models that correctly identified all authentic Robusta green coffee beans from Cameroon and Vietnam and 94% of those from Indonesia. Moreover, PLS-DA afforded independent models for Robusta samples from these three countries with sensitivities and specificities of classifications close to 100% and for Arabica samples from America and

  18. Isolation and quantification of major chlorogenic acids in three major instant coffee brands and their potential effects on H2O2-induced mitochondrial membrane depolarization and apoptosis in PC-12 cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee is a most consumed drink worldwide. In this paper, from three commercially available instant coffees, major chlorogenic acids were isolated and quantified using HPLC and NMR spectroscopic methods. Also, their anti-oxidant and anti-inflammatory activities were determined using DPPH-radical sca...

  19. Coffee Berry Borer, Hypothenemus hampei (Ferrari) (Colecptera: Curculiondae: Scolytinae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer is the most devastating pest of coffee throughout the world. Eggs are deposited inside coffee berries, and insects feed on the coffee seed, severely reducing yields. Conventional chemical control is a very limited option, and there has been a concerted effort to develop biolo...

  20. Experimental analysis of the Italian coffee pot ``moka''

    NASA Astrophysics Data System (ADS)

    Gianino, Concetto

    2007-01-01

    I describe an experiment involving the moka Italian coffee pot. The pot is an ingenious device for making coffee that uses the liquid-vapor equation of state of the water and Darcy's law of linear filtration. The filtration coefficient of coffee is measured and a steam engine model is used to estimate the efficiency of the coffee pot.

  1. Evolution of green coffee protein profiles with maturation and relationship to coffee cup quality.

    PubMed

    Montavon, Philippe; Duruz, Eliane; Rumo, Gilbert; Pratz, Gudrun

    2003-04-01

    Coffee flavor is the product of a complex chain of chemical transformations. The green bean has only a faint odor that is not at all reminiscent of coffee aroma. It contains, however, all of the necessary precursors to generate the unmistakable coffee flavor during roasting. The levels and biochemical status of these precursors may vary in relation to genetic traits, environmental factors, maturation level, postharvest treatment, and storage. To improve our understanding of coffee flavor generation, the sensory and biochemical impact of maturation was assessed. Maturation clearly favored the development of high-quality flavor in the coffee brew. A specific subclass of green coffee beans, however, generated high-quality coffee flavor irrespective of maturation. Biochemical aspects were examined using a dynamic system: immature and mature green coffee suspensions were incubated under air or argon. On the analytical side, a specific pool of flavor precursors was monitored: chlorogenic acids, green coffee proteins, and free amino acids. A link between maturation, the redox behavior of green coffee suspensions, and their sensory scores was identified. Compared to ripe beans, unripe beans were found to be more sensitive to oxidation of chlorogenic acids. Aerobic incubation also triggered the fragmentation or digestion of the 11S seed storage protein and the release of free amino acids. PMID:12670177

  2. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei, is the most economically important insect pest of coffee worldwide, causing millions of dollars in yearly losses to coffee growers. We present the third genomic analysis for a Coleopteran species, a draft genome of female coffee berry borers. The genome s...

  3. Breast cancer and the consumption of coffee.

    PubMed

    Rosenberg, L; Miller, D R; Helmrich, S P; Kaufman, D W; Schottenfeld, D; Stolley, P D; Shapiro, S

    1985-09-01

    The hypothesis has been raised that coffee consumption may increase the incidence of breast cancer, based on the report that fibrocystic breast disease, a risk factor for breast cancer, regresses after abstention from coffee and other methylxanthines. The relation between recent coffee consumption and the risk of breast cancer was evaluated in a case-control study, based on interviews conducted 1975-1982 at several mainly eastern US teaching and community hospitals. The responses of 2,651 women with newly diagnosed breast cancer were compared with those of 1,501 controls with nonmalignant conditions and 385 controls with cancers at other sites. The relative risk estimates for levels of coffee drinking up to seven or more cups daily, relative to none, approximated 1.0 with narrow 95% confidence intervals. After allowance for confounding, the relative risk estimate for drinking at least five cups a day was 1.2 (95% confidence interval, 0.9-1.6) using the noncancer controls and 1.1 (0.7-1.6) using the cancer controls. Coffee consumption was not associated with an increase in the risk of breast cancer among women with a history of fibrocystic breast disease, nor were tea or decaffeinated coffee associated with an increase in the risk of breast cancer. The results suggest that the recent consumption of coffee does not influence the incidence of breast cancer. PMID:4025289

  4. Bronchial reactivity in green coffee exposure.

    PubMed Central

    Zuskin, E; Kanceljak, B; Skurić, Z; Butković, D

    1985-01-01

    Respiratory symptoms and lung function were studied in nine coffee workers who complained of job related respiratory symptoms. Six described symptoms characteristic of occupational asthma. Lung function data showed obstructive changes mostly in the smaller airways with no impairment in diffusing capacity. Bronchoprovocation testing with green coffee allergen provoked immediate asthmatic reactions with acute reductions of ventilatory capacity in four workers. The relative fall in FEF25-75% (ranging from 28% to 66%) was greater than in FEV1 (ranging from 18% to 62% of the control values). Eight of the nine workers had an increased total IgE serum level; five had positive intradermal skin tests to green coffee allergen. Most of the six healthy subjects experimentally exposed to green coffee dust in the working environment showed an acute fall in flow rates on maximum expiratory flow-volume curves. These results indicate that bronchoprovocation with green coffee allergen or green coffee dust may be used to identify subjects sensitive to green coffee. PMID:4005196

  5. Green coffee decontamination by electron beam irradiation

    NASA Astrophysics Data System (ADS)

    Nemtanu, Monica R.; Brasoveanu, Mirela; Grecu, Maria Nicoleta; Minea, R.

    2005-10-01

    Microbiological load of green coffee is a real problem considering that it is extremely sensitive to contamination. Irradiation is a decontamination method for a lot of foodstuffs, being a feasible, very effective and environment friendly one. Beans and ground green coffee were irradiated with electron beams up to 40 kGy. Microbial load, rheological behavior, electron paramagnetic resonance (EPR) and visible spectroscopy were carried out. The results show that electron beam irradiation of green coffee could decontaminate it without severe changes in its properties.

  6. Characterization of mutagenic activity in grain-based coffee-substitute blends and instant coffees

    SciTech Connect

    Johansson, M.A.E.; Knize, M.G.; Felton, J.S.; Jagerstad, M.

    1994-06-01

    Several grain-based coffee-substitute blends and instant coffees showed a mutagenic response in the Ames/Salmonella test using TA98, YG1024 and YG1O29 with metabolic activation. The beverage powders contained 150 to 500 TA98 and 1150 to 4050 YG1024 revertant colonies/gram, respectively. The mutagenic activity in the beverage powders was shown to be stable to heat and the products varied in resistance to acid nitrite treatment. Characterization of the mutagenic activity, using HPLC-and the Ames test of the collected fractions, showed the coffee-substitutes and instant coffees contain several mutagenic compounds, which are most likely aromatic amines.

  7. Study of acrylamide in coffee using an improved liquid chromatography mass spectrometry method: Investigation of colour changes and acrylamide formation in coffee during roasting.

    PubMed

    Senyuva, Hamide Z; Gökmen, Vural

    2005-03-01

    An improved analytical method for the determination of acrylamide in coffee is described using liquid chromatography coupled to mass spectrometric detection (LC-MS). A variety of instant, ground and laboratory roasted coffee samples were analysed using this method. The sample preparation entails extraction of acrylamide with methanol, purification with Carrez I and II solutions, evaporation and solvent change to water, and clean-up with an Oasis HLB solid-phase extraction (SPE) cartridge. The chromatographic conditions allowed separation of acrylamide and the remaining matrix co-extractives with accurate and precise quantification of acrylamide during MS detection in SIM mode. Recoveries for the spiking levels of 50, 100, 250 and 500?microg/kg ranged between 99 and 100% with relative standard deviations of less than 2%. The effects of roasting on the formation of acrylamide and colour development were also investigated at 150, 200 and 225 degrees C. Change in the CIE (Commission Internationale de l'Eclairage) a* colour value was found to show a good correlation with the change in acrylamide. CIE a* and acrylamide data was fitted to a non-linear logarithmic function for the estimation of acrylamide level in coffee. Measured acrylamide levels in commercial roasted coffees compared well with the predicted acrylamide levels from the CIE a* values. PMID:16019790

  8. Advances in genomics for the improvement of quality in coffee.

    PubMed

    Tran, Hue Tm; Lee, L Slade; Furtado, Agnelo; Smyth, Heather; Henry, Robert J

    2016-08-01

    Coffee is an important crop that provides a livelihood to millions of people living in developing countries. Production of genotypes with improved coffee quality attributes is a primary target of coffee genetic improvement programmes. Advances in genomics are providing new tools for analysis of coffee quality at the molecular level. The recent report of a genomic sequence for robusta coffee, Coffea canephora, is a major development. However, a reference genome sequence for the genetically more complex arabica coffee (C. arabica) will also be required to fully define the molecular determinants controlling quality in coffee produced from this high quality coffee species. Genes responsible for control of the levels of the major biochemical components in the coffee bean that are known to be important in determining coffee quality can now be identified by association analysis. However, the narrow genetic base of arabica coffee suggests that genomics analysis of the wild relatives of coffee (Coffea spp.) may be required to find the phenotypic diversity required for effective association genetic analysis. The genomic resources available for the study of coffee quality are described and the potential for the application of next generation sequencing and association genetic analysis to advance coffee quality research are explored. © 2016 Society of Chemical Industry. PMID:26919810

  9. Human coffee drinking: manipulation of concentration and caffeine dose.

    PubMed Central

    Griffiths, R R; Bigelow, G E; Liebson, I A; O'Keeffe, M; O'Leary, D; Russ, N

    1986-01-01

    In a residential research ward coffee drinking was studied in 9 volunteer human subjects with histories of heavy coffee drinking. A series of five experiments was undertaken to characterize adlibitum coffee consumption and to investigate the effects of manipulating coffee concentration, caffeine dose per cup, and caffeine preloads prior to coffee drinking. Manipulations were double-blind and scheduled in randomized sequences across days. When cups of coffee were freely available, coffee drinking tended to be rather regularly spaced during the day with intercup intervals becoming progressively longer throughout the day; experimental manipulations showed that this lengthening of intercup intervals was not due to accumulating caffeine levels. Number of cups of coffee consumed was an inverted U-shaped function of both coffee concentration and caffeine dose per cup; however, coffee-concentration and dose-per-cup manipulations did not produce similar effects on other measures of coffee drinking (intercup interval, time to drink a cup, within-day distribution of cups). Caffeine preload produced dose-related decreases in number of cups consumed. As a whole, these experiments provide some limited evidence for both the suppressive and the reinforcing effects of caffeine on coffee consumption. Examination of total daily coffee and caffeine intake across experiments, however, provides no evidence for precise regulation (i.e., titration) of coffee or caffeine intake. PMID:3958660

  10. The Brazilian Honeybee

    ERIC Educational Resources Information Center

    Michener, Charles D.

    1973-01-01

    Discusses the unusually aggressive Brazilian honeybee, which exhibits many of the attributes of its African antecedants. Describes its abundance and distribution, behaviorial characteristics, future spread, and the potential impact of the Brazilian bee in North America. (JR)

  11. A New Health Perk for Coffee Drinkers?

    MedlinePlus

    ... the coffee that are released in the roasting process," said senior researcher Dr. Gad Rennert. He is director of the Clalit National Israeli Cancer Control Center in Haifa, Israel. These findings can't ...

  12. Coffee: biochemistry and potential impact on health.

    PubMed

    Ludwig, Iziar A; Clifford, Michael N; Lean, Michael E J; Ashihara, Hiroshi; Crozier, Alan

    2014-08-01

    This review provides details on the phytochemicals in green coffee beans and the changes that occur during roasting. Key compounds in the coffee beverage, produced from the ground, roasted beans, are volatile constituents responsible for the unique aroma, the alkaloids caffeine and trigonelline, chlorogenic acids, the diterpenes cafestol and kahweol, and melanoidins, which are Maillard reaction products. The fate of these compounds in the body following consumption of coffee is discussed along with evidence of the mechanisms by which they may impact on health. Finally, epidemiological findings linking coffee consumption to potential health benefits including prevention of several chronic and degenerative diseases, such as cancer, cardiovascular disorders, diabetes, and Parkinson's disease, are evaluated. PMID:24671262

  13. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    PubMed

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  14. Wake up and smell the coffee. Caffeine, coffee, and the medical consequences.

    PubMed Central

    Chou, T

    1992-01-01

    Caffeine is a methylxanthine whose primary biologic effect is antagonism of the adenosine receptor. Its presence in coffee, tea, soda beverages, chocolate, and many prescription and over-the-counter drugs makes it the most commonly consumed stimulant drug. Initially caffeine increases blood pressure, plasma catecholamine levels, plasma renin activity, serum free fatty acid levels, urine production, and gastric acid secretion. Its long-term effects have been more difficult to substantiate. Most of the caffeine consumed in the United States is in coffee, which contains many other chemicals that may have other biologic actions. The consumption of coffee is a self-reinforcing behavior, and caffeine dependence and addiction are common. Coffee and caffeine intake have been linked to many illnesses, but definitive correlations have been difficult to substantiate. Initial trials showing coffee's association with coronary disease and myocardial infarction have been difficult to reproduce and have many confounding variables. Recent studies showing a larger effect over long follow-up periods and with heavy coffee consumption have again brought the question of the role of coffee in disease states to the fore. Caffeine in average dosages does not seem to increase the risk of arrhythmia. At present there is no convincing evidence that caffeine or coffee consumption increases the risk for any solid tumor. The intake of coffee and caffeine has clearly been decreasing in this country over the past two decades, largely brought about by the increasing health consciousness of Americans. Although there have been many studies that hint that the fears of increased disease with coffee drinking may be warranted, many questions have yet to be answered about the health effects of coffee and caffeine use. Images PMID:1441496

  15. Can coffee improve image guidance?

    NASA Astrophysics Data System (ADS)

    Wirz, Raul; Lathrop, Ray A.; Godage, Isuru S.; Burgner-Kahrs, Jessica; Russell, Paul T.; Webster, Robert J.

    2015-03-01

    Anecdotally, surgeons sometimes observe large errors when using image guidance in endonasal surgery. We hypothesize that one contributing factor is the possibility that operating room personnel might accidentally bump the optically tracked rigid body attached to the patient after registration has been performed. In this paper we explore the registration error at the skull base that can be induced by simulated bumping of the rigid body, and find that large errors can occur when simulated bumps are applied to the rigid body. To address this, we propose a new fixation method for the rigid body based on granular jamming (i.e. using particles like ground coffee). Our results show that our granular jamming fixation prototype reduces registration error by 28%-68% (depending on bump direction) in comparison to a standard Brainlab reference headband.

  16. Commercial Agriculture and Modern Transport in Central America.

    ERIC Educational Resources Information Center

    Horst, Oscar H.

    1981-01-01

    Describes an exercise for use in college-level geography courses dealing with the tandem development of transport networks and commercial agriculture in Central America. Using six maps, the author shows the parallels between highway and railroad construction and commercial crops, (coffee, bananas, and cotton) in Central America between 1855-1975.…

  17. In silico identification of coffee genome expressed sequences potentially associated with resistance to diseases

    PubMed Central

    2010-01-01

    Sequences potentially associated with coffee resistance to diseases were identified by in silico analyses using the database of the Brazilian Coffee Genome Project (BCGP). Keywords corresponding to plant resistance mechanisms to pathogens identified in the literature were used as baits for data mining. Expressed sequence tags (ESTs) related to each of these keywords were identified with tools available in the BCGP bioinformatics platform. A total of 11,300 ESTs were mined. These ESTs were clustered and formed 979 EST-contigs with similarities to chitinases, kinases, cytochrome P450 and nucleotide binding site-leucine rich repeat (NBS-LRR) proteins, as well as with proteins related to disease resistance, pathogenesis, hypersensitivity response (HR) and plant defense responses to diseases. The 140 EST-contigs identified through the keyword NBS-LRR were classified according to function. This classification allowed association of the predicted products of EST-contigs with biological processes, including host defense and apoptosis, and with molecular functions such as nucleotide binding and signal transducer activity. Fisher's exact test was used to examine the significance of differences in contig expression between libraries representing the responses to biotic stress challenges and other libraries from the BCGP. This analysis revealed seven contigs highly similar to catalase, chitinase, protein with a BURP domain and unknown proteins. The involvement of these coffee proteins in plant responses to disease is discussed. PMID:21637594

  18. In silico identification of coffee genome expressed sequences potentially associated with resistance to diseases.

    PubMed

    Alvarenga, Samuel Mazzinghy; Caixeta, Eveline Teixeira; Hufnagel, Bárbara; Thiebaut, Flávia; Maciel-Zambolim, Eunize; Zambolim, Laércio; Sakiyama, Ney Sussumu

    2010-10-01

    Sequences potentially associated with coffee resistance to diseases were identified by in silico analyses using the database of the Brazilian Coffee Genome Project (BCGP). Keywords corresponding to plant resistance mechanisms to pathogens identified in the literature were used as baits for data mining. Expressed sequence tags (ESTs) related to each of these keywords were identified with tools available in the BCGP bioinformatics platform. A total of 11,300 ESTs were mined. These ESTs were clustered and formed 979 EST-contigs with similarities to chitinases, kinases, cytochrome P450 and nucleotide binding site-leucine rich repeat (NBS-LRR) proteins, as well as with proteins related to disease resistance, pathogenesis, hypersensitivity response (HR) and plant defense responses to diseases. The 140 EST-contigs identified through the keyword NBS-LRR were classified according to function. This classification allowed association of the predicted products of EST-contigs with biological processes, including host defense and apoptosis, and with molecular functions such as nucleotide binding and signal transducer activity. Fisher's exact test was used to examine the significance of differences in contig expression between libraries representing the responses to biotic stress challenges and other libraries from the BCGP. This analysis revealed seven contigs highly similar to catalase, chitinase, protein with a BURP domain and unknown proteins. The involvement of these coffee proteins in plant responses to disease is discussed. PMID:21637594

  19. Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil.

    PubMed

    Barbosa, Deibs; Alencar, Valquíria Campos; Santos, Daiene Souza; de Freitas Oliveira, Ana Cláudia; de Souza, Alessandra A; Coletta-Filho, Helvecio D; de Oliveira, Regina Souza; Nunes, Luiz R

    2015-05-01

    Strains of Xylella fastidiosa constitute a complex group of bacteria that develop within the xylem of many plant hosts, causing diseases of significant economic importance, such as Pierce's disease in North American grapevines and citrus variegated chlorosis in Brazil. X. fastidiosa has also been obtained from other host plants, in direct correlation with the development of diseases, as in the case of coffee leaf scorch (CLS)--a disease with potential to cause severe economic losses to the Brazilian coffee industry. This paper describes a thorough genomic characterization of coffee-infecting X. fastidiosa strains, initially performed through a microarray-based approach, which demonstrated that CLS strains could be subdivided in two phylogenetically distinct subgroups. Whole-genomic sequencing of two of these bacteria (one from each subgroup) allowed identification of ORFs and horizontally transferred elements (HTEs) that were specific to CLS-related X. fastidiosa strains. Such analyses confirmed the size and importance of HTEs as major mediators of chromosomal evolution amongst these bacteria, and allowed identification of differences in gene content, after comparisons were made with previously sequenced X. fastidiosa strains, isolated from alternative hosts. Although direct experimentation still needs to be performed to elucidate the biological consequences associated with such differences, it was interesting to verify that CLS-related bacteria display variations in genes that produce toxins, as well as surface-related factors (such as fimbrial adhesins and LPS) that have been shown to be involved with recognition of specific host factors in different pathogenic bacteria. PMID:25737482

  20. Determination of acrylamide during roasting of coffee.

    PubMed

    Bagdonaite, Kristina; Derler, Karin; Murkovic, Michael

    2008-08-13

    In this study different Arabica and Robusta coffee beans from different regions of the world were analyzed for acrylamide after roasting in a laboratory roaster. Due to the complex matrix and the comparably low selectivity of the LC-MS at m/ z 72, acrylamide was analyzed after derivatization with 2-mercaptobenzoic acid at m/ z 226. Additionally, the potential precursors of acrylamide (3-aminopropionamide, carbohydrates, and amino acids) were studied. The highest amounts of acrylamide formed in coffee were found during the first minutes of the roasting process [3800 ng/g in Robusta ( Coffea canephora robusta) and 500 ng/g in Arabica ( Coffea arabica)]. When the roasting time was increased, the concentration of acrylamide decreased. It was shown that especially the roasting time and temperature, species of coffee, and amount of precursors in raw material had an influence on acrylamide formation. Robusta coffee contained significantly larger amounts of acrylamide (mean = 708 ng/g) than Arabica coffee (mean = 374 ng/g). Asparagine is the limiting factor for acrylamide formation in coffee. 3-Aminopropionamide formation was observed in a dry model system with mixtures of asparagine with sugars (sucrose, glucose). Thermal decarboxylation and elimination of the alpha-amino group of asparagine at high temperatures (>220 degrees C) led to a measurable but low formation of acrylamide. PMID:18624446

  1. New approaches on the analyses of thermolabile coffee diterpenes by gas chromatography and its relationship with cup quality.

    PubMed

    Novaes, Fábio Junior Moreira; Oigman, Silvia Siag; de Souza, Rodrigo Octavio Mendonça Alves; Rezende, Claudia Moraes; de Aquino Neto, Francisco Radler

    2015-07-01

    A new gas chromatography method using pulsed split injector (PS-GC) was validated to quantify thermolabile diterpenes cafestol, kahweol and isokahweol in methanolysed Arabica coffee oils. Linearity was 0.99 from 8 to 69mgmL(-1), recovery ranged from 99% to 101% and precision of less than 4% was obtained. Besides, Soxhlet extraction time was evaluated and Tukey׳s test indicated that the mass of diterpenes obtained in 4h is equivalent to a 16h period, which represents a space-time yield four times higher. The microwave assisted methanolysis proved to be efficient to quantitatively convert the natural diterpene esters in their respective alcohols and fatty acid methyl esters, accompanied by PS-GC. Also, the intact diterpene esters were analyzed by GC for the first time by the comparison between cold on-column (COC) and PS injection techniques. In all these stages, the molecular integrity of the thermolabile furokaurane diterpenes was maintained. The methanolysed oils from 13 samples of green Brazilian Arabica coffees were analyzed by PS-GC and the diterpenes composition varied from 8 to 12% w/w in oil and 0.7-1% in coffee beans. The ratio between cafestol and kahweol was successfully used to predict the quality of coffee even before the roasting and brewing processes. PMID:25882422

  2. The coffee-machine bacteriome: biodiversity and colonisation of the wasted coffee tray leach

    PubMed Central

    Vilanova, Cristina; Iglesias, Alba; Porcar, Manuel

    2015-01-01

    Microbial communities are ubiquitous in both natural and artificial environments. However, microbial diversity is usually reduced under strong selection pressures, such as those present in habitats rich in recalcitrant or toxic compounds displaying antimicrobial properties. Caffeine is a natural alkaloid present in coffee, tea and soft drinks with well-known antibacterial properties. Here we present the first systematic analysis of coffee machine-associated bacteria. We sampled the coffee waste reservoir of ten different Nespresso machines and conducted a dynamic monitoring of the colonization process in a new machine. Our results reveal the existence of a varied bacterial community in all the machines sampled, and a rapid colonisation process of the coffee leach. The community developed from a pioneering pool of enterobacteria and other opportunistic taxa to a mature but still highly variable microbiome rich in coffee-adapted bacteria. The bacterial communities described here, for the first time, are potential drivers of biotechnologically relevant processes including decaffeination and bioremediation. PMID:26592442

  3. The coffee-machine bacteriome: biodiversity and colonisation of the wasted coffee tray leach.

    PubMed

    Vilanova, Cristina; Iglesias, Alba; Porcar, Manuel

    2015-01-01

    Microbial communities are ubiquitous in both natural and artificial environments. However, microbial diversity is usually reduced under strong selection pressures, such as those present in habitats rich in recalcitrant or toxic compounds displaying antimicrobial properties. Caffeine is a natural alkaloid present in coffee, tea and soft drinks with well-known antibacterial properties. Here we present the first systematic analysis of coffee machine-associated bacteria. We sampled the coffee waste reservoir of ten different Nespresso machines and conducted a dynamic monitoring of the colonization process in a new machine. Our results reveal the existence of a varied bacterial community in all the machines sampled, and a rapid colonisation process of the coffee leach. The community developed from a pioneering pool of enterobacteria and other opportunistic taxa to a mature but still highly variable microbiome rich in coffee-adapted bacteria. The bacterial communities described here, for the first time, are potential drivers of biotechnologically relevant processes including decaffeination and bioremediation. PMID:26592442

  4. Processing of a novel powdered herbal coffee (Pistacia Terebinthus L. Fruits Coffee) and its sensorial properties.

    PubMed

    Secilmis, S S; Yanık, D Kocak; Gogus, F

    2015-07-01

    In this study, the effects of roasting method, grinding and reduction in oil content on the characteristics of Pistacia terebinthus fruit coffee were investigated. Pistacia terebinthus fruit was roasted by microwave, pan and combined (microwave and convection) methods. The degree of roasting was determined by L*, a*, b* color values. The roasting times were 1,500, 1,900 and 1,620 s for microwave, pan and combined roasting methods, respectively. Cold press was used to reduce the oil content both prior to roasting and after the roasting. The oil content was reduced to around 21.5 % in all roasting methods to approach to that of coffee beans. Powdered Pistacia terebinthus fruit coffee brews were compared with each other and Turkish coffee in terms of aroma, flavor, acidity aftertaste, and overall acceptability. Sensorial analysis results showed that coffee brews prepared by pressing after the roasting process were better than those pressing prior to roasting. PMID:26139935

  5. Influence of roasting and different brewing processes on the ochratoxin A content in coffee determined by high-performance liquid chromatography-fluorescence detection (HPLC-FLD).

    PubMed

    La Pera, L; Avellone, G; Lo Turco, V; Di Bella, G; Agozzino, P; Dugo, G

    2008-10-01

    A rapid and reliable procedure has been developed for the determination of ochratoxin A (OTA) in green and roasted coffee. The method consists of extraction of the sample with methanol-5% aqueous sodium hydrogen carbonate/1% PEG8000 (20:80), followed by immunoaffinity column (IAC) clean-up and, finally, high-performance liquid chromatography (HPLC) determination with fluorimetric detection. Mean recoveries for green and roasted coffee spiked at different levels ranging from 94 and 105% were obtained. The limit of determination (S/N = 3) was 0.032 ng g(-1) and the precision (within-laboratory relative standard deviation) was 6%. The method described has been used to assess the influence of roasting and different brewing processes on OTA content in commercial lots of green and roasted coffee. The results provided evidence that roasting led to a significant drop on OTA levels (65-100%). Also, the way coffee is prepared affects the OTA content: brewing using a Moka Express (Italian coffee) led to a significant reduction of OTA concentration (50-75%) since hot water stays in contact with coffee for a short time. On the contrary, Turkish coffee-making (infusion for about 10 min) cause poor reduction in OTA. PMID:18612917

  6. Design and implementation of an integrated management system for ochratoxin A in the coffee production chain.

    PubMed

    Lopez-Garcia, R; Mallmann, C Augusto; Pineiro, M

    2008-02-01

    Coffee is an important export product of Ecuador. Producers are challenged by the implementation of regulatory limits for ochratoxin A. Ecuador has four coffee production areas and the potential for mycotoxin contamination varies due to different environmental conditions and cultural differences in harvesting, storage, processing and commercialization. The major contributors to contamination are the lack of selection during harvesting, delays in drying or rewetting, the lack of proper drying and storage conditions, the mixing of products with different levels of moisture, and the potential for cross-contamination. The long commercialization chain involves different intermediaries that use foreign materials to increase the weight of the product without consideration of quality. An integrated mycotoxin management system using the Hazard Analysis Critical Control Point Systems (HACCP) principles was developed to prevent mycotoxin contamination at each stage of production. Critical control points were developed based on the resources available at the different stages of the production chain. Training programmes helped increase awareness about the impact of contamination, but failed to transform knowledge into improved practices. Thus, different demonstrative models specific for each productive region at all production levels were developed to show the application of prevention mechanisms using limited resources and to demonstrate the increased commercial value of coffee produced using good practices throughout the chain so producers have a better disposition to adopt improved practices. Preliminary results show that coffee managed using the models had a better quality, a lower contamination, a higher yield and better commercial value. The use of local resources and low-cost technology was important in demonstrating the practical approach. PMID:18286413

  7. Heavy Coffee Drinkers Show Lower Risk of Multiple Sclerosis

    MedlinePlus

    ... html Heavy Coffee Drinkers Show Lower Risk of Multiple Sclerosis But the finding isn't reason enough to ... coffee may have a lower risk of developing multiple sclerosis (MS), a new large study suggests. Researchers found ...

  8. Interior view of coffee processing structure No. 1, showing concrete ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of coffee processing structure No. 1, showing concrete reservoirs on floor, view towards the west - Finca Silem, Coffee Processing Structure No. 1, Highway 139, Kilometer 9.3, Maraguez, Ponce Municipio, PR

  9. Exterior view of hipped roof with coffee processing structure in ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Exterior view of hipped roof with coffee processing structure in background, view towards the southwest - Pou Coffee Processing Structure, Casa No. 2, Highway 139, Kilometer 12, Maraguez, Ponce Municipio, PR

  10. Planar view of northwest side of coffee processing structure No. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Planar view of northwest side of coffee processing structure No. 1, view towards the southeast - Finca Silem, Coffee Processing Structure No. 1, Highway 139, Kilometer 9.3, Maraguez, Ponce Municipio, PR

  11. 18. DETAIL VIEW OF DEVICE ON OUTSIDE OF COFFEE HUSKER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. DETAIL VIEW OF DEVICE ON OUTSIDE OF COFFEE HUSKER THAT ADJUSTED ANGLE OF HUSKER VAT WALLS - Hacienda Cafetalera Santa Clara, Coffee Mill, KM 19, PR Route 372, Hacienda La Juanita, Yauco Municipio, PR

  12. Planar view towards the southeast of the front of coffee ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Planar view towards the southeast of the front of coffee processing structure with the Santaella residence to the left - Santaella Coffee Processing Site, Highway 139, Kilometer 10.6, Maraguez, Ponce Municipio, PR

  13. View towards the northeast of coffee beans drying on the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View towards the northeast of coffee beans drying on the third floor with hopper and drum type dryer in background - Santaella Coffee Processing Site, Highway 139, Kilometer 10.6, Maraguez, Ponce Municipio, PR

  14. View of furnace feeding into the drum type coffee dryer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of furnace feeding into the drum type coffee dryer on second floor of structure, view towards southeast - Santaella Coffee Processing Site, Highway 139, Kilometer 10.6, Maraguez, Ponce Municipio, PR

  15. View towards west from across Rio Cerrillos of coffee processing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View towards west from across Rio Cerrillos of coffee processing structure (on left) with the Santaella residence (on right) - Santaella Coffee Processing Site, Highway 139, Kilometer 10.6, Maraguez, Ponce Municipio, PR

  16. Raw coffee based dietary supplements contain carboxyatractyligenin derivatives inhibiting mitochondrial adenine-nucleotide-translocase.

    PubMed

    Lang, Roman; Fromme, Tobias; Beusch, Anja; Lang, Tatjana; Klingenspor, Martin; Hofmann, Thomas

    2014-08-01

    Capsules, powders and tablets containing raw coffee extract are advertised to the consumer as antioxidant rich dietary supplements as part of a healthy diet. We isolated carboxyatractyligenin (4), 2-O-β-d-glucopyranosyl carboxyatractyligenin (6) and 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside (8) from green coffee and found strong inhibitory effects on phosphorylating respiration in isolated mitochondria similar to the effects of the known phytotoxin carboxyatractyloside. LC-MS/MS analysis of commercial green coffee based dietary supplements revealed the occurrence of carboxyatractyligenin, 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside, and 2-O-β-d-glucopyranosyl carboxyatractyligenin in concentrations up to 4.0, 5.7, and 41.6μmol/g, respectively. These data might help to gain first insight into potential physiological side-effects of green coffee containing dietary supplement. PMID:24863614

  17. Production, statistical optimization and application of endoglucanase from Rhizopus stolonifer utilizing coffee husk.

    PubMed

    Navya, P N; Pushpa, S Murthy

    2013-08-01

    Coffee cherry husk (CH) is one of the major by-products obtained from coffee processing industry and accounts to 43 ± 5.9% of cellulose. Screening of fungal organism for cellulase production was carried out and the potential organism was identified as Rhizopus stolonifer by internal transcribed spacer's (ITS)-5.8S rDNA analysis. A systematic study with response surface methodology (RSM) based on CCRD was used to study the interactions among the variables such as pH (3-7), moisture (40-80%) and progression duration (72-168 h) of the fermentation process to maximize the enzyme production. Under the optimized cultivation condition, R. stolonifer synthesized 22,109 U/gds. Model validations at optimum operating conditions showed excellent agreement between the experimental results and the predicted responses with a confidence level of 95%. Endoglucanase thus produced was utilized for ethanol production by simultaneous saccharification and fermentation and maximum of 65.5 g/L of ethanol was obtained. This fungal cellulase has also reported to be efficient detergent additives and promising for commercial use. The present study demonstrates coffee husk as a significant bioprocess substrate. Statistical optimization with major parameters for cellulase production can be highly applicable for industrial scale. Furthermore, value addition to coffee husk with sustainable waste management leading to environment conservation can be achieved. PMID:23223909

  18. Quantitation of volatiles and nonvolatile acids in an extract from coffee beverages: correlation with antioxidant activity.

    PubMed

    Fujioka, Kazutoshi; Shibamoto, Takayuki

    2006-08-01

    The antioxidant activities of a commercial brewed coffee were investigated by measuring malonaldehyde (MA) formation from oxidized cod liver oil using a gas chromatographic method (MA-GC assay) and a thiobarbituric acid method (TBA assay). The highest antioxidant activity obtained by the MA-GC assay was from regular whole brewed coffee (97.8%) at a level of 20%, and the highest antioxidant activity obtained by the TBA assay was from decaffeinated whole brewed coffee (96.6%) at a level of 5%. Among 31 chemicals identified in a dichloromethane extract, guaiacol, ethylguaiacol, and vinylguaiacol exhibited antioxidant activities, which were comparable to that of alpha-tocopherol. Among nine chlorogenic acids (three caffeoylquinic acids, three feruloylquinic acids, and three dicaffeoylquinic acids) identified, 5-caffeoylquinic acid contained the greatest amount both in regular (883.5 microg/mL) and in decaffeinated (1032.6 microg/mL) coffees; it exhibited 24.5% activity by the MA-GC assay and 45.3% activity by the TBA assay at a level of 10 microg/mL. Caffeic and ferulic acids showed moderate antioxidant activities in both assays. PMID:16881716

  19. Discrimination of Complex Mixtures by a Colorimetric Sensor Array: Coffee Aromas

    PubMed Central

    Suslick, Benjamin A.; Feng, Liang; Suslick, Kenneth S.

    2010-01-01

    The analysis of complex mixtures presents a difficult challenge even for modern analytical techniques, and the ability to discriminate among closely similar such mixtures often remains problematic. Coffee provides a readily available archetype of such highly multicomponent systems. The use of a low-cost, sensitive colorimetric sensor array for the detection and identification of coffee aromas is reported. The color changes of the sensor array were used as a digital representation of the array response and analyzed with standard statistical methods, including principal component analysis (PCA) and hierarchical clustering analysis (HCA). PCA revealed that the sensor array has exceptionally high dimensionality with 18 dimensions required to define 90% of the total variance. In quintuplicate runs of 10 commercial coffees and controls, no confusions or errors in classification by HCA were observed in 55 trials. In addition, the effects of temperature and time in the roasting of green coffee beans were readily observed and distinguishable with a resolution better than 10 °C and 5 min, respectively. Colorimetric sensor arrays demonstrate excellent potential for complex systems analysis in real-world applications and provide a novel method for discrimination among closely similar complex mixtures. PMID:20143838

  20. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    ERIC Educational Resources Information Center

    Petracco, Marino

    2005-01-01

    Coffee consumption has spread worldwide and differences in the raw bean consumption, in roasting conditions and in the extraction procedures used to prepare coffee brews result in a great diversity of chemical composition in the final product, the cup of coffee. Hence, beverage preparation is a fundamental step for enjoying the benefits of this…

  1. Determination of acrylamide in brewed coffee and coffee powder using polymeric ionic liquid-based sorbent coatings in solid-phase microextraction coupled to gas chromatography-mass spectrometry.

    PubMed

    Cagliero, Cecilia; Ho, Tien D; Zhang, Cheng; Bicchi, Carlo; Anderson, Jared L

    2016-06-01

    This study describes a simple and rapid sampling method employing a polymeric ionic liquid (PIL) sorbent coating in direct immersion solid-phase microextraction (SPME) for the trace-level analysis of acrylamide in brewed coffee and coffee powder. The crosslinked PIL sorbent coating demonstrated superior sensitivity in the extraction of acrylamide compared to all commercially available SPME coatings. A spin coating method was developed to evenly distribute the PIL coating on the SPME support and reproducibly produce fibers with a large film thickness. Ninhydrin was employed as a quenching reagent during extraction to inhibit the production of interfering acrylamide. The PIL fiber produced a limit of quantitation for acrylamide of 10μgL(-1) and achieved comparable results to the ISO method in the analysis of six coffee powder samples. PMID:27157428

  2. Freezing as a treatment to prevent the spread of coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae) in coffee

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee berry borer, Hypothenemus hampei (Ferrari) is the most serious insect pest of coffee around the world. While it is already present in most of the world’s major coffee growing regions, it is important to delay further spread and to prevent re-introductions which might include hyperparasites or...

  3. Walking with coffee: why does it spill?

    PubMed

    Mayer, H C; Krechetnikov, R

    2012-04-01

    In our busy lives, almost all of us have to walk with a cup of coffee. While often we spill the drink, this familiar phenomenon has never been explored systematically. Here we report on the results of an experimental study of the conditions under which coffee spills for various walking speeds and initial liquid levels in the cup. These observations are analyzed from the dynamical systems and fluid mechanics viewpoints as well as with the help of a model developed here. Particularities of the common cup sizes, the coffee properties, and the biomechanics of walking proved to be responsible for the spilling phenomenon. The studied problem represents an example of the interplay between the complex motion of a cup, due to the biomechanics of a walking individual, and the low-viscosity-liquid dynamics in it. PMID:22680548

  4. Coffee Consumption, Newly Diagnosed Diabetes, and Other Alterations in Glucose Homeostasis: A Cross-Sectional Analysis of the Longitudinal Study of Adult Health (ELSA-Brasil)

    PubMed Central

    Yarmolinsky, James; Mueller, Noel T.; Duncan, Bruce B.; Bisi Molina, Maria del Carmen; Goulart, Alessandra C.; Schmidt, Maria Inês

    2015-01-01

    Introduction Observational studies have reported fairly consistent inverse associations between coffee consumption and risk of type 2 diabetes, but this association has been little investigated with regard to lesser degrees of hyperglycemia and other alterations in glucose homeostasis. Additionally, the association between coffee consumption and diabetes has been rarely investigated in South American populations. We examined the cross-sectional relationships of coffee intake with newly diagnosed diabetes and measures of glucose homeostasis, insulin sensitivity, and insulin secretion, in a large Brazilian cohort of middle-aged and elderly individuals. Methods We used baseline data from 12,586 participants of the Longitudinal Study of Adult Health (ELSA-Brasil). Logistic regression analyses were performed to examine associations between coffee consumption and newly diagnosed diabetes. Analysis of covariance was used to assess coffee intake in relation to two-hour glucose from an oral glucose tolerance test, fasting glucose, glycated hemoglobin, fasting and –2-hour postload insulin and measures of insulin sensitivity. Results We found an inverse association between coffee consumption and newly diagnosed diabetes, after adjusting for multiple covariates [23% and 26% lower odds of diabetes for those consuming coffee 2–3 and >3 times per day, respectively, compared to those reporting never or almost never consuming coffee, (p = .02)]. An inverse association was also found for 2-hour postload glucose [Never/almost never: 7.57 mmol/L, ≤1 time/day: 7.48 mmol/L, 2-3 times/day: 7.22 mmol/L, >3 times/day: 7.12 mol/L, p<0.0001] but not with fasting glucose concentrations (p = 0.07). Coffee was additionally associated with 2-hour postload insulin [Never/almost never: 287.2 pmol/L, ≤1 time/day: 280.1 pmol/L, 2–3 times/day: 275.3 pmol/L, >3 times/day: 262.2 pmol/L, p = 0.0005) but not with fasting insulin concentrations (p = .58). Conclusion Our present study provides

  5. Determination of ochratoxin a in ready-to-drink coffee by immunoaffinity cleanup and liquid chromatography-tandem mass spectrometry.

    PubMed

    Noba, Shigekuni; Uyama, Atsuo; Mochizuki, Naoki

    2009-07-22

    We developed a simple and accurate method for determining ochratoxin A (OTA) in ready-to-drink coffee, using an immunoaffinity column for cleanup and liquid chromatography-tandem mass spectrometry (LC/MS/MS) for identification and quantification. When uniformly stable isotope-labeled OTA (U-[(13)C(20)]-OTA) was employed as an internal standard, the recovery rate of the method was 97.3% (the spiked OTA level was 0.10 ng/mL), the repeatability (relative standard deviation) was 1.9%, and the intermediate precision (relative standard deviation) was 4.0%. The limit of quantification was 0.0065 ng/mL based on a signal-to-noise ratio in coffee of 10:1. The developed method was used for the determination of OTA in ready-to-drink coffee. A total of 30 ready-to-drink coffee samples commercially available in Japan were analyzed. OTA was detected in all of the samples at concentrations ranging from trace levels (0.0020-0.010 ng/mL) to 0.037 ng/mL. This method was shown to be useful for accurately evaluating the intake of OTA from coffee beverages. PMID:19537783

  6. Microbiological and biochemical study of coffee fermentation.

    PubMed

    Avallone, S; Guyot, B; Brillouet, J M; Olguin, E; Guiraud, J P

    2001-04-01

    The coffee fermentation microflora were rich and mainly constituted of aerobic Gram-negative bacilli, with Erwinia and Klebsiella genuses at the highest frequencies. The best population increase was observed with lactic acid bacteria and yeasts, whereas those microorganisms that counted on a pectin medium remained constant during the fermentation step. Qualitatively, lactic acid bacteria belonged mainly to Leuconostoc mesenteroides species but the others microflora were relatively heterogeneous. The microorganisms isolated on pectin medium were Enterobacteriaceae, identified as Erwinia herbicola and Klebsiella pneumoniae, not reported as strong pectolytic strains. Throughout coffee fermentation, 60% of the simple sugars were degraded by the total microflora and not specifically by pectolytic microorganisms. PMID:11178725

  7. Determination of the adsorption capacity of activated carbon made from coffee grounds by chemical activation with ZnCl2 and H3PO4.

    PubMed

    Namane, A; Mekarzia, A; Benrachedi, K; Belhaneche-Bensemra, N; Hellal, A

    2005-03-17

    In order to evaluate the adsorptive capacities of granular activated carbon produced from coffee grounds by chemical activation, the adsorption of different phenols and acid and basic dyes, has been carried out. The comparison with a commercial activated carbon has been made. Adsorption isotherms of phenols and dyes (acid and basic) onto produced and commercial granular activated carbons were experimentally determined by batch tests. Both Freundlich and Langmuir models are well suited to fit the adsorption isotherm data. As a result, the coffee grounds based activated carbon may be promising for phenol and dye removal from aqueous streams. PMID:15752865

  8. Coffee-ring effect beyond the dilute limit

    NASA Astrophysics Data System (ADS)

    Kim, Jin Young; Ryu, Seul-A.; Kim, Hyungdae; Kim, Joon Heon; Park, Jung Su; Park, Yong Seok; Oh, Jeong Su; Weon, Byung Mook

    2015-11-01

    The coffee-ring effect, which is a natural generation of outward capillary flows inside drying coffee drops, is valid at the dilute limit of initial solute concentrations. If the solute is not dilute, the ring deposit is forced to have a non-zero width; higher initial concentration leads to a wider ring. Here we study the coffee-ring effect in the dense limit by demonstrating differences with various initial coffee concentrations from 0.1% to 60%. The coffee drops with high initial concentrations of real coffee particles show interesting evaporation dynamics: dense coffee drops tend to evaporate slowly. This result is different from the classic coffee-ring effect in the dilute limit. We suppose that the slow evaporation of dense coffee drops is associated with the ring growth dynamics. The coffee-ring effect becomes more significant in modern technologies such as self-assembly of nanoparticles, ink-jet printing, painting and ceramics. The complexity in evaporation dynamics of colloidal fluids would be able to be understood by expanding the coffee-ring effects in the dilute as well as the dense limits.

  9. 2-Furoylglycine as a Candidate Biomarker of Coffee Consumption.

    PubMed

    Heinzmann, Silke S; Holmes, Elaine; Kochhar, Sunil; Nicholson, Jeremy K; Schmitt-Kopplin, Philippe

    2015-09-30

    Specific and sensitive food biomarkers are necessary to support dietary intake assessment and link nutritional habits to potential impact on human health. A multistep nutritional intervention study was conducted to suggest novel biomarkers for coffee consumption. (1)H NMR metabolic profiling combined with multivariate data analysis resolved 2-furoylglycine (2-FG) as a novel putative biomarker for coffee consumption. We relatively quantified 2-FG in the urine of coffee drinkers and investigated its origin, metabolism, and excretion kinetics. When searching for its potential precursors, we found different furan derivatives in coffee products, which are known to get metabolized to 2-FG. Maximal urinary excretion of 2-FG occurred 2 h after consumption (p = 0.0002) and returned to baseline after 24 h (p = 0.74). The biomarker was not excreted after consumption of coffee substitutes such as tea and chicory coffee and might therefore be a promising acute biomarker for the detection of coffee consumption in human urine. PMID:26357997

  10. Coffee berry borer (Hypothenemus hampei)—a vector for toxigenic molds and ochratoxin A contamination in coffee beans.

    PubMed

    Velmourougane, Kulandaivelu; Bhat, Rajeev; Gopinandhan, Thirukonda Nannier

    2010-10-01

    Coffee berry borer (CBB, Hypothenemus hampei Ferrari) is a common insect pest in coffee plantations and is a suspected vector of various mycotoxin-producing molds. In the present study, field trials were undertaken consecutively for 3 years to evaluate the impact of CBB on the microbial contamination of Arabica and Robusta coffee bean varieties, with emphasis laid toward ochratoxin A (OTA)-producing fungi. Results revealed higher microbial contamination in CBB-infested beans in both the varieties of coffee with the presence of toxigenic molds (such as Aspergillus niger, Aspergillus ochraceus). The "timely harvested" coffee, which was infested with CBB, was found to possess comparatively lesser OTA levels than those berries left in soil or on coffee plants. Studies carried out on coffee beans collected from nine curing factories indicated the presence of OTA in almost all the CBB-infested coffee beans, irrespective of the variety. Results of the present study provide sufficient baseline information and evidence to understand and correlate the role of CBB with various OTA-producing molds in coffee beans. Understanding the role of CBB might be useful and applicable in the coffee-growing regions of the world, especially in plantations for production of quality coffee. PMID:20618085

  11. Brazilian antidoping public policy.

    PubMed

    Almeida, Claudio Bispo de; Rodrigues, Deyvis Nascimento

    2014-07-01

    Doping, used to improve sports performance, is legally prohibited. This paper describes Brazilian regulations, resolutions, and Federal laws addressing the issue of doping and antidoping which were collected in 2012 from official websites. We conclude that Brazilian laws have constrained doping, and have been updated over the years to conform to worldwide legal guidelines. Study limitations are noted. PMID:24799072

  12. Microbiology: Mixing Wine, Chocolate, and Coffee.

    PubMed

    Goddard, Matthew R

    2016-04-01

    Yeasts associated with cocoa and coffee beans are genetically distinct. These populations have been created through the migration and mixing of populations associated with vineyards, trees in America, and the ancestral seat of this species in Far East Asia. PMID:27046811

  13. Fungal endophytes in green coffee seeds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Green coffee seeds from Colombia, Guatemala, India, Kenya, Papua New Guinea, Puerto Rico, and Vietnam were sampled for the presence of fungal endophytes. Sections of surface sterilized seeds were plated on yeast malt agar, and fungal growth was isolated for subsequent DNA extraction and sequencing....

  14. Redirect research to control coffee pest

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred years ago, one of the most significant biological invasions of an agricultural insect pest in the Americas was initiated. Endemic to Africa, the coffee berry borer (Hypothenemus hampei; Coleoptera: Curculionidae) was accidentally introduced to Brazil in 1913 and years later invaded coff...

  15. The Coffee-Milk Mixture Problem Revisited

    ERIC Educational Resources Information Center

    Marion, Charles F.

    2015-01-01

    This analysis of a problem that is frequently posed at professional development workshops, in print, and on the Web--the coffee-milk mixture riddle--illustrates the timeless advice of George Pólya's masterpiece on problem solving in mathematics, "How to Solve It." In his book, Pólya recommends that problems previously solved and put…

  16. Nuclear Physics in a Coffee Cup

    ERIC Educational Resources Information Center

    Higbie, J.

    1974-01-01

    Discusses physical phenomena which can be demonstrated by using a coffee cup, involving the short-range field, alpha-particle scattering, standing waves, and Bohr's closed electron orbits. Indicates that observation of the physics of the classroom in everyday objects can attract student interest in physics learning. (CC)

  17. Brazilian Small Satellites

    NASA Astrophysics Data System (ADS)

    Carvalho, Himilcon

    Brazilian experience with micro scientific satellites began in 1995 with the SACI project that comprised 2 scientific satellites that carried onboard experiments from Brazil, Japan and US. The first one failed after launch (1998) and the second was lost during the second launch attempt of the Brazilian national launcher, VLS, in1999. Started by 1997, the French-Brazilian Microsatellite Project comprised a set of 9 experiments from French and Brazilian scientists. The project was terminated by the French side in 2002. Currently, there are two ongoing science projects, MIRAX (devoted to X-Ray astronomy) and EQUARS (to study the higher atmosphere). These projects include experiments from US, Netherlands, Japan, Canada, and Brazil, with launch scheduled to 2011 or 2012. This paper presents a brief summary of the history of the development of these satellites along with some highlights on the Brazilian Space Program.

  18. Freshness indices of roasted coffee: monitoring the loss of freshness for single serve capsules and roasted whole beans in different packaging.

    PubMed

    Glöss, Alexia N; Schönbächler, Barbara; Rast, Markus; Deuber, Louis; Yeretzian, Chahan

    2014-01-01

    With the growing demand for high-quality coffee, it is becoming increasingly important to establish quantitative measures of the freshness of coffee, or the loss thereof, over time. Indeed, freshness has become a critical quality criterion in the specialty coffee scene, where the aim is to deliver the most pleasant flavor in the cup, from highest quality beans. A series of intensity ratios of selected volatile organic compounds (VOC) in the headspace of coffee (by gas chromatography-mass spectrometry) were revisited, with the aim to establish robust indicators of freshness of coffee - called freshness indices. Roasted whole beans in four different packaging materials and four commercial capsule systems from the Swiss market were investigated over a period of up to one year of storage time. These measurements revealed three types of insight. First, a clear link between barrier properties of the packaging material and the evolution of selected freshness indices was observed. Packaging materials that contain an aluminum layer offer better protection. Second, processing steps prior to packaging are reflected in the absolute values of freshness indices. Third, differences in the standard deviations of freshness-indices for single serve coffee capsule systems are indicative of differences in the consistency among systems, consistency being an important quality attribute of capsules. PMID:24801853

  19. Cells Deficient in the Fanconi Anemia Protein FANCD2 are Hypersensitive to the Cytotoxicity and DNA Damage Induced by Coffee and Caffeic Acid.

    PubMed

    Burgos-Morón, Estefanía; Calderón-Montaño, José Manuel; Orta, Manuel Luis; Guillén-Mancina, Emilio; Mateos, Santiago; López-Lázaro, Miguel

    2016-01-01

    Epidemiological studies have found a positive association between coffee consumption and a lower risk of cardiovascular disorders, some cancers, diabetes, Parkinson and Alzheimer disease. Coffee consumption, however, has also been linked to an increased risk of developing some types of cancer, including bladder cancer in adults and leukemia in children of mothers who drink coffee during pregnancy. Since cancer is driven by the accumulation of DNA alterations, the ability of the coffee constituent caffeic acid to induce DNA damage in cells may play a role in the carcinogenic potential of this beverage. This carcinogenic potential may be exacerbated in cells with DNA repair defects. People with the genetic disease Fanconi Anemia have DNA repair deficiencies and are predisposed to several cancers, particularly acute myeloid leukemia. Defects in the DNA repair protein Fanconi Anemia D2 (FANCD2) also play an important role in the development of a variety of cancers (e.g., bladder cancer) in people without this genetic disease. This communication shows that cells deficient in FANCD2 are hypersensitive to the cytotoxicity (clonogenic assay) and DNA damage (γ-H2AX and 53BP1 focus assay) induced by caffeic acid and by a commercial lyophilized coffee extract. These data suggest that people with Fanconi Anemia, or healthy people who develop sporadic mutations in FANCD2, may be hypersensitive to the carcinogenic activity of coffee. PMID:27399778

  20. Cells Deficient in the Fanconi Anemia Protein FANCD2 are Hypersensitive to the Cytotoxicity and DNA Damage Induced by Coffee and Caffeic Acid

    PubMed Central

    Burgos-Morón, Estefanía; Calderón-Montaño, José Manuel; Orta, Manuel Luis; Guillén-Mancina, Emilio; Mateos, Santiago; López-Lázaro, Miguel

    2016-01-01

    Epidemiological studies have found a positive association between coffee consumption and a lower risk of cardiovascular disorders, some cancers, diabetes, Parkinson and Alzheimer disease. Coffee consumption, however, has also been linked to an increased risk of developing some types of cancer, including bladder cancer in adults and leukemia in children of mothers who drink coffee during pregnancy. Since cancer is driven by the accumulation of DNA alterations, the ability of the coffee constituent caffeic acid to induce DNA damage in cells may play a role in the carcinogenic potential of this beverage. This carcinogenic potential may be exacerbated in cells with DNA repair defects. People with the genetic disease Fanconi Anemia have DNA repair deficiencies and are predisposed to several cancers, particularly acute myeloid leukemia. Defects in the DNA repair protein Fanconi Anemia D2 (FANCD2) also play an important role in the development of a variety of cancers (e.g., bladder cancer) in people without this genetic disease. This communication shows that cells deficient in FANCD2 are hypersensitive to the cytotoxicity (clonogenic assay) and DNA damage (γ-H2AX and 53BP1 focus assay) induced by caffeic acid and by a commercial lyophilized coffee extract. These data suggest that people with Fanconi Anemia, or healthy people who develop sporadic mutations in FANCD2, may be hypersensitive to the carcinogenic activity of coffee. PMID:27399778

  1. Modulation of coffee aroma via the fermentation of green coffee beans with Rhizopus oligosporus: II. Effects of different roast levels.

    PubMed

    Lee, Liang Wei; Cheong, Mun Wai; Curran, Philip; Yu, Bin; Liu, Shao Quan

    2016-11-15

    This study aims to evaluate how changes of the volatile and non-volatile profiles of green coffees induced by Rhizopus oligosporus fermentation of green coffee beans (Part I) translated to changes in the volatile and aroma profiles of light, medium and dark roasted coffees and non-volatile profile of roasted coffee where fermentation effects were most distinctive (light roast). R. oligosporus fermentation resulted in 1.7-, 1.5- and 1.3-fold increases in pyrazine, 2-methylpyrazine and 2-ethylpyrazine levels in coffees of all roast degrees, respectively. This corresponded with the greater extent of amino acids degradation in light roasted fermented coffee. Ethyl palmitate was detected exclusively in medium and dark roasted fermented coffees. The sweet attribute of light and dark roasted coffees were increased following fermentation along with other aroma profile changes that were roast degree specific. This work aims to develop a direct but novel methodology for coffee aroma modulation through green coffee beans fermentation. PMID:27283714

  2. New Biomarkers of Coffee Consumption Identified by the Non-Targeted Metabolomic Profiling of Cohort Study Subjects

    PubMed Central

    Martin, Jean-François; Lyan, Bernard; Pujos-Guillot, Estelle; Fezeu, Leopold; Hercberg, Serge; Comte, Blandine; Galan, Pilar; Touvier, Mathilde; Manach, Claudine

    2014-01-01

    Coffee contains various bioactives implicated with human health and disease risk. To accurately assess the effects of overall consumption upon health and disease, individual intake must be measured in large epidemiological studies. Metabolomics has emerged as a powerful approach to discover biomarkers of intake for a large range of foods. Here we report the profiling of the urinary metabolome of cohort study subjects to search for new biomarkers of coffee intake. Using repeated 24-hour dietary records and a food frequency questionnaire, 20 high coffee consumers (183–540 mL/d) and 19 low consumers were selected from the French SU.VI.MAX2 cohort. Morning spot urine samples from each subject were profiled by high-resolution mass spectrometry. Partial least-square discriminant analysis of multidimensional liquid chromatography-mass spectrometry data clearly distinguished high consumers from low via 132 significant (p-value<0.05) discriminating features. Ion clusters whose intensities were most elevated in the high consumers were annotated using online and in-house databases and their identities checked using commercial standards and MS-MS fragmentation. The best discriminants, and thus potential markers of coffee consumption, were the glucuronide of the diterpenoid atractyligenin, the diketopiperazine cyclo(isoleucyl-prolyl), and the alkaloid trigonelline. Some caffeine metabolites, such as 1-methylxanthine, were also among the discriminants, however caffeine may be consumed from other sources and its metabolism is subject to inter-individual variation. Receiver operating characteristics curve analysis showed that the biomarkers identified could be used effectively in combination for increased sensitivity and specificity. Once validated in other cohorts or intervention studies, these specific single or combined biomarkers will become a valuable alternative to assessment of coffee intake by dietary survey and finally lead to a better understanding of the health

  3. Some like it hot: the influence and implications of climate change on coffee berry borer (Hypothenemus hampei) and coffee production in East Africa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The negative effects of climate change are already evident for many of the 25 million coffee farmers across the tropics and the 90 billion dollar coffee industry. The coffee berry borer (Hypothenemus hampei), the most devastating pest of coffee worldwide, has already benefited from the temperature r...

  4. Lower esophageal sphincter pressure, acid secretion, and blood gastrin after coffee consumption.

    PubMed

    Van Deventer, G; Kamemoto, E; Kuznicki, J T; Heckert, D C; Schulte, M C

    1992-04-01

    This study tested the hypothesis that differences in the processing of raw coffee beans can account for some of the variability in gastric effects of coffee drinking. Coffees were selected to represent several ways that green coffee beans are treated, ie, processing variables. These included instant and ground coffee processing, decaffeination method (ethyl acetate or methylene chloride extraction), instant coffee processing temperature (112 degrees F or 300 degrees F), and steam treatment. Lower esophageal sphincter pressure, acid secretion, and blood gastrin was measured in eight human subjects after they consumed each of the different coffees. Consumption of coffee was followed by a sustained decrease in lower esophageal sphincter pressure (P less than 0.05) except for three of the four coffees treated with ethyl acetate regardless of whether or not they contained caffeine. Caffeinated ground coffee stimulated more acid secretion that did decaf ground coffees (P less than 0.05), but not more than a steam-treated caffeinated coffee. Instant coffees did not differ in acid-stimulating ability. Ground caffeinated coffee resulted in higher blood gastrin levels than other ground coffees (P less than 0.05). Freeze-dried instant coffee also tended toward higher gastrin stimulation. It is concluded that some of the observed variability in gastric response to coffee consumption can be traced to differences in how green coffee beans are processed. PMID:1551346

  5. Detection and survey of coffee ringspot virus in Brazil.

    PubMed

    Ramalho, T O; Figueira, A R; Wang, R; Jones, O; Harris, L E; Goodin, M M

    2016-02-01

    Coffee ringspot virus (CoRSV) a member of the proposed genus "Dichorhavirus", was surveyed on commercial and research farms spanning an area responsible for the majority of Coffea arabica production in Brazil. Virus-infected plants were found at one hundred percent of locations (n = 45) sampled. All cultivars, regardless of cherry color, were found to serve as hosts, suggesting that there is limited resistance in commercially employed germplasm. Reverse transcription PCR analysis revealed that the virus is contained within symptomatic lesions, with little systemic spread throughout leaves. Phylogenetic analysis based on the ORF1 (nucleocapsid) gene identified a strong geo-spatial relationship among isolates, which clustered into three clades. Despite low genetic diversity among isolates, variation in symptom expression was observed in the experimental host Chenopodium quinoa. Our analyses support the hypothesis that the spread of CoRSV is constrained by the clonal expansion of thelytokous populations of Brevipalpus phoenicis. The widespread occurrence of this virus suggests that it is much more prevalent than previously thought. PMID:26553342

  6. Determination of acrylamide in coffee and coffee products by GC-MS using an improved SPE clean-up.

    PubMed

    Soares, C; Cunha, S; Fernandes, J

    2006-12-01

    An improved gas chromatography-mass spectrometry (GC-MS) method to determine acrylamide (AA) in coffee and coffee products was developed. The method was based on two main purification steps: the first with ethanol and Carrez solutions in order to precipitate polysaccharides and proteins, respectively; and the second with a layered solid-phase extraction (SPE) column which proved to be efficient in the elimination of the main chromatographic interferences. The method is applicable to a wide range of coffee products. Twenty-six samples of different coffee products were analysed. The levels of AA were in the range 11.4-36.2 microg l-1 for 'espresso coffee' and 200.8-229.4 microg l-1 for coffee blends with cereals. The results indicate that the presence of cereals significantly increased the levels of AA. PMID:17118870

  7. Changes in green coffee protein profiles during roasting.

    PubMed

    Montavon, Philippe; Mauron, Anne-France; Duruz, Eliane

    2003-04-01

    To reveal its flavor, coffee has to be roasted. In fact, the green coffee bean contains all ingredients necessary for the later development of coffee flavor. It is now widely accepted that free amino acids and peptides are required for the generation of coffee aroma. However, the mechanisms leading to defined mixtures of free amino acids and peptides remain unknown. Information pertaining to the identification of precursor proteins is also lacking. To answer some of these questions, two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) was used to follow the fate of green coffee proteins. Two conditions were considered: roasting and incubation of green coffee suspensions at 37 degrees C. Coffee beans were observed to acquire the potential to spontaneously release H(2)O(2) upon polymerization of their proteins during roasting. Fragmentation of proteins was also observed. Conversely, H(2)O(2) was found to control polymerization and fragmentation of green coffee proteins in solution at 37 degrees C. Polymerization and fragmentation patterns under the two conditions were comparable. These observations suggest that the two conditions under study triggered, at least to some extent, similar biochemical mechanisms involving autoxidation. Throughout this study, a unique fragmentation cascade involving the 11S coffee storage protein was identified. Generated fragments shared an atypical staining behavior linked to their sensitivity to redox conditions. PMID:12670178

  8. Coffee Consumption and the Incidence of Colorectal Cancer in Women

    PubMed Central

    Groessl, Erik J.; Allison, Matthew A.; Larson, Joseph C.; Ho, Samuel B.; Snetslaar, Linda G.; Lane, Dorothy S.; Tharp, Katie M.; Stefanick, Marcia L.

    2016-01-01

    Background. Higher coffee consumption has been associated with decreased incidence of colorectal cancer. Our objective was to examine the relationship of coffee intake to colorectal cancer incidence in a large observational cohort of postmenopausal US women. Methods. Data were collected for the Women's Health Initiative Observational Study providing a follow-up period of 12.9 years. The mean age of our sample (N = 83,778 women) was 63.5 years. Daily coffee intake was grouped into 3 categories: None, moderate (>0–<4 cups), and high (4+ cups). Proportional hazards modeling was used to evaluate the relationship between coffee intake and colorectal cancer. Results. There were 1,282 (1.53%) new cases of colorectal cancer during follow-up. Compared to nondrinkers, moderate and high coffee drinkers had an increased incidence of colorectal cancer in multivariate analysis (HR 1.15, 1.02–1.29; HR 1.14, 0.93–1.38). Moderate drip brew coffee intake (HR 1.20, 1.05–1.36) and high nondrip brew coffee intake (HR 1.43, 1.01–2.02) were associated with increased odds. Conclusion. Our results suggesting increased incidence of colorectal cancer associated with higher coffee consumption contradict recent meta-analyses but agree with a number of other studies showing that coffee increases risk or has no effect. Brew method results are novel and warrant further research. PMID:27239197

  9. Habitual coffee consumption and blood pressure: An epidemiological perspective

    PubMed Central

    Geleijnse, Johanna M

    2008-01-01

    This paper summarizes the current epidemiological evidence on coffee consumption in relation to blood pressure (BP) and risk of hypertension. Data from cross-sectional studies suggest an inverse linear or U-shaped association of habitual coffee use with BP in different populations. Prospective studies suggest a protective effect of high coffee intake (4 or more cups per day) against hypertension, mainly in women. Furthermore, the risk of hypertension may be lower in coffee abstainers. Randomized controlled trials, which are mostly of short duration (1–12 weeks), have shown that coffee intake around 5 cups per day causes a small elevation in BP (∼2/1 mmHg) when compared to abstinence or use of decaffeinated coffee. With regard to underlying biological mechanisms, most research has been devoted to BP-raising effects of caffeine. However, there are many other substances in coffee, such as polyphenols, soluble fibre and potassium, which could exert a beneficial effect in the cardiovascular system. Although the precise nature of the relation between coffee and BP is still unclear, most evidence suggests that regular intake of caffeinated coffee does not increase the risk of hypertension. PMID:19183744

  10. The cardiovascular effects of regular and decaffeinated coffee.

    PubMed Central

    Smits, P; Thien, T; Van 't Laar, A

    1985-01-01

    In a single-blind study the effects of drinking two cups of regular or decaffeinated coffee on blood pressure, heart rate, forearm blood flow and plasma concentrations of caffeine, renin and catecholamines were studied in 12 normotensive subjects. Drinking regular coffee led to a rise of blood pressure, a fall of heart rate and an increase of plasma catecholamines. Decaffeinated coffee induced a smaller increase of diastolic blood pressure without changing other parameters. This study shows that the cardiovascular effects of drinking coffee are mainly the result of its caffeine content. PMID:4027129

  11. Enhancing medication compliance in coffee groups.

    PubMed

    Olarte, S W; Masnik, R

    1981-06-01

    In an adult outpatient department of a hospital serving a severely disadvantaged population, coffee groups have become an effective means of treating chronic, treatment-resistant patients and reinforcing their compliance with medication regimens. In dealing with the patients, many of whom have problems communicating needs and information, the therapists have developed such approaches as using concrete language, recognizing that many patients use medication transactions to reflect dissatisfaction with changes in group routine, anticipating common problems related to medication, and at times accepting patients' idiosyncratic chemotherapeutic preferences. Important elements of the coffee groups are the caring attitude of the co-therapists, a nonpressured atmosphere, and the presence of a familiar peer group. PMID:7262849

  12. [Occurrence of phenols in coffee melanoidins].

    PubMed

    Heinrich, L; Baltes, W

    1987-11-01

    Compounds with higher molecular weights in roast coffee were separated by means of adsorption chromatography followed by gel chromatography which yielded seven fractions of different molecular weights. These were tested sensorially and degraded by Curie point pyrolysis high-resolution gas chromatography/mass spectrometry (HRGC/MS) about 100 products, among them 33 phenols, were found. The products were compared with fragments formed via model pyrolysis experiments on chlorogenic acid. PMID:3433952

  13. Adsorption of dyes onto carbonaceous materials produced from coffee grounds by microwave treatment.

    PubMed

    Hirata, Mizuho; Kawasaki, Naohito; Nakamura, Takeo; Matsumoto, Kazuoki; Kabayama, Mineaki; Tamura, Takamichi; Tanada, Seiki

    2002-10-01

    Organic wastes have been burned for reclamation. However, they have to be recycled and reused for industrial sustainable development. Carbonaceous materials were produced from coffee grounds by microwave treatment. There are many phenolic hydroxyl and carboxyl groups on the surface of carbonaceous materials. The base consumption of the carbonaceous materials was larger than that of the commercially activated carbon. The carbonaceous materials produced from coffee grounds were applied to the adsorbates for the removal of basic dyes (methylene blue and gentian violet) in wastewater. This result indicated that the adsorption of dyes depended upon the surface polar groups on the carbonaceous materials. Moreover, the Freundlich constants of isotherms for the adsorption of methylene blue and gentian violet onto the carbonaceous materials produced from coffee grounds were greater than those for adsorption onto activated carbon or ceramic activated carbon. The interaction was greatest between the surface or porosity of the carbonaceous materials and methylene blue and gentian violet. The microwave treatment would be useful for the carbonization of organic wastes to save energy. PMID:12702420

  14. Green engineering: Green composite material, biodiesel from waste coffee grounds, and polyurethane bio-foam

    NASA Astrophysics Data System (ADS)

    Cheng, Hsiang-Fu

    In this thesis we developed several ways of producing green materials and energy resources. First, we developed a method to fabricate natural fibers composites, with the purpose to develop green textile/woven composites that could potentially serve as an alternative to materials derived from non-renewable sources. Flax and hemp fabrics were chosen because of their lightweight and exceptional mechanical properties. To make these textile/woven composites withstand moist environments, a commercially available marine resin was utilized as a matrix. The tensile, three-point bending, and edgewise compression strengths of these green textile/woven composites were measured using ASTM protocols. Secondly, we developed a chemical procedure to obtain oil from waste coffee grounds; we did leaching and liquid extractions to get liquid oil from the solid coffee. This coffee oil was used to produce bio-diesel that could be used as a substitute for petroleum-based diesel. Finally, polyurethane Bio-foam formation utilized glycerol that is the by-product from the biodiesel synthesis. A chemical synthesis procedure from the literature was used as the reference system: a triol and isocynate are mixed to produce polyurethane foam. Moreover, we use a similar triol, a by-product from bio-diesel synthesis, to reproduce polyurethane foam.

  15. Brazilian Consensus on Photoprotection

    PubMed Central

    Schalka, Sérgio; Steiner, Denise; Ravelli, Flávia Naranjo; Steiner, Tatiana; Terena, Aripuanã Cobério; Marçon, Carolina Reato; Ayres, Eloisa Leis; Addor, Flávia Alvim Sant'anna; Miot, Helio Amante; Ponzio, Humberto; Duarte, Ida; Neffá, Jane; da Cunha, José Antônio Jabur; Boza, Juliana Catucci; Samorano, Luciana de Paula; Corrêa, Marcelo de Paula; Maia, Marcus; Nasser, Nilton; Leite, Olga Maria Rodrigues Ribeiro; Lopes, Otávio Sergio; Oliveira, Pedro Dantas; Meyer, Renata Leal Bregunci; Cestari, Tânia; dos Reis, Vitor Manoel Silva; Rego, Vitória Regina Pedreira de Almeida

    2014-01-01

    Brazil is a country of continental dimensions with a large heterogeneity of climates and massive mixing of the population. Almost the entire national territory is located between the Equator and the Tropic of Capricorn, and the Earth axial tilt to the south certainly makes Brazil one of the countries of the world with greater extent of land in proximity to the sun. The Brazilian coastline, where most of its population lives, is more than 8,500 km long. Due to geographic characteristics and cultural trends, Brazilians are among the peoples with the highest annual exposure to the sun. Epidemiological data show a continuing increase in the incidence of non-melanoma and melanoma skin cancers. Photoprotection can be understood as a set of measures aimed at reducing sun exposure and at preventing the development of acute and chronic actinic damage. Due to the peculiarities of Brazilian territory and culture, it would not be advisable to replicate the concepts of photoprotection from other developed countries, places with completely different climates and populations. Thus the Brazilian Society of Dermatology has developed the Brazilian Consensus on Photoprotection, the first official document on photoprotection developed in Brazil for Brazilians, with recommendations on matters involving photoprotection. PMID:25761256

  16. Improving the performance of an electronic nose by wine aroma training to distinguish between drip coffee and canned coffee.

    PubMed

    Fujioka, Kouki; Tomizawa, Yasuko; Shimizu, Nobuo; Ikeda, Keiichi; Manome, Yoshinobu

    2015-01-01

    Coffee aroma, with more than 600 components, is considered as one of the most complex food aromas. Although electronic noses have been successfully used for objective analysis and differentiation of total coffee aromas, it is difficult to use them to describe the specific features of coffee aroma (i.e., the type of smell). This is because data obtained by electronic noses are generally based on electrical resistance/current and samples are distinguished by principal component analysis. In this paper, we present an electronic nose that is capable of learning the wine related aromas using the aroma kit "Le Nez du Vin," and the potential to describe coffee aroma in a similar manner comparable to how wine experts describe wine aroma. The results of our investigation showed that the aromas of three drip coffees were more similar to those of pine and honey in the aroma kit than to the aromas of three canned coffees. Conversely, the aromas of canned coffees were more similar to the kit coffee aroma. In addition, the aromatic patterns of coffees were different from those of green tea and red wine. Although further study is required to fit the data to human olfaction, the presented method and the use of vocabularies in aroma kits promise to enhance objective discrimination and description of aromas by electronic noses. PMID:25587981

  17. Improving the Performance of an Electronic Nose by Wine Aroma Training to Distinguish between Drip Coffee and Canned Coffee

    PubMed Central

    Fujioka, Kouki; Tomizawa, Yasuko; Shimizu, Nobuo; Ikeda, Keiichi; Manome, Yoshinobu

    2015-01-01

    Coffee aroma, with more than 600 components, is considered as one of the most complex food aromas. Although electronic noses have been successfully used for objective analysis and differentiation of total coffee aromas, it is difficult to use them to describe the specific features of coffee aroma (i.e., the type of smell). This is because data obtained by electronic noses are generally based on electrical resistance/current and samples are distinguished by principal component analysis. In this paper, we present an electronic nose that is capable of learning the wine related aromas using the aroma kit “Le Nez du Vin,” and the potential to describe coffee aroma in a similar manner comparable to how wine experts describe wine aroma. The results of our investigation showed that the aromas of three drip coffees were more similar to those of pine and honey in the aroma kit than to the aromas of three canned coffees. Conversely, the aromas of canned coffees were more similar to the kit coffee aroma. In addition, the aromatic patterns of coffees were different from those of green tea and red wine. Although further study is required to fit the data to human olfaction, the presented method and the use of vocabularies in aroma kits promise to enhance objective discrimination and description of aromas by electronic noses. PMID:25587981

  18. Effect of roasting conditions on the polycyclic aromatic hydrocarbon content in ground Arabica coffee and coffee brew.

    PubMed

    Houessou, Justin Koffi; Maloug, Saber; Leveque, Anne-Sophie; Delteil, Corine; Heyd, Bertrand; Camel, Valérie

    2007-11-14

    Roasting is a critical process in coffee production as it enables the development of flavor and aroma. At the same time, roasting may lead to the formation of nondesirable compounds, such as polycyclic aromatic hydrocarbons (PAHs). In this study, Arabica green coffee beans from Cuba were roasted under controlled conditions to monitor PAH formation during the roasting process. Roasting was performed in a pilot spouted bed roaster, with the inlet air temperature varying from 180 to 260 degrees C, using both dark (20 min) and light (5 min) roasting conditions. Several PAHs were determined in both roasted coffee samples and green coffee samples. Also, coffee brews, obtained using an electric coffee maker, were analyzed for final estimation of PAH transfer coefficients to the infusion. Formation of phenanthrene, anthracene, and benzo[a]anthracene in coffee beans was observed at temperatures above 220 degrees C, whereas formation of pyrene and chrysene required 260 degrees C. Low levels of benzo[g,h,i]perylene were also noted for dark roasting under 260 degrees C, with simultaneous partial degradation of three-cycle PAHs, suggesting that transformation of low molecular PAHs to high molecular PAHs occurs as the roasting degree is increased. The PAH transfer to the infusion was quite moderate (<35%), with a slightly lower extractability for dark-roasted coffee as compared to light-roasted coffee. PMID:17941690

  19. Effects of coffee management on deforestation rates and forest integrity.

    PubMed

    Hylander, Kristoffer; Nemomissa, Sileshi; Delrue, Josefien; Enkosa, Woldeyohannes

    2013-10-01

    Knowledge about how forest margins are utilized can be crucial for a general understanding of changes in forest cover, forest structure, and biodiversity across landscapes. We studied forest-agriculture transitions in southwestern Ethiopia and hypothesized that the presence of coffee (Coffea arabica)decreases deforestation rates because of coffee's importance to local economies and its widespread occurrence in forests and forest margins. Using satellite images and elevation data, we compared changes in forest cover over 37 years (1973-2010) across elevations in 2 forest-agriculture mosaic landscapes (1100 km(2) around Bonga and 3000 km(2) in Goma-Gera). In the field in the Bonga area, we determined coffee cover and forest structure in 40 forest margins that differed in time since deforestation. Both the absolute and relative deforestation rates were lower at coffee-growing elevations compared with at higher elevations (-10/20% vs. -40/50% comparing relative rates at 1800 m asl and 2300-2500 m asl, respectively). Within the coffee-growing elevation, the proportion of sites with high coffee cover (>20%) was significantly higher in stable margins (42% of sites that had been in the same location for the entire period) than in recently changed margins (0% of sites where expansion of annual crops had changed the margin). Disturbance level and forest structure did not differ between sites with 30% or 3% coffee. However, a growing body of literature on gradients of coffee management in Ethiopia reports coffee's negative effects on abundances of forest-specialist species. Even if the presence of coffee slows down the conversion of forest to annual-crop agriculture, there is a risk that an intensification of coffee management will still threaten forest biodiversity, including the genetic diversity of wild coffee. Conservation policy for Ethiopian forests thus needs to develop strategies that acknowledge that forests without coffee production may have higher deforestation

  20. Induction of AhR-Mediated Gene Transcription by Coffee

    PubMed Central

    Ishikawa, Toshio; Takahashi, Satoshi; Morita, Koji; Okinaga, Hiroko; Teramoto, Tamio

    2014-01-01

    Background Aryl hydrocarbon receptor (AhR) is classically known to be activated by xenobiotics such as dioxins and polycyclic aromatic hydrocarbons (PAHs). Although it has been reported that PAHs are contained in roasted coffee beans, in general coffee beverages are not considered to be AhR activators. We tested whether exposure to coffee would activate AhR in cultured cells. Methods HepG2 cells stably expressing an AhR-responsive reporter gene were treated with coffee samples. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was quantitated by RT-PCR and Western blotting in HepG2, Caco-2, and MCF-7 cells, after treatment with coffee. In order to obtain sensitive and reproducible results, all the experiments were performed with the cells placed in either phosphate-buffered saline (PBS) or pure serum, instead of routinely-used culture medium, whose intrinsic AhR-stimulating activity turned out to be so strong as to interfere with the analyses. Results All the coffee samples tested robustly stimulated AhR-mediated transcription in the reporter gene assays. Of note, to what extent coffee and other AhR agonists activated AhR was different, depending on whether the experiments were done in PBS or serum. CYP1A1 mRNA was induced by coffee, in HepG2, Caco-2, and MCF-7 cells placed in either PBS or serum. CYP1A1 protein expression, which was not detected in these cells incubated in PBS, was also increased by coffee in cells placed in serum. Conclusions By using culture medium-free experimental settings, we have shown that coffee is a strong AhR activator. Our observation may help elucidate as-yet-unrecognized effects of coffee on human health. PMID:25007155

  1. Variation in caffeine concentration in single coffee beans.

    PubMed

    Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh

    2013-11-13

    Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors <2 mg/g. For the single-bean calibration the r(2) values were between 0.85 and 0.93 with standard errors of cross validation of 0.8-1.6 mg/g depending upon calibration. The results showed it was possible to develop NIRS calibrations to estimate the caffeine concentration of individual coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products. PMID:24070227

  2. Evaluation of antioxidant capacity in coffees marketed in Colombia: Relationship with the extent of non-enzymatic browning.

    PubMed

    Contreras-Calderón, José; Mejía-Díaz, Diana; Martínez-Castaño, Marcela; Bedoya-Ramírez, Daniel; López-Rojas, Natalia; Gómez-Narváez, Faver; Medina-Pineda, Yaqueline; Vega-Castro, Oscar

    2016-10-15

    Fifty-eight samples of commercial Colombian coffee with different characteristics (soluble, ground, decaffeinated, etc) were evaluated for antioxidant capacity (AC) (ABTS and FRAP), total soluble phenolics (TP), browning index (BI), color parameters (L(∗), a(∗), b(∗), c(∗) and h(∗)), HMF and furfural. The AC in Colombian coffees was very varied (164-1000, 100.8-885.9μmol of Trolox equiv/g and 12.5-127mg gallic acid equiv/g, respectively for ABTS, FRAP and TP). AC, TP, BI, color, HMF and furfural values were higher (p<0.05) in soluble coffees than in ground ones, showing the lyophilized samples which showed the highest average values. Significant lineal correlations (p<0.05) were found between AC and color parameters, BI, HMF. No significant (p<0.05) differences in the AC between the different types of coffee were found. This work confirms the direct relationship between the rate of non-enzymatic browning and antioxidant capacity. PMID:27173548

  3. [Allergic rhinoconjunctivitis caused by the dust of green coffee beans].

    PubMed

    Glauser, T; Bircher, A; Wüthrich, B

    1992-08-29

    In a 37-year-old worker employed in a coffee roastery who suffered from work-related rhinoconjunctivitis, allergologic investigations demonstrated sensitization to the dust of the green, unroasted coffee bean. This particular allergy is uncommon in Switzerland. The case is discussed and the literature on the subject is reviewed. PMID:1529315

  4. Screening for atopy in a coffee processing factory.

    PubMed

    Panzani, R C; Falagiani, P; Riva, G; Delord, Y; Mercier, P

    1995-01-01

    Screening for blood IgE mediated allergy (atopy) by the RAST technique among 76 people working in a coffee processing factory showed rather unexpected findings: although we found a prevalence of positivity (17.1%) to the common airborne antigens (pollens, mites, cat, Alternaria tenuis) which was close to the prevalence of atopy among normal adults in our area (19.3%), only one case of allergy to green coffee and two cases to castor bean came to the fore. Specific IgG4 antibodies were measured only for castor bean and green coffee, and rather elevated figures were found: green coffee 17.1%, castor bean 13.1%. The occurence of positive RASTs to castor bean is more likely to be due to contamination of the bags containing green coffee. The low prevalence of RAST positivities to green coffee, and the elevated specific IgG4 antibodies to both castor bean and green coffee antigens, raise several possibilities which are discussed; however, all the subjects but one having elevated specific IgG4 levels to green coffee worked in more exposed areas. Probably IgG4 antibodies in this particular case are acting as blocking antibodies. PMID:7631592

  5. Isolation, identification, and quantification of roasted coffee antibacterial compounds.

    PubMed

    Daglia, Maria; Papetti, Adele; Grisoli, Pietro; Aceti, Camilla; Spini, Valentina; Dacarro, Cesare; Gazzani, Gabriella

    2007-12-12

    Coffee brew is a widely consumed beverage with multiple biological activities due both to naturally occurring components and to the hundreds of chemicals that are formed during the roasting process. Roasted coffee extract possesses antibacterial activity against a wide range of microorganisms, including Staphylococcus aureus and Streptococcus mutans, whereas green coffee extract exhibits no such activity. The naturally occurring coffee compounds, such as chlorogenic acids and caffeine, cannot therefore be responsible for the significant antibacterial activity exerted by coffee beverages against both bacteria. The very low minimum inhibitory concentration (MIC) found for standard glyoxal, methylglyoxal, and diacetyl compounds formed during the roasting process points to these alpha-dicarbonyl compounds as the main agents responsible for the antibacterial activity of brewed coffee against Sa. aureus and St. mutans. However, their low concentrations determined in the beverage account for only 50% of its antibacterial activity. The addition of caffeine, which has weak intrinsic antibacterial activity, to a mixture of alpha-dicarbonyl compounds at the concentrations found in coffee demonstrated that caffeine synergistically enhances the antibacterial activity of alpha-dicarbonyl compounds and that glyoxal, methylglyoxal, and diacetyl in the presence of caffeine account for the whole antibacterial activity of roasted coffee. PMID:18001036

  6. 38. East elevation of coffee storage and drying shed with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. East elevation of coffee storage and drying shed with circular, cattle watering pond in left foreground and coffee mill in background right. HAER PR, 6-MAGU, 1C-1 - Hacienda Buena Vista, PR Route 10 (Ponce to Arecibo), Magueyes, Ponce Municipio, PR

  7. Ant patchiness: a spatially quantitative test in coffee agroecosystems

    NASA Astrophysics Data System (ADS)

    Philpott, Stacy M.

    2006-08-01

    Arboreal ants form patchy spatial patterns in tropical agroforest canopies. Such patchy distributions more likely occur in disturbed habitats associated with lower ant diversity and resource availability than in forests. Yet, few studies have quantitatively examined these patchy patterns to statistically test if ants are non-randomly distributed or at what scale. Coffee agroecosystems form a gradient of management intensification along which vegetative complexity and ant diversity decline. Using field studies and a spatially explicit randomization model, I investigated ant patchiness in coffee agroecosystems in Chiapas, Mexico varying in management intensity to examine if: (1) coffee intensification affects occurrence of numerically dominant ants, (2) numerical dominants form statistically distinguishable single-species patches in coffee plants, (3) shade trees play a role in patch location, and (4) patch formation or size varies with management intensity. Coffee intensification correlated with lower occurrence frequency of numerically dominant species generally and of one of four taxa examined. All dominant ant species formed patches but only Azteca instabilis was patchy around shade trees. Ant patchiness did vary somewhat with spatial scale and with strata (within the coffee layer vs around shade trees). Patchiness, however, did not vary with management intensity. These results provide quantitative evidence that numerically dominant ants are patchy within the coffee layer at different scales and that shade tree location, but not coffee management intensity, may play a role in the formation of patchy distributions.

  8. Consumption of coffee or tea and symptoms of anxiety.

    PubMed Central

    Eaton, W W; McLeod, J

    1984-01-01

    The relationship of consumption of coffee or tea to self-reported symptoms of anxiety is examined with data from the detailed examination component of the National Center for Health Statistics Health and Nutrition Examination Survey. Among this nationwide sample of 3,854 respondents, there was no significant association between consumption of coffee or tea and symptoms of anxiety. PMID:6689844

  9. Alkylpyridiniums. 2. Isolation and quantification in roasted and ground coffees.

    PubMed

    Stadler, Richard H; Varga, Natalia; Milo, Christian; Schilter, Benoit; Vera, Francia Arce; Welti, Dieter H

    2002-02-27

    Recent model studies on trigonelline decomposition have identified nonvolatile alkylpyridiniums as major reaction products under certain physicochemical conditions. The quaternary base 1-methylpyridinium was isolated from roasted and ground coffee and purified by ion exchange and thin-layer chromatography. The compound was characterized by nuclear magnetic resonance spectroscopy ((1)H, (13)C) and mass spectrometry techniques. A liquid chromatography-electrospray ionization tandem mass spectrometry method was developed to quantify the alkaloid in coffee by isotope dilution mass spectrometry. The formation of alkylpyridiniums is positively correlated to the roasting degree in arabica coffee, and highest levels of 1-methylpyridinium, reaching up to 0.25% on a per weight basis, were found in dark roasted coffee beans. Analyses of coffee extracts also showed the presence of dimethylpyridinium, at concentrations ranging from 5 to 25 mg/kg. This is the first report on the isolation and quantification of alkylpyridiniums in coffee. These compounds, described here in detail for the first time, may have an impact on the flavor/aroma profile of coffee directly (e.g., bitterness), or indirectly as precursors, and potentially open new avenues in the flavor/aroma modulation of coffee. PMID:11853504

  10. Isotopes as tracers of the Hawaiian coffee-producing regions.

    PubMed

    Rodrigues, Carla; Brunner, Marion; Steiman, Shawn; Bowen, Gabriel J; Nogueira, José M F; Gautz, Loren; Prohaska, Thomas; Máguas, Cristina

    2011-09-28

    Green coffee bean isotopes have been used to trace the effects of different climatic and geological characteristics associated with the Hawaii islands. Isotope ratio mass spectrometry (IRMS) and inductively coupled plasma mass spectrometry ((MC)-ICP-SFMS and ICP-QMS) were applied to determine the isotopic composition of carbon (δ13C), nitrogen (δ15N), sulfur (δ34S), and oxygen (δ18O), the isotope abundance of strontium (87Sr/86Sr), and the concentrations of 30 different elements in 47 green coffees. The coffees were produced in five Hawaii regions: Hawaii, Kauai, Maui, Molokai, and Oahu. Results indicate that coffee plant seed isotopes reflect interactions between the coffee plant and the local environment. Accordingly, the obtained analytical fingerprinting could be used to discriminate between the different Hawaii regions studied. PMID:21838232

  11. Isotopes as Tracers of the Hawaiian Coffee-Producing Regions

    PubMed Central

    2011-01-01

    Green coffee bean isotopes have been used to trace the effects of different climatic and geological characteristics associated with the Hawaii islands. Isotope ratio mass spectrometry (IRMS) and inductively coupled plasma mass spectrometry ((MC)-ICP-SFMS and ICP-QMS) were applied to determine the isotopic composition of carbon (δ13C), nitrogen (δ15N), sulfur (δ34S), and oxygen (δ18O), the isotope abundance of strontium (87Sr/86Sr), and the concentrations of 30 different elements in 47 green coffees. The coffees were produced in five Hawaii regions: Hawaii, Kauai, Maui, Molokai, and Oahu. Results indicate that coffee plant seed isotopes reflect interactions between the coffee plant and the local environment. Accordingly, the obtained analytical fingerprinting could be used to discriminate between the different Hawaii regions studied. PMID:21838232

  12. The role of dissolved cations in coffee extraction.

    PubMed

    Hendon, Christopher H; Colonna-Dashwood, Lesley; Colonna-Dashwood, Maxwell

    2014-05-28

    The flavorsome compounds in coffee beans exist in the form of aprotic charge neutral species, as well as a collection of acids and conjugate salts. The dissolution and extraction of these organic molecules is a process dependent on the dissolved mineral content of the water. It is known that different rates and compositions of coffee extraction are achieved through the control of the water "impurities", Na(+), Mg(2+), and Ca(2+), which coordinate to nucleophilic motifs in coffee. Using density functional theory, we quantify the thermodynamic binding energies of five familiar coffee-contained acids, caffeine, and a representative flavor component, eugenol. From this, we provide insight into the mechanism and ideal mineral composition of water for extraction of flavorsome compounds in coffee. PMID:24802110

  13. Coffee Adulteration: More than Two Decades of Research.

    PubMed

    Toci, Aline Theodoro; Farah, Adriana; Pezza, Helena Redigolo; Pezza, Leonardo

    2016-01-01

    Coffee is a ubiquitous food product of considerable economic importance to the countries that produce and export it. The adulteration of roasted coffee is a strategy used to reduce costs. Conventional methods employed to identify adulteration in roasted and ground coffee involve optical and electron microscopy, which require pretreatment of samples and are time-consuming and subjective. Other analytical techniques have been studied that might be more reliable, reproducible, and widely applicable. The present review provides an overview of three analytical approaches (physical, chemical, and biological) to the identification of coffee adulteration. A total of 30 published articles are considered. It is concluded that despite the existence of a number of excellent studies in this area, there still remains a lack of a suitably sensitive and widely applicable methodology able to take into account the various different aspects of adulteration, considering coffee varieties, defective beans, and external agents. PMID:25633422

  14. Spent coffee grounds as a versatile source of green energy.

    PubMed

    Kondamudi, Narasimharao; Mohapatra, Susanta K; Misra, Mano

    2008-12-24

    The production of energy from renewable and waste materials is an attractive alternative to the conventional agricultural feed stocks such as corn and soybean. This paper describes an approach to extract oil from spent coffee grounds and to further transesterify the processed oil to convert it into biodiesel. This process yields 10-15% oil depending on the coffee species (Arabica or Robusta). The biodiesel derived from the coffee grounds (100% conversion of oil to biodiesel) was found to be stable for more than 1 month under ambient conditions. It is projected that 340 million gallons of biodiesel can be produced from the waste coffee grounds around the world. The coffee grounds after oil extraction are ideal materials for garden fertilizer, feedstock for ethanol, and as fuel pellets. PMID:19053356

  15. In vitro studies on the stability in the proximal gastrointestinal tract and bioaccessibility in Caco-2 cells of chlorogenic acids from spent coffee grounds.

    PubMed

    Monente, Carmen; Ludwig, Iziar A; Stalmach, Angelique; de Peña, Maria Paz; Cid, Concepción; Crozier, Alan

    2015-01-01

    Spent coffee grounds are a potential commercial source of substantial amounts of chlorogenic acids (CGAs). The aim of this study was to evaluate the stability of spent coffee CGAs using in vitro simulated gastroduodenal digestion and to investigate their potential absorption using an in vitro Caco-2 model of human small intestinal epithelium. During in vitro digestion, lactones were partially degraded while caffeoylquinic and feruloylquinic acids were much more stable. Transport and metabolism studies showed that 1% of the total CGAs were absorbed and transported from the apical to the basolateral side of a Caco-2 cell monolayer after 1 h. Lactones and coumaroylquinic acids showed the rate of highest absorption. Caco-2 cells possessed low metabolic activity. In conclusion, spent coffee extracts contain large amounts of CGAs, which remained bioaccessible across the intestinal barrier, albeit to a relatively low degree. PMID:26203817

  16. The coffee berry borer, Hypothenemus hampei: A short review with recent findings and future research directions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer is the most devastating insect pest of coffee throughout the world. Adult females bore a hole in the coffee berry, where they deposit their eggs; upon hatching, larvae feed on the coffee seeds inside the berry, thus reducing yield and quality of the marketable product. The ins...

  17. The coffee berry borer: the centenary of a biological invasion in Brazil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei, is a bark beetle endemic to Africa. This species was first detected in the field in 1897 in Mount Coffee, Liberia, and years later was reported as a pest of coffee in several African countries. In 1913 the coffee berry borer was accidentally introduced in...

  18. Gut microbiota mediate caffeine detoxification in the primary insect pest of coffee

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer (Hypothenemus hampei) is the most devastating insect pest of coffee worldwide. It infests crops in most coffee producing countries, and is of particular concern in developing countries where coffee comprises a significant component of gross domestic product. Of more than 850 i...

  19. [Spectroscopic methods applied to component determination and species identification for coffee].

    PubMed

    Chen, Hua-zhou; Xu, Li-li; Qin, Qiang

    2014-06-01

    Spectroscopic analysis was applied to the determination of the nutrient quality of ground, instant and chicory coffees. By using inductively coupled plasma atomic emission spectrometry (ICP-ES), nine mineral elements were determined in solid coffee samples. Caffeine was determined by ultraviolet (UV) spectrometry and organic matter was investigated by Fourier transform infrared (FTIR) spectroscopy. Oxidation-reduction titration was utilized for measuring the oxalate. The differences between ground coffee and instant coffee was identified on the basis of the contents of caffeine, oxalate and mineral elements. Experimental evidence showed that, caffeine in instant coffee was 2-3 times higher than in ground coffee. Oxalate in instant coffee was significantly higher in ground coffee. Mineral elements of Mg, P and Zn in ground coffee is lower than in instant coffee, while Cu is several times higher. The mineral content in chicory coffee is overall lower than the instant coffee. In addition, we determined the content of Ti for different types of coffees, and simultaneously detected the elements of Cu, Ti and Zn in chicory coffee. As a fast detection technique, FTIR spectroscopy has the potential of detecting the differences between ground coffee and instant coffee, and is able to verify the presence of caffeine and oxalate. PMID:25358189

  20. Predation by Flat Bark Beetles (Coleoptera: Silvanidae and Laemophloeidae) on Coffee Berry Borer (Coleoptera: Curculionidae) in Hawaii coffee

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee berry borer(CBB), Hypothenemus hampei, is a serious pest of coffee worldwide and a new invasive pest in Hawaii. Adult flat bark beetles, mainly Leptophloeus sp.(75%) and Cathartus quadricollis(21%) (Coleoptera: Laemophloeidae and Silvanidae, respectively), were found feeding in CBB-infested c...

  1. Potential genotoxic, mutagenic and antimutagenic effects of coffee: a review.

    PubMed

    Nehlig, A; Debry, G

    1994-04-01

    Coffee and caffeine are mutagenic to bacteria and fungi, and in high concentrations they are also mutagenic to mammalian cells in culture. However, the mutagenic effects of coffee disappear when bacteria or mammalian cells are cultured in the presence of liver extracts which contain detoxifying enzymes. In vivo, coffee and caffeine are devoid of mutagenic effects. Coffee and caffeine are able to interact with many other mutagens and their effects are synergistic with X-rays, ultraviolet light and some chemical agents. Caffeine seems to potentiate rather than to induce chromosomal aberrations and also to transform sublethal damage of mutagenic agents into lethal damage. Conversely, coffee and caffeine are also able to inhibit the mutagenic effects of numerous chemicals. These antimutagenic effects depend on the time of administration of coffee as compared to the acting time of the mutagenic agent. In that case, caffeine seems to be able to restore the normal cycle of mitosis and phosphorylation in irradiated cells. Finally, the potential genotoxic and mutagenic effects of the most important constituents of coffee are reviewed. Mutagenicity of caffeine is mainly attributed to chemically reactive components such as aliphatic dicarbonyls. The latter compounds, formed during the roasting process, are mutagenic to bacteria but less to mammalian cells. Hydrogen peroxide is not very active but seems to considerably enhance mutagenic properties of methylglyoxal. Phenolic compounds are not mutagenic but rather anticarcinogenic. Benzopyrene and mutagens formed during pyrolysis are not mutagenic whereas roasting of coffee beans at high temperature generates mutagenic heterocyclic amines. In conclusion, the mutagenic potential of coffee and caffeine has been demonstrated in lower organisms, but usually at doses several orders of magnitude greater than the estimated lethal dose for caffeine in humans. Therefore, the chances of coffee and caffeine consumption in moderate to

  2. My Morning Coffee: The Effect of Climate Change on the Economies of Coffee-Producing Countries

    NASA Astrophysics Data System (ADS)

    Shilling, K.; Brauman, K. A.

    2012-12-01

    Through its effect on export crops, climate change will have important effects on economic systems and government capacity in sub-Saharan Africa. We show that climate change effects on three important export crops - coffee, cocoa and cotton - will undermine large portions of the economy, not just the rural farmers who grow these crops. Our analysis is based high-resolution data on crop location, temperature, and water requirements in conjunction with new projections for temperature increases and precipitation changes in sub-Saharan Africa. Our focus on export crops is distinct from most work on the effects of climate change on agriculture, which often focuses on subsistence and food crops. We posit that substantial and important effects on the economy and political systems will come from negative impacts on cash crops, which underpin many economies in sub-Saharan Africa. For instance, 3% of cropland in Uganda (and 2% in Ethiopia) is used for coffee production and over 3.5 million households are involved in the sector; by contrast, 7% of cropland in Uganda (and 11% in Ethiopia) is used for maize, which contributes much less to the formal economy. The relationship between the value of coffee exported and government revenue illustrates the importance of coffee to political and economic stability. A drop in the export value of coffee by 10% in Uganda will drive government revenue down by 20%, and while there is uncertainty around the exact impact of climate change, it is likely that production will take a turn for the worse. We use these factors to assess reliance of select country's economy on these crops, from the farmer to the exporter; the sensitivity of the crops to variation in the climate; and the subsequent impact on government capacity. Our research illustrates how strongly the impacts of climate change are linked to economic and political structures.

  3. Rhabdomyolysis induced by excessive coffee drinking.

    PubMed

    Chiang, W-F; Liao, M-T; Cheng, C-J; Lin, S-H

    2014-08-01

    Excessive ingestion of caffeine-containing beverages is a rare cause of rhabdomyolysis. Here, we describe the case of a 44-year-old woman presented with nausea, vomiting, palpitations, and tea-colored urine 6 h after drinking a liter of black coffee containing approximately 565 mg of caffeine for mental alertness. Laboratory studies were notable for myoglobinuria and markedly elevated plasma creatine kinase (CK) level of 7315 U/L. With volume expansion and alkalization, her plasma CK level returned to normal within 5 days. Rhabdomyolysis should be considered a potential health hazard from excessive consumption of caffeine-containing products. PMID:24220878

  4. Brazilian stone meteorites

    NASA Technical Reports Server (NTRS)

    Gomes, C. B.; Keil, K.

    1980-01-01

    A survey of Brazilian meteorites is presented, along with basic premises of meteoritics, including classification, naming, and analytic procedures. Meteorites are noted to be of interest as representative samples of ancient rocks, perhaps half as old as the universe, as sometimes originating from outside the solar system, containing early solar material, and containing evidence of cosmic ray interactions or collisions. The characteristics which make up the achondrite and chondrite group are reviewed, and a listing of the primary characteristics of known Brazilian meteorites is provided.

  5. Aroma recovery from roasted coffee by wet grinding.

    PubMed

    Baggenstoss, J; Thomann, D; Perren, R; Escher, F

    2010-01-01

    Aroma recovery as determined by solid phase microextraction-gas chromatography-mass spectrometry (SPME-GC-MS) was compared in coffees resulting from conventional grinding processes, and from wet grinding with cold and hot water. Freshly roasted coffee as well as old, completely degassed coffee was ground in order to estimate the relationship of internal carbon dioxide pressure in freshly roasted coffee with the aroma loss during grinding. The release of volatile aroma substances during grinding was found to be related to the internal carbon dioxide pressure, and wet grinding with cold water was shown to minimize losses of aroma compounds by trapping them in water. Due to the high solubility of roasted coffee in water, the use of wet-grinding equipment is limited to processes where grinding is followed by an extraction step. Combining grinding and extraction by the use of hot water for wet grinding resulted in considerable losses of aroma compounds because of the prolonged heat impact. Therefore, a more promising two-step process involving cold wet grinding and subsequent hot extraction in a closed system was introduced. The yield of aroma compounds in the resulting coffee was substantially higher compared to conventionally ground coffee. PMID:21535580

  6. A comprehensive review on utilization of wastewater from coffee processing.

    PubMed

    Rattan, Supriya; Parande, A K; Nagaraju, V D; Ghiwari, Girish K

    2015-05-01

    The coffee processing industry is one of the major agro-based industries contributing significantly in international and national growth. Coffee fruits are processed by two methods, wet and dry process. In wet processing, coffee fruits generate enormous quantities of high strength wastewater requiring systematic treatment prior to disposal. Different method approach is used to treat the wastewater. Many researchers have attempted to assess the efficiency of batch aeration as posttreatment of coffee processing wastewater from an upflow anaerobic hybrid reactor (UAHR)-continuous and intermittent aeration system. However, wet coffee processing requires a high degree of processing know-how and produces large amounts of effluents which have the potential to damage the environment. Characteristics of wastewater from coffee processing has a biological oxygen demand (BOD) of up to 20,000 mg/l and a chemical oxygen demand (COD) of up to 50,000 mg/l as well as the acidity of pH below 4. In this review paper, various methods are discussed to treat coffee processing wastewaters; the constitution of wastewater is presented and the technical solutions for wastewater treatment are discussed. PMID:25598156

  7. Effect of regular and decaffeinated coffee on serum gastrin levels.

    PubMed

    Acquaviva, F; DeFrancesco, A; Andriulli, A; Piantino, P; Arrigoni, A; Massarenti, P; Balzola, F

    1986-04-01

    We evaluated the hypothesis that the noncaffeine gastric acid stimulant effect of coffee might be by way of serum gastrin release. After 10 healthy volunteers drank 50 ml of coffee solution corresponding to one cup of home-made regular coffee containing 10 g of sugar and 240 mg/100 ml of caffeine, serum total gastrin levels peaked at 10 min and returned to basal values within 30 min; the response was of little significance (1.24 times the median basal value). Drinking 100 ml of sugared water (as control) resulted in occasional random elevations of serum gastrin which were not statistically significant. Drinking 100 ml of regular or decaffeinated coffee resulted in a prompt and lasting elevation of total gastrin; mean integrated outputs after regular or decaffeinated coffee were, respectively, 2.3 and 1.7 times the values in the control test. Regular and decaffeinated coffees share a strong gastrin-releasing property. Neither distension, osmolarity, calcium, nor amino acid content of the coffee solution can account for this property, which should be ascribed to some other unidentified ingredient. This property is at least partially lost during the process of caffeine removal. PMID:3745848

  8. Equine poisoning by coffee husk (Coffea arabica L.)

    PubMed Central

    2012-01-01

    Background In Brazil, coffee (Coffea arabica) husks are reused in several ways due to their abundance, including as stall bedding. However, field veterinarians have reported that horses become intoxicated after ingesting the coffee husks that are used as bedding. The objective of this study was to evaluate whether coffee husk consumption causes intoxication in horses. Results Six horses fed coast cross hay ad libitum were given access to coffee husks and excitability, restlessness, involuntary muscle tremors, chewing movements and constant tremors of the lips and tongue, excessive sweating and increased respiration and heart rates were the most evident clinical signs. Caffeine levels were measured in the plasma and urine of these horses on two occasions: immediately before the coffee husks were made available to the animals (T0) and at the time of the clinical presentation of intoxication, 56 h after the animals started to consume the husks (T56). The concentrations of caffeine in the plasma (p < 0.001) and urine (p < 0.001) of these animals were significantly greater at T56 than at T0. Conclusions It was concluded that consumption of coffee husks was toxic to horses due to the high levels of caffeine present in their composition. Therefore, coffee husks pose a risk when used as bedding or as feed for horses. PMID:22239973

  9. Coffee consumption vs. cancer risk - a review of scientific data.

    PubMed

    Wierzejska, Regina

    2015-01-01

    Coffee and its impact on health continue to be the topic of much heated debate. Until recently, coffee consumption has been believed to be associated with adverse effects, mainly cardiovascular problems. However, the vast majority of contemporary sources not only emphasize a lack of detrimental effect, but also suggest a beneficial effect of coffee intake. According to the current state of knowledge, coffee consumption is not associated with the majority of cancers although the results of studies on bladder and lung cancer remain conflicting. In case of colorectal, liver and breast cancers, coffee drinking may even have a protective effect. Coffee contains numerous compounds, potentially beneficial as well as harmful. The former include polyphenols which inhibit harmful oxidation processes in the body, while the latter include acrylamide, whose high intake in daily diet may have carcinogenic action. The impact of coffee on the human body is associated also with other factors, e.g. the rate of metabolism and other individual features. PMID:26656410

  10. Coffee and tea consumption in relation to prostate cancer prognosis

    PubMed Central

    Geybels, Milan S.; Neuhouser, Marian L.; Wright, Jonathan L.; Stott-Miller, Marni; Stanford, Janet L.

    2013-01-01

    Background Bioactive compounds found in coffee and tea may delay the progression of prostate cancer. Methods We investigated associations of pre-diagnostic coffee and tea consumption with risk of prostate cancer recurrence/progression. Study participants were men diagnosed with prostate cancer in 2002–2005 in King County, Washington, USA. We assessed the usual pattern of coffee and tea consumption two years before diagnosis date. Prostate cancer outcome events were identified using a detailed follow-up survey. Multivariable Cox proportional hazards regression models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs). Results The analysis of coffee intake in relation to prostate cancer recurrence/progression included 630 patients with a median follow-up of 6.4 years, during which 140 prostate cancer recurrence/progression events were recorded. Approximately 61% of patients consumed at least one cup of coffee per day. Coffee consumption was associated with a reduced risk of prostate cancer recurrence/progression; the adjusted HR for ≥4 cups/day versus ≤1 cup/week was 0.41 (95% CI: 0.20, 0.81; P for trend = 0.01). Approximately 14% of patients consumed one or more cups of tea per day, and tea consumption was unrelated to prostate cancer recurrence/progression. Conclusion Results indicate that pre-diagnostic coffee consumption is associated with a lower risk of prostate cancer recurrence/progression. This finding will require replication in larger studies. PMID:23907772

  11. Acute ventilatory response to green coffee dust extract.

    PubMed

    Zuskin, E; Kanceljak, B; Witek, T J; Schachter, E N

    1991-03-01

    The lung function response to inhalation of an extract of green coffee was studied in ten healthy subjects who were prescreened for airway hyperresponsiveness to an aerosol of green coffee extract. The effects of this provocation were evaluated at rest and following moderate exercise as well as with and without pretreatment with 80 mg of disodium cromoglycate (DSCG). There was a statistically significant decrement in lung function over time (P less than .001) following coffee provocation both at rest and following exercise. No significant protection against this response was observed with DSCG pretreatment. While the majority of these "healthy" coffee reactors exhibited baseline nonspecific airway hyperresponsiveness to methacholine (PC20 FEV1 less than 25 mg/mL in 7/10), there was no correlation in these ten subjects between baseline responsiveness to methacholine and the degree of lung function decrement following coffee (P greater than .05). Also, no correlation was observed between skin prick and lung function response to coffee extract. We conclude that inhalation of green coffee extract causes significant bronchoconstriction in selected healthy volunteers and that this response is not prevented by pretreatment with DSCG. PMID:1900983

  12. Coffee and Depression: A Short Review of Literature.

    PubMed

    Tenore, Gian Carlo; Daglia, Maria; Orlando, Valentina; D'Urso, Emanuela; Saadat, Seyed Hassan; Novellino, Ettore; Nabavi, Seyed Fazel; Nabavi, Seyed Mohammad

    2015-01-01

    Coffee is among the most widespread and healthiest beverages in the world. It is known to be a highly rich source of biologically active natural metabolites which possess therapeutic effects (i.e. caffeine) and functional properties (i.e. chlorogenic acids). Therefore, coffee can be considered a drink which has different positive effects on human health such as cardioprotective, neuroprotective, hepatoprotective, nephroprotective, etc. However, heavy coffee consumption may be related to some unpleasant symptoms, mainly anxiety, headache, increased blood pressure, nausea, and restlessness. During the past two decades, several studies have indicated that there is a close correlation between consumption of coffee and incidence of depression. In addition, phytochemical studies showed that caffeine is the main responsible constituent for antidepressant effects of coffee through multiple molecular mechanisms. The aim of the present paper was to collect the latest literature data (from 1984 to 2014) on the positive and negative impacts of coffee consumption on the major depressive disorders and to clarify the role of bioactive constituents of coffee in the related different clinical trials. To the best of our knowledge, this the first review on this topic. PMID:26303345

  13. Weather and Climate Indicators for Coffee Rust Disease

    NASA Astrophysics Data System (ADS)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  14. Reinforcing effects of caffeine in coffee and capsules.

    PubMed

    Griffiths, R R; Bigelow, G E; Liebson, I A

    1989-09-01

    In a residential research ward the reinforcing and subjective effects of caffeine were studied under double-blind conditions in volunteer subjects with histories of heavy coffee drinking. In Experiment 1, 6 subjects had 13 opportunities each day to self-administer either a caffeine (100 mg) or a placebo capsule for periods of 14 to 61 days. All subjects developed a clear preference for caffeine, with intake of caffeine becoming relatively stable after preference had been attained. Preference for caffeine was demonstrated whether or not preference testing was preceded by a period of 10 to 37 days of caffeine abstinence, suggesting that a recent history of heavy caffeine intake (tolerance/dependence) was not a necessary condition for caffeine to function as a reinforcer. In Experiment 2, 6 subjects had 10 opportunities each day to self-administer a cup of coffee or (on different days) a capsule, dependent upon completing a work requirement that progressively increased and then decreased over days. Each day, one of four conditions was studied: caffeinated coffee (100 mg/cup), decaffeinated coffee, caffeine capsules (100 mg/capsule), or placebo capsules. Caffeinated coffee maintained the most self-administration, significantly higher than decaffeinated coffee and placebo capsules but not different from caffeine capsules. Both decaffeinated coffee and caffeine capsules were significantly higher than placebo capsules but not different from each other. In both experiments, subject ratings of "linking" of coffee or capsules covaried with the self-administration measures. These experiments provide the clearest demonstrations to date of the reinforcing effects of caffeine in capsules and in coffee. PMID:2794839

  15. Coffee, tea, and melanoma risk among postmenopausal women.

    PubMed

    Wu, Haotian; Reeves, Katherine W; Qian, Jing; Sturgeon, Susan R

    2015-07-01

    Laboratory research suggests that components in coffee and tea may have anticarcinogenic effects. Some epidemiologic studies have reported that women who consume coffee and tea have a lower risk for melanoma. We assessed coffee, tea, and melanoma risk prospectively in the Women's Health Initiative - Observational Study cohort of 66,484 postmenopausal women, followed for an average of 7.7 years. Coffee and tea intakes were measured through self-administered questionnaires at baseline and at year 3 of follow-up. Self-reported incident melanomas were adjudicated using medical records. Cox proportional hazard models were used to estimate risk, adjusting for covariates, with person-time accumulation until melanoma diagnosis (n=398), death, loss to follow-up, or through 2005. Daily coffee [hazard ratio (HR)=0.87, 95% confidence interval (CI) 0.68-1.12] and tea (HR=1.03, 95% CI 0.81-1.31) intakes were not significantly associated with melanoma risk compared with nondaily intake of each beverage. No significant trends were observed between melanoma risk and increasing intakes of coffee (P for trend=0.38) or tea (P for trend=0.22). Women who reported daily coffee intake at both baseline and year 3 had a significantly decreased risk compared with women who reported nondaily intake at both time points (HR=0.68, 95% CI 0.48-0.97). Consistent daily tea intake was not associated with decreased melanoma risk. Overall, there is no strong evidence that increasing coffee or tea consumption can lead to a lower melanoma risk. We observed a decrease in melanoma risk among long-term coffee drinkers, but the lack of consistency in the results by dose and type cautioned against overinterpretation of the results. PMID:25325307

  16. Association between coffee consumption and serum lipid profile

    PubMed Central

    KARABUDAK, EFSUN; TÜRKÖZÜ, DUYGU; KÖKSAL, EDA

    2015-01-01

    The aim of the present study was to investigate the association between coffee consumption and serum lipid levels in a study population of 122 Turkish subjects (mean age, 41.4±12.69 years), including 48 males and 74 females. A questionnaire was compiled to determine baseline characteristics, and food and coffee consumption. Subjects were divided into three groups, which included non-drinkers, Turkish coffee and instant coffee drinkers, and anthropometric measurements were acquired, including weight, height and body mass index. Serum lipid levels were analyzed, including the total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and very low-density lipoprotein cholesterol (VLDL-C) levels. Of the population studied, 76.2% had consumed at least one cup of coffee per week over the previous year. Daily consumption values were 62.3±40.60 ml (0.7±0.50 cup) for Turkish coffee and 116.3±121.96 ml (0.7±0.81 cup) for instant coffee. No statistically significant differences were observed in the serum levels of TC, TG, LDL-C, HDL-C or VLDL-C among the three groups. In addition, no statistically significant differences were observed in the serum lipid levels when comparing individuals who consumed coffee with sugar/cream or who smoked and those who did not (P>0.05). Therefore, the present observations indicated no significant association between the consumption of Turkish or instant coffee and serum lipid levels. PMID:26136902

  17. Reinforcing effects of caffeine in coffee and capsules.

    PubMed Central

    Griffiths, R R; Bigelow, G E; Liebson, I A

    1989-01-01

    In a residential research ward the reinforcing and subjective effects of caffeine were studied under double-blind conditions in volunteer subjects with histories of heavy coffee drinking. In Experiment 1, 6 subjects had 13 opportunities each day to self-administer either a caffeine (100 mg) or a placebo capsule for periods of 14 to 61 days. All subjects developed a clear preference for caffeine, with intake of caffeine becoming relatively stable after preference had been attained. Preference for caffeine was demonstrated whether or not preference testing was preceded by a period of 10 to 37 days of caffeine abstinence, suggesting that a recent history of heavy caffeine intake (tolerance/dependence) was not a necessary condition for caffeine to function as a reinforcer. In Experiment 2, 6 subjects had 10 opportunities each day to self-administer a cup of coffee or (on different days) a capsule, dependent upon completing a work requirement that progressively increased and then decreased over days. Each day, one of four conditions was studied: caffeinated coffee (100 mg/cup), decaffeinated coffee, caffeine capsules (100 mg/capsule), or placebo capsules. Caffeinated coffee maintained the most self-administration, significantly higher than decaffeinated coffee and placebo capsules but not different from caffeine capsules. Both decaffeinated coffee and caffeine capsules were significantly higher than placebo capsules but not different from each other. In both experiments, subject ratings of "linking" of coffee or capsules covaried with the self-administration measures. These experiments provide the clearest demonstrations to date of the reinforcing effects of caffeine in capsules and in coffee. PMID:2794839

  18. Tea, Coffee, and Milk Consumption and Colorectal Cancer Risk

    PubMed Central

    Green, Chadwick John; de Dauwe, Palina; Boyle, Terry; Tabatabaei, Seyed Mehdi; Fritschi, Lin; Heyworth, Jane Shirley

    2014-01-01

    Background Data regarding the effects of tea, coffee, and milk on the risk of colorectal cancer are inconsistent. We investigated associations of tea, coffee, and milk consumption with colorectal cancer risk and attempted to determine if these exposures were differentially associated with the risks of proximal colon, distal colon, and rectal cancers. Methods Data from 854 incident cases and 948 controls were analyzed in a case-control study of colorectal cancer in Western Australia during 2005–07. Multivariable logistic regression was used to analyze the associations of black tea (with and without milk), green tea, herbal tea, hot coffee, iced coffee, and milk with colorectal cancer. Results Consumption of 1 or more cups of herbal tea per week was associated with a significantly decreased risk of distal colon cancer (adjusted odds ratio, 0.37; 95% CI, 0.16–0.82; PTrend = 0.044), and consumption of 1 or more cups of iced coffee per week was associated with increased risk of rectal cancer (adjusted odds ratio, 1.52; 95% CI, 0.91–2.54; PTrend = 0.004). Neither herbal tea nor iced coffee was associated with the risk of proximal colon cancer. Hot coffee was associated with a possible increased risk of distal colon cancer. Black tea (with or without milk), green tea, decaffeinated coffee, and milk were not significantly associated with colorectal cancer risk. Conclusions Consumption of herbal tea was associated with reduced risk of distal colon cancer, and consumption of iced coffee was associated with increased rectal cancer risk. PMID:24531002

  19. Effect of coffee (caffeine) against human cataract blindness

    PubMed Central

    Varma, Shambhu D

    2016-01-01

    Previous biochemical and morphological studies with animal experiments have demonstrated that caffeine given topically or orally to certain experimental animal models has significant inhibitory effect on cataract formation. The present studies were undertaken to examine if there is a correlation between coffee drinking and incidence of cataract blindness in human beings. That has been found to be the case. Incidence of cataract blindness was found to be significantly lower in groups consuming higher amounts of coffee in comparison to the groups with lower coffee intake. Mechanistically, the caffeine effect could be multifactorial, involving its antioxidant as well as its bioenergetic effects on the lens. PMID:26869755

  20. Brazilian women in politics.

    PubMed

    Sanders, T G

    1987-01-01

    Women are gradually gaining influence in Brazilian politics, especially since recent advances in the women's movement, but they still play a limited role. There have been journals devoted to feminism and some notable feminists since 1850. In 1932 suffragettes in Brazil gained women the right to vote. Women's associations burgeoned in the 1940s and 1950s, culminating in a peak in number of women in national elected positions in 1965. A repressive military regime reversed the process, which resumed in 1975. 1975 was also significant for the Brazilian women's movement because of the U.N. Women's Year. Several large, influential feminist political action groups were formed, typically by upper class women with leftist views, although some church and union groups from lower classes also appeared. In 1979-1981, the coherence of these groups fell into schism and fragmentation, because of disagreements over the feminist political doctrines and roles, views on legality of abortion, and special interest groups such as lesbians. Another bitter dispute is opposition by leftist women to BEMFAM, the Brazilian Society of Family Welfare, which provides family planning for the poor: leftists oppose BEMFAM because it is supported by funds from "imperialist" countries such as the U.S. There are several types of feminists groups: those that emphasize health, sexuality and violence; those composed of lesbians; those originating from lower classes and unions; publicly instituted organizations. Brazilian law forbids discrimination against women holding public office, but in reality very few women actually do hold office, except for mayors of small towns and a few administrators of the Education and Social Security ministries. Political office in Brazil is gained by clientism, and since women rarely hold powerful positions in business, they are outsiders of the system. Brazilian women have achieved much, considering the low female literacy rate and traditional power system, but their

  1. Integrated Pest Management of Coffee Berry Borer: Strategies from Latin America that Could Be Useful for Coffee Farmers in Hawaii.

    PubMed

    Aristizábal, Luis F; Bustillo, Alex E; Arthurs, Steven P

    2016-01-01

    The coffee berry borer (CBB), Hypothenemus hampei Ferrari (Coleoptera: Curculionidae: Scolytinae) is the primary arthropod pest of coffee plantations worldwide. Since its detection in Hawaii (September 2010), coffee growers are facing financial losses due to reduced quality of coffee yields. Several control strategies that include cultural practices, biological control agents (parasitoids), chemical and microbial insecticides (entomopathogenic fungi), and a range of post-harvest sanitation practices have been conducted to manage CBB around the world. In addition, sampling methods including the use of alcohol based traps for monitoring CBB populations have been implemented in some coffee producing countries in Latin America. It is currently unclear which combination of CBB control strategies is optimal under economical, environmental, and sociocultural conditions of Hawaii. This review discusses components of an integrated pest management program for CBB. We focus on practical approaches to provide guidance to coffee farmers in Hawaii. Experiences of integrated pest management (IPM) of CBB learned from Latin America over the past 25 years may be relevant for establishing strategies of control that may fit under Hawaiian coffee farmers' conditions. PMID:26848690

  2. Integrated Pest Management of Coffee Berry Borer: Strategies from Latin America that Could Be Useful for Coffee Farmers in Hawaii

    PubMed Central

    Aristizábal, Luis F.; Bustillo, Alex E.; Arthurs, Steven P.

    2016-01-01

    The coffee berry borer (CBB), Hypothenemus hampei Ferrari (Coleoptera: Curculionidae: Scolytinae) is the primary arthropod pest of coffee plantations worldwide. Since its detection in Hawaii (September 2010), coffee growers are facing financial losses due to reduced quality of coffee yields. Several control strategies that include cultural practices, biological control agents (parasitoids), chemical and microbial insecticides (entomopathogenic fungi), and a range of post-harvest sanitation practices have been conducted to manage CBB around the world. In addition, sampling methods including the use of alcohol based traps for monitoring CBB populations have been implemented in some coffee producing countries in Latin America. It is currently unclear which combination of CBB control strategies is optimal under economical, environmental, and sociocultural conditions of Hawaii. This review discusses components of an integrated pest management program for CBB. We focus on practical approaches to provide guidance to coffee farmers in Hawaii. Experiences of integrated pest management (IPM) of CBB learned from Latin America over the past 25 years may be relevant for establishing strategies of control that may fit under Hawaiian coffee farmers’ conditions. PMID:26848690

  3. Rapid and cost-effective determination of acrylamide in coffee by planar chromatography and fluorescence detection after derivatization with dansulfinic acid.

    PubMed

    Alpmann, Alexander; Morlock, Gertrud

    2009-01-01

    A new method has been developed for the determination of acrylamide in ground coffee by planar chromatography using prechromatographic in situ derivatization with dansulfinic acid. After pressurized fluid extraction of acrylamide from the coffee samples, the extracts were passed through activated carbon and concentrated. These extracts were applied onto a silica gel 60 HPTLC plate and oversprayed with dansulfinic acid. By heating the plate, acrylamide was derivatized into the fluorescent product dansylpropanamide. The chromatographic separation with ethyl acetate-tert.-butyl methyl ether (8 + 2, v/v) mobile phase was followed by densitometric quantification at 254/>400 nm using a 4 point calibration via the standard addition method over the whole system for which acrylamide was added at different concentrations at the beginning of the extraction process. The method was validated for commercial coffee. The linearity over the whole procedure showed determination coefficients between 0.9995 and 0.9825 (n = 6). Limit of quantitation at a signal-to-noise ratio of 10 was determined to be 48 microg/kg. The within-run precision (relative standard deviation, n = 6) of the chromatographic method was 3%. Commercial coffee samples analyzed showed acrylamide contents between 52 and 191 microg/kg, which was in correlation with amounts reported in previous publications. PMID:19610360

  4. What's Inside That Seed We Brew? A New Approach To Mining the Coffee Microbiome.

    PubMed

    Vaughan, Michael Joe; Mitchell, Thomas; McSpadden Gardener, Brian B

    2015-10-01

    Coffee is a critically important agricultural commodity for many tropical states and is a beverage enjoyed by millions of people worldwide. Recent concerns over the sustainability of coffee production have prompted investigations of the coffee microbiome as a tool to improve crop health and bean quality. This review synthesizes literature informing our knowledge of the coffee microbiome, with an emphasis on applications of fruit- and seed-associated microbes in coffee production and processing. A comprehensive inventory of microbial species cited in association with coffee fruits and seeds is presented as reference tool for researchers investigating coffee-microbe associations. It concludes with a discussion of the approaches and techniques that provide a path forward to improve our understanding of the coffee microbiome and its utility, as a whole and as individual components, to help ensure the future sustainability of coffee production. PMID:26162877

  5. What's Inside That Seed We Brew? A New Approach To Mining the Coffee Microbiome

    PubMed Central

    Mitchell, Thomas; McSpadden Gardener, Brian B.

    2015-01-01

    Coffee is a critically important agricultural commodity for many tropical states and is a beverage enjoyed by millions of people worldwide. Recent concerns over the sustainability of coffee production have prompted investigations of the coffee microbiome as a tool to improve crop health and bean quality. This review synthesizes literature informing our knowledge of the coffee microbiome, with an emphasis on applications of fruit- and seed-associated microbes in coffee production and processing. A comprehensive inventory of microbial species cited in association with coffee fruits and seeds is presented as reference tool for researchers investigating coffee-microbe associations. It concludes with a discussion of the approaches and techniques that provide a path forward to improve our understanding of the coffee microbiome and its utility, as a whole and as individual components, to help ensure the future sustainability of coffee production. PMID:26162877

  6. Improvement of vegetables elemental quality by espresso coffee residues.

    PubMed

    Cruz, Rebeca; Morais, Simone; Mendes, Eulália; Pereira, José A; Baptista, Paula; Casal, Susana

    2014-04-01

    Spent coffee grounds (SCG) are usually disposed as common garbage, without specific reuse strategies implemented so far. Due to its recognised richness in bioactive compounds, the effect of SCG on lettuce's macro- and micro-elements was assessed to define its effectiveness for agro industrial reuse. A greenhouse pot experiment was conducted with different amounts of fresh and composted spent coffee, and potassium, magnesium, phosphorous, calcium, sodium, iron, manganese, zinc and copper were analysed. A progressive decrease on all lettuce mineral elements was verified with the increase of fresh spent coffee, except for potassium. In opposition, an increment of lettuce's essential macro-elements was verified when low amounts of composted spent coffee were applied (5%, v/v), increasing potassium content by 40%, manganese by 30%, magnesium by 20%, and sodium by 10%, of nutritional relevance This practical approach offers an alternative reuse for this by-product, extendable to other crops, providing value-added vegetable products. PMID:24262560

  7. Chemical profiling to differentiate geographic growing origins of coffee.

    PubMed

    Anderson, Kim A; Smith, Brian W

    2002-03-27

    The objective of this research was to demonstrate the feasibility of this method to differentiate the geographical growing regions of coffee beans. Elemental analysis (K, Mg, Ca, Na, Al, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Mo, S, Cd, Pb, and P) of coffee bean samples was performed using ICPAES. There were 160 coffee samples analyzed from the three major coffee-growing regions: Indonesia, East Africa, and Central/South America. A computational evaluation of the data sets was carried out using statistical pattern recognition methods including principal component analysis, discriminant function analysis, and neural network modeling. This paper reports the development of a method combining elemental analysis and classification techniques that may be widely applied to the determination of the geographical origin of foods. PMID:11902958

  8. Determination of polycyclic aromatic hydrocarbons in roasted coffee.

    PubMed

    Jimenez, Angelica; Adisa, Afolabi; Woodham, Cara; Saleh, Mahmoud

    2014-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are suspected to be carcinogenic and mutagenic. This study describes the presence of PAHs in light, medium and dark roasted coffee including instant and decaffeinated brands. Total PAHs concentration was related to the degree of roasting with light roasted coffee showing the least and dark roasted coffee showing the highest level. Both instant and decaffeinated coffee brand showed lower levels of PAHs. Naphthalene, acenaphthylene, pyrene and chrysene were the most abundant individual isomers. The concentrations ranged from 0 to 561 ng g(-1) for naphthalene, 0 to 512 ng g(-1) for acenaphthylene, 60 to 459 ng g(-1) for pyrene and 56 to 371 ng g(-1) for chrysene. Thus, roasting conditions should be controlled to avoid the formation of PAHs due to their suspected carcinogenic and mutagenic properties. PMID:25190557

  9. 32. Coffee bean sluiceway on ground floor showing chute bringing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. Coffee bean sluiceway on ground floor showing chute bringing beans from first floor hopper. HAER PR, 6-MAGU, 1B-17 - Hacienda Buena Vista, PR Route 10 (Ponce to Arecibo), Magueyes, Ponce Municipio, PR

  10. Coffee consumption and the risk of breast cancer.

    PubMed

    La Vecchia, C; Talamini, R; Decarli, A; Franceschi, S; Parazzini, F; Tognoni, G

    1986-09-01

    The relationship of breast cancer to coffee drinking habits was evaluated in a case-control study of 616 women with breast cancer and 616 control subjects with nonmalignant disorders, apparently unrelated to coffee consumption. Compared with women who had never drunk coffee, the relative risk estimates for those women who drank less than two, two or three, and four or more cups each day were 1.5, 1.3, and 1.0, respectively. There was no apparent association with duration of consumption or use of other methylxanthine-containing beverages. The results were not modified by several potential confounding factors, including the major risk factors for breast cancer. The findings suggest that coffee consumption does not increase the risk of malignant neoplasms of the breast. PMID:3738766

  11. All the Exquisite Details of a Coffee Mug.

    ERIC Educational Resources Information Center

    Larsen, Dave M., Jr.

    1999-01-01

    Describes a three-part exercise used in a first semester freshman composition class, intended to show students the world of details in even the most ordinary, everyday objects by having students write about a plastic coffee mug. (SR)

  12. Antioxidative activities of fractions obtained from brewed coffee.

    PubMed

    Yanagimoto, Kenichi; Ochi, Hirotomo; Lee, Kwang-Geun; Shibamoto, Takayuki

    2004-02-11

    The antioxidative activity of column chromatographic fractions obtained from brewed coffee was investigated to find antioxidants and to assess the benefit of coffee drinking. The dichloromethane extract inhibited hexanal oxidation by 100 and 50% for 15 days and 30 days, respectively, at the level of 5 microg/mL. A GC/MS analysis of fractions, which exhibited oxidative activity, revealed the presence of antioxidative heterocyclic compounds including furans, pyrroles, and maltol. The residual aqueous solution exhibited slight antioxidative activity. The inhibitory activity (%) of the seven fractions from an aqueous solution toward malonaldehde formation from lipid oxidation ranged from 10 to 90 at a level of 300 microg/mL. The results indicate that brewed coffee contains many antioxidants and consumption of antioxidant-rich brewed coffee may inhibit diseases caused by oxidative damages. PMID:14759154

  13. Caffeine in coffee: its removal. Why and how?

    PubMed

    Ramalakshmi, K; Raghavan, B

    1999-09-01

    The popularity of coffee as a beverage is ever increasing despite the fact that there are reports antagonized to its consumption. Of the several factors cited, the alkaloid caffeine present in coffee can cause addiction and stimulate the central nervous system. It has an effect on the cardiovascular system with a slight increase in blood pressure and heart output. It undergoes biotransformation in the human body to form methylated derivatives of uric acid. In recent times, much effort has gone into the research on the removal of caffeine in coffee, resulting in a specialty product called decaffeinated coffee. Decaffeination methods mainly employ organic solvents or water or supercritical carbon dioxide. These methods with their attendant advantages and disadvantages are reviewed in this article. PMID:10516914

  14. Space Coffee Cup: Capillary Flow Driven Fluids in Space

    NASA Video Gallery

    Interested in learning more about how fluids react in Space? In this video, Professor Mark Weislogel, and Dr. Marshall Porterfield will discuss the Space Coffee Cup and Capillary Flow Driven Fluids...

  15. Determination of polycyclic aromatic hydrocarbons in roasted coffee

    PubMed Central

    JIMENEZ, ANGELICA; ADISA, AFOLABI; WOODHAM, CARA; SALEH, MAHMOUD

    2016-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are suspected to be carcinogenic and mutagenic. This study describes the presence of PAHs in light, medium and dark roasted coffee including instant and decaffeinated brands. Total PAHs concentration was related to the degree of roasting with light roasted coffee showing the least and dark roasted coffee showing the highest level. Both instant and decaffeinated coffee brand showed lower levels of PAHs. Naphthalene, acenaphthylene, pyrene and chrysene were the most abundant individual isomers. The concentrations ranged from 0 to 561 ng g−1 for naphthalene, 0 to 512 ng g−1 for acenaphthylene, 60 to 459 ng g−1 for pyrene and 56 to 371 ng g−1 for chrysene. Thus, roasting conditions should be controlled to avoid the formation of PAHs due to their suspected carcinogenic and mutagenic properties. PMID:25190557

  16. Familial aggregation and dietary patterns in the Brazilian population.

    PubMed

    Massarani, Fábia Albernaz; Cunha, Diana Barbosa; Muraro, Ana Paula; Souza, Bárbara da Silva Nalin de; Sichieri, Rosely; Yokoo, Edna Massae

    2015-12-01

    The aim of the study was to identify dietary patterns in Brazil and verify aggregation among members of the same family based on the Brazilian National Dietary Survey, a nationwide dietary survey conducted in 2008-2009 in individuals over 10 years of age. Dietary intake was estimated with a food record. Dietary patterns were identified by factor analysis, and familial aggregation was verified by linear regression. Three major dietary patterns were identified: (1) a traditional snack featuring coffee, rolls, oils and fats, and cheese; (2) traditional main meal, based on rice, beans and other legumes, and meat; and (3) fast food type snacks, namely sandwiches, processed meats, soft drinks, snacks, and pizza. Pattern 2 showed the strongest association (β = 0.37-0.64). Patterns 1 and 3 showed positive associations for all pairs of family members, with β ranging from 0.27 to 0.44 and 0.32 to 0.42, respectively. The study showed familial aggregation of dietary patterns in the Brazilian population. PMID:26872230

  17. Associations of coffee drinking with systemic immune and inflammatory markers

    PubMed Central

    Loftfield, Erikka; Shiels, Meredith S.; Graubard, Barry I.; Katki, Hormuzd A.; Chaturvedi, Anil K.; Trabert, Britton; Pinto, Ligia A.; Kemp, Troy J.; Shebl, Fatma M.; Mayne, Susan T.; Wentzensen, Nicolas; Purdue, Mark P.; Hildesheim, Allan; Sinha, Rashmi; Freedman, Neal D.

    2015-01-01

    Background Coffee drinking has been inversely associated with mortality as well as cancers of the endometrium, colon, skin, prostate, and liver. Improved insulin sensitivity and reduced inflammation are among the hypothesized mechanisms by which coffee drinking may affect cancer risk; however, associations between coffee drinking and systemic levels of immune and inflammatory markers have not been well characterized. Methods We used Luminex bead-based assays to measure serum levels of 77 immune and inflammatory markers in 1,728 older non-Hispanic Whites. Usual coffee intake was self-reported using a food frequency questionnaire. We used weighted multivariable logistic regression models to examine associations between coffee and dichotomized marker levels. We conducted statistical trend tests by modeling the median value of each coffee category and applied a 20% false discovery rate criterion to P-values. Results Ten of the 77 markers were nominally associated (P-value for trend<0.05) with coffee drinking. Five markers withstood correction for multiple comparisons and included aspects of the host response namely chemotaxis of monocytes/macrophages (IFNγ, CX3CL1/fractalkine, CCL4/MIP-1β), pro-inflammatory cytokines (sTNFRII) and regulators of cell growth (FGF-2). Heavy coffee drinkers had lower circulating levels of IFNγ (OR=0.35; 95% CI 0.16–0.75), CX3CL1/fractalkine (OR=0.25; 95% CI 0.10–0.64), CCL4/MIP-1β (OR=0.48; 95% CI 0.24–0.99), FGF-2 (OR=0.62; 95% CI 0.28–1.38), and sTNFRII (OR=0.34; 95% CI 0.15–0.79) than non-coffee drinkers. Conclusions Lower circulating levels of inflammatory markers among coffee drinkers may partially mediate previously observed associations of coffee with cancer and other chronic diseases. Impact Validation studies, ideally controlled feeding trials, are needed to confirm these associations. PMID:25999212

  18. Improvement of near infrared spectroscopic (NIRS) analysis of caffeine in roasted Arabica coffee by variable selection method of stability competitive adaptive reweighted sampling (SCARS)

    NASA Astrophysics Data System (ADS)

    Zhang, Xuan; Li, Wei; Yin, Bin; Chen, Weizhong; Kelly, Declan P.; Wang, Xiaoxin; Zheng, Kaiyi; Du, Yiping

    2013-10-01

    Coffee is the most heavily consumed beverage in the world after water, for which quality is a key consideration in commercial trade. Therefore, caffeine content which has a significant effect on the final quality of the coffee products requires to be determined fast and reliably by new analytical techniques. The main purpose of this work was to establish a powerful and practical analytical method based on near infrared spectroscopy (NIRS) and chemometrics for quantitative determination of caffeine content in roasted Arabica coffees. Ground coffee samples within a wide range of roasted levels were analyzed by NIR, meanwhile, in which the caffeine contents were quantitative determined by the most commonly used HPLC-UV method as the reference values. Then calibration models based on chemometric analyses of the NIR spectral data and reference concentrations of coffee samples were developed. Partial least squares (PLS) regression was used to construct the models. Furthermore, diverse spectra pretreatment and variable selection techniques were applied in order to obtain robust and reliable reduced-spectrum regression models. Comparing the respective quality of the different models constructed, the application of second derivative pretreatment and stability competitive adaptive reweighted sampling (SCARS) variable selection provided a notably improved regression model, with root mean square error of cross validation (RMSECV) of 0.375 mg/g and correlation coefficient (R) of 0.918 at PLS factor of 7. An independent test set was used to assess the model, with the root mean square error of prediction (RMSEP) of 0.378 mg/g, mean relative error of 1.976% and mean relative standard deviation (RSD) of 1.707%. Thus, the results provided by the high-quality calibration model revealed the feasibility of NIR spectroscopy for at-line application to predict the caffeine content of unknown roasted coffee samples, thanks to the short analysis time of a few seconds and non

  19. Determination of serotonin released from coffee wax by liquid chromatography.

    PubMed

    Kele, M; Ohmacht, R

    1996-04-12

    A simple hydrolysis and extraction method was developed for the release of serotonin (5-hydroxytryptamine) from a coffee wax sample obtained from decaffeination of coffee beans. The recoverable amount of serotonin was determined by reversed-phase high-performance liquid chromatography with gradient elution and UV detection, using the standard addition method. Different type of basic deactivated chromatographic columns were used for the separation. PMID:8680597

  20. Identification of the odour-active cyclic diketone cis-2,6-dimethyl-1,4-cyclohexanedione in roasted Arabica coffee brew.

    PubMed

    Miyazato, Hironari; Nakamura, Michiaki; Hashimoto, Seiji; Hayashi, Shuichi

    2013-06-15

    We investigated odour-active trace compounds in roasted Brazilian Arabica coffee. Aroma dilution extract analysis (AEDA) applied to the volatile oil extracted from roasted coffee brew revealed 34 odour-active compounds. Among these, a pungent-smelling unknown odour-active compound was determined. The volatile oil was fractioned by silica gel column chromatography. Gas chromatography-olfactometry (GC-O) and multidimensional gas chromatography-mass spectrometry (MDGC-MS) of the fraction which contained a significant amount of the target unknown compound revealed the cyclic 1,4-diketone, cis-2,6-dimethyl-1,4-cyclohexanedione, which had a pungent odour, and was thus first identified in roasted coffee. Model experiments revealed that cis-2,6-dimethyl-1,4-cyclohexanedione was formed via thermal degradation of sugars, especially monosaccharides, under alkaline conditions. Further, we demonstrated that 2-hydroxy-3-pentanone and 1-hydroxy-2-propanone, thermal degradation products of monosaccharides, were closely related to the formation of cis-2,6-dimethyl-1,4-cyclohexanedione. PMID:23497895

  1. Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

    PubMed

    Morello, Luis Gustavo; Sartori, Daniele; de Oliveira Martinez, André Luiz; Vieira, Maria Lúcia Carneiro; Taniwaki, Marta Hiromi; Fungaro, Maria Helena Pelegrinelli

    2007-11-01

    Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique. PMID:17900727

  2. Coffee Ring Effect” in Ophthalmology

    PubMed Central

    Rajabi, Mohammad Taher; Sharifzadeh, Morteza

    2016-01-01

    Abstract The process of formation of Marx line is studied in this article. Various theories have been proposed previously, in order to explain the mechanisms which lead to the development of Marx line. These theories are based on the characteristics of stained area and do not pay attention to the behavior of dye solution itself on the surface. The aim of this study is to investigate the latter behavior and introduce a new theory based on it, in order to explain the process of the Marx line formation. This study also introduces “Coffee Ring Effect” and its possible applications in explaining some ophthalmological phenomena. The effect of dye solution's behavior on the beneath surface is adopted in order to propose a novel theory. This new hypothesis is called “Anionic Dye Deposition” which was based on “Coffee Ring Effect” phenomenon. For evaluation of this theory, Evaporation pattern of Rose Bengal and fluorescein were analyzed on different surfaces. Furthermore, the effect of tear meniscus alteration on lid margin staining is studied. During the evaporation process of dye solutions, it was observed that almost all of the solute was deposited at the edge of the drop on hydrophilic surfaces. Furthermore, in the study of lid margin staining, it is observed that tear meniscus alteration during gaze affects staining pattern. This observation invalidates former hypotheses which only focus on stained surface characteristics. According to the observations in this study, it is proposed that Marx line staining occurs as a result of “anionic dye deposition” due to evaporation. PMID:27057835

  3. Espresso coffee residues: a valuable source of unextracted compounds.

    PubMed

    Cruz, Rebeca; Cardoso, Maria M; Fernandes, Luana; Oliveira, Marta; Mendes, Eulália; Baptista, Paula; Morais, Simone; Casal, Susana

    2012-08-15

    Espresso spent coffee grounds were chemically characterized to predict their potential, as a source of bioactive compounds, by comparison with the ones from the soluble coffee industry. Sampling included a total of 50 samples from 14 trademarks, collected in several coffee shops and prepared with distinct coffee machines. A high compositional variability was verified, particularly with regard to such water-soluble components as caffeine, total chlorogenic acids (CGA), and minerals, supported by strong positive correlations with total soluble solids retained. This is a direct consequence of the reduced extraction efficiency during espresso coffee preparation, leaving a significant pool of bioactivity retained in the extracted grounds. Besides the lipid (12.5%) and nitrogen (2.3%) contents, similar to those of industrial coffee residues, the CGA content (478.9 mg/100 g), for its antioxidant capacity, and its caffeine content (452.6 mg/100 g), due to its extensive use in the food and pharmaceutical industries, justify the selective assembly of this residue for subsequent use. PMID:22812683

  4. Dicinnamoylquinides in roasted coffee inhibit the human adenosine transporter.

    PubMed

    de Paulis, Tomas; Schmidt, Dennis E; Bruchey, Aleksandra K; Kirby, Michael T; McDonald, Michael P; Commers, Patricia; Lovinger, David M; Martin, Peter R

    2002-05-10

    Preliminary screening of a minor, non-xanthine constituent of roasted coffee, 3,4-diferuloyl-1,5-quinolactone (DIFEQ), showed inhibition of the adenosine transporter at low micromolar concentration. DIFEQ is a neutral derivative of the chlorogenic acids, i.e. isomeric mono- and di-substituted coumaroyl-, caffeoyl-, and feruloyl-esters of quinic acid, formed in the roasting process of coffee. Displacement of the adenosine transporter antagonist [(3)H](S)-(nitrobenzyl)-6-thioinosine binding by DIFEQ in cultured U-937 cell preparations, expressing the human adenosine transporter protein (hENT1), showed a K(i) of 0.96+/-0.13 microM. Extracts of regular and decaffeinated coffee showed binding activities equivalent to 30-40 mg DIFEQ per three cups of coffee. Acute administration of a high dose of DIFEQ (100 mg/kg i.p.) reduced open field locomotion in mice for 20 min in correlation with brain levels of DIFEQ. Both 3,4-dicaffeoyl-1,5-quinide and 3,4-dicoumaroyl-1,5-quinide, two close structural analogs of DIFEQ also present in roasted coffee, showed similar affinities for the adenosine transporter, while the corresponding 3- and 4-mono caffeoyl- and feruloyl-quinides were one to two orders of magnitudes less active. This suggests that 3,4-dicinnamoyl-1,5-quinides in coffee could have the potential to raise extra-cellular adenosine levels, thereby counteracting the stimulant effect of caffeine. PMID:12065074

  5. Determination of volatile marker compounds of common coffee roast defects.

    PubMed

    Yang, Ni; Liu, Chujiao; Liu, Xingkun; Degn, Tina Kreuzfeldt; Munchow, Morten; Fisk, Ian

    2016-11-15

    Coffee beans from the same origin were roasted using six time-temperature profiles, in order to identify volatile aroma compounds associated with five common roast coffee defects (light, scorched, dark, baked and underdeveloped). Thirty-seven volatile aroma compounds were selected on the basis that they had previously been identified as potent odorants of coffee and were also identified in all coffee brew preparations; the relative abundance of these aroma compounds was then evaluated using gas chromatography mass spectrometry (GC-MS) with headspace solid phase micro extraction. Some of the 37 key aroma compounds were significantly changed in each coffee roast defect and changes in one marker compound was chosen for each defect type, that is, indole for light defect, 4-ethyl-2-methoxyphenol for scorched defect, phenol for dark defect, maltol for baked defect and 2,5-dimethylfuran for underdeveloped defect. The association of specific changes in aroma profiles for different roast defects has not been shown previously and could be incorporated into screening tools to enable the coffee industry quickly identify if roast defects occur during production. PMID:27283624

  6. Brazilian Trichoptera Checklist II

    PubMed Central

    2014-01-01

    Abstract A second assessment of Brazilian Trichoptera species records is presented here. A total of 625 species were recorded for Brazil. This represents an increase of 65.34% new species recorded during the last decade. The Hydropsychidae (124 spp.), followed by the Hydroptilidae (102 spp.) and Polycentropodidae (97 spp.), are the families with the greatest richness recorded for Brazil. The knowledge on Trichoptera biodiversity in Brazil is geographically unequal. The majority of the species is recorded for the southeastern region. PMID:25349524

  7. Extractive reserves in Brazilian Amazonia

    SciTech Connect

    Fearnside, P.M )

    1989-06-01

    In 1985 an opportunity arose for maintaining tracts of Amazonian forest under sustainable use. Brazil's National Council of Rubber Tappers and the Rural Worker's Union proposed the creation of a set of reserves of a new type, called extractive reserves. The first six are being established in one of the Brazilian states most threatened by deforestatation. The creation of extractive reserves grants legal protection to forest land traditionally used by rubber tappers, Brazil-nut gatherers, and other extractivists. The term extrativismo (extractivism) in Brazil refers to removing nontimber forest products, such as latex, resins, and nuts, without felling the trees. Approximately 30 products are collected for commercial sale. Many more types of forest materials are gathered, for example as food and medicines, for the extractivists' own use. The reserve proposal is attractive for several reasons related to social problems. It allows the rubber tappers to continue their livelihood rather than be expelled by deforestation. However, it is unlikely that sufficient land will be set aside as extractive reserves to employ all the tappers. Displaced rubber tappers already swell the ranks of urban slum dwellers in Brazil's Amazonian cities, and they have become refugees to continue their profession in the forests of neighboring countries, such as Bolivia.

  8. Action of dietary trypsin, pressed coffee oil, silymarin and iron salt on 1,2-dimethylhydrazine tumorigenesis by gavage.

    PubMed

    Gershbein, L L

    1994-01-01

    Sprague-Dawley male rats, 24 days of age, were placed on diets based on a balanced ration as such and supplemented with Brazilian A rabica green coffee bean oil (0.10%), silymarin flavonolignans (0.10%), porcine trypsin (2429 mu/g ration) and ferrous sulfate (0.24% Fe) for a period of 32 weeks. A portion of the controls was switched to the iron salt diet at day 37 when 1,2-dimethylhydrazine was administered by gavage at a dosage of 20 mg/kg (base) and continued weekly for a total of 15 weeks. The colon and small intestinal adenocarcinoma numbers were determined for each group of rats surviving the carcinogen treatment and compared with the respective controls by a statistical design based on Poisson distribution. The results indicate that the adenocarcinoma frequencies of the colon, both total and occurrence in the proximal and distal portions were significantly decreased in the groups fed coffee oil, silymarin group and trypsin. The colon tumor numbers for the iron salt-fed were in the control range except for a decrement in the distal colon for rats on the diet from the start. Small intestinal adenocarcinoma scores with all supplemented diets did not differ significantly from the controls. PMID:8074460

  9. Cuticle-degrading proteases produced by the entomopathogenic fungus Beauveria bassiana in the presence of coffee berry borer cuticle

    PubMed Central

    Dias, B.A.; Neves, P.M.O.J.; Furlaneto-Maia, L.; Furlaneto, M.C.

    2008-01-01

    A Brazilian isolate of Beauveria bassiana (CG425) that shows high virulence against the coffee berry borer (CBB) was examined for the production of subtilisin-like (Pr1) and trypsin-like (Pr2) cuticle-degrading proteases. Fungal growth was either in nitrate-medium or in CBB cuticle-containing medium under both buffered and unbuffered conditions. In unbuffered medium supplemented with cuticle, the pH of cultures dropped and Pr1 and Pr2 activities were detected in high amounts only at a pH of 5.5 or higher. In buffered cultures, Pr1 and Pr2 activities were higher in medium supplemented with cuticle compared to activities with nitrate-medium. The Pr1 and Pr2 activities detected were mostly in the culture supernatant. These data suggest that Pr1 and Pr2 proteases produced by strain CG425 are induced by components of CBB cuticle, and that the culture pH influences the expression of these proteases, indicating the occurrence of an efficient mechanism of protein secretion in this fungus. The results obtained in this study extend the knowledge about protease production in B. bassiana CG425, opening new avenues for studying the role of secreted proteases in virulence against the coffee berry borer during the infection process. PMID:24031220

  10. Brazilian minister sets global goals

    NASA Astrophysics Data System (ADS)

    2014-04-01

    Marco Antonio Raupp, the mathematical physicist who is now Brazil's minister of science, technology and innovation, talks to Physics World about the challenges and opportunities for Brazilian research.

  11. A GC method for simultaneous analysis of bornesitol, other polyalcohols and sugars in coffee and its substitutes.

    PubMed

    Ruiz-Matute, Ana Isabel; Montilla, Antonia; del Castillo, Maria Dolores; Martínez-Castro, Isabel; Sanz, Maria Luz

    2007-03-01

    A GC method has been developed for the determination of polyalcohols and sugars in aqueous extracts from green coffee beans, ground roasted coffee beans submitted to either conventional or torrefacto processes, coffee blends and soluble instant coffees. Bornesitol was detected in aqueous coffee extracts for the first time. Mannitol, myo-inositol, mannose, fructose, galactose, glucose and sucrose have also been determined. Results seem to indicate that coffee manufacturing processes, such as roasting or decaffeination, do not affect the polyalcohol content. Coffee substitutes based on cereals, carob or chicory, have also been studied. The possibility to characterize their presence in coffee extracts was evaluated. PMID:17444224

  12. Coffee, tea and decaffeinated coffee in relation to hepatocellular carcinoma in a European population: multicentre, prospective cohort study.

    PubMed

    Bamia, Christina; Lagiou, Pagona; Jenab, Mazda; Trichopoulou, Antonia; Fedirko, Veronika; Aleksandrova, Krasimira; Pischon, Tobias; Overvad, Kim; Olsen, Anja; Tjønneland, Anne; Boutron-Ruault, Marie-Christine; Fagherazzi, Guy; Racine, Antoine; Kuhn, Tilman; Boeing, Heiner; Floegel, Anna; Benetou, Vasiliki; Palli, Domenico; Grioni, Sara; Panico, Salvatore; Tumino, Rosario; Vineis, Paolo; Bueno-de-Mesquita, H B; Dik, Vincent K; Bhoo-Pathy, Nirmala; Uiterwaal, Cuno S P M; Weiderpass, Elisabete; Lund, Eiliv; Quirós, J Ramón; Zamora-Ros, Raul; Molina-Montes, Esther; Chirlaque, Maria-Dolores; Ardanaz, Eva; Dorronsoro, Miren; Lindkvist, Björn; Wallström, Peter; Nilsson, Lena Maria; Sund, Malin; Khaw, Kay-Tee; Wareham, Nick; Bradbury, Kathryn E; Travis, Ruth C; Ferrari, Pietro; Duarte-Salles, Talita; Stepien, Magdalena; Gunter, Marc; Murphy, Neil; Riboli, Elio; Trichopoulos, Dimitrios

    2015-04-15

    Inverse associations of coffee and/or tea in relation to hepatocellular carcinoma (HCC) risk have been consistently identified in studies conducted mostly in Asia where consumption patterns of such beverages differ from Europe. In the European Prospective Investigation into Cancer and nutrition (EPIC), we identified 201 HCC cases among 486,799 men/women, after a median follow-up of 11 years. We calculated adjusted hazard ratios (HRs) for HCC incidence in relation to quintiles/categories of coffee/tea intakes. We found that increased coffee and tea intakes were consistently associated with lower HCC risk. The inverse associations were substantial, monotonic and statistically significant. Coffee consumers in the highest compared to the lowest quintile had lower HCC risk by 72% [HR: 0.28; 95% confidence intervals (CIs): 0.16-0.50, p-trend < 0.001]. The corresponding association of tea with HCC risk was 0.41 (95% CI: 0.22-0.78, p-trend = 0.003). There was no compelling evidence of heterogeneity of these associations across strata of important HCC risk factors, including hepatitis B or hepatitis C status (available in a nested case-control study). The inverse, monotonic associations of coffee intake with HCC were apparent for caffeinated (p-trend = 0.009), but not decaffeinated (p-trend = 0.45) coffee for which, however, data were available for a fraction of subjects. Results from this multicentre, European cohort study strengthen the existing evidence regarding the inverse association between coffee/tea and HCC risk. Given the apparent lack of heterogeneity of these associations by HCC risk factors and that coffee/tea are universal exposures, our results could have important implications for high HCC risk subjects. PMID:25219573

  13. Influence of conjunctive use of coffee effluent and fresh water on performance of robusta coffee and soil properties.

    PubMed

    Salakinkop, S R; Shivaprasad, P

    2012-01-01

    A field experiment was conducted to study the influence of treated coffee effluent irrigation on performance of established robusta coffee, nutrient contribution and microbial activities in the soil. The results revealed that the field irrigated with coffee effluent from aerobic tank having COD of 1009 ppm, did not affect the yield of clean coffee (1309 kg/ha) and it was statistically similar (on par) with the plots irrigated with fresh water (1310 kg/ha) with respect to clean coffee yield. Effluent irrigation increased significantly the population bacteria, yeast, fungi, actinomycetes and PSB (122, 52, 12, 34 and 6 x 104/g respectively)) in the soil compared to the soil irrigated with fresh water (87, 22, 5, 24 and 2 x 10(4)/g respectively). The organic carbon (2.60%), available nutrients in the soil like P (57.2 kg/ha), K (401.6 kg/ha, Ca (695.3 ppm), S (5.3 ppm),Cu (4.09 ppm) and Zn(4.78 ppm) were also increased due to effluent irrigation compared to fresh water irrigation. Thus analysis of coffee effluent for major and minor plant nutrients content revealed its potential as source of nutrients and water for plant growth. PMID:23741860

  14. Supercritical fluid extraction from spent coffee grounds and coffee husks: antioxidant activity and effect of operational variables on extract composition.

    PubMed

    Andrade, Kátia S; Gonçalvez, Ricardo T; Maraschin, Marcelo; Ribeiro-do-Valle, Rosa Maria; Martínez, Julian; Ferreira, Sandra R S

    2012-01-15

    The present study describes the chemical composition and the antioxidant activity of spent coffee grounds and coffee husks extracts, obtained by supercritical fluid extraction (SFE) with CO(2) and with CO(2) and co-solvent. In order to evaluate the high pressure method in terms of process yield, extract composition and antioxidant activity, low pressure methods, such as ultrasound (UE) and soxhlet (SOX) with different organic solvents, were also applied to obtain the extracts. The conditions for the SFE were: temperatures of 313.15K, 323.15K and 333.15K and pressures from 100 bar to 300 bar. The SFE kinetics and the mathematical modeling of the overall extraction curves (OEC) were also investigated. The extracts obtained by LPE (low pressure extraction) with ethanol showed the best results for the global extraction yield (X(0)) when compared to SFE results. The best extraction yield was 15±2% for spent coffee grounds with ethanol and 3.1±04% for coffee husks. The antioxidant potential was evaluated by DPPH method, ABTS method and Folin-Ciocalteau method. The best antioxidant activity was showed by coffee husk extracts obtained by LPE. The quantification and the identification of the extracts were accomplished using HPLC analysis. The main compounds identified were caffeine and chlorogenic acid for the supercritical extracts from coffee husks. PMID:22265539

  15. Development and validation of a matrix solid-phase dispersion method to determine acrylamide in coffee and coffee substitutes.

    PubMed

    Soares, Cristina M Dias; Alves, Rita C; Casal, Susana; Oliveira, M Beatriz P P; Fernandes, José Oliveira

    2010-04-01

    The present study describes the development and validation of a new method based on a matrix solid-phase dispersion (MSPD) sample preparation procedure followed by GC-MS for determination of acrylamide levels in coffee (ground coffee and brewed coffee) and coffee substitute samples. Samples were dispersed in C(18) sorbent and the mixture was further packed into a preconditioned custom-made ISOLUTE bilayered SPE column (C(18)/Multimode; 1 g + 1 g). Acrylamide was subsequently eluted with water, and then derivatized with bromine and quantified by GC-MS in SIM mode. The MSPD/GC-MS method presented a LOD of 5 microg/kg and a LOQ of 10 microg/kg. Intra and interday precisions ranged from 2% to 4% and 4% to 10%, respectively. To evaluate the performance of the method, 11 samples of ground and brewed coffee and coffee substitutes were simultaneously analyzed by the developed method and also by a previously validated method based in a liquid-extraction (LE) procedure, and the results were compared showing a high correlation between them. PMID:20492315

  16. Coffee, Decaffeinated Coffee, Caffeine, and Tea Consumption in Young Adulthood and Atherosclerosis Later in Life: The CARDIA Study

    PubMed Central

    Reis, Jared P.; Loria, Catherine M.; Steffen, Lyn M; Zhou, Xia; van Horn, Linda; Siscovick, David S.; Jacobs, David R.; Carr, J. Jeffrey

    2010-01-01

    Objective Determine the association of coffee, decaffeinated coffee, caffeine, and tea consumption in young adulthood with the presence and progression of coronary artery calcified (CAC) plaque and carotid intima-media thickness (cIMT) later in life. Methods and Results CARDIA is a cohort of 5115 white and black adults who were 18–30 years when they completed a baseline clinic examination in 1985–1986. Subsequent examinations were conducted 2, 5, 7, 10, 15, and 20 years later. After multivariable adjustment, no association was observed between average coffee, decaffeinated coffee, or caffeine consumption (years 0 and 7) and presence of CAC [score >0 Agatston units (AU) at year 15 or 20], CAC progression (incident CAC at year 20 or an increase in CAC score ≥20 AU), or high cIMT (>80th percentile, year 20). Tea consumption, however, displayed a non-significant trend for an inverse association with CAC (ptrend0.08) and an inverse association with CAC progression (ptrend0.04), but no association with high cIMT (ptrend>0.2). Stratification of the coffee analyses by sex, race, or smoking yielded similar non-significant patterns. Conclusion We observed no substantial association between coffee or caffeine intake and coronary and carotid atherosclerosis. However, our results suggested an inverse association between tea and CAC, but not carotid atherosclerosis. PMID:20616310

  17. COD and BOD reduction from coffee processing wastewater using Avacado peel carbon.

    PubMed

    Devi, Rani; Singh, Vijender; Kumar, Ashok

    2008-04-01

    The aim of this study was the assessment of reduction of chemical oxygen demand (COD) and biological oxygen demand (BOD) of wastewater from coffee processing plant using activated carbon made up of Avacado Peels. The complete study was done in batch mode to investigate the effect of operating parameters. The results of the COD and BOD concentration reduction with avocado peel carbon (APC) and commercial activated carbon (CAC) were compared and optimum operating conditions were determined for maximum reduction. Adsorption isotherm was also studied besides the calculation of optimum treatment parameters for maximum reduction of COD and BOD concentration from effluent of the coffee processing plant. The maximum percentage reduction of COD and BOD concentration under optimum operating conditions using APC was 98.20% and 99.18% respectively and with CAC this reduction was 99.02% and 99.35% respectively. As the adsorption capacity of APC is comparable with that of CAC for reduction of COD and BOD concentration, it could be a lucrative technique for treatment of domestic wastewater generated in decentralized sectors. PMID:17493806

  18. Fast method of elements determination in slim coffees by ICP OES.

    PubMed

    Szymczycha-Madeja, Anna; Welna, Maja; Pohl, Pawel

    2014-03-01

    Six sample preparation procedures, i.e., the total decomposition in a HNO3 and H2O2 mixture by microwave-assisted or hot-plate heating, a partial decomposition by means of solubilisation in aqua regia or tetramethyl ammonium hydroxide and simple dissolution in diluted HNO3 or in H2O, for the determination of the total content of Ba, Ca, Cd, Cr, Cu, Fe, Mg, Mn, Ni, P, Pb, Sr and Zn in slim instant coffees using inductively coupled plasma optical emission spectrometry were compared. The performance of procedures was determined based on the precision and the accuracy of results and limits of detection of elements. It was found that the extraction with aqua regia provides the best results, i.e., limits of detection of elements within 0.11-108ngmL(-1), the precision of 0.6-5% and the accuracy better than 5%. Elements' concentrations agree with those after the wet digestion in the HNO3 and H2O2 mixture, therefore this procedure is a simple and fast alternative to complete sample decomposition procedures and can be easily applied for routine analyses. Six commercial slim coffee products were analysed with the proposed procedure. PMID:24176335

  19. 75 FR 7471 - Chandra Coffee and Rabun Boatworks, Complainants v. Georgia Power Company, Respondent; Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-19

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Chandra Coffee and Rabun Boatworks, Complainants v. Georgia Power Company... January 8, 2010, Chandra Coffee and Rabun Boatworks (Complainants) filed with the Federal...

  20. NIH study finds that coffee drinkers have lower risk of death

    Cancer.gov

    Older adults who drank coffee -- caffeinated or decaffeinated -- had a lower risk of death overall than others who did not drink coffee, according a study by researchers from the National Cancer Institute (NCI), part of the National Institutes of Health,

  1. [Comparison of green coffee beans volatiles chemical composition of Hainan main area].

    PubMed

    Hu, Rong-Suo; Chu, Zhong; Gu, Feng-Lin; Lu, Min-Quan; Lu, Shao-Fang; Wu, Gui-Ping; Tan, Le-He

    2013-02-01

    Chemical component of Hainan green coffee beans was analyzed with solid phase microextraction-gas chromatography-mass spectrometry, and the discrepancy between two green coffee beans was differentiated through the spectrum database retrieval and retention index of compound characterization. The experimental results show that: the chemical composition of Wanning coffee beans and Chengmai coffee beans is basically the same. The quantity of analyzed compound in Wanning area coffee is 91, and in Chengmai area coffee is 106, the quantity of the same compound is 66, and the percent of the same component is 75.52%. The same compounds accounted for 89.86% of the total content of Wanning area coffee, and accounted for 85.70% of the total content of Chengmai area coffee. PMID:23697152

  2. Method development for the determination of manganese, cobalt and copper in green coffee comparing direct solid sampling electrothermal atomic absorption spectrometry and inductively coupled plasma optical emission spectrometry.

    PubMed

    Oleszczuk, Nédio; Castro, Jacira T; da Silva, Márcia M; Korn, Maria das Graças A; Welz, Bernhard; Vale, Maria Goreti R

    2007-10-31

    A method has been developed for the determination of cobalt, copper and manganese in green coffee using direct solid sampling electrothermal atomic absorption spectrometry (SS-ET AAS). The motivation for the study was that only a few elements might be suitable to determine the origin of green coffee so that the multi-element techniques usually applied for this purpose might not be necessary. The three elements have been chosen as test elements as they were found to be significant in previous investigations. A number of botanical certified reference materials (CRM) and pre-analyzed samples of green coffee have been used for method validation, and inductively coupled plasma optical emission spectrometry (ICP OES) after microwave-assisted acid digestion of the samples as reference method. Calibration against aqueous standards could be used for the determination of Mn and Co by SS-ET AAS, but calibration against solid CRM was necessary for the determination of Cu. No significant difference was found between the results obtained with the proposed method and certified or independently determined values. The limits of detection for Mn, Cu and Co were 0.012, 0.006 and 0.004mugg(-1) using SS-ET AAS and 0.015, 0.13 and 0.10mugg(-1) using ICP OES. Seven samples of Brazilian green coffee have been analyzed, and there was no significant difference between the values obtained with SS-ET AAS and ICP OES for Mn and Cu. ICP OES could not be used as a reference method for Co, as essentially all values were below the limit of quantification of this technique. PMID:19073113

  3. Commercial Crew

    NASA Video Gallery

    Phil McAlister delivers a presentation by the Commercial Crew (CC) study team on May 25, 2010, at the NASA Exploration Enterprise Workshop held in Galveston, TX. The purpose of this workshop was to...

  4. A chemometric approach toward the detection and quantification of coffee adulteration by solid-phase microextraction using polymeric ionic liquid sorbent coatings.

    PubMed

    Toledo, Bruna R; Hantao, Leandro W; Ho, Tien D; Augusto, Fabio; Anderson, Jared L

    2014-06-13

    Solid-phase microextraction (SPME) using cross-linked polymeric ionic liquid (PIL)-based sorbent coatings was used to extract volatile aroma-related compounds from coffee samples. Several PIL-based coatings were screened alongside a commercial poly(acrylate) (PA) SPME coating. The best performing PIL-based SPME fiber, poly(1-vinyl-3-hexadecylimidazolium bis[(trifluoromethyl)sulfonylimide]) with 50% (w/w) 1,12-di(3-vinylbenzylimidazolium)dodecane dibis[(trifluoromethyl)sulfonyl]imide incorporated cross-linker, was used to isolate the volatile fraction of Arabica coffee. To illustrate the importance of trace analyte isolation, a method for the detection and quantification of coffee adulteration is described. Chromatographic profiles obtained by gas chromatography/mass spectrometry (GC/MS) were used to create the chemometric model. Partial least squares (PLS) regression was employed to correlate the aroma-related chemical fingerprint to the degree of adulteration. The proposed method successfully detected fraud down to 1% (w/w) of adulterant and accurately determined the degree of coffee adulteration (i.e, root mean square error of calibration and prediction of 0.54% and 0.83% (w/w), respectively). Finally, important aroma-related compounds including furans, methoxyphenols, pyrazines, and ketones were identified. PMID:24786655

  5. The Brazilian continental margin

    NASA Astrophysics Data System (ADS)

    Martins, L. R.; Coutinho, P. N.

    1981-04-01

    The Brazilian continental margin, with its interesting morphology, structure and sediments, has become better known only during the last two decades. Six physiographical provinces can be recognized at the continental margin and the adjacent coast: (1) Cabo Orange-Parnaiba delta; (2) Parnaiba delta-Cabo Sa˜o Roque; (3) Cabo Sa˜o Roque-Belmonte; (4) Belmonte-Cabo Frio; (5) Cabo Frio-Cabo Santa Marta; and (6) Cabo Santa Marta-Chui. The shelf is rather wide near the Amazon Mouth, becoming narrower eastwards, continuing very narrow along the northeastern and eastern coast, and becoming wider again in the south towards the Plate River. Prominent morphological features along the margin are the Amazon cone, the marginal plateaus off northeastern Brazil, the Sa˜o Francisco cone and canyon, the Abrolhos Bank, and the deep-sea plateaus of Pernambuco and Sa˜o Paulo. On the shelf proper a number of relief elements exist, such as sand waves east of the Amazon, submarine terraces at various places, and irregularities of structural origin. The shelf break is rather smooth in the far north and south, more abrupt in the remainder. Surface sediments of the Brazilian shelf show five distinct facies types: littoral quartz sands, mud, transition sand-mud, coralline algae, and biodetrital. The terrigenous elastic fractions dominate off the Amazon and in southern Brazil; between these areas they occupy a very narrow strip near the coast. The carbonate facies, predominantly composed of calcareous algae, is abundant between the Parnaiba delta and Cabo Frio; to the south this facies is more biodetrital and restricted to the outer shelf. Economically important on the Brazilian continental margin besides oil, are sands and gravels, carbonate deposits, evaporites and some subsurface coal. Other possible mineral resources could be phosphate, heavy minerals and clays for ceramics.

  6. Space Commercialization

    NASA Technical Reports Server (NTRS)

    Martin, Gary L.

    2011-01-01

    A robust and competitive commercial space sector is vital to continued progress in space. The United States is committed to encouraging and facilitating the growth of a U.S. commercial space sector that supports U.S. needs, is globally competitive, and advances U.S. leadership in the generation of new markets and innovation-driven entrepreneurship. Energize competitive domestic industries to participate in global markets and advance the development of: satellite manufacturing; satellite-based services; space launch; terrestrial applications; and increased entrepreneurship. Purchase and use commercial space capabilities and services to the maximum practical extent Actively explore the use of inventive, nontraditional arrangements for acquiring commercial space goods and services to meet United States Government requirements, including measures such as public-private partnerships, . Refrain from conducting United States Government space activities that preclude, discourage, or compete with U.S. commercial space activities. Pursue potential opportunities for transferring routine, operational space functions to the commercial space sector where beneficial and cost-effective.

  7. Climatic factors directly impact the volatile organic compound fingerprint in green Arabica coffee bean as well as coffee beverage quality.

    PubMed

    Bertrand, B; Boulanger, R; Dussert, S; Ribeyre, F; Berthiot, L; Descroix, F; Joët, T

    2012-12-15

    Coffee grown at high elevations fetches a better price than that grown in lowland regions. This study was aimed at determining whether climatic conditions during bean development affected sensory perception of the coffee beverage and combinations of volatile compounds in green coffee. Green coffee samples from 16 plots representative of the broad range of climatic variations in Réunion Island were compared by sensory analysis. Volatiles were extracted by solid phase micro-extraction and the volatile compounds were analysed by GC-MS. The results revealed that, among the climatic factors, the mean air temperature during seed development greatly influenced the sensory profile. Positive quality attributes such as acidity, fruity character and flavour quality were correlated and typical of coffees produced at cool climates. Two volatile compounds (ethanal and acetone) were identified as indicators of these cool temperatures. Among detected volatiles, most of the alcohols, aldehydes, hydrocarbons and ketones appeared to be positively linked to elevated temperatures and high solar radiation, while the sensory profiles displayed major defects (i.e. green, earthy flavour). Two alcohols (butan-1,3-diol and butan-2,3-diol) were closely correlated with a reduction in aromatic quality, acidity and an increase in earthy and green flavours. We assumed that high temperatures induce accumulation of these compounds in green coffee, and would be detected as off-flavours, even after roasting. Climate change, which generally involves a substantial increase in average temperatures in mountainous tropical regions, could be expected to have a negative impact on coffee quality. PMID:22980845

  8. Land use change on coffee farms in southern Guatemala and its environmental consequences.

    PubMed

    Haggar, Jeremy; Medina, Byron; Aguilar, Rosa Maria; Munoz, Claudia

    2013-04-01

    Changes in commodity prices, such as the fall in coffee prices from 2000 to 2004, affect land use decisions on farms, and the environmental services they provide. A survey of 50 farms showed a 35% loss in the area under coffee between 2000 and 2004 below 700 m with the majority of this area (64 %) being coffee agroforest systems that included native forest species. Loss of coffee only occurred on large and medium-scale farms; there was no change in area on cooperatives. Coffee productivity declined below 1,100 m altitude for sun and Inga shade coffee, but only below 700 m altitude for agroforest coffee. Coffee productivity was 37-53% lower under agroforests than other systems. Increases in rubber and pasture were related to low altitude large-scale farms, and bananas and timber plantations to mid-altitude farms. Average aboveground carbon stocks for coffee agroforests of 39 t C ha(-1) was similar to rubber plantations, but one-third to one half that of natural forest and timber plantations, respectively. Coffee agroforests had the highest native tree diversity of the productive systems (7-12 species ha(-1)) but lower than natural forest (31 species ha(-1)). Conversion of coffee agroforest to other land uses always led to a reduction in the quality of habitat for native biodiversity, especially avian, but was concentrated among certain farm types. Sustaining coffee agroforests for biodiversity conservation would require targeted interventions such as direct payments or market incentives specifically for biodiversity. PMID:23435611

  9. A predator of the coffee berry borer: is it present in your country?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recently, the predatory thrips Karnyothrips flavipes (Thysanoptera: Phlaeothripidae) was reported in Kenya as a predator of coffee berry borer eggs and larvae. The 1-2 mm long thrips enters the hole bored by the coffee berry borer (Hypothenemus hampei; Coleoptera: Curculionidae) on the coffee berry,...

  10. On the eyes of the coffee berry borer as rudimentary organs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei, is the most damaging insect pest of coffee worldwide. Females bore into the coffee berries and deposit eggs within galleries in the endosperm, with a 10:1 sex ratio favoring females. There is sibling mating followed by females exiting the berry, while mal...

  11. Developing Single Nucleotide Polymorphism markers for the identification of Coffee germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee is one of the most widely consumed beverages that represent a multibillion dollar global industry. Accurate identification of coffee cultivars is essential for efficient management, exchange and use of coffee genetic resources. So far a universal platform that can allow data comparison across...

  12. Evaluating bee (Hymenoptera: Apoidea) diversity using malaise traps in coffee landscapes of Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Even though Arabica coffee (Coffea arabica Linnaeus, Rubiaceae) can self-pollinate, bees are important pollinators, without which there is lower fruit quality and yield. We studied bee diversity in coffee agroecosystems in Costa Rica during two coffee flowering seasons (2005 and 2006). Malaise traps...

  13. Acute Effect of Decaffeinated Coffee on Heart Rate, Blood Pressure, and Exercise Performance in Healthy Subjects

    PubMed Central

    Prakash, Ravi; Kaushik, Vidya S.

    1988-01-01

    The effect of decaffeinated coffee on the cardiovascular exercise performance in nine healthy volunteers was evaluated in a double-blind randomized fashion. The heart rate, blood pressure, and duration of exercise were unchanged, and no arrhythmias or ischemic changes were seen on the electrocardiogram after drinking decaffeinated coffee. It was concluded that decaffeinated coffee has no discernible, acute, adverse cardiovascular effects. PMID:3339645

  14. Land Use Change on Coffee Farms in Southern Guatemala and its Environmental Consequences

    NASA Astrophysics Data System (ADS)

    Haggar, Jeremy; Medina, Byron; Aguilar, Rosa Maria; Munoz, Claudia

    2013-04-01

    Changes in commodity prices, such as the fall in coffee prices from 2000 to 2004, affect land use decisions on farms, and the environmental services they provide. A survey of 50 farms showed a 35 % loss in the area under coffee between 2000 and 2004 below 700 m with the majority of this area (64 %) being coffee agroforest systems that included native forest species. Loss of coffee only occurred on large and medium-scale farms; there was no change in area on cooperatives. Coffee productivity declined below 1,100 m altitude for sun and Inga shade coffee, but only below 700 m altitude for agroforest coffee. Coffee productivity was 37-53 % lower under agroforests than other systems. Increases in rubber and pasture were related to low altitude large-scale farms, and bananas and timber plantations to mid-altitude farms. Average aboveground carbon stocks for coffee agroforests of 39 t C ha-1 was similar to rubber plantations, but one-third to one half that of natural forest and timber plantations, respectively. Coffee agroforests had the highest native tree diversity of the productive systems (7-12 species ha-1) but lower than natural forest (31 species ha-1). Conversion of coffee agroforest to other land uses always led to a reduction in the quality of habitat for native biodiversity, especially avian, but was concentrated among certain farm types. Sustaining coffee agroforests for biodiversity conservation would require targeted interventions such as direct payments or market incentives specifically for biodiversity.

  15. Potential antioxidant response to coffee - A matter of genotype?

    PubMed

    Hassmann, Ute; Haupt, Larisa M; Smith, Robert A; Winkler, Swantje; Bytof, Gerhard; Lantz, Ingo; Griffiths, Lyn R; Marko, Doris

    2014-12-01

    In a human intervention study, coffee combining natural green coffee bean constituents and dark roast products was identified as a genotype-dependent inducer of the Nrf2/ARE pathway, significantly affecting Nrf2 gene expression and downstream GST1A1 and UGT1A1 gene transcription. The observed transcriptional changes correlated with the presence of specific Nrf2 genotypes suggesting their influence on both Nrf2 and subsequent ARE-dependent GST1A1 and UGT1A1 transcription. While the presence of the - 653 SNP seems to be advantageous, resulting in higher Nrf2, GST1A1 and UGT1A1 gene transcription following coffee consumption, in contrast, the presence of the - 651 SNP significantly down-regulated the response to the study coffee. Furthermore, the presence of the B/B genotype in GST1A1 along with the frequency of the [TA]6/6 and [TA]7/7 polymorphisms in UGT1A1 appeared to significantly increase sensitivity toward coffee-induced gene transcription. This data suggests that when examining the role of the Nrf2/ARE pathway in the regulation of antioxidative and chemopreventive phase II efficacy, individual genotypes should be included when considering the potency of bioactive food/food constituents and their therapeutic potential. PMID:25606436

  16. Evolution of robusta green coffee redox enzymatic activities with maturation.

    PubMed

    Montavon, Philippe; Bortlik, Karlheinz

    2004-06-01

    Oxidation reactions in coffee involve redox-sensitive polyphenols and appear to control the fragmentation of coffee storage proteins both in solution and during roasting. Coffee-specific nitrogenous flavor precursors may derive from this process. Accordingly, data converge to suggest that the redox status of the green bean before roasting might control the development of subsequent redox reactions during roasting. Consequently, we decided to identify biological events that may trigger or prevent oxidation during maturation of the coffee cherry and set the final redox status of the green bean. In a previous study, we observed that the sensitivity of green coffee to oxidative processes decreased along maturation. By using the very same samples originating from open-pollinated Robusta clones, we followed the activity of three essential redox enzymes: catalase (CAT), peroxidase (POD) and polyphenoloxidase (PPO). While CAT and POD activities increased with maturation, PPO activities decreased. Thanks to the identification of an atypical immature subclass, it appeared that CAT might be an essential factor in setting the final redox status of the green bean before the roasting event. PMID:15161235

  17. Transfer of ochratoxin A into tea and coffee beverages.

    PubMed

    Malir, Frantisek; Ostry, Vladimir; Pfohl-Leszkowicz, Annie; Toman, Jakub; Bazin, Ingrid; Roubal, Tomas

    2014-01-01

    Ochratoxin A (OTA) is nephrotoxic, hepatotoxic, immunotoxic, neurotoxic, reprotoxic, teratogenic, and carcinogenic (group 2B), being characterized by species and sex differences in sensitivity. Despite the fact that OTA is in some aspects a controversial topic, OTA is the most powerful renal carcinogen. The aim of this study was to make a small survey concerning OTA content in black tea, fruit tea, and ground roasted coffee, and to assess OTA transfer into beverages. OTA content was measured using a validated and accredited HPLC-FLD method with a limit of quantification (LOQ) of 0.35 ng/g. The OTA amount ranged from LOQ up to 250 ng/g in black tea and up to 104 ng/g in fruit tea. Black tea and fruit tea, naturally contaminated, were used to prepare tea infusions. The transfer from black tea to the infusion was 34.8% ± 1.3% and from fruit tea 4.1% ± 0.2%. Ground roasted coffee naturally contaminated at 0.92 ng/g was used to prepare seven kinds of coffee beverages. Depending on the type of process used, OTA transfer into coffee ranged from 22.3% to 66.1%. OTA intakes from fruit and black tea or coffee represent a non-negligible human source. PMID:25525684

  18. Daily intake of trace metals through coffee consumption in India.

    PubMed

    Suseela, B; Bhalke, S; Kumar, A V; Tripathi, R M; Sastry, V N

    2001-02-01

    The trace element contents of five varieties of instant coffee powder available in the Indian market have been analysed. Ca, Cr, Fe, K, Mg, Mn, Ni, Sr, Zn and Pb, Cd, Cu have been determined using atomic absorption spectrophotometry and differential pulse anodic stripping voltammetry, respectively. The metal levels in the coffee powders observed in this study are comparable with those reported for green coffe beans (Arabica and Robusta variety) reported worldwide with the exception of Sr and Zn, which were on the lower side of the reported values. Concentrations of these metals have been converted into intake figures based on coffee consumption. The daily intakes of the above metals through ingestion of coffee are 1.4 mg, 1.58 microg, 124 microg, 41.5 mg, 4.9 mg, 17.9 microg, 2.9 microg, 3.8 microg, 12.5 microg, 0.2 microg, 0.03 microg and 15.5 microg, respectively. The values, which were compared with the total dietary, intake of metals through ingestion by the Mumbai population, indicate that the contribution from coffee is less than or around 1% for most of the elements except for Cr and Ni which are around 3%. PMID:11288908

  19. Characterization and Spectral Monitoring of Coffee Lands in Brazil

    NASA Astrophysics Data System (ADS)

    Alves, H. M. R.; Volpato, M. M. L.; Vieira, T. G. C.; Maciel, D. A.; Gonçalves, T. G.; Dantas, M. F.

    2016-06-01

    In Brazil, coffee production has great economic and social importance. Despite this fact, there is still a shortage of information regarding its spatial distribution, crop management and environment. The aim of this study was to carry out spectral monitoring of coffee lands and to characterize their environments using geotechnologies. Coffee fields with contiguous areas over 0.01 km2 within a 488.5 km2 region in the south of Minas Gerais state were selected for the study. Spectral data from the sensors OLI/Landsat 8 and the Shuttle Radar Topography Mission from 2014 to 2015 were obtained, as well as information on production areas, surface temperature, vegetation indexes, altitude and slope, were gathered and analyzed. The results indicate that there is great variation in the NDVI and NDWI values, with means ranging from 0.21 to 0.91 (NDVI) and 0.108 to 0.543 (NDWI). The altitude ranged from 803 to 1150 m, and the surface temperature from 20.9°C to 27.6°C. The altitude and the surface temperature distribution patterns were correlated with the vegetation indexes. The slope classes were very homogeneous, predominantly with declivities between 8 to 20 %, characterized as wavy relief. This study made possible the characterization and monitoring of coffee lands and its results may be instrumental in decision-making processes related to coffee management.

  20. Transfer of Ochratoxin A into Tea and Coffee Beverages

    PubMed Central

    Malir, Frantisek; Ostry, Vladimir; Pfohl-Leszkowicz, Annie; Toman, Jakub; Bazin, Ingrid; Roubal, Tomas

    2014-01-01

    Ochratoxin A (OTA) is nephrotoxic, hepatotoxic, immunotoxic, neurotoxic, reprotoxic, teratogenic, and carcinogenic (group 2B), being characterized by species and sex differences in sensitivity. Despite the fact that OTA is in some aspects a controversial topic, OTA is the most powerful renal carcinogen. The aim of this study was to make a small survey concerning OTA content in black tea, fruit tea, and ground roasted coffee, and to assess OTA transfer into beverages. OTA content was measured using a validated and accredited HPLC-FLD method with a limit of quantification (LOQ) of 0.35 ng/g. The OTA amount ranged from LOQ up to 250 ng/g in black tea and up to 104 ng/g in fruit tea. Black tea and fruit tea, naturally contaminated, were used to prepare tea infusions. The transfer from black tea to the infusion was 34.8% ± 1.3% and from fruit tea 4.1% ± 0.2%. Ground roasted coffee naturally contaminated at 0.92 ng/g was used to prepare seven kinds of coffee beverages. Depending on the type of process used, OTA transfer into coffee ranged from 22.3% to 66.1%. OTA intakes from fruit and black tea or coffee represent a non-negligible human source. PMID:25525684

  1. Influence of roasting levels on ochratoxin a content in coffee.

    PubMed

    Romani, Santina; Pinnavaia, Gian Gaetano; Dalla Rosa, Marco

    2003-08-13

    Because of inconsistent and contradictory results from investigations concerning the influence of roasting process on the ochratoxin A content in coffee beans, a study was undertaken to assess the elimination of ochratoxin A during the roasting process. Four different green coffee samples, naturally contaminated with ochratoxin A, were submitted to different roasting conditions (light, medium, and dark) and analyzed for roasting parameters (weight loss, color change, density, and moisture content) and ochratoxin A content. The ochratoxin A content of green coffee was reduced by the roasting process; in particular, consistently high percentages of ochratoxin A reduction were found in the highest contaminated samples. This reduction was influenced by the severity of the thermal process and was generally related to the initial ochratoxin A content. Samples obtained with roasting parameters suitable for a typical Italian espresso coffee brew showed reductions of >90% in the ochratoxin A content, in both high and low contaminated samples. Moreover, the presence of off-flavors and visual defects was not found to be directly related to the ochratoxin A content in the green coffee samples. PMID:12903986

  2. Characterization of galactomannan derivatives in roasted coffee beverages.

    PubMed

    Nunes, Fernando M; Reis, Ana; Domingues, M Rosário M; Coimbra, Manuel A

    2006-05-01

    In this work, the galactomannans from roasted coffee infusions were purified by 50% ethanol precipitation, anion exchange chromatography, and phenylboronic acid-immobilized Sepharose chromatography. Specific enzymatic hydrolysis of the beta-(1-->4)-D-mannan backbone allowed us to conclude that the galactomannans of roasted coffee infusions are high molecular weight supports of low molecular weight brown compounds. Also, the molecular weight of the brown compounds linked to the galactomannan increases with the increase of the coffee degree of roast. The reaction pathways of galactomannans during the coffee roasting process were inferred from the detection of specific chemical markers by gas chromatography-electron impact mass spectrometry and/or electrospray ionization tandem mass spectrometry. Maillard reaction, caramelization, isomerization, oxidation, and decarboxylation pathways were identified by detection of Amadori compounds, 1,6-beta-anhydromannose, fructose, glucose, mannonic acid, 2-ketogluconic acid, and arabinonic acid in the reducing end of the obtained oligosaccharides. The implication of the several competitive reaction pathways is discussed and related to the structural changes of the galactomannans present in the roasted coffee infusions. PMID:16637704

  3. Coffee and gastric cancer: systematic review and meta-analysis.

    PubMed

    Botelho, Francisco; Lunet, Nuno; Barros, Henrique

    2006-05-01

    We systematically reviewed the literature on the association between coffee consumption and gastric cancer and performed a meta-analysis of the results. Published cohort and case-control studies were identified in PubMed and reference lists. Random effects meta-analysis was used to pool effects from 23 studies, and heterogeneity was explored by stratification and meta-regression. The odds ratio (OR) for the overall association between coffee and gastric cancer (highest vs. lowest category of exposure) was 0.97 (95%CI: 0.86-1.09), similar for cohort (OR = 1.02; 95%CI: 0.76-1.37) and case-control studies (population-based: OR = 0.90; 95%CI: 0.70-1.15; hospital-based: OR = 0.97; 95%CI: 0.83-1.13). The OR was 1.26 (95%CI: 1.02-1.57) when considering five studies conducted in the USA, 0.97 (95%CI: 0.82-1.14) for the five Japanese studies, 0.98 (95%CI: 0.81-1.17) for the six studies from Europe, and 0.64 (95%CI: 0.47-0.86) for the two studies from South America. In this meta-analysis we found no adverse effect of coffee associated with gastric cancer. Knowledge on the level of exposure to different coffee constituents may provide a deeper understanding of this reassuring result and the real role of coffee on cancer risk. PMID:16680342

  4. Potential antioxidant response to coffee — A matter of genotype?

    PubMed Central

    Hassmann, Ute; Haupt, Larisa M.; Smith, Robert A.; Winkler, Swantje; Bytof, Gerhard; Lantz, Ingo; Griffiths, Lyn R.; Marko, Doris

    2014-01-01

    In a human intervention study, coffee combining natural green coffee bean constituents and dark roast products was identified as a genotype-dependent inducer of the Nrf2/ARE pathway, significantly affecting Nrf2 gene expression and downstream GST1A1 and UGT1A1 gene transcription. The observed transcriptional changes correlated with the presence of specific Nrf2 genotypes suggesting their influence on both Nrf2 and subsequent ARE-dependent GST1A1 and UGT1A1 transcription. While the presence of the − 653 SNP seems to be advantageous, resulting in higher Nrf2, GST1A1 and UGT1A1 gene transcription following coffee consumption, in contrast, the presence of the − 651 SNP significantly down-regulated the response to the study coffee. Furthermore, the presence of the B/B genotype in GST1A1 along with the frequency of the [TA]6/6 and [TA]7/7 polymorphisms in UGT1A1 appeared to significantly increase sensitivity toward coffee-induced gene transcription. This data suggests that when examining the role of the Nrf2/ARE pathway in the regulation of antioxidative and chemopreventive phase II efficacy, individual genotypes should be included when considering the potency of bioactive food/food constituents and their therapeutic potential. PMID:25606436

  5. New biological properties of coffee melanoidins.

    PubMed

    Argirova, Mariana D; Stefanova, Iliyana D; Krustev, Athanas D

    2013-08-01

    Water-soluble melanoidins isolated from roasted coffee induced ex vivo changes in the bioelectric and contractile activity of rat circular gastric smooth muscle tissues. They provoked a depolarization of smooth muscle cellular membranes and an increase in Ca²⁺-influx as evidenced by the increase in the frequency and amplitude of Ca²⁺-generated spike potentials. In the presence of 1 × 10⁻⁶ mol L⁻¹ acetylcholine and 1 × 10⁻⁶ mol L⁻¹ arecoline the melanoidin-evoked contraction was significantly reduced. M-cholinergic receptor blocking agents atropine, ipratropium, pirenzepine, and 4-DAMP also significantly reduced the melanoidin-provoked contraction. Nonspecific N-cholinergic receptor blockers hexamethonium and decamethonium (1 × 10⁻⁵ mol L⁻¹ each) did not influence the melanoidin-induced mechanical reaction. The melanoidins did not affect the strength of contractions evoked by adrenaline and dopamine (1 × 10⁻⁶ mol L⁻¹ each). The results obtained support the assumption that melanoidin-evoked contraction is a result of activation of muscarinic-type cholinergic receptors. PMID:23712216

  6. Brazilian Nanotechnology Initiative

    NASA Astrophysics Data System (ADS)

    Fazzio, Adalberto

    2015-03-01

    In Brazil there is intense research activity in nanotechnology, most of these developed in universities and research institutes. The Brazilian Nanotechnology Initiative (BNI) aims to integrate government actions to promote the competitiveness of the Brazilian industry. This initiative is founded on support for research and development in the laboratories of the National Laboratories for Nanotechnology (SisNANO), starting from an improvement in infrastructure and opening of laboratories for users of academia and business, promoting interaction and transfer knowledge between academia and business. Country currently has 26 thematic networks of nanotechnology, 16 -Virtual-National Institutes of Technology, seven National- Laboratories and 18 Associate Laboratories, which comprise the SisNANO. Seeking to expand and share governance with other government actors, the Interministries Committee for Nanotechnology was set up, composed of 10 ministries, and has the task of coordinating the entire program of the Federal Government Nanotechnology.Cooperation activities are an important part of BNI. Currently Brazil has cooperation programs with U.S., China, Canada and European Union among others. Recently, Brazil decided to join the European NanoReg program where 60 research groups are joining efforts to provide protocols and standards that can help regulatory agencies and governments.

  7. Coffee for morning hunger pangs. An examination of coffee and caffeine on appetite, gastric emptying, and energy intake.

    PubMed

    Schubert, Matthew M; Grant, Gary; Horner, Katy; King, Neil; Leveritt, Michael; Sabapathy, Surendran; Desbrow, Ben

    2014-12-01

    Coffee is one of the most widely consumed beverages in the world and has a number of potential health benefits. Coffee may influence energy expenditure and energy intake, which in turn may affect body weight. However, the influence of coffee and its constituents - particularly caffeine - on appetite remains largely unexplored. The objective of this study was to examine the impact of coffee consumption (with and without caffeine) on appetite sensations, energy intake, gastric emptying, and plasma glucose between breakfast and lunch meals. In a double-blind, randomised crossover design. Participants (n = 12, 9 women; Mean ± SD age and BMI: 26.3 ± 6.3 y and 22.7 ± 2.2 kg•m⁻²) completed 4 trials: placebo (PLA), decaffeinated coffee (DECAF), caffeine (CAF), and caffeine with decaffeinated coffee (COF). Participants were given a standardised breakfast labelled with ¹³C-octanoic acid and 225 mL of treatment beverage and a capsule containing either caffeine or placebo. Two hours later, another 225 mL of the treatment beverage and capsule was administered. Four and a half hours after breakfast, participants were given access to an ad libitum meal for determination of energy intake. Between meals, participants provided exhaled breath samples for determination of gastric emptying; venous blood and appetite sensations. Energy intake was not significantly different between the trials (Means ± SD, p> 0.05; Placebo: 2118 ± 663 kJ; Decaf: 2128 ± 739 kJ; Caffeine: 2287 ± 649 kJ; Coffee: 2016 ± 750 kJ); Other than main effects of time (p <0.05), no significant differences were detected for appetite sensations or plasma glucose between treatments (p > 0.05). Gastric emptying was not significantly different across trials (p > 0.05). No significant effects of decaffeinated coffee, caffeine or their combination were detected. However, the consumption of caffeine and/or coffee for regulation of energy balance

  8. Stable Radical Content and Anti-Radical Activity of Roasted Arabica Coffee: From In-Tact Bean to Coffee Brew

    PubMed Central

    Troup, Gordon J.; Navarini, Luciano; Liverani, Furio Suggi; Drew, Simon C.

    2015-01-01

    The roasting of coffee beans generates stable radicals within melanoidins produced by non-enzymatic browning. Roasting coffee beans has further been suggested to increase the antioxidant (AO) capacity of coffee brews. Herein, we have characterized the radical content and AO capacity of brews prepared from Coffea arabica beans sourced directly from an industrial roasting plant. In-tact beans exhibited electron paramagnetic resonance signals arising from Fe3+, Mn2+ and at least three distinct stable radicals as a function of roasting time, whose intensity changed upon grinding and ageing. In coffee brews, the roasting-induced radicals were harboured within the high molecular weight (> 3 kD) melanoidin-containing fraction at a concentration of 15 nM and was associated with aromatic groups within the melanoidins. The low molecular weight (< 3 kD) fraction exhibited the highest AO capacity using DPPH as an oxidant. The AO activity was not mediated by the stable radicals or by metal complexes within the brew. While other non-AO functions of the roasting-induced radical and metal complexes may be possible in vivo, we confirm that the in vitro antiradical activity of brewed coffee is dominated by low molecular weight phenolic compounds. PMID:25856192

  9. Coffee Consumption Habits and the Risk of Mild Cognitive Impairment: The Italian Longitudinal Study on Aging.

    PubMed

    Solfrizzi, Vincenzo; Panza, Francesco; Imbimbo, Bruno P; D'Introno, Alessia; Galluzzo, Lucia; Gandin, Claudia; Misciagna, Giovanni; Guerra, Vito; Osella, Alberto; Baldereschi, Marzia; Di Carlo, Antonio; Inzitari, Domenico; Seripa, Davide; Pilotto, Alberto; Sabbá, Carlo; Logroscino, Giancarlo; Scafato, Emanuele

    2015-01-01

    Coffee, tea, or caffeine consumption may be protective against cognitive impairment and dementia. We estimated the association between change or constant habits in coffee consumption and the incidence of mild cognitive impairment (MCI). We evaluated 1,445 individuals recruited from 5,632 subjects, aged 65-84 year old, from the Italian Longitudinal Study on Aging, a population-based sample from eight Italian municipalities with a 3.5-year median follow-up. Cognitively normal older individuals who habitually consumed moderate amount of coffee (from 1 to 2 cups of coffee/day) had a lower rate of the incidence of MCI than those who never or rarely consumed coffee [1 cup/day: hazard ratio (HR): 0.47, 95% confidence interval (CI): 0.211 to 1.02 or 1-2 cups/day: HR: 0.31 95% CI: 0.13 to 0.75]. For cognitively normal older subjects who changed their coffee consumption habits, those increasing coffee consumption (>1 cup of coffee/day) had higher rate of the incidence of MCI compared to those with constant habits (up to ±1 cup of coffee/day) (HR: 1.80, 95% CI: 1.11 to 2.92) or those with reduced consumption (<1 cup of coffee/day) (HR: 2.17, 95% CI: 1.16 to 4.08). Finally, there was no significant association between subjects with higher levels of coffee consumption (>2 cups of coffee/day) and the incidence of MCI in comparison with those who never or rarely consumed coffee (HR: 0.26, 95% CI: 0.03 to 2.11). In conclusion, cognitively normal older individuals who increased their coffee consumption had a higher rate of developing MCI, while a constant in time moderate coffee consumption was associated to a reduced rate of the incidence of MCI. PMID:26401769

  10. Gut feelings about smoking and coffee in Parkinson's disease.

    PubMed

    Derkinderen, Pascal; Shannon, Kathleen M; Brundin, Patrik

    2014-07-01

    Strong epidemiologic evidence suggests that smokers and coffee drinkers have a lower risk of Parkinson's disease (PD). The explanation for this finding is still unknown, and the discussion has focused on two main hypotheses. The first suggests that PD patients have premorbid personality traits associated with dislike for coffee-drinking and smoking. The second posits that caffeine and nicotine are neuroprotective. We propose an alternative third hypothesis, in which both cigarette and coffee consumption change the composition of the microbiota in the gut in a way that mitigates intestinal inflammation. This, in turn, would lead to less misfolding of the protein alpha-synuclein in enteric nerves, reducing the risk of PD by minimizing propagation of the protein aggregates to the central nervous system, where they otherwise can induce neurodegeneration. PMID:24753353

  11. Heat of Combustion of Dried and Undried Coffee

    NASA Astrophysics Data System (ADS)

    Giso, Mathew; Amanuel, Samuel

    Globally, over two billion cups of coffee are consumed per day. During roasting, 15-20% of the weight of the coffee beans is lost. We studied the gasses released during the roasting process using an IR spectrometer and identified the evaporation profile of water as a function of temperature. The heat of combustion (Hºc) of the beans was also determined using an Isoperibol Oxygen-Bomb calorimeter and the Hºc of dry beans were determined to be 21.24 +/-0.13 MJ/kg while the Hºc of the wet beans were determined to be 19.56 +/-0.12 MJ/kg. This study can potentially lead to developing more economical and environmentally friendly techniques of roasting coffee beans. This work was partially supported by NSF-DMR: 1229142.

  12. Coffee's country of origin determined by NMR: the Colombian case.

    PubMed

    Arana, V A; Medina, J; Alarcon, R; Moreno, E; Heintz, L; Schäfer, H; Wist, J

    2015-05-15

    The determination of the origin of coffee beans by NMR fingerprinting has been shown promising and classification has been reported for samples of different countries and continents. Here we show that this technique can be extended and applied to discriminate coffee samples from one country against all others, including its closest neighbors. Very high classification rates are reported using a large number of spectra (>300) acquired over a two-year period. As original aspects it can be highlighted that this study was performed in fully automatic mode and with non-deuterated coffee extracts. This is achieved using a series of experiments to procure a robust suppression of the solvent peaks. As is, the method represents a cost effective opportunity for countries to protect their national productions. PMID:25577112

  13. Coffee husk waste for fermentation production of mosquitocidal bacteria.

    PubMed

    Poopathi, Subbiah; Abidha, S

    2011-12-01

    Coffee husk waste (CHW) discarded as bio-organic waste, from coffee industries, is rich in carbohydrates. The current study emphasizes the management of solid waste from agro-industrial residues for the production of biopesticides (Bacillus sphaericus, and B. thuringiensis subsp. israelensis), to control disease transmitting mosquito vectors. An experimental culture medium was prepared by extracting the filtrates from coffee husk. A conventional culture medium (NYSM) also was prepared. The studies revealed that the quantity of mosquitocidal toxins produced from CHW is at par with NYSM. The bacteria produced in these media, were bioassayed against mosquito vectors (Culex quinquefasciatus, Anopheles stephensi, and Aedes aegypti) and it was found that the toxic effect was statistically comparable. Cost-effective analysis have revealed that, production of biopesticides from CHW is highly economical. Therefore, the utilization of CHW provides dual benefits of effective utilization of environmental waste and efficient production of mosquitocidal toxins. PMID:22299340

  14. High-pressure liquid chromatography of caffeine in coffee.

    PubMed

    Madison, B L; Kozarek, W J; Damo, C P

    1976-11-01

    A new method is described for the determination of caffeine in coffee, based on high-pressure liquid chromatography. The caffeine is extracted from the sample with water and/or methylene chloride, and then separated from interfering materials by passing an aliquot of the extract through a high-pressure column containing sulfonated cation exchange resin, using 0.01M nitric acid as the mobile phase. An ultraviolet detector measures the absorption of the solution directly. The method is rapid and eliminates the lengthy separations common to other methods. The procedure was applied successfully to decaffeinated and non-decaffeinated green, roasted, and instant coffees. This method gives a more accurate measure of the caffeine content in decaffeinated coffee samples than the micro Bailey-Andrew and modified Levine methods, with equal or better precision. This method gives results equal to those obtained by the official methods for non-decaffeinated samples. PMID:993180

  15. Pharmacogenetics in the Brazilian Population

    PubMed Central

    Suarez-Kurtz, Guilherme

    2010-01-01

    Brazil is the fifth largest country in the world and its present population, in excess of 190;million, is highly heterogeneous, as a result of centuries of admixture between Amerindians, Europeans, and Sub-Saharan Africans. The estimated individual proportions of biogeographical ancestry vary widely and continuously among Brazilians: most individuals, irrespective of self-identification as White, Brown or Black – the major categories of the Brazilian Census “race/color” system – have significant degrees of European and African ancestry, while a sizeable number display also Amerindian ancestry. These features have important pharmacogenetic (PGx) implications: first, extrapolation of PGx data from relatively well-defined ethnic groups is clearly not applicable to the majority of Brazilians; second, the frequency distribution of polymorphisms in pharmacogenes (e.g., CYP3A5, CYP2C9, GSTM1, ABCB1, GSTM3, VKORC, etc) varies continuously among Brazilians and is not captured by race/color self-identification; third, the intrinsic heterogeneity of the Brazilian population must be acknowledged in the design and interpretation of PGx studies in order to avoid spurious conclusions based on improper matching of study cohorts. The peculiarities of PGx in Brazilians are illustrated with data for different therapeutic groups, such as anticoagulants, HIV protease inhibitors and non-steroidal antinflammatory drugs, and the challenges and advantages created by population admixture for the study and implementation of PGx are discussed. PGx data for Amerindian groups and Brazilian-born, first-generation Japanese are presented to illustrate the rich diversity of the Brazilian population. Finally, I introduce the reader to the Brazilian Pharmacogenetic Network or Refargen1, a nation-wide consortium of research groups, with the mission to provide leadership in PGx research and education in Brazil, with a population health impact. PMID:21833165

  16. Plant Nutrient Partitioning in Coffee Infected with Meloidogyne konaensis

    PubMed Central

    Hurchanik, Denise; Schmitt, D. P.; Hue, N. V.; Sipes, B. S.

    2004-01-01

    Two experiments were conducted to assess nutrient partitioning in coffee (Coffea arabica cv. Typica land race Guatemala) infected with Meloidogyne konaensis. Nutrient levels were quantified from soil, roots, and leaves. In the first experiment, 500-cm3 aliquants of a Kealakekua Andisol were infested with four initial population densities of M. konaensis ranging from 0 to 1,500 freshly hatched second-stage juveniles. Coffee plants (~3 months old) were transplanted into the soil and grown for 25 weeks. Plants responded to nematode infection with decreases (P < 0.05) in concentrations of Ca, Mg, P, and B and increases (P < 0.05) in concentrations of Mn, Cu, Zn, and Ca/B in the roots. Mn and Cu uptake by roots was decreased (P < 0.05) by nematode infection even though concentrations of Mn and Cu increased (P < 0.05) in the roots. Concentrations of Ca and Mg also decreased (P < 0.05) in the leaves, whereas the concentration of Zn increased (P < 0.05). In the second experiment, the soil was amended with Zn at 0 or 5 mg/kg soil and infested with M. konaensis at 0, 100, 1,000 or 10,000 eggs/1,200 cm3 soil. Three-month-old coffee seedlings of similar height were weighed and transplanted into pots and then placed in a greenhouse and grown under 50% shade for 23 weeks. Concentrations of P, K, Ca, Mg, Mn, B, and Zn increased in roots of nematode-free plants growing in Zn-amended soil. The beneficial effects due to the Zn amendment were not apparent in nematode-infected plants. Mn, B, and Zn uptake by coffee roots and P and B concentrations in coffee leaves responded similarly. Management of M. konaensis is necessary to achieve optimal nutrient management in coffee. PMID:19262790

  17. Tea and Coffee Consumption and MRSA Nasal Carriage

    PubMed Central

    Matheson, Eric M.; Mainous, Arch G.; Everett, Charles J.; King, Dana E.

    2011-01-01

    PURPOSE Hot tea and coffee have been found to have antimicrobial properties. The purpose of this study was to determine whether the consumption of tea, coffee, or both is associated with less frequent nasal carriage of methicillin-resistant Staphylococcus aureus (MRSA). METHODS We performed a secondary analysis of data from the 2003–2004 National Health and Nutrition Examination Survey to investigate the relationship between the consumption of coffee, hot tea, cold tea, and soft drinks, and MRSA nasal carriage among the noninstitutionalized population of the United States. RESULTS An estimated 2.5 million persons (1.4% of the population) were MRSA nasal carriers. In an adjusted logistic regression analysis controlling for age, race, sex, poverty-income ratio, current health status, hospitalization in the past 12 months, and use of antibiotics in the past month, individuals who reported consuming hot tea were one-half as likely to have MRSA nasal carriage relative to individuals who drank no hot tea (odds ratio = 0.47; 95% confidence interval, 0.31–0.71). Similarly, individuals who reported consuming coffee had about a one-half reduction in the risk of MRSA nasal carriage relative to individuals who drank no coffee (odds ratio = 0.47; 95% confidence interval, 0.24–0.93). CONCLUSIONS Consumption of hot tea or coffee is associated with a lower likelihood of MRSA nasal carriage. Our findings raise the possibility of a promising new method to decrease MRSA nasal carriage that is safe, inexpensive, and easily accessible. PMID:21747100

  18. Plant Nutrient Partitioning in Coffee Infected with Meloidogyne konaensis.

    PubMed

    Hurchanik, Denise; Schmitt, D P; Hue, N V; Sipes, B S

    2004-03-01

    Two experiments were conducted to assess nutrient partitioning in coffee (Coffea arabica cv. Typica land race Guatemala) infected with Meloidogyne konaensis. Nutrient levels were quantified from soil, roots, and leaves. In the first experiment, 500-cm3 aliquants of a Kealakekua Andisol were infested with four initial population densities of M. konaensis ranging from 0 to 1,500 freshly hatched second-stage juveniles. Coffee plants (~3 months old) were transplanted into the soil and grown for 25 weeks. Plants responded to nematode infection with decreases (P < 0.05) in concentrations of Ca, Mg, P, and B and increases (P < 0.05) in concentrations of Mn, Cu, Zn, and Ca/B in the roots. Mn and Cu uptake by roots was decreased (P < 0.05) by nematode infection even though concentrations of Mn and Cu increased (P < 0.05) in the roots. Concentrations of Ca and Mg also decreased (P < 0.05) in the leaves, whereas the concentration of Zn increased (P < 0.05). In the second experiment, the soil was amended with Zn at 0 or 5 mg/kg soil and infested with M. konaensis at 0, 100, 1,000 or 10,000 eggs/1,200 cm(3) soil. Three-month-old coffee seedlings of similar height were weighed and transplanted into pots and then placed in a greenhouse and grown under 50% shade for 23 weeks. Concentrations of P, K, Ca, Mg, Mn, B, and Zn increased in roots of nematode-free plants growing in Zn-amended soil. The beneficial effects due to the Zn amendment were not apparent in nematode-infected plants. Mn, B, and Zn uptake by coffee roots and P and B concentrations in coffee leaves responded similarly. Management of M. konaensis is necessary to achieve optimal nutrient management in coffee. PMID:19262790

  19. Determination of the 2H/1H and 15N/14N ratios of Alkylpyrazines from coffee beans (Coffea arabica L. and Coffea canephoravar. robusta) by isotope ratio mass spectrometry.

    PubMed

    Richling, Elke; Preston, Christina; Kavvadias, Dominique; Kahle, Kathrin; Heppel, Christopher; Hummel, Silvia; König, Thorsten; Schreier, Peter

    2005-10-01

    The delta15N(AIR) and delta2H(VSMOW) data for several alkylpyrazines formed during the roasting process of coffee are reported. Samples of commercially available roasted (n = 9) as well as self-roasted (n = 8) coffee beans (Coffea arabica L. and Coffea canephora var. robusta) of different origins were investigated. By use of extracts prepared by simultaneous distillation extraction (SDE) and subsequently fractionated by liquid chromatography on silica gel, on-line capillary gas chromatography-isotope ratio mass spectrometry was employed in the combustion (C) and pyrolysis (P) modes (HRGC-C/P-IRMS) to determine the delta15N(AIR) and delta2H(VSMOW) values, respectively. In addition to the constituents of coffee beans, data for commercial synthetic alkylpyrazines and substances declared to be "natural" were determined. The delta15N(AIR) data for coffee alkylpyrazines under study-2-ethyl-5-methylpyrazine (1) and 2-ethyl-6-methylpyrazine (2) (measured as sum 1/2), 2-ethyl-3-methylpyrazine (3), 2-methylpyrazine (4), 2,5-dimethylpyrazine (5) and 2,6-dimethylpyrazine (6) (measured as sum 5/6), and 2,3-dimethylpyrazine (7), as well as 2,3,5-trimethylpyrazine (8)-varied in the range from +8.3 to -10.2 per thousand, thus revealing their biogeneration from amino acids (delta15N(AIR) ranging from +8 per thousand to -10 per thousand). The delta2H(VSMOW) values were determined in the range from -5 per thousand to -127 per thousand. Owing to the analytical differentiation observed between coffee alkylpyrazines and synthetic/"natural" samples of 3, 4, and 7, authenticity assessment of coffee-flavored products seems to be promising, provided that extended data will be available in the future. In the literature, there were no IRMS data available for the alkylpyrazines (1-8) under study. PMID:16190651

  20. Long-Term Coffee Consumption and Risk of Gastric Cancer

    PubMed Central

    Zeng, Shao-Bo; Weng, Hong; Zhou, Meng; Duan, Xiao-Li; Shen, Xian-Feng; Zeng, Xian-Tao

    2015-01-01

    Abstract Association between coffee consumption and gastric cancer risk remains controversial. Hence, we performed a meta-analysis to investigate and quantify the potential dose–response association between long-term coffee consumption and risk of gastric cancer. Pertinent studies were identified by searching PubMed and Embase from January 1996 through February 10, 2015 and by reviewing the reference lists of retrieved publications. Prospective cohort studies in which authors reported effect sizes and corresponding 95% confidence intervals (CIs) of gastric cancer for 3 or more categories of coffee consumption were eligible. Results from eligible studies were aggregated using a random effect model. All analyses were carried out using the STATA 12.0 software. Nine studies involving 15 independent prospective cohorts were finally included. A total of 2019 incident cases of gastric cancer were ascertained among 1,289,314 participants with mean follow-up periods ranging from 8 to 18 years. No nonlinear relationship of coffee consumption with gastric cancer risk was indentified (P for nonlinearity = 0.53; P for heterogeneity = 0.004). The linear regression model showed that the combined relative risk (RR) of every 3 cups/day increment of total coffee consumption was 1.07 (95% CI = 0.95–1.21). Compared with the lowest category of coffee consumption, the RR of gastric cancer was 1.18 (95% CI = 0.90–1.55) for the highest (median 6.5 cups/day) category, 1.06 (95% CI = 0.85–1.32) for the second highest category (median 3.5 cups/day), and 0.97 (95% CI = 0.79–1.20) for the third highest category (median 1.5 cups/day). Subgroup analysis showed an elevated risk in the US population (RR = 1.36, 95% CI = 1.06–1.75) and no adjustment for smoking (RR = 1.67, 95% CI = 1.08–2.59) for 6.5 cups/day. Current evidence indicated there was no nonlinear association between coffee consumption and gastric cancer risk. However, high

  1. Commercial Fishing.

    ERIC Educational Resources Information Center

    Florida State Dept. of Education, Tallahassee. Div. of Vocational Education.

    This document is a curriculum framework for a program in commercial fishing to be taught in Florida secondary and postsecondary institutions. This outline covers the major concepts/content of the program, which is designed to prepare students for employment in occupations with titles such as net fishers, pot fishers, line fishers, shrimp boat…

  2. Commercial applications

    NASA Technical Reports Server (NTRS)

    Togai, Masaki

    1990-01-01

    Viewgraphs on commercial applications of fuzzy logic in Japan are presented. Topics covered include: suitable application area of fuzzy theory; characteristics of fuzzy control; fuzzy closed-loop controller; Mitsubishi heavy air conditioner; predictive fuzzy control; the Sendai subway system; automatic transmission; fuzzy logic-based command system for antilock braking system; fuzzy feed-forward controller; and fuzzy auto-tuning system.

  3. Insight into the mechanism of coffee melanoidin formation using modified "in bean" models.

    PubMed

    Nunes, Fernando M; Cruz, Ana C S; Coimbra, Manuel A

    2012-09-01

    To study the mechanism of coffee melanoidin formation, green coffee beans were prepared by (1) removal of the hot water extractable components (WECoffee); (2) direct incorporation of sucrose (SucCoffee); and (3) direct incorporation of type II arabinogalactan-proteins (AGPCoffee). As a control of sucrose and AGP incorporation, lyophilized green coffee beans were also immersed in water (control). The original coffee and the four modified "in bean" coffee models were roasted and their chemical characteristics compared. The formation of material not identified as carbohydrates or protein, usually referred to as "unknown material" and related to melanoidins, and the development of the brown color during coffee roasting have distinct origins. Therefore, a new parameter for coffee melanoidin evaluation, named the "melanoidin browning index" (MBI), was introduced to handle simultaneously the two concepts. Sucrose is important for the formation of colored structures but not to the formation of "unknown material". Type II AGPs also increase the brown color of the melanoidins, but did not increase the amount of "unknown material". The green coffee hot water extractable components are essential for coffee melanoidin formation during roasting. The cell wall material was able to generate a large amount of "unknown material". The galactomannans modified by the roasting and the melanoidin populations enriched in galactomannans accounted for 47% of the high molecular weight brown color material, showing that these polysaccharides are very relevant for coffee melanoidin formation. PMID:22880950

  4. Removal of lead ions in drinking water by coffee grounds as vegetable biomass.

    PubMed

    Tokimoto, Toshimitsu; Kawasaki, Naohito; Nakamura, Takeo; Akutagawa, Jyunichi; Tanada, Seiki

    2005-01-01

    In an attempt to reuse food waste for useful purposes, we investigated the possibility of using coffee grounds to remove lead ions from drinking water. We studied the lead ion adsorption characteristics of coffee beans and grounds by measuring their fat and protein content, adsorption isotherms for lead ions, and adsorption rates for lead ions. The number of lead ions adsorbed by coffee grounds did not depend on the kind of coffee beans or the temperature at which adsorption tests were performed. The rate of lead ion adsorption by coffee grounds was directly proportional to the amount of coffee grounds added to the solution. When coffee grounds were degreased or boiled, the number of lead ions decreased. When proteins contained in coffee grounds were denatured, the lead ion adsorption was considerably reduced. The lead ion adsorption capacity of coffee grounds decreased with increased concentration of perchloric acid used for treating them and disappeared with 10% perchloric acid. The experiments demonstrated that proteins contained in coffee beans depend upon the adsorption of lead ion. The present study gave an affirmative answer to the possibility of using coffee grounds, an abundant food waste, for removing lead ions from drinking water. PMID:15567380

  5. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    PubMed

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change. PMID:26371395

  6. Analysis of coffee for the presence of acrylamide by LC-MS/MS.

    PubMed

    Andrzejewski, Denis; Roach, John A G; Gay, Martha L; Musser, Steven M

    2004-04-01

    A variety of popular instant, ground, and brewed coffees were analyzed using a modified liquid chromatography-tandem mass spectrometry (LC-MS/MS) method specifically developed for the determination of acrylamide in foods. Coffee test portions were spiked with 13C3-labeled acrylamide as an internal standard prior to their extraction and cleanup. Ground coffees (1 g) and instant coffees (0.5 g) were extracted by shaking with 9 mL of water for 20 min. Brewed coffee test portions (9 mL) were taken through the cleanup procedure without further dilution with extraction solvent. Coffee test portions were cleaned up by passing 1.5 mL first through an Oasis HLB (hydrophilic/lipophilic copolymer sorbent) solid phase extraction (SPE) cartridge and then a Bond Elut-Accucat (cation and anion exchange sorbent) SPE cartridge. The cleaned up extracts were analyzed by positive ion electrospray LC-MS/MS. The MS/MS data was used to detect, confirm, and quantitate acrylamide. The limit of quantitation of the method was 10 ng/g for ground and instant coffees and 1.0 ng/mL for brewed coffee. The levels of acrylamide ranged from 45 to 374 ng/g in unbrewed coffee grounds, from 172 to 539 ng/g in instant coffee crystals, and from 6 to 16 ng/mL in brewed coffee. PMID:15053542

  7. Green coffee bean extract improves human vasoreactivity.

    PubMed

    Ochiai, Ryuji; Jokura, Hiroko; Suzuki, Atsushi; Tokimitsu, Ichiro; Ohishi, Mitsuru; Komai, Norio; Rakugi, Hiromi; Ogihara, Toshio

    2004-10-01

    Our previous study revealed the antihypertensive effects of green coffee bean extract (GCE) ingestion in spontaneously hypertensive rats. We suggested that this antihypertensive action was due to the fact that GCE contains chlorogenic acid (CQA) as a major phenolic compound, and CQA in turn contains ferulic acid as a metabolic component that acts on nitric oxide (NO) derived from the vascular endothelium. In this study, the effects of GCE on blood vessels were evaluated in healthy males. The subjects were 20 healthy males with reduced vasodilation responses measured by strain gauge plethysmograms (SPG) to ischemic reactive hyperemia. Of the 20 subjects, 10 (mean age, 37.2 years) ingested a test drink containing GCE (CQA: 140 mg/day), and the other 10 (mean age, 34.8 years) ingested a placebo drink for 4 months. During the ingestion period, SPG, pulse wave velocity (PWV), and serum biochemical parameters were measured, and acceleration plethysmograms (APG) were taken. The reactive hyperemia ratio (RHR) in the test drink group began to increase after ingestion for 1 month and was significantly higher (p <0.05) than that in the placebo group after ingestion for 3 months and 4 months. In addition, after ingestion for 4 months, the test drink group showed a significant decrease (p <0.01) in the plasma total homocysteine level compared with the pre-ingestion level. However, there were no significant differences in PWV or APG between the test drink group and the placebo drink group. The improvement in RHR after ingestion of a drink containing GCE suggested an improvement in vasoreactivity by this component. PMID:15785008

  8. Wake up and smell the coffee

    SciTech Connect

    Comerford, T.R. )

    1994-04-01

    Early in 1991, Public Service Electric and Gas Co. (PSE G) began investigating various ways to retain businesses and industries in New Jersey. Other organizations were trying, or investigating, different business-retention techniques, many of which centered around surveys to determine businesses' major concerns and problems. Around the same time, PSE G was part of a team that was working to save the Maxwell House Coffee Plant in Hoboken, NJ. General Foods, the parent company of Maxwell House, had determined that they no longer needed the capacity of both the Hoboken facility and a facility in Florida. In the course of responding to Maxwell House, many concerns and problems were uncovered, many of which had been developing for some time. The team responded to each issue and proposed innovative solutions, but Maxwell House decided against Hoboken in favor of Florida. It became apparent that retaining a company that had begun the relocation process would be extremely difficult. PSE G's Marketing Services and Area Development Department and the New Jersey Department of Commerce and Economic Development jointly established the Business Enhancement Program (BEP) in the spring of 1991. Realizing that business concerns had to be confronted before they became major issues, the program was designed as an ongoing communication network. The BEP is committed to addressing business problems or concerns in a timely and professional manner. Not all concerns can be solved to the complete satisfaction of the company. However, the program strives to provide appropriate assessment of the issues and to demonstrate that the business is valued and appreciated in New Jersey.

  9. Mozambioside Is an Arabica-Specific Bitter-Tasting Furokaurane Glucoside in Coffee Beans.

    PubMed

    Lang, Roman; Klade, Stefan; Beusch, Anja; Dunkel, Andreas; Hofmann, Thomas

    2015-12-01

    Sensory-guided fractionation of a roasted coffee beverage revealed a highly polar, bitter-tasting subfraction, from which the furokaurane glucoside mozambioside was isolated and identified in its chemical structure by means of HDMS and NMR spectra. Sensory evaluation revealed a bitter taste recognition threshold of 60 (± 10) μmol/L. UPLC-HDMS quantitation of raw coffee beans showed that Arabica coffees contained 396-1188 nmol/g mozambioside, whereas only traces (<5 nmol/g) were detected in Robusta coffees, thus suggesting that mozambioside can be used as an analytical marker for Arabica coffee. Roasted Arabica contained a substantially reduced concentration (232 ± 37 nmol/g), indicating partial degradation of mozambioside during coffee roasting. Mozambioside was nearly quantitatively extracted into the aqueous brew during coffee-making (86-98%). PMID:26585544

  10. Coffee and cardiovascular disease: in vitro, cellular, animal, and human studies.

    PubMed

    Bonita, Jennifer Stella; Mandarano, Michael; Shuta, Donna; Vinson, Joe

    2007-03-01

    Coffee is a commonly consumed beverage with potential health benefits. This review will focus on cardiovascular disease. There are three preparations of coffee that are commonly consumed and thus worthy of examination; boiled unfiltered coffee, filtered coffee, and decaffeinated coffee. Coffee has over a thousand chemicals, many formed during the roasting process. From a physiological point of view, the potential bioactives are caffeine, the diterpenes cafestol and kahweol found in the oil, and the polyphenols, most notably chlorogenic acid. We will examine coffee and its bioactives and their connection with and effect on the risk factors which are associated with heart disease such as lipids, blood pressure, inflammation, endothelial function, metabolic syndrome and potentially protective in vivo antioxidant activity. These will be critically examined by means of in vitro studies, cell experiments, animal supplementation, epidemiology, and the most definitive evidence, human trials. PMID:17368041

  11. Thermoluminescence of brazilian topaz

    NASA Astrophysics Data System (ADS)

    Souza, Divanízia Do N.; de Lima, José F.; Valerio, Mário Ernesto G.

    Thermoluminiscence measurements were performed on samples of yellowish Brazilian Topaz from Acari, MG. Virgin samples revealed peaks 2 and 4 at about 150 and 300°C. respectively, while in samples with extra dose of y-rays, we observed another peak at 80°C. When topaz samples were thermally treated, peak 4 vanished and peak 3 at about 180°C, became visible. Isothermal decay of peak 2 performed on virgin samples showed that peak 3 is present on this samples too. The spectra of the first 3 peaks are very similar in the range of 350 to 500 nm indicating that the recombination processes related to these 3 peaks could be the same. The dose dependency of the TL intensity of the first 3 peaks was mesured from 0.5 to 400 Gy and it sems to start saturating above 400 Gy.

  12. Brazilian Eratosthenes Project

    NASA Astrophysics Data System (ADS)

    Langhi, R.; Vilaça, J.

    2014-10-01

    The objective of Brazilian Eratosthenes Project is the development and application of teaching training actions according the ``docent autonomy" concept to basic Astronomy Education. Argentina coordinates the project in South America, but Brazil works in this project since 2010 with the theme ``Projeto Eratóstenes Brasil" in the homepage: http://sites.google.com/site/projetoerato. Two schools measure a sticks shadow and communicate their results. After, they calculate an average radius of Earth. The stick (gnomon) should stay in vertical position in the leveled ground. Since 2010, the project received hundreds of Brazilian schools with different experiments that were constructed with autonomy, because our site doesn't show some itinerary pre-ready to elaborate the experiments. To collect data for our research, we will use interviews via Skype with the teachers. These data are useful to researches about Science Education area and the Teaching Formation. Teaching professional practice could change and we see modifications in the teachers work, what depends of their realities and context. This project intents to respect the docent autonomy. This autonomy to responsible modifications during continued formation is called ``activist formative model" according Langhi & Nardi (Educação em Astronomia: repensando a formação de professores. São Paulo: Escrituras Editora, 2012). This project discusses about researches in Astronomy Education - still extreme rare in Brazil, when we compare with other areas in Science Education. We believe that actions like this could motivate the students to learn more Astronomy. Furthermore, this national action can be a rich source of data to investigations about teaching formation and scientific divulgation.

  13. Coffee consumption and human health--beneficial or detrimental?--Mechanisms for effects of coffee consumption on different risk factors for cardiovascular disease and type 2 diabetes mellitus.

    PubMed

    Ranheim, Trine; Halvorsen, Bente

    2005-03-01

    Coffee is probably the most frequently ingested beverage worldwide. Especially Scandinavia has a high prevalence of coffee-drinkers, and they traditionally make their coffee by boiling ground coffee beans and water. Because of its consumption in most countries in the world, it is interesting, from both a public and a scientific perspective, to discuss its potential benefits or adverse aspects in relation to especially two main health problems, namely cardiovascular disease and type 2 diabetes mellitus. Epidemiological studies suggest that consumption of boiled coffee is associated with elevated risk for cardiovascular disease. This is mainly due to the two diterpenes identified in the lipid fraction of coffee grounds, cafestol and kahweol. These compounds promote increased plasma concentration of cholesterol in humans. Coffee is also a rich source of many other ingredients that may contribute to its biological activity, like heterocyclic compounds that exhibit strong antioxidant activity. Based on the literature reviewed, it is apparent that moderate daily filtered, coffee intake is not associated with any adverse effects on cardiovascular outcome. On the contrary, the data shows that coffee has a significant antioxidant activity, and may have an inverse association with the risk of type 2 diabetes mellitus. PMID:15704241

  14. Effects of Coffee Management Intensity on Composition, Structure, and Regeneration Status of Ethiopian Moist Evergreen Afromontane Forests

    NASA Astrophysics Data System (ADS)

    Hundera, Kitessa; Aerts, Raf; Fontaine, Alexandre; Van Mechelen, Maarten; Gijbels, Pieter; Honnay, Olivier; Muys, Bart

    2013-03-01

    The effect of arabica coffee management intensity on composition, structure, and regeneration of moist evergreen Afromontane forests was studied in three traditional coffee-management systems of southwest Ethiopia: semiplantation coffee, semiforest coffee, and forest coffee. Vegetation and environmental data were collected in 84 plots from forests varying in intensity of coffee management. After controlling for environmental variation (altitude, aspect, slope, soil nutrient availability, and soil depth), differences in woody species composition, forest structure, and regeneration potential among management systems were compared using one way analysis of variance. The study showed that intensification of forest coffee cultivation to maximize coffee production negatively affects diversity and structure of Ethiopian moist evergreen Afromontane forests. Intensification of coffee productivity starts with the conversion of forest coffee to semiforest coffee, which has significant negative effects on tree seedling abundance. Further intensification leads to the conversion of semiforest to semiplantation coffee, causing significant diversity losses and the collapse of forest structure (decrease of stem density, basal area, crown closure, crown cover, and dominant tree height). Our study underlines the need for shade certification schemes to include variables other than canopy cover and that the loss of species diversity in intensively managed coffee systems may jeopardize the sustainability of coffee production itself through the decrease of ecosystem resilience and disruption of ecosystem services related to coffee yield, such as pollination and pest control.

  15. Effects of coffee management intensity on composition, structure, and regeneration status of ethiopian moist evergreen afromontane forests.

    PubMed

    Hundera, Kitessa; Aerts, Raf; Fontaine, Alexandre; Van Mechelen, Maarten; Gijbels, Pieter; Honnay, Olivier; Muys, Bart

    2013-03-01

    The effect of arabica coffee management intensity on composition, structure, and regeneration of moist evergreen Afromontane forests was studied in three traditional coffee-management systems of southwest Ethiopia: semiplantation coffee, semiforest coffee, and forest coffee. Vegetation and environmental data were collected in 84 plots from forests varying in intensity of coffee management. After controlling for environmental variation (altitude, aspect, slope, soil nutrient availability, and soil depth), differences in woody species composition, forest structure, and regeneration potential among management systems were compared using one way analysis of variance. The study showed that intensification of forest coffee cultivation to maximize coffee production negatively affects diversity and structure of Ethiopian moist evergreen Afromontane forests. Intensification of coffee productivity starts with the conversion of forest coffee to semiforest coffee, which has significant negative effects on tree seedling abundance. Further intensification leads to the conversion of semiforest to semiplantation coffee, causing significant diversity losses and the collapse of forest structure (decrease of stem density, basal area, crown closure, crown cover, and dominant tree height). Our study underlines the need for shade certification schemes to include variables other than canopy cover and that the loss of species diversity in intensively managed coffee systems may jeopardize the sustainability of coffee production itself through the decrease of ecosystem resilience and disruption of ecosystem services related to coffee yield, such as pollination and pest control. PMID:23180249

  16. Arabinogalactan proteins are incorporated in negatively charged coffee brew melanoidins.

    PubMed

    Bekedam, E Koen; De Laat, Marieke P F C; Schols, Henk A; Van Boekel, Martinus A J S; Smit, Gerrit

    2007-02-01

    The charge properties of melanoidins in high molecular weight (HMw) coffee brew fractions, isolated by diafiltration and membrane dialysis, were studied. Ion exchange chromatography experiments with the HMw fractions showed that coffee brew melanoidins were negatively charged whereas these molecules did not expose any positive charge at the pH of coffee brew. Fractions with different ionic charges were isolated and subsequently characterized by means of the specific extinction coefficient (K(mix 405nm)), sugar composition, phenolic group content, nitrogen content, and the arabinogalactan protein (AGP) specific Yariv gel-diffusion assay. The isolated fractions were different in composition and AGP was found to be present in one of the HMw fractions. The AGP accounted for 6% of the coffee brew dry matter and had a moderate negative charge, probably caused by the presence of uronic acids. As the fraction that precipitated with Yariv was brown (K(mix 405nm) = 1.2), compared to a white color in the green bean, it was concluded that these AGPs had undergone Maillard reaction resulting in an AGP-melanoidin complex. The presence of mannose (presumably from galactomannan) indicates the incorporation of galactomannans in the AGP-melanoidin complex. As the uronic acid content in the more negatively charged melanoidin-rich, AGP-poor HMw fractions decreased, it was hypothesized that acidic groups are formed or incorporated during melanoidin formation. PMID:17263472

  17. CONSERVATION OF GENETIC RESOURCES OF COFFEE USING CRYOPRESERVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Conservation of genetic resources of Coffea, a genus of economic importance worldwide, is difficult because Coffea seeds do not survive conventional seed sotrage protocols. Most coffee germplasm is maintained in field collections, which are expensive to maintain and susceptible to natural disasters...

  18. The Determination of Caffeine in Coffee: Sense or Nonsense?

    ERIC Educational Resources Information Center

    Beckers, Jozef L.

    2004-01-01

    The presence of caffeine in coffee is determined by the use of separation devices and UV-vis spectrophotometry. The results indicate that the use of various analytical tools helps to perceive the higher concentration values obtained through UV-vis spectrophotometry than with separation methods.

  19. Teaching Transport Phenomena around a Cup of Coffee

    ERIC Educational Resources Information Center

    Condoret, Jean Stephane

    2007-01-01

    The very common situation of waiting for the cooling of a cup of coffee is addressed through a conventional engineering approach, where several important concepts of heat and mass transfer are used. A numerical and analytical solution of the differential equations of the problem are proposed, and assessed by comparing to simple experiments.…

  20. Aqueous Polymer in water alter the Coffee-ring effect

    NASA Astrophysics Data System (ADS)

    Seo, Changdeok; Jang, Daeho; Na, Wonhwi; Park, Sera; Shin, Sehyun

    2015-11-01

    When evaporating in droplet system, small particles move toward an edge by outward capillary flow. This phenomenon is known as coffee-ring effect. In experiments that are required to uniformly accumulate particles, this effect can be fatal. In spite of recent challenges for suppressing the coffee-ring effect, it is still insufficiently controlled in film and droplet with various solutions. For deliberate applications, various materials should be out of influence of coffee-ring effect. In this research, we used a bio-compatible and aqueous polymer, polyethylene glycol (PEG) for altering the coffee-ring effect. The influence of PEG on the evaporation of drying colloidal droplets is examined in a wide range of initial concentrations. Adding PEG to water causes a strong vortex flow near the edge of droplet and subsequently leads to significantly uniform patterns of colloidal particle deposition after evaporation. We found the vortex phenomenon by combination of radially outward capillary flow and radially inward Marangoni flows are induced by the radial variation of polymer concentration along the air?water interface. Furthermore, increasing polymer concentration significantly alters the characteristic of ``Marangoni Vortex'' and leads to reproducible patterning of conical structures.

  1. A coffee berry borer (Coleoptera: Curculionidae: Scolytinae) bibliography

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One hundred years ago, one of the most significant biological invasions of an agricultural insect pest in the Americas was initiated. Endemic to Africa, the coffee berry borer (Hypothenemus hampei; Coleoptera: Curculionidae) was accidentally introduced to Brazil in 1913 and years later invaded coffe...

  2. FAIR TRADE ETHANOL: FUEL PRODUCTION FROM COFFEE WASTES

    EPA Science Inventory

    Coffee is an important crop for developing countries, particularly in Latin America. It provides essential income to millions of people, but the wastewater generated threatens the environment and human health. The basic needs in Nicaragua are enormous, similar to many other co...

  3. 40. Coffee bean drying trays that are stored in racks ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    40. Coffee bean drying trays that are stored in racks under building and pulled out to sun dry beans on terraces to the north and south of building. HAER PR, 6-MAGU, 1C-3 - Hacienda Buena Vista, PR Route 10 (Ponce to Arecibo), Magueyes, Ponce Municipio, PR

  4. Associations of tea and coffee consumption with prostate cancer risk

    PubMed Central

    Geybels, Milan S.; Neuhouser, Marian L.; Stanford, Janet L.

    2013-01-01

    Purpose: Tea and coffee contain bioactive compounds and both beverages have recently been associated with a reduced risk of prostate cancer (PCa). Methods: We studied associations of tea and coffee consumption with PCa risk in a population-based case-control study from King County, Washington, US. Prostate cancer cases were diagnosed in 2002-2005 and matched to controls by five-year age groups. Logistic regression was used to generate odds ratios (ORs) and 95% confidence intervals (CIs). Results: Among controls, 19% and 58% consumed at least one cup per day of tea and coffee, respectively. The analysis of tea included 892 cases and 863 controls and tea consumption was associated with a reduced overall PCa risk with an adjusted OR of 0.63 (95% CI: 0.45, 0.90; P for trend = 0.02) for men in the highest compared to lowest category of tea intake (≥2 cups/day versus ≤1 cup/week). Risk estimates did not vary substantially by Gleason grade or disease stage. Coffee consumption was not associated with risk of overall PCa or PCa in subgroups defined by tumor grade or stage. Conclusions: Our results contribute further evidence that tea consumption may be a modifiable exposure that reduces PCa risk. PMID:23412806

  5. Effects of coffee on type 2 diabetes mellitus.

    PubMed

    Akash, Muhammad Sajid Hamid; Rehman, Kanwal; Chen, Shuqing

    2014-01-01

    This review provides the epidemiologic and research evidences documenting the effects of coffee consumption on type 2 diabetes mellitus (T2DM). We summarize the literature concerning the effects of coffee consumption on different mechanistic factors involving in pathogenesis of T2DM, such as glucose tolerance, insulin sensitivity, insulin resistance, glucose-6-phosphatase, intestinal glucose absorption, antioxidant activity, inflammatory biomarkers, nuclear factor-κB inhibition, glucose uptake, glucose homeostasis, glucose metabolism, and insulin secretion. These factors play a crucial role in influencing the normal levels of glucose in blood. Overall, the experimental and epidemiologic evidences presented here elucidate the protective effects of coffee consumption on T2DM, involving multiple preventive mechanisms. Despite the firm evidences available through a growing literature base, it is still uncertain whether the use of coffee should be recommended to patients with diabetes and/or any patient who might be at the risk of T2DM as a supplementary therapy to prevent further progression of T2DM. PMID:24984989

  6. Coffee consumption and the risk of breast cancer.

    PubMed

    Tavani, A; Pregnolato, A; La Vecchia, C; Favero, A; Franceschi, S

    1998-02-01

    On the basis of clinical observations that some women with fibrocystic breast disease experienced resolution of the disease on eliminating methylxanthines from their diet, it has been suggested that coffee intake might be related to breast carcinogenesis. The relationship between coffee (mostly expresso and mocha), decaffeinated coffee and tea intake and breast cancer risk was therefore considered, combining data from two case-control studies, conducted in Italy between 1983 and 1994. Cases were 5,984 women, below age 75, with histologically confirmed breast cancer, and controls were 5,504 women admitted to hospital for a wide spectrum of acute, non-neoplastic, non-hormone-related diseases. The odds ratios (ORs) were estimated from multiple logistic regression equations including terms for study/centre, age, education, body mass index, smoking status, total alcohol intake, age at menarche and menopause, parity and age at first birth, use of oral contraceptives, use of hormone replacement therapy, history of benign breast disease and family history of breast cancer. No relationship was observed between coffee intake and the risk of breast cancer. The multivariate ORs were 1.17 (1.03-1.33), 1.17 (1.04-1.33), 1.21 (1.06-1.37) and 0.96 (0.83-1.11) for women drinking < 2, 2, > 2 to < 4 and > or = 4 cups/day compared to non-drinkers. Decaffeinated coffee was consumed only by 6-7% of cases and controls and the corresponding OR was 0.84 (0.72-0.98). Tea consumption was also low and not associated with the risk of breast cancer (OR 0.94, 95% CI 0.85-1.03). No significant heterogeneity was found for coffee intake across strata of age at diagnosis, education, body mass index, smoking status, total alcohol intake, age at menarche and menopause, parity, age at first birth, ever use of oral contraceptives, hormone replacement therapy, history of benign breast disease and family history of breast cancer. Thus, this study, based on a large data set, allows us to exclude the

  7. Effect of caffeine contained in a cup of coffee on microvascular function in healthy subjects.

    PubMed

    Noguchi, Katsuhiko; Matsuzaki, Toshihiro; Sakanashi, Mayuko; Hamadate, Naobumi; Uchida, Taro; Kina-Tanada, Mika; Kubota, Haruaki; Nakasone, Junko; Sakanashi, Matao; Ueda, Shinichiro; Masuzaki, Hiroaki; Ishiuchi, Shogo; Ohya, Yusuke; Tsutsui, Masato

    2015-02-01

    Recent epidemiological studies have demonstrated that coffee drinking is associated with reduced mortality of cardiovascular disease. However, its precise mechanisms remain to be clarified. In this study, we examined whether single ingestion of caffeine contained in a cup of coffee improves microvascular function in healthy subjects. A double-blind, placebo-controlled, crossover study was performed in 27 healthy volunteers. A cup of either caffeinated or decaffeinated coffee was drunk by the subjects, and reactive hyperemia of finger blood flow was assessed by laser Doppler flowmetry. In an interval of more than 2 days, the same experimental protocol was repeated with another coffee in a crossover manner. Caffeinated coffee intake slightly but significantly elevated blood pressure and decreased finger blood flow as compared with decaffeinated coffee intake. There was no significant difference in heart rate between caffeinated and decaffeinated coffee intake. Importantly, caffeinated coffee intake significantly enhanced post-occlusive reactive hyperemia of finger blood flow, an index of microvascular endothelial function, compared with decaffeinated coffee intake. These results provide the first evidence that caffeine contained in a cup of coffee enhances microvascular function in healthy individuals. PMID:25727960

  8. Chlorogenic acids and lactones in regular and water-decaffeinated arabica coffees.

    PubMed

    Farah, Adriana; de Paulis, Tomas; Moreira, Daniel P; Trugo, Luiz C; Martin, Peter R

    2006-01-25

    The market for decaffeinated coffees has been increasingly expanding over the years. Caffeine extraction may result in losses of other compounds such as chlorogenic acids (CGA) and, consequently, their 1,5-gamma-quinolactones (CGL) in roasted coffee. These phenolic compounds are important for flavor formation as well as the health effects of coffee; therefore, losses due to decaffeination need to be investigated. The present study evaluates the impact of decaffeination processing on CGA and CGL levels of green and roasted arabica coffees. Decaffeination produced a 16% average increase in the levels of total CGA in green coffee (dry matter), along with a 237% increase in CGL direct precursors. Different degrees of roasting showed average increments of 5.5-18% in CGL levels of decaffeinated coffee, compared to regular, a change more consistent with observed levels of total CGA than with those of CGL direct precursors in green samples. On the other hand, CGA levels in roasted coffee were 3-9% lower in decaffeinated coffee compared to regular coffee. Although differences in CGA and CGL contents of regular and decaffeinated roasted coffees appear to be relatively small, they may be enough to affect flavor characteristics as well as the biopharmacological properties of the final beverage, suggesting the need for further study. PMID:16417293

  9. Flaking process increases the NF-κB inhibition activity and melanoidin extractability of coffee.

    PubMed

    Chu, Yi-Fang; Hu, Kang; Hatzold, Thomas; Black, Richard M; Chen, Don

    2013-09-01

    Research on the health impacts of coffee has escalated. However, few studies were devoted to understanding the potential impact of mechanical processing on coffee's chemistry and subsequent health implications. Coffee flaking is a commonly used process to improve extractability and aroma characteristics. In this study, we studied the biochemical activity, chemical composition, and microstructure of coffee before and after flaking. We found that flaked coffee extract had 3.3-fold higher activity in inhibiting nuclear factor-kappa B (NF-κB) activation than regular coffee extract. Interestingly, flaking did not significantly alter the amount of coffee phenolics. It increased coffee melanoidin, by 2.1-fold, which likely contributed to the observed higher activity in inhibiting NF-κB activation. Flaking crushed cell walls revealed by microscopy might possibly result in disruption of polysaccharide entanglement and release of high-molecular-weight compounds, such as melanoidins. Consequently, the increased melanoidin content in the brew resulted in the increased inhibition of NF-κB activation. Small molecules, like coffee phenolics, are readily soluble in water during coffee brewing even without flaking, suggesting that flaking has no effect on its extractability. In summary, our investigation revealed that flaking enhanced NF-κB inhibition activity, possibly through the release of melanoidins from crushed cell microstructures. PMID:24804042

  10. Flaking process increases the NF-κB inhibition activity and melanoidin extractability of coffee

    PubMed Central

    Chu, Yi-Fang; Hu, Kang; Hatzold, Thomas; Black, Richard M; Chen, Don

    2013-01-01

    Research on the health impacts of coffee has escalated. However, few studies were devoted to understanding the potential impact of mechanical processing on coffee's chemistry and subsequent health implications. Coffee flaking is a commonly used process to improve extractability and aroma characteristics. In this study, we studied the biochemical activity, chemical composition, and microstructure of coffee before and after flaking. We found that flaked coffee extract had 3.3-fold higher activity in inhibiting nuclear factor-kappa B (NF-κB) activation than regular coffee extract. Interestingly, flaking did not significantly alter the amount of coffee phenolics. It increased coffee melanoidin, by 2.1-fold, which likely contributed to the observed higher activity in inhibiting NF-κB activation. Flaking crushed cell walls revealed by microscopy might possibly result in disruption of polysaccharide entanglement and release of high-molecular-weight compounds, such as melanoidins. Consequently, the increased melanoidin content in the brew resulted in the increased inhibition of NF-κB activation. Small molecules, like coffee phenolics, are readily soluble in water during coffee brewing even without flaking, suggesting that flaking has no effect on its extractability. In summary, our investigation revealed that flaking enhanced NF-κB inhibition activity, possibly through the release of melanoidins from crushed cell microstructures. PMID:24804042

  11. Identification of coffee components that stimulate dopamine release from pheochromocytoma cells (PC-12).

    PubMed

    Walker, J; Rohm, B; Lang, R; Pariza, M W; Hofmann, T; Somoza, V

    2012-02-01

    Coffee and caffeine are known to affect the limbic system, but data on the influence of coffee and coffee constituents on neurotransmitter release is limited. We investigated dopamine release and Ca(2+)-mobilization in pheochromocytoma cells (PC-12 cells) after stimulation with two lyophilized coffee beverages prepared from either Coffea arabica (AR) or Coffea canephora var. robusta (RB) beans and constituents thereof. Both coffee lyophilizates showed effects in dilutions between 1:100 and 1:10,000. To identify the active coffee compound, coffee constituents were tested in beverage and plasma representative concentrations. Caffeine, trigonelline, N-methylpyridinium, chlorogenic acid, catechol, pyrogallol and 5-hydroxytryptamides increased calcium signaling and dopamine release, although with different efficacies. While N-methylpyridinium stimulated the Ca(2+)-mobilization most potently (EC(200): 0.14±0.29μM), treatment of the cells with pyrogallol (EC(200): 48±14nM) or 5-hydroxytryptamides (EC(200): 10±3nM) lead to the most pronounced effect on dopamine release. In contrast, no effect was seen for the reconstituted biomimetic mixture. We therefore conclude that each of the coffee constituents tested stimulated the dopamine release in PC-12 cells. Since no effect was found for their biomimetic mixture, we hypothesize other coffee constituents being responsible for the dopamine release demonstrated for AR and RB coffee brews. PMID:22019894

  12. Effects of synthetic fertilizer on coffee yields and ecosystem services: Soil glomalin and parasitoids in a Costa Rican coffee agroecosystem

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We explored the relationships between synthetic fertilizer use, yield, and ecosystem services in a coffee agroecosystem in the Tarrazú region in the central highlands of Costa Rica. Working in nine farms ranging from 0.3 to 2.7ha in the CoopeTarrazú farmers' cooperative, we focused on two important ...

  13. Free α-dicarbonyl compounds in coffee, barley coffee and soy sauce and effects of in vitro digestion.

    PubMed

    Papetti, Adele; Mascherpa, Dora; Gazzani, Gabriella

    2014-12-01

    α-Dicarbonyl (α-DC) compounds were characterised in roasted (coffee, barley coffee) and in fermented (soy sauce) food matrices. Glyoxal (GO), methylglyoxal (MGO), diacetyl (DA) and 3-deoxyglucosone (3-DG) were found in all samples, and hydroxypyruvaldehyde and 5-hydroxypentane-2,3-dione in barley and soy. Cis and trans 3,4-dideoxyglucosone-3-ene (3,4-DGE) isomers and 4-glucosyl-5,6-dihydroxy-2-oxohexanal (4-G,3-DG) were found only in barley, and 3,4-DGE only in soy sauce with molasses. GO, MGO, and DA were quantified. Findings indicate that i) α-DC profiles depend on the food matrix and any technological treatments applied; ii) α-DC quantitation by HPLC requires matrix-specific, validated methods; iii) GO and MGO were the most abundant α-DCs; and iv) barley coffee was the matrix richest in α-DCs both qualitatively and quantitatively. In vitro simulated digestion reduced (coffee) or strongly increased (barley, soy sauce) free α-DC content. These findings suggest that α-DC bioavailability could actually depend not on food content but rather on reactions occurring during digestion. PMID:24996332

  14. Lipid content and composition of coffee brews prepared by different methods.

    PubMed

    Ratnayake, W M; Hollywood, R; O'Grady, E; Stavric, B

    1993-04-01

    The lipid content and composition of boiled, filtered, dripped, Turkish and espresso coffees prepared from roasted beans of Coffea arabica and Coffea robusta, and of coffees prepared from different brands of instant coffee were examined. The lipid content varied with the method of preparation. While coffee brews filtered through filter paper contained less than 7 mg lipids, those prepared by boiling without filtering and espresso coffee reached 60-160 mg lipids/150-ml cup. Coffee brew filtered through a metal screener contained 50 mg lipids/150-ml cup. Although the lipid content varied, the method of preparation of the brew and filtration had no important influence on the lipid composition. During paper filtration lipids remained mainly in spent coffee grounds, and the brew and filter paper retained only 0.4 and 9.4%, respectively, of the total lipids recovered. However, the lipids in the brew, filter paper and spent coffee grounds had the same profile, indicating that there was no preferential retention of a particular lipid component in filter paper. Triglycerides and diterpene alcohol esters were the major lipid classes in coffee brewed from ground coffee beans, and ranged from 86.6 to 92.9 and 6.5 to 12.5% of total lipids, respectively. For coffee brews made from instant coffee, the levels of these two lipid classes were 96.4-98.5 and 1.6-3.6%, respectively. The lipid contents of both regular and decaffeinated instant coffees varied slightly from one brand to the other, and ranged from 1.8 to 6.6 mg/150-ml cup. PMID:8477916

  15. Field-testing ecological and economic benefits of coffee certification programs.

    PubMed

    Philpott, Stacy M; Bichier, Peter; Rice, Robert; Greenberg, Russell

    2007-08-01

    Coffee agroecosystems are critical to the success of conservation efforts in Latin America because of their ecological and economic importance. Coffee certification programs may offer one way to protect biodiversity and maintain farmer livelihoods. Established coffee certification programs fall into three distinct, but not mutually exclusive categories: organic, fair trade, and shade. The results of previous studies demonstrate that shade certification can benefit biodiversity, but it remains unclear whether a farmer's participation in any certification program can provide both ecological and economic benefits. To assess the value of coffee certification for conservation efforts in the region, we examined economic and ecological aspects of coffee production for eight coffee cooperatives in Chiapas, Mexico, that were certified organic, certified organic and fair trade, or uncertified. We compared vegetation and ant and bird diversity in coffee farms and forests, and interviewed farmers to determine coffee yield, gross revenue from coffee production, and area in coffee production. Although there are no shade-certified farms in the study region, we used vegetation data to determine whether cooperatives would qualify for shade certification. We found no differences in vegetation characteristics, ant or bird species richness, or fraction of forest fauna in farms based on certification. Farmers with organic and organic and fair-trade certification had more land under cultivation and in some cases higher revenue than uncertified farmers. Coffee production area did not vary among farm types. No cooperative passed shade-coffee certification standards because the plantations lacked vertical stratification, yet vegetation variables for shade certification significantly correlated with ant and bird diversity. Although farmers in the Chiapas highlands with organic and/or fair-trade certification may reap some economic benefits from their certification status, their farms may

  16. Interaction of physical trainings and coffee intakes in fuel utilization during exercise in rats.

    PubMed

    Choi, Eun-Young; Cho, Yun-Ok

    2013-06-01

    This study investigates the impact of exercises, coffee intakes, and physical trainings on fuel utilization in rats. Ninety-six rats were fed a control diet with either water (C) or coffee (CF; 0.12 g freeze-dried instant coffee/100 g body weight/d). Additionally, the animals go through physical training (TC and TCF) or no training (NTC and NTCF) for 4 weeks. For physical training, animals have to exercise on treadmills for 30 minutes (5 d per week, 15° incline, 0.5-0.8 km/h). At the end of week 4, the animals in each group were subdivided into three exercise groups: before exercise (BE), during exercise (DE), and after exercise (AE). The DE rats exercised on treadmills for 1 hour immediately before being sacrificed. Hemoglobin, hematocrit, glucose, glycogen, protein, triglyceride (TG), and free fatty acid (FFA) levels in the plasma, liver, and skeletal muscle of the rats were compared accordingly. Organ weights were also measured. Coffee-training interaction had a significant impact on heart weight, visceral fat, hemoglobin, hematocrit, liver glycogen in DE and AE, and liver triglyceride in DE and AE. Exercise (meaning exercised on a treadmill for 1 hour immediately before being sacrificed) training interaction was significant in liver glycogen, muscle glycogen in control diet and control diet with coffee, FFA and muscle TG levels at control diet with coffee group. Exercise-coffee interactions significantly influenced the FFA with no training groups. Exercise-coffee-training interaction significantly effects on FFA, Liver TG and Muscle TG. Coffee intakes can increase lipolysis during exercising but coffee consumptions delay the recovery of liver glycogen levels in trained rats after exercising. Coffee intakes can increase lipolysis during exercising but coffee consumptions delay the recovery of liver glycogen levels in trained rats after exercising. Coffee can be an effective ergogenic aid during exercise for physically trained rats. PMID:23766878

  17. GIS-Based Multi-Criteria Analysis for Arabica Coffee Expansion in Rwanda

    PubMed Central

    Nzeyimana, Innocent; Hartemink, Alfred E.; Geissen, Violette

    2014-01-01

    The Government of Rwanda is implementing policies to increase the area of Arabica coffee production. Information on the suitable areas for sustainably growing Arabica coffee is still scarce. This study aimed to analyze suitable areas for Arabica coffee production. We analyzed the spatial distribution of actual and potential production zones for Arabica coffee, their productivity levels and predicted potential yields. We used a geographic information system (GIS) for a weighted overlay analysis to assess the major production zones of Arabica coffee and their qualitative productivity indices. Actual coffee yields were measured in the field and were used to assess potential productivity zones and yields using ordinary kriging with ArcGIS software. The production of coffee covers about 32 000 ha, or 2.3% of all cultivated land in the country. The major zones of production are the Kivu Lake Borders, Central Plateau, Eastern Plateau, and Mayaga agro-ecological zones, where coffee is mainly cultivated on moderate slopes. In the highlands, coffee is grown on steep slopes that can exceed 55%. About 21% percent of the country has a moderate yield potential, ranging between 1.0 and 1.6 t coffee ha−1, and 70% has a low yield potential (<1.0 t coffee ha−1). Only 9% of the country has a high yield potential of 1.6–2.4 t coffee ha−1. Those areas are found near Lake Kivu where the dominant soil Orders are Inceptisols and Ultisols. Moderate yield potential is found in the Birunga (volcano), Congo-Nile watershed Divide, Impala and Imbo zones. Low-yield regions (<1 t ha−1) occur in the eastern semi-dry lowlands, Central Plateau, Eastern Plateau, Buberuka Highlands, and Mayaga zones. The weighted overlay analysis and ordinary kriging indicated a large spatial variability of potential productivity indices. Increasing the area and productivity of coffee in Rwanda thus has considerable potential. PMID:25299459

  18. Interaction of physical trainings and coffee intakes in fuel utilization during exercise in rats

    PubMed Central

    Choi, Eun-Young

    2013-01-01

    This study investigates the impact of exercises, coffee intakes, and physical trainings on fuel utilization in rats. Ninety-six rats were fed a control diet with either water (C) or coffee (CF; 0.12 g freeze-dried instant coffee/100 g body weight/d). Additionally, the animals go through physical training (TC and TCF) or no training (NTC and NTCF) for 4 weeks. For physical training, animals have to exercise on treadmills for 30 minutes (5 d per week, 15° incline, 0.5-0.8 km/h). At the end of week 4, the animals in each group were subdivided into three exercise groups: before exercise (BE), during exercise (DE), and after exercise (AE). The DE rats exercised on treadmills for 1 hour immediately before being sacrificed. Hemoglobin, hematocrit, glucose, glycogen, protein, triglyceride (TG), and free fatty acid (FFA) levels in the plasma, liver, and skeletal muscle of the rats were compared accordingly. Organ weights were also measured. Coffee-training interaction had a significant impact on heart weight, visceral fat, hemoglobin, hematocrit, liver glycogen in DE and AE, and liver triglyceride in DE and AE. Exercise (meaning exercised on a treadmill for 1 hour immediately before being sacrificed) training interaction was significant in liver glycogen, muscle glycogen in control diet and control diet with coffee, FFA and muscle TG levels at control diet with coffee group. Exercise-coffee interactions significantly influenced the FFA with no training groups. Exercise-coffee-training interaction significantly effects on FFA, Liver TG and Muscle TG. Coffee intakes can increase lipolysis during exercising but coffee consumptions delay the recovery of liver glycogen levels in trained rats after exercising. Coffee intakes can increase lipolysis during exercising but coffee consumptions delay the recovery of liver glycogen levels in trained rats after exercising. Coffee can be an effective ergogenic aid during exercise for physically trained rats. PMID:23766878

  19. GIS-based multi-criteria analysis for Arabica coffee expansion in Rwanda.

    PubMed

    Nzeyimana, Innocent; Hartemink, Alfred E; Geissen, Violette

    2014-01-01

    The Government of Rwanda is implementing policies to increase the area of Arabica coffee production. Information on the suitable areas for sustainably growing Arabica coffee is still scarce. This study aimed to analyze suitable areas for Arabica coffee production. We analyzed the spatial distribution of actual and potential production zones for Arabica coffee, their productivity levels and predicted potential yields. We used a geographic information system (GIS) for a weighted overlay analysis to assess the major production zones of Arabica coffee and their qualitative productivity indices. Actual coffee yields were measured in the field and were used to assess potential productivity zones and yields using ordinary kriging with ArcGIS software. The production of coffee covers about 32 000 ha, or 2.3% of all cultivated land in the country. The major zones of production are the Kivu Lake Borders, Central Plateau, Eastern Plateau, and Mayaga agro-ecological zones, where coffee is mainly cultivated on moderate slopes. In the highlands, coffee is grown on steep slopes that can exceed 55%. About 21% percent of the country has a moderate yield potential, ranging between 1.0 and 1.6 t coffee ha-1, and 70% has a low yield potential (<1.0 t coffee ha-1). Only 9% of the country has a high yield potential of 1.6-2.4 t coffee ha-1. Those areas are found near Lake Kivu where the dominant soil Orders are Inceptisols and Ultisols. Moderate yield potential is found in the Birunga (volcano), Congo-Nile watershed Divide, Impala and Imbo zones. Low-yield regions (<1 t ha-1) occur in the eastern semi-dry lowlands, Central Plateau, Eastern Plateau, Buberuka Highlands, and Mayaga zones. The weighted overlay analysis and ordinary kriging indicated a large spatial variability of potential productivity indices. Increasing the area and productivity of coffee in Rwanda thus has considerable potential. PMID:25299459

  20. Molecular markers detect cryptic predation on coffee berry borer (Coleoptera: Curculionidae) by silvanid and laemophloeid flat bark beetles (Coleoptera: Silvanidae, Laemophloeidae) in coffee beans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei(Coleoptera: Curculionidae)(Ferrari), is a serious pest of coffee worldwide and has been recently introduced in Hawai’i, first detected in the state in 2010. Adult silvanid flat bark beetles, Cathartus quadricollis (Coleoptera: Silvanidae) and adult laemoph...

  1. Commercial Capaciflector

    NASA Technical Reports Server (NTRS)

    Vranish, John M.

    1991-01-01

    A capacitive proximity/tactile sensor with unique performance capabilities ('capaciflector' or capacitive reflector) is being developed by NASA/Goddard Space Flight Center (GSFC) for use on robots and payloads in space in the interests of safety, efficiency, and ease of operation. Specifically, this sensor will permit robots and their attached payloads to avoid collisions in space with humans and other objects and to dock these payloads in a cluttered environment. The sensor is simple, robust, and inexpensive to manufacture with obvious and recognized commercial possibilities. Accordingly, NASA/GSFC, in conjunction with industry, is embarking on an effort to 'spin' this technology off into the private sector. This effort includes prototypes aimed at commercial applications. The principles of operation of these prototypes are described along with hardware, software, modelling, and test results. The hardware description includes both the physical sensor in terms of a flexible printed circuit board and the electronic circuitry. The software description will include filtering and detection techniques. The modelling will involve finite element electric field analysis and will underline techniques used for design optimization.

  2. Activity-guided fractionation to characterize a coffee beverage that effectively down-regulates mechanisms of gastric acid secretion as compared to regular coffee.

    PubMed

    Rubach, Malte; Lang, Roman; Skupin, Carola; Hofmann, Thomas; Somoza, Veronika

    2010-04-14

    In some individuals, the consumption of coffee beverages is related to symptoms of gastric irritation. Hot water steam-treatment of raw coffee beans is hypothesized to reduce the contents of stomach irritating compounds, and products to which this technology is applied are launched as stomach-friendly coffee. However, data on the effect of steam-treated coffee on gastric acid secretion are conflicting and it has not been proven yet as to which coffee components act as pro- or antisecretory stimulants. The work presented here aimed at the characterization of a coffee beverage that effectively down-regulates mechanisms of proton secretion in human gastric cells (HGT-1). At first, a regular coffee beverage was fractionated by using solvents of different polarity: water, ethylacetate, dichloromethane, and pentane. Functional assays on the proton secretory activity (PSA) of these solvent fractions revealed the least pronounced effect for the water fraction, for which quantitative analyses demonstrated the highest distribution of chlorogenic acid (95%), (beta)N-alkanoyl-5-hydroxytryptamides (55%), and N-methylpyridinium (N-MP, >99%) among all fractions. Following experiments demonstrated that HGT-1 cells treated with regular coffee fortified with N-MP at a concentration of about 20 mg/mL N-MP showed a significantly decreased PSA as compared to cells which were exposed to coffee beverages containing higher (32-34 mg/L) or lower (5 mg/L) N-MP concentrations. Results from cellular pathway analyses of transcription (ATF-1 and Akt1) and signaling (cAMP and EGFr) factors and kinases (ERK1/2), and experiments on the gene expression of pro (histamine-HRH2 and acetylcholine-CHRM3)- and anti (somatostatin-SSTR1)-secretory receptors and H(+),K(+)-ATPase verified this antisecretory activity of N-MP in coffee beverages. PMID:20235536

  3. Interactions between major chlorogenic acid isomers and chemical changes in coffee brew that affect antioxidant activities.

    PubMed

    Liang, Ningjian; Xue, Wei; Kennepohl, Pierre; Kitts, David D

    2016-12-15

    Coffee bean source and roasting conditions significantly (p<0.05) affected the content of chlorogenic acid (CGA) isomers, several indices of browning and subsequent antioxidant values. Principal component analysis was used to interpret the correlations between physiochemical and antioxidant parameters of coffee. CGA isomer content was positively correlated (p<0.001) to capacity of coffee to reduce nitric oxide and scavenge Frémy's salt. Indices of browning in roasted coffee were positively correlated (p<0.001) to ABTS and TEMPO radical scavenging capacity, respectively. Only the CGA content of coffee corresponded to intracellular antioxidant capacity measured in Caco-2 intestinal cells. This study concluded that the intracellular antioxidant capacity that best describes potential health benefits of coffee positively corresponds best with CGA content. PMID:27451179

  4. Investigation of the effects of coffee on alertness and performance during the day and night.

    PubMed

    Smith, A P; Brockman, P; Flynn, R; Maben, A; Thomas, M

    1993-01-01

    An experiment was carried out to examine the effects of coffee on performance and alertness in the day and at night. The results showed that caffeinated coffee had a beneficial effect on alertness and improved performance on a variety of tasks in both day and night sessions. The effects were often very large. For example, at night, consumption of caffeinated coffee produced comparable alertness ratings to the day-time ratings given when juice was drunk. In contrast to the effects of caffeinated coffee, the difference between the decaffeinated coffee and juice were small and variable. Overall, these results clearly demonstrate the beneficial effects of consuming caffeinated coffee, and show that this effect is comparable in the day and night. PMID:8232842

  5. Native bees mediate long-distance pollen dispersal in a shade coffee landscape mosaic

    PubMed Central

    Jha, Shalene; Dick, Christopher W.

    2010-01-01

    Coffee farms are often embedded within a mosaic of agriculture and forest fragments in the world's most biologically diverse tropical regions. Although shade coffee farms can potentially support native pollinator communities, the degree to which these pollinators facilitate gene flow for native trees is unknown. We examined the role of native bees as vectors of gene flow for a reproductively specialized native tree, Miconia affinis, in a shade coffee and remnant forest landscape mosaic. We demonstrate extensive cross-habitat gene flow by native bees, with pollination events spanning more than 1,800 m. Pollen was carried twice as far within shade coffee habitat as in nearby forest, and trees growing within shade coffee farms received pollen from a far greater number of sires than trees within remnant forest. The study shows that shade coffee habitats support specialized native pollinators that enhance the fecundity and genetic diversity of remnant native trees. PMID:20660738

  6. Antioxidant activity and bioactive compounds of lettuce improved by espresso coffee residues.

    PubMed

    Cruz, Rebeca; Gomes, Teresa; Ferreira, Anabela; Mendes, Eulália; Baptista, Paula; Cunha, Sara; Pereira, José Alberto; Ramalhosa, Elsa; Casal, Susana

    2014-02-15

    The antioxidant activity and individual bioactive compounds of lettuce, cultivated with 2.5-30% (v/v) of fresh or composted espresso spent coffee grounds, were assessed. A progressive enhancement of lettuce's antioxidant capacity, evaluated by radical scavenging effect and reducing power, was exhibited with the increment of fresh spent coffee amounts, while this pattern was not so clear with composted treatments. Total reducing capacity also improved, particularly for low spent coffee concentrations. Additionally, very significant positive correlations were observed for all carotenoids in plants from fresh spent coffee treatments, particularly for violaxanthin, evaluated by HPLC. Furthermore, chlorophyll a was a good discriminating factor between control group and all spent coffee treated samples, while vitamin E was not significantly affected. Espresso spent coffee grounds are a recognised and valuable source of bioactive compounds, proving herein, for the first time, to potentiate the antioxidant pool and quality of the vegetables produced. PMID:24128454

  7. The Coffee Berry Borer (Hypothenemus hampei) Invades Hawaii: Preliminary Investigations on Trap Response and Alternate Hosts

    PubMed Central

    Messing, Russell H.

    2012-01-01

    In August 2010 the coffee berry borer, Hypothenemus hampei, was first reported to have invaded the Kona coffee growing region of Hawaii, posing a severe economic challenge to the fourth largest agricultural commodity in the State. Despite its long and widespread occurrence throughout the tropics as the most serious pest of coffee, there are still discrepancies in the literature regarding several basic aspects of berry borer biology relevant to its control. In Kona coffee plantations, we investigated the beetles’ response to several trap and lure formulations, and examined the occurrence of beetles in seeds of alternate host plants occurring adjacent to coffee farms. While traps were shown to capture significant numbers of beetles per day, and the occurrence of beetles in alternate hosts was quite rare, the unique situation of coffee culture in Hawaii will make this pest extremely challenging to manage in the Islands. PMID:26466620

  8. Coffee provides a natural multitarget pharmacopeia against the hallmarks of cancer.

    PubMed

    Gaascht, François; Dicato, Mario; Diederich, Marc

    2015-11-01

    Coffee is the second most popular beverage in the world after water with a consumption of approximately two billion cups per day. Due to its low cost and ease of preparation, it is consumed in almost all countries and by all social classes of the population through different modes of preparation. Despites its simple appearance, a cup of coffee is in fact a complex mixture that contains hundreds of molecules, the composition and concentration of which vary widely and depend on factors including the origin of the coffee tree or its metabolism. Although an excessive consumption of coffee can be harmful, many molecules that are present in this black decoction exert anticancer properties. This review aims to describe the different primary coffee-containing substances that exert chemopreventive and bioactive activities against the different hallmarks and enabling characteristics of cancer, thus explaining the anticancer health benefit of black coffee. PMID:26577824

  9. The Coffee Berry Borer (Hypothenemus hampei) Invades Hawaii: Preliminary Investigations on Trap Response and Alternate Hosts.

    PubMed

    Messing, Russell H

    2012-01-01

    In August 2010 the coffee berry borer, Hypothenemus hampei, was first reported to have invaded the Kona coffee growing region of Hawaii, posing a severe economic challenge to the fourth largest agricultural commodity in the State. Despite its long and widespread occurrence throughout the tropics as the most serious pest of coffee, there are still discrepancies in the literature regarding several basic aspects of berry borer biology relevant to its control. In Kona coffee plantations, we investigated the beetles' response to several trap and lure formulations, and examined the occurrence of beetles in seeds of alternate host plants occurring adjacent to coffee farms. While traps were shown to capture significant numbers of beetles per day, and the occurrence of beetles in alternate hosts was quite rare, the unique situation of coffee culture in Hawaii will make this pest extremely challenging to manage in the Islands. PMID:26466620

  10. The content of Ca, Cu, Fe, Mg and Mn and antioxidant activity of green coffee brews.

    PubMed

    Stelmach, Ewelina; Pohl, Pawel; Szymczycha-Madeja, Anna

    2015-09-01

    A simple and fast method of the analysis of green coffee infusions was developed to measure total concentrations of Ca, Cu, Fe, Mg and Mn by high resolution-continuum source flame atomic absorption spectrometry. The precision of the method was within 1-8%, while the accuracy was within -1% to 2%. The method was used to the analysis of infusions of twelve green coffees of different geographical origin. It was found that Ca and Mg were leached the easiest, i.e., on average 75% and 70%, respectively. As compared to the mug coffee preparation, the rate of the extraction of elements was increased when infusions were prepared using dripper or Turkish coffee preparation methods. Additionally, it was established that the antioxidant activity of green coffee infusions prepared using the mug coffee preparation was high, 75% on average, and positively correlated with the total content of phenolic compounds and the concentration of Ca in the brew. PMID:25842341

  11. Commercial LANDSAT?

    NASA Astrophysics Data System (ADS)

    Private industry should assume responsibility either for the United States' land satellite (LANDSAT) system or for both the land and the weather satellite systems, recommends the Land Remote Sensing Satellite Advisory Committee. The committee (Eos, June 29, 1982, p. 553), composed of representatives from academia, industry, and government, has a working group that is evaluating the potential for commercialization of remote sensing satellites.The recommendations call for industry ownership or operation of either or both of the remote sensing systems, but only up to and including the holding of raw, unprocessed data. The National Aeronautics and Space Administration (NASA) currently operates LANDSAT but will be relinquishing its responsibility to the National Oceanic and Atmospheric Administration (NOAA) on January 31. NOAA already operates the U.S. civilian weather satellite service, which includes the NOAA-5, NOAA-6, and the Geostationary Operational Environmental (GOES) satellites (Eos, June 2, 1981, p. 522).

  12. Geochemistry of Brazilian oil shales

    SciTech Connect

    Neto, C.C.

    1983-02-01

    A general survey of the main brazilian oil shale formations presenting their location, oil reserve, age and stratigraphy introduces this paper. It is followed by a comparative survey of the data on chemical composition (elementary, minerals and organic constituents/biological markers) and of thermal alteration indexes in order to define their maturity. The geochemical phenomena involved with a large diabase intrusion in the Irati formation is particularly stressed. The analytical methods of Solid Phase Extraction and Functional Group Marker developed for the analysis of bitumens and kerogens and the results obtained from the application of these methods to brazilian oil shales are discussed. The paper ends with a brief description of a comprehensive analytical bibliography on brazilian oil shales prepared to serve as a data base for these organites.

  13. [Evaluation of Brazilian online pharmacies].

    PubMed

    Gondim, Ana Paula Soares; Falcão, Cláudio Borges

    2007-04-01

    The growing number of Internet users brought forth an increase in the search for Brazilian online pharmacy services. Aiming at evaluating the validity of information disseminated in these websites, a descriptive study was carried out in 18 virtual pharmacies concerning legal aspects, accessibility, sources of information and drug advertising. It was found 15 pharmacies did not have authorization of the Brazilian National Health Surveillance Agency; the manager pharmaceutical officer's name could not be found in 17 of them; 17 pharmacies marketed drugs with no registration, especially herbal medicines, and did not show either information on adverse drug reactions or this agency's alerts and health recommendations. Since health control and drug commerce in Brazilian online pharmacies have not been yet regulated by proper government agencies, these gaps found in the sites can pose risk to the users' health. PMID:17384808

  14. I drink for my liver, Doc: emerging evidence that coffee prevents cirrhosis.

    PubMed

    Feld, Jordan J; Lavoie, Élise G; Fausther, Michel; Dranoff, Jonathan A

    2015-01-01

    Evidence demonstrating that regular ingestion of coffee has salutary effects on patients with chronic liver disease is accumulating rapidly. Specifically, it appears that coffee ingestion can slow the progression of liver fibrosis, preventing cirrhosis and hepatocellular carcinoma (HCC). This should excite clinicians and scientists alike, since these observations, if true, would create effective, testable hypotheses that should lead to improved understanding on fibrosis pathogenesis and thus may generate novel pharmacologic treatments of patients with chronic liver disease. This review is designed to examine the relevant clinical and epidemiological data in critical fashion and to examine the putative pharmacological effects of coffee relevant to the pathogenesis of liver fibrosis and cirrhosis. We hope that this will inspire relevant critical analyses, especially among "coffee skeptics". Of note, one major assumption made by this review is that the bulk of the effects of coffee consumption are mediated by caffeine, rather than by other chemical constituents of coffee. Our rationales for this assumption are threefold: first, caffeine's effects on adenosinergic signaling provide testable hypotheses; second, although there are  myriad chemical constituents of coffee, they are present in very low concentrations, and perhaps more importantly, vary greatly between coffee products and production methods (it is important to note that we do not dismiss the "botanical" hypothesis here; rather, we do not emphasize it at present due to the limitations of the studies examined); lastly, some (but not all) observational studies have examined both coffee and non-coffee caffeine consumption and found consistent effects, and when examined, no benefit to decaffeinated coffee has been observed. Further, in the interval since we examined this phenomenon last, further evidence has accumulated supporting caffeine as the effector molecule for coffee's salutary effects. PMID:25977756

  15. Interactions between volatile and nonvolatile coffee components. 1. Screening of nonvolatile components.

    PubMed

    Charles-Bernard, Marielle; Kraehenbuehl, Karin; Rytz, Andreas; Roberts, Deborah D

    2005-06-01

    This study is the first of two publications that investigate the phenomena of coffee nonvolatiles interacting with coffee volatile compounds. The purpose was to identify which coffee nonvolatile(s) are responsible for the interactions observed between nonvolatile coffee brew constituents and thiols, sulfides, pyrroles, and diketones. The overall interaction of these compounds with coffee brews prepared with green coffee beans roasted at three different roasting levels (light, medium, and dark), purified nonvolatiles, and medium roasted coffee brew fractions (1% solids after 1 or 24 h) was measured using a headspace solid-phase microextraction technique. The dark roasted coffee brew was slightly more reactive toward the selected compounds than the light roasted coffee brew. Selected pure coffee constituents, such as caffeine, trigonelline, arabinogalactans, chlorogenic acid, and caffeic acid, showed few interactions with the coffee volatiles. Upon fractionation of medium roasted coffee brew by solid-phase extraction, dialysis, size exclusion chromatography, or anion exchange chromatography, characterization of each fraction, evaluation of the interactions with the aromas, and correlation between the chemical composition of the fractions and the magnitude of the interactions, the following general conclusions were drawn. (1) Low molecular weight and positively charged melanoidins present significant interactions. (2) Strong correlations were shown between the melanoidin and protein/peptide content, on one hand, and the extent of interactions, on the other hand (R = 0.83-0.98, depending on the volatile compound). (3) Chlorogenic acids and carbohydrates play a secondary role, because only weak correlations with the interactions were found in complex matrixes. PMID:15913304

  16. [Diphenols and caramel compounds in roasted coffees of different varieties. II. (author's transl)].

    PubMed

    Tressl, R; Bahri, D; Köppler, H; Jensen, A

    1978-08-30

    Eleven diphenols and seven caramel compounds were extracted from roasted coffee with pentane/ether (1 + 1), silylated with BSTFA, characterized, and semiquantified by GC-MS. Seven phenols and five caramel components were identified for the first time in roasted coffee. Robusta coffee contained the highest amounts of phenols and maltol. Arabica showed higher amounts of furaneol (2.5-dimethyl-4-hydroxy-3(2H)-furanone), isomaltol, 5-hydroxymaltol, and 5-hydroxy-5.6-dihydromaltol. PMID:706805

  17. The roasting process does not influence the extent of conjugation of coffee chlorogenic and phenolic acids.

    PubMed

    Sanchez-Bridge, Belén; Renouf, Mathieu; Sauser, Julien; Beaumont, Maurice; Actis-Goretta, Lucas

    2016-05-01

    Understanding the bioavailability and metabolism of coffee compounds will contribute to identify the unknown biological mechanism(s) linked to their beneficial effects. The influence of the roasting process on the metabolism of coffee chlorogenic acids in humans was evaluated. In a randomized, double-blind, crossover study, 12 healthy volunteers consumed four instant coffees namely, high roasted coffee (HRC), low roasted coffee (LRC), unroasted coffee (URC), and in vitro hydrolyzed unroasted coffee (HURC). The sum of areas under the curve (AUC) ranged from 8.65-17.6 to 30.9-126 µM/h (P < 0.05) for HRC, LRC, URC, and HURC, respectively. The AUC of HRC, LRC, and URC was correlated with the initial level of phenolic acids in the coffee drinks. Despite different absorption rates, the extent of conjugation was comparable between HRC, LRC, and URC coffees but different for HURC. The most abundant circulating metabolites during the first 5 H were dihydroferulic acid (DHFA), caffeic acid-3'-O-sulfate (CA3S) and isoferulic-3'-O-glucuronide (iFA3G). DHFA and 5-4-dihydro-m-coumaric acid (mDHCoA) were the main metabolites in the period of 5-24 H. The phenolic compounds after consumption of HURC were most rapidly absorbed (Tmax 1 H) compared with the other coffees (Tmax between 9 and 11 H). Using coffees with different degrees of roasting we highlighted that in spite of different absorption rates the extent of conjugation of phenolic acids was comparable. In addition, by using a hydrolyzed unroasted coffee we demonstrated an increased absorption of phenolic acids in the small intestine. © 2016 BioFactors, 42(3):259-267, 2016. PMID:26899568

  18. Reduced Coffee Consumption Among Individuals with Primary Sclerosing Cholangitis but Not Primary Biliary Cirrhosis

    PubMed Central

    Lammert, Craig; Juran, Brian D.; Schlicht, Erik; Xie, Xiao; Atkinson, Elizabeth J.; de Andrade, Mariza; Lazaridis, Konstantinos N.

    2014-01-01

    Background & Aims Coffee consumption has been associated with decreased risk of liver disease and related outcomes. However, coffee drinking has not been investigated among patients with cholestatic autoimmune liver diseases, primary biliary cirrhosis (PBC), or primary sclerosing cholangitis (PSC). We investigated the relationship between coffee consumption and risk of PBC and PSC in a large North American cohort. Methods Lifetime coffee drinking habits were determined from responses to questionnaires from 606 patients with PBC, 480 with PSC, and 564 healthy volunteers (controls). Patients (those with PBC or PSC) were compared to controls utilizing the Wilcoxon rank sum test for continuous variables and c2 method for discrete variables. Logistic regression was used to analyze the estimate the effects of different coffee parameters (time, frequency, and type of coffee consumption) after adjusting for age, sex, smoking status, and education level. Results Patients with PBC and controls did not differ in coffee parameters. However, 24% of patients with PSC had never drank coffee compared to 16% of controls (P<.05), and only 67% were current drinkers compared with 77% of controls (P<.05). Patients with PSC also consumed fewer lifetime cups per month (45 vs 47 for controls, P<.05) and spent a smaller percentage of their lifetime of coffee drinking coffee (46.6% vs 66.7% for controls, P<.05). These differences remained significant in a multivariate model. Among PSC patients with concurrent ulcerative colitis, coffee protected against proctocolectomy (hazard ratio=0.34, P<.001). Conclusions Coffee consumption is lower among patients with PSC, but not PBC, compared to controls. PMID:24440215

  19. Effect of Household Coffee Processing on Pesticide Residues as a Means of Ensuring Consumers' Safety.

    PubMed

    Mekonen, Seblework; Ambelu, Argaw; Spanoghe, Pieter

    2015-09-30

    Coffee is a highly consumed and popular beverage all over the world; however, coffee beans used for daily consumption may contain pesticide residues that may cause adverse health effects to consumers. In this monitoring study, the effect of household coffee processing on pesticide residues in coffee beans was investigated. Twelve pesticides, including metabolites and isomers (endosulfan α, endosulfan β, cypermethrin, permethrin, deltamethrin, chlorpyrifos ethyl, heptachlor epoxide, hexachlorobenzene, p'p-DDE, p'p-DDD, o'p-DDT, and p'p-DDT) were spiked in coffee beans collected from a local market in southwestern Ethiopia. The subsequent household coffee processing conditions (washing, roasting, and brewing) were established as closely as possible to the traditional household coffee processing in Ethiopia. Washing of coffee beans showed 14.63-57.69 percent reduction, while the roasting process reduced up to 99.8 percent. Chlorpyrifos ethyl, permethrin, cypermethrin, endosulfan α and β in roasting and all of the 12 pesticides in the coffee brewing processes were not detected. Kruskal-Wallis analysis indicated that the reduction of pesticide residues by washing is significantly different from roasting and brewing (P < 0.0001). However, there was no significant difference between coffee roasting and brewing (P > 0.05). The processing factor (PF) was less than one (PF < 1), which indicates reduction of pesticides under study during processing of the coffee beans. The cumulative effect of the three processing methods has a paramount importance in evaluating the risks associated with ingestion of pesticide residues, particularly in coffee beans. PMID:26344013

  20. Physicochemical characteristics of green coffee: comparison of graded and defective beans.

    PubMed

    Ramalakshmi, K; Kubra, I R; Rao, L J M

    2007-06-01

    Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems. PMID:17995751

  1. Screening of raw coffee for thiol binding site precursors using "in bean" model roasting experiments.

    PubMed

    Müller, Christoph; Hofmann, Thomas

    2005-04-01

    The purpose of the following study was to investigate the influence of coffee roasting on the thiol-binding activity of coffee beverages, and to investigate the potential of various green bean compounds as precursors of thiol-binding sites by using promising "in bean" model roast experiments. Headspace gas chromatographic analysis on coffee brews incubated in the presence of the roasty-sulfury smelling 2-furfurylthiol for 20 min at 30 degrees C in septum-closed vessels revealed that the amounts of "free" thiol decreased drastically with increasing the roasting degree of the beans used for preparation of the brews. A half-maximal binding capacity (BC(50)) of 183 mg of 2-furfurylthiol per liter of standard coffee beverage was determined for a roasted coffee (CTN value of 67), thus demonstrating that enormous amounts of the odor-active thiol are "bound" by the coffee. Furthermore, biomimetic "in bean" precursor experiments have been performed in order to elucidate the precursor for the thiol-binding sites in the raw coffee bean. These experiments opened the possibility of studying coffee model reactions under quasi-natural roasting conditions and undoubtedly identified chlorogenic acids as well as thermal degradation products caffeic acid and quinic acid as important precursors for low-molecular-weight thiol-binding sites. In particular, when roasted in the presence of transition metal ions, chlorogenic acids and even more caffeic acid showed thiol-binding activity which was comparable to the activity measured for the authentic coffee brew. PMID:15796603

  2. Effects of coffees before and after special treatment procedure on cell membrane potentials in stomach cells.

    PubMed

    Fiebich, B L; Valente, P; Ferrer-Montiel, A; Candelario-Jalil, E; Menthe, J; Luecker, P

    2006-01-01

    Coffee, one of the most excessively used beverages worldwide, commences the risk of gastroesophageal reflux (GER), which may lead to gastric ulcers and increase the risk of gastric cancer. Many attempts have been made by the coffee industry to diminish the irritating effect on mucosa by means of altering the extraction methods concerning gerbic acids and the roasting processes. This paper describes the effect of differently produced coffees involving two brands of Darboven and two brands of other coffee roasters. The aim of this study was to prove the results of gastric potential measurements we found in literature by using human AGS gastric epithelial cells (human adenocarcinoma). All four coffee extracts tested differentially affected the membrane resting potential of AGS cells. Coffees no. 1 and no. 2 depolarized the cells, presumably by increasing the cation entry into the cytosol. In marked contrast, coffee no. 4 hyperpolarizes the cells, possibly by H(+) extrusion and/or Cl(-) influx, suggesting that this coffee might increase acidity in the stomach, which might negatively affect the stomach, especially in people with gastroesophageal reflux symptoms. Overall, our data suggest that different roasting methods of coffees affect the membrane potentials of AGS stomach cells, resulting in increased influx of H+ possibly resulting in decreased stomach acidity and thus reducing GER. These results are in good accordance with clinical pharmacological results from potential difference measurements in healthy volunteers we found in the literature. PMID:16894406

  3. Coffee Enema for Preparation for Small Bowel Video Capsule Endoscopy: A Pilot Study

    PubMed Central

    Kim, Eun Sun; Keum, Bora; Seo, Yeon Seok; Jeen, Yoon Tae; Lee, Hong Sik; Um, Soon Ho; Kim, Chang Duck; Ryu, Ho Sang

    2014-01-01

    Coffee enemas are believed to cause dilatation of bile ducts and excretion of bile through the colon wall. Proponents of coffee enemas claim that the cafestol palmitate in coffee enhances the activity of glutathione S-transferase, an enzyme that stimulates bile excretion. During video capsule endoscopy (VCE), excreted bile is one of the causes of poor preparation of the small bowel. This study aimed to evaluate the feasibility and effect of coffee enema for preparation of the small bowel during VCE. In this pilot study, 17 of 34 patients were assigned to the coffee enema plus polyethylene glycol (PEG) 2 L ingestion group, whereas the 17 remaining control patients received 2 L of PEG only. The quality of bowel preparation was evaluated in the two patient groups. Bowel preparations in the proximal segments of small bowel were not differ between two groups. In the mid and distal segments of the small intestine, bowel preparations tend to be better in patients who received coffee enemas plus PEG than in patients who received PEG only. The coffee enema group did not experience any complications or side effects. Coffee enemas may be a feasible option, and there were no clinically significant adverse events related to coffee enemas. More prospective randomized studies are warranted to improve small bowel preparation for VCE. PMID:25136541

  4. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    PubMed

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans. PMID:26344962

  5. Effect of Coffee Consumption on the Progression of Type 2 Diabetes Mellitus among Prediabetic Individuals

    PubMed Central

    Lee, Ji-Ho; Lim, Jun-Tae; Kim, Haa-Gyoung; Lee, Won-Joon

    2016-01-01

    Background A previous large-scale cohort study investigated the relationship between coffee intake and the progression of diabetes mellitus in the United States. However, studies on the effects of coffee on diabetes are rare in South Korea. Therefore, this study assessed the amount and method of coffee intake in Koreans in order to determine if coffee intake has a prophylactic effect on diabetes progression. Methods This study included 3,497 prediabetic patients from a single medical institution, with glycated hemoglobin levels ranging from 5.7% to 6.4%. Cross-tabulation and Kaplan-Meier survival analyses were performed to compare patients with and without diabetes progression based on the frequency and method of coffee intake. Cox proportional hazard analysis was performed to correct for confounding variables. Results The observation period (mean±standard deviation) was 3.7±2.3 years. Kaplan-Meier survival analysis revealed that the risk of diabetes progression was lowest in patients who drank black coffee three or more times per day (P=0.036). However, correction for confounding variables in Cox proportional hazard analysis revealed that, while the risk was lower for the patients who typically consumed black coffee than for those who mixed creamer and sugar into their coffees, the difference was not significant. Conclusion The results of this study suggest that drinking coffee without sugar and creamer at least three times daily has the greatest preventive effect on diabetes onset. PMID:26885316

  6. Additive effects of vertebrate predators on insects in a Puerto Rican coffee plantation

    USGS Publications Warehouse

    Borkhataria, R.R.; Collazo, J.A.; Groom, M.J.

    2006-01-01

    A variety of studies have established the value of shaded coffee plantations as habitat for birds. While the value of birds as biological controls in coffee has received some attention, the interactions between birds and other predators of insects have not been tested. We used exclosures to examine the effects of vertebrate predators on the arthropods associated with coffee, in particular the coffee leafminer (Leucoptera coffeella) and the flatid planthopper Petrusa epilepsis, in a shaded coffee plantation in Puerto Rico. We used a 2 x 2 factorial design with four treatments: exclusion of birds, lizards, birds and lizards, and control (no exclusion). Abundance of insects >5 mm increased when birds or both birds and lizards were removed. Birds and lizards had an additive effect for insects <5 mm and for all insects combined. Coffee leafminers showed a weak response to removal of predators while planthopper abundance increased significantly in the absence of avian predators. Arthropod predators and parasitoids did not differ significantly between treatments. Our findings suggest that vertebrate insectivores have an additive effect on insects in coffee and may help control abundances of some coffee pests. Equally important, we present evidence suggesting that they do not interfere with other known natural enemies of coffee pests. ?? 2006 by the Ecological Society of America.

  7. Additive effects of vertebrate predators on insects in a Puerto Rican coffee plantation.

    PubMed

    Borkhataria, Rena R; Collazo, Jaime A; Groom, Martha J

    2006-04-01

    A variety of studies have established the value of shaded coffee plantations as habitat for birds. While the value of birds as biological controls in coffee has received some attention, the interactions between birds and other predators of insects have not been tested. We used exclosures to examine the effects of vertebrate predators on the arthropods associated with coffee, in particular the coffee leafminer (Leucoptera coffeella) and the flatid planthopper Petrusa epilepsis, in a shaded coffee plantation in Puerto Rico. We used a 2 x 2 factorial design with four treatments: exclusion of birds, lizards, birds and lizards, and control (no exclusion). Abundance of insects > 5 mm increased when birds or both birds and lizards were removed. Birds and lizards had an additive effect for insects < 5 mm and for all insects combined. Coffee leafminers showed a weak response to removal of predators while planthopper abundance increased significantly in the absence of avian predators. Arthropod predators and parasitoids did not differ significantly between treatments. Our findings suggest that vertebrate insectivores have an additive effect on insects in coffee and may help control abundances of some coffee pests. Equally important, we present evidence suggesting that they do not interfere with other known natural enemies of coffee pests. PMID:16711056

  8. Automated high resolution mapping of coffee in Rwanda using an expert Bayesian network

    NASA Astrophysics Data System (ADS)

    Mukashema, A.; Veldkamp, A.; Vrieling, A.

    2014-12-01

    African highland agro-ecosystems are dominated by small-scale agricultural fields that often contain a mix of annual and perennial crops. This makes such systems difficult to map by remote sensing. We developed an expert Bayesian network model to extract the small-scale coffee fields of Rwanda from very high resolution data. The model was subsequently applied to aerial orthophotos covering more than 99% of Rwanda and on one QuickBird image for the remaining part. The method consists of a stepwise adjustment of pixel probabilities, which incorporates expert knowledge on size of coffee trees and fields, and on their location. The initial naive Bayesian network, which is a spectral-based classification, yielded a coffee map with an overall accuracy of around 50%. This confirms that standard spectral variables alone cannot accurately identify coffee fields from high resolution images. The combination of spectral and ancillary data (DEM and a forest map) allowed mapping of coffee fields and associated uncertainties with an overall accuracy of 87%. Aggregated to district units, the mapped coffee areas demonstrated a high correlation with the coffee areas reported in the detailed national coffee census of 2009 (R2 = 0.92). Unlike the census data our map provides high spatial resolution of coffee area patterns of Rwanda. The proposed method has potential for mapping other perennial small scale cropping systems in the East African Highlands and elsewhere.

  9. Natural occurrence of ochratoxin A and antioxidant activities of green and roasted coffees and corresponding byproducts.

    PubMed

    Napolitano, Aurora; Fogliano, Vincenzo; Tafuri, Alessio; Ritieni, Alberto

    2007-12-12

    Ochratoxin A is an important mycotoxin that can enter the human food chain in cereals, wine, coffee, spices, beer, cocoa, dried fruits, and pork meats. Coffee is one of the most common beverages and, consequently, it has a potential risk factor for human health related to ochratoxin A exposure. In this study, coffee and corresponding byproducts from seven different geographic regions were investigated for ochratoxin A natural occurrence by HPLC-FLD, nutritional characterization, and antioxidant activities by spectrophotometric assay. The research focused on composition changes in coffee during the processing step "from field to cup". Costa Rica and Indian green coffees were the most contaminated samples, with 13 and 11 microg/kg, respectively, while the Ethiopian coffee was the least contaminated, with 3.8 microg/kg of ochratoxin A. The reduction of ochratoxin A contamination during the roasting step was comparable for any samples that were considered under the recommended level of 4 microg/kg. Total dietary fibers ranged from 58.7% for Vietnam and 48.6% for Ivory Coast in green coffees and ranged from 58.6% for Costa Rica to 61.2% for India in roasted coffee. Coffee silverskin byproduct obtained from Ivory Coast was the highest, with 69.2 and 64.2% of insoluble dietary fibers, respectively. PMID:18020409

  10. Hypothenemus hampei (Coleoptera: Curculionidae) and its interactions with Azteca instabilis and Pheidole synanthropica (Hymenoptera: Formicidae) in a shade coffee agroecosystem.

    PubMed

    Jiménez-Soto, Estelí; Cruz-Rodríguez, Juan A; Vandermeer, John; Perfecto, Ivette

    2013-10-01

    The coffee berry borer is currently the most important insect pest of coffee worldwide. In shaded coffee farms such as Finca Irlanda in Chiapas, Mexico, natural enemies limit coffee berry borer and potentially prevent outbreaks. This research aimed to determine the effect of ants on coffee berry borer damage and to describe behaviors of Azteca instabilis F. Smith and Pheidole synanthropica (Longino 2009) when encountering the coffee berry borer. To these ends, an ant survey was conducted in a 2,500-m(2) plot within the farm. A 4- by 4-m coordinate system was established, and the coffee plant or shade tree closest to the coordinate point was sampled using tuna fish for a total of 168 coffee plants and 46 shade trees sampled. In addition, up to 100 berries were harvested from 138 coffee plants to measure damage and verify the presence of the coffee berry borer. Behavior was determined in the field by placing live coffee berry borer adults on berries and video recording all attacks. Results showed that plants with ants had less percentage of damaged berries and shorter coffee berry borer galleries than plants without ants. However, the length of galleries in plants with A. instabilis showed no significant differences from plants without ants. P. synanthropica was observed carrying coffee berry borer to the nest in 50% of the cases, whereas A. instabilis threw coffee berry borer off of the coffee plant in 79% of the cases. Results indicate that the presence of these species of ants reduce coffee berry borer damage and suggest that different behaviors could explain the pattern of coffee berry borer attack in this agroecosystem. PMID:24331603

  11. Shade-grown coffee in Puerto Rico: Opportunities to preserve biodiversity while reinvigorating a struggling agricultural commodity

    USGS Publications Warehouse

    Borkhataria, R.; Collazo, J.A.; Groom, M.J.; Jordan-Garcia, A.

    2012-01-01

    Shade-grown coffee contributes to biodiversity conservation and has many ecological benefits. We reviewed historical trends in coffee production and interviewed 100 coffee growers in 1999 to determine current management practices and attitudes toward the cultivation of sun and shade coffee in Puerto Rico. We discuss the outlook for the coffee industry in the 21st century and implications for biodiversity conservation, hoping lessons from Puerto Rico will apply to the international coffee industry. Throughout the 20th century, government intervention, including subsidies and technical assistance, supported coffee farming in Puerto Rico. In an effort to modernize coffee production and increase yields, the conversion from shade to sun coffee plantations was encouraged. Despite government support, the amount of land devoted to this once dominant agricultural commodity declined markedly between 1982 and 2007 (84%), due to labor shortages, low income, and catastrophic hurricanes. We found that a return to shaded plantations would be embraced by most farmers. Growers of shaded coffee were generally happier with their cultivation practices (89.3% satisfied) than growers of sun coffee (60.9% satisfied), valued biodiversity, and were willing to cultivate coffee under shade if given similar incentives to those received for farming sun coffee. The future of the coffee industry in Puerto Rico may depend on government programs that capitalize upon emerging markets for sustainably produced, shade-grown coffee. We conclude that where governments have close ties to the coffee industry, they should strive to wed economic development with the conservation of biodiversity and associated ecological services by providing support and incentives for the production of shade coffee. ?? 2011 Elsevier B.V.

  12. Brazilian Mothers' Socialization Goals: Intracultural Differences in Seven Brazilian Cities

    ERIC Educational Resources Information Center

    Seidl-de-Moura, Maria Lucia; Lordelo, Eulina; Vieira, Mauro Luis; Piccinini, Cesar Augusto; Siqueira, Jose de Oliveira; Magalhaes, Celina Maria Colino; Pontes, Fernando Augusto Ramos; Salomao, Nadia Maria; Rimoli, Adriana

    2008-01-01

    The present study aimed to investigate Brazilian mothers' socialization goals. The participants in the study were 349 primiparous mothers, whose ages ranged from 17 to 47 years (mean = 26.6 years), who had children aged between 1 and 48 months (mean = 16.4 months). The families were living in seven different cities representing each of the five…

  13. Microwave-assisted methanolysis of green coffee oil.

    PubMed

    Oigman, S S; de Souza, R O M A; Dos Santos Júnior, H M; Hovell, A M C; Hamerski, L; Rezende, C M

    2012-09-15

    Optimisation of a microwave-assisted methanolysis was performed to obtain cafestol and kahweol directly from green coffee oil (Coffea arabica). A two-factor (the methanolysis period and temperature), three-level, factorial experimental design (3(2)) was adopted. The methanolysis procedure was performed under microwave irradiation, using closed vessel and accurate fast responding internal fibre-optic temperature probe. The effects on the responses were measured by HPLC. After 3 min of microwave irradiation (hold time) at 100°C, with 500 mg of green coffee oil, a yield higher than 99% was obtained. The yield of this reaction is 26% after 2h when working under conventional heating. The methods described in the literature lead to long reaction times, poor yields and formation of side products. The microwave-assisted technique proved to be faster, avoided undesired side products and gave better conversion, when compared to conventional heating process. PMID:23107719

  14. Increased sister chromatid exchange associated with smoking and coffee consumption.

    PubMed

    Reidy, J A; Annest, J L; Chen, A T; Welty, T K

    1988-01-01

    Sister chromatid exchange (SCE) is a very sensitive cytogenetic assay for detecting exposure to chemical mutagens and carcinogens. One application of SCE is the monitoring of populations believed to be exposed to such agents. We have, however, relatively little knowledge about common lifestyle factors that may influence SCE and therefore complicate any study designed to examine the effects of exposure to genotoxins. In this study, we assessed the effect of cigarette smoking and coffee consumption on SCE. Smoking was associated with an increase of approximately 2 SCEs per cell and a decrease in cell proliferation. A positive linear relationship between SCE and coffee consumption was also observed. This effect was similar for smokers and nonsmokers. Additionally, the folic acid content of cell culture medium seemed to affect neither SCE nor cell proliferation. PMID:3169009

  15. CoffeeShop Astrophysics: An Adventure in Public Outreach

    NASA Astrophysics Data System (ADS)

    Chamberlin, Sydney; Decesar, Megan; Caudill, Sarah; Sadeghian, Laleh; Nuttall, Laura; Urban, Alex; McGrath, Casey

    2016-03-01

    Engaging non-scientists in scientific discussions is inarguably important, both for researchers and society. Public lectures have long been utilized as a method for performing such outreach, but due to their format and location often reach a limited audience. More recently, events such as science cafés (events pairing a scientist with the public in a casual venue) have emerged as a potential tool for connecting with general audiences. The success of these events depends on multiple variables. In this talk, we describe an example of such an event entitled CoffeeShop Astrophysics, that uses multiple speakers, demonstrations and humor to successfully engage members of the public. We discuss the key elements that make CoffeeShop Astrophysics effective, and the viability of grassroots, coffeeshop-style outreach. The authors gratefully acknowledge support from the American Physical Society for this work.

  16. Microbiological Spoilage of Spices, Nuts, Cocoa, and Coffee

    NASA Astrophysics Data System (ADS)

    Pinkas, Joan M.; Battista, Karen; Morille-Hinds, Theodora

    Spices, nuts, cocoa, and coffee are raw materials that may be used alone or as ingredients in the manufacture of processed food products. The control of microbiological spoilage of these raw materials at the ingredient stage will enable the food processor to better assure the production of high-quality foods with an acceptable shelf life. While this chapter is limited to four materials, many of the spoilage control procedures recommended can also be applied to other raw materials of a similar nature.

  17. A functional role for the colleters of coffee flowers

    PubMed Central

    Mayer, Juliana Lischka Sampaio; Carmello-Guerreiro, Sandra Maria; Mazzafera, Paulo

    2013-01-01

    Colleters are protuberances or trichomes that produce and release an exudate that overlays vegetative or reproductive buds. Colleters have a functional definition, as they are thought to protect young tissues against dehydration and pest attack. Decaffeinated coffee plants, named Decaffito®, have recently been obtained through chemical mutagenesis, and in addition to the absence of the alkaloid, the flowers of these plants open precociously. Decaffito mutants exhibit minimal production and secretion of the exudate by the colleters. We compared these mutants with normal coffee plants to infer the functional role of colleters and the secreted exudate covering flower buds. Decaffito mutants were obtained by sodium azide mutagenesis of Coffea arabica cv. Catuaí seeds. Wild-type plants were used as controls and are referred to as Catuaí. The flower colleters were analysed by scanning and transmission electron microscopy in addition to histochemical analysis. Histochemical analysis indicated the presence of heterogeneous exudate in the secretory cells of the colleters of both variants of coffee trees. Alkaloids were detected in Catuaí but not in Decaffito. Transmission electron microscopy revealed that the secretory cells in the Catuaí colleters possessed the normal and common characteristics found in secretory structures. In the secretory cells of the Decaffito colleters, it was not possible to identify any organelles or even the nucleus, but the cells had a darkened central cytoplasm, indicating that the secretion is produced in low amounts but not released. Our results offer a proof of concept of colleters in coffee, strongly indicating that the exudate covering the flower parts works as an adhesive to keep the petals together and the flower closed, which in part helps to avoid dehydration. Additionally, the exudate itself helps to prevent water loss from the epidermal cells of the petals.

  18. Commercial applications

    NASA Astrophysics Data System (ADS)

    The near term (one to five year) needs of domestic and foreign commercial suppliers of radiochemicals and radiopharmaceuticals for electromagnetically separated stable isotopes are assessed. Only isotopes purchased to make products for sale and profit are considered. Radiopharmaceuticals produced from enriched stable isotopes supplied by the Calutron facility at ORNL are used in about 600,000 medical procedures each year in the United States. A temporary or permanent disruption of the supply of stable isotopes to the domestic radiopharmaceutical industry could curtail, if not eliminate, the use of such diagnostic procedures as the thallium heart scan, the gallium cancer scan, the gallium abscess scan, and the low radiation dose thyroid scan. An alternative source of enriched stable isotopes exist in the USSR. Alternative starting materials could, in theory, eventually be developed for both the thallium and gallium scans. The development of a new technology for these purposes, however, would take at least five years and would be expensive. Hence, any disruption of the supply of enriched isotopes from ORNL and the resulting unavailability of critical nuclear medicine procedures would have a dramatic negative effect on the level of health care in the United States.

  19. Forest bolsters bird abundance, pest control and coffee yield.

    PubMed

    Karp, Daniel S; Mendenhall, Chase D; Sandí, Randi Figueroa; Chaumont, Nicolas; Ehrlich, Paul R; Hadly, Elizabeth A; Daily, Gretchen C

    2013-11-01

    Efforts to maximise crop yields are fuelling agricultural intensification, exacerbating the biodiversity crisis. Low-intensity agricultural practices, however, may not sacrifice yields if they support biodiversity-driven ecosystem services. We quantified the value native predators provide to farmers by consuming coffee's most damaging insect pest, the coffee berry borer beetle (Hypothenemus hampei). Our experiments in Costa Rica showed birds reduced infestation by ~ 50%, bats played a marginal role, and farmland forest cover increased pest removal. We identified borer-consuming bird species by assaying faeces for borer DNA and found higher borer-predator abundances on more forested plantations. Our coarse estimate is that forest patches doubled pest control over 230 km2 by providing habitat for ~ 55 000 borer-consuming birds. These pest-control services prevented US$75-US$310 ha-year(-1) in damage, a benefit per plantation on par with the average annual income of a Costa Rican citizen. Retaining forest and accounting for pest control demonstrates a win-win for biodiversity and coffee farmers. PMID:23981013

  20. Metal release from coffee machines and electric kettles.

    PubMed

    Müller, Frederic D; Hackethal, Christin; Schmidt, Roman; Kappenstein, Oliver; Pfaff, Karla; Luch, Andreas

    2015-01-01

    The release of elemental ions from 8 coffee machines and 11 electric kettles into food simulants was investigated. Three different types of coffee machines were tested: portafilter espresso machines, pod machines and capsule machines. All machines were tested subsequently on 3 days before and on 3 days after decalcification. Decalcification of the machines was performed with agents according to procedures as specified in the respective manufacturer's manuals. The electric kettles showed only a low release of the elements analysed. For the coffee machines decreasing concentrations of elements were found from the first to the last sample taken in the course of 1 day. Metal release on consecutive days showed a decreasing trend as well. After decalcification a large increase in the amounts of elements released was encountered. In addition, the different machine types investigated clearly differed in their extent of element release. By far the highest leaching, both quantitatively and qualitatively, was found for the portafilter machines. With these products releases of Pb, Ni, Mn, Cr and Zn were in the range and beyond the release limits as proposed by the Council of Europe. Therefore, a careful rinsing routine, especially after decalcification, is recommended for these machines. The comparably lower extent of release of one particular portafilter machine demonstrates that metal release at levels above the threshold that triggers health concerns are technically avoidable. PMID:26436214

  1. Coffee Stains from Drops with Receding Contact Lines

    NASA Astrophysics Data System (ADS)

    Freed-Brown, Julian

    2015-03-01

    We present a framework for calculating the surface density profile of a coffee stain deposited by a drying drop with a receding contact line. For standard coffee stains, the fluid pins to the substrate, forces flow towards the exterior of the drop and deposits a thin, concentrated ring of particles. Unlike a pinned drop, a receding drop pushes fluid towards its interior and continuously deposits mass across its substrate as it evaporates. This gives rise to a new class of mountain-like morphologies that are not seen in the standard coffee ring effect but are reminiscent of recent experimental results. For a thin, circular drop with uniform evaporation, we calculate the surface density profile analytically and find that it diverges towards the center of the drop as η ~r - 1 / 2 , where r is the distance from the center. We estimate how this divergence is softened due to solute interactions at the final stage of drying. Our framework can easily be extended numerically or analytically to investigate novel stain morphologies left by drying drops of different shapes and evaporation profiles. This work is part of a thesis project advised by Tom Witten. It was supported in part by the National Science Foundation's MRSEC Program under Award Number DMR 0820054.

  2. Strength of self-pinning in coffee drops

    NASA Astrophysics Data System (ADS)

    Latka, Andrzej; Kawczinski, Kimberly; Nagel, Sidney

    The equilibrium contact angle θe of a liquid drop placed on a solid surface is uniquely determined by a balance of surface tension forces according to Young's Equation, yet is rarely observed in real systems. Due to contact angle hysteresis, liquids can make contact with a surface at any angle between the receding and advancing contact angle: θR <θe <θA . A particularly striking example of this phenomenon is the familiar coffee stain. For coffee θR = 0 , thus as the drop evaporates the contact line remains pinned at its initial location. This results in the majority of the coffee being deposited in a characteristic ring at the drop's original boundary. We investigate how solid particles suspended in a liquid could so strongly influence contact angle hysteresis, by measuring the receding contact angle of a drop at various times during the evaporation process. For low solute concentrations, θR slowly decreases as the drop evaporates, but remains positive. Surprisingly, we find that increasing the solute concentration results in θR = 0 and a fully pinned contact line almost immediately after the drop is deposited.

  3. Quercetin, not caffeine, is a major neuroprotective component in coffee.

    PubMed

    Lee, Moonhee; McGeer, Edith G; McGeer, Patrick L

    2016-10-01

    Epidemiologic studies indicate that coffee consumption reduces the risk of Parkinson's disease and Alzheimer's disease. To determine the factors involved, we examined the protective effects of coffee components. The test involved prevention of neurotoxicity to SH-SY5Y cells that was induced by lipopolysaccharide plus interferon-γ or interferon-γ released from activated microglia and astrocytes. We found that quercetin, flavones, chlorogenic acid, and caffeine protected SH-SY5Y cells from these toxins. They also reduced the release of tumor necrosis factor-α and interleukin-6 from the activated microglia and astrocytes and attenuated the activation of proteins from P38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa light chain enhancer of activated B cells (NFκB). After exposure to toxin containing glial-stimulated conditioned medium, we also found that quercetin reduced oxidative/nitrative damage to DNA, as well as to the lipids and proteins of SH-SY5Y cells. There was a resultant increase in [GSH]i in SH-SY5Y cells. The data indicate that quercetin is the major neuroprotective component in coffee against Parkinson's disease and Alzheimer's disease. PMID:27479153

  4. Optimization of biogas production from coffee production waste.

    PubMed

    Battista, Federico; Fino, Debora; Mancini, Giuseppe

    2016-01-01

    This study was conducted to investigate the effects of chemical pretreatments on biogas production from coffee waste. After the preparation of a mixture of coffee waste with a TS concentration of 10%w/w, basic and acid pretreatments were conducted in batch mode and their performances were compared with the biogas produced from a mixture without any pretreatment stage. The basic pretreatment demonstrated a very good action on the hydrolysis of the lignin and cellulose, and permitted a biogas production of about 18NL/L with a methane content of almost 80%v/v. Thus, the basic pretreatment has been used to scale-up the process. The coffee refuse was has been carried out in a 45L anaerobic reactor working in continuous mode and in a mesophilic condition (35°C) with a Hydraulic Retention Time (HRT) of about 40days. A high biogas production of 1.14NL/Ld, with a methane percentage of 65%v/v was obtained, thus permitting a process yield of about 83% to be obtained. PMID:26600457

  5. Coffee silverskin: characterization, possible uses, and safety aspects.

    PubMed

    Toschi, Tullia Gallina; Cardenia, Vladimiro; Bonaga, Giorgio; Mandrioli, Mara; Rodriguez-Estrada, Maria Teresa

    2014-11-01

    The reuse of coffee silverskin (CS), the main waste product of the coffee-roasting industry, could be an alternative to its environmental disposal. However, CS could also contain undesirable compounds, such as ochratoxin A (OTA) and phytosterol oxidation products (POPs). A study on the composition of CS (caffeine, moisture, dietary fibers, carbohydrates, and polyphenol contents) was carried out, with emphasis on OTA and POPs for safety reasons. The lipid fraction showed significant amounts of linoleic acid and phytosterols (7.0 and 12.1% of lipid fraction). Noticeable levels of POPs (114.11 mg/100 g CS) were found, and the phytosterol oxidation rate varied from 27.6 to 48.1%. The OTA content was 18.7-34.4 μg/kg CS, which is about 3 times higher than the European Commission limits for coffee products. The results suggest that CS could be used as a source of cellulose and/or bioactive compounds; however, the contents of POPs and OTA might represent a risk for human safety if intended for human or livestock use. PMID:25321090

  6. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    NASA Astrophysics Data System (ADS)

    Petracco, Marino

    2005-08-01

    Coffee beverages are so popular all over the world that there is hardly any need to describe them. But underlying this seemingly commonplace beverage there is a whole realm worth serious scientific study. The complexity of the raw seed matrix, made even more intricate when roasted, requires a deep understanding of its chemical nature. While coffee is not consumed for nutritional purposes, it is appreciated for its taste appeal along with its stimulating effects on mental and physical activity. The attention to quality is of paramount importance to both of these aspects to supply the customers with a pleasant and wholesome product. The chemical approach to the sensory sphere has seen the development of increasingly sophisticated analytical methods where the parts per billion of volatile aromas are not the ultimate frontier of detection limits. In spite of the progress of instrumental techniques, the cup-testing approach still remains the final assessment tool to obtain the approval for choosing the right plant and for conveying the product to the market. This is even truer when espresso, the fashionable type of coffee brewing methods, is considered.

  7. Applications of pectinases in the commercial sector: a review.

    PubMed

    Kashyap, D R; Vohra, P K; Chopra, S; Tewari, R

    2001-05-01

    Pectinases are one of the upcoming enzymes of fruit and textile industries. These enzymes break down complex polysaccharides of plant tissues into simpler molecules like galacturonic acids. The role of acidic pectinases in bringing down the cloudiness and bitterness of fruit juices is well established. Recently, there has been a good number of reports on the application of alkaline pectinases in the textile industry for the retting and degumming of fiber crops, production of good quality paper, fermentation of coffee and tea, oil extractions and treatment of pectic waste water. This review discusses various types of pectinases and their applications in the commercial sector. PMID:11272008

  8. Jorge de Lima: Brazilian Poet

    ERIC Educational Resources Information Center

    Kennedy, James H.

    1973-01-01

    Discusses Jorge de Lima--born in Uniao dos Palmares, Brazil on April 23, 1893, died in Rio de Janeiro on November 15, 1953--who during the Twenties became an important member of the literary movement known as Modernism and wrote both religious and regional poetry constituting the beginnings of a Afro-Brazilian poetry. (Author/JM)

  9. Sustainability in Brazilian Federal Universities

    ERIC Educational Resources Information Center

    Palma, Lisiane Celia; de Oliveira, Lessandra M.; Viacava, Keitiline R.

    2011-01-01

    Purpose: The purpose of this paper is to identify the number of courses related to sustainability offered in bachelor degree programs of business administration in Brazilian federal universities. Design/methodology/approach: An exploratory research was carried out based on a descriptive scope. The process of mapping federal universities in Brazil…

  10. Gramscian Thought and Brazilian Education

    ERIC Educational Resources Information Center

    Dore, Rosemary

    2009-01-01

    In the history of Brazilian education, it is only since the 1980s, during the redemocratization of Brazil, that proposals for public education in a socialist perspective have been presented. The past two decades have been marked by a growing interest in Gramscian thought, mainly in the educational field, making possible the elaboration of…

  11. Implications of Scientific Collaboration Networks on Studies of Aquatic Vertebrates in the Brazilian Amazon

    PubMed Central

    Salinero, María Celeste; Michalski, Fernanda

    2016-01-01

    The quantity of wildlife extracted from the Amazon has increased in the past decades as a consequence of an increase in human population density and income growth. To evaluate the spatial distribution of studies on subsistence and/or commercial hunting conducted in the Brazilian Amazon, we selected eight mid-sized and large-bodied aquatic vertebrate species with a history of human exploitation in the region. We used a combination of searches in the gray and scientific literature from the past 24 years to provide an updated distributional map of studies on the target species. We calculated the distances between the study sites and the locations of the research institutes/universities that the first and last authors of the same study were affiliated to. For the period of 1990 to 2014, we found 105 studies on the subsistence and/or commercial hunting of aquatic vertebrates in the Brazilian Amazon in 271 locations that involved 43 institutions (37 Brazilian and 6 international). The spatial distribution of the studies across the Brazilian Amazon varied, but over 80% took place in the northeast and central Amazon, encompassing three States of the Legal Brazilian Amazon (Amazonas, 51.42%; Pará, 19.05%; and Amapá, 16.19%). Over half of the research study sites (52.91%) were within 500 km of the research institute/university of the first or last authors. Some research institutes/universities did not have any inter-institutional collaborations, while others collaborated with eight or more institutes. Some research institutes/universities conducted many studies, had an extensive collaboration network, and contributed greatly to the network of studies on Amazonian aquatic vertebrates. Our research contributes to the knowledge of studies on the subsistence and/or commercial hunting of the most exploited aquatic vertebrates of the Brazilian Amazon, illustrates the impact that collaboration networks have on research, and highlights potential areas for improvement and the

  12. Implications of Scientific Collaboration Networks on Studies of Aquatic Vertebrates in the Brazilian Amazon.

    PubMed

    Salinero, María Celeste; Michalski, Fernanda

    2016-01-01

    The quantity of wildlife extracted from the Amazon has increased in the past decades as a consequence of an increase in human population density and income growth. To evaluate the spatial distribution of studies on subsistence and/or commercial hunting conducted in the Brazilian Amazon, we selected eight mid-sized and large-bodied aquatic vertebrate species with a history of human exploitation in the region. We used a combination of searches in the gray and scientific literature from the past 24 years to provide an updated distributional map of studies on the target species. We calculated the distances between the study sites and the locations of the research institutes/universities that the first and last authors of the same study were affiliated to. For the period of 1990 to 2014, we found 105 studies on the subsistence and/or commercial hunting of aquatic vertebrates in the Brazilian Amazon in 271 locations that involved 43 institutions (37 Brazilian and 6 international). The spatial distribution of the studies across the Brazilian Amazon varied, but over 80% took place in the northeast and central Amazon, encompassing three States of the Legal Brazilian Amazon (Amazonas, 51.42%; Pará, 19.05%; and Amapá, 16.19%). Over half of the research study sites (52.91%) were within 500 km of the research institute/university of the first or last authors. Some research institutes/universities did not have any inter-institutional collaborations, while others collaborated with eight or more institutes. Some research institutes/universities conducted many studies, had an extensive collaboration network, and contributed greatly to the network of studies on Amazonian aquatic vertebrates. Our research contributes to the knowledge of studies on the subsistence and/or commercial hunting of the most exploited aquatic vertebrates of the Brazilian Amazon, illustrates the impact that collaboration networks have on research, and highlights potential areas for improvement and the

  13. Some Like It Hot: The Influence and Implications of Climate Change on Coffee Berry Borer (Hypothenemus hampei) and Coffee Production in East Africa

    PubMed Central

    Vega, Fernando E.; Davis, Aaron; Borgemeister, Christian; Chabi-Olaye, Adenirin

    2011-01-01

    The negative effects of climate change are already evident for many of the 25 million coffee farmers across the tropics and the 90 billion dollar (US) coffee industry. The coffee berry borer (Hypothenemus hampei), the most important pest of coffee worldwide, has already benefited from the temperature rise in East Africa: increased damage to coffee crops and expansion in its distribution range have been reported. In order to anticipate threats and prioritize management actions for H. hampei we present here, maps on future distributions of H. hampei in coffee producing areas of East Africa. Using the CLIMEX model we relate present-day insect distributions to current climate and then project the fitted climatic envelopes under future scenarios A2A and B2B (for HADCM3 model). In both scenarios, the situation with H. hampei is forecasted to worsen in the current Coffea arabica producing areas of Ethiopia, the Ugandan part of the Lake Victoria and Mt. Elgon regions, Mt. Kenya and the Kenyan side of Mt. Elgon, and most of Rwanda and Burundi. The calculated hypothetical number of generations per year of H. hampei is predicted to increase in all C. arabica-producing areas from five to ten. These outcomes will have serious implications for C. arabica production and livelihoods in East Africa. We suggest that the best way to adapt to a rise of temperatures in coffee plantations could be via the introduction of shade trees in sun grown plantations. The aims of this study are to fill knowledge gaps existing in the coffee industry, and to draft an outline for the development of an adaptation strategy package for climate change on coffee production. An abstract in Spanish is provided as Abstract S1. PMID:21935419

  14. Molecular characterization of a miraculin-like gene differentially expressed during coffee development and coffee leaf miner infestation.

    PubMed

    Mondego, Jorge Maurício Costa; Duarte, Melina Pasini; Kiyota, Eduardo; Martínez, Leandro; de Camargo, Sandra Rodrigues; De Caroli, Fernanda P; Alves, Beatriz Santos Capela; Guerreiro, Sandra Maria Carmello; Oliva, Maria Luiza Vilela; Guerreiro-Filho, Oliveiro; Menossi, Marcelo

    2011-01-01

    The characterization of a coffee gene encoding a protein similar to miraculin-like proteins, which are members of the plant Kunitz serine trypsin inhibitor (STI) family of proteinase inhibitors (PIs), is described. PIs are important proteins in plant defence against insects and in the regulation of proteolysis during plant development. This gene has high identity with the Richadella dulcifica taste-modifying protein miraculin and with the tomato protein LeMir; and was named as CoMir (Coffea miraculin). Structural protein modelling indicated that CoMir had structural similarities with the Kunitz STI proteins, but suggested specific folding structures. CoMir was up-regulated after coffee leaf miner (Leucoptera coffella) oviposition in resistant plants of a progeny derived from crosses between C. racemosa (resistant) and C. arabica (susceptible). Interestingly, this gene was down-regulated during coffee leaf miner herbivory in susceptible plants. CoMir expression was up-regulated after abscisic acid application and wounding stress and was prominent during the early stages of flower and fruit development. In situ hybridization revealed that CoMir transcripts accumulated in the anther tissues that display programmed cell death (tapetum, endothecium and stomium) and in the metaxylem vessels of the petals, stigma and leaves. In addition, the recombinant protein CoMir shows inhibitory activity against trypsin. According to the present results CoMir may act in proteolytic regulation during coffee development and in the defence against L. coffeella. The similarity of CoMir with other Kunitz STI proteins and the role of CoMir in plant development and plant stress are discussed. PMID:20931223

  15. Characterization and Expression Analysis of Genes Directing Galactomannan Synthesis in Coffee

    PubMed Central

    Pré, Martial; Caillet, Victoria; Sobilo, Julien; McCarthy, James

    2008-01-01

    Background and Aims Galactomannans act as storage reserves for the seeds in some plants, such as guar (Cyamopsis tetragonoloba) and coffee (Coffea arabica and Coffea canephora). In coffee, the galactomannans can represent up to 25 % of the mass of the mature green coffee grain, and they exert a significant influence on the production of different types of coffee products. The objective of the current work was to isolate and characterize cDNA encoding proteins responsible for galactomannan synthesis in coffee and to study the expression of the corresponding transcripts in the developing coffee grain from C. arabica and C. canephora, which potentially exhibit slight galactomannan variations. Comparative gene expression analysis was also carried out for several other tissues of C. arabica and C. canephora. Methods cDNA banks, RACE-PCR and genome walking were used to generate full-length cDNA for two putative coffee mannan synthases (ManS) and two galactomannan galactosyl transferases (GMGT). Gene-specific probe-primer sets were then generated and used to carry out comparative expression analysis of the corresponding genes in different coffee tissues using quantitative RT-PCR Key Results Two of the putative galactomannan biosynthetic genes, ManS1 and GMGT1, were demonstrated to have very high expression in the developing coffee grain of both Coffea species during endosperm development, consistent with our proposal that these two genes are responsible for the production of the majority of the galactomannans found in the grain. In contrast, the expression data presented indicates that the ManS2 gene product is probably involved in the synthesis of the galactomannans found in green tissue. Conclusions The identification of genes implicated in galactomannan synthesis in coffee are presented. The data obtained will enable more detailed studies on the biosynthesis of this important component of coffee grain and contribute to a better understanding of some functional

  16. I drink for my liver, Doc: emerging evidence that coffee prevents cirrhosis

    PubMed Central

    Feld, Jordan J.; Lavoie, Élise G.; Fausther, Michel; Dranoff, Jonathan A.

    2015-01-01

    Evidence demonstrating that regular ingestion of coffee has salutary effects on patients with chronic liver disease is accumulating rapidly. Specifically, it appears that coffee ingestion can slow the progression of liver fibrosis, preventing cirrhosis and hepatocellular carcinoma (HCC). This should excite clinicians and scientists alike, since these observations, if true, would create effective, testable hypotheses that should lead to improved understanding on fibrosis pathogenesis and thus may generate novel pharmacologic treatments of patients with chronic liver disease. This review is designed to examine the relevant clinical and epidemiological data in critical fashion and to examine the putative pharmacological effects of coffee relevant to the pathogenesis of liver fibrosis and cirrhosis. We hope that this will inspire relevant critical analyses, especially among “coffee skeptics”. Of note, one major assumption made by this review is that the bulk of the effects of coffee consumption are mediated by caffeine, rather than by other chemical constituents of coffee. Our rationales for this assumption are threefold: first, caffeine’s effects on adenosinergic signaling provide testable hypotheses; second, although there are  myriad chemical constituents of coffee, they are present in very low concentrations, and perhaps more importantly, vary greatly between coffee products and production methods (it is important to note that we do not dismiss the “botanical” hypothesis here; rather, we do not emphasize it at present due to the limitations of the studies examined); lastly, some (but not all) observational studies have examined both coffee and non-coffee caffeine consumption and found consistent effects, and when examined, no benefit to decaffeinated coffee has been observed. Further, in the interval since we examined this phenomenon last, further evidence has accumulated supporting caffeine as the effector molecule for coffee’s salutary effects. PMID

  17. Coffee enhances the expression of chaperones and antioxidant proteins in rats with nonalcoholic fatty liver disease.

    PubMed

    Salomone, Federico; Li Volti, Giovanni; Vitaglione, Paola; Morisco, Filomena; Fogliano, Vincenzo; Zappalà, Agata; Palmigiano, Angelo; Garozzo, Domenico; Caporaso, Nicola; D'Argenio, Giuseppe; Galvano, Fabio

    2014-06-01

    Coffee consumption is inversely related to the degree of liver injury in patients with nonalcoholic fatty liver disease (NAFLD). Molecular mediators contributing to coffee's beneficial effects in NAFLD remain to be elucidated. In this study, we administrated decaffeinated espresso coffee or vehicle to rats fed an high-fat diet (HFD) for 12 weeks and examined the effects of coffee on liver injury by using two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) proteomic analysis combined with mass spectrometry. Rats fed an HFD and water developed panacinar steatosis, lobular inflammation, and mild fibrosis, whereas rats fed an HFD and coffee exhibited only mild steatosis. Coffee consumption increased liver expression of the endoplasmic reticulum chaperones glucose-related protein 78 and protein disulfide-isomerase A3; similarly, coffee drinking enhanced the expression of the mitochondrial chaperones heat stress protein 70 and DJ-1. Furthermore, in agreement with reduced hepatic levels of 8-isoprostanes and 8-hydroxy-2'-deoxyguanosine, proteomic analysis showed that coffee consumption induces the expression of master regulators of redox status (i.e., peroxiredoxin 1, glutathione S-transferase α2, and D-dopachrome tautomerase). Last, proteomics revealed an association of coffee intake with decreased expression of electron transfer flavoprotein subunit α, a component of the mitochondrial respiratory chain, involved in de novo lipogenesis. In this study, we were able to identify by proteomic analysis the stress proteins mediating the antioxidant effects of coffee; moreover, we establish for the first time the contribution of specific coffee-induced endoplasmic reticulum and mitochondrial chaperones ensuring correct protein folding and degradation in the liver. PMID:24365744

  18. Coffee consumption and risk of hypertension in the Polish arm of the HAPIEE cohort study

    PubMed Central

    Grosso, Giuseppe; Stepaniak, Urszula; Polak, Maciej; Micek, Agnieszka; Topor-Madry, Roman; Stefler, Denes; Szafraniec, Krystyna; Pajak, Andrzej

    2015-01-01

    Background/objectives Coffee consumption has been hypothesized to be associated with blood pressure, but previous findings are not homogenous. The aim of this study was to evaluate the association between coffee consumption and the risk of developing hypertension. Subjects/Methods Data on coffee consumption, blood pressure, and use of anti-hypertensive medicament were derived from 2,725 participants of the Polish arm of the HAPIEE project (Health, Alcohol and Psychosocial factors In Eastern Europe) who were free of hypertension at baseline and followed up for an average of 5 years. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by multivariate logistic regression analyses and stratified for potential confounding factors. Results Coffee consumption was related with decreased age, smoking status, and total energy intake. Compared to persons who drink <1 cup coffee per day, systolic blood pressure was significantly associated with coffee consumption and the risk of hypertension was lower for individuals consuming 3-4 cups/day. Despite the analysis stratified by gender showed that the protective effect of coffee consumption on hypertension was significant only in women, the analysis after stratification by smoking status revealed a decreased risk of hypertension in non-smokers drinking 3-4 cups of coffee per day, in both sexes (OR 0.41, 95% CI: 0.21, 0.79 for men and OR 0.54, 95% CI: 0.29, 0.99 for women). Upper category coffee consumption (>4 cups per day) was not related with significant increased risk of hypertension. Conclusions Relation between coffee consumption and incidence of hypertension was related to smoking status. Consumption of 3-4 cups of coffee per day decreased risk of hypertension in non-smoking men and women only. PMID:26220566

  19. The Effects of Preexercise Caffeinated Coffee Ingestion on Endurance Performance: An Evidence-Based Review.

    PubMed

    Higgins, Simon; Straight, Chad R; Lewis, Richard D

    2016-06-01

    Endurance athletes commonly ingest caffeine as a means to enhance training intensity and competitive performance. A widely-used source of caffeine is coffee, however conflicting evidence exists regarding the efficacy of coffee in improving endurance performance. In this context, the aims of this evidence-based review were threefold: 1) to evaluate the effects of preexercise coffee on endurance performance, 2) to evaluate the effects of coffee on perceived exertion during endurance performance, and 3) to translate the research into usable information for athletes to make an informed decision regarding the intake of caffeine via coffee as a potential ergogenic aid. Searches of three major databases were performed using terms caffeine and coffee, or coffee-caffeine, and endurance, or aerobic. Included studies (n = 9) evaluated the effects of caffeinated coffee on human subjects, provided the caffeine dose administered, administered caffeine ≥ 45 min before testing, and included a measure of endurance performance (e.g., time trial). Significant improvements in endurance performance were observed in five of nine studies, which were on average 24.2% over controls for time to exhaustion trials, and 3.1% for time to completion trials. Three of six studies found that coffee reduced perceived exertion during performance measures significantly more than control conditions (p < .05). Based on the reviewed studies there is moderate evidence supporting the use of coffee as an ergogenic aid to improve performance in endurance cycling and running. Coffee providing 3-8.1 mg/kg (1.36-3.68 mg/lb) of caffeine may be used as a safe alternative to anhydrous caffeine to improve endurance performance. PMID:26568580

  20. Biochar from Coffee Residues: A New Promising Sorbent

    NASA Astrophysics Data System (ADS)

    Fotopoulou, Kalliopi; Karapanagioti, Hrissi; Manariotis, Ioannis

    2014-05-01

    Biochar is a carbon-rich material produced by heating biomass in an oxygen-limited environment. Biochar is mainly used as an additive to soils to sequester carbon and improve soil fertility as well as a sorbent for environmental remediation processes. Surface properties such as point of zero charge, surface area and pore volume, surface topography, surface functional groups and acid-base behavior are important factors, which affect sorption efficiency. Understanding the surface alteration of biochars increases our understanding of the pollutant-sorbent interaction. The objective of the present study was to characterize the surface properties of biochar produced, and to investigate the effect of thermal treatment conditions on key characteristics that affect sorptive properties. The espresso coffee residue was obtained after the coffee was brewed through espresso machines in coffee shops. The coffee residue was dried and kept in an oven at 50oC until its pyrolysis at 850oC. Pyrolysis with different coffee mass and containers were tested in order to find optimum biochar characteristics. Detailed characterization techniques were carried out to determine the properties of the produced biochar. The surface area, the pore volume, and the average pore size of the biochars were determined using gas (N2) adsorption-desorption cycles using the Brunauer, Emmett, and Teller (BET) equation. Open surface area and micropore volume were determined using the t-plot method and the Harkins & Jura equation. Total organic carbon was also determined because it is an important factor that affects sorption. The results were compared with the corresponding properties of activated carbons. The biochar produced exhibited a wide range of surface area from 21 to 770 m2/g and open surface area from 21 to 65 m2/g. It is obvious that the surface area results from the formation of pores. Actually it was calculated that up to 90% of the porosity is due to the micropores. More specifically the

  1. High antioxidant activity of coffee silverskin extracts obtained by the treatment of coffee silverskin with subcritical water.

    PubMed

    Narita, Yusaku; Inouye, Kuniyo

    2012-12-01

    Coffee silverskin (CS) is a thin tegument of the outer layer of green coffee beans and a major by-product of the roasting process to produce roasted coffee beans. CS extracts obtained by the treatment of CS with subcritical water at 25-270°C were investigated for their antioxidant activity using hydrophilic oxygen radical absorption capacity (H-ORAC) and DPPH radical scavenging capacity assays. The antioxidant activity increased with increasing the extraction temperature and the highest activity was observed with the extracts obtained at 270°C. The H-ORAC and DPPH values of the extracts were 2629±193 and 379±36μmol TE/g of CS extract, respectively. High correlation (R=0.999) was observed between H-ORAC and DPPH values for the CS extracts. High correlation of the antioxidant activity was also observed with protein and phenolic contents in the extracts. The CS extracts could be useful as a good source of antioxidative materials. PMID:22953809

  2. Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

    SciTech Connect

    Ramalho, T.O.; Figueira, A.R.; Sotero, A.J.; Wang, R.; Geraldino Duarte, P.S.; Farman, M.; Goodin, M.M.

    2014-09-15

    The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays.

  3. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei.

    PubMed

    Vega, Fernando E; Brown, Stuart M; Chen, Hao; Shen, Eric; Nair, Mridul B; Ceja-Navarro, Javier A; Brodie, Eoin L; Infante, Francisco; Dowd, Patrick F; Pain, Arnab

    2015-01-01

    The coffee berry borer, Hypothenemus hampei, is the most economically important insect pest of coffee worldwide. We present an analysis of the draft genome of the coffee berry borer, the third genome for a Coleopteran species. The genome size is ca. 163 Mb with 19,222 predicted protein-coding genes. Analysis was focused on genes involved in primary digestion as well as gene families involved in detoxification of plant defense molecules and insecticides, such as carboxylesterases, cytochrome P450, gluthathione S-transferases, ATP-binding cassette transporters, and a gene that confers resistance to the insecticide dieldrin. A broad range of enzymes capable of degrading complex polysaccharides were identified. We also evaluated the pathogen defense system and found homologs to antimicrobial genes reported in the Drosophila genome. Ten cases of horizontal gene transfer were identified with evidence for expression, integration into the H. hampei genome, and phylogenetic evidence that the sequences are more closely related to bacterial rather than eukaryotic genes. The draft genome analysis broadly expands our knowledge on the biology of a devastating tropical insect pest and suggests new pest management strategies. PMID:26228545

  4. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei

    SciTech Connect

    Vega, Fernando E.; Brown, Stuart M.; Chen, Hao; Shen, Eric; Nair, Mridul B.; Ceja-Navarro, Javier A.; Brodie, Eoin L.; Infante, Francisco; Dowd, Patrick F.; Pain, Arnab

    2015-07-31

    The coffee berry borer, Hypothenemus hampei, is the most economically important insect pest of coffee worldwide. We present an analysis of the draft genome of the coffee berry borer, the third genome for a Coleopteran species. The genome size is ca. 163 Mb with 19,222 predicted protein-coding genes. Analysis was focused on genes involved in primary digestion as well as gene families involved in detoxification of plant defense molecules and insecticides, such as carboxylesterases, cytochrome P450, gluthathione S-transferases, ATP-binding cassette transporters, and a gene that confers resistance to the insecticide dieldrin. A broad range of enzymes capable of degrading complex polysaccharides were identified. We also evaluated the pathogen defense system and found homologs to antimicrobial genes reported in the Drosophila genome. Ten cases of horizontal gene transfer were identified with evidence for expression, integration into the H. hampei genome, and phylogenetic evidence that the sequences are more closely related to bacterial rather than eukaryotic genes. We find the draft genome analysis broadly expands our knowledge on the biology of a devastating tropical insect pest and suggests new pest management strategies.

  5. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei

    DOE PAGESBeta

    Vega, Fernando E.; Brown, Stuart M.; Chen, Hao; Shen, Eric; Nair, Mridul B.; Ceja-Navarro, Javier A.; Brodie, Eoin L.; Infante, Francisco; Dowd, Patrick F.; Pain, Arnab

    2015-07-31

    The coffee berry borer, Hypothenemus hampei, is the most economically important insect pest of coffee worldwide. We present an analysis of the draft genome of the coffee berry borer, the third genome for a Coleopteran species. The genome size is ca. 163 Mb with 19,222 predicted protein-coding genes. Analysis was focused on genes involved in primary digestion as well as gene families involved in detoxification of plant defense molecules and insecticides, such as carboxylesterases, cytochrome P450, gluthathione S-transferases, ATP-binding cassette transporters, and a gene that confers resistance to the insecticide dieldrin. A broad range of enzymes capable of degrading complexmore » polysaccharides were identified. We also evaluated the pathogen defense system and found homologs to antimicrobial genes reported in the Drosophila genome. Ten cases of horizontal gene transfer were identified with evidence for expression, integration into the H. hampei genome, and phylogenetic evidence that the sequences are more closely related to bacterial rather than eukaryotic genes. We find the draft genome analysis broadly expands our knowledge on the biology of a devastating tropical insect pest and suggests new pest management strategies.« less

  6. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei

    PubMed Central

    Vega, Fernando E.; Brown, Stuart M.; Chen, Hao; Shen, Eric; Nair, Mridul B.; Ceja-Navarro, Javier A.; Brodie, Eoin L.; Infante, Francisco; Dowd, Patrick F.; Pain, Arnab

    2015-01-01

    The coffee berry borer, Hypothenemus hampei, is the most economically important insect pest of coffee worldwide. We present an analysis of the draft genome of the coffee berry borer, the third genome for a Coleopteran species. The genome size is ca. 163 Mb with 19,222 predicted protein-coding genes. Analysis was focused on genes involved in primary digestion as well as gene families involved in detoxification of plant defense molecules and insecticides, such as carboxylesterases, cytochrome P450, gluthathione S-transferases, ATP-binding cassette transporters, and a gene that confers resistance to the insecticide dieldrin. A broad range of enzymes capable of degrading complex polysaccharides were identified. We also evaluated the pathogen defense system and found homologs to antimicrobial genes reported in the Drosophila genome. Ten cases of horizontal gene transfer were identified with evidence for expression, integration into the H. hampei genome, and phylogenetic evidence that the sequences are more closely related to bacterial rather than eukaryotic genes. The draft genome analysis broadly expands our knowledge on the biology of a devastating tropical insect pest and suggests new pest management strategies. PMID:26228545

  7. From forest to plantation? Obscure papers reveal alternate host plants for the coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae: Scolytinae), is the most devastating insect pest of coffee throughout the world. The insect is endemic to Africa but can now be found throughout nearly all coffee producing countries. One area of the basic biology of the insec...

  8. Artificial diet sandwiches reveal sub-social behavior in the coffee berry borer Hypothenemus hampei (Coleoptera: Scolytinae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A diet sandwich, consisting of coffee berry borer artificial diet within two glass panes, has been developed to elucidate the behavior of the coffee berry borer, an insect that in nature spends most of its life cycle inside the coffee berry. Various types of behavior have been observed for the first...

  9. Biological control of coffee berry borer: the role of DNA-based gut-content analysis in assessment of predation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The coffee berry borer, Hypothenemus hampei, is the most important pest of coffee worldwide, causing an estimated $500 million in damage annually. Infestation rates from 50-90% have been reported, significantly impacting coffee yields. Adult female H. hampei bore into the berry and lay eggs whose la...

  10. Headspace Analysis of Philippine Civet Coffee Beans Using Gas Chromatography-Mass Spectrometry and Electronic Nose

    NASA Astrophysics Data System (ADS)

    Ongo, E.; Sevilla, F.; Antonelli, A.; Sberveglieri, G.; Montevecchi, G.; Sberveglieri, V.; de Paola, E. L.; Concina, I.; Falasconi, M.

    2011-11-01

    Civet coffee, the most expensive and best coffee in the world, is an economically important export product of the Philippines. With a growing threat of food adulteration and counterfeiting, a need for quality authentication is essential to protect the integrity and strong market value of Philippine civet coffee. At present, there is no internationally accepted method of verifying whether a bean is an authentic civet coffee. This study presented a practical and promising approach to identify and establish the headspace qualitative profile of Philippine civet coffee using electronic nose (E-nose) and gas chromatography-mass spectrometry (GC-MS). E-nose analysis revealed that aroma characteristic is one of the most important quality indicators of civet coffee. The findings were supported by GC-MS analysis. Principal component analysis (PCA) exhibited a clearly separated civet coffees from their control beans. The chromatographic fingerprints indicated that civet coffees differed with their control beans in terms of composition and concentration of individual volatile constituents.

  11. Kinetic characterization of thermophilic and mesophilic anaerobic digestion for coffee grounds and waste activated sludge.

    PubMed

    Li, Qian; Qiao, Wei; Wang, Xiaochang; Takayanagi, Kazuyuki; Shofie, Mohammad; Li, Yu-You

    2015-02-01

    This study was conducted to characterize the kinetics of an anaerobic process (hydrolysis, acetogenesis, acidogenesis and methanogenesis) under thermophilic (55 °C) and mesophilic (35 °C) conditions with coffee grounds and waste activated sludge (WAS) as the substrates. Special focus was given to the kinetics of propionic acid degradation to elucidate the accumulation of VFAs. Under the thermophilic condition, the methane production rate of all substrates (WAS, ground coffee and raw coffee) was about 1.5 times higher than that under the mesophilic condition. However, the effects on methane production of each substrate under the thermophilic condition differed: WAS increased by 35.8-48.2%, raw coffee decreased by 76.3-64.5% and ground coffee decreased by 74.0-57.9%. Based on the maximum reaction rate (Rmax) of each anaerobic stage obtained from the modified Gompertz model, acetogenesis was found to be the rate-limiting step for coffee grounds and WAS. This can be explained by the kinetics of propionate degradation under thermophilic condition in which a long lag-phase (more than 18 days) was observed, although the propionate concentration was only 500 mg/L. Under the mesophilic condition, acidogenesis and hydrolysis were found to be the rate-limiting step for coffee grounds and WAS, respectively. Even though reducing the particle size accelerated the methane production rate of coffee grounds, but did not change the rate-limiting step: acetogenesis in thermophilic and acidogenesis in mesophilic. PMID:25534040

  12. Coffee consumption and reduced risk of hepatocellular carcinoma: findings from the Singapore Chinese Health Study

    PubMed Central

    Johnson, Shane; Koh, Woon-Puay; Wang, Renwei; Govindarajan, Sugantha; Yu, Mimi C.

    2012-01-01

    Background Coffee consumption has been associated with reduced markers of hepatic cell damage, reduced risk of chronic liver disease, and cirrhosis across a variety of populations. Data on the association between coffee consumption and risk of hepatocellular carcinoma (HCC), especially in high-risk populations, are sparse. Methods This study examines the relationship between coffee and caffeine consumption, and the risk of developing HCC within the Singapore Chinese Health Study, a prospective cohort of 63,257 middle-aged and older Chinese men and women, a relatively high-risk population for HCC. Baseline data on coffee consumption and other dietary and lifestyle factors were collected through inperson interviews at enrollment between 1993 and 1998. Results As of 31 December 2006, 362 cohort participants had developed HCC. High levels of coffee or caffeine consumption were associated with reduced risk of HCC (p for trend < 0.05). Compared with non-drinkers of coffee, individuals who consumed three or more cups of coffee per day experienced a statistically significant 44% reduction in risk of HCC (hazard ratio 0.56, 95% confidence interval, 0.31–1.00, p = .049) after adjustment for potential confounders and tea consumption. Conclusion These data suggest that coffee consumption may reduce the risk of developing HCC in Chinese in Singapore. PMID:21258859

  13. Fungal endophyte diversity in coffee plants from Colombia, Hawaii, Mexico and Puerto Rico

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A survey of fungal endophytes in coffee plants was conducted in Colombia, Hawaii, Mexico and Puerto Rico. Coffee plant sections were sterilized and fungal endophytes were isolated using standard techniques, followed by DNA extraction and sequencing of the internal transcribed spacer region (ITS) of...

  14. Coffee prevents proximal colorectal adenomas in Japanese men: a prospective cohort study.

    PubMed

    Nakamura, Tomiyo; Ishikawa, Hideki; Mutoh, Michihiro; Wakabayashi, Keiji; Kawano, Atsuko; Sakai, Toshiyuki; Matsuura, Nariaki

    2016-09-01

    This prospective cohort study aimed to show that coffee prevents the recurrence of colorectal tumors (adenomas, precursors of colorectal cancer, and early-stage colorectal cancers) as well as colorectal cancer. The present study included 307 patients who participated in a clinical study that required endoscopy to remove a colorectal tumor. The amount of coffee consumed by the patients at study inclusion and the frequency of colorectal tumors, as detected by colonoscopy over the subsequent 4 years, were assessed. Coffee consumption was determined using a diet survey that included 3-consecutive-day food records. The risk of colorectal tumor recurrence was significantly lower (odds ratio=0.21; 95% confidence interval, 0.06-0.74) in patients who consumed more than three cups of coffee per day compared with those who consumed no coffee. No correlation was observed between the examined factors, including green tea and black tea intake and the amount of caffeine consumed. In subanalysis divided by the tumor location within the colorectum, the odds ratio of colorectal tumor recurrence in the proximal colon showed a tendency toward reduction as coffee consumption increased; however, increased coffee consumption significantly increased colorectal tumor recurrence in the distal colon. We showed that high coffee consumption reduced the overall occurrence of colorectal tumors, affected by the reduction in the proximal colon. PMID:26291025

  15. Biological control potential of Colletotrichum gloeosporioides for coffee senna (Cassia occidentalis)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A fungal pathogen, Colletotrichum gloeosporioides was isolated from a greenhouse-grown seedling of coffee senna (Cassia occidentalis) and evaluated as a mycoherbicide for that weed. Host range tests revealed that coffee senna, wild senna (C. pilosa),and sicklepod (C. obtusifolia) were also affected...

  16. Soil biological community structure in coffee (Coffea arabica L.) agroecosystems in the Caribbean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coffee production in the Caribbean and Latin America is an important commodity in terms of economic, ecologic and social value. Coffee production in Puerto Rico was intensified in the 1960s, with the shift to higher-yield varieties, increased use of pesticides and fertilizers, increased mechanizati...

  17. Coffee Consumption and Oxidative Stress: A Review of Human Intervention Studies.

    PubMed

    Martini, Daniela; Del Bo', Cristian; Tassotti, Michele; Riso, Patrizia; Del Rio, Daniele; Brighenti, Furio; Porrini, Marisa

    2016-01-01

    Research on the potential protective effects of coffee and its bioactives (caffeine, chlorogenic acids and diterpenes) against oxidative stress and related chronic disease risk has been increasing in the last years. The present review summarizes the main findings on the effect of coffee consumption on protection against lipid, protein and DNA damage, as well as on the modulation of antioxidant capacity and antioxidant enzymes in human studies. Twenty-six dietary intervention studies (involving acute and chronic coffee intake) have been considered. Overall, the results suggest that coffee consumption can increase glutathione levels and improve protection against DNA damage, especially following regular/repeated intake. On the contrary, the effects of coffee on plasma antioxidant capacity and antioxidant enzymes, as well as on protein and lipid damage, are unclear following both acute and chronic exposure. The high heterogeneity in terms of type of coffee, doses and duration of the studies, the lack of information on coffee and/or brew bioactive composition, as well as the choice of biomarkers and the methods used for their evaluation, may partially explain the variability observed among findings. More robust and well-controlled intervention studies are necessary for a thorough understanding of the effect of coffee on oxidative stress markers in humans. PMID:27483219

  18. Modelling the Cooling of Coffee: Insights from a Preliminary Study in Indonesia

    ERIC Educational Resources Information Center

    Widjaja, Wanty

    2010-01-01

    This paper discusses an attempt to examine pre-service teachers' mathematical modelling skills. A modelling project investigating relationships between temperature and time in the process of cooling of coffee was chosen. The analysis was based on group written reports of the cooling of coffee project and observation of classroom discussion.…

  19. 76 FR 73776 - Wiregrass Central Railway, LLC-Abandonment Exemption-in Coffee County, AL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-29

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Surface Transportation Board Wiregrass Central Railway, LLC--Abandonment Exemption--in Coffee County, AL....2 in Enterprise, in Coffee County, Ala. (the line).\\1\\ The line traverses United States...

  20. Evaluation of the mechanical and thermal properties of coffee tree wood flour - polypropylene composites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Columbian coffee trees are subject to frequent replacement plantings due to disease and local climate changes which makes them an ideal source of wood fibers for wood plastic composites (WPC). Composites of polypropylene (PP) consisting of 25% and 40% by weight of coffee wood flour (CF) and 0% or 5%...

  1. Coffee, tea, and fatal oral/pharyngeal cancer in a large prospective US cohort.

    PubMed

    Hildebrand, Janet S; Patel, Alpa V; McCullough, Marjorie L; Gaudet, Mia M; Chen, Amy Y; Hayes, Richard B; Gapstur, Susan M

    2013-01-01

    Epidemiologic studies suggest that coffee intake is associated with reduced risk of oral/pharyngeal cancer. The authors examined associations of caffeinated coffee, decaffeinated coffee, and tea intake with fatal oral/pharyngeal cancer in the Cancer Prevention Study II, a prospective US cohort study begun in 1982 by the American Cancer Society. Among 968,432 men and women who were cancer free at enrollment, 868 deaths due to oral/pharyngeal cancer occurred during 26 years of follow-up. Cox proportional hazards regression was used to estimate multivariable-adjusted relative risk. Intake of >4 cups/day of caffeinated coffee was associated with a 49% lower risk of oral/pharyngeal cancer death relative to no/occasional coffee intake (relative risk = 0.51, 95% confidence interval: 0.40, 0.64) (1 cup/day = 237 ml). A dose-related decline in relative risk was observed with each single cup/day consumed (P(trend) < 0.001). The association was not modified by sex, smoking status, or alcohol use. An inverse association for >2 cups/day of decaffeinated coffee intake was suggested (relative risk = 0.61, 95% confidence interval: 0.37, 1.01). No association was found for tea drinking. In this large prospective study, caffeinated coffee intake was inversely associated with oral/pharyngeal cancer mortality. Research is needed to elucidate biologic mechanisms whereby coffee might help to protect against these often fatal cancers. PMID:23230042

  2. Consumption of coffee, but not black tea, is associated with decreased risk of premenopausal breast cancer.

    PubMed

    Baker, Julie A; Beehler, Gregory P; Sawant, Abhishek C; Jayaprakash, Vijayvel; McCann, Susan E; Moysich, Kirsten B

    2006-01-01

    Caffeine has been suggested as a possible risk factor for breast cancer, potentially through its effect of facilitating the development of benign breast disease. However, coffee and tea also contain polyphenols, which exhibit anticarcinogenic properties. A hospital-based, case-control study was conducted to evaluate the role of coffee, decaffeinated coffee, and black tea in breast cancer etiology. Study participants included 1932 cases with primary, incident breast cancer and 1895 hospital controls with nonneoplastic conditions. All participants completed a comprehensive epidemiological questionnaire. Among premenopausal women, consumption of regular coffee was associated with linear declines in breast cancer risk (P for trend = 0.03); consumers of >or=4 cups/d experienced a 40% risk reduction (odds ratio = 0.62, 95% CI 0.39-0.98). No clear associations between intake of black tea or decaffeinated coffee and breast cancer risk were noted among premenopausal women, although black tea was associated with a protective effect unique to a subsample of cases with lobular histology. Among postmenopausal women, breast cancer risk was not associated with consumption of coffee, tea, or decaffeinated coffee. Results among postmenopausal women did not differ by histologic subtype. Our findings support a protective effect of coffee intake on premenopausal, but not postmenopausal breast cancer risk. Further studies are warranted to confirm these findings. PMID:16365077

  3. Genomic Sequencing of Two Coffee-Infecting Strains of Xylella fastidiosa Isolated from Brazil.

    PubMed

    Alencar, Valquíria C; Barbosa, Deibs; Santos, Daiene S; Oliveira, Ana Cláudia F; de Oliveira, Regina C; Nunes, Luiz R

    2014-01-01

    Here, we describe the draft genome sequences of two Xylella fastidiosa strains: Xf6c and Xf32, which have been obtained from infected coffee plants in Brazil, and are associated with the disease known as coffee leaf scorch (CLS). PMID:24435874

  4. Cytogenetic response to coffee in Chinese hamster ovary AUXB1 cells and human peripheral lymphocytes.

    PubMed

    Tucker, J D; Taylor, R T; Christensen, M L; Strout, C L; Hanna, M L

    1989-09-01

    We have investigated the genotoxic effects of three different brands and three types of coffee (freshly brewed regular, instant regular and freshly brewed decaffeinated) in two mammalian systems: the Chinese hamster ovary (CHO) AUXB1 cell line and human peripheral lymphocytes. Sister-chromatid exchanges (SCEs) and endoreduplicated cells (ERCs) were used as the endpoints. Coffee was prepared according to the manufacturer's suggestions, and after cooling, administered to cultured cells at dilutions ranging up to 11% that of full-strength coffee. Each brand and type of coffee induced significant levels of SCEs and ERCs in AUXB1 cells. SCEs, but not ERCs, were induced in human peripheral lymphocytes. Bisulfite, which complexes with carbonyls and reduces their genotoxicity, significantly diminished the number of SCEs and ERCs found after administration of coffee. Catalase and peroxidase, enzymes that destroy hydrogen peroxide activity, had no significant effect upon the SCE and ERC frequencies in AUXB1 cultures treated with freshly brewed regular coffee. These experiments indicate that different brands and types of coffee have sufficient genotoxic activity to increase SCEs and ERCs at levels only a fraction of those normally consumed. 1,2-Dicarbonyls alone and peroxides alone do not appear to be responsible for the majority of SCEs and ERCs that were observed to be induced by dilute coffee. PMID:2687627

  5. Parasitoids for biocontrol of coffee berry borer: past, present and future.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Detailed surveys for coffee berry borer parasitoids were initiated in October 2006 in two coffee growing areas of Kenya (Kisii and Embu). The most abundant parasitoid species are Prorops nasuta (Hymenoptera: Bethylidae) and Aphanogmus sp. (Hymenoptera: Ceraphronidae). Our preliminary findings indica...

  6. Coffee consumption and nonalcoholic fatty liver onset: a prospective study in the general population.

    PubMed

    Zelber-Sagi, Shira; Salomone, Federico; Webb, Muriel; Lotan, Roni; Yeshua, Hanny; Halpern, Zamir; Santo, Erwin; Oren, Ran; Shibolet, Oren

    2015-03-01

    Retrospective studies suggest that coffee consumption may exert beneficial effects in patients with nonalcoholic fatty liver; however, prospective data supporting a protective role on liver steatosis development are lacking. In this study, we aimed to evaluate the association between coffee consumption and fatty liver onset in the general population. The analysis was performed both in a cross-sectional cohort (n = 347) and, prospectively, in a subcohort of patients without fatty liver at baseline and followed-up for 7 years (n = 147). Fatty liver was diagnosed with abdominal ultrasound and liver steatosis was quantified noninvasively by hepatorenal index (HRI) and SteatoTest, whereas FibroTest was used to assess fibrosis degree. A structured questionnaire on coffee consumption was administrated during a face-to-face interview. Neither the incidence nor the prevalence of fatty liver according to ultrasonography, SteatoTest, and the HRI was associated with coffee consumption. In the cross-sectional study, high coffee consumption was associated with a lower proportion of clinically significant fibrosis ≥ F2 (8.8% vs 16.3%; P = 0.038); consistently, in multivariate logistic regression analysis, high coffee consumption was associated with lower odds for significant fibrosis (odds ratio = 0.49, 95% confidence interval, 0.25-0.97; P = 0.041) and was the strongest predictor for significant fibrosis. No association was demonstrated between coffee consumption and the new onset of nonalcoholic fatty liver, but coffee intake may exert beneficial effects on fibrosis progression. PMID:25468486

  7. PENICILLIUM BROCAE A NEW SPECIES ASSOCIATED WITH THE COFFEE BERRY BORER IN CHIAPAS, MEXICO

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Penicillium brocae is a new monoverticillate species isolated from coffee berry borers collected at coffee plantations in Mexico near Cacahoatán, Chiapas, or from borers reared on artificial diets at ECOSUR laboratory facilities in Tapachula, Chiapas. Phenotypically, it is in Penicillium series Imp...

  8. Carotenoids of lettuce (Lactuca sativa L.) grown on soil enriched with spent coffee grounds.

    PubMed

    Cruz, Rebeca; Baptista, Paula; Cunha, Sara; Pereira, José Alberto; Casal, Susana

    2012-01-01

    The impact of spent coffee grounds on carotenoid and chlorophyll content in lettuce (Lactuca sativa L. var. capitata) was evaluated. A greenhouse pot experiment was conducted with spent coffee amounts ranging from 0% to 20% (v/v). All evaluated pigments increased proportionally to spent coffee amounts. Lutein and β-carotene levels increased up to 90% and 72%, respectively, while chlorophylls increased up to 61%. Biomass was also improved in the presence of 2.5% to 10% spent coffee, decreasing for higher amounts. Nevertheless, all plants were characterized by lower organic nitrogen content than the control ones, inversely to the spent coffee amounts, pointing to possible induced stress. Collected data suggests that plants nutritional features, with regards to these bioactive compounds, can be improved by the presence of low amounts of spent coffee grounds (up to 10%). This observation is particularly important because soil amendment with spent coffee grounds is becoming increasingly common within domestic agriculture. Still, further studies on the detailed influence of spent coffee bioactive compounds are mandatory, particularly regarding caffeine. PMID:22314378

  9. Black medicine: an observational study of doctors’ coffee purchasing patterns at work

    PubMed Central

    Hamilton, David F; Erschbamer, Matthias; Jost, Bernhard

    2015-01-01

    Objective To evaluate doctors’ coffee consumption at work and differences between specialties. Design Single centre retrospective cohort study. Setting Large teaching hospital in Switzerland. Participants 766 qualified doctors (425 men, 341 women) from all medical specialties (201 internal medicine, 76 general surgery, 67 anaesthetics, 54 radiology, 48 orthopaedics, 43 gynaecology, 36 neurology, 23 neurosurgery, 96 other specialties). Data source Staff purchasing history from staff canteens’ electronic payment system linked to separate anonymised personal data from the human resource database. Main outcome measure Numbers of coffees purchased per person per year. Results 84% (644) of doctors purchased coffee at one of the hospital canteens. 70 772 coffees were consumed by doctors in 2014. There was a significant association between specialty and yearly coffee purchasing (F=12.45; P<0.01). On average orthopaedic surgeons purchased the most coffee per person per year (mean 189, SD 136) followed by radiologists (177, SD 191) and general surgeons (167, SD 138). Anaesthetists purchased the least coffee (39, SD 48). Male doctors bought significantly more coffees per person per year (128 (SD 140) v 86 (SD 86), t=−4.66, P<0.01) and twice as many espressos as female doctors (mean 27 (SD 46) v 10 (SD 19), t=−6.54, P<0.01). Hierarchical position was associated with coffee purchasing (F=4.55; P=0.04). Senior consultants (>5 years’ experience) bought most coffees per person per year (140, SD 169) and junior doctors and registrars bought fewest (95, SD 85). Propensity of buying rounds also increased with hierarchical position (χ2=556.24; P<0.01), with heads of departments buying more rounds than junior doctors (30% v 15%). Conclusions Doctors commonly use coffee as a stimulant. Substantial variation exists between specialties. Surgeons drink notably more coffee than physicians, with orthopaedic surgeons consuming the greatest amount in the communal cafeteria

  10. Particle concentration effect: adsorption of divalent metal ions on coffee grounds.

    PubMed

    Utomo, Handojo Djati; Hunter, Keith A

    2010-03-01

    The adsorption of divalent metal ions Cu2+, Pb2+, Zn2+, and Cd2+ on coffee grounds as a function of coffee grounds concentration was studied in which adsorption density decreased as the concentration of coffee grounds (C(s)) increased. Adsorption studies were conducted by equilibrating aqueous solutions of each metal ion at concentrations in the range 19-291 micromol L(-1) with coffee suspensions in the concentration range 0.971-8.738 g L(-1), with the initial pH adjusted to 5.0+/-0.1 using NaOH or HNO3. Metastable Equilibrium Adsorption theory did not adequately explain the adsorption phenomenon, except at low concentrations of coffee grounds and trace metal ions. Instead the results indicated that flocculation might reduce the surface availability thus reducing the adsorption density. The flocculation theory was confirmed after a further experiment adding dispersant sodium hexa-meta-phosphate (NaHMP) to the suspension. PMID:19660940

  11. The effect of bean origin and temperature on grinding roasted coffee

    NASA Astrophysics Data System (ADS)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  12. The effect of bean origin and temperature on grinding roasted coffee

    PubMed Central

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-01-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily. PMID:27086837

  13. The effect of bean origin and temperature on grinding roasted coffee.

    PubMed

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T; Melot, Brent C; Speirs, Rory W; Hendon, Christopher H

    2016-01-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily. PMID:27086837

  14. The influence of espresso coffee on neurocognitive function in HIV-infected patients.

    PubMed

    Bragança, M; Marinho, M; Marques, J; Moreira, R; Palha, A; Marques-Teixeira, J; Esteves, M

    2016-09-01

    The aim of our study was to evaluate the impact of coffee intake on cognitive function in persons living with HIV (PLWH). 130 PLWH with CD4 > 200 cells/mm(3), undetectable viral load, treated with HAART were included. A structured interview was applied and relevant clinical and laboratory data were assessed, including coffee intake. For neuropsychological assessment, the HIV Neurobehavioral Research Center Battery was chosen. Univariate nonparametric statistics and multivariate regression model were used. A significant association between espresso coffee use and a better cognitive function was verified in five of the eight psychometric measurements. In the multivariate analysis, after variable adjustment, linear regression analysis showed that coffee intake was a positive predictor for attention/working memory, executive functions and Global Deficit Score. Although the mechanisms behind the influence of caffeine on cognitive functioning are controversial, regular espresso coffee intake may have favourable effects on cognitive deterioration caused by HIV. PMID:26932511

  15. Evaluation of three composting systems for the management of spent coffee grounds.

    PubMed

    Liu, K; Price, G W

    2011-09-01

    This study was conducted to evaluate the optimum composting approach for the management of spent coffee grounds from the restaurant and ready-to-serve coffee industry. Three composting systems were assessed, including in-vessel composting, vermicomposting bins, and aerated static pile bin composting, over study periods ranging from 47 to 98 days. Total carbon content was reduced by 5-7% in the spent coffee ground treatments across the three composting systems. Nitrogen and other mineral nutrient contents were conserved or enhanced from the initial to the final composts in all the composting systems assessed. Earthworm growth and survival (15-80%) was reduced in all the treatments but mortality rates were lower in coffee treatments with cardboard additions. A decline in earthworm mortality with cardboard additions was the result of reduced exposure to organic compounds and chemicals released through the decomposition of spent coffee grounds. PMID:21704514

  16. Adsorption properties of biomass-based activated carbon prepared with spent coffee grounds and pomelo skin by phosphoric acid activation

    NASA Astrophysics Data System (ADS)

    Ma, Xiaodong; Ouyang, Feng

    2013-03-01

    Activated carbon prepared from spent coffee grounds and pomelo skin by phosphoric acid activation had been employed as the adsorbent for ethylene and n-butane at room temperature. Prepared activated carbon was characterized by means of nitrogen adsorption-desorption, X-ray powder diffraction, scanning electron microscope and Fourier transform infrared spectroscope. It was confirmed that pore structure played an important role during the adsorption testes. Adsorption isotherms of ethylene and n-butane fitted well with Langmuir equation. The prepared samples owned better adsorption capacity for n-butane than commercial activated carbon. Isosteric heats of adsorptions at different coverage were calculated through Clausius-Clapeyron equation. Micropore filling effect was explained in a thermodynamic way.

  17. Identification of aroma active compounds of cereal coffee brew and its roasted ingredients.

    PubMed

    Majcher, Małgorzata A; Klensporf-Pawlik, Dorota; Dziadas, Mariusz; Jeleń, Henryk H

    2013-03-20

    Cereal coffee is a coffee substitute made mainly from roasted cereals such as barley and rye (60-70%), chicory (15-20%), and sugar beets (6-10%). It is perceived by consumers as a healthy, caffeine free, non-irritating beverage suitable for those who cannot drink regular coffee made from coffee beans. In presented studies, typical Polish cereal coffee brew has been subjected to the key odorants analysis with the application of gas chromatography-olfactometry (GC-O) and aroma extract dilution analysis (AEDA). In the analyzed cereal coffee extract, 30 aroma-active volatiles have been identified with FD factors ranging from 16 to 4096. This approach was also used for characterization of key odorants in ingredients used for the cereal coffee production. Comparing the main odors detected in GC-O analysis of roasted cereals brew to the odor notes of cereal coffee brew, it was evident that the aroma of cereal coffee brew is mainly influenced by roasted barley. Flavor compound identification and quantitation has been performed with application of comprehensive multidimentional gas chromatography and time-of-flight mass spectrometry (GCxGC-ToFMS). The results of the quantitative measurements followed by calculation of the odor activity values (OAV) revealed 17 aroma active compounds of the cereal coffee brew with OAV ranging from 12.5 and 2000. The most potent odorant was 2-furfurylthiol followed by the 3-mercapto-3-methylbutyl formate, 3-isobutyl-2-methoxypyrazine and 2-ethyl-3,5-dimethylpyrazine, 2-thenylthiol, 2,3-butanedione, 2-methoxy phenol and 2-methoxy-4-vinyl phenol, 3(sec-butyl)-2-methoxypyrazine, 2-acetyl-1-pyrroline, 3-(methylthio)-propanal, 2,3-pentanedione, 4-hydroxy-2,5-dimethyl-3-(2H)-furanone, (E,E)-2,4-decadienal, (Z)-4-heptenal, phenylacetaldehyde, and 1-octen-3-one. PMID:23414530

  18. The Storage of Green Coffee (Coffea arabica): Decrease of Viability and Changes of Potential Aroma Precursors

    PubMed Central

    Selmar, Dirk; Bytof, Gerhard; Knopp, Sven-Erik

    2008-01-01

    Background and Aims When green coffee is stored for a prolonged time the coffee quality decreases distinctively. Apart from well-known ‘off-notes’ that arise from undesired oxidations of lipids, a typical ‘flattening’ of the cup quality is detectable. In order to elucidate the biological causes for this phenomenon, differentially processed coffees (wet, dry, semi-dry processing), were stored under standard conditions for 2 years and analysed comprehensively. Methods Wet-processed coffee was stored either as parchment coffee, where the endocarp remained around the beans or as hulled beans. Viability of coffee seeds was estimated using the tetrazolium-test of seed viability. Changes in concentration of free amino acids and soluble carbohydrates were analysed by HPLC. Key Results Whereas all other coffees lost viability within the first 6 months of storage, coffee beans stored within the parchment remained viable for >1 year. Glucose and fructose decreased slightly in the course of storage and glutamine content declined significantly. However, the changes observed in sugar and amino acid content were not correlated with the viability of the coffee beans. Consequently, neither typical metabolic reactions occurring within living cells nor characteristic post-mortem reactions could be responsible for the observed changes. As a result of post-mortem reactions in re-imbibed seeds, a characteristic bluish-green colour developed, putatively due to the oxidation of chlorogenic acids and subsequent reactions with primary amino compounds. This coloration might be an appropriate marker to substantiate if coffee seeds had been stored for an expanded time and putative quality losses were not relevant so far. Conclusions It is suggested that loss of viability is relevant for the aroma flattening. As neither metabolic nor post-mortem reactions were responsible for the observed changes, it is concluded that Maillard reactions that occur during storage might be the cause of

  19. Coffee and cancer: a review of epidemiological studies, 1990-1999.

    PubMed

    Tavani, A; La Vecchia, C

    2000-08-01

    Epidemiological studies on the relation between coffee consumption and cancer risk have been mainly focused on cancers of the urinary bladder, pancreas and colorectum. The relation between coffee and bladder cancer is controversial, despite a large number of studies published over the last three decades. In most studies, the risk tends to be higher in coffee drinkers than in those who do not drink coffee, but the excess risk is generally moderate and is neither dose- nor duration-related. Thus, a strong association between coffee drinking and bladder cancer can be excluded, although it is still unclear whether the weak association is causal or nonspecific and due to some bias or confounding. For pancreatic cancer, a possible association with coffee consumption has been postulated in a large case-control study published in 1981; since then, however, most studies have shown no substantial association, and overall evidence suggests that coffee is not materially related to pancreatic cancer risk. Overall evidence on the coffee-colorectal cancer relation suggests an inverse association, since most case-control studies found odds ratios below unity, particularly for colon cancer. The pattern of risk is less clear for cohort studies. A plausible biological explanation has been given in terms of coffee-related reduction of bile acids and neutral sterol secretion in the colon. For other cancer sites, including oral cavity, oesophagus, stomach, liver, breast, ovary, kidney and lymphoid neoplasms, the relation of coffee drinking with cancer risk has been less extensively investigated, but the evidence is largely reassuring. PMID:10958327

  20. Effects of habitual coffee consumption on cardiometabolic disease, cardiovascular health, and all-cause mortality.

    PubMed

    O'Keefe, James H; Bhatti, Salman K; Patil, Harshal R; DiNicolantonio, James J; Lucan, Sean C; Lavie, Carl J

    2013-09-17

    Coffee, after water, is the most widely consumed beverage in the United States, and is the principal source of caffeine intake among adults. The biological effects of coffee may be substantial and are not limited to the actions of caffeine. Coffee is a complex beverage containing hundreds of biologically active compounds, and the health effects of chronic coffee intake are wide ranging. From a cardiovascular (CV) standpoint, coffee consumption may reduce the risk of type 2 diabetes mellitus and hypertension, as well as other conditions associated with CV risk such as obesity and depression; but it may adversely affect lipid profiles depending on how the beverage is prepared. Regardless, a growing body of data suggests that habitual coffee consumption is neutral to beneficial regarding the risks of a variety of adverse CV outcomes including coronary heart disease, congestive heart failure, arrhythmias, and stroke. Moreover, large epidemiological studies suggest that regular coffee drinkers have reduced risks of mortality, both CV and all-cause. The potential benefits also include protection against neurodegenerative diseases, improved asthma control, and lower risk of select gastrointestinal diseases. A daily intake of ∼2 to 3 cups of coffee appears to be safe and is associated with neutral to beneficial effects for most of the studied health outcomes. However, most of the data on coffee's health effects are based on observational data, with very few randomized, controlled studies, and association does not prove causation. Additionally, the possible advantages of regular coffee consumption have to be weighed against potential risks (which are mostly related to its high caffeine content) including anxiety, insomnia, tremulousness, and palpitations, as well as bone loss and possibly increased risk of fractures. PMID:23871889

  1. The impact of a shade coffee certification program on forest conservation: a case study from a wild coffee forest in Ethiopia.

    PubMed

    Takahashi, Ryo; Todo, Yasuyuki

    2013-11-30

    In recent years, shade coffee certification programs have attracted increasing attention from conservation and development organizations. Certification programs offer an opportunity to link environmental and economic goals by providing a premium price to producers and thereby contributing to forest conservation. However, the significance of the conservation efforts of certification programs remains unclear because of a lack of empirical evidence. The purpose of this study was to examine the impact of a shade coffee certification program on forest conservation. The study was conducted in the Belete-Gera Regional Forest Priority Area in Ethiopia, and remote sensing data of 2005 and 2010 were used to gauge the change of forest area. Using propensity score matching estimation, we found that forests under the coffee certification program were less likely to be deforested than forests without forest coffee. By contrast, the difference in the degree of deforestation between forests with forest coffee but not under the certification program and forests with no forest coffee is statistically insignificant. These results suggest that the certification program has had a large effect on forest protection, decreasing the probability of deforestation by 1.7 percentage points. PMID:24061085

  2. Independent Origins of Yeast Associated with Coffee and Cacao Fermentation.

    PubMed

    Ludlow, Catherine L; Cromie, Gareth A; Garmendia-Torres, Cecilia; Sirr, Amy; Hays, Michelle; Field, Colburn; Jeffery, Eric W; Fay, Justin C; Dudley, Aimée M

    2016-04-01

    Modern transportation networks have facilitated the migration and mingling of previously isolated populations of plants, animals, and insects. Human activities can also influence the global distribution of microorganisms. The best-understood example is yeasts associated with winemaking. Humans began making wine in the Middle East over 9,000 years ago [1, 2]. Selecting favorable fermentation products created specialized strains of Saccharomyces cerevisiae [3, 4] that were transported along with grapevines. Today, S. cerevisiae strains residing in vineyards around the world are genetically similar, and their population structure suggests a common origin that followed the path of human migration [3-7]. Like wine, coffee and cacao depend on microbial fermentation [8, 9] and have been globally dispersed by humans. Theobroma cacao originated in the Amazon and Orinoco basins of Colombia and Venezuela [10], was cultivated in Central America by Mesoamerican peoples, and was introduced to Europeans by Hernán Cortés in 1530 [11]. Coffea, native to Ethiopia, was disseminated by Arab traders throughout the Middle East and North Africa in the 6(th) century and was introduced to European consumers in the 17(th) century [12]. Here, we tested whether the yeasts associated with coffee and cacao are genetically similar, crop-specific populations or genetically diverse, geography-specific populations. Our results uncovered populations that, while defined by niche and geography, also bear signatures of admixture between major populations in events independent of the transport of the plants. Thus, human-associated fermentation and migration may have affected the distribution of yeast involved in the production of coffee and chocolate. PMID:27020745

  3. The Coffee Sand and Ripley aquifers in Mississippi

    USGS Publications Warehouse

    Boswell, E.H.

    1978-01-01

    The Coffee Sand and Ripley aquifers, of Cretaceous age, are in the Selma Group in northern Mississippi. The aquifers contain freshwater in an area of about 4,400 square miles in northern Mississippi. Water produced from the aquifers by public water systems and numerous industries in 1975 averaged about 4 Mgal/d. Regional water-level declines have been very small and the aquifers have a moderate potential for future development. The aquifers are used in some areas where there are no other significant sources of ground water. The most common problems in developing water supplies are low yields to wells and hard water. (Kosco-USGS)

  4. Alice, Benzene, and Coffee: The ABCs of Ecopharmacognosy.

    PubMed

    Cordell, Geoffrey A

    2015-12-01

    The sesquicentennial celebrations of the publication of "Alice's Adventures in Wonderland" and the structure of benzene offer a unique opportunity to develop a contemporary interpretation of aspects of Alice's adventures, illuminate the symbolism of benzene, and contextualize both with the globalization of coffee, transitioning to how the philosophy and sustainable practices of ecopharmacognosy may be applied to modulating approaches to the quality, safety, efficacy, and consistency (QSEC) of traditional medicines and dietary supplements through technology integration, thereby improving patient-centered health care. PMID:26882696

  5. Biological and chemical studies on overheated brewed coffee.

    PubMed

    Sasaki, Y; Shibamoto, T; Wei, C I; Fernando, S

    1987-03-01

    Vapour formed from overheated decaffeinated coffee was condensed and tested for mutagenicity using the Ames assay in Salmonella typhimurium strains TA98 and TA100. Vapour produced at 73 and 100 degrees C exhibited no mutagenicity. The basic fraction of vapour produced at 350 degrees C showed weak mutagenicity towards strains TA98 with metabolic activation. The chemical analysis of this fraction identified pyridines and pyrazines as the major constituents. None of the compounds identified in this fraction has been reported as mutagenic when tested in the Ames assay. PMID:3570110

  6. Coffee consumption and risk of endometrial cancer: a dose-response meta-analysis of prospective cohort studies.

    PubMed

    Zhou, Quan; Luo, Mei-Ling; Li, Hui; Li, Min; Zhou, Jian-Guo

    2015-01-01

    This is a dose-response (DR) meta-analysis to evaluate the association of coffee consumption on endometrial cancer (EC) risk. A total 1,534,039 participants from 13 published articles were added in this meta-analysis. The RR of total coffee consumption and EC were 0.80 (95% CI: 0.74-0.86). A stronger association between coffee intake and EC incidence was found in patients who were never treated with hormones, 0.60 (95% CI: 0.50-0.72), and subjects with a BMI ≥25 kg/m(2), 0.57 (95% CI: 0.46-0.71). The overall RRs for caffeinated and decaffeinated coffee were 0.66 (95% CI: 0.52-0.84) and 0.77 (95% CI: 0.63-0.94), respectively. A linear DR relationship was seen in coffee, caffeinated coffee, decaffeinated coffee and caffeine intake. The EC risk decreased by 5% for every 1 cup per day of coffee intake, 7% for every 1 cup per day of caffeinated coffee intake, 4% for every 1 cup per day of decaffeinated intake of coffee, and 4% for every 100 mg of caffeine intake per day. In conclusion, coffee and intake of caffeine might significantly reduce the incidence of EC, and these effects may be modified by BMI and history of hormone therapy. PMID:26302813

  7. Coffee consumption and risk of endometrial cancer: a dose-response meta-analysis of prospective cohort studies

    PubMed Central

    Zhou, Quan; Luo, Mei-Ling; Li, Hui; Li, Min; Zhou, Jian-Guo

    2015-01-01

    This is a dose-response (DR) meta-analysis to evaluate the association of coffee consumption on endometrial cancer (EC) risk. A total 1,534,039 participants from 13 published articles were added in this meta-analysis. The RR of total coffee consumption and EC were 0.80 (95% CI: 0.74–0.86). A stronger association between coffee intake and EC incidence was found in patients who were never treated with hormones, 0.60 (95% CI: 0.50–0.72), and subjects with a BMI ≥25 kg/m2, 0.57 (95% CI: 0.46–0.71). The overall RRs for caffeinated and decaffeinated coffee were 0.66 (95% CI: 0.52–0.84) and 0.77 (95% CI: 0.63–0.94), respectively. A linear DR relationship was seen in coffee, caffeinated coffee, decaffeinated coffee and caffeine intake. The EC risk decreased by 5% for every 1 cup per day of coffee intake, 7% for every 1 cup per day of caffeinated coffee intake, 4% for every 1 cup per day of decaffeinated intake of coffee, and 4% for every 100 mg of caffeine intake per day. In conclusion, coffee and intake of caffeine might significantly reduce the incidence of EC, and these effects may be modified by BMI and history of hormone therapy. PMID:26302813

  8. Geotechnologies for the Characterization of Specialty Coffee Environments of Mantiqueira de Minas in Brazil

    NASA Astrophysics Data System (ADS)

    Alves, H. M. R.; Vieira, T. G. C.; Volpato, M. M. L.; Lacerda, M. P. C.; Borém, F. M.

    2016-06-01

    Land-use/land-cover change (LUCC) is a major cause of environmental transformation. Distant drivers, often associated with emerging markets for specific products, are now being considered one of the main factors of LUCC and are gaining attention in land change science. Consumers show an increasing interest in local and quality food, certified for its origin and its environmental production standards. A kind of agricultural product certification, Geographic Indication, identifies a product as originating from a specific region where a given quality, reputation or characteristic is attributed to its geographical origin. Sustainable land use is potentially an indirect effect of Geographic Indication, as it requires better land management in order to preserve the natural resources associated with the unique characteristics of the certified product. Located in the southern region of the state of Minas Gerais in Brazil is the region of Mantiqueira de Minas, considered one of the most important regions for the production of specialty coffees in Brazil. In 2011, the region's tradition and reputation were recognized with a Geographic Indication, the second given for coffee regions in the country. To explore the full potential of this area for producing coffees with higher quality and meet the growing demand of this new international market, which aggregates value at specialty coffees, it became fundamental to understand the coffee environments of the region, the "terroirs" where these coffees are obtained. Geotechnology can give a significant contribution in filling this gap. This work is part of a research project that made a detailed characterization of the region's coffee agroecosystems. Geotechnologies were employed to map the areas occupied by coffee plantations by using RapidEye satellite images and SPRING and ArcGIS software. All the segments of the environment were characterized and mapped in detail and the relations with coffee quality were evaluated. The results

  9. The influence of different types of preparation (espresso and brew) on coffee aroma and main bioactive constituents.

    PubMed

    Caprioli, Giovanni; Cortese, Manuela; Sagratini, Gianni; Vittori, Sauro

    2015-01-01

    Coffee is one of the most popular hot drinks in the world; it may be prepared by several methods, but the most common forms are boiled (brew) and pressurized (espresso). Analytical studies on the substances responsible for the pleasant aroma of roasted coffee have been carried out for more than 100 years. Brew coffee and espresso coffee (EC) have a different and peculiar aroma profile, demonstrating the importance of the brewing process on the final product sensorial quality. Concerning bioactive compounds, the extraction mechanism plays a crucial role. The differences in the composition of coffee brew in chlorogenic acids and caffeine content is the result of the different procedures of coffee preparation. The aim of the present review is to detail how the brewing process affects coffee aroma and composition. PMID:26171629

  10. Serum biomarkers of habitual coffee consumption may provide insight into the mechanism underlying the association between coffee consumption and colorectal cancer12345

    PubMed Central

    Guertin, Kristin A; Loftfield, Erikka; Boca, Simina M; Sampson, Joshua N; Moore, Steven C; Xiao, Qian; Huang, Wen-Yi; Xiong, Xiaoqin; Freedman, Neal D; Cross, Amanda J; Sinha, Rashmi

    2015-01-01

    Background: Coffee intake may be inversely associated with colorectal cancer; however, previous studies have been inconsistent. Serum coffee metabolites are integrated exposure measures that may clarify associations with cancer and elucidate underlying mechanisms. Objectives: Our aims were 2-fold as follows: 1) to identify serum metabolites associated with coffee intake and 2) to examine these metabolites in relation to colorectal cancer. Design: In a nested case-control study of 251 colorectal cancer cases and 247 matched control subjects from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial, we conducted untargeted metabolomics analyses of baseline serum by using ultrahigh-performance liquid-phase chromatography–tandem mass spectrometry and gas chromatography–mass spectrometry. Usual coffee intake was self-reported in a food-frequency questionnaire. We used partial Pearson correlations and linear regression to identify serum metabolites associated with coffee intake and conditional logistic regression to evaluate associations between coffee metabolites and colorectal cancer. Results: After Bonferroni correction for multiple comparisons (P = 0.05 ÷ 657 metabolites), 29 serum metabolites were positively correlated with coffee intake (partial correlation coefficients: 0.18–0.61; P < 7.61 × 10−5); serum metabolites most highly correlated with coffee intake (partial correlation coefficients >0.40) included trigonelline (N′-methylnicotinate), quinate, and 7 unknown metabolites. Of 29 serum metabolites, 8 metabolites were directly related to caffeine metabolism, and 3 of these metabolites, theophylline (OR for 90th compared with 10th percentiles: 0.44; 95% CI: 0.25, 0.79; P-linear trend = 0.006), caffeine (OR for 90th compared with 10th percentiles: 0.56; 95% CI: 0.35, 0.89; P-linear trend = 0.015), and paraxanthine (OR for 90th compared with 10th percentiles: 0.58; 95% CI: 0.36, 0.94; P-linear trend = 0.027), were inversely associated with

  11. Analysis of mycotoxins in coffee and risk assessment in Spanish adolescents and adults.

    PubMed

    García-Moraleja, A; Font, G; Mañes, J; Ferrer, E

    2015-12-01

    Mycotoxins are toxic compounds produced by fungal secondary metabolism that cause toxicological effects. Coffee is a highly popular beverage that is susceptible to contamination by mycotoxigenic fungi. The aim of the present study was to determine the presence of the following 21 mycotoxins in coffee using liquid chromatography tandem mass spectrometry (LC-MS/MS-IT): aflatoxin B1, B2, G1 and G2; ochratoxin A; nivalenol; deoxynivalenol; 3-acetyldeoxynivalenol; 15-acetyldeoxynivalenol; diacetoxyscirpenol; neosolaniol; T-2 and HT-2 toxin; sterigmatocystin; enniatin A, A1, B, and B1; beauvericin; and fumonisin B1 and B2. We aimed to determine differences by coffee process (coffee maker, electrical machine, soluble and traditional Turkish process) and to calculate the estimated daily intake (EDI) and risk assessment of mycotoxins from coffee consumption using deterministic approach at various scenarios of food consumption in Spanish adolescents and adults. The results demonstrate that all studied mycotoxins were detected in samples with mean concentrations ranging from 0.69 µg/kg to 282.89 µg/kg. Eleven percent of samples did not show contamination with legislated mycotoxins. Only 15-acetyldeoxynivalenol, deoxynivalenol, neosolaniol, fumonisin B1, and ochratoxin A exhibited significant differences between methods of coffee brewing. The results show that coffee intake does not represent a potential risk for consumers with respect to individual mycotoxin contamination. PMID:26514696

  12. Complementary ecosystem services provided by pest predators and pollinators increase quantity and quality of coffee yields.

    PubMed

    Classen, Alice; Peters, Marcell K; Ferger, Stefan W; Helbig-Bonitz, Maria; Schmack, Julia M; Maassen, Genevieve; Schleuning, Matthias; Kalko, Elisabeth K V; Böhning-Gaese, Katrin; Steffan-Dewenter, Ingolf

    2014-03-22

    Wild animals substantially support crop production by providing ecosystem services, such as pollination and natural pest control. However, the strengths of synergies between ecosystem services and their dependencies on land-use management are largely unknown. Here, we took an experimental approach to test the impact of land-use intensification on both individual and combined pollination and pest control services in coffee production systems at Mount Kilimanjaro. We established a full-factorial pollinator and vertebrate exclosure experiment along a land-use gradient from traditional homegardens (agroforestry systems), shaded coffee plantations to sun coffee plantations (total sample size = 180 coffee bushes). The exclusion of vertebrates led to a reduction in fruit set of ca 9%. Pollinators did not affect fruit set, but significantly increased fruit weight of coffee by an average of 7.4%. We found no significant decline of these ecosystem services along the land-use gradient. Pest control and pollination service were thus complementary, contributing to coffee production by affecting the quantity and quality of a major tropical cash crop across different coffee production systems at Mount Kilimanjaro. PMID:24500173

  13. Cascading effects of insectivorous birds and bats in tropical coffee plantations.

    PubMed

    Karp, Daniel S; Daily, Gretchen C

    2014-04-01

    The loss of apex predators is known to have reverberating consequences for ecosystems, but how changes in broader predator assemblages affect vital ecosystem functions and services is largely unknown. Predators and their prey form complex interaction networks, in which predators consume not only herbivores but also other predators. Resolving these interactions will be essential for predicting changes in many important ecosystem functions, such as the control of damaging crop pests. Here, we examine how birds, bats, and arthropods interact to determine herbivorous arthropod abundance and leaf damage in Costa Rican coffee plantations. In an exclosure experiment, we found that birds and bats reduced non-flying arthropod abundance by -35% and -25%, respectively. In contrast, birds and bats increased the abundance of flying arthropods, probably by consuming spiders. The frequency of this intraguild predation differed between birds and bats, with cascading consequences for coffee shrubs. Excluding birds caused a greater increase in herbivorous arthropod abundance than excluding bats, leading to increased coffee leaf damage. Excluding bats caused an increase in spiders and other predatory arthropods, increasing the ratio of predators to herbivores in the arthropod community. Bats, therefore, did not provide benefits to coffee plants. Leaf damage on coffee was low, and probably did not affect coffee yields. Bird-mediated control of herbivores, however, may aid coffee shrubs in the long-term by preventing pest outbreaks. Regardless, our results demonstrate how complex, cascading interactions between predators and herbivores may impact plants and people. PMID:24933824

  14. Fate of 14C-acrylamide in roasted and ground coffee during storage.

    PubMed

    Baum, Matthias; Böhm, Nadine; Görlitz, Jessica; Lantz, Ingo; Merz, Karl Heinz; Ternité, Rüdiger; Eisenbrand, Gerhard

    2008-05-01

    Acrylamide (AA) is formed during heating of carbohydrate rich foods in the course of the Maillard reaction. AA has been classified as probably carcinogenic to humans. Storage experiments with roasted coffee have shown that AA levels decrease depending on storage time and temperature. In the present study the fate of AA lost during storage of roasted and ground (R&G) coffee was studied, using 14C-labeled AA as radiotracer. Radiolabel was measured in coffee brew, filter residue, and volatiles. In the brew, total (14)C-label decreased during storage of R&G coffee, while activity in the filter residue built up concomitantly. [2,3-14C]-AA (14C-AA) was the only 14C-related water extractable low molecular compound in the brew detected by radio-HPLC. No formation of volatile 14C-AA-related compounds was detected during storage and coffee brewing. Close to 90% of the radiolabel in the filter residue (spent R&G coffee, spent grounds) remained firmly bound to the matrix, largely resisting extraction by aqueous ammonia, ethyl acetate, chloroform, hexane, and sequential polyenzymatic digest. Furanthiols, which are abundant as aroma components in roasted coffee, have not been found to be involved in the formation of covalent AA adducts and thus do not contribute substantially to the decrease of AA during storage. PMID:18435440

  15. Ricoseius loxocheles, a phytoseiid mite that feeds on coffee leaf rust.

    PubMed

    Oliveira, Cleber M; Ferreira, João A M; Oliveira, Rafael M; Santos, Francisco O; Pallini, Angelo

    2014-10-01

    One of the most important diseases of coffee plants is the coffee leaf rust fungus Hemileia vastatrix Berkeley and Broome (Uredinales). It can cause 30 % yield loss in some varieties of Coffea arabica (L.). Besides fungus, the coffee plants are attacked by phytophagous mites. The most common species is the coffee red mite, Oligonychus ilicis McGregor (Acari: Tetranychidae). Predatory mites of the Phytoseiidae family are well-known for their potential to control herbivorous mites and insects, but they can also develop and reproduce on various other food sources, such as plant pathogenic fungi. In a field survey, we found Ricoseius loxocheles (De Leon) (Acari: Phytoseiidae) on the necrotic areas caused by the coffee leaf rust fungus during the reproductive phase of the pathogen. We therefore assessed the development, survivorship and reproduction of R. loxocheles feeding on coffee leaf rust fungus and measured predation and oviposition of this phytoseiid having coffee red mite as prey under laboratory conditions. The mite fed, survived, developed and reproduced successfully on this pathogen but it was not able to prey on O. ilicis. Survival and oviposition with only prey were the same as without food. This phytoseiid mite does not really use O. ilicis as food. It is suggested that R. loxocheles is one phytoseiid that uses fungi as a main food source. PMID:24744058

  16. Survivability of Vibrio cholerae O1 in Cooked Rice, Coffee, and Tea.

    PubMed

    Tang, John Yew Huat; Izenty, Bariah Ibrahim; Nur' Izzati, Ahmad Juanda; Masran, Siti Rahmah; Yeo, Chew Chieng; Roslan, Arshad; Abu Bakar, Che Abdullah

    2013-01-01

    This study aimed to investigate the survival of Vibrio cholerae O1 in 3 types of preparation for cooked rice, Oryza sativa L., (plain rice, rice with coconut milk, and rice with ginger); coffee, Coffea canephora, (plain coffee, coffee with sugar, and coffee with sweetened condensed milk); and tea, Camellia sinensis, (plain tea, tea with sugar, and tea with sweetened condensed milk) held at room temperature (27°C). The survival of V. cholerae O1 was determined by spread plate method on TCBS agar. Initial cultures of 8.00 log CFU/mL were inoculated into each food sample. After 6 h incubation, significant growth was only detected in rice with coconut milk (9.67 log CFU/mL; P < 0.05). However, all 3 types of rice preparation showed significant growth of V. cholerae after 24 h (P < 0.05). For coffee and tea preparations, V. cholerae survived up to 6 h in tea with condensed milk (4.72 log CFU/mL) but not in similar preparation of coffee. This study showed evidence for the survivability of V. cholerae in rice, coffee, and tea. Thus, holding these food and beverages for an extended period of time at room temperature should be avoided. PMID:26904604

  17. Coffee Consumption and Pancreatic Cancer Risk: An Update Meta-analysis of Cohort Studies

    PubMed Central

    Ran, Heng-Quan; Wang, Jun-Zhou; Sun, Chang-Qin

    2016-01-01

    Background & Objective: The results of epidemiologic studies on the relationship between the coffee consumption and pancreatic cancer risk were inconsistent. Thus, we performed an update meta-analysis of cohort studies to quantitatively summarize the association between coffee consumption and pancreatic cancer risk. Methods: We searched CBM (China Biology Medicine disc) and MEDLINE for studies of coffee consumption and pancreatic cancer risk up to June 2015. A total of 20 cohort studies were identified in this meta-analysis, and we analyzed these studies using random effects model. The dose-response analysis was conducted too. Results: The overall relative risk (RR) for highest coffee consumption versus lowest coffee consumption was 0.75 (95% Confidence Interval (CI), 0.63-0.86). Statistic significant heterogeneity was found among these studies (I2 =37.8%, P for heterogeneity =0.045). The pooled RR for increment of 1 cup/day of coffee consumption was 0.99 (95%CI, 0.96-1.03) for the nine studies, without statistically significant. Conclusions: High coffee consumption is associated with a reduced pancreatic cancer risk. However, the result should be accepted with caution, due to the potential confounder and bias could not be excluded. Further well designed studies are needed to confirm the finding. PMID:27022386

  18. Survivability of Vibrio cholerae O1 in Cooked Rice, Coffee, and Tea

    PubMed Central

    Tang, John Yew Huat; Izenty, Bariah Ibrahim; Nur' Izzati, Ahmad Juanda; Masran, Siti Rahmah; Yeo, Chew Chieng; Roslan, Arshad; Abu Bakar, Che Abdullah

    2013-01-01

    This study aimed to investigate the survival of Vibrio cholerae O1 in 3 types of preparation for cooked rice, Oryza sativa L., (plain rice, rice with coconut milk, and rice with ginger); coffee, Coffea canephora, (plain coffee, coffee with sugar, and coffee with sweetened condensed milk); and tea, Camellia sinensis, (plain tea, tea with sugar, and tea with sweetened condensed milk) held at room temperature (27°C). The survival of V. cholerae O1 was determined by spread plate method on TCBS agar. Initial cultures of 8.00 log CFU/mL were inoculated into each food sample. After 6 h incubation, significant growth was only detected in rice with coconut milk (9.67 log CFU/mL; P < 0.05). However, all 3 types of rice preparation showed significant growth of V. cholerae after 24 h (P < 0.05). For coffee and tea preparations, V. cholerae survived up to 6 h in tea with condensed milk (4.72 log CFU/mL) but not in similar preparation of coffee. This study showed evidence for the survivability of V. cholerae in rice, coffee, and tea. Thus, holding these food and beverages for an extended period of time at room temperature should be avoided. PMID:26904604

  19. Identification of hydrogen peroxide as a major cytotoxic component in Maillard reaction mixtures and coffee.

    PubMed

    Hegele, Jörg; Münch, Gerald; Pischetsrieder, Monika

    2009-06-01

    The cytotoxic activity of Maillard reaction products and coffee was studied using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay and the neutral red uptake (NRU) assay. Equimolar mixtures of sugars and lysine were heated at 120 degrees C and used to stimulate bovine aorta endothelial cells for 24 h. The cytotoxic activity increased with increase in educt concentration and heating time. Mixtures containing ribose were most active, followed by lactose and glucose. Hydrogen peroxide, which was present in the Maillard mixtures in concentrations between 7 and 87 microM, was identified as one of their major cytotoxic components. H2O2-concentrations increased further up to 130 microM under cell culture conditions. Filter coffee, espresso, and green coffee extract reduced cell viability significantly to 10, 19, and 83% of PBS-treated control. The effect was largely attenuated by the addition of catalase. Nil, 33, and 41 microM H2O2 was measured in green coffee extract, filter coffee, and espresso, respectively, increasing to 13, 369, and 333 microM during cell culture conditions. No additional H2O2 formation was detected when coffee was incubated for up to 5 h without further treatment. In conclusion, hydrogen peroxide is a major product in Maillard mixtures and coffee inducing cell death in vitro. PMID:19199286

  20. Coffee consumption and the risk of prostate cancer: the Ohsaki Cohort Study

    PubMed Central

    Li, Q; Kakizaki, M; Sugawara, Y; Tomata, Y; Watanabe, T; Nishino, Y; Tsuji, I

    2013-01-01

    Background: Epidemiological evidence regarding the effect of coffee on the incidence of prostate cancer is inconsistent. We aimed to investigate coffee consumption and the risk of prostate cancer risk in a general Japanese population. Methods: We conducted a prospective cohort study in Ohsaki city, Japan, where 18 853 men aged 40–79 years participated in a baseline survey. Coffee consumption was assessed via a validated self-administered questionnaire. During 11 years of follow-up (from January 1 1995 to December 31, 2005), 318 incident cases of prostate cancer were detected. The Cox proportional hazards regression model was used to calculate the hazard ratios (HRs) and 95% confidence interval (CIs). Results: There was a significant inverse association between coffee consumption and the incidence risk of prostate cancer. Compared with those who did not drink coffee, the multivariate adjusted HRs were 0.81 (95% CI: 0.61–1.07), 0.73 (95% CI: 0.53–1.00), and 0.63 (095% CI: 0.39–1.00) for those who drank coffee occasionally, 1–2 cups per day, and ⩾3 cups per day, respectively, with a P for trend of 0.02. Conclusion: This prospective finding from a Japanese population adds evidence that coffee intake is inversely associated with the incidence of prostate cancer. PMID:23674088

  1. Coffee Silverskin Extract Protects against Accelerated Aging Caused by Oxidative Agents.

    PubMed

    Iriondo-DeHond, Amaia; Martorell, Patricia; Genovés, Salvador; Ramón, Daniel; Stamatakis, Konstantinos; Fresno, Manuel; Molina, Antonio; Del Castillo, Maria Dolores

    2016-01-01

    Nowadays, coffee beans are almost exclusively used for the preparation of the beverage. The sustainability of coffee production can be achieved introducing new applications for the valorization of coffee by-products. Coffee silverskin is the by-product generated during roasting, and because of its powerful antioxidant capacity, coffee silverskin aqueous extract (CSE) may be used for other applications, such as antiaging cosmetics and dermaceutics. This study aims to contribute to the coffee sector's sustainability through the application of CSE to preserve skin health. Preclinical data regarding the antiaging properties of CSE employing human keratinocytes and Caenorhabditis elegans are collected during the present study. Accelerated aging was induced by tert-butyl hydroperoxide (t-BOOH) in HaCaT cells and by ultraviolet radiation C (UVC) in C. elegans. Results suggest that the tested concentrations of coffee extracts were not cytotoxic, and CSE 1 mg/mL gave resistance to skin cells when oxidative damage was induced by t-BOOH. On the other hand, nematodes treated with CSE (1 mg/mL) showed a significant increased longevity compared to those cultured on a standard diet. In conclusion, our results support the antiaging properties of the CSE and its great potential for improving skin health due to its antioxidant character associated with phenols among other bioactive compounds present in the botanical material. PMID:27258247

  2. Complementary ecosystem services provided by pest predators and pollinators increase quantity and quality of coffee yields

    PubMed Central

    Classen, Alice; Peters, Marcell K.; Ferger, Stefan W.; Helbig-Bonitz, Maria; Schmack, Julia M.; Maassen, Genevieve; Schleuning, Matthias; Kalko, Elisabeth K. V.; Böhning-Gaese, Katrin; Steffan-Dewenter, Ingolf

    2014-01-01

    Wild animals substantially support crop production by providing ecosystem services, such as pollination and natural pest control. However, the strengths of synergies between ecosystem services and their dependencies on land-use management are largely unknown. Here, we took an experimental approach to test the impact of land-use intensification on both individual and combined pollination and pest control services in coffee production systems at Mount Kilimanjaro. We established a full-factorial pollinator and vertebrate exclosure experiment along a land-use gradient from traditional homegardens (agroforestry systems), shaded coffee plantations to sun coffee plantations (total sample size = 180 coffee bushes). The exclusion of vertebrates led to a reduction in fruit set of ca 9%. Pollinators did not affect fruit set, but significantly increased fruit weight of coffee by an average of 7.4%. We found no significant decline of these ecosystem services along the land-use gradient. Pest control and pollination service were thus complementary, contributing to coffee production by affecting the quantity and quality of a major tropical cash crop across different coffee production systems at Mount Kilimanjaro. PMID:24500173

  3. N,N-dimethylpiperidinium (mepiquat) Part 2. Formation in roasted coffee and barley during thermal processing.

    PubMed

    Wermann, Silke; Theurillat, Viviane; Verzegnassi, Ludovica; Hofmann, Jocelyne; Kuchenbecker, Ralf; Constable, Anne; Delatour, Thierry; Stadler, Richard H

    2014-01-01

    Previous work in model systems has demonstrated that mepiquat can be formed under typical roasting conditions from the amino acid lysine via the Maillard reaction and trigonelline, the latter alkaloid serving as a methyl donor. This study shows for the first time that mepiquat is formed in low mg kg(-1) amounts during the coffee roasting process and consequently can be detected in roast and ground as well as soluble coffee up to levels of 1.4 mg kg(-1). Darker roast coffees contain relatively higher amounts of mepiquat versus light roasted beans, with an excellent correlation of mepiquat formation to roast colour (r(2) = 0.99) in robusta beans. A survey of 20 of the major green coffee origins (robusta and arabica coffees) showed the absence of mepiquat (<0.005 mg kg(-1)). Preliminary studies indicate that mepiquat is not formed during processing (thermal treatment) in most of the cereal-based foods such as pizza and ready-to-eat cereals, but was detected in barley after roasting (0.64 mg kg(-1)). Mepiquat can therefore be considered a process-induced compound formed from natural constituents during the roasting process. Even considering a high intake of seven cups per day of soluble coffee containing 1.4 mg kg(-1) mepiquat in the coffee powder (the highest amount measured in this study), the resulting intake would exhaust less than 0.2% of the ADI of mepiquat. PMID:24303872

  4. Coffee bean arabinogalactans: acidic polymers covalently linked to protein.

    PubMed

    Redgwell, Robert J; Curti, Delphine; Fischer, Monica; Nicolas, Pierre; Fay, Laurent B

    2002-02-11

    The arabinogalactan content of green coffee beans (Coffea arabica var. Yellow Caturra) was released by a combination of chemical extraction and enzymatic hydrolysis of the mannan-cellulose component of the wall. Several arabinogalactan fractions were isolated, purified by gel-permeation and ion-exchange chromatography and characterised by compositional and linkage analysis. The AG fractions contained between 6 and 8% glucuronic acid, and gave a positive test for the beta-glucosyl-Yariv reagent, a stain specific for arabinogalactan-proteins. The protein component accounted for between 0.5 and 2.0% of the AGPs and contained between 7 and 12% hydroxyproline. The AG moieties displayed considerable heterogeneity with regard to their degree of arabinosylation and the extent and composition of their side-chains. They possessed a MW average of 650 kDa which ranged between 150 and 2000 kDa. An investigation of the structural features of the major AG fraction, released following enzymatic hydrolysis of the mannan-cellulose polymers, allowed a partial structure of coffee arabinogalactan to be proposed. PMID:11844494

  5. Enzymatic oxidation of phenolic compounds in coffee processing wastewater.

    PubMed

    Torres, Juliana Arriel; Batista Chagas, Pricila Maria; Silva, Maria Cristina; dos Santos, Custódio Donizete; Duarte Corrêa, Angelita

    2016-01-01

    Peroxidases can be used in the treatment of wastewater containing phenolic compounds. The effluent from the wet processing of coffee fruits contains high content of these pollutants and although some studies propose treatments for this wastewater, none targets specifically the removal of these recalcitrant compounds. This study evaluates the potential use of different peroxidase sources in the oxidation of caffeic acid and of total phenolic compounds in coffee processing wastewater (CPW). The identification and quantification of phenolic compounds in CPW was performed and caffeic acid was found to be the major phenolic compound. Some factors, such as reaction time, pH, amount of H2O2 and enzyme were evaluated, in order to determine the optimum conditions for the enzyme performance for maximum oxidation of caffeic acid. The turnip peroxidase (TPE) proved efficient in the removal of caffeic acid, reaching an oxidation of 51.05% in just 15 minutes of reaction. However, in the bioremediation of the CPW, the horseradish peroxidase (HRP) was more efficient with 32.70%±0.16 of oxidation, followed by TPE with 18.25%±0.11. The treatment proposed in this work has potential as a complementary technology, since the efficiency of the existing process is intimately conditioned to the presence of these pollutants. PMID:26744933

  6. Behavioral diversity of predatory arboreal ants in coffee agroecosystems.

    PubMed

    Philpott, Stacy M; Perfecto, Ivette; Vandermeer, John

    2008-02-01

    Aspects of predator assemblages that alter predator effects on prey have received extensive recent attention. Among other mechanisms, differences in behavior or resource use within predator trophic levels may enhance predator effects on prey, especially if effects of each predator species differ with environmental conditions. We address whether three common ant species (Azteca instabilis F. Smith, Camponotus textor Forel, and Crematogaster spp.) are functionally unique in coffee agroecosystems, asking if each species differs in (1) cooperative foraging behavior, (2) responses to experimentally introduced herbivores, and (3) responses to pest outbreaks. Furthermore, we examined the behaviors and effects of each ant species under different conditions by varying herbivore species, herbivore size, and herbivore density and carrying out observations in different seasons. Ant species significantly differed in foraging behaviors, in effects on individual herbivores, and in responses to pest outbreaks in terms of both type and time of response to herbivores. The behaviors and effects of each ant species differed in the dry and wet seasons and for different herbivore species and sizes. Although A. instabilis generally removed more larvae and more quickly removed larvae, this was not the case under all conditions. The data presented thus support that common ant species in coffee agroecosystems are behaviorally diverse in their responses to herbivores under different conditions. We discuss the implications of these differences in ant behaviors for enhancement of predatory function in light of both multipredator effects and in terms of the potential importance of predator diversity. PMID:18348809

  7. Analysis of amino acids and carbohydrates in green coffee.

    PubMed

    Murkovic, Michael; Derler, Karin

    2006-11-30

    The analysis of carbohydrates and amino acids in green coffee is of the utmost importance since these two classes of compounds act as precursors of the Maillard reaction during which the colour and aroma are formed. During the course of the Maillard reaction potentially harmful substances like acrylamide or 5-hydroxymethyl-furfural accrue as well. The carbohydrates were analysed by anion-exchange chromatography with pulsed amperometric detection and the amino acids by reversed phase chromatography after derivatization with 6-amino-quinolyl-N-hydroxysuccinimidyl carbamate and fluorescence detection. Both methods had to be optimized to obtain a sufficient resolution of the analytes for identification and quantification. Sucrose is the dominant carbohydrate in green coffee with a concentration of up to 90 mg/g (mean = 73 mg/g) in arabica beans and significantly lower amounts in robusta beans (mean=45 mg/g). Alanine is the amino acid with the highest concentration (mean = 1200 microg/g) followed by asparagine (mean = 680 microg/g) in robusta and 800 microg/g and 360 microg/g in arabica respectively. In general, the concentration of amino acids is higher in robusta than in arabica. PMID:16563515

  8. [Extraction and quantification of polyphenols from coffee pulp].

    PubMed

    García, L A; Vélez, A J; de Rozo, M P

    1985-09-01

    The polyphenol content of coffee pulp extracts was determined using the Folin-Ciocalteau method. The use of polyvynilpirrolidone (PVP) was introduced in order to eliminate interferences. Condensed polyphenols in the extracts were determined by the method of acidified vanillin. Chlorogenic acid and catechin were used as standards for Folin-Ciocalteau and Vanillin methods, respectively, and a calibration curve was constructed for each solvent. The solvents used were methanol, methanol-water (50:50), ammonium hydroxide (3%) and calcium hydroxide (1%), using times of extraction of 10 minutes and 1 hour. No differences were found in the amount of polyphenols extracted by the different solvents at the two extraction times. After 10 minutes, the alkaline solvents NH4OH (3%) and Ca(OH)2 (1%), extracted more polyphenols than the other two solvents. Nevertheless, ammonium hydroxide (3%) was more efficient in extracting condensed polyphenols. The results herein presented suggest that treating coffee pulp with mild alkaline solvents may improve its nutritive value. PMID:3842054

  9. Effects of land use on bird populations and pest control services on coffee farms.

    PubMed

    Railsback, Steven F; Johnson, Matthew D

    2014-04-22

    Global increases in both agriculture and biodiversity awareness raise a key question: Should cropland and biodiversity habitat be separated, or integrated in mixed land uses? Ecosystem services by wildlife make this question more complex. For example, birds benefit agriculture by preying on pest insects, but other habitat is needed to maintain the birds. Resulting land use questions include what areas and arrangements of habitat support sufficient birds to control pests, whether this pest control offsets the reduced cropland, and the comparative benefits of "land sharing" (i.e., mixed cropland and habitat) vs. "land sparing" (i.e., separate areas of intensive agriculture and habitat). Such questions are difficult to answer using field studies alone, so we use a simulation model of Jamaican coffee farms, where songbirds suppress the coffee berry borer (CBB). Simulated birds select habitat and prey in five habitat types: intact forest, trees (including forest fragments), shade coffee, sun coffee, and unsuitable habitat. The trees habitat type appears to be especially important, providing efficient foraging and roosting sites near coffee plots. Small areas of trees (but not forest alone) could support a sufficient number of birds to suppress CBB in sun coffee; the degree to which trees are dispersed within coffee had little effect. In simulations without trees, shade coffee supported sufficient birds to offset its lower yield. High areas of both trees and shade coffee reduced pest control because CBB was less often profitable prey. Because of the pest control service provided by birds, land sharing was predicted to be more beneficial than land sparing in this system. PMID:24711377

  10. Environmental characterization of a coffee processing workplace with obliterative bronchiolitis in former workers.

    PubMed

    Duling, Matthew G; LeBouf, Ryan F; Cox-Ganser, Jean M; Kreiss, Kathleen; Martin, Stephen B; Bailey, Rachel L

    2016-10-01

    Obliterative bronchiolitis in five former coffee processing employees at a single workplace prompted an exposure study of current workers. Exposure characterization was performed by observing processes, assessing the ventilation system and pressure relationships, analyzing headspace of flavoring samples, and collecting and analyzing personal breathing zone and area air samples for diacetyl and 2,3-pentanedione vapors and total inhalable dust by work area and job title. Mean airborne concentrations were calculated using the minimum variance unbiased estimator of the arithmetic mean. Workers in the grinding/packaging area for unflavored coffee had the highest mean diacetyl exposures, with personal concentrations averaging 93 parts per billion (ppb). This area was under positive pressure with respect to flavored coffee production (mean personal diacetyl levels of 80 ppb). The 2,3-pentanedione exposures were highest in the flavoring room with mean personal exposures of 122 ppb, followed by exposures in the unflavored coffee grinding/packaging area (53 ppb). Peak 15-min airborne concentrations of 14,300 ppb diacetyl and 13,800 ppb 2,3-pentanedione were measured at a small open hatch in the lid of a hopper containing ground unflavored coffee on the mezzanine over the grinding/packaging area. Three out of the four bulk coffee flavorings tested had at least a factor of two higher 2,3-pentanedione than diacetyl headspace measurements. At a coffee processing facility producing both unflavored and flavored coffee, we found the grinding and packaging of unflavored coffee generate simultaneous exposures to diacetyl and 2,3-pentanedione that were well in excess of the NIOSH proposed RELs and similar in magnitude to those in the areas using a flavoring substitute for diacetyl. These findings require physicians to be alert for obliterative bronchiolitis and employers, government, and public health consultants to assess the similarities and differences across the industry to

  11. Not All Flavor Expertise Is Equal: The Language of Wine and Coffee Experts

    PubMed Central

    Majid, Asifa

    2016-01-01

    People in Western cultures are poor at naming smells and flavors. However, for wine and coffee experts, describing smells and flavors is part of their daily routine. So are experts better than lay people at conveying smells and flavors in language? If smells and flavors are more easily linguistically expressed by experts, or more “codable”, then experts should be better than novices at describing smells and flavors. If experts are indeed better, we can also ask how general this advantage is: do experts show higher codability only for smells and flavors they are expert in (i.e., wine experts for wine and coffee experts for coffee) or is their linguistic dexterity more general? To address these questions, wine experts, coffee experts, and novices were asked to describe the smell and flavor of wines, coffees, everyday odors, and basic tastes. The resulting descriptions were compared on a number of measures. We found expertise endows a modest advantage in smell and flavor naming. Wine experts showed more consistency in how they described wine smells and flavors than coffee experts, and novices; but coffee experts were not more consistent for coffee descriptions. Neither expert group was any more accurate at identifying everyday smells or tastes. Interestingly, both wine and coffee experts tended to use more source-based terms (e.g., vanilla) in descriptions of their own area of expertise whereas novices tended to use more evaluative terms (e.g., nice). However, the overall linguistic strategies for both groups were en par. To conclude, experts only have a limited, domain-specific advantage when communicating about smells and flavors. The ability to communicate about smells and flavors is a matter not only of perceptual training, but specific linguistic training too. PMID:27322035

  12. Coffee or tea consumption and the risk of rheumatoid arthritis: a meta-analysis.

    PubMed

    Lee, Young Ho; Bae, Sang-Cheol; Song, Gwan Gyu

    2014-11-01

    Meta-analysis of the cohort studies revealed a trend of an association between total coffee intake and RA incidence (RR of the highest vs. the lowest group = 1.309, 95 % confidence interval [CI] = 0.967-1.771, p = 0.085). Meta-analysis of case-control studies showed a significant association between total coffee intake and RA incidence (RR = 1.201, 95 % CI =1.058-1.361, p = 0.005). There were differences in the reference groups (all categories of coffee) between the case-control meta-analysis that showed a significant association and the cohort studies where meta-analysis results were non-significant. In addition, the highest category of coffee intake varied between Heliovaara et al. cohort study from Finland where the highest category included drinking up to 13 cups per day, compared to US studies where it was very unusual to have > 4 cups coffee intake per day. Combining the data of the cohort and case-control studies showed a significant association between total coffee intake and RA incidence (RR = 1.217, 95 % CI = 1.083-1.368,p = 0.001). Meta-analysis stratified by seropositivity indicated a significant association between coffee consumption and seropositive RA risk (RR=1.309, 95 % CI=1.142-1.499, p=1.1x10-5), but not seronegative RA risk (RR=1.097, 95 % CI=0.886-1.357, p=0.396). There was no significant association between decaffeinated coffee consumption and RA incidence (RR=1.709, 95 % CI 0.786-3.715), or between caffeinated coffee consumption and RA incidence (RR=1.055, 95 % CI 0.782-1.421). [corrected]. PMID:24763752

  13. The effects of the decaffeination of coffee samples on platelet aggregation in hyperlipidemic rats.

    PubMed

    Silvério, Alessandra dos Santos Danziger; Pereira, Rosemary Gualberto Fonseca Alvarenga; Lima, Adriene Ribeiro; Paula, Fernanda Borges de Araújo; Rodrigues, Maria Rita; Baldissera, Lineu; Duarte, Stella Maris da Silveira

    2013-09-01

    The effect of coffee on cardiovascular diseases is still controversial. It is known that the process of decaffeination may influence the chemical constitution and, therefore, the biological effects of coffee. This study thus evaluated the effects of decaffeination on the levels of total phenols and chlorogenic acids in Coffea arabica L. samples, as well as the effects of ingesting both integral and decaffeinated coffee on the lipid profile and hemostatic and hematological parameters in normal and hyperlipidemic rats. Samples of integral and decaffeinated lyophilized coffee (Coffea arabica L., planted in Brazil) were used for chemical analysis (total phenols, chlorogenic acid and caffeine contents). For the bioassays, coffee beverages were prepared with non-lyophilized samples (10% w/v) and were filtered and administered to animals by gavage (7.2 mL/kg/day) over 30 days. On the 31st day after beginning the treatment with coffee beverages, hyperlipidemia was induced to the animals by administering Triton WR-1339 (300 mg/kg body weight). On day 32, blood was taken to determine the lipid profile, platelet aggregation, prothrombin time, partially activated thromboplastin time and hemogram. The contents of both phenolic compounds and chlorogenic acid in the integral coffee beverage were significantly lower than those in the decaffeinated coffee beverage. The animals treated with Triton WR-1339 presented a mixed hyperlipidemia. Although the decaffeination process caused a relative increase in total phenols and chlorogenic acids, the coffee drinks were unable to change the lipid profile or the hemostatic and hematological parameters in the studied animals. PMID:23780748

  14. Coffee consumption and bladder cancer: a meta-analysis of observational studies

    PubMed Central

    Wu, Weixiang; Tong, Yeqing; Zhao, Qiang; Yu, Guangxia; Wei, Xiaoyun; Lu, Qing

    2015-01-01

    Controversial results of the association between coffee consumption and bladder cancer (BC) risk were reported among epidemiological studies. Therefore, we conducted this meta-analysis to clarify the association. Relevant studies were identified according to the inclusion criteria. Totally, 34 case-control studies and 6 cohort studies were included in our meta-analysis. The overall odds ratio (OR) with 95% confidence interval (CI) between coffee consumption and BC risk was 1.33 (95% CI 1.19 to 1.48). The summary ORs of BC for an increase of 1 cup of coffee per day were 1.05 (95% CI 1.03 to 1.06) for case-control studies and 1.03 (95% CI 0.99 to 1.06) for cohort studies. The overall ORs for male coffee drinkers, female coffee drinkers and coffee drinkers of both gender were 1.31 (95% CI: 1.08 to 1.59), 1.30 (95% CI: 0.87 to 1.96) and 1.35 (95% CI: 1.20 to 1.51). Compared with smokers (OR = 1.24, 95% CI: 0.91 to 1.70), non-smokers had a higher risk (OR = 1.72, 95% CI: 1.25 to 2.35) for BC. Results of this meta-analysis suggested that there was an increased risk between coffee consumption and BC. Male coffee drinkers and non-smoking coffee drinkers were more likely to develop BC. PMID:25761588

  15. Not All Flavor Expertise Is Equal: The Language of Wine and Coffee Experts.

    PubMed

    Croijmans, Ilja; Majid, Asifa

    2016-01-01

    People in Western cultures are poor at naming smells and flavors. However, for wine and coffee experts, describing smells and flavors is part of their daily routine. So are experts better than lay people at conveying smells and flavors in language? If smells and flavors are more easily linguistically expressed by experts, or more "codable", then experts should be better than novices at describing smells and flavors. If experts are indeed better, we can also ask how general this advantage is: do experts show higher codability only for smells and flavors they are expert in (i.e., wine experts for wine and coffee experts for coffee) or is their linguistic dexterity more general? To address these questions, wine experts, coffee experts, and novices were asked to describe the smell and flavor of wines, coffees, everyday odors, and basic tastes. The resulting descriptions were compared on a number of measures. We found expertise endows a modest advantage in smell and flavor naming. Wine experts showed more consistency in how they described wine smells and flavors than coffee experts, and novices; but coffee experts were not more consistent for coffee descriptions. Neither expert group was any more accurate at identifying everyday smells or tastes. Interestingly, both wine and coffee experts tended to use more source-based terms (e.g., vanilla) in descriptions of their own area of expertise whereas novices tended to use more evaluative terms (e.g., nice). However, the overall linguistic strategies for both groups were en par. To conclude, experts only have a limited, domain-specific advantage when communicating about smells and flavors. The ability to communicate about smells and flavors is a matter not only of perceptual training, but specific linguistic training too. PMID:27322035

  16. Effects of land use on bird populations and pest control services on coffee farms

    PubMed Central

    Railsback, Steven F.; Johnson, Matthew D.

    2014-01-01

    Global increases in both agriculture and biodiversity awareness raise a key question: Should cropland and biodiversity habitat be separated, or integrated in mixed land uses? Ecosystem services by wildlife make this question more complex. For example, birds benefit agriculture by preying on pest insects, but other habitat is needed to maintain the birds. Resulting land use questions include what areas and arrangements of habitat support sufficient birds to control pests, whether this pest control offsets the reduced cropland, and the comparative benefits of “land sharing” (i.e., mixed cropland and habitat) vs. “land sparing” (i.e., separate areas of intensive agriculture and habitat). Such questions are difficult to answer using field studies alone, so we use a simulation model of Jamaican coffee farms, where songbirds suppress the coffee berry borer (CBB). Simulated birds select habitat and prey in five habitat types: intact forest, trees (including forest fragments), shade coffee, sun coffee, and unsuitable habitat. The trees habitat type appears to be especially important, providing efficient foraging and roosting sites near coffee plots. Small areas of trees (but not forest alone) could support a sufficient number of birds to suppress CBB in sun coffee; the degree to which trees are dispersed within coffee had little effect. In simulations without trees, shade coffee supported sufficient birds to offset its lower yield. High areas of both trees and shade coffee reduced pest control because CBB was less often profitable prey. Because of the pest control service provided by birds, land sharing was predicted to be more beneficial than land sparing in this system. PMID:24711377

  17. Brazilian peppertree (Schinus terebinthifolius) in Florida and South America: Evidence of a possible niche shift driven by hybridization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Brazilian peppertree (Schinus terebinthifolius Raddi, Anacardiaceae) was introduced into Florida from South America in the 1800s and commercialized as an ornamental plant. Based on herbaria records and available literature, it began to escape cultivation and invade ruderal and natural habitats in t...

  18. Sociocultural Influences on Brazilian Children's Drawings.

    ERIC Educational Resources Information Center

    Stokrocki, Mary

    2000-01-01

    Reports on insights about sociocultural influences on Brazilian children's drawings, using visual anthropology to examine children's drawings that depicted what they like to do. Discusses visual anthropology, provides information on Brazilian educational influences, and presents the context and findings of the study. (CMK)

  19. Identification Of Geographical Origin Of Coffee Before And After Roasting By Electronic Noses

    NASA Astrophysics Data System (ADS)

    Sberveglieri, V.; Concina, I.; Falasconi, M.; Ongo, E.; Pulvirenti, A.; Fava, P.

    2011-09-01

    Geographical origin traceability of food is a relevant issue for both producers' business protection and customers' rights safeguard. Differentiation of coffees on the basis of geographical origin is still a challenging issue, though possible by means of chemical techniques [1]. Between the most widely consumed beverage, coffee is a valuable one, with an aroma constituted by hundreds of volatiles [2]. Since the final global volatile composition is also determined by the cultivation climatic conditions, Electronic Noses (ENs) could be interesting candidates for distinguishing the geographical provenience by exploiting differences in chemical volatile profile. The present investigation is directed toward the characterization of green and roasted coffees samples according to their geographical origin.

  20. Increased chromosome fragility as a consequence of blood folate levels, smoking status, and coffee consumption

    SciTech Connect

    Chen, A.T.L.; Reidy, J.A.; Annest, J.L.; Welty, T.K.; Zhou, H. )

    1989-01-01

    Chromosome fragility in 96 h, low-folate cultures was found to be associated with smoking status, coffee consumption, and blood folate level. The higher proportion of cells with chromosome aberrations in cigarette smokers was attributable to lower red cell folate levels in smokers compared with nonsmokers. There was a positive linear relationship between the average cups of coffee consumed per day and the proportion of cells with aberrations. This association was independent of the effects of smoking and red cell folate level. These data suggest that smoking history, coffee consumption, and red cell folate level are important considerations for the design and interpretation of fragile site studies in cancer cytogenetics.