Sample records for controls bacterial genes

  1. Bacterial avirulence genes.

    PubMed

    Leach, J E; White, F F

    1996-01-01

    Although more than 30 bacterial avirulence genes have been cloned and characterized, the function of the gene products in the elictitation of resistance is unknown in all cases but one. The product of avrD from Pseudomonas syringae pv. glycinea likely functions indirectly to elicit resistance in soybean, that is, evidence suggests the gene product is an enzyme involved in elicitor production. In most if not all cases, bacterial avirulence gene function is dependent on interactions with the hypersensitive response and pathogenicity (hrp) genes. Many hrp genes are similar to genes involved in delivery of pathogenicity factors in mammalian bacterial pathogens. Thus, analogies between mammalian and plant pathogens may provide needed clues to elucidate how virulence gene products control induction of resistance.

  2. Genome engineering and gene expression control for bacterial strain development.

    PubMed

    Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

    2015-01-01

    In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A maize resistance gene functions against bacterial streak disease in rice.

    PubMed

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  4. A maize resistance gene functions against bacterial streak disease in rice

    PubMed Central

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease. PMID:16230639

  5. Computational design of a Zn2+ receptor that controls bacterial gene expression

    NASA Astrophysics Data System (ADS)

    Dwyer, M. A.; Looger, L. L.; Hellinga, H. W.

    2003-09-01

    The control of cellular physiology and gene expression in response to extracellular signals is a basic property of living systems. We have constructed a synthetic bacterial signal transduction pathway in which gene expression is controlled by extracellular Zn2+. In this system a computationally designed Zn2+-binding periplasmic receptor senses the extracellular solute and triggers a two-component signal transduction pathway via a chimeric transmembrane protein, resulting in transcriptional up-regulation of a -galactosidase reporter gene. The Zn2+-binding site in the designed receptor is based on a four-coordinate, tetrahedral primary coordination sphere consisting of histidines and glutamates. In addition, mutations were introduced in a secondary coordination sphere to satisfy the residual hydrogen-bonding potential of the histidines coordinated to the metal. The importance of the secondary shell interactions is demonstrated by their effect on metal affinity and selectivity, as well as protein stability. Three designed protein sequences, comprising two distinct metal-binding positions, were all shown to bind Zn2+ and to function in the cell-based assay, indicating the generality of the design methodology. These experiments demonstrate that biological systems can be manipulated with computationally designed proteins that have drastically altered ligand-binding specificities, thereby extending the repertoire of genetic control by extracellular signals.

  6. Changes in rhizosphere bacterial gene expression following glyphosate treatment.

    PubMed

    Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W

    2016-05-15

    In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All

  7. Sugar Lego: gene composition of bacterial carbohydrate metabolism genomic loci.

    PubMed

    Kaznadzey, Anna; Shelyakin, Pavel; Gelfand, Mikhail S

    2017-11-25

    Bacterial carbohydrate metabolism is extremely diverse, since carbohydrates serve as a major energy source and are involved in a variety of cellular processes. Bacterial genes belonging to same metabolic pathway are often co-localized in the chromosome, but it is not a strict rule. Gene co-localization in linked to co-evolution and co-regulation. This study focuses on a large-scale analysis of bacterial genomic loci related to the carbohydrate metabolism. We demonstrate that only 53% of 148,000 studied genes from over six hundred bacterial genomes are co-localized in bacterial genomes with other carbohydrate metabolism genes, which points to a significant role of singleton genes. Co-localized genes form cassettes, ranging in size from two to fifteen genes. Two major factors influencing the cassette-forming tendency are gene function and bacterial phylogeny. We have obtained a comprehensive picture of co-localization preferences of genes for nineteen major carbohydrate metabolism functional classes, over two hundred gene orthologous clusters, and thirty bacterial classes, and characterized the cassette variety in size and content among different species, highlighting a significant role of short cassettes. The preference towards co-localization of carbohydrate metabolism genes varies between 40 and 76% for bacterial taxa. Analysis of frequently co-localized genes yielded forty-five significant pairwise links between genes belonging to different functional classes. The number of such links per class range from zero to eight, demonstrating varying preferences of respective genes towards a specific chromosomal neighborhood. Genes from eleven functional classes tend to co-localize with genes from the same class, indicating an important role of clustering of genes with similar functions. At that, in most cases such co-localization does not originate from local duplication events. Overall, we describe a complex web formed by evolutionary relationships of bacterial

  8. Bacterial community and arsenic functional genes diversity in arsenic contaminated soils from different geographic locations

    PubMed Central

    Gu, Yunfu; D. Van Nostrand, Joy; Wu, Liyou; He, Zhili; Qin, Yujia; Zhao, Fang-Jie; Zhou, Jizhong

    2017-01-01

    To understand how soil microbial communities and arsenic (As) functional genes respond to soil arsenic (As) contamination, five soils contaminated with As at different levels were collected from diverse geographic locations, incubated for 54 days under flooded conditions, and examined by both MiSeq sequencing of 16S rRNA gene amplicons and functional gene microarray (GeoChip 4.0). The results showed that both bacterial community structure and As functional gene structure differed among geographical locations. The diversity of As functional genes correlated positively with the diversity of 16S rRNA genes (P< 0.05). Higher diversities of As functional genes and 16S rRNA genes were observed in the soils with higher available As. Soil pH, phosphate-extractable As, and amorphous Fe content were the most important factors in shaping the bacterial community structure and As transformation functional genes. Geographic location was also important in controlling both the bacterial community and As transformation functional potential. These findings provide insights into the variation of As transformation functional genes in soils contaminated with different levels of As at different geographic locations, and the impact of environmental As contamination on the soil bacterial community. PMID:28475654

  9. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    PubMed Central

    McDonald, Bradon R.

    2017-01-01

    ABSTRACT Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces. Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution. PMID:28588130

  10. Genetic analysis of a bacterial genetic exchange element: The gene transfer agent of Rhodobacter capsulatus

    PubMed Central

    Lang, Andrew S.; Beatty, J. T.

    2000-01-01

    An unusual system of genetic exchange exists in the purple nonsulfur bacterium Rhodobacter capsulatus. DNA transmission is mediated by a small bacteriophage-like particle called the gene transfer agent (GTA) that transfers random 4.5-kb segments of the producing cell's genome to recipient cells, where allelic replacement occurs. This paper presents the results of gene cloning, analysis, and mutagenesis experiments that show that GTA resembles a defective prophage related to bacteriophages from diverse genera of bacteria, which has been adopted by R. capsulatus for genetic exchange. A pair of cellular proteins, CckA and CtrA, appear to constitute part of a sensor kinase/response regulator signaling pathway that is required for expression of GTA structural genes. This signaling pathway controls growth-phase-dependent regulation of GTA gene messages, yielding maximal gene expression in the stationary phase. We suggest that GTA is an ancient prophage remnant that has evolved in concert with the bacterial genome, resulting in a genetic exchange process controlled by the bacterial cell. PMID:10639170

  11. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDonald, Bradon R.; Currie, Cameron R.

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. For this paper, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genusStreptomyces. Using a molecular clock, we estimate that theStreptomycesbacteria are ~380 million years old, indicating that this bacterial genus is as ancient as landmore » vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span,Streptomycesaccumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution.Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genusStreptomyces, with merely one gene acquired inStreptomyceslineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new

  12. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    DOE PAGES

    McDonald, Bradon R.; Currie, Cameron R.

    2017-06-06

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. For this paper, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genusStreptomyces. Using a molecular clock, we estimate that theStreptomycesbacteria are ~380 million years old, indicating that this bacterial genus is as ancient as landmore » vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span,Streptomycesaccumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution.Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genusStreptomyces, with merely one gene acquired inStreptomyceslineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new

  13. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces.

    PubMed

    McDonald, Bradon R; Currie, Cameron R

    2017-06-06

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution. IMPORTANCE Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genus Streptomyces , with merely one gene acquired in Streptomyces lineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new

  14. Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.

    PubMed

    Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C

    2015-09-01

    The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.

  15. Genome-wide identification of bacterial plant colonization genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.

    Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

  16. Genome-wide identification of bacterial plant colonization genes

    DOE PAGES

    Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.; ...

    2017-09-22

    Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

  17. CRISPR Perturbation of Gene Expression Alters Bacterial Fitness under Stress and Reveals Underlying Epistatic Constraints.

    PubMed

    Otoupal, Peter B; Erickson, Keesha E; Escalas-Bordoy, Antoni; Chatterjee, Anushree

    2017-01-20

    The evolution of antibiotic resistance has engendered an impending global health crisis that necessitates a greater understanding of how resistance emerges. The impact of nongenetic factors and how they influence the evolution of resistance is a largely unexplored area of research. Here we present a novel application of CRISPR-Cas9 technology for investigating how gene expression governs the adaptive pathways available to bacteria during the evolution of resistance. We examine the impact of gene expression changes on bacterial adaptation by constructing a library of deactivated CRISPR-Cas9 synthetic devices to tune the expression of a set of stress-response genes in Escherichia coli. We show that artificially inducing perturbations in gene expression imparts significant synthetic control over fitness and growth during stress exposure. We present evidence that these impacts are reversible; strains with synthetically perturbed gene expression regained wild-type growth phenotypes upon stress removal, while maintaining divergent growth characteristics under stress. Furthermore, we demonstrate a prevailing trend toward negative epistatic interactions when multiple gene perturbations are combined simultaneously, thereby posing an intrinsic constraint on gene expression underlying adaptive trajectories. Together, these results emphasize how CRISPR-Cas9 can be employed to engineer gene expression changes that shape bacterial adaptation, and present a novel approach to synthetically control the evolution of antimicrobial resistance.

  18. Evaluating bacterial gene-finding HMM structures as probabilistic logic programs.

    PubMed

    Mørk, Søren; Holmes, Ian

    2012-03-01

    Probabilistic logic programming offers a powerful way to describe and evaluate structured statistical models. To investigate the practicality of probabilistic logic programming for structure learning in bioinformatics, we undertook a simplified bacterial gene-finding benchmark in PRISM, a probabilistic dialect of Prolog. We evaluate Hidden Markov Model structures for bacterial protein-coding gene potential, including a simple null model structure, three structures based on existing bacterial gene finders and two novel model structures. We test standard versions as well as ADPH length modeling and three-state versions of the five model structures. The models are all represented as probabilistic logic programs and evaluated using the PRISM machine learning system in terms of statistical information criteria and gene-finding prediction accuracy, in two bacterial genomes. Neither of our implementations of the two currently most used model structures are best performing in terms of statistical information criteria or prediction performances, suggesting that better-fitting models might be achievable. The source code of all PRISM models, data and additional scripts are freely available for download at: http://github.com/somork/codonhmm. Supplementary data are available at Bioinformatics online.

  19. Determination of the Core of a Minimal Bacterial Gene Set†

    PubMed Central

    Gil, Rosario; Silva, Francisco J.; Peretó, Juli; Moya, Andrés

    2004-01-01

    The availability of a large number of complete genome sequences raises the question of how many genes are essential for cellular life. Trying to reconstruct the core of the protein-coding gene set for a hypothetical minimal bacterial cell, we have performed a computational comparative analysis of eight bacterial genomes. Six of the analyzed genomes are very small due to a dramatic genome size reduction process, while the other two, corresponding to free-living relatives, are larger. The available data from several systematic experimental approaches to define all the essential genes in some completely sequenced bacterial genomes were also considered, and a reconstruction of a minimal metabolic machinery necessary to sustain life was carried out. The proposed minimal genome contains 206 protein-coding genes with all the genetic information necessary for self-maintenance and reproduction in the presence of a full complement of essential nutrients and in the absence of environmental stress. The main features of such a minimal gene set, as well as the metabolic functions that must be present in the hypothetical minimal cell, are discussed. PMID:15353568

  20. Bacterial gene abundances as indicators of greenhouse gas emission in soils.

    PubMed

    Morales, Sergio E; Cosart, Theodore; Holben, William E

    2010-06-01

    Nitrogen fixing and denitrifying bacteria, respectively, control bulk inputs and outputs of nitrogen in soils, thereby mediating nitrogen-based greenhouse gas emissions in an ecosystem. Molecular techniques were used to evaluate the relative abundances of nitrogen fixing, denitrifying and two numerically dominant ribotypes (based on the > or =97% sequence similarity at the 16S rRNA gene) of bacteria in plots representing 10 agricultural and other land-use practices at the Kellogg biological station long-term ecological research site. Quantification of nitrogen-related functional genes (nitrite reductase, nirS; nitrous oxide reductase, nosZ; and nitrogenase, nifH) as well as two dominant 16S ribotypes (belonging to the phyla Acidobacteria, Thermomicrobia) allowed us to evaluate the hypothesis that microbial community differences are linked to greenhouse gas emissions under different land management practices. Our results suggest that the successional stages of the ecosystem are strongly linked to bacterial functional group abundance, and that the legacy of agricultural practices can be sustained over decades. We also link greenhouse gas emissions with specific compositional responses in the soil bacterial community and assess the use of denitrifying gene abundances as proxies for determining nitrous oxide emissions from soils.

  1. Can dead bacterial cells be defined and are genes expressed after cell death?

    PubMed

    Trevors, J T

    2012-07-01

    There is a paucity of knowledge on gene expression in dead bacterial cells. Why would this knowledge be useful? The cells are dead. However, the time duration of gene expression following cell death is often unknown, and possibly in the order of minutes. In addition, it is a challenge to determine if bacterial cells are dead, or viable but non-culturable (VBNC), and what is an agreed upon correct definition of dead bacteria. Cells in the bacterial population or community may die at different rates or times and this complicates both the viability and gene expression analysis. In this article, the definition of dead bacterial cells is discussed and its significance in continued gene expression in cells following death. The definition of living and dead has implications for possible, completely, synthetic bacterial cells that may be capable of growth and division. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Bacterial α2-macroglobulins: colonization factors acquired by horizontal gene transfer from the metazoan genome?

    PubMed Central

    Budd, Aidan; Blandin, Stephanie; Levashina, Elena A; Gibson, Toby J

    2004-01-01

    Background Invasive bacteria are known to have captured and adapted eukaryotic host genes. They also readily acquire colonizing genes from other bacteria by horizontal gene transfer. Closely related species such as Helicobacter pylori and Helicobacter hepaticus, which exploit different host tissues, share almost none of their colonization genes. The protease inhibitor α2-macroglobulin provides a major metazoan defense against invasive bacteria, trapping attacking proteases required by parasites for successful invasion. Results Database searches with metazoan α2-macroglobulin sequences revealed homologous sequences in bacterial proteomes. The bacterial α2-macroglobulin phylogenetic distribution is patchy and violates the vertical descent model. Bacterial α2-macroglobulin genes are found in diverse clades, including purple bacteria (proteobacteria), fusobacteria, spirochetes, bacteroidetes, deinococcids, cyanobacteria, planctomycetes and thermotogae. Most bacterial species with bacterial α2-macroglobulin genes exploit higher eukaryotes (multicellular plants and animals) as hosts. Both pathogenically invasive and saprophytically colonizing species possess bacterial α2-macroglobulins, indicating that bacterial α2-macroglobulin is a colonization rather than a virulence factor. Conclusions Metazoan α2-macroglobulins inhibit proteases of pathogens. The bacterial homologs may function in reverse to block host antimicrobial defenses. α2-macroglobulin was probably acquired one or more times from metazoan hosts and has then spread widely through other colonizing bacterial species by more than 10 independent horizontal gene transfers. yfhM-like bacterial α2-macroglobulin genes are often found tightly linked with pbpC, encoding an atypical peptidoglycan transglycosylase, PBP1C, that does not function in vegetative peptidoglycan synthesis. We suggest that YfhM and PBP1C are coupled together as a periplasmic defense and repair system. Bacterial α2-macroglobulins might

  3. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data.

    PubMed

    Tintle, Nathan L; Sitarik, Alexandra; Boerema, Benjamin; Young, Kylie; Best, Aaron A; Dejongh, Matthew

    2012-08-08

    Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  4. Bacterial gene transfer by natural genetic transformation in the environment.

    PubMed Central

    Lorenz, M G; Wackernagel, W

    1994-01-01

    Natural genetic transformation is the active uptake of free DNA by bacterial cells and the heritable incorporation of its genetic information. Since the famous discovery of transformation in Streptococcus pneumoniae by Griffith in 1928 and the demonstration of DNA as the transforming principle by Avery and coworkers in 1944, cellular processes involved in transformation have been studied extensively by in vitro experimentation with a few transformable species. Only more recently has it been considered that transformation may be a powerful mechanism of horizontal gene transfer in natural bacterial populations. In this review the current understanding of the biology of transformation is summarized to provide the platform on which aspects of bacterial transformation in water, soil, and sediments and the habitat of pathogens are discussed. Direct and indirect evidence for gene transfer routes by transformation within species and between different species will be presented, along with data suggesting that plasmids as well as chromosomal DNA are subject to genetic exchange via transformation. Experiments exploring the prerequisites for transformation in the environment, including the production and persistence of free DNA and factors important for the uptake of DNA by cells, will be compiled, as well as possible natural barriers to transformation. The efficiency of gene transfer by transformation in bacterial habitats is possibly genetically adjusted to submaximal levels. The fact that natural transformation has been detected among bacteria from all trophic and taxonomic groups including archaebacteria suggests that transformability evolved early in phylogeny. Probable functions of DNA uptake other than gene acquisition will be discussed. The body of information presently available suggests that transformation has a great impact on bacterial population dynamics as well as on bacterial evolution and speciation. PMID:7968924

  5. Dynamics of Bacterial Gene Regulatory Networks.

    PubMed

    Shis, David L; Bennett, Matthew R; Igoshin, Oleg A

    2018-05-20

    The ability of bacterial cells to adjust their gene expression program in response to environmental perturbation is often critical for their survival. Recent experimental advances allowing us to quantitatively record gene expression dynamics in single cells and in populations coupled with mathematical modeling enable mechanistic understanding on how these responses are shaped by the underlying regulatory networks. Here, we review how the combination of local and global factors affect dynamical responses of gene regulatory networks. Our goal is to discuss the general principles that allow extrapolation from a few model bacteria to less understood microbes. We emphasize that, in addition to well-studied effects of network architecture, network dynamics are shaped by global pleiotropic effects and cell physiology.

  6. A gene-targeted approach to investigate the intestinal butyrate-producing bacterial community

    PubMed Central

    2013-01-01

    Background Butyrate, which is produced by the human microbiome, is essential for a well-functioning colon. Bacteria that produce butyrate are phylogenetically diverse, which hinders their accurate detection based on conventional phylogenetic markers. As a result, reliable information on this important bacterial group is often lacking in microbiome research. Results In this study we describe a gene-targeted approach for 454 pyrotag sequencing and quantitative polymerase chain reaction for the final genes in the two primary bacterial butyrate synthesis pathways, butyryl-CoA:acetate CoA-transferase (but) and butyrate kinase (buk). We monitored the establishment and early succession of butyrate-producing communities in four patients with ulcerative colitis who underwent a colectomy with ileal pouch anal anastomosis and compared it with three control samples from healthy colons. All patients established an abundant butyrate-producing community (approximately 5% to 26% of the total community) in the pouch within the 2-month study, but patterns were distinctive among individuals. Only one patient harbored a community profile similar to the healthy controls, in which there was a predominance of but genes that are similar to reference genes from Acidaminococcus sp., Eubacterium sp., Faecalibacterium prausnitzii and Roseburia sp., and an almost complete absence of buk genes. Two patients were greatly enriched in buk genes similar to those of Clostridium butyricum and C. perfringens, whereas a fourth patient displayed abundant communities containing both genes. Most butyrate producers identified in previous studies were detected and the general patterns of taxa found were supported by 16S rRNA gene pyrotag analysis, but the gene-targeted approach provided more detail about the potential butyrate-producing members of the community. Conclusions The presented approach provides quantitative and genotypic insights into butyrate-producing communities and facilitates a more specific

  7. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes

    PubMed Central

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-01-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression. PMID:22434878

  8. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

    PubMed

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-07-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

  9. RNA-Seq for Bacterial Gene Expression.

    PubMed

    Poulsen, Line Dahl; Vinther, Jeppe

    2018-06-01

    RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.

  10. Transport of Magnesium by a Bacterial Nramp-Related Gene

    PubMed Central

    Rodionov, Dmitry A.; Freedman, Benjamin G.; Senger, Ryan S.; Winkler, Wade C.

    2014-01-01

    Magnesium is an essential divalent metal that serves many cellular functions. While most divalent cations are maintained at relatively low intracellular concentrations, magnesium is maintained at a higher level (∼0.5–2.0 mM). Three families of transport proteins were previously identified for magnesium import: CorA, MgtE, and MgtA/MgtB P-type ATPases. In the current study, we find that expression of a bacterial protein unrelated to these transporters can fully restore growth to a bacterial mutant that lacks known magnesium transporters, suggesting it is a new importer for magnesium. We demonstrate that this transport activity is likely to be specific rather than resulting from substrate promiscuity because the proteins are incapable of manganese import. This magnesium transport protein is distantly related to the Nramp family of proteins, which have been shown to transport divalent cations but have never been shown to recognize magnesium. We also find gene expression of the new magnesium transporter to be controlled by a magnesium-sensing riboswitch. Importantly, we find additional examples of riboswitch-regulated homologues, suggesting that they are a frequent occurrence in bacteria. Therefore, our aggregate data discover a new and perhaps broadly important path for magnesium import and highlight how identification of riboswitch RNAs can help shed light on new, and sometimes unexpected, functions of their downstream genes. PMID:24968120

  11. The FUN of identifying gene function in bacterial pathogens; insights from Salmonella functional genomics.

    PubMed

    Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D

    2013-10-01

    The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

    PubMed

    Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

    2007-03-01

    In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

  13. Encyclopedia of bacterial gene circuits whose presence or absence correlate with pathogenicity--a large-scale system analysis of decoded bacterial genomes.

    PubMed

    Shestov, Maksim; Ontañón, Santiago; Tozeren, Aydin

    2015-10-13

    Bacterial infections comprise a global health challenge as the incidences of antibiotic resistance increase. Pathogenic potential of bacteria has been shown to be context dependent, varying in response to environment and even within the strains of the same genus. We used the KEGG repository and extensive literature searches to identify among the 2527 bacterial genomes in the literature those implicated as pathogenic to the host, including those which show pathogenicity in a context dependent manner. Using data on the gene contents of these genomes, we identified sets of genes highly abundant in pathogenic but relatively absent in commensal strains and vice versa. In addition, we carried out genome comparison within a genus for the seventeen largest genera in our genome collection. We projected the resultant lists of ortholog genes onto KEGG bacterial pathways to identify clusters and circuits, which can be linked to either pathogenicity or synergy. Gene circuits relatively abundant in nonpathogenic bacteria often mediated biosynthesis of antibiotics. Other synergy-linked circuits reduced drug-induced toxicity. Pathogen-abundant gene circuits included modules in one-carbon folate, two-component system, type-3 secretion system, and peptidoglycan biosynthesis. Antibiotics-resistant bacterial strains possessed genes modulating phagocytosis, vesicle trafficking, cytoskeletal reorganization, and regulation of the inflammatory response. Our study also identified bacterial genera containing a circuit, elements of which were previously linked to Alzheimer's disease. Present study produces for the first time, a signature, in the form of a robust list of gene circuitry whose presence or absence could potentially define the pathogenicity of a microbiome. Extensive literature search substantiated a bulk majority of the commensal and pathogenic circuitry in our predicted list. Scanning microbiome libraries for these circuitry motifs will provide further insights into the complex

  14. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Restoration using Azolla imbricata increases nitrogen functional bacterial groups and genes in soil.

    PubMed

    Lu, Xiao-Ming; Lu, Peng-Zhen; Yang, Ke

    2017-05-01

    Microbial groups are major factors that influence soil function. Currently, there is a lack of studies on microbial functional groups. Although soil microorganisms play an important role in the nitrogen cycle, systematic studies of the effects of environmental factors on microbial populations in relation to key metabolic processes in the nitrogen cycle are seldom reported. In this study, we conducted a systematic analysis of the changes in nitrogen functional groups in mandarin orange garden soil treated with Azolla imbricata. The structures of the major functional bacterial groups and the functional gene abundances involved in key processes of the soil nitrogen cycle were analyzed using high-throughput sequencing (HTS) and quantitative real-time PCR, respectively. The results indicated that returning A. imbricata had an important influence on the composition of soil nitrogen functional bacterial communities. Treatment with A. imbricata increased the diversity of the nitrogen functional bacteria. The abundances of nitrogen functional genes were significantly higher in the treated soil compared with the control soil. Both the diversity of the major nitrogen functional bacteria (nifH bacteria, nirK bacteria, and narG bacteria) and the abundances of nitrogen functional genes in the soil showed significant positive correlations with the soil pH, the organic carbon content, available nitrogen, available phosphorus, and NH 4 + -N and NO 3 - -N contents. Treatment with 12.5 kg fresh A. imbricata per mandarin orange tree was effective to improve the quality of the mandarin orange garden soil. This study analyzed the mechanism of the changes in functional bacterial groups and genes involved in key metabolic processes of the nitrogen cycle in soil treated by A. imbricata.

  16. Dynamics of Immune System Gene Expression upon Bacterial Challenge and Wounding in a Social Insect (Bombus terrestris)

    PubMed Central

    Erler, Silvio; Popp, Mario; Lattorff, H. Michael G.

    2011-01-01

    The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge. Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment. Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the

  17. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji

    2015-01-01

    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  18. A novel ion-beam-mutation effect application in identification of gene involved in bacterial antagonism to fungal infection of ornamental crops

    NASA Astrophysics Data System (ADS)

    Mahadtanapuk, S.; Teraarusiri, W.; Nanakorn, W.; Yu, L. D.; Thongkumkoon, P.; Anuntalabhochai, S.

    2014-05-01

    This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection.

  19. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants

    PubMed Central

    Zhang, Bing; Xia, Yu; Wen, Xianghua; Wang, Xiaohui; Yang, Yunfeng; Zhou, Jizhong; Zhang, Yu

    2016-01-01

    Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs) are as an important sink and source of pathogens and antibiotic resistance genes (ARGs). Virulence genes (encoding virulence factors) are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs. PMID:27907117

  20. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease

    PubMed Central

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B.; Yang, Bing; White, Frank F.; Wang, Nian; Jones, Jeffrey B.

    2014-01-01

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccAw, induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations. PMID:24474801

  1. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease.

    PubMed

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B; Yang, Bing; White, Frank F; Wang, Nian; Jones, Jeffrey B

    2014-01-28

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccA(w), induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations.

  2. Plagiarized bacterial genes in the human book of life.

    PubMed

    Ponting, C P

    2001-05-01

    The initial analysis of the human genome draft sequence reveals that our 'book of life' is multi-authored. A small but significant proportion of our genes owes their heritage not to antecedent eukaryotes but instead to bacteria. The publicly funded Human Genome Project study indicates that about 0.5% of all human genes were copied into the genome from bacterial sources. Detailed sequence analyses point to these 'horizontal gene transfer' events having occurred relatively recently. So how did the human 'book of life' evolve to be a chimaera, part animal and part bacterium? And what was the probable evolutionary impact of such gene plagiarism?

  3. Gene silencing using the recessive rice bacterial blight resistance gene xa13 as a new paradigm in plant breeding.

    PubMed

    Li, Changyan; Wei, Jing; Lin, Yongjun; Chen, Hao

    2012-05-01

    Resistant germplasm resources are valuable for developing resistant varieties in agricultural production. However, recessive resistance genes are usually overlooked in hybrid breeding. Compared with dominant traits, however, they may confer resistance to different pathogenic races or pest biotypes with different mechanisms of action. The recessive rice bacterial blight resistance gene xa13, also involved in pollen development, has been cloned and its resistance mechanism has been recently characterized. This report describes the conversion of bacterial blight resistance mediated by the recessive xa13 gene into a dominant trait to facilitate its use in a breeding program. This was achieved by knockdown of the corresponding dominant allele Xa13 in transgenic rice using recently developed artificial microRNA technology. Tissue-specific promoters were used to exclude most of the expression of artificial microRNA in the anther to ensure that Xa13 functioned normally during pollen development. A battery of highly bacterial blight resistant transgenic plants with normal seed setting rates were acquired, indicating that highly specific gene silencing had been achieved. Our success with xa13 provides a paradigm that can be adapted to other recessive resistance genes.

  4. Systematic bacterialization of yeast genes identifies a near-universally swappable pathway

    PubMed Central

    Kachroo, Aashiq H; Laurent, Jon M; Akhmetov, Azat; Szilagyi-Jones, Madelyn; McWhite, Claire D; Zhao, Alice; Marcotte, Edward M

    2017-01-01

    Eukaryotes and prokaryotes last shared a common ancestor ~2 billion years ago, and while many present-day genes in these lineages predate this divergence, the extent to which these genes still perform their ancestral functions is largely unknown. To test principles governing retention of ancient function, we asked if prokaryotic genes could replace their essential eukaryotic orthologs. We systematically replaced essential genes in yeast by their 1:1 orthologs from Escherichia coli. After accounting for mitochondrial localization and alternative start codons, 31 out of 51 bacterial genes tested (61%) could complement a lethal growth defect and replace their yeast orthologs with minimal effects on growth rate. Replaceability was determined on a pathway-by-pathway basis; codon usage, abundance, and sequence similarity contributed predictive power. The heme biosynthesis pathway was particularly amenable to inter-kingdom exchange, with each yeast enzyme replaceable by its bacterial, human, or plant ortholog, suggesting it as a near-universally swappable pathway. DOI: http://dx.doi.org/10.7554/eLife.25093.001 PMID:28661399

  5. Impact of bacterial biocontrol agents on aflatoxin biosynthetic genes, aflD and aflR expression, and phenotypic aflatoxin B₁ production by Aspergillus flavus under different environmental and nutritional regimes.

    PubMed

    Al-Saad, Labeed A; Al-Badran, Adnan I; Al-Jumayli, Sami A; Magan, Naresh; Rodríguez, Alicia

    2016-01-18

    The objectives of this study were to examine the efficacy of four bacterial antagonists against Aspergillus flavus using 50:50 ratio of bacterial cells/conidia for the control of aflatoxin B1 (AFB1) production on two different nutritional matrices, nutrient and maize-based media at different water availabilities (0.98, 0.94 water activity (aw) on nutrient medium; 0.995, 0.98 aw on maize meal agar medium) at 35°C. The indicators of efficacy used were the relative expression of one structural and regulatory gene in the biosynthetic pathway (aflD and aflR respectively) and the production of AFB1. These studies showed that some of the bacterial species could significantly inhibit the relative expression of the aflD and aflR genes at both 0.98 and 0.94 aw on nutrient agar. On maize-based media some of the bacterial antagonists reduced the activity of both genes at 0.94 aw and some at 0.995 aw. However, the results for AFB1 production were not consistent with the effects on gene expression. Some bacterial species stimulated AFB1 production on both nutrient and maize-based media regardless of aw. However, some bacterial treatments did inhibit AFB1 production significantly when compared to the control. Overall, this study suggests that temporal studies are required on the biosynthetic genes under different environmental and nutritional conditions to evaluate the potential of antagonists to control AFB1. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    NASA Astrophysics Data System (ADS)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  7. Application of Chemical Genomics to Plant-Bacteria Communication: A High-Throughput System to Identify Novel Molecules Modulating the Induction of Bacterial Virulence Genes by Plant Signals.

    PubMed

    Vandelle, Elodie; Puttilli, Maria Rita; Chini, Andrea; Devescovi, Giulia; Venturi, Vittorio; Polverari, Annalisa

    2017-01-01

    The life cycle of bacterial phytopathogens consists of a benign epiphytic phase, during which the bacteria grow in the soil or on the plant surface, and a virulent endophytic phase involving the penetration of host defenses and the colonization of plant tissues. Innovative strategies are urgently required to integrate copper treatments that control the epiphytic phase with complementary tools that control the virulent endophytic phase, thus reducing the quantity of chemicals applied to economically and ecologically acceptable levels. Such strategies include targeted treatments that weaken bacterial pathogens, particularly those inhibiting early infection steps rather than tackling established infections. This chapter describes a reporter gene-based chemical genomic high-throughput screen for the induction of bacterial virulence by plant molecules. Specifically, we describe a chemical genomic screening method to identify agonist and antagonist molecules for the induction of targeted bacterial virulence genes by plant extracts, focusing on the experimental controls required to avoid false positives and thus ensuring the results are reliable and reproducible.

  8. Gene calling and bacterial genome annotation with BG7.

    PubMed

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  9. Genetic Variation in the β2-Adrenocepter Gene Is Associated with Susceptibility to Bacterial Meningitis in Adults

    PubMed Central

    Adriani, Kirsten S.; Brouwer, Matthijs C.; Baas, Frank; Zwinderman, Aeilko H.; van der Ende, Arie; van de Beek, Diederik

    2012-01-01

    Recently, the biased β2-adrenoceptor/β-arrestin pathway was shown to play a pivotal role in crossing of the blood brain barrier by Neisseria meningitidis. We hypothesized that genetic variation in the β2-adrenoceptor gene (ADRB2) may influence susceptibility to bacterial meningitis. In a prospective genetic association study we genotyped 542 patients with CSF culture proven community acquired bacterial meningitis and 376 matched controls for 2 functional single nucleotide polymorphisms in the β2-adrenoceptor gene (ADRB2). Furthermore, we analyzed if the use of non-selective beta-blockers, which bind to the β2-adrenoceptor, influenced the risk of bacterial meningitis. We identified a functional polymorphism in ADRB2 (rs1042714) to be associated with an increased risk for bacterial meningitis (Odds ratio [OR] 1.35, 95% confidence interval [CI] 1.04–1.76; p = 0.026). The association remained significant after correction for age and was more prominent in patients with pneumococcal meningitis (OR 1.52, 95% CI 1.12–2.07; p = 0.007). For meningococcal meningitis the difference in genotype frequencies between patients and controls was similar to that in pneumococcal meningitis, but this was not statistically significant (OR 1.43, 95% CI 0.60–3.38; p = 0.72). Patients with bacterial meningitis had a lower frequency of non-selective beta-blockers use compared to the age matched population (0.9% vs. 1.8%), although this did not reach statistical significance (OR 1.96 [95% CI 0.88–4.39]; p = 0.09). In conclusion, we identified an association between a genetic variant in the β2-adrenoceptor and increased susceptibility to bacterial meningitis. The potential benefit of pharmacological treatment targeting the β2-adrenoceptor to prevent bacterial meningitis in the general population or patients with bacteraemia should be further studied in both experimental studies and observational cohorts. PMID:22624056

  10. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    PubMed

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  11. Statistical Analysis of Hurst Exponents of Essential/Nonessential Genes in 33 Bacterial Genomes

    PubMed Central

    Liu, Xiao; Wang, Baojin; Xu, Luo

    2015-01-01

    Methods for identifying essential genes currently depend predominantly on biochemical experiments. However, there is demand for improved computational methods for determining gene essentiality. In this study, we used the Hurst exponent, a characteristic parameter to describe long-range correlation in DNA, and analyzed its distribution in 33 bacterial genomes. In most genomes (31 out of 33) the significance levels of the Hurst exponents of the essential genes were significantly higher than for the corresponding full-gene-set, whereas the significance levels of the Hurst exponents of the nonessential genes remained unchanged or increased only slightly. All of the Hurst exponents of essential genes followed a normal distribution, with one exception. We therefore propose that the distribution feature of Hurst exponents of essential genes can be used as a classification index for essential gene prediction in bacteria. For computer-aided design in the field of synthetic biology, this feature can build a restraint for pre- or post-design checking of bacterial essential genes. Moreover, considering the relationship between gene essentiality and evolution, the Hurst exponents could be used as a descriptive parameter related to evolutionary level, or be added to the annotation of each gene. PMID:26067107

  12. Prevalence of antibiotic resistance genes in bacterial communities associated with Cladophora glomerata mats along the nearshore of Lake Ontario.

    PubMed

    Ibsen, Michael; Fernando, Dinesh M; Kumar, Ayush; Kirkwood, Andrea E

    2017-05-01

    The alga Cladophora glomerata can erupt in nuisance blooms throughout the lower Great Lakes. Since bacterial abundance increases with the emergence and decay of Cladophora, we investigated the prevalence of antibiotic resistance (ABR) in Cladophora-associated bacterial communities up-gradient and down-gradient from a large sewage treatment plant (STP) on Lake Ontario. Although STPs are well-known sources of ABR, we also expected detectable ABR from up-gradient wetland communities, since they receive surface run-off from urban and agricultural sources. Statistically significant differences in aquatic bacterial abundance and ABR were found between down-gradient beach samples and up-gradient coastal wetland samples (ANOVA, Holm-Sidak test, p < 0.05). Decaying and free-floating Cladophora sampled near the STP had the highest bacterial densities overall, including on ampicillin- and vancomycin-treated plates. However, quantitative polymerase chain reaction analysis of the ABR genes ampC, tetA, tetB, and vanA from environmental communities showed a different pattern. Some of the highest ABR gene levels occurred at the 2 coastal wetland sites (vanA). Overall, bacterial ABR profiles from environmental samples were distinguishable between living and decaying Cladophora, inferring that Cladophora may control bacterial ABR depending on its life-cycle stage. Our results also show how spatially and temporally dynamic ABR is in nearshore aquatic bacteria, which warrants further research.

  13. Alignment-free detection of horizontal gene transfer between closely related bacterial genomes.

    PubMed

    Domazet-Lošo, Mirjana; Haubold, Bernhard

    2011-09-01

    Bacterial epidemics are often caused by strains that have acquired their increased virulence through horizontal gene transfer. Due to this association with disease, the detection of horizontal gene transfer continues to receive attention from microbiologists and bioinformaticians alike. Most software for detecting transfer events is based on alignments of sets of genes or of entire genomes. But despite great advances in the design of algorithms and computer programs, genome alignment remains computationally challenging. We have therefore developed an alignment-free algorithm for rapidly detecting horizontal gene transfer between closely related bacterial genomes. Our implementation of this algorithm is called alfy for "ALignment Free local homologY" and is freely available from http://guanine.evolbio.mpg.de/alfy/. In this comment we demonstrate the application of alfy to the genomes of Staphylococcus aureus. We also argue that-contrary to popular belief and in spite of increasing computer speed-algorithmic optimization is becoming more, not less, important if genome data continues to accumulate at the present rate.

  14. Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution.

    PubMed

    Erickson, Keesha E; Otoupal, Peter B; Chatterjee, Anushree

    2017-01-01

    Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment through stress

  15. Genetic Diversity of Bacterial Communities and Gene Transfer Agents in Northern South China Sea

    PubMed Central

    Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Jiang, Zhao-Yu; Sun, Cui-Ci; Cheng, Hao

    2014-01-01

    Pyrosequencing of the 16S ribosomal RNA gene (rDNA) amplicons was performed to investigate the unique distribution of bacterial communities in northern South China Sea (nSCS) and evaluate community structure and spatial differences of bacterial diversity. Cyanobacteria, Proteobacteria, Actinobacteria, and Bacteroidetes constitute the majority of bacteria. The taxonomic description of bacterial communities revealed that more Chroococcales, SAR11 clade, Acidimicrobiales, Rhodobacterales, and Flavobacteriales are present in the nSCS waters than other bacterial groups. Rhodobacterales were less abundant in tropical water (nSCS) than in temperate and cold waters. Furthermore, the diversity of Rhodobacterales based on the gene transfer agent (GTA) major capsid gene (g5) was investigated. Four g5 gene clone libraries were constructed from samples representing different regions and yielded diverse sequences. Fourteen g5 clusters could be identified among 197 nSCS clones. These clusters were also related to known g5 sequences derived from genome-sequenced Rhodobacterales. The composition of g5 sequences in surface water varied with the g5 sequences in the sampling sites; this result indicated that the Rhodobacterales population could be highly diverse in nSCS. Phylogenetic tree analysis result indicated distinguishable diversity patterns among tropical (nSCS), temperate, and cold waters, thereby supporting the niche adaptation of specific Rhodobacterales members in unique environments. PMID:25364820

  16. Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans

    PubMed Central

    Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo

    2012-01-01

    Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122

  17. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    PubMed

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-03-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  18. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato

    PubMed Central

    Tai, Thomas H.; Dahlbeck, Douglas; Clark, Eszter T.; Gajiwala, Paresh; Pasion, Romela; Whalen, Maureen C.; Stall, Robert E.; Staskawicz, Brian J.

    1999-01-01

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site–leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species. PMID:10570214

  19. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

    PubMed

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

    1999-11-23

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  20. Emerging contaminants and nutrients synergistically affect the spread of class 1 integron-integrase (intI1) and sul1 genes within stable streambed bacterial communities.

    PubMed

    Subirats, Jèssica; Timoner, Xisca; Sànchez-Melsió, Alexandre; Balcázar, José Luis; Acuña, Vicenç; Sabater, Sergi; Borrego, Carles M

    2018-07-01

    Wastewater effluents increase the nutrient load of receiving streams while introducing a myriad of anthropogenic chemical pollutants that challenge the resident aquatic (micro)biota. Disentangling the effects of both kind of stressors and their potential interaction on the dissemination of antibiotic resistance genes in bacterial communities requires highly controlled manipulative experiments. In this work, we investigated the effects of a combined regime of nutrients (at low, medium and high concentrations) and a mixture of emerging contaminants (ciprofloxacin, erythromycin, sulfamethoxazole, diclofenac, and methylparaben) on the bacterial composition, abundance and antibiotic resistance profile of biofilms grown in artificial streams. In particular, we investigated the effect of this combined stress on genes encoding resistance to ciprofloxacin (qnrS), erythromycin (ermB), sulfamethoxazole (sul1 and sul2) as well as the class 1 integron-integrase gene (intI1). Only genes conferring resistance to sulfonamides (sul1 and sul2) and intI1 gene were detected in all treatments during the study period. Besides, bacterial communities exposed to emerging contaminants showed higher copy numbers of sul1 and intI1 genes than those not exposed, whereas nutrient amendments did not affect their abundance. However, bacterial communities exposed to both emerging contaminants and a high nutrient concentration (1, 25 and 1 mg L -1 of phosphate, nitrate and ammonium, respectively) showed the highest increase on the abundance of sul1 and intI1 genes thus suggesting a factors synergistic effect of both stressors. Since none of the treatments caused a significant change on the composition of bacterial communities, the enrichment of sul1 and intI1 genes within the community was caused by their dissemination under the combined pressure exerted by nutrients and emerging contaminants. To the best of our knowledge, this is the first study demonstrating the contribution of nutrients on

  1. Mutant phenotypes for thousands of bacterial genes of unknown function

    DOE PAGES

    Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan; ...

    2018-05-16

    One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less

  2. Mutant phenotypes for thousands of bacterial genes of unknown function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Price, Morgan N.; Wetmore, Kelly M.; Waters, R. Jordan

    One-third of all protein-coding genes from bacterial genomes cannot be annotated with a function. Here, to investigate the functions of these genes, we present genome-wide mutant fitness data from 32 diverse bacteria across dozens of growth conditions. We identified mutant phenotypes for 11,779 protein-coding genes that had not been annotated with a specific function. Many genes could be associated with a specific condition because the gene affected fitness only in that condition, or with another gene in the same bacterium because they had similar mutant phenotypes. Of the poorly annotated genes, 2,316 had associations that have high confidence because theymore » are conserved in other bacteria. By combining these conserved associations with comparative genomics, we identified putative DNA repair proteins; in addition, we propose specific functions for poorly annotated enzymes and transporters and for uncharacterized protein families. Lastly, our study demonstrates the scalability of microbial genetics and its utility for improving gene annotations.« less

  3. Messing with Bacterial Quorum Sensing

    PubMed Central

    González, Juan E.; Keshavan, Neela D.

    2006-01-01

    Quorum sensing is widely recognized as an efficient mechanism to regulate expression of specific genes responsible for communal behavior in bacteria. Several bacterial phenotypes essential for the successful establishment of symbiotic, pathogenic, or commensal relationships with eukaryotic hosts, including motility, exopolysaccharide production, biofilm formation, and toxin production, are often regulated by quorum sensing. Interestingly, eukaryotes produce quorum-sensing-interfering (QSI) compounds that have a positive or negative influence on the bacterial signaling network. This eukaryotic interference could result in further fine-tuning of bacterial quorum sensing. Furthermore, recent work involving the synthesis of structural homologs to the various quorum-sensing signal molecules has resulted in the development of additional QSI compounds that could be used to control pathogenic bacteria. The creation of transgenic plants that express bacterial quorum-sensing genes is yet another strategy to interfere with bacterial behavior. Further investigation on the manipulation of quorum-sensing systems could provide us with powerful tools against harmful bacteria. PMID:17158701

  4. Involvement of β-carbonic anhydrase (β-CA) genes in bacterial genomic islands and horizontal transfer to protists.

    PubMed

    Zolfaghari Emameh, Reza; Barker, Harlan R; Hytönen, Vesa P; Parkkila, Seppo

    2018-05-25

    Genomic islands (GIs) are a type of mobile genetic element (MGE) that are present in bacterial chromosomes. They consist of a cluster of genes which produce proteins that contribute to a variety of functions, including, but not limited to, regulation of cell metabolism, anti-microbial resistance, pathogenicity, virulence, and resistance to heavy metals. The genes carried in MGEs can be used as a trait reservoir in times of adversity. Transfer of genes using MGEs, occurring outside of reproduction, is called horizontal gene transfer (HGT). Previous literature has shown that numerous HGT events have occurred through endosymbiosis between prokaryotes and eukaryotes.Beta carbonic anhydrase (β-CA) enzymes play a critical role in the biochemical pathways of many prokaryotes and eukaryotes. We have previously suggested horizontal transfer of β-CA genes from plasmids of some prokaryotic endosymbionts to their protozoan hosts. In this study, we set out to identify β-CA genes that might have transferred between prokaryotic and protist species through HGT in GIs. Therefore, we investigated prokaryotic chromosomes containing β-CA-encoding GIs and utilized multiple bioinformatics tools to reveal the distinct movements of β-CA genes among a wide variety of organisms. Our results identify the presence of β-CA genes in GIs of several medically and industrially relevant bacterial species, and phylogenetic analyses reveal multiple cases of likely horizontal transfer of β-CA genes from GIs of ancestral prokaryotes to protists. IMPORTANCE The evolutionary process is mediated by mobile genetic elements (MGEs), such as genomic islands (GIs). A gene or set of genes in the GIs are exchanged between and within various species through horizontal gene transfer (HGT). Based on the crucial role that GIs can play in bacterial survival and proliferation, they were introduced as the environmental- and pathogen-associated factors. Carbonic anhydrases (CAs) are involved in many critical

  5. A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

    PubMed

    Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

    2010-03-01

    Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers.

  6. Bacterial lineages putatively associated with the dissemination of antibiotic resistance genes in a full-scale urban wastewater treatment plant.

    PubMed

    Narciso-da-Rocha, Carlos; Rocha, Jaqueline; Vaz-Moreira, Ivone; Lira, Felipe; Tamames, Javier; Henriques, Isabel; Martinez, José Luis; Manaia, Célia M

    2018-06-05

    Urban wastewater treatment plants (UWTPs) are reservoirs of antibiotic resistance. Wastewater treatment changes the bacterial community and inevitably impacts the fate of antibiotic resistant bacteria and antibiotic resistance genes (ARGs). Some bacterial groups are major carriers of ARGs and hence, their elimination during wastewater treatment may contribute to increasing resistance removal efficiency. This study, conducted at a full-scale UWTP, evaluated variations in the bacterial community and ARGs loads and explored possible associations among them. With that aim, the bacterial community composition (16S rRNA gene Illumina sequencing) and ARGs abundance (real-time PCR) were characterized in samples of raw wastewater (RWW), secondary effluent (sTWW), after UV disinfection (tTWW), and after a period of 3 days storage to monitoring possible bacterial regrowth (tTWW-RE). Culturable enterobacteria were also enumerated. Secondary treatment was associated with the most dramatic bacterial community variations and coincided with reductions of ~2 log-units in the ARGs abundance. In contrast, no significant changes in the bacterial community composition and ARGs abundance were observed after UV disinfection of sTWW. Nevertheless, after UV treatment, viability losses were indicated ~2 log-units reductions of culturable enterobacteria. The analysed ARGs (qnrS, bla CTX-M , bla OXA-A , bla TEM , bla SHV , sul1, sul2, and intI1) were strongly correlated with taxa more abundant in RWW than in the other types of water, and which associated with humans and animals, such as members of the families Campylobacteraceae, Comamonadaceae, Aeromonadaceae, Moraxellaceae, and Bacteroidaceae. Further knowledge of the dynamics of the bacterial community during wastewater treatment and its relationship with ARGs variations may contribute with information useful for wastewater treatment optimization, aiming at a more effective resistance control. Copyright © 2018 Elsevier Ltd. All rights

  7. Towards an informative mutant phenotype for every bacterial gene

    DOE PAGES

    Deutschbauer, Adam; Price, Morgan N.; Wetmore, Kelly M.; ...

    2014-08-11

    Mutant phenotypes provide strong clues to the functions of the underlying genes and could allow annotation of the millions of sequenced yet uncharacterized bacterial genes. However, it is not known how many genes have a phenotype under laboratory conditions, how many phenotypes are biologically interpretable for predicting gene function, and what experimental conditions are optimal to maximize the number of genes with a phenotype. To address these issues, we measured the mutant fitness of 1,586 genes of the ethanol-producing bacterium Zymomonas mobilis ZM4 across 492 diverse experiments and found statistically significant phenotypes for 89% of all assayed genes. Thus, inmore » Z. mobilis, most genes have a functional consequence under laboratory conditions. We demonstrate that 41% of Z. mobilis genes have both a strong phenotype and a similar fitness pattern (cofitness) to another gene, and are therefore good candidates for functional annotation using mutant fitness. Among 502 poorly characterized Z. mobilis genes, we identified a significant cofitness relationship for 174. For 57 of these genes without a specific functional annotation, we found additional evidence to support the biological significance of these gene-gene associations, and in 33 instances, we were able to predict specific physiological or biochemical roles for the poorly characterized genes. Last, we identified a set of 79 diverse mutant fitness experiments in Z. mobilis that are nearly as biologically informative as the entire set of 492 experiments. Therefore, our work provides a blueprint for the functional annotation of diverse bacteria using mutant fitness.« less

  8. Fate of tetracycline, sulfonamide and fluoroquinolone resistance genes and the changes in bacterial diversity during composting of swine manure.

    PubMed

    Selvam, Ammaiyappan; Xu, Delin; Zhao, Zhenyong; Wong, Jonathan W C

    2012-12-01

    This study monitored the abundance of antibiotic resistant genes (ARGs) and the bacterial diversity during composting of swine manure spiked with chlortetracycline, sulfadiazine and ciprofloxacin at two different levels and a control without antibiotics. Resistance genes of tetracycline (tetQ, tetW, tetC, tetG, tetZ and tetY), sulfonamide (sul1, sul2, dfrA1 and dfrA7) and fluoroquinolone (gyrA and parC) represented 0.02-1.91%, 0.67-10.28% and 0.00005-0.0002%, respectively, of the total 16S rDNA copies in the initial composting mass. After 28-42 days of composting, these ARGs, except parC, were undetectable in the composting mass indicating that composting is a potential method of manure management. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis of bacterial 16S rDNA of the composting mass indicated that the addition of antibiotics up to 100, 20 and 20mg/kg of chlortetracycline, sulfadiazine and ciprofloxacin, respectively, elicited only a transient perturbation and the bacterial diversity was restored in due course of composting. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Insight into the effects of different cropping systems on soil bacterial community and tobacco bacterial wilt rate.

    PubMed

    Niu, Jiaojiao; Chao, Jin; Xiao, Yunhua; Chen, Wu; Zhang, Chao; Liu, Xueduan; Rang, Zhongwen; Yin, Huaqun; Dai, Linjian

    2017-01-01

    Rotation is an effective strategy to control crop disease and improve plant health. However, the effects of crop rotation on soil bacterial community composition and structure, and crop health remain unclear. In this study, using 16S rRNA gene sequencing, we explored the soil bacterial communities under four different cropping systems, continuous tobacco cropping (control group), tobacco-maize rotation, tobacco-lily rotation, and tobacco-turnip rotation. Results of detrended correspondence analysis and dissimilarity tests showed that soil bacterial community composition and structure changed significantly among the four groups, such that Acidobacteria and Actinobacteria were more abundant in the maize rotation group (16.6 and 11.5%, respectively) than in the control (8.5 and 7.1%, respectively). Compared with the control group (57.78%), maize and lily were effective rotation crops in controlling tobacco bacterial wilt (about 23.54 and 48.67%). On the other hand, tobacco bacterial wilt rate was increased in the turnip rotation (59.62%) relative to the control. Further study revealed that the abundances of several bacterial populations were directly correlated with tobacco bacterial wilt. For example, Acidobacteria and Actinobacteria were significantly negatively correlated to the tobacco bacterial wilt rate, so they may be probiotic bacteria. Canonical correspondence analysis showed that soil pH and calcium content were key factors in determining soil bacterial communities. In conclusion, our study revealed the composition and structure of bacterial communities under four different cropping systems and may unveil molecular mechanisms for the interactions between soil microorganisms and crop health. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Simultaneous amplification of two bacterial genes: more reliable method of Helicobacter pylori detection in microbial rich dental plaque samples.

    PubMed

    Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali

    2011-01-01

    Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.

  11. Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population.

    PubMed

    Wang, X H; Shi, H P; Li, F J

    2016-07-25

    We determined whether two common single nucleotide polymorphisms (SNPs) in the Toll-like receptor 9 gene (TLR9) (TLR9+2848 rs352140 and TLR9-1237 rs5743836) influenced susceptibility to bacterial meningitis in a Chinese population. The study comprised 126 patients with bacterial meningitis and 252 control subjects, all of whom were recruited from the Tuberculosis Hospital of Shanxi Province. Genotyping of TLR9+2848 rs352140 and TLR9-1237 rs5743836 was performed by polymerase chain reaction coupled with restriction fragment length polymorphism. Using logistic regression analysis, we found that individuals with the AA genotype were associated with an increased risk of bacterial meningitis compared with those with the GG genotype (OR = 0.43, 95%CI = 0.19-0.95; P = 0.03). In a recessive model, the AA genotype was correlated with an elevated risk of bacterial meningitis compared with the GG+GA genotype (OR = 0.49, 95%CI = 0.22-0.99; P = 0.04). However, no significant differences were observed in the association between the TLR9-1237 rs5743836 polymorphism and the risk of bacterial meningitis in the codominant, dominant, or recessive models. In conclusion, the results of our study suggest an association between the TLR9+2848 polymorphism and a reduced risk of bacterial meningitis in the codominant and recessive models.

  12. Gene regulation mediates host specificity of a bacterial pathogen.

    PubMed

    Killiny, Nabil; Almeida, Rodrigo P P

    2011-12-01

    Many bacterial plant pathogens have a gene-for-gene relationship that determines host specificity. However, there are pathogens such as the xylem-limited bacterium Xylella fastidiosa that do not carry genes considered essential for the gene-for-gene model, such as those coding for a type III secretion system and effector molecules. Nevertheless, X. fastidiosa subspecies are host specific. A comparison of symptom development and host colonization after infection of plants with several mutant strains in two hosts, grapevines and almonds, indicated that X. fastidiosa virulence mechanisms are similar in those plants. Thus, we tested if modification of gene regulation patterns, by affecting the production of a cell-cell signalling molecule (DSF), impacted host specificity in X. fastidiosa. Results show that disruption of the rpfF locus, required for DSF synthesis, in a strain incapable of causing disease in grapevines, leads to symptom development in that host. These data are indicative that the core machinery required for the colonization of grapevines is present in that strain, and that changes in gene regulation alone can lead X. fastidiosa to exploit a novel host. The study of the evolution and mechanisms of host specificity mediated by gene regulation at the genome level could lead to important insights on the emergence of new diseases. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  13. Bacterial community structure and abundances of antibiotic resistance genes in heavy metals contaminated agricultural soil.

    PubMed

    Zhang, Fengli; Zhao, Xiaoxue; Li, Qingbo; Liu, Jia; Ding, Jizhe; Wu, Huiying; Zhao, Zongsheng; Ba, Yue; Cheng, Xuemin; Cui, Liuxin; Li, Hongping; Zhu, Jingyuan

    2018-04-01

    Soil contamination with heavy metals is a worldwide problem especially in China. The interrelation of soil bacterial community structure, antibiotic resistance genes, and heavy metal contamination in soil is still unclear. Here, seven agricultural areas (G1-G7) with heavy metal contamination were sampled with different distances (741 to 2556 m) to the factory. Denaturing gradient gel electrophoresis (DGGE) and Shannon index were used to analyze bacterial community diversity. Real-time fluorescence quantitative PCR was used to detect the relative abundance of ARGs sul1, sul2, tetA, tetM, tetW, one mobile genetic elements (MGE) inti1. Results showed that all samples were polluted by Cadmium (Cd), and some of them were polluted by lead (Pb), mercury (Hg), arsenic (As), copper (Cu), and zinc (Zn). DGGE showed that the most abundant bacterial species were found in G7 with the lightest heavy metal contamination. The results of the principal component analysis and clustering analysis both showed that G7 could not be classified with other samples. The relative abundance of sul1 was correlated with Cu, Zn concentration. Gene sul2 are positively related with total phosphorus, and tetM was associated with organic matter. Total gene abundances and relative abundance of inti1 both correlated with organic matter. Redundancy analysis showed that Zn and sul2 were significantly related with bacterial community structure. Together, our results indicate a complex linkage between soil heavy metal concentration, bacterial community composition, and some global disseminated ARG abundance.

  14. Production of Phloroglucinol, a Platform Chemical, in Arabidopsis using a Bacterial Gene.

    PubMed

    Abdel-Ghany, Salah E; Day, Irene; Heuberger, Adam L; Broeckling, Corey D; Reddy, Anireddy S N

    2016-12-07

    Phloroglucinol (1,3,5-trihydroxybenzene; PG) and its derivatives are phenolic compounds that are used for various industrial applications. Current methods to synthesize PG are not sustainable due to the requirement for carbon-based precursors and co-production of toxic byproducts. Here, we describe a more sustainable production of PG using plants expressing a native bacterial or a codon-optimized synthetic PhlD targeted to either the cytosol or chloroplasts. Transgenic lines were analyzed for the production of PG using gas and liquid chromatography coupled to mass spectroscopy. Phloroglucinol was produced in all transgenic lines and the line with the highest PhlD transcript level showed the most accumulation of PG. Over 80% of the produced PG was glycosylated to phlorin. Arabidopsis leaves have the machinery to glycosylate PG to form phlorin, which can be hydrolyzed enzymatically to produce PG. Furthermore, the metabolic profile of plants with PhlD in either the cytosol or chloroplasts was altered. Our results provide evidence that plants can be engineered to produce PG using a bacterial gene. Phytoproduction of PG using a bacterial gene paves the way for further genetic manipulations to enhance the level of PG with implications for the commercial production of this important platform chemical in plants.

  15. Strategies used for genetically modifying bacterial genome: ite-directed mutagenesis, gene inactivation, and gene over-expression*

    PubMed Central

    Xu, Jian-zhong; Zhang, Wei-guo

    2016-01-01

    With the availability of the whole genome sequence of Escherichia coli or Corynebacterium glutamicum, strategies for directed DNA manipulation have developed rapidly. DNA manipulation plays an important role in understanding the function of genes and in constructing novel engineering bacteria according to requirement. DNA manipulation involves modifying the autologous genes and expressing the heterogenous genes. Two alternative approaches, using electroporation linear DNA or recombinant suicide plasmid, allow a wide variety of DNA manipulation. However, the over-expression of the desired gene is generally executed via plasmid-mediation. The current review summarizes the common strategies used for genetically modifying E. coli and C. glutamicum genomes, and discusses the technical problem of multi-layered DNA manipulation. Strategies for gene over-expression via integrating into genome are proposed. This review is intended to be an accessible introduction to DNA manipulation within the bacterial genome for novices and a source of the latest experimental information for experienced investigators. PMID:26834010

  16. Disruption of the M949_RS01915 gene changed the bacterial lipopolysaccharide pattern, pathogenicity and gene expression of Riemerella anatipestifer.

    PubMed

    Dou, Yafeng; Wang, Xiaolan; Yu, Guijing; Wang, Shaohui; Tian, Mingxing; Qi, Jingjing; Li, Tao; Ding, Chan; Yu, Shengqing

    2017-02-06

    Riemerella anatipestifer is an important pathogen that causes septicemia anserum exsudativa in ducks. Lipopolysaccharide (LPS) is considered to be a major virulence factor of R. anatipestifer. To identify genes involved in LPS biosynthesis, we screened a library of random Tn4351 transposon mutants using a monoclonal antibody against R. anatipestifer serotype 1 LPS (anti-LPS MAb). A mutant strain RA1067 which lost the reactivity in an indirect ELISA was obtained. Southern blot and sequencing analyses indicated a single Tn4351 was inserted at 116 bp in the M949_RS01915 gene in the RA1067 chromosomal DNA. Silver staining and Western blot analyses indicated that the RA1067 LPS was defected compared to the wild-type strain CH3 LPS. The RA1067 displayed a significant decreased growth rate at the late stage of growth in TSB in comparison with CH3. In addition, RA1067 showed higher susceptibility to complement-dependent killing, more than 360-fold attenuated virulence based on the median lethal dose determination, increased bacterial adhesion and invasion capacities to Vero cells and significantly decreased blood bacterial loads in RA1067 infected ducks, when compared to the CH3. An animal experiment indicated that inactivated RA1067 cells was effective in cross-protecting of the ducks from challenging with R. anatipestifer strains WJ4 (serotype 1), Yb2 (serotype 2) and HXb2 (serotype 10), further confirming the alteration of the RA1067 antigenicity. Moreover, RNA-Seq analysis and real-time PCR verified two up-regulated and three down-regulated genes in RA1067. Our findings demonstrate that the M949_RS01915 gene is associated to bacterial antigenicity, pathogenicity and gene regulation of R. anatipestifer.

  17. Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

    USGS Publications Warehouse

    Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

    2009-01-01

    Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an

  18. Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

    PubMed

    Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

    2017-01-01

    Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

  19. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep.

    PubMed

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T

    2017-08-08

    Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high

  20. Near-infrared light-controlled systems for gene transcription regulation, protein targeting and spectral multiplexing.

    PubMed

    Redchuk, Taras A; Kaberniuk, Andrii A; Verkhusha, Vladislav V

    2018-05-01

    Near-infrared (NIR, 740-780 nm) optogenetic systems are well-suited to spectral multiplexing with blue-light-controlled tools. Here, we present two protocols, one for regulation of gene transcription and another for control of protein localization, that use a NIR-responsive bacterial phytochrome BphP1-QPAS1 optogenetic pair. In the first protocol, cells are transfected with the optogenetic constructs for independently controlling gene transcription by NIR (BphP1-QPAS1) and blue (LightOn) light. The NIR and blue-light-controlled gene transcription systems show minimal spectral crosstalk and induce a 35- to 40-fold increase in reporter gene expression. In the second protocol, the BphP1-QPAS1 pair is combined with a light-oxygen-voltage-sensing (LOV) domain-based construct into a single optogenetic tool, termed iRIS. This dual-light-controllable protein localization tool allows tridirectional protein translocation among the cytoplasm, nucleus and plasma membrane. Both procedures can be performed within 3-5 d. Use of NIR light-controlled optogenetic systems should advance basic and biomedical research.

  1. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    PubMed Central

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  2. Trimeric autotransporter adhesins contribute to Actinobacillus pleuropneumoniae pathogenicity in mice and regulate bacterial gene expression during interactions between bacteria and porcine primary alveolar macrophages.

    PubMed

    Qin, Wanhai; Wang, Lei; Zhai, Ruidong; Ma, Qiuyue; Liu, Jianfang; Bao, Chuntong; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P R; Lei, Liancheng

    2016-01-01

    Actinobacillus pleuropneumoniae is an important pathogen that causes respiratory disease in pigs. Trimeric autotransporter adhesin (TAA) is a recently discovered bacterial virulence factor that mediates bacterial adhesion and colonization. Two TAA coding genes have been found in the genome of A. pleuropneumoniae strain 5b L20, but whether they contribute to bacterial pathogenicity is unclear. In this study, we used homologous recombination to construct a double-gene deletion mutant, ΔTAA, in which both TAA coding genes were deleted and used it in in vivo and in vitro studies to confirm that TAAs participate in bacterial auto-aggregation, biofilm formation, cell adhesion and virulence in mice. A microarray analysis was used to determine whether TAAs can regulate other A. pleuropneumoniae genes during interactions with porcine primary alveolar macrophages. The results showed that deletion of both TAA coding genes up-regulated 36 genes, including ene1514, hofB and tbpB2, and simultaneously down-regulated 36 genes, including lgt, murF and ftsY. These data illustrate that TAAs help to maintain full bacterial virulence both directly, through their bioactivity, and indirectly by regulating the bacterial type II and IV secretion systems and regulating the synthesis or secretion of virulence factors. This study not only enhances our understanding of the role of TAAs but also has significance for those studying A. pleuropneumoniae pathogenesis.

  3. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest

    PubMed Central

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2011-01-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees were monitored at bimonthly intervals through 16S rRNA gene-based terminal restriction fragment length polymorphism profiling and quantitative PCR analysis. Effects on nitrifying and denitrifying groups were assessed by measuring the abundances of nirS and nosZ genes as well as bacterial and archaeal amoA genes. Seasonal dynamics displayed by key phylogenetic and nitrogen (N) cycling functional groups were found to be tightly coupled with seasonal alterations in labile C and N pools as well as with variation in soil temperature and soil moisture. In particular, archaea and acidobacteria were highly responsive to soil nutritional and soil climatic changes associated with seasonality, indicating their high metabolic versatility and capability to adapt to environmental changes. For these phyla, significant interrelations with soil chemical and microbial process data were found suggesting their potential, but poorly described contribution to nitrification or denitrification in temperate forest soils. In conclusion, our extensive approach allowed us to get novel insights into effects of seasonality and resource availability on the microbial community, in particular on hitherto poorly studied bacterial phyla and functional groups. PMID:20882059

  4. RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

    PubMed

    Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

    2018-01-01

    With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

    PubMed Central

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-01-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  6. Bacterial responses to antibiotics and their combinations.

    PubMed

    Mitosch, Karin; Bollenbach, Tobias

    2014-12-01

    Antibiotics affect bacterial cell physiology at many levels. Rather than just compensating for the direct cellular defects caused by the drug, bacteria respond to antibiotics by changing their morphology, macromolecular composition, metabolism, gene expression and possibly even their mutation rate. Inevitably, these processes affect each other, resulting in a complex response with changes in the expression of numerous genes. Genome-wide approaches can thus help in gaining a comprehensive understanding of bacterial responses to antibiotics. In addition, a combination of experimental and theoretical approaches is needed for identifying general principles that underlie these responses. Here, we review recent progress in our understanding of bacterial responses to antibiotics and their combinations, focusing on effects at the levels of growth rate and gene expression. We concentrate on studies performed in controlled laboratory conditions, which combine promising experimental techniques with quantitative data analysis and mathematical modeling. While these basic research approaches are not immediately applicable in the clinic, uncovering the principles and mechanisms underlying bacterial responses to antibiotics may, in the long term, contribute to the development of new treatment strategies to cope with and prevent the rise of resistant pathogenic bacteria.

  7. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    PubMed Central

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human’s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistance to quinolones and possibly also to the co-emergence of resistance to β-lactams. Novel findings were made that qepA and aac-(6′)-Ib genes that were previously regarded as similarly abundant with qnr genes are now dominant among PMQR genes in aquatic environments. Further statistical analysis suggested that the correlation between PMQR and β-lactam resistance genes in the environment is still weak, that the correlations between antimicrobial resistance genes could be weakened by sufficient wastewater treatment, and that the prevalence of PMQR has been implicated in environmental, pathogenic, predatory, anaerobic, and more importantly, human symbiotic bacteria. This work provides a comprehensive analysis of PMQR genes in aquatic environments in Jinan, China, and provides information with which combat with the antimicrobial resistance problem may be fought. PMID:28094345

  8. Human gut bacterial communities are altered by addition of cruciferous vegetables to a controlled fruit- and vegetable-free diet.

    PubMed

    Li, Fei; Hullar, Meredith A J; Schwarz, Yvonne; Lampe, Johanna W

    2009-09-01

    In the human gut, commensal bacteria metabolize food components that typically serve as energy sources. These components have the potential to influence gut bacterial community composition. Cruciferous vegetables, such as broccoli and cabbage, contain distinctive compounds that can be utilized by gut bacteria. For example, glucosinolates can be hydrolyzed by certain bacteria, and dietary fibers can be fermented by a range of species. We hypothesized that cruciferous vegetable consumption would alter growth of certain bacteria, thereby altering bacterial community composition. We tested this hypothesis in a randomized, crossover, controlled feeding study. Fecal samples were collected from 17 participants at the end of 2 14-d intake periods: a low-phytochemical, low-fiber basal diet (i.e. refined grains without fruits or vegetables) and a high ("double") cruciferous vegetable diet [basal diet + 14 g cruciferous vegetables/(kg body weightd)]. Fecal bacterial composition was analyzed by the terminal restriction fragment length polymorphism (tRFLP) method using the bacterial 16S ribosomal RNA gene and nucleotide sequencing. Using blocked multi-response permutation procedures analysis, we found that overall bacterial community composition differed between the 2 consumption periods (delta = 0.603; P = 0.011). The bacterial community response to cruciferous vegetables was individual-specific, as revealed by nonmetric multidimensional scaling ordination analysis. Specific tRFLP fragments that characterized each of the diets were identified using indicator species analysis. Putative species corresponding to these fragments were identified through gene sequencing as Eubacterium hallii, Phascolarctobacterium faecium, Burkholderiales spp., Alistipes putredinis, and Eggerthella spp. In conclusion, human gut bacterial community composition was altered by cruciferous vegetable consumption, which could ultimately influence gut metabolism of bioactive food components and host

  9. Phylogeny Inference of Closely Related Bacterial Genomes: Combining the Features of Both Overlapping Genes and Collinear Genomic Regions

    PubMed Central

    Zhang, Yan-Cong; Lin, Kui

    2015-01-01

    Overlapping genes (OGs) represent one type of widespread genomic feature in bacterial genomes and have been used as rare genomic markers in phylogeny inference of closely related bacterial species. However, the inference may experience a decrease in performance for phylogenomic analysis of too closely or too distantly related genomes. Another drawback of OGs as phylogenetic markers is that they usually take little account of the effects of genomic rearrangement on the similarity estimation, such as intra-chromosome/genome translocations, horizontal gene transfer, and gene losses. To explore such effects on the accuracy of phylogeny reconstruction, we combine phylogenetic signals of OGs with collinear genomic regions, here called locally collinear blocks (LCBs). By putting these together, we refine our previous metric of pairwise similarity between two closely related bacterial genomes. As a case study, we used this new method to reconstruct the phylogenies of 88 Enterobacteriale genomes of the class Gammaproteobacteria. Our results demonstrated that the topological accuracy of the inferred phylogeny was improved when both OGs and LCBs were simultaneously considered, suggesting that combining these two phylogenetic markers may reduce, to some extent, the influence of gene loss on phylogeny inference. Such phylogenomic studies, we believe, will help us to explore a more effective approach to increasing the robustness of phylogeny reconstruction of closely related bacterial organisms. PMID:26715828

  10. Reduced toll-like receptor 4 and substance P gene expression is associated with airway bacterial colonization in children.

    PubMed

    Grissell, Terry V; Chang, Anne B; Gibson, Peter G

    2007-04-01

    Neuro-immune interactions are increasingly relevant to human health and disease. The neuropeptide Substance P also has antibacterial activity and bears similarities to the innate immune antibacterial defensins. This suggests possible co-regulation of neuropeptide and innate immune mediators. In this study, non-bronchoscopic bronchoalveolar lavage (BAL) was performed on 69 children. BAL was examined for cellular profile, microbiology (bacteria, virus) and gene expression for TLRs 2, 3, 4; chemokine receptors (CCR3, CCR5, CXCR1); neurotrophins and neurokinin genes (TAC1, TAC3, CGRP, NGF). In children with bacterial colonization (n=10) there was an airway inflammatory response with increased BAL neutrophils, IL-8 protein, and CXCR1 expression. Substance P (TAC1) and TLR4 RNA expression were reduced in children with bacterial colonization. TLR3 mRNA was increased in 7.2% (n=5) children with rhinovirus, and there was a non-significant trend to increased TLR2. There is evidence for co-regulation of neurokinin (TAC1) and TLR4 gene expression in airway cells from children with airway bacterial colonization and their reduced expression may be associated with an impaired bacterial clearance. (c) 2007 Wiley-Liss, Inc.

  11. Relationship of the luminous bacterial symbiont of the Caribbean flashlight fish, Kryptophanaron alfredi (family Anomalopidae) to other luminous bacteria based on bacterial luciferase (luxA) genes.

    PubMed

    Haygood, M G

    1990-01-01

    Flashlight fishes (family Anomalopidae) have light organs that contain luminous bacterial symbionts. Although the symbionts have not yet been successfully cultured, the luciferase genes have been cloned directly from the light organ of the Caribbean species, Kryptophanaron alfredi. The goal of this project was to evaluate the relationship of the symbiont to free-living luminous bacteria by comparison of genes coding for bacterial luciferase (lux genes). Hybridization of a lux AB probe from the Kryptophanaron alfredi symbiont to DNAs from 9 strains (8 species) of luminous bacteria showed that none of the strains tested had lux genes highly similar to the symbiont. The most similar were a group consisting of Vibrio harveyi, Vibrio splendidus and Vibrio orientalis. The nucleotide sequence of the luciferase alpha subunit gene luxA) of the Kryptophanaron alfredi symbiont was determined in order to do a more detailed comparison with published luxA sequences from Vibrio harveyi, Vibrio fischeri and Photobacterium leiognathi. The hybridization results, sequence comparisons and the mol% G + C of the Kryptophanaron alfredi symbiont luxA gene suggest that the symbiont may be considered as a new species of luminous Vibrio related to Vibrio harveyi.

  12. CONJUGAL GENE TRANSFER IN THE RHIZOSPHERE OF WATER GRASS (ECHINOCHLORA CRUSGALLI): INFLUENCE OF ROOT EXUDATE AND BACTERIAL ACTIVITY

    EPA Science Inventory

    The premise that genetic exchange is primarily localized in niches characterized by dense bacterial populations and high availability of growth substrates was tested by relating conjugal gene transfer of an RP4 derivative to availability of root exudates and bacterial metabolic a...

  13. Bacterial Genome Instability

    PubMed Central

    Darmon, Elise

    2014-01-01

    SUMMARY Bacterial genomes are remarkably stable from one generation to the next but are plastic on an evolutionary time scale, substantially shaped by horizontal gene transfer, genome rearrangement, and the activities of mobile DNA elements. This implies the existence of a delicate balance between the maintenance of genome stability and the tolerance of genome instability. In this review, we describe the specialized genetic elements and the endogenous processes that contribute to genome instability. We then discuss the consequences of genome instability at the physiological level, where cells have harnessed instability to mediate phase and antigenic variation, and at the evolutionary level, where horizontal gene transfer has played an important role. Indeed, this ability to share DNA sequences has played a major part in the evolution of life on Earth. The evolutionary plasticity of bacterial genomes, coupled with the vast numbers of bacteria on the planet, substantially limits our ability to control disease. PMID:24600039

  14. The changes of bacterial communities and antibiotic resistance genes in microbial fuel cells during long-term oxytetracycline processing.

    PubMed

    Yan, Weifu; Guo, Yunyan; Xiao, Yong; Wang, Shuhua; Ding, Rui; Jiang, Jiaqi; Gang, Haiyin; Wang, Han; Yang, Jun; Zhao, Feng

    2018-05-28

    Microbial fuel cell (MFC) is regarded as a promising alternative for enhancing the removal of antibiotic pollutants. In this study, oxytetracycline served as an electron donor in the anode chamber of MFCs, and after continuous operation for 330 days, the efficiency of removal of 10 mg/L oxytetracycline in MFCs increased to 99.00% in 78 h, whereas removal efficiency of only 58.26% was achieved in microbial controls. Compared to microbial controls, higher ATP concentration and persistent electrical stimulation mainly contributed to bioelectrochemical reactions more rapidly to enhance oxytetracycline removal in MFCs. In addition, the analysis of bacterial communities revealed that Eubacterium spp.-as the main functional bacterial genus responsible for oxytetracycline biodegradation-flourished starting from merely 0.00%-91.69% ± 0.27% (mean ± SD) in MFCs. High-throughput quantitative PCR showed that the normalized copy numbers of total antibiotic resistance genes (ARGs) and mobile genetic elements in MFCs were 1.7364 and 0.0065 copies/cell respectively, which were markedly lower than those in the microbial controls. Furthermore, there was no significant correlation between oxytetracycline concentration in the influent and abundance of ARGs in effluent from MFCs. Nevertheless, Tp614, a transposase gene, was found to be enriched in both MFCs and microbial reactors, suggesting that it may be a common challenge for different biological processes for wastewater treatment. This study therefore showed a lower probability of upregulation and transmission of ARGs in MFCs when compared to a traditional anaerobic microbial treatment. Copyright © 2018. Published by Elsevier Ltd.

  15. Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

    PubMed

    Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

    2003-05-01

    We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

  16. Diversity of pufM genes, involved in aerobic anoxygenic photosynthesis, in the bacterial communities associated with colonial ascidians.

    PubMed

    Martínez-García, Manuel; Díaz-Valdés, Marta; Antón, Josefa

    2010-03-01

    Ascidians are invertebrate filter feeders widely distributed in benthic marine environments. A total of 14 different ascidian species were collected from the Western Mediterranean and their bacterial communities were analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene. Results showed that ascidian tissues harbored Bacteria belonging to Gamma- and Alphaproteobacteria classes, some of them phylogenetically related to known aerobic anoxygenic phototrophs (AAPs), such as Roseobacter sp. In addition, hierarchical cluster analysis of DGGE patterns showed a large variability in the bacterial diversity among the different ascidians analyzed, which indicates that they would harbor different bacterial communities. Furthermore, pufM genes, involved in aerobic anoxygenic photosynthesis in marine and freshwater systems, were widely detected within the ascidians analyzed, because nine out of 14 species had pufM genes inside their tissues. The pufM gene was only detected in those specimens that inhabited shallow waters (<77 m of depth). Most pufM gene sequences were very closely related to that of uncultured marine bacteria. Thus, our results suggest that the association of ascidians with bacteria related to AAPs could be a general phenomenon and that ascidian-associated microbiota could use the light that penetrates through the tunic tissue as an energy source.

  17. Abundance of antibiotic resistance genes and bacterial community composition in wild freshwater fish species.

    PubMed

    Marti, Elisabet; Huerta, Belinda; Rodríguez-Mozaz, Sara; Barceló, Damià; Marcé, Rafael; Balcázar, Jose Luis

    2018-04-01

    This study was aimed to determine the abundance of four antibiotic resistance genes (bla TEM , ermB, qnrS and sulI), as well as bacterial community composition associated with the intestinal mucus of wild freshwater fish species collected from the Foix and La Llosa del Cavall reservoirs, which represent ecosystems with high and low anthropogenic disturbance, respectively. Water and sediments from these reservoirs were also collected and analyzed to determine the pollution level by antibiotics. The bla TEM gene was only detected in brown trout and Ebro barbel, which were collected from La Llosa del Cavall reservoir. In contrast, the sulI and qnrS genes were only detected in common carp, which were collected from the Foix reservoir. Although the ermB gene was also detected in common carp, the values were below the limit of quantification. Likewise, water and sediment samples from the Foix reservoir had higher concentrations and more classes of antibiotics than those from La Llosa del Cavall. Pyrosequencing analysis of 16S rRNA genes revealed significant differences in bacterial communities associated with the intestinal mucus of fish species. Therefore, these findings suggest that anthropogenic activities are not only increasing the pollution of aquatic environments, but also contributing to the emergence and spread of antibiotic resistance in organisms that inhabit such environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain

    PubMed Central

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-01-01

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  19. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain.

    PubMed

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Abbott, James; Micklem, Chris N; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-06-14

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology.

  20. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    PubMed

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

  1. Conditions for the Evolution of Gene Clusters in Bacterial Genomes

    PubMed Central

    Ballouz, Sara; Francis, Andrew R.; Lan, Ruiting; Tanaka, Mark M.

    2010-01-01

    Genes encoding proteins in a common pathway are often found near each other along bacterial chromosomes. Several explanations have been proposed to account for the evolution of these structures. For instance, natural selection may directly favour gene clusters through a variety of mechanisms, such as increased efficiency of coregulation. An alternative and controversial hypothesis is the selfish operon model, which asserts that clustered arrangements of genes are more easily transferred to other species, thus improving the prospects for survival of the cluster. According to another hypothesis (the persistence model), genes that are in close proximity are less likely to be disrupted by deletions. Here we develop computational models to study the conditions under which gene clusters can evolve and persist. First, we examine the selfish operon model by re-implementing the simulation and running it under a wide range of conditions. Second, we introduce and study a Moran process in which there is natural selection for gene clustering and rearrangement occurs by genome inversion events. Finally, we develop and study a model that includes selection and inversion, which tracks the occurrence and fixation of rearrangements. Surprisingly, gene clusters fail to evolve under a wide range of conditions. Factors that promote the evolution of gene clusters include a low number of genes in the pathway, a high population size, and in the case of the selfish operon model, a high horizontal transfer rate. The computational analysis here has shown that the evolution of gene clusters can occur under both direct and indirect selection as long as certain conditions hold. Under these conditions the selfish operon model is still viable as an explanation for the evolution of gene clusters. PMID:20168992

  2. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    PubMed

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-09-24

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  3. Code-assisted discovery of TAL effector targets in bacterial leaf streak of rice reveals contrast with bacterial blight and a novel susceptibility gene

    USDA-ARS?s Scientific Manuscript database

    Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...

  4. Bacterial Adaptation of Respiration from Oxic to Microoxic and Anoxic Conditions: Redox Control

    PubMed Central

    Bueno, Emilio; Mesa, Socorro; Bedmar, Eulogio J.; Richardson, David J.

    2012-01-01

    Abstract Under a shortage of oxygen, bacterial growth can be faced mainly by two ATP-generating mechanisms: (i) by synthesis of specific high-affinity terminal oxidases that allow bacteria to use traces of oxygen or (ii) by utilizing other substrates as final electron acceptors such as nitrate, which can be reduced to dinitrogen gas through denitrification or to ammonium. This bacterial respiratory shift from oxic to microoxic and anoxic conditions requires a regulatory strategy which ensures that cells can sense and respond to changes in oxygen tension and to the availability of other electron acceptors. Bacteria can sense oxygen by direct interaction of this molecule with a membrane protein receptor (e.g., FixL) or by interaction with a cytoplasmic transcriptional factor (e.g., Fnr). A third type of oxygen perception is based on sensing changes in redox state of molecules within the cell. Redox-responsive regulatory systems (e.g., ArcBA, RegBA/PrrBA, RoxSR, RegSR, ActSR, ResDE, and Rex) integrate the response to multiple signals (e.g., ubiquinone, menaquinone, redox active cysteine, electron transport to terminal oxidases, and NAD/NADH) and activate or repress target genes to coordinate the adaptation of bacterial respiration from oxic to anoxic conditions. Here, we provide a compilation of the current knowledge about proteins and regulatory networks involved in the redox control of the respiratory adaptation of different bacterial species to microxic and anoxic environments. Antioxid. Redox Signal. 16, 819–852. PMID:22098259

  5. Influence of zeolite and superphosphate as additives on antibiotic resistance genes and bacterial communities during factory-scale chicken manure composting.

    PubMed

    Peng, Shuang; Li, Huijie; Song, Dan; Lin, Xiangui; Wang, Yiming

    2018-04-30

    Factory-scale chicken manure composting added with zeolite (F), superphosphate (G), or zeolite and ferrous sulfate (FL) simultaneously, were evaluate for their effects on the behaviors of antibiotic resistance genes (ARGs) and bacterial communities. After composting, ARGs in manure decreased by 67.3% in the control, whereas the reductions were 86.5%, 68.6% and 72.2% in F, G and FL, respectively. ARGs encoding ribosomal protection proteins (tetO, tetB(P), and tetM) were reduced to a greater extent than tetG, tetL, sul1 and sul2. Bacteria pathogens were also effectively removed by composting. Network analysis showed that Firmicutes were the important potential host bacteria for ARGs. The bacterial communities and environmental factors, as well as the intI gene, contributed significantly to the variation of ARGs. The ARGs and integrons were reduced more when zeolite was added than when superphosphate was added; thus, it may be useful for reducing the risks of ARGs in chicken manure. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired genes

    PubMed Central

    2014-01-01

    Background Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. Results A unique 34 kbp long fragment with 27 clustered genes (TvLF) of prokaryote origin was identified in the sequenced genome of the protozoan parasite Trichomonas vaginalis. Using a PCR based approach we confirmed the presence of the orthologous fragment in four additional T. vaginalis strains. Detailed sequence analyses unambiguously suggest that TvLF is the result of one single, recent LGT event. The proposed donor is a close relative to the firmicute bacterium Peptoniphilus harei. High nucleotide sequence similarity between T. vaginalis strains, as well as to P. harei, and the absence of homologs in other Trichomonas species, suggests that the transfer event took place after the radiation of the genus Trichomonas. Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional annotations reveal that genes involved in informational processes are particularly prone to degradation. Conclusions We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. PMID:24898731

  7. Riboregulation of bacterial and archaeal transposition.

    PubMed

    Ellis, Michael J; Haniford, David B

    2016-05-01

    The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  8. Phylotype Dynamics of Bacterial P Utilization Genes in Microbialites and Bacterioplankton of a Monomictic Endorheic Lake.

    PubMed

    Valdespino-Castillo, Patricia M; Alcántara-Hernández, Rocío J; Merino-Ibarra, Martín; Alcocer, Javier; Macek, Miroslav; Moreno-Guillén, Octavio A; Falcón, Luisa I

    2017-02-01

    Microbes can modulate ecosystem function since they harbor a vast genetic potential for biogeochemical cycling. The spatial and temporal dynamics of this genetic diversity should be acknowledged to establish a link between ecosystem function and community structure. In this study, we analyzed the genetic diversity of bacterial phosphorus utilization genes in two microbial assemblages, microbialites and bacterioplankton of Lake Alchichica, a semiclosed (i.e., endorheic) system with marked seasonality that varies in nutrient conditions, temperature, dissolved oxygen, and water column stability. We focused on dissolved organic phosphorus (DOP) utilization gene dynamics during contrasting mixing and stratification periods. Bacterial alkaline phosphatases (phoX and phoD) and alkaline beta-propeller phytases (bpp) were surveyed. DOP utilization genes showed different dynamics evidenced by a marked change within an intra-annual period and a differential circadian pattern of expression. Although Lake Alchichica is a semiclosed system, this dynamic turnover of phylotypes (from lake circulation to stratification) points to a different potential of DOP utilization by the microbial communities within periods. DOP utilization gene dynamics was different among genetic markers and among assemblages (microbialite vs. bacterioplankton). As estimated by the system's P mass balance, P inputs and outputs were similar in magnitude (difference was <10 %). A theoretical estimation of water column P monoesters was used to calculate the potential P fraction that can be remineralized on an annual basis. Overall, bacterial groups including Proteobacteria (Alpha and Gamma) and Bacteroidetes seem to be key participants in DOP utilization responses.

  9. Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

    PubMed

    Inouye, Satoshi; Suzuki, Takahiro

    2016-12-01

    The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Phenotypic Signatures Arising from Unbalanced Bacterial Growth

    PubMed Central

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-01-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify “phenotypic signatures” by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains. PMID:25101949

  11. Phenotypic signatures arising from unbalanced bacterial growth.

    PubMed

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-08-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify "phenotypic signatures" by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains.

  12. Vizantin inhibits bacterial adhesion without affecting bacterial growth and causes Streptococcus mutans biofilm to detach by altering its internal architecture.

    PubMed

    Takenaka, Shoji; Oda, Masataka; Domon, Hisanori; Ohsumi, Tatsuya; Suzuki, Yuki; Ohshima, Hayato; Yamamoto, Hirofumi; Terao, Yutaka; Noiri, Yuichiro

    2016-11-11

    An ideal antibiofilm strategy is to control both in the quality and quantity of biofilm while maintaining the benefits derived from resident microflora. Vizantin, a recently developed immunostimulating compound, has also been found to have antibiofilm property. This study evaluated the influence on biofilm formation of Streptococcus mutans in the presence of sulfated vizantin and biofilm development following bacterial adhesion on a hydroxyapatite disc coated with sulfated vizantin. Supplementation with sulfated vizantin up to 50 μM did not affect either bacterial growth or biofilm formation, whereas 50 μM sulfated vizantin caused the biofilm to readily detach from the surface. Sulfated vizantin at the concentration of 50 μM upregulated the expression of the gtfB and gtfC genes, but downregulated the expression of the gtfD gene, suggesting altered architecture in the biofilm. Biofilm development on the surface coated with sulfated vizantin was inhibited depending on the concentration, suggesting prevention from bacterial adhesion. Among eight genes related to bacterial adherence in S. mutans, expression of gtfB and gtfC was significantly upregulated, whereas the expression of gtfD, GbpA and GbpC was downregulated according to the concentration of vizantin, especially with 50 μM vizantin by 0.8-, 0.4-, and 0.4-fold, respectively. These findings suggest that sulfated vizantin may cause structural degradation as a result of changing gene regulation related to bacterial adhesion and glucan production of S. mutans. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Diversity of bacterial dimethylsulfoniopropionate degradation genes in surface seawater of Arctic Kongsfjorden.

    PubMed

    Zeng, Yin-Xin; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong; Luo, Wei

    2016-09-08

    Dimethylsulfoniopropionate (DMSP), which is the major source of organic sulfur in the world's oceans, plays a significant role in the global sulfur cycle. This compound is rapidly degraded by marine bacteria either by cleavage to dimethylsulfide (DMS) or demethylation to 3-methylmercaptopropionate (MMPA). The diversity of genes encoding bacterial demethylation (dmdA) and DMS production (dddL and dddP) were measured in Arctic Kongsfjorden. Both dmdA and dddL genes were detected in all stations along a transect from the outer to the inner fjord, while dddP gene was only found in the outer and middle parts of the fjord. The dmdA gene was completely confined to the Roseobacter clade, while the dddL gene was confined to the genus Sulfitobacter. Although the dddP gene pool was also dominated by homologs from the Roseobacter clade, there were a few dddP genes showing close relationships to both Alphaproteobacter and Gammaproteobacter. The results of this study suggest that the Roseobacter clade may play an important role in DMSP catabolism via both demethylation and cleavage pathways in surface waters of Kongsfjorden during summer.

  14. Diversity of bacterial dimethylsulfoniopropionate degradation genes in surface seawater of Arctic Kongsfjorden

    NASA Astrophysics Data System (ADS)

    Zeng, Yin-Xin; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong; Luo, Wei

    2016-09-01

    Dimethylsulfoniopropionate (DMSP), which is the major source of organic sulfur in the world’s oceans, plays a significant role in the global sulfur cycle. This compound is rapidly degraded by marine bacteria either by cleavage to dimethylsulfide (DMS) or demethylation to 3-methylmercaptopropionate (MMPA). The diversity of genes encoding bacterial demethylation (dmdA) and DMS production (dddL and dddP) were measured in Arctic Kongsfjorden. Both dmdA and dddL genes were detected in all stations along a transect from the outer to the inner fjord, while dddP gene was only found in the outer and middle parts of the fjord. The dmdA gene was completely confined to the Roseobacter clade, while the dddL gene was confined to the genus Sulfitobacter. Although the dddP gene pool was also dominated by homologs from the Roseobacter clade, there were a few dddP genes showing close relationships to both Alphaproteobacter and Gammaproteobacter. The results of this study suggest that the Roseobacter clade may play an important role in DMSP catabolism via both demethylation and cleavage pathways in surface waters of Kongsfjorden during summer.

  15. Control of bacterial adhesion and growth on honeycomb-like patterned surfaces.

    PubMed

    Yang, Meng; Ding, Yonghui; Ge, Xiang; Leng, Yang

    2015-11-01

    It is a great challenge to construct a persistent bacteria-resistant surface even though it has been demonstrated that several surface features might be used to control bacterial behavior, including surface topography. In this study, we develop micro-scale honeycomb-like patterns of different sizes (0.5-10 μm) as well as a flat area as the control on a single platform to evaluate the bacterial adhesion and growth. Bacteria strains, Escherichia coli and Staphylococcus aureus with two distinct shapes (rod and sphere) are cultured on the platforms, with the patterned surface-up and surface-down in the culture medium. The results demonstrate that the 1 μm patterns remarkably reduce bacterial adhesion and growth while suppressing bacterial colonization when compared to the flat surface. The selective adhesion of the bacterial cells on the patterns reveals that the bacterial adhesion is cooperatively mediated by maximizing the cell-substrate contact area and minimizing the cell deformation, from a thermodynamic point of view. Moreover, study of bacterial behaviors on the surface-up vs. surface-down samples shows that gravity does not apparently affect the spatial distribution of the adherent cells although it indeed facilitates bacterial adhesion. Furthermore, the experimental results suggest that two major factors, i.e. the availability of energetically favorable adhesion sites and the physical confinements, contribute to the anti-bacterial nature of the honeycomb-like patterns. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Analysis of gene expression levels in individual bacterial cells without image segmentation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwak, In Hae; Son, Minjun; Hagen, Stephen J., E-mail: sjhagen@ufl.edu

    2012-05-11

    Highlights: Black-Right-Pointing-Pointer We present a method for extracting gene expression data from images of bacterial cells. Black-Right-Pointing-Pointer The method does not employ cell segmentation and does not require high magnification. Black-Right-Pointing-Pointer Fluorescence and phase contrast images of the cells are correlated through the physics of phase contrast. Black-Right-Pointing-Pointer We demonstrate the method by characterizing noisy expression of comX in Streptococcus mutans. -- Abstract: Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on amore » segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly.« less

  17. Activity of Uncleaved Caspase-8 Controls Anti-bacterial Immune Defense and TLR-Induced Cytokine Production Independent of Cell Death.

    PubMed

    Philip, Naomi H; DeLaney, Alexandra; Peterson, Lance W; Santos-Marrero, Melanie; Grier, Jennifer T; Sun, Yan; Wynosky-Dolfi, Meghan A; Zwack, Erin E; Hu, Baofeng; Olsen, Tayla M; Rongvaux, Anthony; Pope, Scott D; López, Carolina B; Oberst, Andrew; Beiting, Daniel P; Henao-Mejia, Jorge; Brodsky, Igor E

    2016-10-01

    Caspases regulate cell death programs in response to environmental stresses, including infection and inflammation, and are therefore critical for the proper operation of the mammalian immune system. Caspase-8 is necessary for optimal production of inflammatory cytokines and host defense against infection by multiple pathogens including Yersinia, but whether this is due to death of infected cells or an intrinsic role of caspase-8 in TLR-induced gene expression is unknown. Caspase-8 activation at death signaling complexes results in its autoprocessing and subsequent cleavage and activation of its downstream apoptotic targets. Whether caspase-8 activity is also important for inflammatory gene expression during bacterial infection has not been investigated. Here, we report that caspase-8 plays an essential cell-intrinsic role in innate inflammatory cytokine production in vivo during Yersinia infection. Unexpectedly, we found that caspase-8 enzymatic activity regulates gene expression in response to bacterial infection as well as TLR signaling independently of apoptosis. Using newly-generated mice in which caspase-8 autoprocessing is ablated (Casp8DA/DA), we now demonstrate that caspase-8 enzymatic activity, but not autoprocessing, mediates induction of inflammatory cytokines by bacterial infection and a wide variety of TLR stimuli. Because unprocessed caspase-8 functions in an enzymatic complex with its homolog cFLIP, our findings implicate the caspase-8/cFLIP heterodimer in control of inflammatory cytokines during microbial infection, and provide new insight into regulation of antibacterial immune defense.

  18. Variation of bacterial communities and expression of Toll-like receptor genes in the rumen of steers differing in susceptibility to subacute ruminal acidosis.

    PubMed

    Chen, Yanhong; Oba, Masahito; Guan, Le Luo

    2012-10-12

    In order to determine differences in the ruminal bacterial community and host Toll-like receptor (TLR) gene expression of beef cattle with different susceptibility to acidosis, rumen papillae and content were collected from acidosis-susceptible (AS, n=3) and acidosis-resistant (AR, n=3) steers. The ruminal bacterial community was characterized using PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and quantitative real time PCR (qRT-PCR) analysis. Global R analysis of bacterial profile similarity revealed that bacterial diversity was significantly different between AR and AS groups for both rumen content (P=0.001) and epithelial (P=0.002) communities. The copy number of total bacterial 16S rRNA genes in content of AS steers was 10-fold higher than that of AR steers, and the copy number of total 16S rRNA genes of epimural bacteria in AR steers was positively correlated with ruminal pH (r=0.59, P=0.04), and negatively correlated with total VFA concentration (r=-0.59, P=0.05). The expressions of host TLR2 and 4 genes were significantly higher in AR steers compared to those in AS steers. These findings enhance our understanding about the ruminal microbial ecology and host gene expression changes that may be useful in the prevention of ruminal acidosis. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system

    PubMed Central

    Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C.; Moon, Tae Seok

    2016-01-01

    A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA–asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions. PMID:26837577

  20. Efficacy of fungal and bacterial antagonists for controlling growth, FUM1 gene expression and fumonisin B1 production by Fusarium verticillioides on maize cobs of different ripening stages.

    PubMed

    Samsudin, Nik Iskandar Putra; Rodriguez, Alicia; Medina, Angel; Magan, Naresh

    2017-04-04

    This study was carried out to examine the efficacy of two biocontrol agents (Clonostachys rosea 016, BCA1; Gram-negative bacterium, BCA5) for control of FUM1 gene expression and fumonisin B 1 (FB 1 ) production by F. verticillioides FV1 on maize cobs of different ripening stages: R 3 , Milk (0.985 a w ); R 4 , Dough (0.976 a w ); R 5 , Dent (0.958 a w ). Initially, temporal studies on FUM1 gene expression and FB 1 production were performed on maize kernels for up to 14days. This revealed that day 10 was optimum for both parameters, and was used in the biocontrol studies. Maize cobs were inoculated with 50:50 mixtures of the pathogen:antagonist inoculum and incubated in environmental chambers to maintain the natural a w conditions for ten days at 25 and 30°C. The growth rates of F. verticillioides FV1, the relative expression of the FUM1 gene and FB 1 production were quantified. It was found that, a w ×temp had significant impacts on growth, FUM1 gene expression and FB 1 production by F. verticillioides FV1 on maize cobs of different maturities. The fungal antagonist (BCA1) significantly reduced FB 1 contamination on maize cobs by >70% at 25°C, and almost 60% at 30°C regardless of maize ripening stage. For the bacterial antagonist (BCA5) however, FB 1 levels on maize cobs were significantly decreased only in some treatments. These results suggest that efficacy of antagonists to control mycotoxin production in ripening maize cobs needs to take account of the ecophysiology of the pathogen and the antagonists, as well as the physiological status of the maize during silking to ensure effective control. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Can the Bacterial Community of a High Arctic Glacier Surface Escape Viral Control?

    PubMed Central

    Rassner, Sara M. E.; Anesio, Alexandre M.; Girdwood, Susan E.; Hell, Katherina; Gokul, Jarishma K.; Whitworth, David E.; Edwards, Arwyn

    2016-01-01

    Glacial ice surfaces represent a seasonally evolving three-dimensional photic zone which accumulates microbial biomass and potentiates positive feedbacks in ice melt. Since viruses are abundant in glacial systems and may exert controls on supraglacial bacterial production, we examined whether changes in resource availability would promote changes in the bacterial community and the dynamics between viruses and bacteria of meltwater from the photic zone of a Svalbard glacier. Our results indicated that, under ambient nutrient conditions, low estimated viral decay rates account for a strong viral control of bacterial productivity, incurring a potent viral shunt of a third of bacterial carbon in the supraglacial microbial loop. Moreover, it appears that virus particles are very stable in supraglacial meltwater, raising the prospect that viruses liberated in melt are viable downstream. However, manipulating resource availability as dissolved organic carbon, nitrogen, and phosphorous in experimental microcosms demonstrates that the photic zone bacterial communities can escape viral control. This is evidenced by a marked decline in virus-to-bacterium ratio (VBR) concomitant with increased bacterial productivity and number. Pyrosequencing shows a few bacterial taxa, principally Janthinobacterium sp., dominate both the source meltwater and microcosm communities. Combined, our results suggest that viruses maintain high VBR to promote contact with low-density hosts, by the manufacture of robust particles, but that this necessitates a trade-off which limits viral production. Consequently, dominant bacterial taxa appear to access resources to evade viral control. We propose that a delicate interplay of bacterial and viral strategies affects biogeochemical cycling upon glaciers and, ultimately, downstream ecosystems. PMID:27446002

  2. The Bacterial Mobile Resistome Transfer Network Connecting the Animal and Human Microbiomes.

    PubMed

    Hu, Yongfei; Yang, Xi; Li, Jing; Lv, Na; Liu, Fei; Wu, Jun; Lin, Ivan Y C; Wu, Na; Weimer, Bart C; Gao, George F; Liu, Yulan; Zhu, Baoli

    2016-11-15

    Horizontally acquired antibiotic resistance genes (ARGs) in bacteria are highly mobile and have been ranked as principal risk resistance determinants. However, the transfer network of the mobile resistome and the forces driving mobile ARG transfer are largely unknown. Here, we present the whole profile of the mobile resistome in 23,425 bacterial genomes and explore the effects of phylogeny and ecology on the recent transfer (≥99% nucleotide identity) of mobile ARGs. We found that mobile ARGs are mainly present in four bacterial phyla and are significantly enriched in Proteobacteria The recent mobile ARG transfer network, which comprises 703 bacterial species and 16,859 species pairs, is shaped by the bacterial phylogeny, while an ecological barrier also exists, especially when interrogating bacteria colonizing different human body sites. Phylogeny is still a driving force for the transfer of mobile ARGs between farm animals and the human gut, and, interestingly, the mobile ARGs that are shared between the human and animal gut microbiomes are also harbored by diverse human pathogens. Taking these results together, we suggest that phylogeny and ecology are complementary in shaping the bacterial mobile resistome and exert synergistic effects on the development of antibiotic resistance in human pathogens. The development of antibiotic resistance threatens our modern medical achievements. The dissemination of antibiotic resistance can be largely attributed to the transfer of bacterial mobile antibiotic resistance genes (ARGs). Revealing the transfer network of these genes in bacteria and the forces driving the gene flow is of great importance for controlling and predicting the emergence of antibiotic resistance in the clinic. Here, by analyzing tens of thousands of bacterial genomes and millions of human and animal gut bacterial genes, we reveal that the transfer of mobile ARGs is mainly controlled by bacterial phylogeny but under ecological constraints. We also found

  3. The Bacterial Mobile Resistome Transfer Network Connecting the Animal and Human Microbiomes

    PubMed Central

    Hu, Yongfei; Yang, Xi; Li, Jing; Lv, Na; Liu, Fei; Wu, Jun; Lin, Ivan Y. C.; Wu, Na; Gao, George F.

    2016-01-01

    ABSTRACT Horizontally acquired antibiotic resistance genes (ARGs) in bacteria are highly mobile and have been ranked as principal risk resistance determinants. However, the transfer network of the mobile resistome and the forces driving mobile ARG transfer are largely unknown. Here, we present the whole profile of the mobile resistome in 23,425 bacterial genomes and explore the effects of phylogeny and ecology on the recent transfer (≥99% nucleotide identity) of mobile ARGs. We found that mobile ARGs are mainly present in four bacterial phyla and are significantly enriched in Proteobacteria. The recent mobile ARG transfer network, which comprises 703 bacterial species and 16,859 species pairs, is shaped by the bacterial phylogeny, while an ecological barrier also exists, especially when interrogating bacteria colonizing different human body sites. Phylogeny is still a driving force for the transfer of mobile ARGs between farm animals and the human gut, and, interestingly, the mobile ARGs that are shared between the human and animal gut microbiomes are also harbored by diverse human pathogens. Taking these results together, we suggest that phylogeny and ecology are complementary in shaping the bacterial mobile resistome and exert synergistic effects on the development of antibiotic resistance in human pathogens. IMPORTANCE The development of antibiotic resistance threatens our modern medical achievements. The dissemination of antibiotic resistance can be largely attributed to the transfer of bacterial mobile antibiotic resistance genes (ARGs). Revealing the transfer network of these genes in bacteria and the forces driving the gene flow is of great importance for controlling and predicting the emergence of antibiotic resistance in the clinic. Here, by analyzing tens of thousands of bacterial genomes and millions of human and animal gut bacterial genes, we reveal that the transfer of mobile ARGs is mainly controlled by bacterial phylogeny but under ecological

  4. SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.

    PubMed

    Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B

    2016-02-04

    Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with

  5. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    PubMed

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  6. Exploring the Abundance and Diversity of Bacterial Communities and Quantifying Antibiotic-Related Genes Along an Elevational Gradient in Taibai Mountain, China.

    PubMed

    Peng, Chu; Wang, He; Jiang, Yingying; Yang, Jinhua; Lai, Hangxian; Wei, Xiaomin

    2018-05-10

    Thus far, no studies have investigated the soil microbial diversity over an elevational gradient in Taibai Mountain, the central massif of the Qinling Mountain Range. Here, we used Illumina sequencing and quantitative PCR of the 16S rRNA gene to assess the diversity and abundance of bacterial communities along an elevational gradient in representative vegetation soils in Taibai Mountain. We identified the soil, climate, and vegetation factors driving the variations in soil bacterial community structure by Pearson correlation and redundancy analysis. We also evaluated the potential for antibiotic discovery by quantitative PCR of the PKS-I, PKS-II, and NRPS genes from Actinobacteria. The results showed that soil bacterial alpha diversity increased first and then decreased with an elevational rise in both the northern and southern slopes of Taibai Mountain. The bacterial abundance was significantly correlated with soil organic matter and nitrate nitrogen. The average relative abundance of Actinobacteria in Taibai Mountain was markedly higher than those in other mountain forest soils. The absolute abundance of PKS and NPRS gene was significantly higher in the tested soils compared with the gene copy numbers reported in tropical urban soils. Taibai Mountain is rich in actinomycete resources and has great potential for antibiotic excavation.

  7. Antibiotic resistance genes and intI1 prevalence in a swine wastewater treatment plant and correlation with metal resistance, bacterial community and wastewater parameters.

    PubMed

    Yuan, Qing-Bin; Zhai, Yi-Fan; Mao, Bu-Yun; Hu, Nan

    2018-06-07

    The livestock wastewater treatment plant represents an important reservoir of antibiotic resistance determinants in the environment. The study explored the prevalence of five antibiotic resistance genes (ARGs, including sulI, tetA, qnrD, mphB and mcr-1) and class 1 integron (intI1) in a typical livestock wastewater treatment plant, and analyzed their integrated association with two metal resistance genes (copA and czcA), two pathogens genes (Staphylococcus and Campylobacter), bacterial community and wastewater properties. Results indicated that all investigated genes were detected in the plant. The treatment plant could not completely remove ARGs abundances, with up to 2.2 × 10 4 ~3.7 × 10 8 copies/L of them remaining in the effluent. Mcr-1 was further enriched by 27-fold in the subsequent pond. The correlation analysis showed that mphB significantly correlateed with tetA and intI. Mcr-1 strongly correlated with copA. MphB and intI significantly correlated with czcA. The correlations implied a potential co-selection risk of bacterial resistant to antibiotics and metals. Redundancy analyses indicated that qnrD and mcr-1 strongly correlated with 13 and 14 bacterial genera, respectively. Most ARGs positively correlated to wastewater nutrients, indicating that an efficient reduction of wastewater nutrients would contribute to the antibiotic resistance control. The study will provide useful implications on fates and reductions of ARGs in livestock facilities and receiving environments. Copyright © 2018. Published by Elsevier Inc.

  8. Gene dosage imbalance during DNA replication controls bacterial cell-fate decision

    NASA Astrophysics Data System (ADS)

    Igoshin, Oleg

    Genes encoding proteins in a common regulatory network are frequently located close to one another on the chromosome to facilitate co-regulation or couple gene expression to growth rate. Contrasting with these observations, here we demonstrate a functional role for the arrangement of Bacillus subtilis sporulation network genes on opposite sides of the chromosome. We show that the arrangement of two sporulation network genes, one located close to the origin, the other close to the terminus leads to a transient gene dosage imbalance during chromosome replication. This imbalance is detected by the sporulation network to produce cell-cycle coordinated pulses of the sporulation master regulator Spo0A~P. This pulsed response allows cells to decide between sporulation and continued vegetative growth during each cell-cycle spent in starvation. Furthermore, changes in DNA replication and cell-cycle parameters with decreased growth rate in starvation conditions enable cells to indirectly detect starvation without the need for evaluating specific metabolites. The simplicity of the uncovered coordination mechanism and starvation sensing suggests that it may be widely applicable in a variety of gene regulatory and stress-response settings. This work is supported by National Science Foundation Grants MCB-1244135, EAGER-1450867, MCB-1244423, NIH NIGMS Grant R01 GM088428 and HHMI International Student Fellowship.

  9. Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by algU.

    PubMed

    Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

    2007-11-01

    Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.

  10. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards.

    PubMed

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-11-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle.

  11. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards* #

    PubMed Central

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-01-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle. PMID:25367788

  12. Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system.

    PubMed

    Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C; Moon, Tae Seok

    2016-03-18

    A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA-asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections

    USDA-ARS?s Scientific Manuscript database

    To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

  14. Bacterial RNA Biology on a Genome Scale.

    PubMed

    Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg

    2018-06-07

    Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Chemical Approaches to Control Gene Expression

    PubMed Central

    Gottesfeld, Joel M.; Turner, James M.; Dervan, Peter B.

    2000-01-01

    A current goal in molecular medicine is the development of new strategies to interfere with gene expression in living cells in the hope that novel therapies for human disease will result from these efforts. This review focuses on small-molecule or chemical approaches to manipulate gene expression by modulating either transcription of messenger RNA-coding genes or protein translation. The molecules under study include natural products, designed ligands, and compounds identified through functional screens of combinatorial libraries. The cellular targets for these molecules include DNA, messenger RNA, and the protein components of the transcription, RNA processing, and translational machinery. Studies with model systems have shown promise in the inhibition of both cellular and viral gene transcription and mRNA utilization. Moreover, strategies for both repression and activation of gene transcription have been described. These studies offer promise for treatment of diseases of pathogenic (viral, bacterial, etc.) and cellular origin (cancer, genetic diseases, etc.). PMID:11097426

  16. Physicochemical control of bacterial and protist community composition and diversity in Antarctic sea ice.

    PubMed

    Torstensson, Anders; Dinasquet, Julie; Chierici, Melissa; Fransson, Agneta; Riemann, Lasse; Wulff, Angela

    2015-10-01

    Due to climate change, sea ice experiences changes in terms of extent and physical properties. In order to understand how sea ice microbial communities are affected by changes in physicochemical properties of the ice, we used 454-sequencing of 16S and 18S rRNA genes to examine environmental control of microbial diversity and composition in Antarctic sea ice. We observed a high diversity and richness of bacteria, which were strongly negatively correlated with temperature and positively with brine salinity. We suggest that bacterial diversity in sea ice is mainly controlled by physicochemical properties of the ice, such as temperature and salinity, and that sea ice bacterial communities are sensitive to seasonal and environmental changes. For the first time in Antarctic interior sea ice, we observed a strong eukaryotic dominance of the dinoflagellate phylotype SL163A10, comprising 63% of the total sequences. This phylotype is known to be kleptoplastic and could be a significant primary producer in sea ice. We conclude that mixotrophic flagellates may play a greater role in the sea ice microbial ecosystem than previously believed, and not only during the polar night but also during summer when potential food sources are abundant. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    PubMed

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  18. Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

    PubMed Central

    Tsang, Jennifer; Hoover, Timothy R.

    2014-01-01

    Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734

  19. Presence or Absence of mlr Genes and Nutrient Concentrations Co-Determine the Microcystin Biodegradation Efficiency of a Natural Bacterial Community

    PubMed Central

    Lezcano, María Ángeles; Morón-López, Jesús; Agha, Ramsy; López-Heras, Isabel; Nozal, Leonor; Quesada, Antonio; El-Shehawy, Rehab

    2016-01-01

    The microcystin biodegradation potential of a natural bacterial community coexisting with a toxic cyanobacterial bloom was investigated in a water reservoir from central Spain. The biodegradation capacity was confirmed in all samples during the bloom and an increase of mlrA gene copies was found with increasing microcystin concentrations. Among the 24 microcystin degrading strains isolated from the bacterial community, only 28% showed presence of mlrA gene, strongly supporting the existence and abundance of alternative microcystin degradation pathways in nature. In vitro degradation assays with both mlr+ and mlr− bacterial genotypes (with presence and absence of the complete mlr gene cluster, respectively) were performed with four isolated strains (Sphingopyxis sp. IM-1, IM-2 and IM-3; Paucibacter toxinivorans IM-4) and two bacterial degraders from the culture collection (Sphingosinicella microcystinivorans Y2; Paucibacter toxinivorans 2C20). Differences in microcystin degradation efficiencies between genotypes were found under different total organic carbon and total nitrogen concentrations. While mlr+ strains significantly improved microcystin degradation rates when exposed to other carbon and nitrogen sources, mlr− strains showed lower degradation efficiencies. This suggests that the presence of alternative carbon and nitrogen sources possibly competes with microcystins and impairs putative non-mlr microcystin degradation pathways. Considering the abundance of the mlr− bacterial population and the increasing frequency of eutrophic conditions in aquatic systems, further research on the diversity of this population and the characterization and conditions affecting non-mlr degradation pathways deserves special attention. PMID:27827872

  20. Presence or Absence of mlr Genes and Nutrient Concentrations Co-Determine the Microcystin Biodegradation Efficiency of a Natural Bacterial Community.

    PubMed

    Lezcano, María Ángeles; Morón-López, Jesús; Agha, Ramsy; López-Heras, Isabel; Nozal, Leonor; Quesada, Antonio; El-Shehawy, Rehab

    2016-11-03

    The microcystin biodegradation potential of a natural bacterial community coexisting with a toxic cyanobacterial bloom was investigated in a water reservoir from central Spain. The biodegradation capacity was confirmed in all samples during the bloom and an increase of mlr A gene copies was found with increasing microcystin concentrations. Among the 24 microcystin degrading strains isolated from the bacterial community, only 28% showed presence of mlr A gene, strongly supporting the existence and abundance of alternative microcystin degradation pathways in nature. In vitro degradation assays with both mlr ⁺ and mlr - bacterial genotypes (with presence and absence of the complete mlr gene cluster, respectively) were performed with four isolated strains ( Sphingopyxis sp. IM-1, IM-2 and IM-3; Paucibacter toxinivorans IM-4) and two bacterial degraders from the culture collection ( Sphingosinicella microcystinivorans Y2; Paucibacter toxinivorans 2C20). Differences in microcystin degradation efficiencies between genotypes were found under different total organic carbon and total nitrogen concentrations. While mlr ⁺ strains significantly improved microcystin degradation rates when exposed to other carbon and nitrogen sources, mlr - strains showed lower degradation efficiencies. This suggests that the presence of alternative carbon and nitrogen sources possibly competes with microcystins and impairs putative non- mlr microcystin degradation pathways. Considering the abundance of the mlr - bacterial population and the increasing frequency of eutrophic conditions in aquatic systems, further research on the diversity of this population and the characterization and conditions affecting non- mlr degradation pathways deserves special attention.

  1. GPo1 alkB gene expression for improvement of the degradation of diesel oil by a bacterial consortium.

    PubMed

    Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong

    2015-01-01

    To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium.

  2. GPo1 alkB gene expression for improvement of the degradation of diesel oil by a bacterial consortium

    PubMed Central

    Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong

    2015-01-01

    To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium. PMID:26413044

  3. Distinct antimicrobial peptide expression determines host species-specific bacterial associations

    PubMed Central

    Franzenburg, Sören; Walter, Jonas; Künzel, Sven; Wang, Jun; Baines, John F.; Bosch, Thomas C. G.; Fraune, Sebastian

    2013-01-01

    Animals are colonized by coevolved bacterial communities, which contribute to the host’s health. This commensal microbiota is often highly specific to its host-species, inferring strong selective pressures on the associated microbes. Several factors, including diet, mucus composition, and the immune system have been proposed as putative determinants of host-associated bacterial communities. Here we report that species-specific antimicrobial peptides account for different bacterial communities associated with closely related species of the cnidarian Hydra. Gene family extensions for potent antimicrobial peptides, the arminins, were detected in four Hydra species, with each species possessing a unique composition and expression profile of arminins. For functional analysis, we inoculated arminin-deficient and control polyps with bacterial consortia characteristic for different Hydra species and compared their selective preferences by 454 pyrosequencing of the bacterial microbiota. In contrast to control polyps, arminin-deficient polyps displayed decreased potential to select for bacterial communities resembling their native microbiota. This finding indicates that species-specific antimicrobial peptides shape species-specific bacterial associations. PMID:24003149

  4. Quantitative real time RT-PCR study of pathogen-induced gene expression in rock bream (Oplegnathus fasciatus): internal controls for data normalization.

    PubMed

    Zhang, Bao-cun; Sun, Li; Xiao, Zhi-zhong; Hu, Yong-hua

    2014-06-01

    Rock bream Oplegnathus fasciatus is an important economic fish species. In this study, we evaluated the appropriateness of six housekeeping genes as internal controls for quantitative real-time PCR (RT-qPCR) analysis of gene expression in rock bream before and after pathogen infection. The expression of the selected genes in eight tissues infected with Vibrio alginolyticus or megalocytivirus was determined by RT-qPCR, and the PCR data were analyzed with geNorm and NormFinder algorithms. The results showed that before pathogen infection, mediator of RNA polymerase II transcription subunit 8 and β-actin were ranked as the most stable genes across the examined tissues. After bacterial or viral infection, the stabilities of the housekeeping genes varied to significant extents in tissue-dependent manners, and no single pair of genes was identified as suitable references for all tissues for either of the pathogen stimuli. In addition, for the majority of tissues, the most stable genes during bacterial infection differed from those during viral infection. Nevertheless, optimum reference genes were identified for each tissue under different conditions. Taken together, these results indicate that tissue type and the nature of the infectious agent used in the study can all influence the choice of normalization factors, and that the optimum reference genes identified in this study will provide a useful guidance for the selection of internal controls in future RT-PCR study of gene expression in rock bream. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. A dual switch controls bacterial enhancer-dependent transcription

    PubMed Central

    Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

    2012-01-01

    Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

  6. Gene expression in gut symbiotic organ of stinkbug affected by extracellular bacterial symbiont.

    PubMed

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations.

  7. Rifaximin has minor effects on bacterial composition, inflammation, and bacterial translocation in cirrhosis: A randomized trial.

    PubMed

    Kimer, Nina; Pedersen, Julie S; Tavenier, Juliette; Christensen, Jeffrey E; Busk, Troels M; Hobolth, Lise; Krag, Aleksander; Al-Soud, Waleed Abu; Mortensen, Martin S; Sørensen, Søren J; Møller, Søren; Bendtsen, Flemming

    2018-01-01

    Decompensated cirrhosis is characterized by disturbed hemodynamics, immune dysfunction, and high risk of infections. Translocation of viable bacteria and bacterial products from the gut to the blood is considered a key driver in this process. Intestinal decontamination with rifaximin may reduce bacterial translocation (BT) and decrease inflammation. A randomized, placebo-controlled trial investigated the effects of rifaximin on inflammation and BT in decompensated cirrhosis. Fifty-four out-patients with cirrhosis and ascites were randomized, mean age 56 years (± 8.4), and model for end-stage liver disease score 12 (± 3.9). Patients received rifaximin 550-mg BD (n = 36) or placebo BD (n = 18). Blood and fecal (n = 15) sampling were conducted at baseline and after 4 weeks. Bacterial DNA in blood was determined by real-time qPCR 16S rRNA gene quantification. Bacterial composition in feces was analyzed by 16S rRNA gene sequencing. Circulating markers of inflammation, including tumor necrosis factor alpha, interleukins 6, 10, and 18, stromal cell-derived factor 1-α, transforming growth factor β-1, and high sensitivity C-reactive protein, were unaltered by rifaximin treatment. Rifaximin altered abundance of bacterial taxa in blood marginally, only a decrease in Pseudomonadales was observed. In feces, rifaximin decreased bacterial richness, but effect on particular species was not observed. Subgroup analyses on patients with severely disturbed hemodynamics (n = 34) or activated lipopolysaccharide binding protein (n = 37) revealed no effect of rifaximin. Four weeks of treatment with rifaximin had no impact on the inflammatory state and only minor effects on BT and intestinal bacterial composition in stable, decompensated cirrhosis (NCT01769040). © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  8. Bacterial community succession during in situ uranium bioremediation: spatial similarities along controlled flow paths.

    PubMed

    Hwang, Chiachi; Wu, Weimin; Gentry, Terry J; Carley, Jack; Corbin, Gail A; Carroll, Sue L; Watson, David B; Jardine, Phil M; Zhou, Jizhong; Criddle, Craig S; Fields, Matthew W

    2009-01-01

    Bacterial community succession was investigated in a field-scale subsurface reactor formed by a series of wells that received weekly ethanol additions to re-circulating groundwater. Ethanol additions stimulated denitrification, metal reduction, sulfate reduction and U(VI) reduction to sparingly soluble U(IV). Clone libraries of SSU rRNA gene sequences from groundwater samples enabled tracking of spatial and temporal changes over a 1.5-year period. Analyses showed that the communities changed in a manner consistent with geochemical variations that occurred along temporal and spatial scales. Canonical correspondence analysis revealed that the levels of nitrate, uranium, sulfide, sulfate and ethanol were strongly correlated with particular bacterial populations. As sulfate and U(VI) levels declined, sequences representative of sulfate reducers and metal reducers were detected at high levels. Ultimately, sequences associated with sulfate-reducing populations predominated, and sulfate levels declined as U(VI) remained at low levels. When engineering controls were compared with the population variation through canonical ordination, changes could be related to dissolved oxygen control and ethanol addition. The data also indicated that the indigenous populations responded differently to stimulation for bioreduction; however, the two biostimulated communities became more similar after different transitions in an idiosyncratic manner. The strong associations between particular environmental variables and certain populations provide insight into the establishment of practical and successful remediation strategies in radionuclide-contaminated environments with respect to engineering controls and microbial ecology.

  9. Genome-wide selective sweeps and gene-specific sweeps in natural bacterial populations

    DOE PAGES

    Bendall, Matthew L.; Stevens, Sarah L.R.; Chan, Leong-Keat; ...

    2016-01-08

    Multiple models describe the formation and evolution of distinct microbial phylogenetic groups. These evolutionary models make different predictions regarding how adaptive alleles spread through populations and how genetic diversity is maintained. Processes predicted by competing evolutionary models, for example, genome-wide selective sweeps vs gene-specific sweeps, could be captured in natural populations using time-series metagenomics if the approach were applied over a sufficiently long time frame. Direct observations of either process would help resolve how distinct microbial groups evolve. Using a 9-year metagenomic study of a freshwater lake (2005–2013), we explore changes in single-nucleotide polymorphism (SNP) frequencies and patterns of genemore » gain and loss in 30 bacterial populations. SNP analyses revealed substantial genetic heterogeneity within these populations, although the degree of heterogeneity varied by >1000-fold among populations. SNP allele frequencies also changed dramatically over time within some populations. Interestingly, nearly all SNP variants were slowly purged over several years from one population of green sulfur bacteria, while at the same time multiple genes either swept through or were lost from this population. Furthermore, these patterns were consistent with a genome-wide selective sweep in progress, a process predicted by the ‘ecotype model’ of speciation but not previously observed in nature. In contrast, other populations contained large, SNP-free genomic regions that appear to have swept independently through the populations prior to the study without purging diversity elsewhere in the genome. Finally, evidence for both genome-wide and gene-specific sweeps suggests that different models of bacterial speciation may apply to different populations coexisting in the same environment.« less

  10. Bacterial ice crystal controlling proteins.

    PubMed

    Lorv, Janet S H; Rose, David R; Glick, Bernard R

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions.

  11. Both msa genes in Renibacterium salmoninarum are needed for full virulence in bacterial kidney disease

    USGS Publications Warehouse

    Coady, A.M.; Murray, A.L.; Elliott, D.G.; Rhodes, L.D.

    2006-01-01

    Renibacterium salmoninarum, a gram-positive diplococcobacillus that causes bacterial kidney disease among salmon and trout, has two chromosomal loci encoding the major soluble antigen (msa) gene. Because the MSA protein is widely suspected to be an important virulence factor, we used insertion-duplication mutagenesis to generate disruptions of either the msa1 or msa2 gene. Surprisingly, expression of MSA protein in broth cultures appeared unaffected. However, the virulence of either mutant in juvenile Chinook salmon (Oncorhynchus tshawytscha) by intraperitoneal challenge was severely attenuated, suggesting that disruption of the msa1 or msa2 gene affected in vivo expression. Copyright ?? 2006, American Society for Microbiology. All Rights Reserved.

  12. Different impacts of manure and chemical fertilizers on bacterial community structure and antibiotic resistance genes in arable soils.

    PubMed

    Liu, Peng; Jia, Shuyu; He, Xiwei; Zhang, Xuxiang; Ye, Lin

    2017-12-01

    Both manure and chemical fertilizers are widely used in modern agriculture. However, the impacts of different fertilizers on bacterial community structure and antibiotic resistance genes (ARGs) in arable soils still remain unclear. In this study, high-throughput sequencing and quantitative PCR were employed to investigate the bacterial community structure, ARGs and mobile genetic elements (MGEs) influenced by the application of different fertilizers, including chemical fertilizers, piggery manure and straw ash. The results showed that the application of fertilizers could significantly change the soil bacterial community and the abundance of Gaiella under phylum Actinobacteria was significantly reduced from 12.9% in unfertilized soil to 4.1%-7.4% in fertilized soil (P < 0.05). It was also found that the application of manure could cause a transient effect on soil resistome composition and the relative abundance of ARGs increased from 7.37 ppm to 32.10 ppm. The abundance of aminoglycoside, sulfonamide and tetracycline resistance genes greatly increased after manure fertilization and then gradually returned to normal levels with the decay of some intestinal bacteria carrying ARGs. In contrast, the application of chemical fertilizers and straw ash significantly changed the bacterial community structure but exerted little effect on soil resistome. Overall, the results of this study illustrated the different effects of different fertilizers on the soil resistome and revealed that the changes of soil resistome induced by manure application mainly resulted from alteration of bacteria community rather than the horizontal gene transfer. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians.

    PubMed

    Newmark, Phillip A; Reddien, Peter W; Cebrià, Francesc; Sánchez Alvarado, Alejandro

    2003-09-30

    Freshwater planarian flatworms are capable of regenerating complete organisms from tiny fragments of their bodies; the basis for this regenerative prowess is an experimentally accessible stem cell population that is present in the adult planarian. The study of these organisms, classic experimental models for investigating metazoan regeneration, has been revitalized by the application of modern molecular biological approaches. The identification of thousands of unique planarian ESTs, coupled with large-scale whole-mount in situ hybridization screens, and the ability to inhibit planarian gene expression through double-stranded RNA-mediated genetic interference, provide a wealth of tools for studying the molecular mechanisms that regulate tissue regeneration and stem cell biology in these organisms. Here we show that, as in Caenorhabditis elegans, ingestion of bacterially expressed double-stranded RNA can inhibit gene expression in planarians. This inhibition persists throughout the process of regeneration, allowing phenotypes with disrupted regenerative patterning to be identified. These results pave the way for large-scale screens for genes involved in regenerative processes.

  14. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

    PubMed

    Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

    2015-10-27

    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

  15. Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

    PubMed

    Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

    2017-06-01

    Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

  16. Using Bacterial Extract along with Differential Gene Expression in Acropora millepora Larvae to Decouple the Processes of Attachment and Metamorphosis

    PubMed Central

    Siboni, Nachshon; Abrego, David; Seneca, Francois; Motti, Cherie A.; Andreakis, Nikos; Tebben, Jan; Blackall, Linda L.; Harder, Tilmann

    2012-01-01

    Biofilms of the bacterium Pseudoalteromonas induce metamorphosis of acroporid coral larvae. The bacterial metabolite tetrabromopyrrole (TBP), isolated from an extract of Pseudoalteromonas sp. associated with the crustose coralline alga (CCA) Neogoniolithon fosliei, induced coral larval metamorphosis (100%) with little or no attachment (0–2%). To better understand the molecular events and mechanisms underpinning the induction of Acropora millepora larval metamorphosis, including cell proliferation, apoptosis, differentiation, migration, adhesion and biomineralisation, two novel coral gene expression assays were implemented. These involved the use of reverse-transcriptase quantitative PCR (RT-qPCR) and employed 47 genes of interest (GOI), selected based on putative roles in the processes of settlement and metamorphosis. Substantial differences in transcriptomic responses of GOI were detected following incubation of A. millepora larvae with a threshold concentration and 10-fold elevated concentration of TBP-containing extracts of Pseudoalteromonas sp. The notable and relatively abrupt changes of the larval body structure during metamorphosis correlated, at the molecular level, with significant differences (p<0.05) in gene expression profiles of 24 GOI, 12 hours post exposure. Fourteen of those GOI also presented differences in expression (p<0.05) following exposure to the threshold concentration of bacterial TBP-containing extract. The specificity of the bacterial TBP-containing extract to induce the metamorphic stage in A. millepora larvae without attachment, using a robust, low cost, accurate, ecologically relevant and highly reproducible RT-qPCR assay, allowed partially decoupling of the transcriptomic processes of attachment and metamorphosis. The bacterial TBP-containing extract provided a unique opportunity to monitor the regulation of genes exclusively involved in the process of metamorphosis, contrasting previous gene expression studies that utilized cues

  17. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  18. The plant pathogenic fungus Gaeumannomyces graminis var. tritici improves bacterial growth and triggers early gene regulations in the biocontrol strain Pseudomonas fluorescens Pf29Arp.

    PubMed

    Barret, M; Frey-Klett, P; Boutin, M; Guillerm-Erckelboudt, A-Y; Martin, F; Guillot, L; Sarniguet, A

    2009-01-01

    In soil, some antagonistic rhizobacteria contribute to reduce root diseases caused by phytopathogenic fungi. Direct modes of action of these bacteria have been largely explored; however, commensal interaction also takes place between these microorganisms and little is known about the influence of filamentous fungi on bacteria. An in vitro confrontation bioassay between the pathogenic fungus Gaeumannomyces graminis var. tritici (Ggt) and the biocontrol bacterial strain Pseudomonas fluorescens Pf29Arp was set up to analyse bacterial transcriptional changes induced by the fungal mycelium at three time-points of the interaction before cell contact and up until contact. For this, a Pf29Arp shotgun DNA microarray was constructed. Specifity of Ggt effect was assessed in comparison with one of two other filamentous fungi, Laccaria bicolor and Magnaporthe grisea. During a commensal interaction, Ggt increased the growth rate of Pf29Arp. Before contact, Ggt induced bacterial genes involved in mycelium colonization. At contact, genes encoding protein of stress response and a patatin-like protein were up-regulated. Among all the bacterial genes identified, xseB was specifically up-regulated at contact by Ggt but down-regulated by the other fungi. Data showed that the bacterium sensed the presence of the fungus early, but the main gene alteration occurred during bacterial-fungal cell contact.

  19. Bacterial sex in dental plaque.

    PubMed

    Olsen, Ingar; Tribble, Gena D; Fiehn, Nils-Erik; Wang, Bing-Yan

    2013-01-01

    Genes are transferred between bacteria in dental plaque by transduction, conjugation, and transformation. Membrane vesicles can also provide a mechanism for horizontal gene transfer. DNA transfer is considered bacterial sex, but the transfer is not parallel to processes that we associate with sex in higher organisms. Several examples of bacterial gene transfer in the oral cavity are given in this review. How frequently this occurs in dental plaque is not clear, but evidence suggests that it affects a number of the major genera present. It has been estimated that new sequences in genomes established through horizontal gene transfer can constitute up to 30% of bacterial genomes. Gene transfer can be both inter- and intrageneric, and it can also affect transient organisms. The transferred DNA can be integrated or recombined in the recipient's chromosome or remain as an extrachromosomal inheritable element. This can make dental plaque a reservoir for antimicrobial resistance genes. The ability to transfer DNA is important for bacteria, making them better adapted to the harsh environment of the human mouth, and promoting their survival, virulence, and pathogenicity.

  20. Sulfamethoxazole and COD increase abundance of sulfonamide resistance genes and change bacterial community structures within sequencing batch reactors.

    PubMed

    Guo, Xueping; Pang, Weihai; Dou, Chunling; Yin, Daqiang

    2017-05-01

    The abundant microbial community in biological treatment processes in wastewater treatment plants (WWTPs) may potentially enhance the horizontal gene transfer of antibiotic resistance genes with the presence of antibiotics. A lab-scale sequencing batch reactor was designed to investigate response of sulfonamide resistance genes (sulI, sulII) and bacterial communities to various concentrations of sulfamethoxazole (SMX) and chemical oxygen demand (COD) of wastewater. The SMX concentrations (0.001 mg/L, 0.1 mg/L and 10 mg/L) decreased with treatment time and higher SMX level was more difficult to remove. The presence of SMX also significantly reduced the removal efficiency of ammonia nitrogen, affecting the normal function of WWTPs. All three concentrations of SMX raised both sulI and sulII genes with higher concentrations exhibiting greater increases. The abundance of sul genes was positive correlated with treatment time and followed the second-order reaction kinetic model. Interestingly, these two genes have rather similar activity. SulI and sulII gene abundance also performed similar response to COD. Simpson index and Shannon-Weiner index did not show changes in the microbial community diversity. However, the 16S rRNA gene cloning and sequencing results showed the bacterial community structures varied during different stages. The results demonstrated that influent antibiotics into WWTPs may facilitate selection of ARGs and affect the wastewater conventional treatment as well as the bacteria community structures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Analysis of bacterial xylose isomerase gene diversity using gene-targeted metagenomics.

    PubMed

    Nurdiani, Dini; Ito, Michihiro; Maruyama, Toru; Terahara, Takeshi; Mori, Tetsushi; Ugawa, Shin; Takeyama, Haruko

    2015-08-01

    Bacterial xylose isomerases (XI) are promising resources for efficient biofuel production from xylose in lignocellulosic biomass. Here, we investigated xylose isomerase gene (xylA) diversity in three soil metagenomes differing in plant vegetation and geographical location, using an amplicon pyrosequencing approach and two newly-designed primer sets. A total of 158,555 reads from three metagenomic DNA replicates for each soil sample were classified into 1127 phylotypes, detected in triplicate and defined by 90% amino acid identity. The phylotype coverage was estimated to be within the range of 84.0-92.7%. The xylA gene phylotypes obtained were phylogenetically distributed across the two known xylA groups. They shared 49-100% identities with their closest-related XI sequences in GenBank. Phylotypes demonstrating <90% identity with known XIs in the database accounted for 89% of the total xylA phylotypes. The differences among xylA members and compositions within each soil sample were significantly smaller than they were between different soils based on a UniFrac distance analysis, suggesting soil-specific xylA genotypes and taxonomic compositions. The differences among xylA members and their compositions in the soil were strongly correlated with 16S rRNA variation between soil samples, also assessed by amplicon pyrosequencing. This is the first report of xylA diversity in environmental samples assessed by amplicon pyrosequencing. Our data provide information regarding xylA diversity in nature, and can be a basis for the screening of novel xylA genotypes for practical applications. Copyright © 2015. Published by Elsevier B.V.

  2. Dynamics of fecal indicator bacteria, bacterial pathogen genes, and organic wastewater contaminants in the Little Calumet River: Portage Burns Waterway, Indiana

    USGS Publications Warehouse

    Haack, Sheridan K.; Duris, Joseph W.

    2013-01-01

    Little information exists on the co-occurrence of fecal indicator bacteria (FIB), bacterial pathogens, and organic wastewater-associated chemicals (OWCs) within Great Lakes tributaries. Fifteen watershed sites and one beach site adjacent to the Little Calumet River–Portage Burns Waterway (LCRPBW) on Lake Michigan were tested on four dates for pH, dissolved oxygen, specific conductance, chloride, color, ammonia- and nitrate-nitrogen, soluble phosphorus, sulfate, turbidity, and atrazine; for concentrations of FIB; and for genes indicating the presence of human-pathogenic enterococci (ENT) and of Shiga-toxin producing Escherichia coli (EC) from various animal sources. Nineteen samples were also tested for 60 OWCs. Half of the watershed samples met EC recreational water quality standards; none met ENT standards. Human-wastewater-associated OWC detections were correlated with human-influence indicators such as population/km2, chloride concentrations, and the presence of WWTP effluents, but EC and ENT concentrations were not. Bacterial pathogen genes indicated rural human and several potential animal sources. OWCs of human or ecosystem health concern (musk fragrances AHTN and HHCB, alkylphenols, carbamazepine) and 3 bacterial pathogen genes were detected at the mouth of the LCRPBW, but no such OWCs and only 1 pathogen gene were detected at the beach. The LCRPBW has significant potential to deliver FIB, potential bacterial pathogens, and OWCs of human or ecosystem health concern to the nearshore of Lake Michigan, under conditions enhancing nearshore transport of the river plume. Nearshore mixing of lake and river water, and the lack of relationship between OWCs and FIB or pathogen genes, pose numerous challenges for watershed and nearshore assessment and remediation.

  3. Selected Lactic Acid-Producing Bacterial Isolates with the Capacity to Reduce Salmonella Translocation and Virulence Gene Expression in Chickens

    PubMed Central

    Yang, Xiaojian; Brisbin, Jennifer; Yu, Hai; Wang, Qi; Yin, Fugui; Zhang, Yonggang; Sabour, Parviz; Sharif, Shayan; Gong, Joshua

    2014-01-01

    Background Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB) isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. Methodology/Principal Findings In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0) and high bile salt (0.3–1.5%) and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (106–7 CFU/chick) or phosphate-buffered saline (PBS) at 1 day of age followed by Salmonella challenge (104 CFU/chick) next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1). These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures) were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10) in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. Conclusions/Significance The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in vivo can be one

  4. Selected lactic acid-producing bacterial isolates with the capacity to reduce Salmonella translocation and virulence gene expression in chickens.

    PubMed

    Yang, Xiaojian; Brisbin, Jennifer; Yu, Hai; Wang, Qi; Yin, Fugui; Zhang, Yonggang; Sabour, Parviz; Sharif, Shayan; Gong, Joshua

    2014-01-01

    Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB) isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0) and high bile salt (0.3-1.5%) and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (10(6-7) CFU/chick) or phosphate-buffered saline (PBS) at 1 day of age followed by Salmonella challenge (10(4) CFU/chick) next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1). These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures) were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10) in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in vivo can be one of the strategies for controlling Salmonella infection in chickens.

  5. Bacterial genes mutL, mutS, and dcm participate in repair of mismatches at 5-methylcytosine sites.

    PubMed Central

    Lieb, M

    1987-01-01

    Certain amber mutations in the cI gene of bacteriophage lambda appear to recombine very frequently with nearby mutations. The aberrant mutations included C-to-T transitions at the second cytosine in 5'CC(A/T)GG sequences (which are subject to methylation by bacterial cytosine methylase) and in 5'CCAG and 5'CAGG sequences. Excess cI+ recombinants arising in crosses that utilize these mutations are attributable to the correction of mismatches by a bacterial very-short-patch (VSP) mismatch repair system. In the present study I found that two genes required for methyladenine-directed (long-patch) mismatch repair, mutL and mutS, also functioned in VSP mismatch repair; mutH and mutU (uvrD) were dispensable. VSP mismatch repair was greatly reduced in a dcm Escherichia coli mutant, in which 5-methylcytosine was not methylated. However, mismatches in heteroduplexes prepared from lambda DNA lacking 5-methylcytosine were repaired in dcm+ bacteria. These results indicate that the product of gene dcm has a repair function in addition to its methylase activity. PMID:2959653

  6. INFLUENCE OF ROOT EXUDATES AND BACTERIAL METABOLIC ACTIVITY ON APPARENT CONJUGAL GENE TRANSFER FREQUENCIES IN THE RHIZOSPHERE OF WATER GRASS (ECHINOCLORA CRUSGALLI)

    EPA Science Inventory

    The premise that genetic exchange is primarily localized in niches characterized by dense bacterial populations and high availability of growth substrates was tested by relating conjugal gene transfer of an RP4 derivative to availability of root exudates and bacterial metabolic a...

  7. Variable effects of oxytetracycline on antibiotic resistance gene abundance and the bacterial community during aerobic composting of cow manure.

    PubMed

    Qian, Xun; Sun, Wei; Gu, Jie; Wang, Xiao-Juan; Sun, Jia-Jun; Yin, Ya-Nan; Duan, Man-Li

    2016-09-05

    Livestock manure is often subjected to aerobic composting but little is known about the variation in antibiotic resistance genes (ARGs) during the composting process under different concentrations of antibiotics. This study compared the effects of three concentrations of oxytetracycline (OTC; 10, 60, and 200mg/kg) on ARGs and the succession of the bacterial community during composting. Very similar trends were observed in the relative abundances (RAs) of each ARG among the OTC treatments and the control during composting. After composting, the RAs of tetC, tetX, sul1, sul2, and intI1 increased 2-43 times, whereas those of tetQ, tetM, and tetW declined by 44-99%. OTC addition significantly increased the absolute abundances and RAs of tetC and intI1, while 200mg/kg OTC also enhanced those of tetM, tetQ, and drfA7. The bacterial community could be grouped according to the composting time under different treatments. The highest concentration of OTC had a more persistent effect on the bacterial community. In the present study, the succession of the bacterial community appeared to have a greater influence on the variation of ARGs during composting than the presence of antibiotics. Aerobic composting was not effective in reducing most of the ARGs, and thus the compost product should be considered as an important reservoir for ARGs. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Bacterial Ice Crystal Controlling Proteins

    PubMed Central

    Lorv, Janet S. H.; Rose, David R.; Glick, Bernard R.

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions. PMID:24579057

  9. Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

    PubMed

    Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

    2012-09-01

    Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  10. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    PubMed

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  11. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  12. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators.

  13. Variation of nonylphenol-degrading gene abundance and bacterial community structure in bioaugmented sediment microcosm.

    PubMed

    Wang, Zhao; Yang, Yuyin; Sun, Weimin; Dai, Yu; Xie, Shuguang

    2015-02-01

    Nonylphenol (NP) can accumulate in river sediment. Bioaugmentation is an attractive option to dissipate heavy NP pollution in river sediment. In this study, two NP degraders were isolated from crude oil-polluted soil and river sediment. Microcosms were constructed to test their ability to degrade NP in river sediment. The shift in the proportion of NP-degrading genes and bacterial community structure in sediment microcosms were characterized using quantitative PCR assay and terminal restriction fragment length polymorphism analysis, respectively. Phylogenetic analysis indicated that the soil isolate belonged to genus Stenotrophomonas, while the sediment isolate was a Sphingobium species. Both of them could almost completely clean up a high level of NP in river sediment (150 mg/kg NP) in 10 or 14 days after inoculation. An increase in the proportion of alkB and sMO genes was observed in sediment microcosms inoculated with Stenotrophomonas strain Y1 and Sphingobium strain Y2, respectively. Moreover, bioaugmentation using Sphingobium strain Y2 could have a strong impact on sediment bacterial community structure, while inoculation of Stenotrophomonas strain Y1 illustrated a weak impact. This study can provide some new insights towards NP biodegradation and bioremediation.

  14. Gene Expression in Gut Symbiotic Organ of Stinkbug Affected by Extracellular Bacterial Symbiont

    PubMed Central

    Futahashi, Ryo; Tanaka, Kohjiro; Tanahashi, Masahiko; Nikoh, Naruo; Kikuchi, Yoshitomo; Lee, Bok Luel; Fukatsu, Takema

    2013-01-01

    The bean bug Riptortus pedestris possesses a specialized symbiotic organ in a posterior region of the midgut, where numerous crypts harbor extracellular betaproteobacterial symbionts of the genus Burkholderia. Second instar nymphs orally acquire the symbiont from the environment, and the symbiont infection benefits the host by facilitating growth and by occasionally conferring insecticide resistance. Here we performed comparative transcriptomic analyses of insect genes expressed in symbiotic and non-symbiotic regions of the midgut dissected from Burkholderia-infected and uninfected R. pedestris. Expression sequence tag analysis of cDNA libraries and quantitative reverse transcription PCR identified a number of insect genes expressed in symbiosis- or aposymbiosis-associated patterns. For example, genes up-regulated in symbiotic relative to aposymbiotic individuals, including many cysteine-rich secreted protein genes and many cathepsin protease genes, are likely to play a role in regulating the symbiosis. Conversely, genes up-regulated in aposymbiotic relative to symbiotic individuals, including a chicken-type lysozyme gene and a defensin-like protein gene, are possibly involved in regulation of non-symbiotic bacterial infections. Our study presents the first transcriptomic data on gut symbiotic organ of a stinkbug, which provides initial clues to understanding of molecular mechanisms underlying the insect-bacterium gut symbiosis and sheds light on several intriguing commonalities between endocellular and extracellular symbiotic associations. PMID:23691247

  15. A Host-Produced Autoinducer-2 Mimic Activates Bacterial Quorum Sensing.

    PubMed

    Ismail, Anisa S; Valastyan, Julie S; Bassler, Bonnie L

    2016-04-13

    Host-microbial symbioses are vital to health; nonetheless, little is known about the role crosskingdom signaling plays in these relationships. In a process called quorum sensing, bacteria communicate with one another using extracellular signal molecules called autoinducers. One autoinducer, AI-2, is proposed to promote interspecies bacterial communication, including in the mammalian gut. We show that mammalian epithelia produce an AI-2 mimic activity in response to bacteria or tight-junction disruption. This AI-2 mimic is detected by the bacterial AI-2 receptor, LuxP/LsrB, and can activate quorum-sensing-controlled gene expression, including in the enteric pathogen Salmonella typhimurium. AI-2 mimic activity is induced when epithelia are directly or indirectly exposed to bacteria, suggesting that a secreted bacterial component(s) stimulates its production. Mutagenesis revealed genes required for bacteria to both detect and stimulate production of the AI-2 mimic. These findings uncover a potential role for the mammalian AI-2 mimic in fostering crosskingdom signaling and host-bacterial symbioses. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere

    PubMed Central

    Matilla, Miguel A; Espinosa-Urgel, Manuel; Rodríguez-Herva, José J; Ramos, Juan L; Ramos-González, María Isabel

    2007-01-01

    Background Mutualistic interactions less well known than those between rhizobia and legumes are commonly found between plants and bacteria, frequently pseudomonads, which colonize roots and adjacent soil areas (the rhizosphere). Results A global analysis of Pseudomonas putida genes expressed during their interaction with maize roots revealed how a bacterial population adjusts its genetic program to this lifestyle. Differentially expressed genes were identified by comparing rhizosphere-colonizing populations with three distinct controls covering a variety of nutrients, growth phases and life styles (planktonic and sessile). Ninety rhizosphere up-regulated (rup) genes, which were induced relative to all three controls, were identified, whereas there was no repressed gene in common between the experiments. Genes involved in amino acid uptake and metabolism of aromatic compounds were preferentially expressed in the rhizosphere, which reflects the availability of particular nutrients in root exudates. The induction of efflux pumps and enzymes for glutathione metabolism indicates that adaptation to adverse conditions and stress (oxidative) response are crucial for bacterial life in this environment. The finding of a GGDEF/EAL domain response regulator among the induced genes suggests a role for the turnover of the secondary messenger c-diGMP in root colonization. Several mutants in rup genes showed reduced fitness in competitive root colonization. Conclusion Our results show the importance of two selective forces of different nature to colonize the rhizosphere: stress adaptation and availability of particular nutrients. We also identify new traits conferring bacterial survival in this niche and open a way to the characterization of specific signalling and regulatory processes governing the plant-Pseudomonas association. PMID:17784941

  17. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

    PubMed

    Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

    2005-04-15

    The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

  18. {open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlueter, K.; Fuetterer, J.; Potrykus, I.

    1995-10-01

    The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, andmore » revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.« less

  19. Conserved gene clusters in bacterial genomes provide further support for the primacy of RNA

    NASA Technical Reports Server (NTRS)

    Siefert, J. L.; Martin, K. A.; Abdi, F.; Widger, W. R.; Fox, G. E.

    1997-01-01

    Five complete bacterial genome sequences have been released to the scientific community. These include four (eu)Bacteria, Haemophilus influenzae, Mycoplasma genitalium, M. pneumoniae, and Synechocystis PCC 6803, as well as one Archaeon, Methanococcus jannaschii. Features of organization shared by these genomes are likely to have arisen very early in the history of the bacteria and thus can be expected to provide further insight into the nature of early ancestors. Results of a genome comparison of these five organisms confirm earlier observations that gene order is remarkably unpreserved. There are, nevertheless, at least 16 clusters of two or more genes whose order remains the same among the four (eu)Bacteria and these are presumed to reflect conserved elements of coordinated gene expression that require gene proximity. Eight of these gene orders are essentially conserved in the Archaea as well. Many of these clusters are known to be regulated by RNA-level mechanisms in Escherichia coli, which supports the earlier suggestion that this type of regulation of gene expression may have arisen very early. We conclude that although the last common ancestor may have had a DNA genome, it likely was preceded by progenotes with an RNA genome.

  20. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    PubMed Central

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  1. Copy Number Variation of the Beta Defensin Gene Cluster on Chromosome 8p Influences the Bacterial Microbiota within the Nasopharynx of Otitis-Prone Children

    PubMed Central

    Bevins, Charles L.; Hollox, Edward J.; Bakaletz, Lauren O.

    2014-01-01

    As there is increasing evidence that aberrant defensin expression is related to susceptibility for infectious disease and inflammatory disorders, we sought to determine if copy number of the beta-defensin gene cluster located on chromosome 8p23.1 (DEFB107, 106, 105, 104, 103, DEFB4 and SPAG11), that shows copy number variation as a block, was associated with susceptibility to otitis media (OM). The gene DEFB103 within this complex encodes human beta defensin-3 (hBD-3), an antimicrobial peptide (AP) expressed by epithelial cells that line the mammalian airway, important for defense of mucosal surfaces and previously shown to have bactericidal activity in vitro against multiple human pathogens, including the three that predominate in OM. To this end, we conducted a retrospective case-control study of 113 OM prone children and 267 controls aged five to sixty months. We identified the copy number of the above defined beta-defensin gene cluster (DEFB-CN) in each study subject by paralogue ratio assays. The mean DEFB-CN was indistinguishable between subjects classified as OM prone based on a recent history of multiple episodes of OM and control subjects who had no history of OM (4.4±0.96 versus 4.4±1.08, respectively: Odds Ratio [OR]: 1.16 (95% CI: 0.61, 2.20). Despite a lack of direct association, we observed a statistically significant correlation between DEFB-CN and nasopharyngeal bacterial colonization patterns. Collectively, our findings suggested that susceptibility to OM might be mediated by genetic variation among individuals, wherein a DEFB-CN less than 4 exerts a marked influence on the microbiota of the nasopharynx, specifically with regard to colonization by the three predominant bacterial pathogens of OM. PMID:24867293

  2. Identification of a new steroid degrading bacterial strain H5 from the Baltic Sea and isolation of two estradiol inducible genes.

    PubMed

    Sang, Yingying; Xiong, Guangming; Maser, Edmund

    2012-03-01

    The presence of steroid hormones in the aquatic environment is potentially threatening the population dynamics of all kinds of sea animals and public health. Environmental estrogens in water have been reported to be associated with abnormal sexual development and abnormal feminizing responses in some animals. New approaches for the bioremediation of steroid hormones from the environment are therefore urgently sought. We have previously isolated a steroid degrading bacterial strain (H5) from the Baltic Sea, at Kiel, Germany. In the present investigation, 16S rRNA analysis showed that marine strain H5 belongs to the genus Vibrio, family Vibrionaceae and class Gamma-Proteobacteria. To enable identification of steroid inducible genes from bacterial strain H5, a library was constructed of H5 chromosomal DNA fragments cloned into a fluorescent reporter (pKEGFP-2). A reporter plasmid pK3α-4.6-EGFP3 containing the estrogen-inducible gene 3α-hydroxysteroid dehydrogenase/carbonyl reductase (3α-HSD/CR) from Comamonas testosteroni (C. testosteroni) was created as a positive control. Steroid induction could be detected by a microplate fluorescence reader, when the plasmids were transformed into Escherichia coli (E. coli) HB101 cells. With our meta-genomic pKEGFP-2 approach, we identified two estradiol-inducible genes from marine strain H5, which are obviously involved in steroid degradation. Sequencing of the pKEGFP-2 inserts and data base research at NCBI revealed that one gene corresponds to 3-ketosteroid-delta-1-dehydrogenase from several Mycobacterium strains, while the other showed high similarity to carboxylesterase in Sebadella termitidis and Brachyspira murdochii. Both 3-ketosteroid-delta-1-dehydrogenase and carboxylesterase are one of the first enzymes in steroid degradation. In addition, we identified a strain H5 specific DNA sequence of 480bp which allows sensitive PCR detection and quantification of strain H5 bacteria in "unknown" seawater samples. Currently, the

  3. Conventional and nonconventional strategies for controlling bacterial contamination in fuel ethanol fermentations.

    PubMed

    Ceccato-Antonini, Sandra Regina

    2018-05-25

    Ethanol bio-production in Brazil has some unique characteristics that inevitably lead to bacterial contamination, which results in the production of organic acids and biofilms and flocculation that impair the fermentation yield by affecting yeast viability and diverting sugars to metabolites other than ethanol. The ethanol-producing units commonly give an acid treatment to the cells after each fermentative cycle to decrease the bacterial number, which is not always effective. An alternative strategy must be employed to avoid bacterial multiplication but must be compatible with economic, health and environmental aspects. This review analyzes the issue of bacterial contamination in sugarcane-based fuel ethanol fermentation, and the potential strategies that may be utilized to control bacterial growth besides acid treatment and antibiotics. We have emphasized the efficiency and suitability of chemical products other than acids and those derived from natural sources in industrial conditions. In addition, we have also presented bacteriocins, bacteriophages, and beneficial bacteria as non-conventional antimicrobial agents to mitigate bacterial contamination in the bioethanol industry.

  4. Influence of prophylactic probiotics and selective decontamination on bacterial translocation in patients undergoing pancreatic surgery: a randomized controlled trial.

    PubMed

    Diepenhorst, Gwendolyn M P; van Ruler, Oddeke; Besselink, Marc G H; van Santvoort, Hjalmar C; Wijnandts, Paul R; Renooij, Willem; Gouma, Dirk J; Gooszen, Hein G; Boermeester, Marja A

    2011-01-01

    Bacterial translocation (BT) is suspected to play a major role in the development of infections in surgical patients. However, the clinical association between intestinal barrier dysfunction, BT, and septic morbidity has remained unconfirmed. The objective of this study was to study BT in patients undergoing major abdominal surgery and the effects of probiotics, selective decontamination of the digestive tract (SDD), and standard treatment on intestinal barrier function. In a randomized controlled setting, 30 consecutive patients planned for elective pylorus-preserving pancreaticoduodenectomy (PPPD) were allocated to receive perioperatively probiotics, SDD, or standard treatment. To assess intestinal barrier function, intestinal fatty acid-binding protein (mucosal damage) and polyethylene glycol recovery (intestinal permeability) in urine were measured perioperatively. BT was assessed by real-time polymerase chain reaction and multiplex ligation-dependent probe amplification (MLPA) in mesenteric lymph nodes (MLNs) harvested early (baseline control) and at the end of surgery ("end-of-surgery" MLNs, after 3h in PPPD patients). Polymerase chain reaction detected bacterial DNA in 18 of 27 end-of-surgery MLNs and in 13 of 23 control MLNs (P = 0.378). Probiotics and SDD had no significant effect on the number of positive MLNs or the change in bacterial DNA during operation. Multiplex ligation-dependent probe amplification analysis showed significantly increased expression of only 4 of 30 inflammatory mediator-related genes in end-of-surgery compared with early sampled MLN (P < 0.05). Polyethylene glycol recovery was unaffected by operation, probiotics and SDD as compared with standard treatment. Intestinal fatty acid-binding protein levels were increased shortly postoperatively only in patients treated with SDD (P = 0.02). Probiotics and SDD did not influence BT, intestinal permeability, or inflammatory mediator expression. Bacterial translocation after abdominal surgery

  5. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage

    PubMed Central

    2017-01-01

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway. PMID:28826208

  6. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  7. 13. CONTROL ROOM OF GENE PUMPING STATION. CONTROL CUBICLES ARRAYED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. CONTROL ROOM OF GENE PUMPING STATION. CONTROL CUBICLES ARRAYED BEHIND MANAGER'S ART DECO-STYLE CONTROL DESK, WITH CONTROL CUBICLE 1 AT FAR RIGHT AND CONTROL CUBICLE 9 AT FAR LEFT. - Gene Pump Plant, South of Gene Wash Reservoir, 2 miles west of Whitsett Pump Plant, Parker Dam, San Bernardino County, CA

  8. Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

    PubMed

    Washington, Tracy A; Smith, Janet L; Grossman, Alan D

    2017-10-01

    DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.

  9. Transcriptional response of Musca domestica larvae to bacterial infection.

    PubMed

    Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei

    2014-01-01

    The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

  10. Genes for all metals--a bacterial view of the periodic table. The 1996 Thom Award Lecture.

    PubMed

    Silver, S

    1998-01-01

    Bacterial chromosomes have genes for transport proteins for inorganic nutrient cations and oxyanions, such as NH4+, K+, Mg2+, Co2+, Fe3+, Mn2+, Zn2+ and other trace cations, and PO4(3-), SO4(2-) and less abundant oxyanions. Together these account for perhaps a few hundred genes in many bacteria. Bacterial plasmids encode resistance systems for toxic metal and metalloid ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. Most resistance systems function by energy-dependent efflux of toxic ions. A few involve enzymatic (mostly redox) transformations. Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. The Cd(2+)-resistance cation pump of Gram-positive bacteria is membrane P-type ATPase, which has been labeled with 32P from [gamma-32P]ATP and drives ATP-dependent Cd2+ (and Zn2+) transport by membrane vesicles. The genes defective in the human hereditary diseases of copper metabolism, Menkes syndrome and Wilson's disease, encode P-type ATPases that are similar to bacterial cadmium ATPases. The arsenic resistance system transports arsenite [As(III)], alternatively with the ArsB polypeptide functioning as a chemiosmotic efflux transporter or with two polypeptides, ArsB and ArsA, functioning as an ATPase. The third protein of the arsenic resistance system is an enzyme that reduces intracellular arsenate [As(V)] to arsenite [As(III)], the substrate of the efflux system. In Gram-negative cells, a three polypeptide complex functions as a chemiosmotic cation/protein exchanger to efflux Cd2+, Zn2+ and Co2+. This pump consists of an inner membrane (CzcA), an outer membrane (CzcC) and a membrane-spanning (CzcB) protein that function together.

  11. Biomarkers and bacterial pneumonia risk in patients with treated HIV infection: a case-control study.

    PubMed

    Bjerk, Sonja M; Baker, Jason V; Emery, Sean; Neuhaus, Jacqueline; Angus, Brian; Gordin, Fred M; Pett, Sarah L; Stephan, Christoph; Kunisaki, Ken M

    2013-01-01

    Despite advances in HIV treatment, bacterial pneumonia continues to cause considerable morbidity and mortality in patients with HIV infection. Studies of biomarker associations with bacterial pneumonia risk in treated HIV-infected patients do not currently exist. We performed a nested, matched, case-control study among participants randomized to continuous combination antiretroviral therapy (cART) in the Strategies for Management of Antiretroviral Therapy trial. Patients who developed bacterial pneumonia (cases) and patients without bacterial pneumonia (controls) were matched 1∶1 on clinical center, smoking status, age, and baseline cART use. Baseline levels of Club Cell Secretory Protein 16 (CC16), Surfactant Protein D (SP-D), C-reactive protein (hsCRP), interleukin-6 (IL-6), and d-dimer were compared between cases and controls. Cases (n = 72) and controls (n = 72) were 25.7% female, 51.4% black, 65.3% current smokers, 9.7% diabetic, 36.1% co-infected with Hepatitis B/C, and 75.0% were on cART at baseline. Median (IQR) age was 45 (41, 51) years with CD4+ count of 553 (436, 690) cells/mm(3). Baseline CC16 and SP-D were similar between cases and controls, but hsCRP was significantly higher in cases than controls (2.94 µg/mL in cases vs. 1.93 µg/mL in controls; p = 0.02). IL-6 and d-dimer levels were also higher in cases compared to controls, though differences were not statistically significant (p-value 0.06 and 0.10, respectively). In patients with cART-treated HIV infection, higher levels of systemic inflammatory markers were associated with increased bacterial pneumonia risk, while two pulmonary-specific inflammatory biomarkers, CC16 and SP-D, were not associated with bacterial pneumonia risk.

  12. Biomarkers and Bacterial Pneumonia Risk in Patients with Treated HIV Infection: A Case-Control Study

    PubMed Central

    Bjerk, Sonja M.; Baker, Jason V.; Emery, Sean; Neuhaus, Jacqueline; Angus, Brian; Gordin, Fred M.; Pett, Sarah L.; Stephan, Christoph; Kunisaki, Ken M.

    2013-01-01

    Background Despite advances in HIV treatment, bacterial pneumonia continues to cause considerable morbidity and mortality in patients with HIV infection. Studies of biomarker associations with bacterial pneumonia risk in treated HIV-infected patients do not currently exist. Methods We performed a nested, matched, case-control study among participants randomized to continuous combination antiretroviral therapy (cART) in the Strategies for Management of Antiretroviral Therapy trial. Patients who developed bacterial pneumonia (cases) and patients without bacterial pneumonia (controls) were matched 1∶1 on clinical center, smoking status, age, and baseline cART use. Baseline levels of Club Cell Secretory Protein 16 (CC16), Surfactant Protein D (SP-D), C-reactive protein (hsCRP), interleukin-6 (IL-6), and d-dimer were compared between cases and controls. Results Cases (n = 72) and controls (n = 72) were 25.7% female, 51.4% black, 65.3% current smokers, 9.7% diabetic, 36.1% co-infected with Hepatitis B/C, and 75.0% were on cART at baseline. Median (IQR) age was 45 (41, 51) years with CD4+ count of 553 (436, 690) cells/mm3. Baseline CC16 and SP-D were similar between cases and controls, but hsCRP was significantly higher in cases than controls (2.94 µg/mL in cases vs. 1.93 µg/mL in controls; p = 0.02). IL-6 and d-dimer levels were also higher in cases compared to controls, though differences were not statistically significant (p-value 0.06 and 0.10, respectively). Conclusions In patients with cART-treated HIV infection, higher levels of systemic inflammatory markers were associated with increased bacterial pneumonia risk, while two pulmonary-specific inflammatory biomarkers, CC16 and SP-D, were not associated with bacterial pneumonia risk. PMID:23457535

  13. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    PubMed Central

    Bhauso, Tengale Dipak; Radhakrishnan, Thankappan; Kumar, Abhay; Mishra, Gyan Prakash; Dobaria, Jentilal Ramjibhai; Patel, Kirankumar; Rajam, Manchikatla Venkat

    2014-01-01

    In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L.) crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated. PMID:25436223

  14. Linkage of the Nit1C gene cluster to bacterial cyanide assimilation as a nitrogen source.

    PubMed

    Jones, Lauren B; Ghosh, Pallab; Lee, Jung-Hyun; Chou, Chia-Ni; Kunz, Daniel A

    2018-05-21

    A genetic linkage between a conserved gene cluster (Nit1C) and the ability of bacteria to utilize cyanide as the sole nitrogen source was demonstrated for nine different bacterial species. These included three strains whose cyanide nutritional ability has formerly been documented (Pseudomonas fluorescens Pf11764, Pseudomonas putida BCN3 and Klebsiella pneumoniae BCN33), and six not previously known to have this ability [Burkholderia (Paraburkholderia) xenovorans LB400, Paraburkholderia phymatum STM815, Paraburkholderia phytofirmans PsJN, Cupriavidus (Ralstonia) eutropha H16, Gluconoacetobacter diazotrophicus PA1 5 and Methylobacterium extorquens AM1]. For all bacteria, growth on or exposure to cyanide led to the induction of the canonical nitrilase (NitC) linked to the gene cluster, and in the case of Pf11764 in particular, transcript levels of cluster genes (nitBCDEFGH) were raised, and a nitC knock-out mutant failed to grow. Further studies demonstrated that the highly conserved nitB gene product was also significantly elevated. Collectively, these findings provide strong evidence for a genetic linkage between Nit1C and bacterial growth on cyanide, supporting use of the term cyanotrophy in describing what may represent a new nutritional paradigm in microbiology. A broader search of Nit1C genes in presently available genomes revealed its presence in 270 different bacteria, all contained within the domain Bacteria, including Gram-positive Firmicutes and Actinobacteria, and Gram-negative Proteobacteria and Cyanobacteria. Absence of the cluster in the Archaea is congruent with events that may have led to the inception of Nit1C occurring coincidentally with the first appearance of cyanogenic species on Earth, dating back 400-500 million years.

  15. Substrate Diffusion Heterogeneity Controls Bacterial Competition and Coexistence

    NASA Astrophysics Data System (ADS)

    Dechesne, A.; Or, D.; Smets, B. F.

    2005-12-01

    Diffusion has long been recognized as a key process affecting bacterial physiological functions ranging from nutrient uptake to removal of metabolic waste products. In the vadose zone, significant convective flows are limited and bacteria rely primarily on diffusion for nutrient supply. Even under relatively "wet" conditions (e.g. matric potentials -20 J/kg), soil water is fragmented and exists as thin liquid films or held in crevices imposing constraints on substrate diffusion. Our objective was to investigate the role of diffusion on soil microbial diversity, by focusing on one of the processes that shapes the structure of bacterial communities: competitive interactions. We used a simplified setup, in which the substrate (citrate) fluxes were controlled by different agar gels thicknesses and spatially heterogeneous diffusive pathways were created by an impermeable film with prescribed hole sizes and patterns. Our competition experiments involved two soil bacteria: Burkholderia xenovorans LB400 and Pseudomonas putida KT2440, which were tagged with different constitutive fluorescent markers, allowing for their on line microscopic detection. The growth parameters on citrate of these strains were thoroughly assessed. B. xenovorans LB400 is the weaker competitor. As a result, this strain was outcompeted by KT2440 under high substrate diffusivity and homogeneous conditions. Conversely, the disadvantage of the weakest competitor was not so marked under low substrate diffusivity condition. These results suggest that dry conditions in soil would provide conditions allowing the sustaining of weak bacterial competitors, resulting in the maintenance of high bacterial diversity.

  16. From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

    PubMed

    Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

    2010-01-30

    Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

  17. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    PubMed Central

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  18. PRODORIC2: the bacterial gene regulation database in 2018

    PubMed Central

    Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

    2018-01-01

    Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

  19. Towards Spectral Library-free MALDI-TOF MS Bacterial Identification.

    PubMed

    Cheng, Ding; Qiao, Liang; Horvatovich, Péter

    2018-05-11

    Bacterial identification is of great importance in clinical diagnosis, environmental monitoring and food safety control. Among various strategies, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has drawn significant interests, and has been clinically used. Nevertheless, current bioinformatics solutions use spectral libraries for the identification of bacterial strains. Spectral library generation requires acquisition of MALDI-TOF spectra from monoculture bacterial colonies, which is time-consuming and not possible for many species and strains. We propose a strategy for bacterial typing by MALDI-TOF using protein sequences from public database, i.e. UniProt. Ten genes were identified to encode proteins most often observed by MALD-TOF from bacteria through 500 times repeated a 10-fold double cross-validation procedure, using 403 MALDI-TOF spectra corresponding to 14 genera, 81 species and 403 strains, and the protein sequences of 1276 species in UniProt. The 10 genes were then used to annotate peaks on MALDI-TOF spectra of bacteria for bacterial identification. With the approach, bacteria can be identified at the genus level by searching against a database containing the protein sequences of 42 genera of bacteria from UniProt. Our approach identified 84.1% of the 403 spectra correctly at the genus level. Source code of the algorithm is available at https://github.com/dipcarbon/BacteriaMSLF.

  20. Copper control of bacterial nitrous oxide emission and its impact on vitamin B12-dependent metabolism

    PubMed Central

    Sullivan, Matthew J.; Gates, Andrew J.; Appia-Ayme, Corinne; Rowley, Gary; Richardson, David J.

    2013-01-01

    Global agricultural emissions of the greenhouse gas nitrous oxide (N2O) have increased by around 20% over the last 100 y, but regulation of these emissions and their impact on bacterial cellular metabolism are poorly understood. Denitrifying bacteria convert nitrate in soils to inert di-nitrogen gas (N2) via N2O and the biochemistry of this process has been studied extensively in Paracoccus denitrificans. Here we demonstrate that expression of the gene encoding the nitrous oxide reductase (NosZ), which converts N2O to N2, is regulated in response to the extracellular copper concentration. We show that elevated levels of N2O released as a consequence of decreased cellular NosZ activity lead to the bacterium switching from vitamin B12-dependent to vitamin B12-independent biosynthetic pathways, through the transcriptional modulation of genes controlled by vitamin B12 riboswitches. This inhibitory effect of N2O can be rescued by addition of exogenous vitamin B12. PMID:24248380

  1. Transcriptional Control of the Lateral-Flagellar Genes of Bradyrhizobium diazoefficiens.

    PubMed

    Mongiardini, Elías J; Quelas, J Ignacio; Dardis, Carolina; Althabegoiti, M Julia; Lodeiro, Aníbal R

    2017-08-01

    Bradyrhizobium diazoefficiens , a soybean N 2 -fixing symbiont, possesses a dual flagellar system comprising a constitutive subpolar flagellum and inducible lateral flagella. Here, we analyzed the genomic organization and biosynthetic regulation of the lateral-flagellar genes. We found that these genes are located in a single genomic cluster, organized in two monocistronic transcriptional units and three operons, one possibly containing an internal transcription start site. Among the monocistronic units is blr6846, homologous to the class IB master regulators of flagellum synthesis in Brucella melitensis and Ensifer meliloti and required for the expression of all the lateral-flagellar genes except lafA2 , whose locus encodes a single lateral flagellin. We therefore named blr6846 lafR ( la teral- f lagellar r egulator). Despite its similarity to two-component response regulators and its possession of a phosphorylatable Asp residue, lafR behaved as an orphan response regulator by not requiring phosphorylation at this site. Among the genes induced by lafR is flbT L , a class III regulator. We observed different requirements for FlbT L in the synthesis of each flagellin subunit. Although the accumulation of lafA1 , but not lafA2 , transcripts required FlbT L , the production of both flagellin polypeptides required FlbT L Moreover, the regulation cascade of this lateral-flagellar regulon appeared to be not as strictly ordered as those found in other bacterial species. IMPORTANCE Bacterial motility seems essential for the free-living style in the environment, and therefore these microorganisms allocate a great deal of their energetic resources to the biosynthesis and functioning of flagella. Despite energetic costs, some bacterial species possess dual flagellar systems, one of which is a primary system normally polar or subpolar, and the other is a secondary, lateral system that is produced only under special circumstances. Bradyrhizobium diazoefficiens , an N 2 -fixing

  2. Yeast Kluyveromyces lactis as host for expression of the bacterial lipase: cloning and adaptation of the new lipase gene from Serratia sp.

    PubMed

    Šiekštelė, Rimantas; Veteikytė, Aušra; Tvaska, Bronius; Matijošytė, Inga

    2015-10-01

    Many microbial lipases have been successfully expressed in yeasts, but not in industrially attractive Kluyveromyces lactis, which among other benefits can be cultivated on a medium supplemented with whey--cheap and easily available industrial waste. A new bacterial lipase from Serratia sp. was isolated and for the first time expressed into the yeast Kluyveromyces lactis by heterologous protein expression system based on a strong promoter of Kluyveromyces marxianus triosephosphate isomerase gene and signal peptide of Kluyveromyces marxianus endopolygalacturonase gene. In addition, the bacterial lipase gene was synthesized de novo by taking into account a codon usage bias optimal for K. lactis and was expressed into the yeast K. lactis also. Both resulting strains were characterized by high output level of the target protein secreted extracellularly. Secreted lipases were characterized for activity and stability.

  3. Analysis of apolipoprotein genes and their involvement in disease response of channel catfish after bacterial infection.

    PubMed

    Yang, Yujia; Fu, Qiang; Zhou, Tao; Li, Yun; Liu, Shikai; Zeng, Qifan; Wang, Xiaozhu; Jin, Yulin; Tian, Changxu; Qin, Zhenkui; Dunham, Rex; Liu, Zhanjiang

    2017-02-01

    Apolipoproteins are protein component of plasma lipoproteins. They exert crucial roles in lipoprotein metabolism and serve as enzyme cofactors, receptor ligands, and lipid transfer carriers in mammals. In teleosts, apolipoproteins are also involved in diverse processes including embryonic and ontogenic development, liver and digestive system organogenesis, and innate immunity. In this study, we identified a set of 19 apolipoprotein genes in channel catfish (Ictalurus punctatus). Phylogenetic analysis and syntenic analysis were conducted to determine their identities and evolutionary relationships. The expression signatures of apolipoproteins in channel catfish were determined in healthy tissues and after infections with two major bacterial pathogens, Edwardsiella ictaluri and Flavobacterium columnare. In healthy channel catfish, most apolipoprotein genes exhibited tissue-specific expression patterns in channel catfish. After ESC and columnaris infections, 5 and 7 apolipoprotein genes were differentially expressed respectively, which presented a pathogen-specific and time-dependent pattern of regulation. After ESC infection, three exchangeable apolipoproteins (apoA-IB, apoC-I, and apoE-B) were suppressed in catfish intestine, while two nonexchangeable apolipoproteins (apoB-A and apoB-B) were slightly up-regulated. After columnaris infection, apoB-B, apoD-B, and apoE-A were significantly down-regulated in catfish gill, while apoF, apoL-IV, apoO-like, and apo-14 kDa showed significantly up-regulation. Taken together, these results suggested that apolipoprotein genes may play significant roles in innate immune responses to bacterial pathogens in channel catfish. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Recent trends in control methods for bacterial wilt diseases caused by Ralstonia solanacearum.

    PubMed

    Yuliar; Nion, Yanetri Asi; Toyota, Koki

    2015-01-01

    Previous studies have described the development of control methods against bacterial wilt diseases caused by Ralstonia solanacearum. This review focused on recent advances in control measures, such as biological, physical, chemical, cultural, and integral measures, as well as biocontrol efficacy and suppression mechanisms. Biological control agents (BCAs) have been dominated by bacteria (90%) and fungi (10%). Avirulent strains of R. solanacearum, Pseudomonas spp., Bacillus spp., and Streptomyces spp. are well-known BCAs. New or uncommon BCAs have also been identified such as Acinetobacter sp., Burkholderia sp., and Paenibacillus sp. Inoculation methods for BCAs affect biocontrol efficacy, such as pouring or drenching soil, dipping of roots, and seed coatings. The amendment of different organic matter, such as plant residue, animal waste, and simple organic compounds, have frequently been reported to suppress bacterial wilt diseases. The combined application of BCAs and their substrates was shown to more effectively suppress bacterial wilt in the tomato. Suppression mechanisms are typically attributed to the antibacterial metabolites produced by BCAs or those present in natural products; however, the number of studies related to host resistance to the pathogen is increasing. Enhanced/modified soil microbial communities are also indirectly involved in disease suppression. New promising types of control measures include biological soil disinfection using substrates that release volatile compounds. This review described recent advances in different control measures. We focused on the importance of integrated pest management (IPM) for bacterial wilt diseases.

  5. Recent Trends in Control Methods for Bacterial Wilt Diseases Caused by Ralstonia solanacearum

    PubMed Central

    Yuliar; Nion, Yanetri Asi; Toyota, Koki

    2015-01-01

    Previous studies have described the development of control methods against bacterial wilt diseases caused by Ralstonia solanacearum. This review focused on recent advances in control measures, such as biological, physical, chemical, cultural, and integral measures, as well as biocontrol efficacy and suppression mechanisms. Biological control agents (BCAs) have been dominated by bacteria (90%) and fungi (10%). Avirulent strains of R. solanacearum, Pseudomonas spp., Bacillus spp., and Streptomyces spp. are well-known BCAs. New or uncommon BCAs have also been identified such as Acinetobacter sp., Burkholderia sp., and Paenibacillus sp. Inoculation methods for BCAs affect biocontrol efficacy, such as pouring or drenching soil, dipping of roots, and seed coatings. The amendment of different organic matter, such as plant residue, animal waste, and simple organic compounds, have frequently been reported to suppress bacterial wilt diseases. The combined application of BCAs and their substrates was shown to more effectively suppress bacterial wilt in the tomato. Suppression mechanisms are typically attributed to the antibacterial metabolites produced by BCAs or those present in natural products; however, the number of studies related to host resistance to the pathogen is increasing. Enhanced/modified soil microbial communities are also indirectly involved in disease suppression. New promising types of control measures include biological soil disinfection using substrates that release volatile compounds. This review described recent advances in different control measures. We focused on the importance of integrated pest management (IPM) for bacterial wilt diseases. PMID:25762345

  6. Refined identification of Vibrio bacterial flora from Acanthasther planci based on biochemical profiling and analysis of housekeeping genes.

    PubMed

    Rivera-Posada, J A; Pratchett, M; Cano-Gomez, A; Arango-Gomez, J D; Owens, L

    2011-09-09

    We used a polyphasic approach for precise identification of bacterial flora (Vibrionaceae) isolated from crown-of-thorns starfish (COTS) from Lizard Island (Great Barrier Reef, Australia) and Guam (U.S.A., Western Pacific Ocean). Previous 16S rRNA gene phylogenetic analysis was useful to allocate and identify isolates within the Photobacterium, Splendidus and Harveyi clades but failed in the identification of Vibrio harveyi-like isolates. Species of the V harveyi group have almost indistinguishable phenotypes and genotypes, and thus, identification by standard biochemical tests and 16S rRNA gene analysis is commonly inaccurate. Biochemical profiling and sequence analysis of additional topA and mreB housekeeping genes were carried out for definitive identification of 19 bacterial isolates recovered from sick and wild COTS. For 8 isolates, biochemical profiles and topA and mreB gene sequence alignments with the closest relatives (GenBank) confirmed previous 16S rRNA-based identification: V. fortis and Photobacterium eurosenbergii species (from wild COTS), and V natriegens (from diseased COTS). Further phylogenetic analysis based on topA and mreB concatenated sequences served to identify the remaining 11 V harveyi-like isolates: V. owensii and V. rotiferianus (from wild COTS), and V. owensii, V. rotiferianus, and V. harveyi (from diseased COTS). This study further confirms the reliability of topA-mreB gene sequence analysis for identification of these close species, and it reveals a wider distribution range of the potentially pathogenic V. harveyi group.

  7. Ectopic activation of the rice NLR heteropair RGA4/RGA5 confers resistance to bacterial blight and bacterial leaf streak diseases.

    PubMed

    Hutin, Mathilde; Césari, Stella; Chalvon, Véronique; Michel, Corinne; Tran, Tuan Tu; Boch, Jens; Koebnik, Ralf; Szurek, Boris; Kroj, Thomas

    2016-10-01

    Bacterial blight (BB) and bacterial leaf streak (BLS) are important diseases in Oryza sativa caused by Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc), respectively. In both bacteria, transcription activator-like (TAL) effectors are major virulence determinants that act by transactivating host genes downstream of effector-binding elements (EBEs) bound in a sequence-specific manner. Resistance to Xoo is mostly related to the action of TAL effectors, either by polymorphisms that prevent the induction of susceptibility (S) genes or by executor (R) genes with EBEs embedded in their promoter, and that induce cell death and resistance. For Xoc, no resistance sources are known in rice. Here, we investigated whether the recognition of effectors by nucleotide binding and leucine-rich repeat domain immune receptors (NLRs), the most widespread resistance mechanism in plants, is also able to stop BB and BLS. In one instance, transgenic rice lines harboring the AVR1-CO39 effector gene from the rice blast fungus Magnaporthe oryzae, under the control of an inducible promoter, were challenged with transgenic Xoo and Xoc strains carrying a TAL effector designed to transactivate the inducible promoter. This induced AVR1-CO39 expression and triggered BB and BLS resistance when the corresponding Pi-CO39 resistance locus was present. In a second example, the transactivation of an auto-active NLR by Xoo-delivered designer TAL effectors resulted in BB resistance, demonstrating that NLR-triggered immune responses efficiently control Xoo. This forms the foundation for future BB and BLS disease control strategies, whereupon endogenous TAL effectors will target synthetic promoter regions of Avr or NLR executor genes. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  8. Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

    PubMed

    Israni, B; Rajam, M V

    2017-04-01

    RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

  9. Prevalence of Antibiotic Resistance Genes and Bacterial Community Composition in a River Influenced by a Wastewater Treatment Plant

    PubMed Central

    Marti, Elisabet; Jofre, Juan; Balcazar, Jose Luis

    2013-01-01

    Antibiotic resistance represents a global health problem, requiring better understanding of the ecology of antibiotic resistance genes (ARGs), their selection and their spread in the environment. Antibiotics are constantly released to the environment through wastewater treatment plant (WWTP) effluents. We investigated, therefore, the effect of these discharges on the prevalence of ARGs and bacterial community composition in biofilm and sediment samples of a receiving river. We used culture-independent approaches such as quantitative PCR to determine the prevalence of eleven ARGs and 16S rRNA gene-based pyrosequencing to examine the composition of bacterial communities. Concentration of antibiotics in WWTP influent and effluent were also determined. ARGs such as qnrS, bla TEM, bla CTX-M, bla SHV, erm(B), sul(I), sul(II), tet(O) and tet(W) were detected in all biofilm and sediment samples analyzed. Moreover, we observed a significant increase in the relative abundance of ARGs in biofilm samples collected downstream of the WWTP discharge. We also found significant differences with respect to community structure and composition between upstream and downstream samples. Therefore, our results indicate that WWTP discharges may contribute to the spread of ARGs into the environment and may also impact on the bacterial communities of the receiving river. PMID:24205347

  10. Interference in Bacterial Quorum Sensing: A Biopharmaceutical Perspective

    PubMed Central

    Rémy, Benjamin; Mion, Sonia; Plener, Laure; Elias, Mikael; Chabrière, Eric; Daudé, David

    2018-01-01

    Numerous bacteria utilize molecular communication systems referred to as quorum sensing (QS) to synchronize the expression of certain genes regulating, among other aspects, the expression of virulence factors and the synthesis of biofilm. To achieve this process, bacteria use signaling molecules, known as autoinducers (AIs), as chemical messengers to share information. Naturally occurring strategies that interfere with bacterial signaling have been extensively studied in recent years, examining their potential to control bacteria. To interfere with QS, bacteria use quorum sensing inhibitors (QSIs) to block the action of AIs and quorum quenching (QQ) enzymes to degrade signaling molecules. Recent studies have shown that these strategies are promising routes to decrease bacterial pathogenicity and decrease biofilms, potentially enhancing bacterial susceptibility to antimicrobial agents including antibiotics and bacteriophages. The efficacy of QSIs and QQ enzymes has been demonstrated in various animal models and are now considered in the development of new medical devices against bacterial infections, including dressings, and catheters for enlarging the therapeutic arsenal against bacteria. PMID:29563876

  11. High-throughput platform for the discovery of elicitors of silent bacterial gene clusters.

    PubMed

    Seyedsayamdost, Mohammad R

    2014-05-20

    Over the past decade, bacterial genome sequences have revealed an immense reservoir of biosynthetic gene clusters, sets of contiguous genes that have the potential to produce drugs or drug-like molecules. However, the majority of these gene clusters appear to be inactive for unknown reasons prompting terms such as "cryptic" or "silent" to describe them. Because natural products have been a major source of therapeutic molecules, methods that rationally activate these silent clusters would have a profound impact on drug discovery. Herein, a new strategy is outlined for awakening silent gene clusters using small molecule elicitors. In this method, a genetic reporter construct affords a facile read-out for activation of the silent cluster of interest, while high-throughput screening of small molecule libraries provides potential inducers. This approach was applied to two cryptic gene clusters in the pathogenic model Burkholderia thailandensis. The results not only demonstrate a prominent activation of these two clusters, but also reveal that the majority of elicitors are themselves antibiotics, most in common clinical use. Antibiotics, which kill B. thailandensis at high concentrations, act as inducers of secondary metabolism at low concentrations. One of these antibiotics, trimethoprim, served as a global activator of secondary metabolism by inducing at least five biosynthetic pathways. Further application of this strategy promises to uncover the regulatory networks that activate silent gene clusters while at the same time providing access to the vast array of cryptic molecules found in bacteria.

  12. Intercellular and intracellular signalling systems that globally control the expression of virulence genes in plant pathogenic bacteria.

    PubMed

    Ham, Jong Hyun

    2013-04-01

    Plant pathogenic bacteria utilize complex signalling systems to control the expression of virulence genes at the cellular level and within populations. Quorum sensing (QS), an important intercellular communication mechanism, is mediated by different types of small molecules, including N-acyl homoserine lactones (AHLs), fatty acids and small proteins. AHL-mediated signalling systems dependent on the LuxI and LuxR family proteins play critical roles in the virulence of a wide range of Gram-negative plant pathogenic bacteria belonging to the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. Xanthomonas spp. and Xylella fastidiosa, members of the Gammaproteobacteria, however, possess QS systems that are mediated by fatty acid-type diffusible signal factors (DSFs). Recent studies have demonstrated that Ax21, a 194-amino-acid protein in Xanthomonas oryzae pv. oryzae, plays dual functions in activating a rice innate immune pathway through binding to the rice XA21 pattern recognition receptor and in regulating bacterial virulence and biofilm formation as a QS signal molecule. In xanthomonads, DSF-mediated QS systems are connected with the signalling pathways mediated by cyclic diguanosine monophosphate (c-di-GMP), which functions as a second messenger for the control of virulence gene expression in these bacterial pathogens. © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

  13. Impact of Bacillus amyloliquefaciens S13-3 on control of bacterial wilt and powdery mildew in tomato.

    PubMed

    Yamamoto, Shoko; Shiraishi, Soma; Kawagoe, Yumi; Mochizuki, Mai; Suzuki, Shunji

    2015-05-01

    Biological control is a non-hazardous technique to control plant diseases. Researchers have explored microorganisms that show high plant-disease control efficiency for use as biological control agents. A single soil application of Bacillus amyloliquefaciens strain S13-3 suppressed tomato bacterial wilt caused by Ralstonia solanacearum, a soilborne bacterial pathogen, through production of antibiotics augmented possibly by induction of systemic acquired resistance. Soil application also controlled tomato powdery mildew disease through induction of systemic acquired resistance. S13-3 showing bifunctional activity with a single application to soil may be an innovative biological control agent against bacterial wilt and powdery mildew in tomato. © 2014 Society of Chemical Industry.

  14. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  15. The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

    PubMed

    Xiao, W; Rank, G H

    1989-03-15

    The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

  16. Metagenomic analysis of bacterial community composition and antibiotic resistance genes in a wastewater treatment plant and its receiving surface water.

    PubMed

    Tang, Junying; Bu, Yuanqing; Zhang, Xu-Xiang; Huang, Kailong; He, Xiwei; Ye, Lin; Shan, Zhengjun; Ren, Hongqiang

    2016-10-01

    The presence of pathogenic bacteria and the dissemination of antibiotic resistance genes (ARGs) may pose big risks to the rivers that receive the effluent from municipal wastewater treatment plants (WWTPs). In this study, we investigated the changes of bacterial community and ARGs along treatment processes of one WWTP, and examined the effects of the effluent discharge on the bacterial community and ARGs in the receiving river. Pyrosequencing was applied to reveal bacterial community composition including potential bacterial pathogen, and Illumina high-throughput sequencing was used for profiling ARGs. The results showed that the WWTP had good removal efficiency on potential pathogenic bacteria (especially Arcobacter butzleri) and ARGs. Moreover, the bacterial communities of downstream and upstream of the river showed no significant difference. However, the increase in the abundance of potential pathogens and ARGs at effluent outfall was observed, indicating that WWTP effluent might contribute to the dissemination of potential pathogenic bacteria and ARGs in the receiving river. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Method of controlling gene expression

    DOEpatents

    Peters, Norman K.; Frost, John W.; Long, Sharon R.

    1991-12-03

    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  18. Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

    PubMed Central

    Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

    2012-01-01

    Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

  19. Bacterial community transcription patterns during a marine phytoplankton bloom.

    PubMed

    Rinta-Kanto, Johanna M; Sun, Shulei; Sharma, Shalabh; Kiene, Ronald P; Moran, Mary Ann

    2012-01-01

    Bacterioplankton consume a large proportion of photosynthetically fixed carbon in the ocean and control its biogeochemical fate. We used an experimental metatranscriptomics approach to compare bacterial activities that route energy and nutrients during a phytoplankton bloom compared with non-bloom conditions. mRNAs were sequenced from duplicate bloom and control microcosms 1 day after a phytoplankton biomass peak, and transcript copies per litre of seawater were calculated using an internal mRNA standard. Transcriptome analysis revealed a potential novel mechanism for enhanced efficiency during carbon-limited growth, mediated through membrane-bound pyrophosphatases [V-type H(+)-translocating; hppA]; bloom bacterioplankton participated less in this metabolic energy scavenging than non-bloom bacterioplankton, with possible implications for differences in growth yields on organic substrates. Bloom bacterioplankton transcribed more copies of genes predicted to increase cell surface adhesiveness, mediated by changes in bacterial signalling molecules related to biofilm formation and motility; these may be important in microbial aggregate formation. Bloom bacterioplankton also transcribed more copies of genes for organic acid utilization, suggesting an increased importance of this compound class in the bioreactive organic matter released during phytoplankton blooms. Transcription patterns were surprisingly faithful within a taxon regardless of treatment, suggesting that phylogeny broadly predicts the ecological roles of bacterial groups across 'boom' and 'bust' environmental backgrounds. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  20. Electronic control of gene expression and cell behaviour in Escherichia coli through redox signalling

    NASA Astrophysics Data System (ADS)

    Tschirhart, Tanya; Kim, Eunkyoung; McKay, Ryan; Ueda, Hana; Wu, Hsuan-Chen; Pottash, Alex Eli; Zargar, Amin; Negrete, Alejandro; Shiloach, Joseph; Payne, Gregory F.; Bentley, William E.

    2017-01-01

    The ability to interconvert information between electronic and ionic modalities has transformed our ability to record and actuate biological function. Synthetic biology offers the potential to expand communication `bandwidth' by using biomolecules and providing electrochemical access to redox-based cell signals and behaviours. While engineered cells have transmitted molecular information to electronic devices, the potential for bidirectional communication stands largely untapped. Here we present a simple electrogenetic device that uses redox biomolecules to carry electronic information to engineered bacterial cells in order to control transcription from a simple synthetic gene circuit. Electronic actuation of the native transcriptional regulator SoxR and transcription from the PsoxS promoter allows cell response that is quick, reversible and dependent on the amplitude and frequency of the imposed electronic signals. Further, induction of bacterial motility and population based cell-to-cell communication demonstrates the versatility of our approach and potential to drive intricate biological behaviours.

  1. Survival of Mice with Gastrointestinal Acute Radiation Syndrome through Control of Bacterial Translocation.

    PubMed

    Suzuki, Fujio; Loucas, Bradford D; Ito, Ichiaki; Asai, Akira; Suzuki, Sumihiro; Kobayashi, Makiko

    2018-07-01

    Macrophages (Mϕ) with the M2b phenotype (Pheno2b-Mϕ) in bacterial translocation sites have been described as cells responsible for the increased susceptibility of mice with gastrointestinal acute radiation syndrome to sepsis caused by gut bacteria. In this study, we tried to reduce the mortality of mice exposed to 7-10 Gy of gamma rays by controlling Pheno2b-Mϕ polarization in bacterial translocation sites. MicroRNA-222 was induced in association with gamma irradiation. Pheno2b-Mϕ polarization was promoted and maintained in gamma-irradiated mice through the reduction of a long noncoding RNA growth arrest-specific transcript 5 (a CCL1 gene silencer) influenced by this microRNA. Therefore, the host resistance of 7-9-Gy gamma-irradiated mice to sepsis caused by bacterial translocation was improved after treatment with CCL1 antisense oligodeoxynucleotide. However, the mortality of 10-Gy gamma-irradiated mice was not alleviated by this treatment. The crypts and villi in the ileum of 10-Gy gamma-irradiated mice were severely damaged, but these were markedly improved after transplantation of intestinal lineage cells differentiated from murine embryonic stem cells. All 10-Gy gamma-irradiated mice given both of the oligodeoxynucleotide and intestinal lineage cells survived, whereas all of the same mice given either of them died. These results indicate that high mortality rates of mice irradiated with 7-10 Gy of gamma rays are reducible by depleting CCL1 in combination with the intestinal lineage cell transplantation. These findings support the novel therapeutic possibility of victims who have gastrointestinal acute radiation syndrome for the reduction of their high mortality rates. Copyright © 2018 by The American Association of Immunologists, Inc.

  2. Molecular breeding of transgenic rice plants expressing a bacterial chlorocatechol dioxygenase gene.

    PubMed

    Shimizu, Masami; Kimura, Tetsuya; Koyama, Takayoshi; Suzuki, Katsuhisa; Ogawa, Naoto; Miyashita, Kiyotaka; Sakka, Kazuo; Ohmiya, Kunio

    2002-08-01

    The cbnA gene encoding the chlorocatechol dioxygenase gene from Ralstonia eutropha NH9 was introduced into rice plants. The cbnA gene was expressed in transgenic rice plants under the control of a modified cauliflower mosaic virus 35S promoter. Western blot analysis using anti-CbnA protein indicated that the cbnA gene was expressed in leaf tissue, roots, culms, and seeds. Transgenic rice calluses expressing the cbnA gene converted 3-chlorocatechol to 2-chloromucote efficiently. Growth and morphology of the transgenic rice plants expressing the cbnA gene were not distinguished from those of control rice plants harboring only a Ti binary vector. It is thus possible to breed transgenic plants that degrade chloroaromatic compounds in soil and surface water.

  3. Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

    PubMed

    Naville, Magali; Gautheret, Daniel

    2010-01-01

    Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

  4. Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

    PubMed Central

    Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

    1985-01-01

    The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

  5. Genome-Wide Association Study Identifies NBS-LRR-Encoding Genes Related with Anthracnose and Common Bacterial Blight in the Common Bean.

    PubMed

    Wu, Jing; Zhu, Jifeng; Wang, Lanfen; Wang, Shumin

    2017-01-01

    Nucleotide-binding site and leucine-rich repeat (NBS-LRR) genes represent the largest and most important disease resistance genes in plants. The genome sequence of the common bean ( Phaseolus vulgaris L.) provides valuable data for determining the genomic organization of NBS-LRR genes. However, data on the NBS-LRR genes in the common bean are limited. In total, 178 NBS-LRR-type genes and 145 partial genes (with or without a NBS) located on 11 common bean chromosomes were identified from genome sequences database. Furthermore, 30 NBS-LRR genes were classified into Toll/interleukin-1 receptor (TIR)-NBS-LRR (TNL) types, and 148 NBS-LRR genes were classified into coiled-coil (CC)-NBS-LRR (CNL) types. Moreover, the phylogenetic tree supported the division of these PvNBS genes into two obvious groups, TNL types and CNL types. We also built expression profiles of NBS genes in response to anthracnose and common bacterial blight using qRT-PCR. Finally, we detected nine disease resistance loci for anthracnose (ANT) and seven for common bacterial blight (CBB) using the developed NBS-SSR markers. Among these loci, NSSR24, NSSR73, and NSSR265 may be located at new regions for ANT resistance, while NSSR65 and NSSR260 may be located at new regions for CBB resistance. Furthermore, we validated NSSR24, NSSR65, NSSR73, NSSR260, and NSSR265 using a new natural population. Our results provide useful information regarding the function of the NBS-LRR proteins and will accelerate the functional genomics and evolutionary studies of NBS-LRR genes in food legumes. NBS-SSR markers represent a wide-reaching resource for molecular breeding in the common bean and other food legumes. Collectively, our results should be of broad interest to bean scientists and breeders.

  6. Genome-Wide Association Study Identifies NBS-LRR-Encoding Genes Related with Anthracnose and Common Bacterial Blight in the Common Bean

    PubMed Central

    Wu, Jing; Zhu, Jifeng; Wang, Lanfen; Wang, Shumin

    2017-01-01

    Nucleotide-binding site and leucine-rich repeat (NBS-LRR) genes represent the largest and most important disease resistance genes in plants. The genome sequence of the common bean (Phaseolus vulgaris L.) provides valuable data for determining the genomic organization of NBS-LRR genes. However, data on the NBS-LRR genes in the common bean are limited. In total, 178 NBS-LRR-type genes and 145 partial genes (with or without a NBS) located on 11 common bean chromosomes were identified from genome sequences database. Furthermore, 30 NBS-LRR genes were classified into Toll/interleukin-1 receptor (TIR)-NBS-LRR (TNL) types, and 148 NBS-LRR genes were classified into coiled-coil (CC)-NBS-LRR (CNL) types. Moreover, the phylogenetic tree supported the division of these PvNBS genes into two obvious groups, TNL types and CNL types. We also built expression profiles of NBS genes in response to anthracnose and common bacterial blight using qRT-PCR. Finally, we detected nine disease resistance loci for anthracnose (ANT) and seven for common bacterial blight (CBB) using the developed NBS-SSR markers. Among these loci, NSSR24, NSSR73, and NSSR265 may be located at new regions for ANT resistance, while NSSR65 and NSSR260 may be located at new regions for CBB resistance. Furthermore, we validated NSSR24, NSSR65, NSSR73, NSSR260, and NSSR265 using a new natural population. Our results provide useful information regarding the function of the NBS-LRR proteins and will accelerate the functional genomics and evolutionary studies of NBS-LRR genes in food legumes. NBS-SSR markers represent a wide-reaching resource for molecular breeding in the common bean and other food legumes. Collectively, our results should be of broad interest to bean scientists and breeders. PMID:28848595

  7. Determination of internal controls for quantitative real time RT-PCR analysis of the effect of Edwardsiella tarda infection on gene expression in turbot (Scophthalmus maximus).

    PubMed

    Dang, Wei; Sun, Li

    2011-02-01

    In recent years, quantitative real time reverse transcriptase-PCR (qRT-PCR) has been used frequently in the study of gene expression in turbot (Scophthalmus maximus) in relation to bacterial infection. However, no investigations on appropriate qRT-PCR reference genes have been documented. In this report, we determined the potential of eight housekeeping genes, i.e. β-actin (ACTB), ribosomal protein L17 (RPL17), α-tubulin (TUBA), elongation factor-1-α(EF1A), β-2-Microglobulin (B2M), RNA polymerase II subunit D (RPSD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 18S ribosomal RNA (18S rRNA), as internal standards for qRT-PCR analysis of gene expression in turbot as a function of bacterial infection. For this purpose, the expression of the eight housekeeping genes in seven turbot tissues was determined by qRT-PCR before and after bacterial challenge, and the data were analyzed with the geNorm and NormFinder algorisms. The results showed that the expression of all the examined genes exhibited tissue-dependent variations both before and after bacterial challenge. Before bacterial challenge, geNorm and NormFinder identified RPSD as the gene that showed least tissue specific expression. At 12 h post-bacterial infection, geNorm ranked ACTB/GAPDH, 18S rRNA/ACTB, ACTB/GAPDH, 18S rRNA/ACTB, RPL17/TUBA, RPSD/GAPDH, and RPSD/B2M, respectively, as the most stably expressed genes in liver, spleen, kidney, gill, heart, muscle, and brain. Comparable ranking orders were produced by NormFinder. Similar results were obtained at 24 h post-bacterial infection. Taken together, these results indicate that RPSD is the most stable gene across tissue types under normal physiological conditions and that, during bacterial infection, ACTB might be used as an internal standard for the normalization of gene expression in immune relevant organs; however, no single gene or single pair of genes in the examined set of housekeeping genes can serve as a universal reference across all

  8. Applications of CRISPR/Cas System to Bacterial Metabolic Engineering.

    PubMed

    Cho, Suhyung; Shin, Jongoh; Cho, Byung-Kwan

    2018-04-05

    The clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) adaptive immune system has been extensively used for gene editing, including gene deletion, insertion, and replacement in bacterial and eukaryotic cells owing to its simple, rapid, and efficient activities in unprecedented resolution. Furthermore, the CRISPR interference (CRISPRi) system including deactivated Cas9 (dCas9) with inactivated endonuclease activity has been further investigated for regulation of the target gene transiently or constitutively, avoiding cell death by disruption of genome. This review discusses the applications of CRISPR/Cas for genome editing in various bacterial systems and their applications. In particular, CRISPR technology has been used for the production of metabolites of high industrial significance, including biochemical, biofuel, and pharmaceutical products/precursors in bacteria. Here, we focus on methods to increase the productivity and yield/titer scan by controlling metabolic flux through individual or combinatorial use of CRISPR/Cas and CRISPRi systems with introduction of synthetic pathway in industrially common bacteria including Escherichia coli . Further, we discuss additional useful applications of the CRISPR/Cas system, including its use in functional genomics.

  9. Transcriptome landscape of a bacterial pathogen under plant immunity.

    PubMed

    Nobori, Tatsuya; Velásquez, André C; Wu, Jingni; Kvitko, Brian H; Kremer, James M; Wang, Yiming; He, Sheng Yang; Tsuda, Kenichi

    2018-03-27

    Plant pathogens can cause serious diseases that impact global agriculture. The plant innate immunity, when fully activated, can halt pathogen growth in plants. Despite extensive studies into the molecular and genetic bases of plant immunity against pathogens, the influence of plant immunity in global pathogen metabolism to restrict pathogen growth is poorly understood. Here, we developed RNA sequencing pipelines for analyzing bacterial transcriptomes in planta and determined high-resolution transcriptome patterns of the foliar bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana with a total of 27 combinations of plant immunity mutants and bacterial strains. Bacterial transcriptomes were analyzed at 6 h post infection to capture early effects of plant immunity on bacterial processes and to avoid secondary effects caused by different bacterial population densities in planta We identified specific "immune-responsive" bacterial genes and processes, including those that are activated in susceptible plants and suppressed by plant immune activation. Expression patterns of immune-responsive bacterial genes at the early time point were tightly linked to later bacterial growth levels in different host genotypes. Moreover, we found that a bacterial iron acquisition pathway is commonly suppressed by multiple plant immune-signaling pathways. Overexpression of a P. syringae sigma factor gene involved in iron regulation and other processes partially countered bacterial growth restriction during the plant immune response triggered by AvrRpt2. Collectively, this study defines the effects of plant immunity on the transcriptome of a bacterial pathogen and sheds light on the enigmatic mechanisms of bacterial growth inhibition during the plant immune response.

  10. The impact of persistent bacterial bronchitis on the pulmonary microbiome of children

    PubMed Central

    Bingle, Lynne; Cookson, William O. C. M.; Everard, Mark L.; Moffatt, Miriam F.

    2017-01-01

    Introduction Persistent bacterial bronchitis (PBB) is a leading cause of chronic wet cough in young children. This study aimed to characterise the respiratory bacterial microbiota of healthy children and to assess the impact of the changes associated with the development of PBB. Blind, protected brushings were obtained from 20 healthy controls and 24 children with PBB, with an additional directed sample obtained from PBB patients. DNA was extracted, quantified using a 16S rRNA gene quantitative PCR assay prior to microbial community analysis by 16S rRNA gene sequencing. Results No significant difference in bacterial diversity or community composition (R2 = 0.01, P = 0.36) was observed between paired blind and non-blind brushes, showing that blind brushings are a valid means of accessing the airway microbiota. This has important implications for collecting lower respiratory samples from healthy children. A significant decrease in bacterial diversity (P < 0.001) and change in community composition (R2 = 0.08, P = 0.004) was observed among controls, in comparison with patients. Bacterial communities within patients with PBB were dominated by Proteobacteria, and indicator species analysis showed that Haemophilus and Neisseria were significantly associated with the patient group. In 15 (52.9%) cases the dominant organism by sequencing was not identified by standard routine clinical culture. Conclusion The bacteria present in the lungs of patients with PBB were less diverse in terms of richness and evenness. The results validate the clinical diagnosis, and suggest that more attention to bacterial communities in children with chronic cough may lead to more rapid recognition of this condition with earlier treatment and reduction in disease burden. PMID:29281698

  11. Simple F Test Reveals Gene-Gene Interactions in Case-Control Studies

    PubMed Central

    Chen, Guanjie; Yuan, Ao; Zhou, Jie; Bentley, Amy R.; Adeyemo, Adebowale; Rotimi, Charles N.

    2012-01-01

    Missing heritability is still a challenge for Genome Wide Association Studies (GWAS). Gene-gene interactions may partially explain this residual genetic influence and contribute broadly to complex disease. To analyze the gene-gene interactions in case-control studies of complex disease, we propose a simple, non-parametric method that utilizes the F-statistic. This approach consists of three steps. First, we examine the joint distribution of a pair of SNPs in cases and controls separately. Second, an F-test is used to evaluate the ratio of dependence in cases to that of controls. Finally, results are adjusted for multiple tests. This method was used to evaluate gene-gene interactions that are associated with risk of Type 2 Diabetes among African Americans in the Howard University Family Study. We identified 18 gene-gene interactions (P < 0.0001). Compared with the commonly-used logistical regression method, we demonstrate that the F-ratio test is an efficient approach to measuring gene-gene interactions, especially for studies with limited sample size. PMID:22837643

  12. The Extent of Genome Flux and Its Role in the Differentiation of Bacterial Lineages

    PubMed Central

    Nowell, Reuben W.; Green, Sarah; Laue, Bridget E.; Sharp, Paul M.

    2014-01-01

    Horizontal gene transfer (HGT) and gene loss are key processes in bacterial evolution. However, the role of gene gain and loss in the emergence and maintenance of ecologically differentiated bacterial populations remains an open question. Here, we use whole-genome sequence data to quantify gene gain and loss for 27 lineages of the plant-associated bacterium Pseudomonas syringae. We apply an extensive error-control procedure that accounts for errors in draft genome data and greatly improves the accuracy of patterns of gene occurrence among these genomes. We demonstrate a history of extensive genome fluctuation for this species and show that individual lineages could have acquired thousands of genes in the same period in which a 1% amino acid divergence accrues in the core genome. Elucidating the dynamics of genome fluctuation reveals the rapid turnover of gained genes, such that the majority of recently gained genes are quickly lost. Despite high observed rates of fluctuation, a phylogeny inferred from patterns of gene occurrence is similar to a phylogeny based on amino acid replacements within the core genome. Furthermore, the core genome phylogeny suggests that P. syringae should be considered a number of distinct species, with levels of divergence at least equivalent to those between recognized bacterial species. Gained genes are transferred from a variety of sources, reflecting the depth and diversity of the potential gene pool available via HGT. Overall, our results provide further insights into the evolutionary dynamics of genome fluctuation and implicate HGT as a major factor contributing to the diversification of P. syringae lineages. PMID:24923323

  13. The group B streptococcal sialic acid O-acetyltransferase is encoded by neuD, a conserved component of bacterial sialic acid biosynthetic gene clusters.

    PubMed

    Lewis, Amanda L; Hensler, Mary E; Varki, Ajit; Nizet, Victor

    2006-04-21

    Nearly two dozen microbial pathogens have surface polysaccharides or lipo-oligosaccharides that contain sialic acid (Sia), and several Sia-dependent virulence mechanisms are known to enhance bacterial survival or result in host tissue injury. Some pathogens are also known to O-acetylate their Sias, although the role of this modification in pathogenesis remains unclear. We report that neuD, a gene located within the Group B Streptococcus (GBS) Sia biosynthetic gene cluster, encodes a Sia O-acetyltransferase that is itself required for capsular polysaccharide (CPS) sialylation. Homology modeling and site-directed mutagenesis identified Lys-123 as a critical residue for Sia O-acetyltransferase activity. Moreover, a single nucleotide polymorphism in neuD can determine whether GBS displays a "high" or "low" Sia O-acetylation phenotype. Complementation analysis revealed that Escherichia coli K1 NeuD also functions as a Sia O-acetyltransferase in GBS. In fact, NeuD homologs are commonly found within Sia biosynthetic gene clusters. A bioinformatic approach identified 18 bacterial species with a Sia biosynthetic gene cluster that included neuD. Included in this list are the sialylated human pathogens Legionella pneumophila, Vibrio parahemeolyticus, Pseudomonas aeruginosa, and Campylobacter jejuni, as well as an additional 12 bacterial species never before analyzed for Sia expression. Phylogenetic analysis shows that NeuD homologs of sialylated pathogens share a common evolutionary lineage distinct from the poly-Sia O-acetyltransferase of E. coli K1. These studies define a molecular genetic approach for the selective elimination of GBS Sia O-acetylation without concurrent loss of sialylation, a key to further studies addressing the role(s) of this modification in bacterial virulence.

  14. Along the Central Dogma-Controlling Gene Expression with Small Molecules.

    PubMed

    Schneider-Poetsch, Tilman; Yoshida, Minoru

    2018-05-04

    The central dogma of molecular biology, that DNA is transcribed into RNA and RNA translated into protein, was coined in the early days of modern biology. Back in the 1950s and 1960s, bacterial genetics first opened the way toward understanding life as the genetically encoded interaction of macromolecules. As molecular biology progressed and our knowledge of gene control deepened, it became increasingly clear that expression relied on many more levels of regulation. In the process of dissecting mechanisms of gene expression, specific small-molecule inhibitors played an important role and became valuable tools of investigation. Small molecules offer significant advantages over genetic tools, as they allow inhibiting a process at any desired time point, whereas mutating or altering the gene of an important regulator would likely result in a dead organism. With the advent of modern sequencing technology, it has become possible to monitor global cellular effects of small-molecule treatment and thereby overcome the limitations of classical biochemistry, which usually looks at a biological system in isolation. This review focuses on several molecules, especially natural products, that have played an important role in dissecting gene expression and have opened up new fields of investigation as well as clinical venues for disease treatment. Expected final online publication date for the Annual Review of Biochemistry Volume 87 is June 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.

  15. Global analysis of gene expression reveals mRNA superinduction is required for the inducible immune response to a bacterial pathogen

    PubMed Central

    Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E

    2017-01-01

    The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283

  16. Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

    PubMed

    Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

    2010-06-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

  17. Eye-specification genes in the bacterial light organ of the bobtail squid Euprymna scolopes, and their expression in response to symbiont cues.

    PubMed

    Peyer, Suzanne M; Pankey, M Sabrina; Oakley, Todd H; McFall-Ngai, Margaret J

    2014-02-01

    The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or 'light organ', which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ∼1/4 into embryogenesis (Naef stage 18) and the light organ ∼3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light

  18. Eye-specification genes in the bacterial light organ of the bobtail squid Euprymna scolopes, and their expression in response to symbiont cues

    PubMed Central

    Peyer, Suzanne M.; Pankey, M. Sabrina; Oakley, Todd H.; McFall-Ngai, Margaret J.

    2014-01-01

    The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or ‘light organ’, which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ~1/4 into embryogenesis (Naef stage 18) and the light organ ~3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light

  19. Bacterial community dynamics during bioremediation of diesel oil-contaminated Antarctic soil.

    PubMed

    Vázquez, S; Nogales, B; Ruberto, L; Hernández, E; Christie-Oleza, J; Lo Balbo, A; Bosch, R; Lalucat, J; Mac Cormack, W

    2009-05-01

    The effect of nutrient and inocula amendment in a bioremediation field trial using a nutrient-poor Antarctic soil chronically contaminated with hydrocarbons was tested. The analysis of the effects that the treatments caused in bacterial numbers and hydrocarbon removal was combined with the elucidation of the changes occurring on the bacterial community, by 16S rDNA-based terminal restriction fragment length polymorphism (T-RFLP) typing, and the detection of some of the genes involved in the catabolism of hydrocarbons. All treatments caused a significant increase in the number of bacteria able to grow on hydrocarbons and a significant decrease in the soil hydrocarbon content, as compared to the control. However, there were no significant differences between treatments. Comparison of the soil T-RFLP profiles indicated that there were changes in the structure and composition of bacterial communities during the bioremediation trial, although the communities in treated plots were highly similar irrespective of the treatment applied, and they had a similar temporal dynamics. These results showed that nutrient addition was the main factor contributing to the outcome of the bioremediation experiment. This was supported by the lack of evidence of the establishment of inoculated consortia in soils, since their characteristic electrophoretic peaks were only detectable in soil profiles at the beginning of the experiment. Genetic potential for naphthalene degradation, evidenced by detection of nahAc gene, was observed in all soil plots including the control. In treated plots, an increase in the detection of catechol degradation genes (nahH and catA) and in a key gene of denitrification (nosZ) was observed as well. These results indicate that treatments favored the degradation of aromatic hydrocarbons and probably stimulated denitrification, at least transiently. This mesocosm study shows that recovery of chronically contaminated Antarctic soils can be successfully accelerated

  20. Elevated gene expression of S100A12 is correlated with the predominant clinical inflammatory factors in patients with bacterial pneumonia.

    PubMed

    Hou, Fei; Wang, Likui; Wang, Hong; Gu, Junchao; Li, Meiling; Zhang, Jingkai; Ling, Xiao; Gao, Xiaofang; Luo, Cheng

    2015-06-01

    Inflammation is the predominant characteristic of pneumonia. The present study aimed to to identify a faster and more reliable novel inflammatory marker for the diagnosis of pneumonia. The expression of the S100A12 gene was analyzed by reverse transcription quantitative polymerase chain reaction in samples obtained from 46 patients with bacterial pneumonia and other infections, compared with samples from 20 healthy individuals, using the 2‑ΔΔCt method. The expression levels of S100A12 were increased in 12 patients with bacterial pneumonia. Compared with clinical inflammatory data, a positive correlation was observed between the expression of the S100A12 gene and levels of white blood cells, C‑reactive protein (CRP), thrombocytocrit, neutrophils, erythrocyte sedimentation and soterocytes, and an inverse correlation was observed with the width of red blood cell volume distribution and platelet distribution, monocytes and hemoglobin, using Pearson's product‑moment correlation method. The P‑value of CRP and erythrocyte sedimentation were revealed to be statistically significant (P<0.05). A sporadic distribution of S100A12 was observed in a heatmap among the patients with different infections and bacterial pneumonia. Furthermore, the expression of S100A12 occurred in parallel to the number of clumps of inflamed tissue observed in chest computed tomography and X‑ray. The value of gene expression of S100A12 (>1.0) determined using the 2‑ΔΔCt method was associated with more severe respiratory diseases in the patients compromised by bacterial pneumonia, sepsis and pancreatitis. These findings suggested that S100A12 is an effective marker for inflammatory diseases.

  1. Four Genes of Medicago truncatula Controlling Components of a Nod Factor Transduction Pathway

    PubMed Central

    Catoira, Romy; Galera, Christine; de Billy, Francoise; Penmetsa, R. Varma; Journet, Etienne-Pascal; Maillet, Fabienne; Rosenberg, Charles; Cook, Douglas; Gough, Clare; Dénarié, Jean

    2000-01-01

    Rhizobium nodulation (Nod) factors are lipo-chitooligosaccharides that act as symbiotic signals, eliciting several key developmental responses in the roots of legume hosts. Using nodulation-defective mutants of Medicago truncatula, we have started to dissect the genetic control of Nod factor transduction. Mutants in four genes (DMI1, DMI2, DMI3, and NSP) were pleiotropically affected in Nod factor responses, indicating that these genes are required for a Nod factor–activated signal transduction pathway that leads to symbiotic responses such as root hair deformations, expressions of nodulin genes, and cortical cell divisions. Mutant analysis also provides evidence that Nod factors have a dual effect on the growth of root hair: inhibition of endogenous (plant) tip growth, and elicitation of a novel tip growth dependent on (bacterial) Nod factors. dmi1, dmi2, and dmi3 mutants are also unable to establish a symbiotic association with endomycorrhizal fungi, indicating that there are at least three common steps to nodulation and endomycorrhization in M. truncatula and providing further evidence for a common signaling pathway between nodulation and mycorrhization. PMID:11006338

  2. Response of soil bacterial community to repeated applications of carbendazim.

    PubMed

    Wang, Xiuguo; Song, Min; Wang, Yiqi; Gao, Chunming; Zhang, Qun; Chu, Xiaoqiang; Fang, Hua; Yu, Yunlong

    2012-01-01

    The effect of repeated carbendazim applications on functional diversity of culturable microorganisms and bacterial community composition was studied under field conditions. The functional diversity of soil culturable microbial community (Shannon index, H') reduced significantly (P<0.05) after the first introduction of carbendazim at levels of 0.94, 1.88 and 4.70 kg active ingredient (a.i.)ha(-1) and then recovered to that in the control with subsequent applications. An evident (P<0.01) difference in the bacterial community composition was observed after the second carbendazim application by Temperature Gradient Gel Electrophoresis (TGGE) analysis of 16S rRNA genes amplified from treated and control soils, which remained after the third and fourth treatments. Our results indicated that repeated carbendazim applications have a transient harmful effect on functional diversity of soil culturable microbial community and result in an alteration in bacterial community composition largely due to one species within the γ-proteobacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Genetic and epigenetic control of gene expression by CRISPR–Cas systems

    PubMed Central

    Lo, Albert; Qi, Lei

    2017-01-01

    The discovery and adaption of bacterial clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) systems has revolutionized the way researchers edit genomes. Engineering of catalytically inactivated Cas variants (nuclease-deficient or nuclease-deactivated [dCas]) combined with transcriptional repressors, activators, or epigenetic modifiers enable sequence-specific regulation of gene expression and chromatin state. These CRISPR–Cas-based technologies have contributed to the rapid development of disease models and functional genomics screening approaches, which can facilitate genetic target identification and drug discovery. In this short review, we will cover recent advances of CRISPR–dCas9 systems and their use for transcriptional repression and activation, epigenome editing, and engineered synthetic circuits for complex control of the mammalian genome. PMID:28649363

  4. Characterization of the Bacteroides fragilis bfr Gene Product Identifies a Bacterial DPS-Like Protein and Suggests Evolutionary Links in the Ferritin Superfamily

    PubMed Central

    Gauss, George H.; Reott, Michael A.; Rocha, Edson R.; Young, Mark J.; Douglas, Trevor

    2012-01-01

    A factor contributing to the pathogenicity of Bacteroides fragilis, the most common anaerobic species isolated from clinical infections, is the bacterium's extreme aerotolerance, which allows survival in oxygenated tissues prior to anaerobic abscess formation. We investigated the role of the bacterioferritin-related (bfr) gene in the B. fragilis oxidative stress response. The bfr mRNA levels are increased in stationary phase or in response to O2 or iron. In addition, bfr null mutants exhibit reduced aerotolerance, and the bfr gene product protects DNA from hydroxyl radical cleavage in vitro. Crystallographic studies revealed a protein with a dodecameric structure and greater similarity to an archaeal DNA protection in starved cells (DPS)-like protein than to the 24-subunit bacterioferritins. Similarity to the DPS-like (DPSL) protein extends to the subunit and includes a pair of conserved cysteine residues juxtaposed to a buried dimetal binding site within the four-helix bundle. Compared to archaeal DPSLs, however, this bacterial DPSL protein contains several unique features, including a significantly different conformation in the C-terminal tail that alters the number and location of pores leading to the central cavity and a conserved metal binding site on the interior surface of the dodecamer. Combined, these characteristics confirm this new class of miniferritin in the bacterial domain, delineate the similarities and differences between bacterial DPSL proteins and their archaeal homologs, allow corrected annotations for B. fragilis bfr and other dpsl genes within the bacterial domain, and suggest an evolutionary link within the ferritin superfamily that connects dodecameric DPS to the (bacterio)ferritin 24-mer. PMID:22020642

  5. Analysis of gene expression levels in individual bacterial cells without image segmentation.

    PubMed

    Kwak, In Hae; Son, Minjun; Hagen, Stephen J

    2012-05-11

    Studies of stochasticity in gene expression typically make use of fluorescent protein reporters, which permit the measurement of expression levels within individual cells by fluorescence microscopy. Analysis of such microscopy images is almost invariably based on a segmentation algorithm, where the image of a cell or cluster is analyzed mathematically to delineate individual cell boundaries. However segmentation can be ineffective for studying bacterial cells or clusters, especially at lower magnification, where outlines of individual cells are poorly resolved. Here we demonstrate an alternative method for analyzing such images without segmentation. The method employs a comparison between the pixel brightness in phase contrast vs fluorescence microscopy images. By fitting the correlation between phase contrast and fluorescence intensity to a physical model, we obtain well-defined estimates for the different levels of gene expression that are present in the cell or cluster. The method reveals the boundaries of the individual cells, even if the source images lack the resolution to show these boundaries clearly. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    PubMed

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  7. Gut microbial translocation corrupts myeloid cell function to control bacterial infection during liver cirrhosis.

    PubMed

    Hackstein, Carl-Philipp; Assmus, Lisa Mareike; Welz, Meike; Klein, Sabine; Schwandt, Timo; Schultze, Joachim; Förster, Irmgard; Gondorf, Fabian; Beyer, Marc; Kroy, Daniela; Kurts, Christian; Trebicka, Jonel; Kastenmüller, Wolfgang; Knolle, Percy A; Abdullah, Zeinab

    2017-03-01

    Patients with liver cirrhosis suffer from increased susceptibility to life-threatening bacterial infections that cause substantial morbidity. Experimental liver fibrosis in mice induced by bile duct ligation or CCl 4 application was used to characterise the mechanisms determining failure of innate immunity to control bacterial infections. In murine liver fibrosis, translocation of gut microbiota induced tonic type I interferon (IFN) expression in the liver. Such tonic IFN expression conditioned liver myeloid cells to produce high concentrations of IFN upon intracellular infection with Listeria that activate cytosolic pattern recognition receptors. Such IFN-receptor signalling caused myeloid cell interleukin (IL)-10 production that corrupted antibacterial immunity, leading to loss of infection-control and to infection-associated mortality. In patients with liver cirrhosis, we also found a prominent liver IFN signature and myeloid cells showed increased IL-10 production after bacterial infection. Thus, myeloid cells are both source and target of IFN-induced and IL-10-mediated immune dysfunction. Antibody-mediated blockade of IFN-receptor or IL-10-receptor signalling reconstituted antibacterial immunity and prevented infection-associated mortality in mice with liver fibrosis. In severe liver fibrosis and cirrhosis, failure to control bacterial infection is caused by augmented IFN and IL-10 expression that incapacitates antibacterial immunity of myeloid cells. Targeted interference with the immune regulatory host factors IL-10 and IFN reconstitutes antibacterial immunity and may be used as therapeutic strategy to control bacterial infections in patients with liver cirrhosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. Comprehensive search for accessory proteins encoded with archaeal and bacterial type III CRISPR-cas gene cassettes reveals 39 new cas gene families.

    PubMed

    Shah, Shiraz A; Alkhnbashi, Omer S; Behler, Juliane; Han, Wenyuan; She, Qunxin; Hess, Wolfgang R; Garrett, Roger A; Backofen, Rolf

    2018-06-19

    A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .

  9. Deletion of pilA, a Minor Pilin-Like Gene, from Xanthomonas citri subsp. citri Influences Bacterial Physiology and Pathogenesis.

    PubMed

    Petrocelli, Silvana; Arana, Maite R; Cabrini, Marcela N; Casabuono, Adriana C; Moyano, Laura; Beltramino, Matías; Moreira, Leandro M; Couto, Alicia S; Orellano, Elena G

    2016-12-01

    Type IV pili (Tfp) are widely distributed adhesins of bacterial surfaces. In plant pathogenic bacteria, Tfp are involved in host colonization and pathogenesis. Xanthomonas citri subsp. citri (Xcc) is the phytopathogen responsible for citrus canker disease. In this work, three Tfp structural genes, fimA, fimA1, and pilA from Xcc were studied. A pilA mutant strain from Xcc (XccΔpilA) was constructed and differences in physiological features, such as motilities, adhesion, and biofilm formation, were observed. A structural study of the purified Tfp fractions from Xcc wild-type and Xcc∆pilA showed that pilins are glycosylated in both strains and that FimA and FimA1 are the main structural components of the pili. Furthermore, smaller lesion symptoms and reduced bacterial growth were produced by Xcc∆pilA in orange plants compared to the wild-type strain. These results indicate that the minor pilin-like gene, pilA, is involved in Tfp performance during the infection process.

  10. Low-shear modeled microgravity: a global environmental regulatory signal affecting bacterial gene expression, physiology, and pathogenesis

    NASA Technical Reports Server (NTRS)

    Nickerson, Cheryl A.; Ott, C. Mark; Wilson, James W.; Ramamurthy, Rajee; LeBlanc, Carly L.; Honer zu Bentrup, Kerstin; Hammond, Timothy; Pierson, Duane L.

    2003-01-01

    Bacteria inhabit an impressive variety of ecological niches and must adapt constantly to changing environmental conditions. While numerous environmental signals have been examined for their effect on bacteria, the effects of mechanical forces such as shear stress and gravity have only been investigated to a limited extent. However, several important studies have demonstrated a key role for the environmental signals of low shear and/or microgravity in the regulation of bacterial gene expression, physiology, and pathogenesis [Chem. Rec. 1 (2001) 333; Appl. Microbiol. Biotechnol. 54 (2000) 33; Appl. Environ. Microbiol. 63 (1997) 4090; J. Ind. Microbiol. 18 (1997) 22; Curr. Microbiol. 34(4) (1997) 199; Appl. Microbiol. Biotechnol. 56(3-4) (2001) 384; Infect Immun. 68(6) (2000) 3147; Cell 109(7) (2002) 913; Appl. Environ. Microbiol. 68(11) (2002) 5408; Proc. Natl. Acad. Sci. U. S. A. 99(21) (2002) 13807]. The response of bacteria to these environmental signals, which are similar to those encountered during prokaryotic life cycles, may provide insight into bacterial adaptations to physiologically relevant conditions. This review focuses on the current and potential future research trends aimed at understanding the effect of the mechanical forces of low shear and microgravity analogues on different bacterial parameters. In addition, this review also discusses the use of microgravity technology to generate physiologically relevant human tissue models for research in bacterial pathogenesis.

  11. Ubiquity and Diversity of Heterotrophic Bacterial nasA Genes in Diverse Marine Environments

    PubMed Central

    Jiang, Xuexia; Dang, Hongyue; Jiao, Nianzhi

    2015-01-01

    Nitrate uptake by heterotrophic bacteria plays an important role in marine N cycling. However, few studies have investigated the diversity of environmental nitrate assimilating bacteria (NAB). In this study, the diversity and biogeographical distribution of NAB in several global oceans and particularly in the western Pacific marginal seas were investigated using both cultivation and culture-independent molecular approaches. Phylogenetic analyses based on 16S rRNA and nasA (encoding the large subunit of the assimilatory nitrate reductase) gene sequences indicated that the cultivable NAB in South China Sea belonged to the α-Proteobacteria, γ-Proteobacteria and CFB (Cytophaga-Flavobacteria-Bacteroides) bacterial groups. In all the environmental samples of the present study, α-Proteobacteria, γ-Proteobacteria and Bacteroidetes were found to be the dominant nasA-harboring bacteria. Almost all of the α-Proteobacteria OTUs were classified into three Roseobacter-like groups (I to III). Clone library analysis revealed previously underestimated nasA diversity; e.g. the nasA gene sequences affiliated with β-Proteobacteria, ε-Proteobacteria and Lentisphaerae were observed in the field investigation for the first time, to the best of our knowledge. The geographical and vertical distributions of seawater nasA-harboring bacteria indicated that NAB were highly diverse and ubiquitously distributed in the studied marginal seas and world oceans. Niche adaptation and separation and/or limited dispersal might mediate the NAB composition and community structure in different water bodies. In the shallow-water Kueishantao hydrothermal vent environment, chemolithoautotrophic sulfur-oxidizing bacteria were the primary NAB, indicating a unique nitrate-assimilating community in this extreme environment. In the coastal water of the East China Sea, the relative abundance of Alteromonas and Roseobacter-like nasA gene sequences responded closely to algal blooms, indicating that NAB may be

  12. Biological Potential of Bioorganic Fertilizer Fortified with Bacterial Antagonist for the Control of Tomato Bacterial Wilt and the Promotion of Crop Yields.

    PubMed

    Wu, Kai; Fang, Zhiying; Wang, Lili; Yuan, Saifei; Guo, Rong; Shen, Biao; Shen, Qirong

    2016-10-28

    The application of Bacillus sp. in the biological control of plant soilborne diseases has been shown to be an environmentally friendly alternative to the use of chemical fungicides. In this study, the effects of bioorganic fertilizer (BOF) fortified with Bacillus amyloliquefaciens SQY 162 on the suppression of tomato bacterial wilt were investigated in pot experiments. The disease incidence of tomato wilt after the application of BOF was 65.18% and 41.62% lower at 10 and 20 days after transplantation, respectively, than in the control condition. BOF also promoted the plant growth. The SQY 162 populations efficiently colonized the tomato rhizosphere, which directly suppressed the number of Ralstonia solanacearum in the tomato rhizosphere soil. In the presence of BOF, the activities of defense-related enzymes in tomato were lower than in the presence of the control treatment, but the expression levels of the defense-related genes of the plants in the salicylic acid and jasmonic acid pathways were enhanced. It was also found that strain SQY 162 could secrete antibiotic surfactin, but not volatile organic compounds, to suppress Ralstonia . The strain could also produce plant growth promotion compounds such as siderophores and indole-3-acetic acid. Thus, owing to its innate multiple-functional traits and its broad biocontrol activities, we found that this antagonistic strain isolated from the tobacco rhizosphere could establish itself successfully in the tomato rhizosphere to control soilborne diseases.

  13. Comparative Genomic Analyses of the Bacterial Phosphotransferase System

    PubMed Central

    Barabote, Ravi D.; Saier, Milton H.

    2005-01-01

    We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738

  14. Carbendazim induces a temporary change in soil bacterial community structure.

    PubMed

    Wang, Xiuguo; Song, Min; Gao, Chunming; Dong, Bin; Zhang, Qun; Fang, Hua; Yu, Yunlong

    2009-01-01

    The effect of carbendazim applications on the diversity and structure of a soil bacterial community was studied under field conditions using temperature gradient gel electrophoresis (TGGE) and partial sequence analysis of PCR-amplified 16S rRNA gene. After four successive introductions of carbendazim at a level of 0.94 kg active ingredient (a.i.)/ha, the genetic diversity (expressed as Shannon index, H') decreased from 1.43 in the control to 1.29 in treated soil. This harmful effect seems to increase with the concentration of carbendazim. The value of H' in the soil treated with carbendazim at 4.70 kg a.i./ha was reduced to 1.05 (P < or = 0.05). The structure of soil bacterial community was also affected after four repeated applications of carbendazim at levels of 0.94, 1.88 and 4.70 kg a.i./ha, as seen in the relative intensities of the individual band. However, the bacterial community in carbendazim-treated soil recovered to that in the control 360 d after the first treatment. The results indicated that repeated applications of carbendazim could reduce soil microbial diversity and alter the bacterial community structure temporarily.

  15. Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection.

    PubMed

    Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J

    2018-04-01

    Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Assessment of Bacterial bph Gene in Amazonian Dark Earth and Their Adjacent Soils

    PubMed Central

    Brossi, Maria Julia de Lima; Mendes, Lucas William; Germano, Mariana Gomes; Lima, Amanda Barbosa; Tsai, Siu Mui

    2014-01-01

    Amazonian Anthrosols are known to harbour distinct and highly diverse microbial communities. As most of the current assessments of these communities are based on taxonomic profiles, the functional gene structure of these communities, such as those responsible for key steps in the carbon cycle, mostly remain elusive. To gain insights into the diversity of catabolic genes involved in the degradation of hydrocarbons in anthropogenic horizons, we analysed the bacterial bph gene community structure, composition and abundance using T-RFLP, 454-pyrosequencing and quantitative PCR essays, respectively. Soil samples were collected in two Brazilian Amazon Dark Earth (ADE) sites and at their corresponding non-anthropogenic adjacent soils (ADJ), under two different land use systems, secondary forest (SF) and manioc cultivation (M). Redundancy analysis of T-RFLP data revealed differences in bph gene structure according to both soil type and land use. Chemical properties of ADE soils, such as high organic carbon and organic matter, as well as effective cation exchange capacity and pH, were significantly correlated with the structure of bph communities. Also, the taxonomic affiliation of bph gene sequences revealed the segregation of community composition according to the soil type. Sequences at ADE sites were mostly affiliated to aromatic hydrocarbon degraders belonging to the genera Streptomyces, Sphingomonas, Rhodococcus, Mycobacterium, Conexibacter and Burkholderia. In both land use sites, shannon's diversity indices based on the bph gene data were higher in ADE than ADJ soils. Collectively, our findings provide evidence that specific properties in ADE soils shape the structure and composition of bph communities. These results provide a basis for further investigations focusing on the bio-exploration of novel enzymes with potential use in the biotechnology/biodegradation industry. PMID:24927167

  17. Assessment of bacterial bph gene in Amazonian dark earth and their adjacent soils.

    PubMed

    Brossi, Maria Julia de Lima; Mendes, Lucas William; Germano, Mariana Gomes; Lima, Amanda Barbosa; Tsai, Siu Mui

    2014-01-01

    Amazonian Anthrosols are known to harbour distinct and highly diverse microbial communities. As most of the current assessments of these communities are based on taxonomic profiles, the functional gene structure of these communities, such as those responsible for key steps in the carbon cycle, mostly remain elusive. To gain insights into the diversity of catabolic genes involved in the degradation of hydrocarbons in anthropogenic horizons, we analysed the bacterial bph gene community structure, composition and abundance using T-RFLP, 454-pyrosequencing and quantitative PCR essays, respectively. Soil samples were collected in two Brazilian Amazon Dark Earth (ADE) sites and at their corresponding non-anthropogenic adjacent soils (ADJ), under two different land use systems, secondary forest (SF) and manioc cultivation (M). Redundancy analysis of T-RFLP data revealed differences in bph gene structure according to both soil type and land use. Chemical properties of ADE soils, such as high organic carbon and organic matter, as well as effective cation exchange capacity and pH, were significantly correlated with the structure of bph communities. Also, the taxonomic affiliation of bph gene sequences revealed the segregation of community composition according to the soil type. Sequences at ADE sites were mostly affiliated to aromatic hydrocarbon degraders belonging to the genera Streptomyces, Sphingomonas, Rhodococcus, Mycobacterium, Conexibacter and Burkholderia. In both land use sites, shannon's diversity indices based on the bph gene data were higher in ADE than ADJ soils. Collectively, our findings provide evidence that specific properties in ADE soils shape the structure and composition of bph communities. These results provide a basis for further investigations focusing on the bio-exploration of novel enzymes with potential use in the biotechnology/biodegradation industry.

  18. Role of the gut microbiota in host appetite control: bacterial growth to animal feeding behaviour.

    PubMed

    Fetissov, Sergueï O

    2017-01-01

    The life of all animals is dominated by alternating feelings of hunger and satiety - the main involuntary motivations for feeding-related behaviour. Gut bacteria depend fully on their host for providing the nutrients necessary for their growth. The intrinsic ability of bacteria to regulate their growth and to maintain their population within the gut suggests that gut bacteria can interfere with molecular pathways controlling energy balance in the host. The current model of appetite control is based mainly on gut-brain signalling and the animal's own needs to maintain energy homeostasis; an alternative model might also involve bacteria-host communications. Several bacterial components and metabolites have been shown to stimulate intestinal satiety pathways; at the same time, their production depends on bacterial growth cycles. This short-term bacterial growth-linked modulation of intestinal satiety can be coupled with long-term regulation of appetite, controlled by the neuropeptidergic circuitry in the hypothalamus. Indeed, several bacterial products are detected in the systemic circulation, which might act directly on hypothalamic neurons. This Review analyses the data relevant to possible involvement of the gut bacteria in the regulation of host appetite and proposes an integrative homeostatic model of appetite control that includes energy needs of both the host and its gut bacteria.

  19. Identification and transcriptional profile of multiple genes in the posterior kidney of Nile tilapia at 6h post bacterial infections

    USDA-ARS?s Scientific Manuscript database

    To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

  20. Capturing Early Changes in the Marine Bacterial Community as a Result of Crude Oil Pollution in a Mesocosm Experiment.

    PubMed

    Krolicka, Adriana; Boccadoro, Catherine; Nilsen, Mari Mæland; Baussant, Thierry

    2017-12-27

    The results of marine bacterial community succession from a short-term study of seawater incubations at 4°C to North Sea crude oil are presented herein. Oil was used alone (O) or in combination with a dispersant (OD). Marine bacterial communities resulting from these incubations were characterized by a fingerprinting analysis and pyrosequencing of the 16S rRNA gene with the aim of 1) revealing differences in bacterial communities between the control, O treatment, and OD treatment and 2) identifying the operational taxonomic units (OTUs) of early responders in order to define the bacterial gene markers of oil pollution for in situ monitoring.After an incubation for 1 d, the distribution of the individual ribotypes of bacterial communities in control and oil-treated (O and OD) tanks differed. Differences related to the structures of bacterial communities were observed at later stages of the incubation. Among the early responders identified (Pseudoalteromonas, Sulfitobacter, Vibrio, Pseudomonas, Glaciecola, Neptunomonas, Methylophaga, and Pseudofulvibacter), genera that utilize a disintegrated biomass or hydrocarbons as well as biosurfactant producers were detected. None of these genera included obligate hydrocarbonoclastic bacteria (OHCB). After an incubation for 1 d, the abundances of Glaciecola and Pseudofulvibacter were approximately 30-fold higher in the OD and O tanks than in the control tank. OTUs assigned to the Glaciecola genus were represented more in the OD tank, while those of Pseudofulvibacter were represented more in the O tank. We also found that 2 to 3% of the structural community shift originated from the bacterial community in the oil itself, with Polaribacter being a dominant bacterium.

  1. Comparing wastewater chemicals, indicator bacteria concentrations, and bacterial pathogen genes as fecal pollution indicators

    USGS Publications Warehouse

    Haack, S.K.; Duris, J.W.; Fogarty, L.R.; Kolpin, D.W.; Focazio, M.J.; Furlong, E.T.; Meyer, M.T.

    2009-01-01

    The objective of this study was to compare fecal indicator bacteria (FIB) (fecal coliforms, Escherichia coli [EC], and enterococci [ENT]) concentrations with a wide array of typical organic wastewater chemicals and selected bacterial genes as indicators of fecal pollution in water samples collected at or near 18 surface water drinking water intakes. Genes tested included esp (indicating human-pathogenic ENT) and nine genes associated with various animal sources of shiga-toxin-producing EC (STEC). Fecal pollution was indicated by genes and/or chemicals for 14 of the 18 tested samples, with little relation to FIB standards. Of 13 samples with <50 EC 100 mL-1, human pharmaceuticals or chemical indicators of wastewater treatment plant effluent occurred in six, veterinary antibiotics were detected in three, and stx1 or stx2 genes (indicating varying animal sources of STEC) were detected in eight. Only the EC eaeA gene was positively correlated with FIB concentrations. Human-source fecal pollution was indicated by the esp gene and the human pharmaceutical carbamazepine in one of the nine samples that met all FIB recreational water quality standards. Escherichia coli rfbO157 and stx2c genes, which are typically associated with cattle sources and are of potential human health significance, were detected in one sample in the absence of tested chemicals. Chemical and gene-based indicators of fecal contamination may be present even when FIB standards are met, and some may, unlike FIB, indicate potential sources. Application of multiple water quality indicators with variable environmental persistence and fate may yield greater confidence in fecal pollution assessment and may inform remediation decisions. Copyright ?? 2009 by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America. All rights reserved.

  2. How controlled release technology can aid gene delivery.

    PubMed

    Jo, Jun-Ichiro; Tabata, Yasuhiko

    2015-01-01

    Many types of gene delivery systems have been developed to enhance the level of gene expression. Controlled release technology is a feasible gene delivery system which enables genes to extend the expression duration by maintaining and releasing them at the injection site in a controlled manner. This technology can reduce the adverse effects by the bolus dose administration and avoid the repeated administration. Biodegradable biomaterials are useful as materials for the controlled release-based gene delivery technology and various biodegradable biomaterials have been developed. Controlled release-based gene delivery plays a critical role in a conventional gene therapy and genetic engineering. In the gene therapy, the therapeutic gene is released from biodegradable biomaterial matrices around the tissue to be treated. On the other hand, the intracellular controlled release of gene from the sub-micro-sized matrices is required for genetic engineering. Genetic engineering is feasible for cell transplantation as well as research of stem cells biology and medicine. DNA hydrogel containing a sequence of therapeutic gene and the exosome including the individual specific nucleic acids may become candidates for controlled release carriers. Technologies to deliver genes to cell aggregates will play an important role in the promotion of regenerative research and therapy.

  3. Adsorption of bacterial plasmids in pure mineral mixtures

    NASA Astrophysics Data System (ADS)

    Zhang, L.; Cochran, J. P.; Seaman, J. C.; Parrott, B.

    2017-12-01

    Microorganisms play an important role in controlling the fate and transport of subsurface contaminants through the direct degradation of organic contaminants to the control of chemical redox conditions that impact the speciation and partitioning of inorganic contaminants. Genes that control these processes, including the relative tolerance associated with direct exposure to toxic contaminants, are found within the bacteria's chromosomal DNA and also within distinct, circular DNA elements called plasmids. Plasmids are mobile genetic elements that can be exchanged with other bacterial species through horizontal gene transfer (HGT). The frequency of HGT in soil is influenced by several factors, with the physicochemical characteristics of soil possibly being a primary factor. Thus, the objective for our research was to determine the movement and persistence of bacterial plasmids within soil. Our current study focuses on batch sorption experiments designed to evaluate the partitioning of bacterial plasmids in idealized mineral mixtures that represent the clay mineralogy of highly weathered soils of the Southeastern US. Specifically, we compared plasmid adsorption among pure goethite, kaolinite, and a mixture of goethite and kaolinite. We also determined the adsorption of plasmids on the above minerals over increasing pH (3 to 10). Our results show that adsorption decreased in the following order: goethite > kaolinite > mixture of goethite and kaolinite. We also found that plasmids adsorption was higher at lower pH levels, with pH 3 having the adsorption maximum. However, at pH 3, DNA denaturing may have occurred, leading to aggregation or precipitation of plasmids on the mineral surfaces. Our study was the first steps in determining the influence of soil properties on plasmid adsorption. Our future goals are to determine the adsorption in other pure minerals and in natural soils.

  4. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    PubMed

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  5. Influence of uranium on bacterial communities: a comparison of natural uranium-rich soils with controls.

    PubMed

    Mondani, Laure; Benzerara, Karim; Carrière, Marie; Christen, Richard; Mamindy-Pajany, Yannick; Février, Laureline; Marmier, Nicolas; Achouak, Wafa; Nardoux, Pascal; Berthomieu, Catherine; Chapon, Virginie

    2011-01-01

    This study investigated the influence of uranium on the indigenous bacterial community structure in natural soils with high uranium content. Radioactive soil samples exhibiting 0.26% - 25.5% U in mass were analyzed and compared with nearby control soils containing trace uranium. EXAFS and XRD analyses of soils revealed the presence of U(VI) and uranium-phosphate mineral phases, identified as sabugalite and meta-autunite. A comparative analysis of bacterial community fingerprints using denaturing gradient gel electrophoresis (DGGE) revealed the presence of a complex population in both control and uranium-rich samples. However, bacterial communities inhabiting uraniferous soils exhibited specific fingerprints that were remarkably stable over time, in contrast to populations from nearby control samples. Representatives of Acidobacteria, Proteobacteria, and seven others phyla were detected in DGGE bands specific to uraniferous samples. In particular, sequences related to iron-reducing bacteria such as Geobacter and Geothrix were identified concomitantly with iron-oxidizing species such as Gallionella and Sideroxydans. All together, our results demonstrate that uranium exerts a permanent high pressure on soil bacterial communities and suggest the existence of a uranium redox cycle mediated by bacteria in the soil.

  6. Influence of Uranium on Bacterial Communities: A Comparison of Natural Uranium-Rich Soils with Controls

    PubMed Central

    Mondani, Laure; Benzerara, Karim; Carrière, Marie; Christen, Richard; Mamindy-Pajany, Yannick; Février, Laureline; Marmier, Nicolas; Achouak, Wafa; Nardoux, Pascal; Berthomieu, Catherine; Chapon, Virginie

    2011-01-01

    This study investigated the influence of uranium on the indigenous bacterial community structure in natural soils with high uranium content. Radioactive soil samples exhibiting 0.26% - 25.5% U in mass were analyzed and compared with nearby control soils containing trace uranium. EXAFS and XRD analyses of soils revealed the presence of U(VI) and uranium-phosphate mineral phases, identified as sabugalite and meta-autunite. A comparative analysis of bacterial community fingerprints using denaturing gradient gel electrophoresis (DGGE) revealed the presence of a complex population in both control and uranium-rich samples. However, bacterial communities inhabiting uraniferous soils exhibited specific fingerprints that were remarkably stable over time, in contrast to populations from nearby control samples. Representatives of Acidobacteria, Proteobacteria, and seven others phyla were detected in DGGE bands specific to uraniferous samples. In particular, sequences related to iron-reducing bacteria such as Geobacter and Geothrix were identified concomitantly with iron-oxidizing species such as Gallionella and Sideroxydans. All together, our results demonstrate that uranium exerts a permanent high pressure on soil bacterial communities and suggest the existence of a uranium redox cycle mediated by bacteria in the soil. PMID:21998695

  7. Abundances and profiles of antibiotic resistance genes as well as co-occurrences with human bacterial pathogens in ship ballast tank sediments from a shipyard in Jiangsu Province, China.

    PubMed

    Lv, Baoyi; Cui, Yuxue; Tian, Wen; Li, Jing; Xie, Bing; Yin, Fang

    2018-08-15

    Ship ballasting operations may transfer harmful aquatic organisms across global ocean. This study aims to reveal the occurrences and abundances of antibiotic resistance genes (ARGs) and human bacterial pathogens (HBPs) in ballast tank sediments. Nine samples were collected and respectively analyzed by real-time quantitative PCR and high-throughput sequencing technologies. Ten ARGs (aadA1, blaCTX-M, blaTEM, ermB, mefA, strB, sul1, sul2, tetM, and tetQ) and the Class-I integron gene (intI1) were highly prevalent (10 5 -10 9 gene copies/g) in ballast tank sediments. The sul1 was the most abundant ARG with the concentration of 10 8 -10 9 copies/g and intI1 was much more abundant than the ARGs in ballast tank sediments. The strong positive correlations between intI1 and ARGs (blaCTX-M, sul1, sul2 and tetM) indicated the potential spread of ARGs via horizontal gene transfer. In ballast tank sediments, 44 bacterial species were identified as HBPs and accounted for 0.13-21.46% of the total bacterial population although the three indicator pathogenic microbes (Vibrio cholerae, Escherichia coli, and Enterococci) proposed by the International Maritime Organization were not detected. Pseudomonas pseudoalcaligenes, Enterococcus hirae, Shigella sonnei and Bacillus anthracis were the dominant pathogens in ballast tank sediments. Zn and P in sediments had positive effects on the ARGs. Network analysis results indicated that sul1 and sul2 genes existed in several bacterial pathogens. Ballast tank sediments could be regarded as a carrier for the migration of ARGs. It is important to manage ballast tank sediments reasonably in order to prevent the dissemination of ARGs and bacterial pathogens. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    PubMed

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  9. Crosstalk between vertical and horizontal gene transfer: plasmid replication control by a conjugative relaxase

    PubMed Central

    Lorenzo-Díaz, Fabián; Fernández-López, Cris; Lurz, Rudi

    2017-01-01

    Abstract Horizontal gene transfer is a key process in the evolution of bacteria and also represents a source of genetic variation in eukaryotes. Among elements participating in gene transfer, thousands of small (<10 kb) mobile bacterial plasmids that replicate by the rolling circle mechanism represent a driving force in the spread of antibiotic resistances. In general, these plasmids are built as genetic modules that encode a replicase, an antibiotic-resistance determinant, and a relaxase that participates in their conjugative mobilization. Further, they control their relatively high copy number (∼30 copies per genome equivalent) by antisense RNAs alone or combined with a repressor protein. We report here that the MobM conjugative relaxase encoded by the promiscuous plasmid pMV158 participates in regulation of the plasmid copy number by transcriptional repression of the antisense RNA, thus increasing the number of plasmid molecules ready to be horizontally transferred (mobilization) and/or vertically inherited (replication). This type of crosstalk between genetic modules involved in vertical and horizontal gene flow has not been reported before. PMID:28525572

  10. Control of Flagellar Gene Regulation in Legionella pneumophila and Its Relation to Growth Phase▿ †

    PubMed Central

    Albert-Weissenberger, Christiane; Sahr, Tobias; Sismeiro, Odile; Hacker, Jörg; Heuner, Klaus; Buchrieser, Carmen

    2010-01-01

    The bacterial pathogen Legionella pneumophila responds to environmental changes by differentiation. At least two forms are well described: replicative bacteria are avirulent; in contrast, transmissive bacteria express virulence traits and flagella. Phenotypic analysis, Western blotting, and electron microscopy of mutants of the regulatory genes encoding RpoN, FleQ, FleR, and FliA demonstrated that flagellin expression is strongly repressed and that the mutants are nonflagellated in the transmissive phase. Transcriptome analyses elucidated that RpoN, together with FleQ, enhances transcription of 14 out of 31 flagellar class II genes, which code for the basal body, hook, and regulatory proteins. Unexpectedly, FleQ independent of RpoN enhances the transcription of fliA encoding sigma 28. Expression analysis of a fliA mutant showed that FliA activates three out of the five remaining flagellar class III genes and the flagellar class IV genes. Surprisingly, FleR does not induce but inhibits expression of at least 14 flagellar class III genes on the transcriptional level. Thus, we propose that flagellar class II genes are controlled by FleQ and RpoN, whereas the transcription of the class III gene fliA is controlled in a FleQ-dependent but RpoN-independent manner. However, RpoN and FleR might influence flagellin synthesis on a posttranscriptional level. In contrast to the commonly accepted view that enhancer-binding proteins such as FleQ always interact with RpoN to fullfill their regulatory functions, our results strongly indicate that FleQ regulates gene expression that is RpoN dependent and RpoN independent. Finally, FliA induces expression of flagellar class III and IV genes leading to the complete synthesis of the flagellum. PMID:19915024

  11. Bacterial disease management: challenges, experience, innovation and future prospects: Challenges in Bacterial Molecular Plant Pathology.

    PubMed

    Sundin, George W; Castiblanco, Luisa F; Yuan, Xiaochen; Zeng, Quan; Yang, Ching-Hong

    2016-12-01

    only identify optimal targets in the pathogens, but also optimal seasonal timings for deployment. Host resistance to effectors must be exploited, carefully and correctly. Are there other candidate genes that could be targeted in transgenic approaches? How can new technologies (CRISPR, TALEN, etc.) be most effectively used to add sustainable disease resistance to existing commercially desirable plant cultivars? We need an insider's perspective on the management of systemic pathogens. In addition to host resistance or reduced sensitivity, are there other methods that can be used to target these pathogen groups? Biological systems are variable. Can biological control strategies be improved for bacterial disease management and be made more predictable in function? The answers to the research foci outlined above are not all available, as will become apparent in this article, but we are heading in the right direction. In this article, we summarize the contributions from past experiences in bacterial disease management, and also describe how advances in bacterial genetics, genomics and host-pathogen interactions are informing novel strategies in virulence inhibition and in host resistance. We also outline potential innovations that could be exploited as the pressures to maximize a safe and productive food supply continue to become more numerous and more complex. © 2016 BSPP and John Wiley & Sons Ltd.

  12. Non-coding-regulatory regions of human brain genes delineated by bacterial artificial chromosome knock-in mice.

    PubMed

    Schmouth, Jean-François; Castellarin, Mauro; Laprise, Stéphanie; Banks, Kathleen G; Bonaguro, Russell J; McInerny, Simone C; Borretta, Lisa; Amirabbasi, Mahsa; Korecki, Andrea J; Portales-Casamar, Elodie; Wilson, Gary; Dreolini, Lisa; Jones, Steven J M; Wasserman, Wyeth W; Goldowitz, Daniel; Holt, Robert A; Simpson, Elizabeth M

    2013-10-14

    The next big challenge in human genetics is understanding the 98% of the genome that comprises non-coding DNA. Hidden in this DNA are sequences critical for gene regulation, and new experimental strategies are needed to understand the functional role of gene-regulation sequences in health and disease. In this study, we build upon our HuGX ('high-throughput human genes on the X chromosome') strategy to expand our understanding of human gene regulation in vivo. In all, ten human genes known to express in therapeutically important brain regions were chosen for study. For eight of these genes, human bacterial artificial chromosome clones were identified, retrofitted with a reporter, knocked single-copy into the Hprt locus in mouse embryonic stem cells, and mouse strains derived. Five of these human genes expressed in mouse, and all expressed in the adult brain region for which they were chosen. This defined the boundaries of the genomic DNA sufficient for brain expression, and refined our knowledge regarding the complexity of gene regulation. We also characterized for the first time the expression of human MAOA and NR2F2, two genes for which the mouse homologs have been extensively studied in the central nervous system (CNS), and AMOTL1 and NOV, for which roles in CNS have been unclear. We have demonstrated the use of the HuGX strategy to functionally delineate non-coding-regulatory regions of therapeutically important human brain genes. Our results also show that a careful investigation, using publicly available resources and bioinformatics, can lead to accurate predictions of gene expression.

  13. QTLs for Resistance to Major Rice Diseases Exacerbated by Global Warming: Brown Spot, Bacterial Seedling Rot, and Bacterial Grain Rot.

    PubMed

    Mizobuchi, Ritsuko; Fukuoka, Shuichi; Tsushima, Seiya; Yano, Masahiro; Sato, Hiroyuki

    2016-12-01

    In rice (Oryza sativa L.), damage from diseases such as brown spot, caused by Bipolaris oryzae, and bacterial seedling rot and bacterial grain rot, caused by Burkholderia glumae, has increased under global warming because the optimal temperature ranges for growth of these pathogens are relatively high (around 30 °C). Therefore, the need for cultivars carrying genes for resistance to these diseases is increasing to ensure sustainable rice production. In contrast to the situation for other important rice diseases such as blast and bacterial blight, no genes for complete resistance to brown spot, bacterial seedling rot or bacterial grain rot have yet been discovered. Thus, rice breeders have to use partial resistance, which is largely influenced by environmental conditions. Recent progress in molecular genetics and improvement of evaluation methods for disease resistance have facilitated detection of quantitative trait loci (QTLs) associated with resistance. In this review, we summarize the results of worldwide screening for cultivars with resistance to brown spot, bacterial seedling rot and bacterial grain rot and we discuss the identification of QTLs conferring resistance to these diseases in order to provide useful information for rice breeding programs.

  14. Expression of the Nitric Oxide Synthase 2 Gene Is Not Essential for Early Control of Mycobacterium tuberculosis in the Murine Lung

    PubMed Central

    Cooper, Andrea M.; Pearl, John E.; Brooks, Jason V.; Ehlers, Stefan; Orme, Ian M.

    2000-01-01

    The interleukin-12 and gamma interferon (IFN-γ) pathway of macrophage activation plays a pivotal role in controlling tuberculosis. In the murine model, the generation of supplementary nitric oxide by the induction of the nitric oxide synthase 2 (NOS2) gene product is considered the principal antimicrobial mechanism of IFN-γ-activated macrophages. Using a low-dose aerosol-mediated infection model in the mouse, we have investigated the role of nitric oxide in controlling Mycobacterium tuberculosis in the lung. In contrast to the consequences of a systemic infection, a low dose of bacteria introduced directly into the lungs of mice lacking the NOS2 gene is controlled almost as well as in intact animals. This is in contrast to the rapid progression of disease in mice lacking IFN-γ or a key member of the IFN signaling pathway, interferon regulatory factor 1. Thus while IFN-γ is pivotal in early control of bacterial growth in the lung, this control does not completely depend upon the expression of the NOS2 gene. The absence of inducible nitric oxide in the lung does, however, result in increased polymorphonuclear cell involvement and eventual necrosis in the pulmonary granulomas of the infected mice lacking the NOS2 gene. PMID:11083808

  15. Linking internal and external bacterial community control gives mechanistic framework for pelagic virus-to-bacteria ratios.

    PubMed

    Våge, Selina; Pree, Bernadette; Thingstad, T Frede

    2016-11-01

    For more than 25 years, virus-to-bacteria ratios (VBR) have been measured and interpreted as indicators of the importance of viruses in aquatic ecosystems, yet a generally accepted theory for understanding mechanisms controlling VBR is still lacking. Assuming that the denominator (total bacterial abundance) is primarily predator controlled, while viral lysis compensates for host growth rates exceeding this grazing loss, the numerator (viral abundance) reflects activity differences between prokaryotic hosts. VBR is then a ratio between mechanisms generating structure within the bacterial community and interactions between different plankton functional types controlling bacterial community size. We here show how these arguments can be formalized by combining a recently published model for co-evolutionary host-virus interactions, with a previously published "minimum" model for the microbial food web. The result is a framework where viral lysis links bacterial diversity to microbial food web structure and function, creating relationships between different levels of organization that are strongly modified by organism-level properties such as cost of resistance. © 2016 The Authors. Environmental Microbiology Reports published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Linking internal and external bacterial community control gives mechanistic framework for pelagic virus‐to‐bacteria ratios

    PubMed Central

    Pree, Bernadette; Thingstad, T. Frede

    2016-01-01

    Summary For more than 25 years, virus‐to‐bacteria ratios (VBR) have been measured and interpreted as indicators of the importance of viruses in aquatic ecosystems, yet a generally accepted theory for understanding mechanisms controlling VBR is still lacking. Assuming that the denominator (total bacterial abundance) is primarily predator controlled, while viral lysis compensates for host growth rates exceeding this grazing loss, the numerator (viral abundance) reflects activity differences between prokaryotic hosts. VBR is then a ratio between mechanisms generating structure within the bacterial community and interactions between different plankton functional types controlling bacterial community size. We here show how these arguments can be formalized by combining a recently published model for co‐evolutionary host‐virus interactions, with a previously published “minimum” model for the microbial food web. The result is a framework where viral lysis links bacterial diversity to microbial food web structure and function, creating relationships between different levels of organization that are strongly modified by organism‐level properties such as cost of resistance. PMID:27231817

  17. RNA search engines empower the bacterial intranet.

    PubMed

    Dendooven, Tom; Luisi, Ben F

    2017-08-15

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

  18. RNA search engines empower the bacterial intranet

    PubMed Central

    Dendooven, Tom

    2017-01-01

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287

  19. Inheritance of bacterial spot resistance in Capsicum annuum var. annuum.

    PubMed

    Silva, L R A; Rodrigues, R; Pimenta, S; Correa, J W S; Araújo, M S B; Bento, C S; Sudré, C P

    2017-04-20

    Since 2008, Brazil is the largest consumer of agrochemicals, which increases production costs and risks of agricultural products, environment, and farmers' contamination. Sweet pepper, which is one of the main consumed vegetables in the country, is on top of the list of the most sprayed crops. The bacterial spot, caused by Xanthomonas spp, is one of the most damaging diseases of pepper crops. Genetic resistant consists of a suitable way of disease control, but development of durable resistant cultivars as well as understanding of plant-bacterium interaction is being a challenge for plant breeders and pathologists worldwide. Inheritance of disease resistance is often variable, depending on genetic background of the parents. The knowledge of the genetic base controlling such resistance is the first step in a breeding program aiming to develop new genotypes, bringing together resistance and other superior agronomic traits. This study reports the genetic basis of bacterial spot resistance in Capsicum annuum var. annuum using mean generation analysis from crosses between accessions UENF 2285 (susceptible) and UENF 1381 (resistant). The plants of each generation were grown in a greenhouse and leaflets were inoculated with bacterial strain ENA 4135 at 10 5 CFU/mL in 1.0 cm 2 of the mesophyll. Evaluations were performed using a scoring scale whose grades ranged from 1.0 (resistant) to 5.0 (susceptible), depending on symptom manifestation. Genetic control of bacterial spot has a quantitative aspect, with higher additive effect. The quantitative analysis showed that five genes were the minimum number controlling bacterial spot resistance. Additive effect was higher (6.06) than dominant (3.31) and explained 86.36% of total variation.

  20. A Glycine Riboswitch in Streptococcus pyogenes Controls Expression of a Sodium:Alanine Symporter Family Protein Gene.

    PubMed

    Khani, Afsaneh; Popp, Nicole; Kreikemeyer, Bernd; Patenge, Nadja

    2018-01-01

    Regulatory RNAs play important roles in the control of bacterial gene expression. In this study, we investigated gene expression regulation by a putative glycine riboswitch located in the 5'-untranslated region of a sodium:alanine symporter family (SAF) protein gene in the group A Streptococcus pyogenes serotype M49 strain 591. Glycine-dependent gene expression mediated by riboswitch activity was studied using a luciferase reporter gene system. Maximal reporter gene expression was observed in the absence of glycine and in the presence of low glycine concentrations. Differences in glycine-dependent gene expression were not based on differential promoter activity. Expression of the SAF protein gene and the downstream putative cation efflux protein gene was investigated in wild-type bacteria by RT-qPCR transcript analyses. During growth in the presence of glycine (≥1 mM), expression of the genes were downregulated. Northern blot analyses revealed premature transcription termination in the presence of high glycine concentrations. Growth in the presence of 0.1 mM glycine led to the production of a full-length transcript. Furthermore, stability of the SAF protein gene transcript was drastically reduced in the presence of glycine. We conclude that the putative glycine riboswitch in S. pyogenes serotype M49 strain 591 represses expression of the SAF protein gene and the downstream putative cation efflux protein gene in the presence of high glycine concentrations. Sequence and secondary structure comparisons indicated that the streptococcal riboswitch belongs to the class of tandem aptamer glycine riboswitches.

  1. The physicochemical process of bacterial attachment to abiotic surfaces: Challenges for mechanistic studies, predictability and the development of control strategies.

    PubMed

    Wang, Yi; Lee, Sui Mae; Dykes, Gary

    2015-01-01

    Bacterial attachment to abiotic surfaces can be explained as a physicochemical process. Mechanisms of the process have been widely studied but are not yet well understood due to their complexity. Physicochemical processes can be influenced by various interactions and factors in attachment systems, including, but not limited to, hydrophobic interactions, electrostatic interactions and substratum surface roughness. Mechanistic models and control strategies for bacterial attachment to abiotic surfaces have been established based on the current understanding of the attachment process and the interactions involved. Due to a lack of process control and standardization in the methodologies used to study the mechanisms of bacterial attachment, however, various challenges are apparent in the development of models and control strategies. In this review, the physicochemical mechanisms, interactions and factors affecting the process of bacterial attachment to abiotic surfaces are described. Mechanistic models established based on these parameters are discussed in terms of their limitations. Currently employed methods to study these parameters and bacterial attachment are critically compared. The roles of these parameters in the development of control strategies for bacterial attachment are reviewed, and the challenges that arise in developing mechanistic models and control strategies are assessed.

  2. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

    PubMed Central

    Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

    2012-01-01

    Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

  3. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    PubMed

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  4. Bacteriophages for detection and control of bacterial pathogens in food and food-processing environment.

    PubMed

    Brovko, Lubov Y; Anany, Hany; Griffiths, Mansel W

    2012-01-01

    This chapter presents recent advances in bacteriophage research and their application in the area of food safety. Section 1 describes general facts on phage biology that are relevant to their application for control and detection of bacterial pathogens in food and environmental samples. Section 2 summarizes the recently acquired data on application of bacteriophages to control growth of bacterial pathogens and spoilage organisms in food and food-processing environment. Section 3 deals with application of bacteriophages for detection and identification of bacterial pathogens. Advantages of bacteriophage-based methods are presented and their shortcomings are discussed. The chapter is intended for food scientist and food product developers, and people in food inspection and health agencies with the ultimate goal to attract their attention to the new developing technology that has a tremendous potential in providing means for producing wholesome and safe food. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Capturing Early Changes in the Marine Bacterial Community as a Result of Crude Oil Pollution in a Mesocosm Experiment

    PubMed Central

    Krolicka, Adriana; Boccadoro, Catherine; Nilsen, Mari Mæland; Baussant, Thierry

    2017-01-01

    The results of marine bacterial community succession from a short-term study of seawater incubations at 4°C to North Sea crude oil are presented herein. Oil was used alone (O) or in combination with a dispersant (OD). Marine bacterial communities resulting from these incubations were characterized by a fingerprinting analysis and pyrosequencing of the 16S rRNA gene with the aim of 1) revealing differences in bacterial communities between the control, O treatment, and OD treatment and 2) identifying the operational taxonomic units (OTUs) of early responders in order to define the bacterial gene markers of oil pollution for in situ monitoring. After an incubation for 1 d, the distribution of the individual ribotypes of bacterial communities in control and oil-treated (O and OD) tanks differed. Differences related to the structures of bacterial communities were observed at later stages of the incubation. Among the early responders identified (Pseudoalteromonas, Sulfitobacter, Vibrio, Pseudomonas, Glaciecola, Neptunomonas, Methylophaga, and Pseudofulvibacter), genera that utilize a disintegrated biomass or hydrocarbons as well as biosurfactant producers were detected. None of these genera included obligate hydrocarbonoclastic bacteria (OHCB). After an incubation for 1 d, the abundances of Glaciecola and Pseudofulvibacter were approximately 30-fold higher in the OD and O tanks than in the control tank. OTUs assigned to the Glaciecola genus were represented more in the OD tank, while those of Pseudofulvibacter were represented more in the O tank. We also found that 2 to 3% of the structural community shift originated from the bacterial community in the oil itself, with Polaribacter being a dominant bacterium. PMID:29187706

  6. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  7. Temperature controls on aquatic bacterial production and community dynamics in arctic lakes and streams.

    PubMed

    Adams, Heather E; Crump, Byron C; Kling, George W

    2010-05-01

    The impact of temperature on bacterial activity and community composition was investigated in arctic lakes and streams in northern Alaska. Aquatic bacterial communities incubated at different temperatures had different rates of production, as measured by (14)C-leucine uptake, indicating that populations within the communities had different temperature optima. Samples from Toolik Lake inlet and outlet were collected at water temperatures of 14.2 degrees C and 15.9 degrees C, respectively, and subsamples incubated at temperatures ranging from 6 degrees C to 20 degrees C. After 5 days, productivity rates varied from 0.5 to approximately 13.7 microg C l(-1) day(-1) and two distinct activity optima appeared at 12 degrees C and 20 degrees C. At these optima, activity was 2- to 11-fold higher than at other incubation temperatures. The presence of two temperature optima indicates psychrophilic and psychrotolerant bacteria dominate under different conditions. Community fingerprinting via denaturant gradient gel electrophoresis (DGGE) of 16S rRNA genes showed strong shifts in the composition of communities driven more by temperature than by differences in dissolved organic matter source; e.g. four and seven unique operational taxonomic units (OTUs) were found only at 2 degrees C and 25 degrees C, respectively, and not found at other incubation temperatures after 5 days. The impact of temperature on bacteria is complex, influencing both bacterial productivity and community composition. Path analysis of measurements of 24 streams and lakes sampled across a catchment 12 times in 4 years indicates variable timing and strength of correlation between temperature and bacterial production, possibly due to bacterial community differences between sites. As indicated by both field and laboratory experiments, shifts in dominant community members can occur on ecologically relevant time scales (days), and have important implications for understanding the relationship of bacterial

  8. Fitness and Recovery of Bacterial Communities and Antibiotic Resistance Genes in Urban Wastewaters Exposed to Classical Disinfection Treatments.

    PubMed

    Di Cesare, Andrea; Fontaneto, Diego; Doppelbauer, Julia; Corno, Gianluca

    2016-09-20

    Antibiotic resistance genes (ARGs) are increasingly appreciated to be important as micropollutants. Indirectly produced by human activities, they are released into the environment, as they are untargeted by conventional wastewater treatments. In order to understand the fate of ARGs and of other resistant forms (e.g., phenotypical adaptations) in urban wastewater treatment plants (WWTPs), we monitored three WWTPs with different disinfection processes (chlorine, peracetic acid (PAA), and ultraviolet light (UV)). We monitored WWTPs influx and pre- and postdisinfection effluent over 24 h, followed by incubation experiments lasting for 96 h. We measured bacterial abundance, size distribution and aggregational behavior, the proportion of intact (active) cells, and the abundances of four ARGs and of the mobile element integron1. While all the predisinfection treatments of all WWTPs removed the majority of bacteria and of associated ARGs, of the disinfection processes only PAA efficiently removed bacterial cells. However, the stress imposed by PAA selected for bacterial aggregates and, similarly to chlorine, stimulated the selection of ARGs during the incubation experiment. This suggests disinfections based on chemically aggressive destruction of bacterial cell structures can promote a residual microbial community that is more resistant to antibiotics and, given the altered aggregational behavior, to competitive stress in nature.

  9. Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

    PubMed Central

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

    2015-01-01

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

  10. Transgenic plants producing the bacterial pheromone N-acyl-homoserine lactone exhibit enhanced resistance to the bacterial phytopathogen Erwinia carotovora.

    PubMed

    Mäe, A; Montesano, M; Koiv, V; Palva, E T

    2001-09-01

    Bacterial pheromones, mainly different homoserine lactones, are central to a number of bacterial signaling processes, including those involved in plant pathogenicity. We previously demonstrated that N-oxoacyl-homoserine lactone (OHL) is essential for quorum sensing in the soft-rot phytopathogen Erwinia carotovora. In this pathogen, OHL controls the coordinate activation of genes encoding the main virulence determinants, extracellular plant cell wall degrading enzymes (PCWDEs), in a cell density-dependent manner. We suggest that E. carotovora employ quorum sensing to avoid the premature production of PCWDEs and subsequent activation of plant defense responses. To test whether modulating this sensory system would affect the outcome of a plant-pathogen interaction, we generated transgenic tobacco, producing OHL. This was accomplished by ectopic expression in tobacco of the E. carotovora gene expI, which is responsible for OHL biosynthesis. We show that expI-positive transgenic tobacco lines produced the active pheromone and partially complemented the avirulent phenotype of expI mutants. The OHL-producing tobacco lines exhibited enhanced resistance to infection by wild-type E. carotovora. The results were confirmed by exogenous addition of OHL to wild-type plants, which also resulted in increased resistance to E. carotovora.

  11. Abundance and Diversity of Bacterial Nitrifiers and Denitrifiers and Their Functional Genes in Tannery Wastewater Treatment Plants Revealed by High-Throughput Sequencing

    PubMed Central

    Wang, Zhu; Zhang, Xu-Xiang; Lu, Xin; Liu, Bo; Li, Yan; Long, Chao; Li, Aimin

    2014-01-01

    Biological nitrification/denitrification is frequently used to remove nitrogen from tannery wastewater containing high concentrations of ammonia. However, information is limited about the bacterial nitrifiers and denitrifiers and their functional genes in tannery wastewater treatment plants (WWTPs) due to the low-throughput of the previously used methods. In this study, 454 pyrosequencing and Illumina high-throughput sequencing, combined with molecular methods, were used to comprehensively characterize structures and functions of nitrification and denitrification bacterial communities in aerobic and anaerobic sludge of two full-scale tannery WWTPs. Pyrosequencing of 16S rRNA genes showed that Proteobacteria and Synergistetes dominated in the aerobic and anaerobic sludge, respectively. Ammonia-oxidizing bacteria (AOB) amoA gene cloning revealed that Nitrosomonas europaea dominated the ammonia-oxidizing community in the WWTPs. Metagenomic analysis showed that the denitrifiers mainly included the genera of Thauera, Paracoccus, Hyphomicrobium, Comamonas and Azoarcus, which may greatly contribute to the nitrogen removal in the two WWTPs. It is interesting that AOB and ammonia-oxidizing archaea had low abundance although both WWTPs demonstrated high ammonium removal efficiency. Good correlation between the qPCR and metagenomic analysis is observed for the quantification of functional genes amoA, nirK, nirS and nosZ, indicating that the metagenomic approach may be a promising method used to comprehensively investigate the abundance of functional genes of nitrifiers and denitrifiers in the environment. PMID:25420093

  12. Bacterial group II introns: not just splicing.

    PubMed

    Toro, Nicolás; Jiménez-Zurdo, José Ignacio; García-Rodríguez, Fernando Manuel

    2007-04-01

    Group II introns are both catalytic RNAs (ribozymes) and mobile retroelements that were discovered almost 14 years ago. It has been suggested that eukaryotic mRNA introns might have originated from the group II introns present in the alphaproteobacterial progenitor of the mitochondria. Bacterial group II introns are of considerable interest not only because of their evolutionary significance, but also because they could potentially be used as tools for genetic manipulation in biotechnology and for gene therapy. This review summarizes what is known about the splicing mechanisms and mobility of bacterial group II introns, and describes the recent development of group II intron-based gene-targetting methods. Bacterial group II intron diversity, evolutionary relationships, and behaviour in bacteria are also discussed.

  13. Genes, Parenting, Self-Control, and Criminal Behavior.

    PubMed

    Watts, Stephen J; McNulty, Thomas L

    2016-03-01

    Self-control has been found to predict a wide variety of criminal behaviors. In addition, studies have consistently shown that parenting is an important influence on both self-control and offending. However, few studies have examined the role that biological factors may play in moderating the relationship between parenting, self-control, and offending. Using a sample of adolescent males drawn from the National Longitudinal Study of Adolescent Health (N = 3,610), we explore whether variants of the monoamine oxidase A gene (MAOA) and the dopamine transporter (DAT1) gene interact with parenting to affect self-control and offending. Results reveal that parenting interacts with these genes to influence self-control and offending, and that the parenting-by-gene interaction effect on offending is mediated by self-control. The effects of parenting on self-control and offending are most pronounced for those who carry plasticity alleles for both MAOA and DAT1. Thus, MAOA and DAT1 may be implicated in offending because they increase the negative effects of parenting on self-control. Implications for theory are discussed. © The Author(s) 2014.

  14. Analysis of host response to bacterial infection using error model based gene expression microarray experiments

    PubMed Central

    Stekel, Dov J.; Sarti, Donatella; Trevino, Victor; Zhang, Lihong; Salmon, Mike; Buckley, Chris D.; Stevens, Mark; Pallen, Mark J.; Penn, Charles; Falciani, Francesco

    2005-01-01

    A key step in the analysis of microarray data is the selection of genes that are differentially expressed. Ideally, such experiments should be properly replicated in order to infer both technical and biological variability, and the data should be subjected to rigorous hypothesis tests to identify the differentially expressed genes. However, in microarray experiments involving the analysis of very large numbers of biological samples, replication is not always practical. Therefore, there is a need for a method to select differentially expressed genes in a rational way from insufficiently replicated data. In this paper, we describe a simple method that uses bootstrapping to generate an error model from a replicated pilot study that can be used to identify differentially expressed genes in subsequent large-scale studies on the same platform, but in which there may be no replicated arrays. The method builds a stratified error model that includes array-to-array variability, feature-to-feature variability and the dependence of error on signal intensity. We apply this model to the characterization of the host response in a model of bacterial infection of human intestinal epithelial cells. We demonstrate the effectiveness of error model based microarray experiments and propose this as a general strategy for a microarray-based screening of large collections of biological samples. PMID:15800204

  15. Combined use of Bacillus subtilis strain B-001 and bactericide for the control of tomato bacterial wilt.

    PubMed

    Peng, Di; Luo, Kun; Jiang, Huidan; Deng, Yanan; Bai, Lianyang; Zhou, Xiaomao

    2017-06-01

    Tomato bacterial wilt caused by Ralstonia solanacearum poses a serious threat to tomato production. However, no effective control measures are available. In this study, the bactericide Saisentong was combined with an effective biological control agent, Bacillus subtilis B-001, to control tomato bacterial wilt under greenhouse and field conditions. Growth of B-001 in vitro was unaffected by Saisentong. In greenhouse experiments, the combined application of B-001 and Saisentong via root irrigation or spray resulted in better disease control compared with either agent alone. In two field trials, at a Saisentong concentration of 400 or 500 mg kg -1 , the combined treatment was more effective than expected and showed a synergistic effect. A lower concentration of Saisentong (200 or 300 mg kg -1 ) in combination with B-001 resulted in an antagonistic effect. However, disease control was significantly greater compared with either treatment alone. The combination of Saisentong and B-001 effectively controls tomato bacterial wilt. The integrated strategy represents a promising new tool to control this disease. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  16. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment.

    PubMed

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution.

  17. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment

    PubMed Central

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution. PMID:26042091

  18. Induction of plant defense gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse-grown tomatoes.

    PubMed

    Herman, M A B; Davidson, J K; Smart, C D

    2008-11-01

    Plant activators provide an appealing management option for bacterial diseases of greenhouse-grown tomatoes. Two types of plant activators, one that induces systemic acquired resistance (SAR) and a second that activates induced systemic resistance (ISR), were evaluated for control of Pseudomonas syringae pv. tomato and effect on plant defense gene activation. Benzothiadiazole (BTH, SAR-inducing compound) effectively reduced bacterial speck incidence and severity, both alone and in combination with the ISR-inducing product. Application of BTH also led to elevated activation of salicylic acid and ethylene-mediated responses, based on real-time polymerase chain reaction analysis of marker gene expression levels. In contrast, the ISR-inducing product (made up of plant growth-promoting rhizobacteria) inconsistently modified defense gene expression and did not provide disease control to the same level as did BTH. No antagonism was observed by combining the two activators as control of bacterial speck was similar to or better than BTH alone.

  19. Long-Term Effects from Bacterial Meningitis in Childhood and Adolescence on Postural Control

    PubMed Central

    Petersen, Hannes; Patel, Mitesh; Ingason, Einar F.; Einarsson, Einar J.; Haraldsson, Ásgeir; Fransson, Per-Anders

    2014-01-01

    Bacterial meningitis in childhood is associated with cognitive deficiencies, sensorimotor impairments and motor dysfunction later in life. However, the long-term effects on postural control is largely unknown, e.g., whether meningitis subjects as adults fully can utilize visual information and adaptation to enhance stability. Thirty-six subjects (20 women, mean age 19.3 years) treated in childhood or adolescence for bacterial meningitis, and 25 controls (13 women, mean age 25.1 years) performed posturography with eyes open and closed under unperturbed and perturbed standing. The meningitis subjects were screened for subjective vertigo symptoms using a questionnaire, clinically tested with headshake and head thrust test, as well as their hearing was evaluated. Meningitis subjects were significantly more unstable than controls during unperturbed (p≤0.014) and perturbed standing, though while perturbed only with eyes open in anteroposterior direction (p = 0.034) whereas in lateral direction both with eyes open and closed (p<0.001). Meningitis subjects had poorer adaption ability to balance perturbations especially with eyes open, and they frequently reported symptoms of unsteadiness (88% of the subjects) and dizziness (81%), which was found significantly correlated to objectively decreased stability. Out of the 36 subjects only 3 had unilateral hearing impairment. Hence, survivors of childhood bacterial meningitis may suffer long-term disorders affecting postural control, and would greatly benefit if these common late effects became generally known so treatments can be developed and applied. PMID:25405756

  20. Distribution, diversity and abundance of bacterial laccase-like genes in different particle size fractions of sediments in a subtropical mangrove ecosystem.

    PubMed

    Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong

    2015-10-01

    This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p < 0.05), and decreased in the order of sand > clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p < 0.05), while the total organic carbon contents were positively related to the abundance of bacterial laccase-like genes in particle size fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.

  1. Top-down and bottom-up control on bacterial diversity in a western Norwegian deep-silled fjord.

    PubMed

    Storesund, Julia E; Erga, Svein Rune; Ray, Jessica L; Thingstad, T Frede; Sandaa, Ruth-Anne

    2015-07-01

    We investigated the relationship between viruses and co-occurring bacterial communities in the Sognefjord, a deep-silled fjord in Western Norway. A combination of flow cytometry and automated ribosomal intergenic spacer analysis (ARISA) was used to assess prokaryote and viral abundances, and bacterial diversity and community composition, respectively, in depth profiles and at two different sampling seasons (November and May). With one exception, bacterial diversity did not vary between samples regardless of depth or season. The virus and prokaryote abundances as well as bacterial community composition, however, varied significantly with season and depth, suggesting a link between the Sognefjord viral community and potential bacterial host community diversity. To our knowledge, these findings provide the first description of microbial communities in the unique Sognefjord ecosystem, and in addition are in agreement with the simple model version of the 'Killing the Winner' theory (KtW), which postulates that microbial community diversity is a feature that is essentially top-down controlled by viruses, while community composition is bottom-up controlled by competition for limiting growth substrates. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Evolutionary genomics: transdomain gene transfers.

    PubMed

    Bordenstein, Seth R

    2007-11-06

    Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

  3. Bacterial identification and subtyping using DNA microarray and DNA sequencing.

    PubMed

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

    2012-01-01

    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  4. High level bacterial contamination of secondary school students' mobile phones.

    PubMed

    Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

    2017-06-01

    While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.

  5. Next-generation sequencing identification of pathogenic bacterial genes and their relationship with fecal indicator bacteria in different water sources in the Kathmandu Valley, Nepal.

    PubMed

    Ghaju Shrestha, Rajani; Tanaka, Yasuhiro; Malla, Bikash; Bhandari, Dinesh; Tandukar, Sarmila; Inoue, Daisuke; Sei, Kazunari; Sherchand, Jeevan B; Haramoto, Eiji

    2017-12-01

    Bacteriological analysis of drinking water leads to detection of only conventional fecal indicator bacteria. This study aimed to explore and characterize bacterial diversity, to understand the extent of pathogenic bacterial contamination, and to examine the relationship between pathogenic bacteria and fecal indicator bacteria in different water sources in the Kathmandu Valley, Nepal. Sixteen water samples were collected from shallow dug wells (n=12), a deep tube well (n=1), a spring (n=1), and rivers (n=2) in September 2014 for 16S rRNA gene next-generation sequencing. A total of 525 genera were identified, of which 81 genera were classified as possible pathogenic bacteria. Acinetobacter, Arcobacter, and Clostridium were detected with a relatively higher abundance (>0.1% of total bacterial genes) in 16, 13, and 5 of the 16 samples, respectively, and the highest abundance ratio of Acinetobacter (85.14%) was obtained in the deep tube well sample. Furthermore, the bla OXA23-like genes of Acinetobacter were detected using SYBR Green-based quantitative PCR in 13 (35%) of 37 water samples, including the 16 samples that were analyzed for next-generation sequencing, with concentrations ranging 5.3-7.5logcopies/100mL. There was no sufficient correlation found between fecal indicator bacteria, such as Escherichia coli and total coliforms, and potential pathogenic bacteria, as well as the bla OXA23-like gene of Acinetobacter. These results suggest the limitation of using conventional fecal indicator bacteria in evaluating the pathogenic bacteria contamination of different water sources in the Kathmandu Valley. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. New Weapons to Fight Old Enemies: Novel Strategies for the (Bio)control of Bacterial Biofilms in the Food Industry.

    PubMed

    Coughlan, Laura M; Cotter, Paul D; Hill, Colin; Alvarez-Ordóñez, Avelino

    2016-01-01

    Biofilms are microbial communities characterized by their adhesion to solid surfaces and the production of a matrix of exopolymeric substances, consisting of polysaccharides, proteins, DNA and lipids, which surround the microorganisms lending structural integrity and a unique biochemical profile to the biofilm. Biofilm formation enhances the ability of the producer/s to persist in a given environment. Pathogenic and spoilage bacterial species capable of forming biofilms are a significant problem for the healthcare and food industries, as their biofilm-forming ability protects them from common cleaning processes and allows them to remain in the environment post-sanitation. In the food industry, persistent bacteria colonize the inside of mixing tanks, vats and tubing, compromising food safety and quality. Strategies to overcome bacterial persistence through inhibition of biofilm formation or removal of mature biofilms are therefore necessary. Current biofilm control strategies employed in the food industry (cleaning and disinfection, material selection and surface preconditioning, plasma treatment, ultrasonication, etc.), although effective to a certain point, fall short of biofilm control. Efforts have been explored, mainly with a view to their application in pharmaceutical and healthcare settings, which focus on targeting molecular determinants regulating biofilm formation. Their application to the food industry would greatly aid efforts to eradicate undesirable bacteria from food processing environments and, ultimately, from food products. These approaches, in contrast to bactericidal approaches, exert less selective pressure which in turn would reduce the likelihood of resistance development. A particularly interesting strategy targets quorum sensing systems, which regulate gene expression in response to fluctuations in cell-population density governing essential cellular processes including biofilm formation. This review article discusses the problems associated

  7. New Weapons to Fight Old Enemies: Novel Strategies for the (Bio)control of Bacterial Biofilms in the Food Industry

    PubMed Central

    Coughlan, Laura M.; Cotter, Paul D.; Hill, Colin; Alvarez-Ordóñez, Avelino

    2016-01-01

    Biofilms are microbial communities characterized by their adhesion to solid surfaces and the production of a matrix of exopolymeric substances, consisting of polysaccharides, proteins, DNA and lipids, which surround the microorganisms lending structural integrity and a unique biochemical profile to the biofilm. Biofilm formation enhances the ability of the producer/s to persist in a given environment. Pathogenic and spoilage bacterial species capable of forming biofilms are a significant problem for the healthcare and food industries, as their biofilm-forming ability protects them from common cleaning processes and allows them to remain in the environment post-sanitation. In the food industry, persistent bacteria colonize the inside of mixing tanks, vats and tubing, compromising food safety and quality. Strategies to overcome bacterial persistence through inhibition of biofilm formation or removal of mature biofilms are therefore necessary. Current biofilm control strategies employed in the food industry (cleaning and disinfection, material selection and surface preconditioning, plasma treatment, ultrasonication, etc.), although effective to a certain point, fall short of biofilm control. Efforts have been explored, mainly with a view to their application in pharmaceutical and healthcare settings, which focus on targeting molecular determinants regulating biofilm formation. Their application to the food industry would greatly aid efforts to eradicate undesirable bacteria from food processing environments and, ultimately, from food products. These approaches, in contrast to bactericidal approaches, exert less selective pressure which in turn would reduce the likelihood of resistance development. A particularly interesting strategy targets quorum sensing systems, which regulate gene expression in response to fluctuations in cell-population density governing essential cellular processes including biofilm formation. This review article discusses the problems associated

  8. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    DOE PAGES

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

  9. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    PubMed

    Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying

    2017-01-01

    The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  10. Bacterial Community Composition of South China Sea Sediments through Pyrosequencing-Based Analysis of 16S rRNA Genes

    PubMed Central

    Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

    2013-01-01

    Background Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Methodology/Principal Findings Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. Conclusions This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m. PMID:24205246

  11. Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

    PubMed

    Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

    2013-01-01

    Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

  12. Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

    PubMed

    Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

    2006-12-01

    Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

  13. Abundance and Distribution of Dimethylsulfoniopropionate Degradation Genes and the Corresponding Bacterial Community Structure at Dimethyl Sulfide Hot Spots in the Tropical and Subtropical Pacific Ocean

    PubMed Central

    Suzuki, Shotaro; Omori, Yuko; Wong, Shu-Kuan; Ijichi, Minoru; Kaneko, Ryo; Kameyama, Sohiko; Tanimoto, Hiroshi; Hamasaki, Koji

    2015-01-01

    Dimethylsulfoniopropionate (DMSP) is mainly produced by marine phytoplankton but is released into the microbial food web and degraded by marine bacteria to dimethyl sulfide (DMS) and other products. To reveal the abundance and distribution of bacterial DMSP degradation genes and the corresponding bacterial communities in relation to DMS and DMSP concentrations in seawater, we collected surface seawater samples from DMS hot spot sites during a cruise across the Pacific Ocean. We analyzed the genes encoding DMSP lyase (dddP) and DMSP demethylase (dmdA), which are responsible for the transformation of DMSP to DMS and DMSP assimilation, respectively. The averaged abundance (±standard deviation) of these DMSP degradation genes relative to that of the 16S rRNA genes was 33% ± 12%. The abundances of these genes showed large spatial variations. dddP genes showed more variation in abundances than dmdA genes. Multidimensional analysis based on the abundances of DMSP degradation genes and environmental factors revealed that the distribution pattern of these genes was influenced by chlorophyll a concentrations and temperatures. dddP genes, dmdA subclade C/2 genes, and dmdA subclade D genes exhibited significant correlations with the marine Roseobacter clade, SAR11 subgroup Ib, and SAR11 subgroup Ia, respectively. SAR11 subgroups Ia and Ib, which possessed dmdA genes, were suggested to be the main potential DMSP consumers. The Roseobacter clade members possessing dddP genes in oligotrophic subtropical regions were possible DMS producers. These results suggest that DMSP degradation genes are abundant and widely distributed in the surface seawater and that the marine bacteria possessing these genes influence the degradation of DMSP and regulate the emissions of DMS in subtropical gyres of the Pacific Ocean. PMID:25862229

  14. Abundance and distribution of dimethylsulfoniopropionate degradation genes and the corresponding bacterial community structure at dimethyl sulfide hot spots in the tropical and subtropical pacific ocean.

    PubMed

    Cui, Yingshun; Suzuki, Shotaro; Omori, Yuko; Wong, Shu-Kuan; Ijichi, Minoru; Kaneko, Ryo; Kameyama, Sohiko; Tanimoto, Hiroshi; Hamasaki, Koji

    2015-06-15

    Dimethylsulfoniopropionate (DMSP) is mainly produced by marine phytoplankton but is released into the microbial food web and degraded by marine bacteria to dimethyl sulfide (DMS) and other products. To reveal the abundance and distribution of bacterial DMSP degradation genes and the corresponding bacterial communities in relation to DMS and DMSP concentrations in seawater, we collected surface seawater samples from DMS hot spot sites during a cruise across the Pacific Ocean. We analyzed the genes encoding DMSP lyase (dddP) and DMSP demethylase (dmdA), which are responsible for the transformation of DMSP to DMS and DMSP assimilation, respectively. The averaged abundance (±standard deviation) of these DMSP degradation genes relative to that of the 16S rRNA genes was 33% ± 12%. The abundances of these genes showed large spatial variations. dddP genes showed more variation in abundances than dmdA genes. Multidimensional analysis based on the abundances of DMSP degradation genes and environmental factors revealed that the distribution pattern of these genes was influenced by chlorophyll a concentrations and temperatures. dddP genes, dmdA subclade C/2 genes, and dmdA subclade D genes exhibited significant correlations with the marine Roseobacter clade, SAR11 subgroup Ib, and SAR11 subgroup Ia, respectively. SAR11 subgroups Ia and Ib, which possessed dmdA genes, were suggested to be the main potential DMSP consumers. The Roseobacter clade members possessing dddP genes in oligotrophic subtropical regions were possible DMS producers. These results suggest that DMSP degradation genes are abundant and widely distributed in the surface seawater and that the marine bacteria possessing these genes influence the degradation of DMSP and regulate the emissions of DMS in subtropical gyres of the Pacific Ocean. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ

    PubMed Central

    Mank, Nils N.; Berghoff, Bork A.; Hermanns, Yannick N.; Klug, Gabriele

    2012-01-01

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA. PMID:22988125

  16. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  17. Diagnosis of Meningococcal Meningitis by Broad-Range Bacterial PCR with Cerebrospinal Fluid

    PubMed Central

    Kotilainen, Pirkko; Jalava, Jari; Meurman, Olli; Lehtonen, Olli-Pekka; Rintala, Esa; Seppälä, Olli-Pekka; Eerola, Erkki; Nikkari, Simo

    1998-01-01

    We used broad-range bacterial PCR combined with DNA sequencing to examine prospectively cerebrospinal fluid (CSF) samples from patients with suspected meningitis. Fifty-six CSF samples from 46 patients were studied during the year 1995. Genes coding for bacterial 16S and/or 23S rRNA genes could be amplified from the CSF samples from five patients with a clinical picture consistent with acute bacterial meningitis. For these patients, the sequenced PCR product shared 98.3 to 100% homology with the Neisseria meningitidis sequence. For one patient, the diagnosis was initially made by PCR alone. Of the remaining 51 CSF samples, for 50 (98.0%) samples the negative PCR findings were in accordance with the negative findings by bacterial culture and Gram staining, as well as with the eventual clinical diagnosis for the patient. However, the PCR test failed to detect the bacterial rRNA gene in one CSF sample, the culture of which yielded Listeria monocytogenes. These results invite new research efforts to be focused on the application of PCR with broad-range bacterial primers to improve the etiologic diagnosis of bacterial meningitis. In a clinical setting, Gram staining and bacterial culture still remain the cornerstones of diagnosis. PMID:9665992

  18. Bacterial toxin-antitoxin systems: more than selfish entities?

    PubMed

    Van Melderen, Laurence; Saavedra De Bast, Manuel

    2009-03-01

    Bacterial toxin-antitoxin (TA) systems are diverse and widespread in the prokaryotic kingdom. They are composed of closely linked genes encoding a stable toxin that can harm the host cell and its cognate labile antitoxin, which protects the host from the toxin's deleterious effect. TA systems are thought to invade bacterial genomes through horizontal gene transfer. Some TA systems might behave as selfish elements and favour their own maintenance at the expense of their host. As a consequence, they may contribute to the maintenance of plasmids or genomic islands, such as super-integrons, by post-segregational killing of the cell that loses these genes and so suffers the stable toxin's destructive effect. The function of the chromosomally encoded TA systems is less clear and still open to debate. This Review discusses current hypotheses regarding the biological roles of these evolutionarily successful small operons. We consider the various selective forces that could drive the maintenance of TA systems in bacterial genomes.

  19. Bacterial Toxin–Antitoxin Systems: More Than Selfish Entities?

    PubMed Central

    Van Melderen, Laurence; Saavedra De Bast, Manuel

    2009-01-01

    Bacterial toxin–antitoxin (TA) systems are diverse and widespread in the prokaryotic kingdom. They are composed of closely linked genes encoding a stable toxin that can harm the host cell and its cognate labile antitoxin, which protects the host from the toxin's deleterious effect. TA systems are thought to invade bacterial genomes through horizontal gene transfer. Some TA systems might behave as selfish elements and favour their own maintenance at the expense of their host. As a consequence, they may contribute to the maintenance of plasmids or genomic islands, such as super-integrons, by post-segregational killing of the cell that loses these genes and so suffers the stable toxin's destructive effect. The function of the chromosomally encoded TA systems is less clear and still open to debate. This Review discusses current hypotheses regarding the biological roles of these evolutionarily successful small operons. We consider the various selective forces that could drive the maintenance of TA systems in bacterial genomes. PMID:19325885

  20. Proteomic analysis of the bacterial cell cycle

    PubMed Central

    Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

    2001-01-01

    A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

  1. Bacteriophages and Bacterial Plant Diseases

    PubMed Central

    Buttimer, Colin; McAuliffe, Olivia; Ross, R. P.; Hill, Colin; O’Mahony, Jim; Coffey, Aidan

    2017-01-01

    Losses in crop yields due to disease need to be reduced in order to meet increasing global food demands associated with growth in the human population. There is a well-recognized need to develop new environmentally friendly control strategies to combat bacterial crop disease. Current control measures involving the use of traditional chemicals or antibiotics are losing their efficacy due to the natural development of bacterial resistance to these agents. In addition, there is an increasing awareness that their use is environmentally unfriendly. Bacteriophages, the viruses of bacteria, have received increased research interest in recent years as a realistic environmentally friendly means of controlling bacterial diseases. Their use presents a viable control measure for a number of destructive bacterial crop diseases, with some phage-based products already becoming available on the market. Phage biocontrol possesses advantages over chemical controls in that tailor-made phage cocktails can be adapted to target specific disease-causing bacteria. Unlike chemical control measures, phage mixtures can be easily adapted for bacterial resistance which may develop over time. In this review, we will examine the progress and challenges for phage-based disease biocontrol in food crops. PMID:28163700

  2. Bacterial pathogen gene abundance and relation to recreational water quality at seven Great Lakes beaches.

    PubMed

    Oster, Ryan J; Wijesinghe, Rasanthi U; Haack, Sheridan K; Fogarty, Lisa R; Tucker, Taaja R; Riley, Stephen C

    2014-12-16

    Quantitative assessment of bacterial pathogens, their geographic variability, and distribution in various matrices at Great Lakes beaches are limited. Quantitative PCR (qPCR) was used to test for genes from E. coli O157:H7 (eaeO157), shiga-toxin producing E. coli (stx2), Campylobacter jejuni (mapA), Shigella spp. (ipaH), and a Salmonella enterica-specific (SE) DNA sequence at seven Great Lakes beaches, in algae, water, and sediment. Overall, detection frequencies were mapA>stx2>ipaH>SE>eaeO157. Results were highly variable among beaches and matrices; some correlations with environmental conditions were observed for mapA, stx2, and ipaH detections. Beach seasonal mean mapA abundance in water was correlated with beach seasonal mean log10 E. coli concentration. At one beach, stx2 gene abundance was positively correlated with concurrent daily E. coli concentrations. Concentration distributions for stx2, ipaH, and mapA within algae, sediment, and water were statistically different (Non-Detect and Data Analysis in R). Assuming 10, 50, or 100% of gene copies represented viable and presumably infective cells, a quantitative microbial risk assessment tool developed by Michigan State University indicated a moderate probability of illness for Campylobacter jejuni at the study beaches, especially where recreational water quality criteria were exceeded. Pathogen gene quantification may be useful for beach water quality management.

  3. Bacterial diversity and real-time PCR based assessment of linA and linB gene distribution at hexachlorocyclohexane contaminated sites.

    PubMed

    Lal, Devi; Jindal, Swati; Kumari, Hansi; Jit, Simran; Nigam, Aeshna; Sharma, Pooja; Kumari, Kirti; Lal, Rup

    2015-03-01

    The disposal of hexachlorocyclohexane (HCH) muck has created large number of HCH dumpsites all over the world from where the harmful HCH isomers are leaking into the environment. Bacteria have evolved at such contaminated sites that have the ability to degrade HCH. Degradation of various HCH isomers in bacterial strains is mediated primarily by two genes: linA and linB which encode dehydrochlorinase and haloalkane dehalogenase respectively. In this study we explored one such highly contaminated HCH dumpsite located in Lucknow, Uttar Pradesh, India. To assess the biostimulation potential of the contaminated site, microbial diversity study and real-time PCR based quantification of lin genes was carried out. The soil samples from dumpsite and surrounding areas were found to be highly contaminated with HCH residue levels as high as 1.8 × 10(5)  mg kg(-1). The residues were detected in areas upto 13 km from the dumpsite. Sphingomonads, Chromohalobacter, and Marinobacter were the dominant genera present at the dump-site. Role of Sphingomonads in HCH degradation has been well documented. The highest copy numbers of linA and linB genes as determined using real-time PCR were 6.2 × 10(4) and 5.3 × 10(5), respectively, were found in sample from the dump site. The presence of Sphingomonads, linA, and linB genes from HCH contaminated soil indicates the presence of indigenous bacterial communities capable of HCH degradation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Bacterial colonization of a fumigated alkaline saline soil.

    PubMed

    Bello-López, Juan M; Domínguez-Mendoza, Cristina A; de León-Lorenzana, Arit S; Delgado-Balbuena, Laura; Navarro-Noya, Yendi E; Gómez-Acata, Selene; Rodríguez-Valentín, Analine; Ruíz-Valdiviezo, Victor M; Luna-Guido, Marco; Verhulst, Nele; Govaerts, Bram; Dendooven, Luc

    2014-07-01

    After chloroform fumigating an arable soil, the relative abundance of phylotypes belonging to only two phyla (Actinobacteria and Firmicutes) and two orders [Actinomycetales and Bacillales (mostly Bacillus)] increased in a subsequent aerobic incubation, while it decreased for a wide range of bacterial groups. It remained to be seen if similar bacterial groups were affected when an extreme alkaline saline soil was fumigated. Soil with electrolytic conductivity between 139 and 157 dS m(-1), and pH 10.0 and 10.3 was fumigated and the bacterial community structure determined after 0, 1, 5 and 10 days by analysis of the 16S rRNA gene, while an unfumigated soil served as control. The relative abundance of the Firmicutes increased in the fumigated soil (52.8%) compared to the unfumigated soil (34.2%), while that of the Bacteroidetes decreased from 16.2% in the unfumigated soil to 8.8% in the fumigated soil. Fumigation increased the relative abundance of the genus Bacillus from 14.7% in the unfumigated soil to 25.7%. It was found that phylotypes belonging to the Firmicutes, mostly of the genus Bacillus, were dominant in colonizing the fumigated alkaline saline as found in the arable soil, while the relative abundance of a wide range of bacterial groups decreased.

  5. Genomic features of bacterial adaptation to plants

    PubMed Central

    Levy, Asaf; Gonzalez, Isai Salas; Mittelviefhaus, Maximilian; Clingenpeel, Scott; Paredes, Sur Herrera; Miao, Jiamin; Wang, Kunru; Devescovi, Giulia; Stillman, Kyra; Monteiro, Freddy; Alvarez, Bryan Rangel; Lundberg, Derek S.; Lu, Tse-Yuan; Lebeis, Sarah; Jin, Zhao; McDonald, Meredith; Klein, Andrew P.; Feltcher, Meghan E.; del Rio, Tijana Glavina; Grant, Sarah R.; Doty, Sharon L.; Ley, Ruth E.; Zhao, Bingyu; Venturi, Vittorio; Pelletier, Dale A.; Vorholt, Julia A.; Tringe, Susannah G.; Woyke, Tanja; Dangl, Jeffery L.

    2017-01-01

    Plants intimately associate with diverse bacteria. Plant-associated (PA) bacteria have ostensibly evolved genes enabling adaptation to the plant environment. However, the identities of such genes are mostly unknown and their functions are poorly characterized. We sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3837 bacterial genomes to identify thousands of PA gene clusters. Genomes of PA bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant associated genomes. We experimentally validated candidates from two sets of PA genes, one involved in plant colonization, the other serving in microbe-microbe competition between PA bacteria. We also identified 64 PA protein domains that potentially mimic plant domains; some are shared with PA fungi and oomycetes. This work expands the genome-based understanding of plant-microbe interactions and provides leads for efficient and sustainable agriculture through microbiome engineering. PMID:29255260

  6. Hospital Effluents Are One of Several Sources of Metal, Antibiotic Resistance Genes, and Bacterial Markers Disseminated in Sub-Saharan Urban Rivers

    PubMed Central

    Laffite, Amandine; Kilunga, Pitchouna I.; Kayembe, John M.; Devarajan, Naresh; Mulaji, Crispin K.; Giuliani, Gregory; Slaveykova, Vera I.; Poté, John

    2016-01-01

    Data concerning the occurrence of emerging biological contaminants such as antibiotic resistance genes (ARGs) and fecal indicator bacteria (FIB) in aquatic environments in Sub-Saharan African countries is limited. On the other hand, antibiotic resistance remains a worldwide problem which may pose serious potential risks to human and animal health. Consequently, there is a growing number of reports concerning the prevalence and dissemination of these contaminants into various environmental compartments. Sediments provide the opportunity to reconstruct the pollution history and evaluate impacts so this study investigates the abundance and distribution of toxic metals, FIB, and ARGs released from hospital effluent wastewaters and their presence in river sediments receiving systems. ARGs (blaTEM, blaCTX-M, blaSHV, and aadA), total bacterial load, and selected bacterial species FIB [Escherichia coli, Enterococcus (ENT)] and species (Psd) were quantified by targeting species specific genes using quantitative PCR (qPCR) in total DNA extracted from the sediments recovered from 4 hospital outlet pipes (HOP) and their river receiving systems in the City of Kinshasa in the Democratic Republic of the Congo. The results highlight the great concentration of toxic metals in HOP, reaching the values (in mg kg−1) of 47.9 (Cr), 213.6 (Cu), 1434.4 (Zn), 2.6 (Cd), 281.5 (Pb), and 13.6 (Hg). The results also highlight the highest (P < 0.05) values of 16S rRNA, FIB, and ARGs copy numbers in all sampling sites including upstream (control site), discharge point, and downstream of receiving rivers, indicating that the hospital effluent water is not an exclusive source of the biological contaminants entering the urban rivers. Significant correlation were observed between (i) all analyzed ARGs and total bacterial load (16S rRNA) 0.51 to 0.72 (p < 0.001, n = 65); (ii) ARGs (except blaTEM) and FIB and Psd 0.57 < r < 0.82 (p < 0.001, n = 65); and (iii) ARGs (except blaTEM) and toxic metals

  7. The significance of oral streptococci in patients with pneumonia with risk factors for aspiration: the bacterial floral analysis of 16S ribosomal RNA gene using bronchoalveolar lavage fluid.

    PubMed

    Akata, Kentaro; Yatera, Kazuhiro; Yamasaki, Kei; Kawanami, Toshinori; Naito, Keisuke; Noguchi, Shingo; Fukuda, Kazumasa; Ishimoto, Hiroshi; Taniguchi, Hatsumi; Mukae, Hiroshi

    2016-05-11

    Aspiration pneumonia has been a growing interest in an aging population. Anaerobes are important pathogens, however, the etiology of aspiration pneumonia is not fully understood. In addition, the relationship between the patient clinical characteristics and the causative pathogens in pneumonia patients with aspiration risk factors are unclear. To evaluate the relationship between the patient clinical characteristics with risk factors for aspiration and bacterial flora in bronchoalveolar lavage fluid (BALF) in pneumonia patients, the bacterial floral analysis of 16S ribosomal RNA gene was applied in addition to cultivation methods in BALF samples. From April 2010 to February 2014, BALF samples were obtained from the affected lesions of pneumonia via bronchoscopy, and were evaluated by the bacterial floral analysis of 16S rRNA gene in addition to cultivation methods in patients with community-acquired pneumonia (CAP) and healthcare-associated pneumonia (HCAP). Factors associated with aspiration risks in these patients were analyzed. A total of 177 (CAP 83, HCAP 94) patients were enrolled. According to the results of the bacterial floral analysis, detection rate of oral streptococci as the most detected bacterial phylotypes in BALF was significantly higher in patients with aspiration risks (31.0 %) than in patients without aspiration risks (14.7 %) (P = 0.009). In addition, the percentages of oral streptococci in each BALF sample were significantly higher in patients with aspiration risks (26.6 ± 32.0 %) than in patients without aspiration risks (13.8 ± 25.3 %) (P = 0.002). A multiple linear regression analysis showed that an Eastern Cooperative Oncology Group (ECOG) performance status (PS) of ≥3, the presence of comorbidities, and a history of pneumonia within a previous year were significantly associated with a detection of oral streptococci in BALF. The bacterial floral analysis of 16S rRNA gene revealed that oral streptococci were mostly

  8. High level bacterial contamination of secondary school students’ mobile phones

    PubMed Central

    Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

    2017-01-01

    Introduction While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students’ mobile phones. Methods Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline (tetA, tetB, tetM), erythromycin (ermB) and sulphonamide (sul1) resistance genes was assessed. Results We found a high median bacterial count on secondary school students’ mobile phones (10.5 CFU/cm2) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes (Staphylococcus aureus, Acinetobacter spp., Pseudomonas spp., Bacillus cereus and Neisseria flavescens) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner’s gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Conclusion Quantitative study methods revealed high level bacterial contamination of secondary school students’ mobile phones. PMID:28626737

  9. Global analysis of saliva as a source of bacterial genes for insights into human population structure and migration studies.

    PubMed

    Henne, Karsten; Li, Jing; Stoneking, Mark; Kessler, Olga; Schilling, Hildegard; Sonanini, Anne; Conrads, Georg; Horz, Hans-Peter

    2014-08-22

    The genetic diversity of the human microbiome holds great potential for shedding light on the history of our ancestors. Helicobacter pylori is the most prominent example as its analysis allowed a fine-scale resolution of past migration patterns including some that could not be distinguished using human genetic markers. However studies of H. pylori require stomach biopsies, which severely limits the number of samples that can be analysed. By focussing on the house-keeping gene gdh (coding for the glucose-6-phosphate dehydrogenase), on the virulence gene gtf (coding for the glucosyltransferase) of mitis-streptococci and on the 16S-23S rRNA internal transcribed spacer (ITS) region of the Fusobacterium nucleatum/periodonticum-group we here tested the hypothesis that bacterial genes from human saliva have the potential for distinguishing human populations. Analysis of 10 individuals from each of seven geographic regions, encompassing Africa, Asia and Europe, revealed that the genes gdh and ITS exhibited the highest number of polymorphic sites (59% and 79%, respectively) and most OTUs (defined at 99% identity) were unique to a given country. In contrast, the gene gtf had the lowest number of polymorphic sites (21%), and most OTUs were shared among countries. Most of the variation in the gdh and ITS genes was explained by the high clonal diversity within individuals (around 80%) followed by inter-individual variation of around 20%, leaving the geographic region as providing virtually no source of sequence variation. Conversely, for gtf the variation within individuals accounted for 32%, between individuals for 57% and among geographic regions for 11%. This geographic signature persisted upon extension of the analysis to four additional locations from the American continent. Pearson correlation analysis, pairwise Fst-cluster analysis as well as UniFrac analyses consistently supported a tree structure in which the European countries clustered tightly together and branched

  10. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    PubMed

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  11. Enhancement of Population Size of a Biological Control Agent and Efficacy in Control of Bacterial Speck of Tomato through Salicylate and Ammonium Sulfate Amendments

    PubMed Central

    Ji, Pingsheng; Wilson, Mark

    2003-01-01

    Sodium salicylate and ammonium sulfate were applied to leaf surfaces along with suspensions of the biological control agents Pseudomonas syringae Cit7(pNAH7), which catabolizes salicylate, and Cit7, which does not catabolize salicylate, to determine whether enhanced biological control of bacterial speck of tomato could be achieved. Foliar amendment with salicylate alone significantly enhanced the population size and the efficacy of Cit7(pNAH7), but not of Cit7, on tomato leaves. Application of ammonium sulfate alone did not result in enhanced population size or biological control efficacy of either Cit7(pNAH7) or Cit7; however, when foliar amendments with both sodium salicylate and ammonium sulfate were applied, a trend toward further increases in population size and biological control efficacy of Cit7(pNAH7) was observed. This study demonstrates the potential of using a selective carbon source to improve the efficacy of a bacterial biological control agent in the control of a bacterial plant disease and supports previous conclusions that the growth of P. syringae in the phyllosphere is primarily carbon limited and secondarily nitrogen limited. PMID:12571060

  12. Prevalence of quinolone resistance genes, copper resistance genes, and the bacterial communities in a soil-ryegrass system co-polluted with copper and ciprofloxacin.

    PubMed

    Tuo, Xiaxia; Gu, Jie; Wang, Xiaojuan; Sun, YiXin; Duan, Manli; Sun, Wei; Yin, Yanan; Guo, Aiyun; Zhang, Li

    2018-04-01

    The presence of high concentrations of residual antibiotics and antibiotic resistance genes (ARGs) in soil may pose potential health and environmental risks. This study investigated the prevalence of plasmid-mediated quinolone resistance (PMQR) genes, copper resistance genes (CRGs), and the bacterial communities in a soil-ryegrass pot system co-polluted with copper and ciprofloxacin (CIP; 0, 20, or 80 mg kg -1 dry soil). Compared with the samples on day 0, the total relative abundances of the PMQR genes and mobile genetic elements (MGEs) were reduced significantly by 80-89% in the ryegrass and soil by the cutting stage (after 75 days). The abundances of PMQR genes and MGEs were reduced by 63-81% in soil treated with 20 mg kg -1 CIP compared with the other treatments, but the abundances of CRGs increased by 18-42%. The presence of 80 mg kg -1 CIP affected the microbial community structure in the soil by increasing the abundances of Acidobacteria and Thaumarchaeota, but decreasing those of Firmicutes. Redundancy analysis indicated that the pH and microbial composition were the main factors that affected the variations in PMQR genes, MGEs, and CRGs, where they could explain 42.2% and 33.3% of the variation, respectively. Furthermore, intI2 may play an important role in the transfer of ARGs. We found that 80 mg kg -1 CIP could increase the abundances of ARGs and CRGs in a soil-ryegrass pot system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Benthic bacterial diversity in submerged sinkhole ecosystems.

    PubMed

    Nold, Stephen C; Pangborn, Joseph B; Zajack, Heidi A; Kendall, Scott T; Rediske, Richard R; Biddanda, Bopaiah A

    2010-01-01

    Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities.

  14. Two poplar-associated bacterial isolates induce additive favorable responses in a constructed plant-microbiome system

    DOE PAGES

    Jawdy, Sara S.; Gunter, Lee E.; Engle, Nancy L.; ...

    2016-04-26

    Here, the biological function of the plant-microbiome system is the result of contributions from the host plant and microbiome members. In this work we study the function of a simplified community consisting of Pseudomonas and Burkholderia bacterial strains isolated from Populus hosts and inoculated on axenic Populus cutting in controlled laboratory conditions. Inoculation individually with either bacterial isolate increased root growth relative to uninoculated controls. Root area, photosynthetic efficiency, gene expression and metabolite expression data in individual and dual inoculated treatments indicate that the effects of these bacteria are unique and additive, suggesting that the function of a microbiome communitymore » may be predicted from the additive functions of the individual members.« less

  15. The germin-like protein OsGLP2-1 enhances resistance to fungal blast and bacterial blight in rice.

    PubMed

    Liu, Qing; Yang, Jianyuan; Yan, Shijuan; Zhang, Shaohong; Zhao, Junliang; Wang, Wenjuan; Yang, Tifeng; Wang, Xiaofei; Mao, Xingxue; Dong, Jingfang; Zhu, Xiaoyuan; Liu, Bin

    2016-11-01

    This is the first report that GLP gene (OsGLP2-1) is involved in panicle blast and bacterial blight resistance in rice. In addition to its resistance to blast and bacterial blight, OsGLP2-1 has also been reported to co-localize with a QTLs for sheath blight resistance in rice. These suggest that the disease resistance provided by OsGLP2-1 is quantitative and broad spectrum. Its good resistance to these major diseases in rice makes it to be a promising target in rice breeding. Rice (Oryza sativa) blast caused by Magnaporthe oryzae and bacterial blight caused by Xanthomonas oryzae pv. oryzae are the two most destructive rice diseases worldwide. Germin-like protein (GLP) gene family is one of the important defense gene families which have been reported to be involved in disease resistance in plants. Although GLP proteins have been demonstrated to positively regulate leaf blast resistance in rice, their involvement in resistance to panicle blast and bacterial blight, has not been reported. In this study, we reported that one of the rice GLP genes, OsGLP2-1, was significantly induced by blast fungus. Overexpression of OsGLP2-1 quantitatively enhanced resistance to leaf blast, panicle blast and bacterial blight. The temporal and spatial expression analysis revealed that OsGLP2-1is highly expressed in leaves and panicles and sub-localized in the cell wall. Compared with empty vector transformed (control) plants, the OsGLP2-1 overexpressing plants exhibited higher levels of H 2 O 2 both before and after pathogen inoculation. Moreover, OsGLP2-1 was significantly induced by jasmonic acid (JA). Overexpression of OsGLP2-1 induced three well-characterized defense-related genes which are associated in JA-dependent pathway after pathogen infection. Higher endogenous level of JA was also identified in OsGLP2-1 overexpressing plants than in control plants both before and after pathogen inoculation. Together, these results suggest that OsGLP2-1 functions as a positive regulator to

  16. Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)

    1998-01-01

    Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.

  17. Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

    PubMed

    Krieger, John N; Thumbikat, Praveen

    2016-02-01

    Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

  18. Prevalence of antibiotic resistance genes in the bacterial flora of integrated fish farming environments of Pakistan and Tanzania.

    PubMed

    Shah, Syed Q A; Colquhoun, Duncan J; Nikuli, Hamisi L; Sørum, Henning

    2012-08-21

    The use of a wide variety of antimicrobials in human and veterinary medicine, including aquaculture, has led to the emergence of antibiotic resistant pathogens. In the present study, bacteria from water, sediments, and fish were collected from fish farms in Pakistan and Tanzania with no recorded history of antibiotic use. The isolates were screened for the presence of resistance genes against various antimicrobials used in aquaculture and animal husbandry. Resistant isolates selected by disk diffusion and genotyped by Southern hybridization were further screened by polymerase chain reaction (PCR) and amplicon sequencing. The prominent resistance genes identified encoded tetracycline [tetA(A) and tetA(G)], trimethoprim [dfrA1, dfrA5, dfrA7, dfrA12, and dfrA15], amoxicillin [bla(TEM)], streptomycin [strA-strB], chloramphenicol [cat-1], and erythromycin resistance [mefA]. The int1 gene was found in more than 30% of the bacterial isolates in association with gene cassettes. MAR indices ranged from 0.2 to 1. The bla(NDM-1) gene was not identified in ertapenem resistant isolates. It is hypothesized that integrated fish farming practices utilizing domestic farm and poultry waste along with antibiotic residues from animal husbandry may have contributed to a pool of resistance genes in the aquaculture systems studied.

  19. Bacterial Community Succession During in situ Uranium Bioremediation: Spatial Similarities Along Controlled Flow Paths

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Chiachi; Wu, Weimin; Gentry, Terry J.

    2009-05-22

    Bacterial community succession was investigated in a field-scale subsurface reactor formed by a series of wells that received weekly ethanol additions to re-circulating groundwater. Ethanol additions stimulated denitrification, metal reduction, sulfate reduction, and U(VI) reduction to sparingly soluble U(IV). Clone libraries of SSU rRNA gene sequences from groundwater samples enabled tracking of spatial and temporal changes over a 1.5 y period. Analyses showed that the communities changed in a manner consistent with geochemical variations that occurred along temporal and spatial scales. Canonical correspondence analysis revealed that the levels of nitrate, uranium, sulfide, sulfate, and ethanol strongly correlated with particular bacterialmore » populations. As sulfate and U(VI) levels declined, sequences representative of sulfate-reducers and metal-reducers were detected at high levels. Ultimately, sequences associated with sulfate-reducing populations predominated, and sulfate levels declined as U(VI) remained at low levels. When engineering controls were compared to the population variation via canonical ordination, changes could be related to dissolved oxygen control and ethanol addition. The data also indicated that the indigenous populations responded differently to stimulation for bio-reduction; however, the two bio-stimulated communities became more similar after different transitions in an idiosyncratic manner. The strong associations between particular environmental variables and certain populations provide insight into the establishment of practical and successful remediation strategies in radionuclide-contaminated environments with respect to engineering controls and microbial ecology.« less

  20. Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

    PubMed

    Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

    2010-11-01

    Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

  1. Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice.

    PubMed

    Suh, Jung-Pil; Jeung, Ji-Ung; Noh, Tae-Hwan; Cho, Young-Chan; Park, So-Hyun; Park, Hyun-Su; Shin, Mun-Sik; Kim, Chung-Kon; Jena, Kshirod K

    2013-02-08

    The development of resistant cultivars has been the most effective and economical strategy to control bacterial leaf blight (BB) disease of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). Molecular markers have made it possible to identify and pyramid valuable genes of agronomic importance in resistance rice breeding. In this study, three resistance genes (Xa4 + xa5 + Xa21) were transferred from an indica donor (IRBB57), using a marker-assisted backcrossing (MAB) breeding strategy, into a BB-susceptible elite japonica rice cultivar, Mangeumbyeo, which is high yielding with good grain quality. Our analysis led to the development of three elite advanced backcross breeding lines (ABL) with three resistance genes by foreground and phenotypic selection in a japonica genetic background without linkage drag. The background genome recovery of the ABL expressed more than 92.1% using genome-wide SSR marker analysis. The pathogenicity assays of three resistance-gene-derived ABL were conducted under glasshouse conditions with the 18 isolates of Xoo prevalent in Korea. The ABL exhibited very small lesion lengths, indicating a hypersensitive reaction to all 18 isolates of Xoo, with agronomic and grain quality traits similar to those of the recurrent parent. Pyramiding the resistance genes Xa4, xa5 and Xa21 provided a higher resistance to Xoo than the introduction of the individual resistance genes. Additionally, the combination of two dominant and one recessive BB resistance gene did not express any negative effect on agronomic traits in the ABL. The strategy of simultaneous foreground and phenotypic selection to introduce multiple R genes is very useful to reduce the cost and the time required for the isolation of desirable recombinants with target resistance genes in rice. The resistance-gene-derived ABL have practical breeding value without a yield penalty by providing broad-spectrum resistance against most of the existing isolates of BB in South Korea and will

  2. Structure-Function Analysis of a Broad Specificity Populus trichocarpa Endo-β-glucanase Reveals an Evolutionary Link between Bacterial Licheninases and Plant XTH Gene Products*

    PubMed Central

    Eklöf, Jens M.; Shojania, Shaheen; Okon, Mark; McIntosh, Lawrence P.; Brumer, Harry

    2013-01-01

    The large xyloglucan endotransglycosylase/hydrolase (XTH) gene family continues to be the focus of much attention in studies of plant cell wall morphogenesis due to the unique catalytic functions of the enzymes it encodes. The XTH gene products compose a subfamily of glycoside hydrolase family 16 (GH16), which also comprises a broad range of microbial endoglucanases and endogalactanases, as well as yeast cell wall chitin/β-glucan transglycosylases. Previous whole-family phylogenetic analyses have suggested that the closest relatives to the XTH gene products are the bacterial licheninases (EC 3.2.1.73), which specifically hydrolyze linear mixed linkage β(1→3)/β(1→4)-glucans. In addition to their specificity for the highly branched xyloglucan polysaccharide, XTH gene products are distinguished from the licheninases and other GH16 enzyme subfamilies by significant active site loop alterations and a large C-terminal extension. Given these differences, the molecular evolution of the XTH gene products in GH16 has remained enigmatic. Here, we present the biochemical and structural analysis of a unique, mixed function endoglucanase from black cottonwood (Populus trichocarpa), which reveals a small, newly recognized subfamily of GH16 members intermediate between the bacterial licheninases and plant XTH gene products. We postulate that this clade comprises an important link in the evolution of the large plant XTH gene families from a putative microbial ancestor. As such, this analysis provides new insights into the diversification of GH16 and further unites the apparently disparate members of this important family of proteins. PMID:23572521

  3. Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli.

    PubMed Central

    Altieri, M; Suit, J L; Fan, M L; Luria, S E

    1986-01-01

    The kil gene of the ColE1 plasmid was cloned under control of the lac promoter. Its expression under this promoter gave rise to the same pattern of bacterial cell damage and lethality as that which accompanies induction of the kil gene in the colicin operon by mitomycin C. This confirms that cell damage after induction is solely due to expression of kil and is independent of the cea or imm gene products. Escherichia coli derivatives resistant to the lethal effects of kil gene expression under either the normal or the lac promoter were isolated and found to fall into several classes, some of which were altered in sensitivity to agents that affect the bacterial envelope. PMID:2946661

  4. Structural alterations of faecal and mucosa-associated bacterial communities in irritable bowel syndrome.

    PubMed

    Durbán, Ana; Abellán, Juan J; Jiménez-Hernández, Nuria; Salgado, Patricia; Ponce, Marta; Ponce, Julio; Garrigues, Vicente; Latorre, Amparo; Moya, Andrés

    2012-04-01

    Irritable bowel syndrome (IBS) is the most common functional gastrointestinal disorder in western countries. Previous studies on IBS, mostly based on faecal samples, suggest alterations in the intestinal microbiota. However, no consensus has been reached regarding the association between specific bacteria and IBS. We explore the alterations of intestinal bacterial communities in IBS using massive sequencing of amplified 16S rRNA genes. Mucosal biopsies of the ascending and descending colon and faeces from 16 IBS patients and 9 healthy controls were analysed. Strong inter-individual variation was observed in the composition of the bacterial communities in both patients and controls. These communities showed less diversity in IBS cases. There were larger differences in the microbiota composition between biopsies and faeces than between patients and controls. We found a few over-represented and under-represented taxa in IBS cases with respect to controls. The detected alterations varied by site, with no changes being consistent across sample types. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Developments in the control of bacterial kidney disease of salmonid fishes

    USGS Publications Warehouse

    Elliott, D.G.; Pascho, R.J.; Bullock, G.L.

    1989-01-01

    Bacterial kidney disease of salmonid fishes, caused by Renibactenum salrnoninarum, was first reported more than 50 yr ago; nevertheless, large gaps persist in our knowledge of the infection - particularly in methods for its control. In the 1950's, principal control measures consisted of prophylactic or therapeutic feeding of sulfonamides, which were later supplanted by the antibiotic erythromycin. Chemotherapy has effected some reduction of mortality, but benefits are typically transient and mortality usually resumes after the drug is withdrawn. Some studies have indicated that diet composition affects the prevalence and severity of the disease. Although tests of chemotherapeutants and diet modification have continued, research emphasis has shifted partly toward prevention of the disease by breaking the infection cycle. It is now generally accepted that R. salrnoninarum can be transmitted both vertically and horizontally. Experimental evidence indicates that immersion of newly fertilized eggs in iodophor or erythromycin does not prevent vertical transmission. However, the injection of female salmon with erythromycin before they spawn shows promise as a practical means of interrupting vertical transmission. The results of attempts to prevent infection of juvenile salmonids by vaccination against bacterial kidney disease have been disappointing, thus underscoring a basic need for a better understanding of protective mechanisms in salmonids. The recent development of more sensitive and quantitative detection methods should aid in evaluating the efficacy of current and future control strategies.

  6. Nitrous oxide production and mRNA expression analysis of nitrifying and denitrifying bacterial genes under floodwater disappearance and fertilizer application.

    PubMed

    Riya, Shohei; Takeuchi, Yuki; Zhou, Sheng; Terada, Akihiko; Hosomi, Masaaki

    2017-06-01

    A pulse of nitrous oxide (N 2 O) emission has been observed following the disappearance of floodwater by drainage. However, its mechanism is not well understood. We conducted a column study to clarify the mechanism for N 2 O production during floodwater disappearance by using a microsensor and determining the bacterial gene expression. An increase in N 2 O flux was observed following floodwater disappearance after the addition of NH 4 + , with a corresponding increase in the concentrations of NO 3 - and dissolved N 2 O in the oxic and anoxic soil layers, respectively. The transcription level of the bacterial amoA mRNA did not change, while that of nirK mRNA increased sharply after an hour of floodwater disappearance. An additional anoxic soil slurry experiment demonstrated that the addition of NO 3 - induced the expression of nirK gene and caused a concomitant increase in N 2 O production. These findings suggest that NO 3 - production in the oxic layers is important as it provides a substrate and induces the synthesis of denitrification enzymes in the anoxic layer during N 2 O production.

  7. Influence of Biopreparations on the Bacterial Community of Oily Waste

    NASA Astrophysics Data System (ADS)

    Biktasheva, L. R.; Galitskaya, P. Yu; Selivanovskaya, S. Yu

    2018-01-01

    Oil pollution is reported to be one the most serious environmental problems nowadays. Therefore, methods of remediation of oily polluted soils and oily wastes are of great importance. Bioremediation being a perspective method of sanitation of oil pollutions, includes biostimulation of the polluted sites’ indigenous microflora, and in some cases additional introduction of active strains able to decompose hydrocarbon. The efficacy of introducing such biopreparations depends on the interactions between the introduced microbes and the indigenous ones. In this study, the influence of bacterial consortium (Rhodococcus jialingiae, Stenotrophomonas rhizophila and Pseudomonas gessardii) introduction on the bioremediation of an oily waste sampled from a refinery situated in the Mari El region (Russia) was estimated. Single and multiple inoculations of the consortium in addition to moistening and aeration were compared with a control sample, which included only aeration and moistening of the waste. It was shown, that two of the three introduced strains (Rh. jialingiae and Ps.gessardii) gene copy numbers were higher in the inoculated variants than in the control sample and with their initial counts, which meant that these strains survived and included into the bacterial community of the wastes. At the same time, bacterial counts were significantly lower, and the physiological profile of waste microflora slightly altered in the inoculated remediation variants as compared with the control sample. Interestingly, no difference in the degradation rates of hydrocarbons was revealed in the inoculated remediation variants and the control sample.

  8. Colonic bacterial composition in Parkinson's disease.

    PubMed

    Keshavarzian, Ali; Green, Stefan J; Engen, Phillip A; Voigt, Robin M; Naqib, Ankur; Forsyth, Christopher B; Mutlu, Ece; Shannon, Kathleen M

    2015-09-01

    We showed that Parkinson's disease (PD) patients have alpha-synuclein (α-Syn) aggregation in their colon with evidence of colonic inflammation. If PD patients have altered colonic microbiota, dysbiosis might be the mechanism of neuroinflammation that leads to α-Syn misfolding and PD pathology. Sixty-six sigmoid mucosal biopsies and 65 fecal samples were collected from 38 PD patients and 34 healthy controls. Mucosal-associated and feces microbiota compositions were characterized using high-throughput ribosomal RNA gene amplicon sequencing. Data were correlated with clinical measures of PD, and a predictive assessment of microbial community functional potential was used to identify microbial functions. The mucosal and fecal microbial community of PD patients was significantly different than control subjects, with the fecal samples showing more marked differences than the sigmoid mucosa. At the taxonomic level of genus, putative, "anti-inflammatory" butyrate-producing bacteria from the genera Blautia, Coprococcus, and Roseburia were significantly more abundant in feces of controls than PD patients. Bacteria from the genus Faecalibacterium were significantly more abundant in the mucosa of controls than PD. Putative, "proinflammatory" Proteobacteria of the genus Ralstonia were significantly more abundant in mucosa of PD than controls. Predictive metagenomics indicated that a large number of genes involved in metabolism were significantly lower in the PD fecal microbiome, whereas genes involved in lipopolysaccharide biosynthesis and type III bacterial secretion systems were significantly higher in PD patients. This report provides evidence that proinflammatory dysbiosis is present in PD patients and could trigger inflammation-induced misfolding of α-Syn and development of PD pathology. © 2015 International Parkinson and Movement Disorder Society.

  9. Bacterial communities in soil samples from the Mingyong Glacier of southwestern China.

    PubMed

    Li, Haoyu; Taj, Muhammad Kamran; Ji, Xiuling; Zhang, Qi; Lin, Liangbing; Zhou, Zhimei; Wei, Yunlin

    2017-05-01

    The present study was an effort to determine the bacterial diversity of soils in Mingyong Glacier located at the Meili Snow Mountains of southwestern China. Mingyong Glacier has different climatic zones within a very narrow area, and bacterial community diversity in this low temperature area remains largely unknown. In this study, soil samples were collected from four different climatic zones: M11A (dry warm valley), M14 (forest), M15 (grass land), and M16 (glacier zones). Phylogenetic analysis based on 16S rRNA gene V6 hypervariable region showed high bacterial abundance in the glacier. The number of Operational Taxonomic Units ranged from 2.24×10 3 to 5.56×10 3 in soil samples. Statistical analysis of 16S rRNA gene clone libraries results showed that bacterial diversity in zones M11A,M14 and M16 are higher than in zone M15. The bacterial community structures are clearly distinguishable, and phylogenetic analysis showed that the predominant phyla were Proteobacteria, Deinococcus-Thermus, Firmicutes, Actinobacteria, and Nitrospirae in Mingyong Glacier. Seventy-nine different orders from four zones have been isolated. Bacterial diversity and distribution of bacterial communities related to the anthropogenic perturbations in zone (M15) were confirmed by diversity index analysis, and the diversity index of other three zones was satisfactory through this analysis software. The results suggest that bacterial diversity and distribution analyses using bacterial 16S rRNA gene V6 hypervariable region were successful, and bacterial communities in this area not only had the same bacterial phyla compared to other glaciers but also had their own rare species.

  10. Evolution of bacterial-like phosphoprotein phosphatases in photosynthetic eukaryotes features ancestral mitochondrial or archaeal origin and possible lateral gene transfer.

    PubMed

    Uhrig, R Glen; Kerk, David; Moorhead, Greg B

    2013-12-01

    Protein phosphorylation is a reversible regulatory process catalyzed by the opposing reactions of protein kinases and phosphatases, which are central to the proper functioning of the cell. Dysfunction of members in either the protein kinase or phosphatase family can have wide-ranging deleterious effects in both metazoans and plants alike. Previously, three bacterial-like phosphoprotein phosphatase classes were uncovered in eukaryotes and named according to the bacterial sequences with which they have the greatest similarity: Shewanella-like (SLP), Rhizobiales-like (RLPH), and ApaH-like (ALPH) phosphatases. Utilizing the wealth of data resulting from recently sequenced complete eukaryotic genomes, we conducted database searching by hidden Markov models, multiple sequence alignment, and phylogenetic tree inference with Bayesian and maximum likelihood methods to elucidate the pattern of evolution of eukaryotic bacterial-like phosphoprotein phosphatase sequences, which are predominantly distributed in photosynthetic eukaryotes. We uncovered a pattern of ancestral mitochondrial (SLP and RLPH) or archaeal (ALPH) gene entry into eukaryotes, supplemented by possible instances of lateral gene transfer between bacteria and eukaryotes. In addition to the previously known green algal and plant SLP1 and SLP2 protein forms, a more ancestral third form (SLP3) was found in green algae. Data from in silico subcellular localization predictions revealed class-specific differences in plants likely to result in distinct functions, and for SLP sequences, distinctive and possibly functionally significant differences between plants and nonphotosynthetic eukaryotes. Conserved carboxyl-terminal sequence motifs with class-specific patterns of residue substitutions, most prominent in photosynthetic organisms, raise the possibility of complex interactions with regulatory proteins.

  11. Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)

    NASA Astrophysics Data System (ADS)

    Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina

    2014-09-01

    Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.

  12. Essentiality, conservation, evolutionary pressure and codon bias in bacterial genomes.

    PubMed

    Dilucca, Maddalena; Cimini, Giulio; Giansanti, Andrea

    2018-07-15

    Essential genes constitute the core of genes which cannot be mutated too much nor lost along the evolutionary history of a species. Natural selection is expected to be stricter on essential genes and on conserved (highly shared) genes, than on genes that are either nonessential or peculiar to a single or a few species. In order to further assess this expectation, we study here how essentiality of a gene is connected with its degree of conservation among several unrelated bacterial species, each one characterised by its own codon usage bias. Confirming previous results on E. coli, we show the existence of a universal exponential relation between gene essentiality and conservation in bacteria. Moreover, we show that, within each bacterial genome, there are at least two groups of functionally distinct genes, characterised by different levels of conservation and codon bias: i) a core of essential genes, mainly related to cellular information processing; ii) a set of less conserved nonessential genes with prevalent functions related to metabolism. In particular, the genes in the first group are more retained among species, are subject to a stronger purifying conservative selection and display a more limited repertoire of synonymous codons. The core of essential genes is close to the minimal bacterial genome, which is in the focus of recent studies in synthetic biology, though we confirm that orthologs of genes that are essential in one species are not necessarily essential in other species. We also list a set of highly shared genes which, reasonably, could constitute a reservoir of targets for new anti-microbial drugs. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Randomized Controlled Trial to Reduce Bacterial Colonization of Surgical Drains After Breast and Axillary Operations

    PubMed Central

    Degnim, Amy C.; Scow, Jeffrey S.; Hoskin, Tanya L.; Miller, Joyce P.; Loprinzi, Margie; Boughey, Judy C.; Jakub, James W.; Throckmorton, Alyssa; Patel, Robin; Baddour, Larry M.

    2014-01-01

    Objective To determine if bacterial colonization of drains can be reduced by local antiseptic interventions. Summary Background Drains are a potential source of bacterial entry into surgical wounds and may contribute to surgical site infection (SSI) after breast surgery. Methods Following IRB approval, patients undergoing total mastectomy and/or axillary lymph node dissection were randomized to standard drain care (control) or drain antisepsis (treated). Standard drain care comprised twice daily cleansing with alcohol swabs. Antisepsis drain care included 1) a chlorhexidine disc at the drain exit site and 2) irrigation of the drain bulb twice daily with dilute sodium hypochlorite (Dakin’s) solution. Cultures results of drain fluid and tubing were compared between control and antisepsis groups. Results Overall, 100 patients with 125 drains completed the study with 48 patients (58 drains) in the control group and 52 patients (67 drains) in the antisepsis group. Cultures of drain bulb fluid at one week were positive (1+ or greater growth) in 66% (38/58) of control drains compared to 21% of antisepsis drains (14/67), (p=0.0001). Drain tubing cultures demonstrated >50 CFU in 19% (8/43) of control drains versus 0% (0/53) of treated drains (p=0.004). SSI was diagnosed in 6 patients (6%) - 5 patients in the control group and 1 patient in the antisepsis group (p=0.06). Conclusions Simple and inexpensive local antiseptic interventions with a chlorhexidine disc and hypochlorite solution reduce bacterial colonization of drains. Based on these data, further study of drain antisepsis and its potential impact on SSI rate is warranted. PMID:23518704

  14. An Acidic PATHOGENESIS-RELATED1 Gene of Oryza grandiglumis is Involved in Disease Resistance Response Against Bacterial Infection

    PubMed Central

    Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo

    2014-01-01

    Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005

  15. Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

    DOEpatents

    Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

    2007-02-27

    The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

  16. Bacterial communications in implant infections: a target for an intelligence war.

    PubMed

    Costerton, J W; Montanaro, L; Arciola, C R

    2007-09-01

    The status of population density is communicated among bacteria by specific secreted molecules, called pheromones or autoinducers, and the control mechanism is called "quorum-sensing". Quorum-sensing systems regulate the expression of a panel of genes, allowing bacteria to adapt to modified environmental conditions at a high density of population. The two known different quorum systems are described as the LuxR-LuxI system in gram-negative bacteria, which uses an N-acyl-homoserine lactone (AHL) as signal, and the agr system in gram-positive bacteria, which uses a peptide-tiolactone as signal and the RNAIII as effector molecules. Both in gram-negative and in gram-positive bacteria, quorum-sensing systems regulate the expression of adhesion mechanisms (biofilm and adhesins) and virulence factors (toxins and exoenzymes) depending on population cell density. In gram-negative Pseudomonas aeruginosa, analogs of signaling molecules such as furanone analogs, are effective in attenuating bacterial virulence and controlling bacterial infections. In grampositive Staphylococcus aureus, the quorum-sensing RNAIII-inhibiting peptide (RIP), tested in vitro and in animal infection models, has been proved to inhibit virulence and prevent infections. Attenuation of bacterial virulence by quorum-sensing inhibitors, rather than by bactericidal or bacteriostatic drugs, is a highly attractive concept because these antibacterial agents are less likely to induce the development of bacterial resistance.

  17. Toward Personalized Control of Human Gut Bacterial Communities.

    PubMed

    David, Lawrence A

    2018-01-01

    A key challenge in microbiology will be developing tools for manipulating human gut bacterial communities. Our ability to predict and control the dynamics of these communities is now in its infancy. To manage human gut microbiota, I am developing methods in three research domains. First, I am refining in vitro tools to experimentally study gut microbes at high throughput and in controlled settings. Second, I am adapting "big data" techniques to overcome statistical challenges confronting microbiota modeling. Third, I am testing study designs that can streamline human testing of microbiota manipulations. Assembling these methods creates new challenges, including training scientists who can work across disciplines such as engineering, ecology, and medicine. Nevertheless, I envision that overcoming these obstacles will enable my group to construct platforms that can personalize microbiota treatments, particularly ones based on diet. More broadly, I anticipate that such platforms will have applications across fields such as agriculture, biotechnology, and environmental management.

  18. Structural characteristics of ScBx genes controlling the biosynthesis of hydroxamic acids in rye (Secale cereale L.).

    PubMed

    Bakera, Beata; Makowska, Bogna; Groszyk, Jolanta; Niziołek, Michał; Orczyk, Wacław; Bolibok-Brągoszewska, Hanna; Hromada-Judycka, Aneta; Rakoczy-Trojanowska, Monika

    2015-08-01

    Benzoxazinoids (BX) are major secondary metabolites of gramineous plants that play an important role in disease resistance and allelopathy. They also have many other unique properties including anti-bacterial and anti-fungal activity, and the ability to reduce alfa-amylase activity. The biosynthesis and modification of BX are controlled by the genes Bx1 ÷ Bx10, GT and glu, and the majority of these Bx genes have been mapped in maize, wheat and rye. However, the genetic basis of BX biosynthesis remains largely uncharacterized apart from some data from maize and wheat. The aim of this study was to isolate, sequence and characterize five genes (ScBx1, ScBx2, ScBx3, ScBx4 and ScBx5) encoding enzymes involved in the synthesis of DIBOA, an important defense compound of rye. Using a modified 3D procedure of BAC library screening, seven BAC clones containing all of the ScBx genes were isolated and sequenced. Bioinformatic analyses of the resulting contigs were used to examine the structure and other features of these genes, including their promoters, introns and 3'UTRs. Comparative analysis showed that the ScBx genes are similar to those of other Poaceae species, especially to the TaBx genes. The polymorphisms present both in the coding sequences and non-coding regions of ScBx in relation to other Bx genes are predicted to have an impact on the expression, structure and properties of the encoded proteins.

  19. Clavibacter michiganensis ssp. michiganensis: bacterial canker of tomato, molecular interactions and disease management.

    PubMed

    Nandi, Munmun; Macdonald, Jacqueline; Liu, Peng; Weselowski, Brian; Yuan, Ze-Chun

    2018-03-12

    Bacterial canker disease is considered to be one of the most destructive diseases of tomato (Solanum lycopersicum), and is caused by the seed-borne Gram-positive bacterium Clavibacter michiganensis ssp. michiganensis (Cmm). This vascular pathogen generally invades and proliferates in the xylem through natural openings or wounds, causing wilt and canker symptoms. The incidence of symptomless latent infections and the invasion of tomato seeds by Cmm are widespread. Pathogenicity is mediated by virulence factors and transcriptional regulators encoded by the chromosome and two natural plasmids. The virulence factors include serine proteases, cell wall-degrading enzymes (cellulases, xylanases, pectinases) and others. Mutational analyses of these genes and gene expression profiling (via quantitative reverse transcription-polymerase chain reaction, transcriptomics and proteomics) have begun to shed light on their roles in colonization and virulence, whereas the expression of tomato genes in response to Cmm infection suggests plant factors involved in the defence response. These findings may aid in the generation of target-specific bactericides or new resistant varieties of tomato. Meanwhile, various chemical and biological controls have been researched to control Cmm. This review presents a detailed investigation regarding the pathogen Cmm, bacterial canker infection, molecular interactions between Cmm and tomato, and current perspectives on improved disease management. © 2018 AGRICULTURE AND AGRI-FOOD CANADA. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.

  20. High throughput 16SrRNA gene sequencing reveals the correlation between Propionibacterium acnes and sarcoidosis.

    PubMed

    Zhao, Meng-Meng; Du, Shan-Shan; Li, Qiu-Hong; Chen, Tao; Qiu, Hui; Wu, Qin; Chen, Shan-Shan; Zhou, Ying; Zhang, Yuan; Hu, Yang; Su, Yi-Liang; Shen, Li; Zhang, Fen; Weng, Dong; Li, Hui-Ping

    2017-02-01

    This study aims to use high throughput 16SrRNA gene sequencing to examine the bacterial profile of lymph node biopsy samples of patients with sarcoidosis and to further verify the association between Propionibacterium acnes (P. acnes) and sarcoidosis. A total of 36 mediastinal lymph node biopsy specimens were collected from 17 cases of sarcoidosis, 8 tuberculosis (TB group), and 11 non-infectious lung diseases (control group). The V4 region of the bacterial 16SrRNA gene in the specimens was amplified and sequenced using the high throughput sequencing platform MiSeq, and bacterial profile was established. The data analysis software QIIME and Metastats were used to compare bacterial relative abundance in the three patient groups. Overall, 545 genera were identified; 38 showed significantly lower and 29 had significantly higher relative abundance in the sarcoidosis group than in the TB and control groups (P < 0.01). P. acnes 16SrRNA was exclusively found in all the 17 samples of the sarcoidosis group, whereas was not detected in the TB and control groups. The relative abundance of P. acnes in the sarcoidosis group (0.16% ± 0. 11%) was significantly higher than that in the TB (Metastats analysis: P = 0.0010, q = 0.0044) and control groups (Metastats analysis: P = 0.0010, q = 0.0038). The relative abundance of P. granulosum was only 0.0022% ± 0. 0044% in the sarcoidosis group. P. granulosum 16SrRNA was not detected in the other two groups. High throughput 16SrRNA gene sequencing appears to be a useful tool to investigate the bacterial profile of sarcoidosis specimens. The results suggest that P. acnes may be involved in sarcoidosis development.

  1. ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

    PubMed Central

    Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

    2002-01-01

    ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

  2. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  3. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  4. Dynamic Blue Light-Inducible T7 RNA Polymerases (Opto-T7RNAPs) for Precise Spatiotemporal Gene Expression Control.

    PubMed

    Baumschlager, Armin; Aoki, Stephanie K; Khammash, Mustafa

    2017-11-17

    Light has emerged as a control input for biological systems due to its precise spatiotemporal resolution. The limited toolset for light control in bacteria motivated us to develop a light-inducible transcription system that is independent from cellular regulation through the use of an orthogonal RNA polymerase. Here, we present our engineered blue light-responsive T7 RNA polymerases (Opto-T7RNAPs) that show properties such as low leakiness of gene expression in the dark state, high expression strength when induced with blue light, and an inducible range of more than 300-fold. Following optimization of the system to reduce expression variability, we created a variant that returns to the inactive dark state within minutes once the blue light is turned off. This allows for precise dynamic control of gene expression, which is a key aspect for most applications using optogenetic regulation. The regulators, which only require blue light from ordinary light-emitting diodes for induction, were developed and tested in the bacterium Escherichia coli, which is a crucial cell factory for biotechnology due to its fast and inexpensive cultivation and well understood physiology and genetics. Opto-T7RNAP, with minor alterations, should be extendable to other bacterial species as well as eukaryotes such as mammalian cells and yeast in which the T7 RNA polymerase and the light-inducible Vivid regulator have been shown to be functional. We anticipate that our approach will expand the applicability of using light as an inducer for gene expression independent from cellular regulation and allow for a more reliable dynamic control of synthetic and natural gene networks.

  5. Translational control of small heat shock genes in mesophilic and thermophilic cyanobacteria by RNA thermometers

    PubMed Central

    Cimdins, Annika; Klinkert, Birgit; Aschke-Sonnenborn, Ursula; Kaiser, Friederike M; Kortmann, Jens; Narberhaus, Franz

    2014-01-01

    Cyanobacteria constitute a heterogeneous phylum of oxygen-producing, photosynthetic prokaryotes. They are susceptible to various stress conditions like heat, salt, or light stress, all inducing the cyanobacterial heat shock response (HSR). Cyanobacterial small heat shock proteins (sHsps) are known to preserve thylakoid membrane integrity under stress conditions, thereby protecting the photosynthesis machinery. In Synechocystis sp PCC 6803, synthesis of the sHsp Hsp17 is regulated by an RNA thermometer (RNAT) in the 5′-untranslated region (5′-UTR) of the hsp17 mRNA. RNATs are direct temperature sensors that control expression of many bacterial heat shock and virulence genes. They hinder translation at low temperatures by base pairing, thus blocking ribosome access to the mRNA.   To explore the temperature range in which RNATs act, we studied various RNAT candidates upstream of sHsp genes from mesophilic and thermophilic cyanobacteria. The mesophilic cyanobacteria Anabaena variabilis and Nostoc sp chromosomally encode two sHsps each. Reporter gene studies suggested RNAT-mediated post-transcriptional regulation of shsp expression in both organisms. Detailed structural analysis of the two A. variabilis candidates revealed two novel RNAT types. The first, avashort, regulates translation primarily by masking of the AUG translational start codon. The second, featuring an extended initial hairpin, thus named avalong, presumably makes use of complex tertiary interaction. The 5′-UTR of the small heat shock gene hspA in the thermophile Thermosynechococcus elongatus is predicted to adopt an extended secondary structure. Structure probing revealed that the ribosome binding site was blocked at temperatures below 55 °C. The results of this study demonstrate that cyanobacteria commonly use RNATs to control expression of their small heat shock genes. PMID:24755616

  6. Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes.

    PubMed

    Mathioni, Sandra M; Patel, Nrupali; Riddick, Bianca; Sweigard, James A; Czymmek, Kirk J; Caplan, Jeffrey L; Kunjeti, Sridhara G; Kunjeti, Saritha; Raman, Vidhyavathi; Hillman, Bradley I; Kobayashi, Donald Y; Donofrio, Nicole M

    2013-01-01

    Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.

  7. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry.

    PubMed

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar

    2016-01-01

    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed.

  8. Characterization of bacterial community associated with phytoplankton bloom in a eutrophic lake in South Norway using 16S rRNA gene amplicon sequence analysis.

    PubMed

    Parulekar, Niranjan Nitin; Kolekar, Pandurang; Jenkins, Andrew; Kleiven, Synne; Utkilen, Hans; Johansen, Anette; Sawant, Sangeeta; Kulkarni-Kale, Urmila; Kale, Mohan; Sæbø, Mona

    2017-01-01

    Interactions between different phytoplankton taxa and heterotrophic bacterial communities within aquatic environments can differentially support growth of various heterotrophic bacterial species. In this study, phytoplankton diversity was studied using traditional microscopic techniques and the bacterial communities associated with phytoplankton bloom were studied using High Throughput Sequencing (HTS) analysis of 16S rRNA gene amplicons from the V1-V3 and V3-V4 hypervariable regions. Samples were collected from Lake Akersvannet, a eutrophic lake in South Norway, during the growth season from June to August 2013. Microscopic examination revealed that the phytoplankton community was mostly represented by Cyanobacteria and the dinoflagellate Ceratium hirundinella. The HTS results revealed that Proteobacteria (Alpha, Beta, and Gamma), Bacteriodetes, Cyanobacteria, Actinobacteria and Verrucomicrobia dominated the bacterial community, with varying relative abundances throughout the sampling season. Species level identification of Cyanobacteria showed a mixed population of Aphanizomenon flos-aquae, Microcystis aeruginosa and Woronichinia naegeliana. A significant proportion of the microbial community was composed of unclassified taxa which might represent locally adapted freshwater bacterial groups. Comparison of cyanobacterial species composition from HTS and microscopy revealed quantitative discrepancies, indicating a need for cross validation of results. To our knowledge, this is the first study that uses HTS methods for studying the bacterial community associated with phytoplankton blooms in a Norwegian lake. The study demonstrates the value of considering results from multiple methods when studying bacterial communities.

  9. Intestinal microbiota and innate immunity-related gene alteration in cirrhotic rats with liver transplantation.

    PubMed

    Xie, Y R; Liu, S L; Liu, X; Luo, Z B; Zhu, B; Li, Z F; Li, L J; He, Y; Jiang, L; Li, H; Ruan, B

    2011-12-01

    The present study investigated the alteration of intestinal microbiota, innate immunity-related genes, and bacterial translocation in rats with cirrhosis and liver transplantation. Specific pathogen-free Sprague-Dawley rats were randomized into 4 groups: (1) normal controls (N); (2) liver cirrhosis (LC); (3) normal control groups with liver transplantation (LTN); and (4) liver cirrhosis with liver transplantation (LTC). We examined plasma endotoxin, bacterial tacslocation, denaturing gradient gel electrophoresis (DGGE) profile of intestinal mucosa-associated bacteria, abundance of key bacterial populations, and expression of innate immunity-related gene. The LTC and LC group, showed higher endotoxin levels (1.08±0.73 EU/mL and 0.74±0.70 EU/mL, respectively) than the N group (0.27±0.13 EU/mL; P<.05). the incidence of bacterial translocation (BT) to liver and mesenteric lymph nodes (MLN), and the number of total bacteria were increased significantly in the LTC and LC groups compared with the N group (P<.05). The counts of Lactobacilli and Bacteroides were lower, whereas Enterobacteria were higher in the LC than the N group (P<.05). Mucins (MUC2, MUC3) and Toll-like receptors (TLR2, TLR4) messenger RNA (mRNA) expression were significantly higher in the LC and LTC groups than the N group (P<.05). The marked difference between the groups in the overall structure of the bacterial community was also generated by DGGE profiles. Liver cirrhosis disturbs intestinal microbiota and innate immunity-related genes, which contributes to endotoxemia and bacterial translocation. These had not completely recovered in cirrhotic rats until 1 month after orthotopic liver transplantation. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Growth-rate dependent global effects on gene expression in bacteria

    PubMed Central

    Klumpp, Stefan; Zhang, Zhongge; Hwa, Terence

    2010-01-01

    Summary Bacterial gene expression depends not only on specific regulations but also directly on bacterial growth, because important global parameters such as the abundance of RNA polymerases and ribosomes are all growth-rate dependent. Understanding these global effects is necessary for a quantitative understanding of gene regulation and for the robust design of synthetic genetic circuits. The observed growth-rate dependence of constitutive gene expression can be explained by a simple model using the measured growth-rate dependence of the relevant cellular parameters. More complex growth dependences for genetic circuits involving activators, repressors and feedback control were analyzed, and salient features were verified experimentally using synthetic circuits. The results suggest a novel feedback mechanism mediated by general growth-dependent effects and not requiring explicit gene regulation, if the expressed protein affects cell growth. This mechanism can lead to growth bistability and promote the acquisition of important physiological functions such as antibiotic resistance and tolerance (persistence). PMID:20064380

  11. Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.

    PubMed

    Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav

    2018-05-22

    Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.

  12. 14. GENE PUMPING STATION CONTROL ROOM AS SEEN FROM MAIN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. GENE PUMPING STATION CONTROL ROOM AS SEEN FROM MAIN STATION MANAGER'S CONTROL DESK. ELECTRICAL CONTROL INDICATORS AND CONTROLS FOR REGULATING ELECTRICITY INTO PLANT AS WELL AS SYNCHRONIZING STARTUP OF PUMPS. - Gene Pump Plant, South of Gene Wash Reservoir, 2 miles west of Whitsett Pump Plant, Parker Dam, San Bernardino County, CA

  13. Airborne bacterial assemblage in a zero carbon building: A case study.

    PubMed

    Leung, M H Y; Tong, X; Tong, J C K; Lee, P K H

    2018-01-01

    Currently, there is little information pertaining to the airborne bacterial communities of green buildings. In this case study, the air bacterial community of a zero carbon building (ZCB) in Hong Kong was characterized by targeting the bacterial 16S rRNA gene. Bacteria associated with the outdoor environment dominated the indoor airborne bacterial assemblage, with a modest contribution from bacteria associated with human skin. Differences in overall community diversity, membership, and composition associated with short (day-to-day) and long-term temporal properties were detected, which may have been driven by specific environmental genera and taxa. Furthermore, time-decay relationships in community membership (based on unweighted UniFrac distances) and composition (based on weighted UniFrac distances) differed depending on the season and sampling location. A Bayesian source-tracking approach further supported the importance of adjacent outdoor air bacterial assemblage in sourcing the ZCB indoor bioaerosol. Despite the unique building attributes, the ZCB microbial assemblage detected and its temporal characteristics were not dissimilar to that of conventional built environments investigated previously. Future controlled experiments and microbial assemblage investigations of other ZCBs will undoubtedly uncover additional knowledge related to how airborne bacteria in green buildings may be influenced by their distinctive architectural attributes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Bacterial diversity in water injection systems of Brazilian offshore oil platforms.

    PubMed

    Korenblum, Elisa; Valoni, Erika; Penna, Mônica; Seldin, Lucy

    2010-01-01

    Biogenic souring and microbial-influenced corrosion is a common scenario in water-flooded petroleum reservoirs. Water injection systems are continuously treated to control bacterial contamination, but some bacteria that cause souring and corrosion can persist even after different treatments have been applied. Our aim was to increase our knowledge of the bacterial communities that persist in the water injection systems of three offshore oil platforms in Brazil. To achieve this goal, we used a culture-independent molecular approach (16S ribosomal RNA gene clone libraries) to analyze seawater samples that had been subjected to different treatments. Phylogenetic analyses revealed that the bacterial communities from the different platforms were taxonomically different. A predominance of bacterial clones affiliated with Gammaproteobacteria, mostly belonging to the genus Marinobacter (60.7%), were observed in the platform A samples. Clones from platform B were mainly related to the genera Colwellia (37.9%) and Achromobacter (24.6%), whereas clones obtained from platform C were all related to unclassified bacteria. Canonical correspondence analyses showed that different treatments such as chlorination, deoxygenation, and biocide addition did not significantly influence the bacterial diversity in the platforms studied. Our results demonstrated that the injection water used in secondary oil recovery procedures contained potentially hazardous bacteria, which may ultimately cause souring and corrosion.

  15. Top-down controls on bacterial community structure: microbial network analysis of bacteria, T4-like viruses and protists

    PubMed Central

    Chow, Cheryl-Emiliane T; Kim, Diane Y; Sachdeva, Rohan; Caron, David A; Fuhrman, Jed A

    2014-01-01

    Characterizing ecological relationships between viruses, bacteria and protists in the ocean are critical to understanding ecosystem function, yet these relationships are infrequently investigated together. We evaluated these relationships through microbial association network analysis of samples collected approximately monthly from March 2008 to January 2011 in the surface ocean (0–5 m) at the San Pedro Ocean Time series station. Bacterial, T4-like myoviral and protistan communities were described by Automated Ribosomal Intergenic Spacer Analysis and terminal restriction fragment length polymorphism of the gene encoding the major capsid protein (g23) and 18S ribosomal DNA, respectively. Concurrent shifts in community structure suggested similar timing of responses to environmental and biological parameters. We linked T4-like myoviral, bacterial and protistan operational taxonomic units by local similarity correlations, which were then visualized as association networks. Network links (correlations) potentially represent synergistic and antagonistic relationships such as viral lysis, grazing, competition or other interactions. We found that virus–bacteria relationships were more cross-linked than protist–bacteria relationships, suggestive of increased taxonomic specificity in virus–bacteria relationships. We also found that 80% of bacterial–protist and 74% of bacterial–viral correlations were positive, with the latter suggesting that at monthly and seasonal timescales, viruses may be following their hosts more often than controlling host abundance. PMID:24196323

  16. Dynamics of indigenous bacterial communities associated with crude oil degradation in soil microcosms during nutrient-enhanced bioremediation.

    PubMed

    Chikere, Chioma B; Surridge, Karen; Okpokwasili, Gideon C; Cloete, Thomas E

    2012-03-01

    Bacterial population dynamics were examined during bioremediation of an African soil contaminated with Arabian light crude oil and nutrient enrichment (biostimulation). Polymerase chain reaction followed by denaturing gradient gel electrophoresis (DGGE) were used to generate bacterial community fingerprints of the different treatments employing the 16S ribosomal ribonucleic acid (rRNA) gene as molecular marker. The DGGE patterns of the nutrient-amended soils indicated the presence of distinguishable bands corresponding to the oil-contaminated-nutrient-enriched soils, which were not present in the oil-contaminated and pristine control soils. Further characterization of the dominant DGGE bands after excision, reamplification and sequencing revealed that Corynebacterium spp., Dietzia spp., Rhodococcus erythropolis sp., Nocardioides sp., Low G+C (guanine plus cytosine) Gram positive bacterial clones and several uncultured bacterial clones were the dominant bacterial groups after biostimulation. Prominent Corynebacterium sp. IC10 sequence was detected across all nutrient-amended soils but not in oil-contaminated control soil. Total heterotrophic and hydrocarbon utilizing bacterial counts increased significantly in the nutrient-amended soils 2 weeks post contamination whereas oil-contaminated and pristine control soils remained fairly stable throughout the experimental period. Gas chromatographic analysis of residual hydrocarbons in biostimulated soils showed marked attenuation of contaminants starting from the second to the sixth week after contamination whereas no significant reduction in hydrocarbon peaks were seen in the oil-contaminated control soil throughout the 6-week experimental period. Results obtained indicated that nutrient amendment of oil-contaminated soil selected and enriched the bacterial communities mainly of the Actinobacteria phylogenetic group capable of surviving in toxic contamination with concomitant biodegradation of the hydrocarbons. The

  17. Distinct Bacterial Communities in Surficial Seafloor Sediments Following the 2010 Deepwater Horizon Blowout.

    PubMed

    Yang, Tingting; Speare, Kelly; McKay, Luke; MacGregor, Barbara J; Joye, Samantha B; Teske, Andreas

    2016-01-01

    A major fraction of the petroleum hydrocarbons discharged during the 2010 Macondo oil spill became associated with and sank to the seafloor as marine snow flocs. This sedimentation pulse induced the development of distinct bacterial communities. Between May 2010 and July 2011, full-length 16S rRNA gene clone libraries demonstrated bacterial community succession in oil-polluted sediment samples near the wellhead area. Libraries from early May 2010, before the sedimentation event, served as the baseline control. Freshly deposited oil-derived marine snow was collected on the surface of sediment cores in September 2010, and was characterized by abundantly detected members of the marine Roseobacter cluster within the Alphaproteobacteria. Samples collected in mid-October 2010 closest to the wellhead contained members of the sulfate-reducing, anaerobic bacterial families Desulfobacteraceae and Desulfobulbaceae within the Deltaproteobacteria, suggesting that the oil-derived sedimentation pulse triggered bacterial oxygen consumption and created patchy anaerobic microniches that favored sulfate-reducing bacteria. Phylotypes of the polycyclic aromatic hydrocarbon-degrading genus Cycloclasticus, previously found both in surface oil slicks and the deep hydrocarbon plume, were also found in oil-derived marine snow flocs sedimenting on the seafloor in September 2010, and in surficial sediments collected in October and November 2010, but not in any of the control samples. Due to the relative recalcitrance and stability of polycyclic aromatic compounds, Cycloclasticus represents the most persistent microbial marker of seafloor hydrocarbon deposition that we could identify in this dataset. The bacterial imprint of the DWH oil spill had diminished in late November 2010, when the bacterial communities in oil-impacted sediment samples collected near the Macondo wellhead began to resemble their pre-spill counterparts and spatial controls. Samples collected in summer of 2011 did not show

  18. Distinct Bacterial Communities in Surficial Seafloor Sediments Following the 2010 Deepwater Horizon Blowout

    PubMed Central

    Yang, Tingting; Speare, Kelly; McKay, Luke; MacGregor, Barbara J.; Joye, Samantha B.; Teske, Andreas

    2016-01-01

    A major fraction of the petroleum hydrocarbons discharged during the 2010 Macondo oil spill became associated with and sank to the seafloor as marine snow flocs. This sedimentation pulse induced the development of distinct bacterial communities. Between May 2010 and July 2011, full-length 16S rRNA gene clone libraries demonstrated bacterial community succession in oil-polluted sediment samples near the wellhead area. Libraries from early May 2010, before the sedimentation event, served as the baseline control. Freshly deposited oil-derived marine snow was collected on the surface of sediment cores in September 2010, and was characterized by abundantly detected members of the marine Roseobacter cluster within the Alphaproteobacteria. Samples collected in mid-October 2010 closest to the wellhead contained members of the sulfate-reducing, anaerobic bacterial families Desulfobacteraceae and Desulfobulbaceae within the Deltaproteobacteria, suggesting that the oil-derived sedimentation pulse triggered bacterial oxygen consumption and created patchy anaerobic microniches that favored sulfate-reducing bacteria. Phylotypes of the polycyclic aromatic hydrocarbon-degrading genus Cycloclasticus, previously found both in surface oil slicks and the deep hydrocarbon plume, were also found in oil-derived marine snow flocs sedimenting on the seafloor in September 2010, and in surficial sediments collected in October and November 2010, but not in any of the control samples. Due to the relative recalcitrance and stability of polycyclic aromatic compounds, Cycloclasticus represents the most persistent microbial marker of seafloor hydrocarbon deposition that we could identify in this dataset. The bacterial imprint of the DWH oil spill had diminished in late November 2010, when the bacterial communities in oil-impacted sediment samples collected near the Macondo wellhead began to resemble their pre-spill counterparts and spatial controls. Samples collected in summer of 2011 did not show

  19. The positioning logic and copy number control of genes in bacteria under stress

    NASA Astrophysics Data System (ADS)

    Zhang, Qiucen; Austin, Robert; Vyawahare, Saurabh; Lau, Alexandra

    2013-03-01

    Escherichia coli (E. coli) cells when challenged with sublethal concentrations of the genotoxic antibiotic ciprofloxacin cease to divide and form long filaments which contain multiple bacterial chromosomes. These filaments are individual mesoscopic environmental niches which provide protection for a community of chromosomes (as opposed to cells) under mutagenic stress and can provide an evolutionary fitness advantage within the niche. We use comparative genomic hybridization to show that the mesoscopic niche evolves within 20 minutes of ciprofloxacin exposure via replication of multiple copies of genes expressing ATP dependent transporters. We show that this rapid genomic amplification is done in a time efficient manner via placement of the genes encoding the pumps near the origin of replication on the bacterial chromosome. The de-amplification of multiple copies back to the wild type number is a function of the duration is a function of the ciprofloxacin exposure duration: the longer the exposure, the slower the removal of the multiple copies. The project described was supported by the National Science Foundation and the National Cancer Institute

  20. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novelmore » regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.« less

  1. Factors influencing efficacy of plastic shelters for control of bacterial blight of lilac

    USDA-ARS?s Scientific Manuscript database

    Plastic shelters are thought to manage bacterial blight by protecting plants from rain and/or frost. In February to April 2008 and 2009, we studied the contribution of frost protection to efficacy of this cultural control practice. Lilacs in 1-gallon pots were exposed to four treatments: 1) plants...

  2. Bacterial community structure in the drinking water microbiome is governed by filtration processes.

    PubMed

    Pinto, Ameet J; Xi, Chuanwu; Raskin, Lutgarde

    2012-08-21

    The bacterial community structure of a drinking water microbiome was characterized over three seasons using 16S rRNA gene based pyrosequencing of samples obtained from source water (a mix of a groundwater and a surface water), different points in a drinking water plant operated to treat this source water, and in the associated drinking water distribution system. Even though the source water was shown to seed the drinking water microbiome, treatment process operations limit the source water's influence on the distribution system bacterial community. Rather, in this plant, filtration by dual media rapid sand filters played a primary role in shaping the distribution system bacterial community over seasonal time scales as the filters harbored a stable bacterial community that seeded the water treatment processes past filtration. Bacterial taxa that colonized the filter and sloughed off in the filter effluent were able to persist in the distribution system despite disinfection of finished water by chloramination and filter backwashing with chloraminated backwash water. Thus, filter colonization presents a possible ecological survival strategy for bacterial communities in drinking water systems, which presents an opportunity to control the drinking water microbiome by manipulating the filter microbial community. Grouping bacterial taxa based on their association with the filter helped to elucidate relationships between the abundance of bacterial groups and water quality parameters and showed that pH was the strongest regulator of the bacterial community in the sampled drinking water system.

  3. Bacterial DNA indicated as an important inducer of fish cathelicidins.

    PubMed

    Maier, Valerie Helene; Schmitt, Clemens Nikolaus Zeno; Gudmundsdottir, Sigridur; Gudmundsson, Gudmundur Hrafn

    2008-04-01

    Cathelicidins are antimicrobial peptides indicated as important in the control of the natural microflora as well as in the fight against bacterial invasion in mammals. Little is known about cathelicidins in fish and here the Chinook salmon (Oncorhynchus tshawytscha) embryo cell line (CHSE-214) was used as a model system to study the expression of cathelicidins due to fish pathogenic bacteria. The cDNA of cathelicidin from CHSE-214 cells (csCath) was cloned and shown to be closely related to gene 2 of both rainbow trout and Atlantic salmon. The deducted amino acid sequence showed highest sequence identity to rtCath2 with 95% and 72% for the cathelin and the antibacterial part, respectively. Cathelicidin gene expression was studied and various Gram positive and Gram negative bacteria caused the upregulation of the gene (csCath). Bacterial DNA and protein were shown important for the induction of cathelicidin expression in these cells. LPS (Escherichia coli) also causes the upregulation of cathelicidins, but digestion of the LPS with DNase I before incubation of the cells, totally abolished the upregulation of cathelicidin and suggests DNA contamination in the LPS to be the trigger for this effect. These results could explain the limited responsiveness of fish cells towards pure LPS and confirm previous suggestions that fish cells are less sensitive to LPS than mammalian cells.

  4. Tissue- and cell-specific expression of mouse xanthine oxidoreductase gene in vivo: regulation by bacterial lipopolysaccharide.

    PubMed Central

    Kurosaki, M; Li Calzi, M; Scanziani, E; Garattini, E; Terao, M

    1995-01-01

    The expression of the xanthine oxidoreductase gene was studied in various mouse organs and tissues, under basal conditions and on treatment with bacterial lipopolysaccharide. Levels of xanthine oxidoreductase protein and mRNA were compared in order to understand the molecular mechanisms regulating the expression of this enzyme system. The highest amounts of xanthine oxidoreductase and the respective mRNA are observed in the duodenum and jejunum, where the protein is present in an unusual form because of a specific proteolytic cleavage of the primary translation product present in all locations. Under basal conditions, multiple tissue-specific mechanisms of xanthine oxidoreductase regulation are evident. Lipopolysaccharide increases enzyme activity in some, but not all tissues, mainly via modulation of the respective transcript, although translational and post-translational mechanisms are also active. In situ hybridization studies on tissue sections obtained from mice under control conditions or with lipopolysaccharide treatment demonstrate that xanthine oxidoreductase is present in hepatocytes, predominantly in the proximal tubules of the kidney, epithelial layer of the gastrointestinal mucosa, the alveolar compartment of the lung, the pulpar region of the spleen and the vascular component of the heart. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:7864814

  5. Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism

    DOE PAGES

    Staley, Christopher; Ferrieri, Abigail P.; Tfaily, Malak M.; ...

    2017-06-24

    The circadian clock regulates plant metabolic functions and is an important component in plant health and productivity. Rhizosphere bacteria play critical roles in plant growth, health, and development and are shaped primarily by soil communities. Using Illumina next-generation sequencing and high-resolution mass spectrometry, we characterized bacterial communities of wild-type (Col-0) Arabidopsis thaliana and an acyclic line (OX34) ectopically expressing the circadian clock-associated cca1 transcription factor, relative to a soil control, to determine how cycling dynamics affected the microbial community. Microbial communities associated with Brachypodium distachyon (BD21) were also evaluated.Significantly different bacterial community structures ( P = 0.031) were observed inmore » the rhizosphere of wild-type plants between light and dark cycle samples. Furthermore, 13% of the community showed cycling, with abundances of several families, including Burkholderiaceae, Rhodospirillaceae, Planctomycetaceae, and Gaiellaceae, exhibiting fluctuation in abundances relative to the light cycle. However, limited-to-no cycling was observed in the acyclic CCAox34 line or in soil controls. Significant cycling was also observed, to a lesser extent, in Brachypodium. Functional gene inference revealed that genes involved in carbohydrate metabolism were likely more abundant in near-dawn, dark samples. Additionally, the composition of organic matter in the rhizosphere showed a significant variation between dark and light cycles.The results of this study suggest that the rhizosphere bacterial community is regulated, to some extent, by the circadian clock and is likely influenced by, and exerts influences, on plant metabolism and productivity. The timing of bacterial cycling in relation to that of Arabidopsis further suggests that diurnal dynamics influence plant-microbe carbon metabolism and exchange. Equally important, our results suggest that previous studies done without

  6. Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Staley, Christopher; Ferrieri, Abigail P.; Tfaily, Malak M.

    The circadian clock regulates plant metabolic functions and is an important component in plant health and productivity. Rhizosphere bacteria play critical roles in plant growth, health, and development and are shaped primarily by soil communities. Using Illumina next-generation sequencing and high-resolution mass spectrometry, we characterized bacterial communities of wild-type (Col-0) Arabidopsis thaliana and an acyclic line (OX34) ectopically expressing the circadian clock-associated cca1 transcription factor, relative to a soil control, to determine how cycling dynamics affected the microbial community. Microbial communities associated with Brachypodium distachyon (BD21) were also evaluated.Significantly different bacterial community structures ( P = 0.031) were observed inmore » the rhizosphere of wild-type plants between light and dark cycle samples. Furthermore, 13% of the community showed cycling, with abundances of several families, including Burkholderiaceae, Rhodospirillaceae, Planctomycetaceae, and Gaiellaceae, exhibiting fluctuation in abundances relative to the light cycle. However, limited-to-no cycling was observed in the acyclic CCAox34 line or in soil controls. Significant cycling was also observed, to a lesser extent, in Brachypodium. Functional gene inference revealed that genes involved in carbohydrate metabolism were likely more abundant in near-dawn, dark samples. Additionally, the composition of organic matter in the rhizosphere showed a significant variation between dark and light cycles.The results of this study suggest that the rhizosphere bacterial community is regulated, to some extent, by the circadian clock and is likely influenced by, and exerts influences, on plant metabolism and productivity. The timing of bacterial cycling in relation to that of Arabidopsis further suggests that diurnal dynamics influence plant-microbe carbon metabolism and exchange. Equally important, our results suggest that previous studies done without

  7. Bacterial pathogen gene abundance and relation to recreational water quality at seven Great Lakes beaches

    USGS Publications Warehouse

    Oster, Ryan J.; Wijesinghe, Rasanthi U.; Fogarty, Lisa Reynolds; Haack, Sheridan K.; Fogarty, Lisa R.; Tucker, Taaja R.; Riley, Stephen

    2014-01-01

    Quantitative assessment of bacterial pathogens, their geographic variability, and distribution in various matrices at Great Lakes beaches are limited. Quantitative PCR (qPCR) was used to test for genes from E. coli O157:H7 (eaeO157), shiga-toxin producing E. coli (stx2), Campylobacter jejuni (mapA), Shigella spp. (ipaH), and a Salmonella enterica-specific (SE) DNA sequence at seven Great Lakes beaches, in algae, water, and sediment. Overall, detection frequencies were mapA>stx2>ipaH>SE>eaeO157. Results were highly variable among beaches and matrices; some correlations with environmental conditions were observed for mapA, stx2, and ipaH detections. Beach seasonal mean mapA abundance in water was correlated with beach seasonal mean log10E. coli concentration. At one beach, stx2 gene abundance was positively correlated with concurrent daily E. coli concentrations. Concentration distributions for stx2, ipaH, and mapA within algae, sediment, and water were statistically different (Non-Detect and Data Analysis in R). Assuming 10, 50, or 100% of gene copies represented viable and presumably infective cells, a quantitative microbial risk assessment tool developed by Michigan State University indicated a moderate probability of illness for Campylobacter jejuni at the study beaches, especially where recreational water quality criteria were exceeded. Pathogen gene quantification may be useful for beach water quality management.

  8. Genomic features of bacterial adaptation to plants

    DOE PAGES

    Levy, Asaf; Salas Gonzalez, Isai; Mittelviefhaus, Maximilian; ...

    2017-12-18

    Plants intimately associate with diverse bacteria. Plant-associated bacteria have ostensibly evolved genes that enable them to adapt to plant environments. However, the identities of such genes are mostly unknown, and their functions are poorly characterized. In this study, we sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3,837 bacterial genomes to identify thousands of plant-associated gene clusters. Genomes of plant-associated bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant-associated genomes do. We experimentally validated candidates from two sets of plant-associated genes: one involved in plant colonization, and themore » other serving in microbe–microbe competition between plant-associated bacteria. We also identified 64 plant-associated protein domains that potentially mimic plant domains; some are shared with plant-associated fungi and oomycetes. In conclusion, this work expands the genome-based understanding of plant–microbe interactions and provides potential leads for efficient and sustainable agriculture through microbiome engineering.« less

  9. Genomic features of bacterial adaptation to plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Levy, Asaf; Salas Gonzalez, Isai; Mittelviefhaus, Maximilian

    Plants intimately associate with diverse bacteria. Plant-associated bacteria have ostensibly evolved genes that enable them to adapt to plant environments. However, the identities of such genes are mostly unknown, and their functions are poorly characterized. In this study, we sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3,837 bacterial genomes to identify thousands of plant-associated gene clusters. Genomes of plant-associated bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant-associated genomes do. We experimentally validated candidates from two sets of plant-associated genes: one involved in plant colonization, and themore » other serving in microbe–microbe competition between plant-associated bacteria. We also identified 64 plant-associated protein domains that potentially mimic plant domains; some are shared with plant-associated fungi and oomycetes. In conclusion, this work expands the genome-based understanding of plant–microbe interactions and provides potential leads for efficient and sustainable agriculture through microbiome engineering.« less

  10. Unique core genomes of the bacterial family vibrionaceae: insights into niche adaptation and speciation.

    PubMed

    Kahlke, Tim; Goesmann, Alexander; Hjerde, Erik; Willassen, Nils Peder; Haugen, Peik

    2012-05-10

    The criteria for defining bacterial species and even the concept of bacterial species itself are under debate, and the discussion is apparently intensifying as more genome sequence data is becoming available. However, it is still unclear how the new advances in genomics should be used most efficiently to address this question. In this study we identify genes that are common to any group of genomes in our dataset, to determine whether genes specific to a particular taxon exist and to investigate their potential role in adaptation of bacteria to their specific niche. These genes were named unique core genes. Additionally, we investigate the existence and importance of unique core genes that are found in isolates of phylogenetically non-coherent groups. These groups of isolates, that share a genetic feature without sharing a closest common ancestor, are termed genophyletic groups. The bacterial family Vibrionaceae was used as the model, and we compiled and compared genome sequences of 64 different isolates. Using the software orthoMCL we determined clusters of homologous genes among the investigated genome sequences. We used multilocus sequence analysis to build a host phylogeny and mapped the numbers of unique core genes of all distinct groups of isolates onto the tree. The results show that unique core genes are more likely to be found in monophyletic groups of isolates. Genophyletic groups of isolates, in contrast, are less common especially for large groups of isolate. The subsequent annotation of unique core genes that are present in genophyletic groups indicate a high degree of horizontally transferred genes. Finally, the annotation of the unique core genes of Vibrio cholerae revealed genes involved in aerotaxis and biosynthesis of the iron-chelator vibriobactin. The presented work indicates that genes specific for any taxon inside the bacterial family Vibrionaceae exist. These unique core genes encode conserved metabolic functions that can shed light on the

  11. Defense reactions of bean genotypes to bacterial pathogens in controlled conditions

    NASA Astrophysics Data System (ADS)

    Uysal, B.; Bastas, K. K.

    2018-03-01

    This study was focused on the role of antioxidant enzymes and total protein in imparting resistance against common bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) and halo blight caused by Pseudomonas syringae pv. phaseolicola (Psp) in bean. Activities of Ascorbate peroxidase (APX), Catalase (CAT) and total protein were studied in resistant and susceptible bean genotypes. Five-day-old seedlings were inoculated with a bacterial suspension (108 CFU ml-1) and harvested at different time intervals (0, 12, 24 and 36 up to 72 h) under controlled growing conditions and assayed for antioxidant enzymes and total protein. Temporal increase of CAT, APX enzymes activities showed maximum activity at 12 h after both pathogens inoculation (hpi) in resistant cultivar, whereas in susceptible it increased at 72 h after both pathogens inoculation for CAT and 12, 24 h for APX enzymes. Maximum total protein activities were observed at 12 h and 24 h respectively after Xap, Psp inoculation (hpi) in resistant and maximum activities were observed at 24 h and 72 h respectively after Xap, Psp inoculation (hpi) in susceptible. Increase of antioxidant enzyme and total protein activities might be an important component in the defense strategy of resistance and susceptible bean genotypes against the bacterial infection. These findings suggest that disease protection is proportional to the amount of enhanced CAT, APX enzyme and total protein activity.

  12. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Coelomocytes of Sea Cucumber (Apostichopus japonicus) after Vibrio splendidus Challenge.

    PubMed

    Gao, Qiong; Liao, Meijie; Wang, Yingeng; Li, Bin; Zhang, Zheng; Rong, Xiaojun; Chen, Guiping; Wang, Lan

    2015-07-17

    Vibrio splendidus is identified as one of the major pathogenic factors for the skin ulceration syndrome in sea cucumber (Apostichopus japonicus), which has vastly limited the development of the sea cucumber culture industry. In order to screen the immune genes involving Vibrio splendidus challenge in sea cucumber and explore the molecular mechanism of this process, the related transcriptome and gene expression profiling of resistant and susceptible biotypes of sea cucumber with Vibrio splendidus challenge were collected for analysis. A total of 319,455,942 trimmed reads were obtained, which were assembled into 186,658 contigs. After that, 89,891 representative contigs (without isoform) were clustered. The analysis of the gene expression profiling identified 358 differentially expression genes (DEGs) in the bacterial-resistant group, and 102 DEGs in the bacterial-susceptible group, compared with that in control group. According to the reported references and annotation information from BLAST, GO and KEGG, 30 putative bacterial-resistant genes and 19 putative bacterial-susceptible genes were identified from DEGs. The qRT-PCR results were consistent with the RNA-Seq results. Furthermore, many DGEs were involved in immune signaling related pathways, such as Endocytosis, Lysosome, MAPK, Chemokine and the ERBB signaling pathway.

  13. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

  14. Benthic Bacterial Diversity in Submerged Sinkhole Ecosystems▿ †

    PubMed Central

    Nold, Stephen C.; Pangborn, Joseph B.; Zajack, Heidi A.; Kendall, Scott T.; Rediske, Richard R.; Biddanda, Bopaiah A.

    2010-01-01

    Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities. PMID:19880643

  15. Elevated Air Humidity Changes Soil Bacterial Community Structure in the Silver Birch Stand.

    PubMed

    Truu, Marika; Ostonen, Ivika; Preem, Jens-Konrad; Lõhmus, Krista; Nõlvak, Hiie; Ligi, Teele; Rosenvald, Katrin; Parts, Kaarin; Kupper, Priit; Truu, Jaak

    2017-01-01

    Soil microbes play a fundamental role in forest ecosystems and respond rapidly to changes in the environment. Simultaneously with the temperature increase the climate change scenarios also predict an intensified hydrological cycle for the Baltic Sea runoff region. The aim of this study was to assess the effect of elevated air humidity on the top soil microbial community structure of a silver birch ( Betula pendula Roth.) stand by using a free air humidity manipulation facility (FAHM). The bacterial community structures of bulk soil and birch rhizosphere were analyzed using high-throughput sequencing of bacteria-specific16S rRNA gene fragments and quantification of denitrification related genes. The increased air humidity altered both bulk soil and rhizosphere bacterial community structures, and changes in the bacterial communities initiated by elevated air humidity were related to modified soil abiotic and biotic variables. Network analysis revealed that variation in soil bacterial community structural units is explained by altered abiotic conditions such as increased pH value in bulk soil, while in rhizosphere the change in absorptive root morphology had a higher effect. Among root morphological traits, the absorptive root diameter was strongest related to the bacterial community structure. The changes in bacterial community structures under elevated air humidity are associated with shifts in C, N, and P turnover as well as mineral weathering processes in soil. Increased air humidity decreased the nir and nosZ gene abundance in the rhizosphere bacterial community. The potential contribution of the denitrification to the N 2 O emission was not affected by the elevated air humidity in birch stand soil. In addition, the study revealed a strong link between the bacterial community structure, abundance of denitrification related genes, and birch absorptive root morphology in the ecosystem system adaptation to elevated air humidity.

  16. Elevated Air Humidity Changes Soil Bacterial Community Structure in the Silver Birch Stand

    PubMed Central

    Truu, Marika; Ostonen, Ivika; Preem, Jens-Konrad; Lõhmus, Krista; Nõlvak, Hiie; Ligi, Teele; Rosenvald, Katrin; Parts, Kaarin; Kupper, Priit; Truu, Jaak

    2017-01-01

    Soil microbes play a fundamental role in forest ecosystems and respond rapidly to changes in the environment. Simultaneously with the temperature increase the climate change scenarios also predict an intensified hydrological cycle for the Baltic Sea runoff region. The aim of this study was to assess the effect of elevated air humidity on the top soil microbial community structure of a silver birch (Betula pendula Roth.) stand by using a free air humidity manipulation facility (FAHM). The bacterial community structures of bulk soil and birch rhizosphere were analyzed using high-throughput sequencing of bacteria-specific16S rRNA gene fragments and quantification of denitrification related genes. The increased air humidity altered both bulk soil and rhizosphere bacterial community structures, and changes in the bacterial communities initiated by elevated air humidity were related to modified soil abiotic and biotic variables. Network analysis revealed that variation in soil bacterial community structural units is explained by altered abiotic conditions such as increased pH value in bulk soil, while in rhizosphere the change in absorptive root morphology had a higher effect. Among root morphological traits, the absorptive root diameter was strongest related to the bacterial community structure. The changes in bacterial community structures under elevated air humidity are associated with shifts in C, N, and P turnover as well as mineral weathering processes in soil. Increased air humidity decreased the nir and nosZ gene abundance in the rhizosphere bacterial community. The potential contribution of the denitrification to the N2O emission was not affected by the elevated air humidity in birch stand soil. In addition, the study revealed a strong link between the bacterial community structure, abundance of denitrification related genes, and birch absorptive root morphology in the ecosystem system adaptation to elevated air humidity. PMID:28421053

  17. Spatially Correlated Gene Expression in Bacterial Groups: The Role of Lineage History, Spatial Gradients, and Cell-Cell Interactions.

    PubMed

    van Vliet, Simon; Dal Co, Alma; Winkler, Annina R; Spriewald, Stefanie; Stecher, Bärbel; Ackermann, Martin

    2018-04-25

    Gene expression levels in clonal bacterial groups have been found to be spatially correlated. These correlations can partly be explained by the shared lineage history of nearby cells, although they could also arise from local cell-cell interactions. Here, we present a quantitative framework that allows us to disentangle the contributions of lineage history, long-range spatial gradients, and local cell-cell interactions to spatial correlations in gene expression. We study pathways involved in toxin production, SOS stress response, and metabolism in Escherichia coli microcolonies and find for all pathways that shared lineage history is the main cause of spatial correlations in gene expression levels. However, long-range spatial gradients and local cell-cell interactions also contributed to spatial correlations in SOS response, amino acid biosynthesis, and overall metabolic activity. Together, our data show that the phenotype of a cell is influenced by its lineage history and population context, raising the question of whether bacteria can arrange their activities in space to perform functions they cannot achieve alone. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. The effect of dietary bacterial organic selenium on growth performance, antioxidant capacity, and Selenoproteins gene expression in broiler chickens.

    PubMed

    Dalia, A M; Loh, T C; Sazili, A Q; Jahromi, M F; Samsudin, A A

    2017-08-18

    Selenium (Se) is an essential trace mineral in broilers, which has several important roles in biological processes. Organic forms of Se are more efficient than inorganic forms and can be produced biologically via Se microbial reduction. Hence, the possibility of using Se-enriched bacteria as feed supplement may provide an interesting source of organic Se, and benefit broiler antioxidant system and other biological processes. The objective of this study was to examine the impacts of inorganic Se and different bacterial organic Se sources on the performance, serum and tissues Se status, antioxidant capacity, and liver mRNA expression of selenoproteins in broilers. Results indicated that different Se sources did not significantly (P ≤ 0.05) affect broiler growth performance. However, bacterial organic Se of T5 (basal diet +0.3 mg /kg feed ADS18 Se), T4 (basal diet +0.3 mg /kg feed ADS2 Se), and T3 (basal diet +0.3 mg /kg feed ADS1 Se) exhibited significantly (P ≤ 0.05) highest Se concentration in serum, liver, and kidney respectively. Dietary inorganic Se and bacterial organic Se were observed to significantly affect broiler serum ALT, AST, LDH activities and serum creatinine level. ADS18 supplemented Se of (Stenotrophomonas maltophilia) bacterial strain showed the highest GSH-Px activity with the lowest MDA content in serum, and the highest GSH-Px and catalase activity in the kidney, while bacterial Se of ADS2 (Klebsiella pneumoniae) resulted in a higher level of GSH-Px1 and catalase in liver. Moreover, our study showed that in comparison with sodium selenite, only ADS18 bacterial Se showed a significantly higher mRNA level in GSH-Px1, GSH-Px4, DIO1, and TXNDR1, while both ADS18 and ADS2 showed high level of mRNA of DIO2 compared to sodium selenite. The supplementation of bacterial organic Se in broiler chicken, improved tissue Se deposition, antioxidant status, and selenoproteins gene expression, and can be considered as an effective alternative source of

  19. Intraperitoneal infection with Salmonella abortusovis is partially controlled by a gene closely linked with the Ity gene.

    PubMed Central

    Oswald, I P; Lantier, F; Moutier, R; Bertrand, M F; Skamene, E

    1992-01-01

    The aim of the present study was to determine whether the Ity gene, which controls the resistance to S. typhimurium infection in mice, also governs the resistance to S. abortusovis, a serotype specific for goat and sheep. During either i.v. or i.p. infection, BALB/c mice (Itys) were not able to control the growth of S. abortusovis and eventually died from infection. In contrast CBA (Ityr) or (C.CB)F1 (Ityr/s) mice were able to control the growth of these bacteria. Using congenic C.D2 Ityr mice, we found that the gene controlling resistance to S. abortusovis was tightly linked to the Ity gene on chromosome 1. Furthermore, in the spleen and the liver of backcross BALB/c x (CBA x BALB/c) mice, the S. abortusovis resistance phenotype cosegregated with the two alleles of the Len-1 gene, a gene tightly linked to the Ity gene. By contrast, in these backcross mice, the level of infection of the peritoneal cavity, the site of inoculation, did not correlated with the Len-1 phenotype of the animal. These results provide evidence that after i.p. inoculation the control of S. abortusovis growth in the spleen and the liver is controlled by the Ity gene, but also suggest that additional gene(s) regulate the number of bacteria at the site of inoculation. PMID:1544222

  20. Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

    PubMed Central

    Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

    2016-01-01

    ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study

  1. A plant natriuretic peptide-like gene in the bacterial pathogen Xanthomonas axonopodis may induce hyper-hydration in the plant host: a hypothesis of molecular mimicry.

    PubMed

    Nembaware, Victoria; Seoighe, Cathal; Sayed, Muhammed; Gehring, Chris

    2004-03-24

    Plant natriuretic peptides (PNPs) are systemically mobile molecules that regulate homeostasis at nanomolar concentrations. PNPs are up-regulated under conditions of osmotic stress and PNP-dependent processes include changes in ion transport and increases of H2O uptake into protoplasts and whole tissue. The bacterial citrus pathogen Xanthomonas axonopodis pv. Citri str. 306 contains a gene encoding a PNP-like protein. We hypothesise that this bacterial protein can alter plant cell homeostasis and thus is likely to represent an example of molecular mimicry that enables the pathogen to manipulate plant responses in order to bring about conditions favourable to the pathogen such as the induced plant tissue hyper-hydration seen in the wet edged lesions associated with Xanthomonas axonopodis infection. We found a Xanthomonas axonopodis PNP-like protein that shares significant sequence similarity and identical domain organisation with PNPs. We also observed a significant excess of conserved residues between the two proteins within the domain previously identified as being sufficient to induce biological activity. Structural modelling predicts identical six stranded double-psi beta barrel folds for both proteins thus supporting the hypothesis of similar modes of action. No significant similarity between the Xanthomonas axonopodis protein and other bacterial proteins from GenBank was found. Sequence similarity of the Xanthomonas axonopodis PNP-like protein with the Arabidopsis thaliana PNP (AtPNP-A), shared domain organisation and incongruent phylogeny suggest that the PNP-gene may have been acquired by the bacteria in an ancient lateral gene transfer event. Finally, activity of a recombinant Xanthomonas axonopodis protein in plant tissue and changes in symptoms induced by a Xanthomonas axonopodis mutant with a knocked-out PNP-like gene will be experimental proof of molecular mimicry. If the hypothesis is true, it could at least in part explain why the citrus pathogen

  2. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results

  3. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry

    PubMed Central

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar

    2016-01-01

    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed. PMID:27375566

  4. Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

    PubMed

    Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

    2016-07-02

    Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.

  5. Newer systems for bacterial resistances to toxic heavy metals.

    PubMed Central

    Silver, S; Ji, G

    1994-01-01

    Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus

  6. Bacterial interactions in dental biofilm development.

    PubMed

    Hojo, K; Nagaoka, S; Ohshima, T; Maeda, N

    2009-11-01

    Recent analyses with ribosomal RNA-based technologies have revealed the diversity of bacterial populations within dental biofilms, and have highlighted their important contributions to oral health and disease. Dental biofilms are exceedingly complex and multispecies ecosystems, where oral bacteria interact cooperatively or competitively with other members. Bacterial interactions that influence dental biofilm communities include various different mechanisms. During the early stage of biofilm formation, it is known that planktonic bacterial cells directly attach to surfaces of the oral cavity or indirectly bind to other bacterial cells that have already colonized. Adherence through co-aggregation may be critical for the temporary retention of bacteria on dental surfaces, and may facilitate eventual bacterial colonization. It is likely that metabolic communication, genetic exchange, production of inhibitory factors (e.g., bacteriocins, hydrogen peroxide, etc.), and quorum-sensing are pivotal regulatory factors that determine the bacterial composition and/or metabolism. Since each bacterium can easily access a neighboring bacterial cell and its metabolites, genetic exchanges and metabolic communication may occur frequently in dental biofilms. Quorum-sensing is defined as gene regulation in response to cell density, which influences various functions, e.g., virulence and bacteriocin production. In this review, we discuss these important interactions among oral bacteria within the dental biofilm communities.

  7. Magnetic field-controlled gene expression in encapsulated cells

    PubMed Central

    Ortner, Viktoria; Kaspar, Cornelius; Halter, Christian; Töllner, Lars; Mykhaylyk, Olga; Walzer, Johann; Günzburg, Walter H.; Dangerfield, John A.; Hohenadl, Christine; Czerny, Thomas

    2012-01-01

    Cell and gene therapies have an enormous range of potential applications, but as for most other therapies, dosing is a critical issue, which makes regulated gene expression a prerequisite for advanced strategies. Several inducible expression systems have been established, which mainly rely on small molecules as inducers, such as hormones or antibiotics. The application of these inducers is difficult to control and the effects on gene regulation are slow. Here we describe a novel system for induction of gene expression in encapsulated cells. This involves the modification of cells to express potential therapeutic genes under the control of a heat inducible promoter and the co-encapsulation of these cells with magnetic nanoparticles. These nanoparticles produce heat when subjected to an alternating magnetic field; the elevated temperatures in the capsules then induce gene expression. In the present study we define the parameters of such systems and provide proof-of-principle using reporter gene constructs. The fine-tuned heating of nanoparticles in the magnetic field allows regulation of gene expression from the outside over a broad range and within short time. Such a system has great potential for advancement of cell and gene therapy approaches. PMID:22197778

  8. Predicting effects of structural stress in a genome-reduced model bacterial metabolism

    NASA Astrophysics Data System (ADS)

    Güell, Oriol; Sagués, Francesc; Serrano, M. Ángeles

    2012-08-01

    Mycoplasma pneumoniae is a human pathogen recently proposed as a genome-reduced model for bacterial systems biology. Here, we study the response of its metabolic network to different forms of structural stress, including removal of individual and pairs of reactions and knockout of genes and clusters of co-expressed genes. Our results reveal a network architecture as robust as that of other model bacteria regarding multiple failures, although less robust against individual reaction inactivation. Interestingly, metabolite motifs associated to reactions can predict the propagation of inactivation cascades and damage amplification effects arising in double knockouts. We also detect a significant correlation between gene essentiality and damages produced by single gene knockouts, and find that genes controlling high-damage reactions tend to be expressed independently of each other, a functional switch mechanism that, simultaneously, acts as a genetic firewall to protect metabolism. Prediction of failure propagation is crucial for metabolic engineering or disease treatment.

  9. Combined prime-boost vaccination against tick-borne encephalitis (TBE) using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

    PubMed Central

    Aleshin, SE; Timofeev, AV; Khoretonenko, MV; Zakharova, LG; Pashvykina, GV; Stephenson, JR; Shneider, AM; Altstein, AD

    2005-01-01

    Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV) and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE) virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines. PMID:16076390

  10. High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

    PubMed Central

    Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

    2014-01-01

    In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

  11. Light without substrate amendment: the bacterial luciferase gene cassette as a mammalian bioreporter

    NASA Astrophysics Data System (ADS)

    Close, Dan M.; Xu, Tingting; Smartt, Abby E.; Jegier, Pat; Ripp, Steven A.; Sayler, Gary S.

    2011-06-01

    Bioluminescent production represents a facile method for bioreporter detection in mammalian tissues. The lack of endogenous bioluminescent reactions in these tissues allows for high signal to noise ratios even at low signal strength compared to fluorescent signal detection. While the luciferase enzymes commonly employed for bioluminescent detection are those from class Insecta (firefly and click beetle luciferases), these are handicapped in that they require concurrent administration of a luciferin compound to elicit a bioluminescent signal. The bacterial luciferase (lux) gene cassette offers the advantages common to other bioluminescent proteins, but is simultaneously capable of synthesizing its own luciferin substrates using endogenously available cellular compounds. The longstanding shortcoming of the lux cassette has been its recalcitrance to function in the mammalian cellular environment. This paper will present an overview of the work completed to date to overcome this limitation and provide examples of mammalian lux-based bioreporter technologies that could provide the framework for advanced, biomedically relevant real-time sensor development.

  12. antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.

    PubMed

    Medema, Marnix H; Blin, Kai; Cimermancic, Peter; de Jager, Victor; Zakrzewski, Piotr; Fischbach, Michael A; Weber, Tilmann; Takano, Eriko; Breitling, Rainer

    2011-07-01

    Bacterial and fungal secondary metabolism is a rich source of novel bioactive compounds with potential pharmaceutical applications as antibiotics, anti-tumor drugs or cholesterol-lowering drugs. To find new drug candidates, microbiologists are increasingly relying on sequencing genomes of a wide variety of microbes. However, rapidly and reliably pinpointing all the potential gene clusters for secondary metabolites in dozens of newly sequenced genomes has been extremely challenging, due to their biochemical heterogeneity, the presence of unknown enzymes and the dispersed nature of the necessary specialized bioinformatics tools and resources. Here, we present antiSMASH (antibiotics & Secondary Metabolite Analysis Shell), the first comprehensive pipeline capable of identifying biosynthetic loci covering the whole range of known secondary metabolite compound classes (polyketides, non-ribosomal peptides, terpenes, aminoglycosides, aminocoumarins, indolocarbazoles, lantibiotics, bacteriocins, nucleosides, beta-lactams, butyrolactones, siderophores, melanins and others). It aligns the identified regions at the gene cluster level to their nearest relatives from a database containing all other known gene clusters, and integrates or cross-links all previously available secondary-metabolite specific gene analysis methods in one interactive view. antiSMASH is available at http://antismash.secondarymetabolites.org.

  13. Association of RNA Biosignatures With Bacterial Infections in Febrile Infants Aged 60 Days or Younger.

    PubMed

    Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T Charles; Smith, Bennett; Alpern, Elizabeth R; Anders, Jennifer; Atabaki, Shireen M; Bennett, Jonathan E; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M; Crain, Ellen F; Cruz, Andrea T; Dayan, Peter S; Gattu, Rajender; Greenberg, Richard; Hoyle, John D; Jaffe, David M; Levine, Deborah A; Lillis, Kathleen; Linakis, James G; Muenzer, Jared; Nigrovic, Lise E; Powell, Elizabeth C; Rogers, Alexander J; Roosevelt, Genie; Ruddy, Richard M; Saunders, Mary; Tunik, Michael G; Tzimenatos, Leah; Vitale, Melissa; Dean, J Michael; Ramilo, Octavio

    Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns ("RNA biosignatures") in response to infections may provide an alternative diagnostic approach. To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. Of 1883 febrile infants (median age, 37 days; 55.7% boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections-including 32 with bacteremia and 15 with urinary tract infections-and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87% (95% CI, 73%-95%) sensitivity and 89% (95% CI, 81%-93%) specificity. Ten classifier genes distinguished infants with bacteremia from those without bacterial infections in the test set with 94% (95% CI, 70

  14. Response of soil bacterial communities to lead and zinc pollution revealed by Illumina MiSeq sequencing investigation.

    PubMed

    Xu, Xihui; Zhang, Zhou; Hu, Shunli; Ruan, Zhepu; Jiang, Jiandong; Chen, Chen; Shen, Zhenguo

    2017-01-01

    Soil provides a critical environment for microbial community development. However, microorganisms may be sensitive to substances such as heavy metals (HMs), which are common soil contaminants. This study investigated bacterial communities using 16S ribosomal RNA (rRNA) gene fragment sequencing in geographic regions with and without HM pollution to elucidate the effects of soil properties and HMs on bacterial communities. No obvious changes in the richness or diversity of bacterial communities were observed between samples from mining and control areas. Significant differences in bacterial richness and diversity were detected between samples from different geographic regions, indicating that the basic soil characteristics were the most important factors affecting bacterial communities other than HMs. However, the abundances of several phyla and genera differed significantly between mining and control samples, suggesting that Zn and Pb pollution may impact the soil bacterial community composition. Moreover, regression analyses showed that the relative abundances of these phyla and genera were correlated significantly with the soil-available Zn and Pb contents. Redundancy analysis indicated that the soil K, ammoniacal nitrogen (NH 4 + -N), total Cu, and available Zn and Cu contents were the most important factors. Our results not only suggested that the soil bacteria were sensitive to HM stresses but also indicated that other soil properties may affect soil microorganisms to a greater extent.

  15. Application of a microcomputer-based system to control and monitor bacterial growth.

    PubMed

    Titus, J A; Luli, G W; Dekleva, M L; Strohl, W R

    1984-02-01

    A modular microcomputer-based system was developed to control and monitor various modes of bacterial growth. The control system was composed of an Apple II Plus microcomputer with 64-kilobyte random-access memory; a Cyborg ISAAC model 91A multichannel analog-to-digital and digital-to-analog converter; paired MRR-1 pH, pO(2), and foam control units; and in-house-designed relay, servo control, and turbidimetry systems. To demonstrate the flexibility of the system, we grew bacteria under various computer-controlled and monitored modes of growth, including batch, turbidostat, and chemostat systems. The Apple-ISAAC system was programmed in Labsoft BASIC (extended Applesoft) with an average control program using ca. 6 to 8 kilobytes of memory and up to 30 kilobytes for datum arrays. This modular microcomputer-based control system was easily coupled to laboratory scale fermentors for a variety of fermentations.

  16. Application of a Microcomputer-Based System to Control and Monitor Bacterial Growth

    PubMed Central

    Titus, Jeffrey A.; Luli, Gregory W.; Dekleva, Michael L.; Strohl, William R.

    1984-01-01

    A modular microcomputer-based system was developed to control and monitor various modes of bacterial growth. The control system was composed of an Apple II Plus microcomputer with 64-kilobyte random-access memory; a Cyborg ISAAC model 91A multichannel analog-to-digital and digital-to-analog converter; paired MRR-1 pH, pO2, and foam control units; and in-house-designed relay, servo control, and turbidimetry systems. To demonstrate the flexibility of the system, we grew bacteria under various computer-controlled and monitored modes of growth, including batch, turbidostat, and chemostat systems. The Apple-ISAAC system was programmed in Labsoft BASIC (extended Applesoft) with an average control program using ca. 6 to 8 kilobytes of memory and up to 30 kilobytes for datum arrays. This modular microcomputer-based control system was easily coupled to laboratory scale fermentors for a variety of fermentations. PMID:16346462

  17. Mountain pine beetles colonizing historical and naive host trees are associated with a bacterial community highly enriched in genes contributing to terpene metabolism.

    PubMed

    Adams, Aaron S; Aylward, Frank O; Adams, Sandye M; Erbilgin, Nadir; Aukema, Brian H; Currie, Cameron R; Suen, Garret; Raffa, Kenneth F

    2013-06-01

    The mountain pine beetle, Dendroctonus ponderosae, is a subcortical herbivore native to western North America that can kill healthy conifers by overcoming host tree defenses, which consist largely of high terpene concentrations. The mechanisms by which these beetles contend with toxic compounds are not well understood. Here, we explore a component of the hypothesis that beetle-associated bacterial symbionts contribute to the ability of D. ponderosae to overcome tree defenses by assisting with terpene detoxification. Such symbionts may facilitate host tree transitions during range expansions currently being driven by climate change. For example, this insect has recently breached the historical geophysical barrier of the Canadian Rocky Mountains, providing access to näive tree hosts and unprecedented connectivity to eastern forests. We use culture-independent techniques to describe the bacterial community associated with D. ponderosae beetles and their galleries from their historical host, Pinus contorta, and their more recent host, hybrid P. contorta-Pinus banksiana. We show that these communities are enriched with genes involved in terpene degradation compared with other plant biomass-processing microbial communities. These pine beetle microbial communities are dominated by members of the genera Pseudomonas, Rahnella, Serratia, and Burkholderia, and the majority of genes involved in terpene degradation belong to these genera. Our work provides the first metagenome of bacterial communities associated with a bark beetle and is consistent with a potential microbial contribution to detoxification of tree defenses needed to survive the subcortical environment.

  18. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

  19. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    PubMed

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  20. A novel bacterial blight resistance gene from Oryza nivara mapped to 38 kb region on chromosome 4L and transferred to Oryza sativa L.

    PubMed

    Cheema, Kuljit K; Grewal, Navjit K; Vikal, Yogesh; Sharma, Rajiv; Lore, Jagjeet S; Das, Aparna; Bhatia, Dharminder; Mahajan, Ritu; Gupta, Vikas; Bharaj, Tajinder S; Singh, Kuldeep

    2008-10-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv oryzae (Xoo) is one of the major constraints to productivity in South-East Asia. The strategy of using major genes, singly or in combination, continues to be the most effective approach for BB management. Currently, more than two dozen genes have been designated but not all the known genes are effective against all the prevalent pathotypes. The challenge, therefore, is to continue to expand the gene pool of effective and potentially durable resistance genes. Wild species constitute an important reservoir of the resistance genes including BB. An accession of Oryza nivara (IRGC 81825) was found to be resistant to all the seven Xoo pathotypes prevalent in northern states of India. Inheritance and mapping of resistance in O. nivara was studied by using F2, BC2F2, BC3F1 and BC3F2 progenies of the cross involving Oryza sativa cv PR114 and the O. nivara acc. 81825 using the most virulent Xoo pathotype. Genetic analysis of the segregating progenies revealed that the BB resistance in O. nivara was conditioned by a single dominant gene. Bulked segregant analysis (BSA) of F2 population using 191 polymorphic SSR markers identified a approximately 35 centiMorgans (cM) chromosomal region on 4L, bracketed by RM317 and RM562, to be associated with BB resistance. Screening of BC3F1 and BC2F2 progenies and their genotyping with more than 30 polymorphic SSR markers in the region, covering Bacterial artificial chromosome (BAC) clone OSJNBb0085C12, led to mapping of the resistance gene between the STS markers based on annotated genes LOC_Os04g53060 and LOC_Os04g53120, which is approximately 38.4 kb. Since none of the known Xa genes, which are mapped on chromosome 4L, are effective against the Xoo pathotypes tested, the BB resistance gene identified and transferred from O. nivara is novel and is tentatively designated as Xa30(t). Homozygous resistant BC3F3 progenies with smallest introgression region have been identified.

  1. Pattern Triggered Immunity (PTI) in Tobacco: Isolation of Activated Genes Suggests Role of the Phenylpropanoid Pathway in Inhibition of Bacterial Pathogens

    PubMed Central

    Szatmári, Ágnes; Zvara, Ágnes; Móricz, Ágnes M.; Besenyei, Eszter; Szabó, Erika; Ott, Péter G.; Puskás, László G.; Bozsó, Zoltán

    2014-01-01

    Background Pattern Triggered Immunity (PTI) or Basal Resistance (BR) is a potent, symptomless form of plant resistance. Upon inoculation of a plant with non-pathogens or pathogenicity-mutant bacteria, the induced PTI will prevent bacterial proliferation. Developed PTI is also able to protect the plant from disease or HR (Hypersensitive Response) after a challenging infection with pathogenic bacteria. Our aim was to reveal those PTI-related genes of tobacco (Nicotiana tabacum) that could possibly play a role in the protection of the plant from disease. Methodology/Principal Findings Leaves were infiltrated with Pseudomonas syringae pv. syringae hrcC- mutant bacteria to induce PTI, and samples were taken 6 and 48 hours later. Subtraction Suppressive Hybridization (SSH) resulted in 156 PTI-activated genes. A cDNA microarray was generated from the SSH clone library. Analysis of hybridization data showed that in the early (6 hpi) phase of PTI, among others, genes of peroxidases, signalling elements, heat shock proteins and secondary metabolites were upregulated, while at the late phase (48 hpi) the group of proteolysis genes was newly activated. Microarray data were verified by real time RT-PCR analysis. Almost all members of the phenyl-propanoid pathway (PPP) possibly leading to lignin biosynthesis were activated. Specific inhibition of cinnamic-acid-4-hydroxylase (C4H), rate limiting enzyme of the PPP, decreased the strength of PTI - as shown by the HR-inhibition and electrolyte leakage tests. Quantification of cinnamate and p-coumarate by thin-layer chromatography (TLC)-densitometry supported specific changes in the levels of these metabolites upon elicitation of PTI. Conclusions/Significance We believe to provide first report on PTI-related changes in the levels of these PPP metabolites. Results implicated an actual role of the upregulation of the phenylpropanoid pathway in the inhibition of bacterial pathogenic activity during PTI. PMID:25101956

  2. Effects of bacterial inoculants on the indigenous microbiome and secondary metabolites of chamomile plants

    PubMed Central

    Schmidt, Ruth; Köberl, Martina; Mostafa, Amr; Ramadan, Elshahat M.; Monschein, Marlene; Jensen, Kenneth B.; Bauer, Rudolf; Berg, Gabriele

    2014-01-01

    Plant-associated bacteria fulfill important functions for plant growth and health. However, our knowledge about the impact of bacterial treatments on the host's microbiome and physiology is limited. The present study was conducted to assess the impact of bacterial inoculants on the microbiome of chamomile plants Chamomilla recutita (L.) Rauschert grown in a field under organic management in Egypt. Chamomile seedlings were inoculated with three indigenous Gram-positive strains (Streptomyces subrutilus Wbn2-11, Bacillus subtilis Co1-6, Paenibacillus polymyxa Mc5Re-14) from Egypt and three European Gram-negative strains (Pseudomonas fluorescens L13-6-12, Stenotrophomonas rhizophila P69, Serratia plymuthica 3Re4-18) already known for their beneficial plant-microbe interaction. Molecular fingerprints of 16S rRNA gene as well as real-time PCR analyses did not show statistically significant differences for all applied bacterial antagonists compared to the control. In contrast, a pyrosequencing analysis of the 16S rRNA gene libraries revealed significant differences in the community structure of bacteria between the treatments. These differences could be clearly shown by a shift within the community structure and corresponding beta-diversity indices. Moreover, B. subtilis Co1-6 and P. polymyxa Mc5Re-14 showed an enhancement of the bioactive secondary metabolite apigenin-7-O-glucoside. This indicates a possible new function of bacterial inoculants: to interact with the plant microbiome as well as to influence the plant metabolome. PMID:24600444

  3. Bacterial membrane proteomics.

    PubMed

    Poetsch, Ansgar; Wolters, Dirk

    2008-10-01

    About one quarter to one third of all bacterial genes encode proteins of the inner or outer bacterial membrane. These proteins perform essential physiological functions, such as the import or export of metabolites, the homeostasis of metal ions, the extrusion of toxic substances or antibiotics, and the generation or conversion of energy. The last years have witnessed completion of a plethora of whole-genome sequences of bacteria important for biotechnology or medicine, which is the foundation for proteome and other functional genome analyses. In this review, we discuss the challenges in membrane proteome analysis, starting from sample preparation and leading to MS-data analysis and quantification. The current state of available proteomics technologies as well as their advantages and disadvantages will be described with a focus on shotgun proteomics. Then, we will briefly introduce the most abundant proteins and protein families present in bacterial membranes before bacterial membrane proteomics studies of the last years will be presented. It will be shown how these works enlarged our knowledge about the physiological adaptations that take place in bacteria during fine chemical production, bioremediation, protein overexpression, and during infections. Furthermore, several examples from literature demonstrate the suitability of membrane proteomics for the identification of antigens and different pathogenic strains, as well as the elucidation of membrane protein structure and function.

  4. Control of corrosive bacterial community by bronopol in industrial water system.

    PubMed

    Narenkumar, Jayaraman; Ramesh, Nachimuthu; Rajasekar, Aruliah

    2018-01-01

    Ten aerobic corrosive bacterial strains were isolated from a cooling tower water system (CWS) which were identified based on the biochemical characterization and 16S rRNA gene sequencing. Out of them, dominant corrosion-causing bacteria, namely, Bacillus thuringiensis EN2, Terribacillus aidingensis EN3, and Bacillus oleronius EN9, were selected for biocorrosion studies on mild steel 1010 (MS) in a CWS. The biocorrosion behaviour of EN2, EN3, and EN9 strains was studied using immersion test (weight loss method), electrochemical analysis, and surface analysis. To address the corrosion problems, an anti-corrosive study using a biocide, bronopol was also demonstrated. Scanning electron microscopy and Fourier-transform infrared spectroscopy analyses of the MS coupons with biofilm developed after exposure to CWS confirmed the accumulation of extracellular polymeric substances and revealed that biofilms was formed as microcolonies, which subsequently cause pitting corrosion. In contrast, the biocide system, no pitting type of corrosion, was observed and weight loss was reduced about 32 ± 2 mg over biotic system (286 ± 2 mg). FTIR results confirmed the adsorption of bronopol on the MS metal surface as protective layer (co-ordination of NH 2 -Fe 3+ ) to prevent the biofilm formation and inhibit the corrosive chemical compounds and thus led to reduction of corrosion rate (10 ± 1 mm/year). Overall, the results from WL, EIS, SEM, XRD, and FTIR concluded that bronopol was identified as effective biocide and corrosion inhibitor which controls the both chemical and biocorrosion of MS in CWS.

  5. Abundance and activity of 16S rRNA, amoA and nifH bacterial genes during assisted phytostabilization of mine tailings

    PubMed Central

    Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2014-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings. PMID:25495940

  6. Abundance and Activity of 16S rRNA, AmoA and NifH Bacterial Genes During Assisted Phytostabilization of Mine Tailings.

    PubMed

    Nelson, Karis N; Neilson, Julia W; Root, Robert A; Chorover, Jon; Maier, Raina M

    2015-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings.

  7. The role of a groundwater bacterial community in the degradation of the herbicide terbuthylazine.

    PubMed

    Caracciolo, Anna Barra; Fajardo, Carmen; Grenni, Paola; Saccà, Maria Ludovica; Amalfitano, Stefano; Ciccoli, Roberto; Martin, Margarita; Gibello, Alicia

    2010-01-01

    A bacterial community in an aquifer contaminated by s-triazines was studied. Groundwater microcosms were treated with terbuthylazine at a concentration of 100 microg L(-1) and degradation of the herbicide was assessed. The bacterial community structure (abundance and phylogenetic composition) and function (carbon production and cell viability) were analysed. The bacterial community was able to degrade the terbuthylazine; in particular, Betaproteobacteria were involved in the herbicide biotransformation. Identification of some bacterial isolates by PCR amplification of the 16S rRNA gene revealed the presence of two Betaproteobacteria species able to degrade the herbicide: Advenella incenata and Janthinobacterium lividum. PCR detection of the genes encoding s-triazine-degrading enzymes indicated the presence of the atzA and atzB genes in A. incenata and the atzB and atzC genes in J. lividum. The nucleotide sequences of the PCR fragments of the atz genes from these strains were 100% identical to the homologous genes of the Pseudomonas sp. strain ADP. In conclusion, the results show the potential for the use of a natural attenuation strategy in the treatment of aquifers polluted with the terbuthylazine. The two bacteria isolated could facilitate the implementation of effective bioremediation protocols, especially in the case of the significant amounts of herbicide that can be found in groundwater as a result of accidental spills.

  8. [Bacterial diversity within different sections of summer sea-ice samples from the Prydz Bay, Antarctica].

    PubMed

    Ma, Jifei; Du, Zongjun; Luo, Wei; Yu, Yong; Zeng, Yixin; Chen, Bo; Li, Huirong

    2013-02-04

    In order to assess bacterial abundance and diversity within three different sections of summer sea-ice samples collected from the Prydz Bay, Antarctica. Fluorescence in situ hybridization was applied to determine the proportions of Bacteria in sea-ice. Bacterial community composition within sea ice was analyzed by 16S rRNA gene clone library construction. Correlation analysis was performed between the physicochemical parameters and the bacterial diversity and abundance within sea ice. The result of fluorescence in situ hybridization shows that bacteria were abundant in the bottom section, and the concentration of total organic carbon, total organic nitrogen and phosphate may be the main factors for bacterial abundance. In bacterial 16S rRNA gene libraries of sea-ice, nearly complete 16S rRNA gene sequences were grouped into three distinct lineages of Bacteria (gamma-Proteobacteria, alpha-Proteobacteria and Bacteroidetes). Most clone sequences were related to cultured bacterial isolates from the marine environment, arctic and Antarctic sea-ice with high similarity. The member of Bacteroidetes was not detected in the bottom section of sea-ice. The bacterial communities within sea-ice were little heterogeneous at the genus-level between different sections, and the concentration of NH4+ may cause this distribution. The number of bacteria was abundant in the bottom section of sea-ice. Gamma-proteobacteria was the dominant bacterial lineage in sea-ice.

  9. Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

    PubMed Central

    Srinivasan, Sujatha; Hoffman, Noah G.; Morgan, Martin T.; Matsen, Frederick A.; Fiedler, Tina L.; Hall, Robert W.; Ross, Frederick J.; McCoy, Connor O.; Bumgarner, Roger; Marrazzo, Jeanne M.; Fredricks, David N.

    2012-01-01

    Background Bacterial vaginosis (BV) is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. Methodology/Principal Findings Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel’s clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs) significantly associated with each of the four Amsel’s criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. Conclusions/Significance The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain) diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased incidence of BV in

  10. Evaluation of endogenous control gene(s) for gene expression studies in human blood exposed to 60Co γ-rays ex vivo.

    PubMed

    Vaiphei, S Thangminlal; Keppen, Joshua; Nongrum, Saibadaiahun; Chaubey, R C; Kma, L; Sharan, R N

    2015-01-01

    In gene expression studies, it is critical to normalize data using a stably expressed endogenous control gene in order to obtain accurate and reliable results. However, we currently do not have a universally applied endogenous control gene for normalization of data for gene expression studies, particularly those involving (60)Co γ-ray-exposed human blood samples. In this study, a comparative assessment of the gene expression of six widely used housekeeping endogenous control genes, namely 18S, ACTB, B2M, GAPDH, MT-ATP6 and CDKN1A, was undertaken for a range of (60)Co γ-ray doses (0.5, 1.0, 2.0 and 4.0 Gy) at 8.4 Gy min(-1) at 0 and 24 h post-irradiation time intervals. Using the NormFinder algorithm, real-time PCR data obtained from six individuals (three males and three females) were analyzed with respect to the threshold cycle (Ct) value and abundance, ΔCt pair-wise comparison, intra- and inter-group variability assessments, etc. GAPDH, either alone or in combination with 18S, was found to be the most suitable endogenous control gene and should be used in gene expression studies, especially those involving qPCR of γ-ray-exposed human blood samples. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  11. GenePRIMP: A software quality control tool

    ScienceCinema

    Amrita Pati

    2017-12-09

    Amrita Pati of the DOE Joint Genome Institute's Genome Biology group describes the software tool GenePRIMP and how it fits into the quality control pipeline for microbial genomics. Further details regarding GenePRIMP appear in a paper published online May 2, 2010 in Nature Methods.

  12. Horizon-Specific Bacterial Community Composition of German Grassland Soils, as Revealed by Pyrosequencing-Based Analysis of 16S rRNA Genes ▿ †

    PubMed Central

    Will, Christiane; Thürmer, Andrea; Wollherr, Antje; Nacke, Heiko; Herold, Nadine; Schrumpf, Marion; Gutknecht, Jessica; Wubet, Tesfaye; Buscot, François; Daniel, Rolf

    2010-01-01

    The diversity of bacteria in soil is enormous, and soil bacterial communities can vary greatly in structure. Here, we employed a pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to characterize the overall and horizon-specific (A and B horizons) bacterial community compositions in nine grassland soils, which covered three different land use types. The entire data set comprised 752,838 sequences, 600,544 of which could be classified below the domain level. The average number of sequences per horizon was 41,824. The dominant taxonomic groups present in all samples and horizons were the Acidobacteria, Betaproteobacteria, Actinobacteria, Gammaproteobacteria, Alphaproteobacteria, Deltaproteobacteria, Chloroflexi, Firmicutes, and Bacteroidetes. Despite these overarching dominant taxa, the abundance, diversity, and composition of bacterial communities were horizon specific. In almost all cases, the estimated bacterial diversity (H′) was higher in the A horizons than in the corresponding B horizons. In addition, the H′ was positively correlated with the organic carbon content, the total nitrogen content, and the C-to-N ratio, which decreased with soil depth. It appeared that lower land use intensity results in higher bacterial diversity. The majority of sequences affiliated with the Actinobacteria, Bacteroidetes, Cyanobacteria, Fibrobacteres, Firmicutes, Spirochaetes, Verrucomicrobia, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria were derived from A horizons, whereas the majority of the sequences related to Acidobacteria, Chloroflexi, Gemmatimonadetes, Nitrospira, TM7, and WS3 originated from B horizons. The distribution of some bacterial phylogenetic groups and subgroups in the different horizons correlated with soil properties such as organic carbon content, total nitrogen content, or microbial biomass. PMID:20729324

  13. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes.

    PubMed

    Wang, Hang; Li, Hongyi; Gilbert, Jack A; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang; Zhang, Zhijian

    2015-11-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Housefly Larva Vermicomposting Efficiently Attenuates Antibiotic Resistance Genes in Swine Manure, with Concomitant Bacterial Population Changes

    PubMed Central

    Wang, Hang; Li, Hongyi; Gilbert, Jack A.; Li, Haibo; Wu, Longhua; Liu, Meng; Wang, Liling; Zhou, Qiansheng; Yuan, Junxiang

    2015-01-01

    Manure from swine treated with antimicrobials as feed additives is a major source for the expansion of the antibiotic resistance gene (ARG) reservoir in the environment. Vermicomposting via housefly larvae (Musca domestica) can be efficiently used to treat manure and regenerate biofertilizer, but few studies have investigated its effect on ARG attenuation. Here, we tracked the abundances of 9 ARGs and the composition and structure of the bacterial communities in manure samples across 6 days of full-scale manure vermicomposting. On day 6, the abundances of genes encoding tetracycline resistance [tet(M), tet(O), tet(Q), and tet(W)] were reduced (P < 0.05), while those of genes encoding sulfonamide resistance (sul1 and sul2) were increased (P < 0.05) when normalized to 16S rRNA. The abundances of tetracycline resistance genes were correlated (P < 0.05) with the changing concentrations of tetracyclines in the manure. The overall diversity and richness of the bacteria significantly decreased during vermicomposting, accompanied by a 100 times increase in the relative abundance of Flavobacteriaceae spp. Variations in the abundances of ARGs were correlated with the changing microbial community structure and the relative abundances of the family Ruminococcaceae, class Bacilli, or phylum Proteobacteria. Vermicomposting, as a waste management practice, can reduce the overall abundance of ARGs. More research is warranted to assess the use of this waste management practice as a measure to attenuate the dissemination of antimicrobial residues and ARGs from livestock production before vermicompost can be safely used as biofertilizer in agroecosystems. PMID:26296728

  15. Additive roles of PthAs in bacterial growth and pathogenicity associated with nucleotide polymorphisms in effector-binding elements of citrus canker susceptibility genes.

    PubMed

    Abe, Valeria Yukari; Benedetti, Celso Eduardo

    2016-10-01

    Citrus canker, caused by Xanthomonas citri, affects most commercial citrus varieties. All X. citri strains possess at least one transcription activator-like effector of the PthA family that activates host disease susceptibility (S) genes. The X. citri strain 306 encodes four PthA effectors; nevertheless, only PthA4 is known to elicit cankers on citrus. As none of the PthAs act as avirulence factors on citrus, we hypothesized that PthAs 1-3 might also contribute to pathogenicity on certain hosts. Here, we show that, although PthA4 is indispensable for canker formation in six Brazilian citrus varieties, PthAs 1 and 3 contribute to canker development in 'Pera' sweet orange, but not in 'Tahiti' lemon. Deletions in two or more pthA genes reduce bacterial growth in planta more pronouncedly than single deletions, suggesting an additive role of PthAs in pathogenicity and bacterial fitness. The contribution of PthAs 1 and 3 in canker formation in 'Pera' plants does not correlate with the activation of the canker S gene, LOB1 (LATERAL ORGAN BOUNDARIES 1), but with the induction of other PthA targets, including LOB2 and citrus dioxygenase (DIOX). LOB1, LOB2 and DIOX show differential PthA-dependent expression between 'Pera' and 'Tahiti' plants that appears to be associated with nucleotide polymorphisms found at or near PthA-binding sites. We also present evidence that LOB1 activation alone is not sufficient to elicit cankers on citrus, and that DIOX acts as a canker S gene in 'Pera', but not 'Tahiti', plants. Our results suggest that the activation of multiple S genes, such as LOB1 and DIOX, is necessary for full canker development. © 2015 BSPP and John Wiley & Sons Ltd.

  16. Effect of copper treatment on the composition and function of the bacterial community in the sponge Haliclona cymaeformis.

    PubMed

    Tian, Ren-Mao; Wang, Yong; Bougouffa, Salim; Gao, Zhao-Ming; Cai, Lin; Zhang, Wei-Peng; Bajic, Vladimir; Qian, Pei-Yuan

    2014-11-04

    Marine sponges are the most primitive metazoan and host symbiotic microorganisms. They are crucial components of the marine ecological system and play an essential role in pelagic processes. Copper pollution is currently a widespread problem and poses a threat to marine organisms. Here, we examined the effects of copper treatment on the composition of the sponge-associated bacterial community and the genetic features that facilitate the survival of enriched bacteria under copper stress. The 16S rRNA gene sequencing results showed that the sponge Haliclona cymaeformis harbored symbiotic sulfur-oxidizing Ectothiorhodospiraceae and photosynthetic Cyanobacteria as dominant species. However, these autotrophic bacteria decreased substantially after treatment with a high copper concentration, which enriched for a heterotrophic-bacterium-dominated community. Metagenomic comparison revealed a varied profile of functional genes and enriched functions, including bacterial motility and chemotaxis, extracellular polysaccharide and capsule synthesis, virulence-associated genes, and genes involved in cell signaling and regulation, suggesting short-period mechanisms of the enriched bacterial community for surviving copper stress in the microenvironment of the sponge. Microscopic observation and comparison revealed dynamic bacterial aggregation within the matrix and lysis of sponge cells. The bacteriophage community was also enriched, and the complete genome of a dominant phage was determined, implying that a lytic phage cycle was stimulated by the high copper concentration. This study demonstrated a copper-induced shift in the composition of functional genes of the sponge-associated bacterial community, revealing the selective effect of copper treatment on the functions of the bacterial community in the microenvironment of the sponge. This study determined the bacterial community structure of the common sponge Haliclona cymaeformis and examined the effect of copper treatment on

  17. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    PubMed Central

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  18. Handling gene and protein names in the age of bioinformatics: the special challenge of secreted multimodular bacterial enzymes such as the cbhA/cbh9A gene of Clostridium thermocellum.

    PubMed

    Schwarz, Wolfgang H; Brunecky, Roman; Broeker, Jannis; Liebl, Wolfgang; Zverlov, Vladimir V

    2018-02-26

    An increasing number of researchers working in biology, biochemistry, biotechnology, bioengineering, bioinformatics and other related fields of science are using biological molecules. As the scientific background of the members of different scientific communities is more diverse than ever before, the number of scientists not familiar with the rules for non-ambiguous designation of genetic elements is increasing. However, with biological molecules gaining importance through biotechnology, their functional and unambiguous designation is vital. Unfortunately, naming genes and proteins is not an easy task. In addition, the traditional concepts of bioinformatics are challenged with the appearance of proteins comprising different modules with a respective function in each module. This article highlights basic rules and novel solutions in designation recently used within the community of bacterial geneticists, and we discuss the present-day handling of gene and protein designations. As an example we will utilize a recent mischaracterization of gene nomenclature. We make suggestions for better handling of names in future literature as well as in databases and annotation projects. Our methodology emphasizes the hydrolytic function of multi-modular genes and extracellular proteins from bacteria.

  19. Self-Organization in High-Density Bacterial Colonies: Efficient Crowd Control

    PubMed Central

    Campbell, Kyle; Melke, Pontus; Williams, Joshua W; Jedynak, Bruno; Stevens, Ann M; Groisman, Alex; Levchenko, Andre

    2007-01-01

    Colonies of bacterial cells can display complex collective dynamics, frequently culminating in the formation of biofilms and other ordered super-structures. Recent studies suggest that to cope with local environmental challenges, bacterial cells can actively seek out small chambers or cavities and assemble there, engaging in quorum sensing behavior. By using a novel microfluidic device, we showed that within chambers of distinct shapes and sizes allowing continuous cell escape, bacterial colonies can gradually self-organize. The directions of orientation of cells, their growth, and collective motion are mutually correlated and dictated by the chamber walls and locations of chamber exits. The ultimate highly organized steady state is conducive to a more-organized escape of cells from the chambers and increased access of nutrients into and evacuation of waste out of the colonies. Using a computational model, we suggest that the lengths of the cells might be optimized to maximize self-organization while minimizing the potential for stampede-like exit blockage. The self-organization described here may be crucial for the early stage of the organization of high-density bacterial colonies populating small, physically confined growth niches. It suggests that this phenomenon can play a critical role in bacterial biofilm initiation and development of other complex multicellular bacterial super-structures, including those implicated in infectious diseases. PMID:18044986

  20. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Coelomocytes of Sea Cucumber (Apostichopus japonicus) after Vibrio splendidus Challenge

    PubMed Central

    Gao, Qiong; Liao, Meijie; Wang, Yingeng; Li, Bin; Zhang, Zheng; Rong, Xiaojun; Chen, Guiping; Wang, Lan

    2015-01-01

    Vibrio splendidus is identified as one of the major pathogenic factors for the skin ulceration syndrome in sea cucumber (Apostichopus japonicus), which has vastly limited the development of the sea cucumber culture industry. In order to screen the immune genes involving Vibrio splendidus challenge in sea cucumber and explore the molecular mechanism of this process, the related transcriptome and gene expression profiling of resistant and susceptible biotypes of sea cucumber with Vibrio splendidus challenge were collected for analysis. A total of 319,455,942 trimmed reads were obtained, which were assembled into 186,658 contigs. After that, 89,891 representative contigs (without isoform) were clustered. The analysis of the gene expression profiling identified 358 differentially expression genes (DEGs) in the bacterial-resistant group, and 102 DEGs in the bacterial-susceptible group, compared with that in control group. According to the reported references and annotation information from BLAST, GO and KEGG, 30 putative bacterial-resistant genes and 19 putative bacterial-susceptible genes were identified from DEGs. The qRT-PCR results were consistent with the RNA-Seq results. Furthermore, many DGEs were involved in immune signaling related pathways, such as Endocytosis, Lysosome, MAPK, Chemokine and the ERBB signaling pathway. PMID:26193268

  1. Control of bacteriophage P2 gene expression: analysis of transcription of the ogr gene.

    PubMed Central

    Birkeland, N K; Lindqvist, B H; Christie, G E

    1991-01-01

    The bacteriophage P2 ogr gene encodes an 8.3-kDa protein that is a positive effector of P2 late gene transcription. The ogr gene is preceded by a promoter sequence (Pogr) resembling a normal Escherichia coli promoter and is located just downstream of a late transcription unit. We analyzed the kinetics and regulation of ogr gene transcription by using an ogr-specific antisense RNA probe in an S1 mapping assay. During a normal P2 infection, ogr gene transcription starts from Pogr at an intermediate time between the onset of early and late transcription. At late times after infection the ogr gene is cotranscribed with the late FETUD operon; the ogr gene product thus positively regulates its own synthesis from the P2 late promoter PF. Expression of the P2 late genes also requires P2 DNA replication. Complementation experiments and transcriptional analysis show that a nonreplicating P2 phage expresses the ogr gene from Pogr but is unable to transcribe the late genes. A P2 ogr-defective phage makes an increased level of ogr mRNA, consistent with autogenous control from Pogr. Transcription of the ogr gene in the prophage of a P2 heteroimmune lysogen is stimulated after infection with P2, suggesting that Pogr is under indirect immunity control and is activated by a yet-unidentified P2 early gene product during infection. Images FIG. 4 FIG. 5 FIG. 6 FIG. 7 FIG. 8 PMID:1938896

  2. Orally Delivered Scorpion Antimicrobial Peptides Exhibit Activity against Pea Aphid (Acyrthosiphon pisum) and Its Bacterial Symbionts.

    PubMed

    Luna-Ramirez, Karen; Skaljac, Marisa; Grotmann, Jens; Kirfel, Phillipp; Vilcinskas, Andreas

    2017-08-24

    Aphids are severe agricultural pests that damage crops by feeding on phloem sap and vectoring plant pathogens. Chemical insecticides provide an important aphid control strategy, but alternative and sustainable control measures are required to avoid rapidly emerging resistance, environmental contamination, and the risk to humans and beneficial organisms. Aphids are dependent on bacterial symbionts, which enable them to survive on phloem sap lacking essential nutrients, as well as conferring environmental stress tolerance and resistance to parasites. The evolution of aphids has been accompanied by the loss of many immunity-related genes, such as those encoding antibacterial peptides, which are prevalent in other insects, probably because any harm to the bacterial symbionts would inevitably affect the aphids themselves. This suggests that antimicrobial peptides (AMPs) could replace or at least complement conventional insecticides for aphid control. We fed the pea aphids ( Acyrthosiphon pisum ) with AMPs from the venom glands of scorpions. The AMPs reduced aphid survival, delayed their reproduction, displayed in vitro activity against aphid bacterial symbionts, and reduced the number of symbionts in vivo. Remarkably, we found that some of the scorpion AMPs compromised the aphid bacteriome, a specialized organ that harbours bacterial symbionts. Our data suggest that scorpion AMPs holds the potential to be developed as bio-insecticides, and are promising candidates for the engineering of aphid-resistant crops.

  3. Orally Delivered Scorpion Antimicrobial Peptides Exhibit Activity against Pea Aphid (Acyrthosiphon pisum) and Its Bacterial Symbionts

    PubMed Central

    Luna-Ramirez, Karen; Skaljac, Marisa; Grotmann, Jens; Kirfel, Phillipp; Vilcinskas, Andreas

    2017-01-01

    Aphids are severe agricultural pests that damage crops by feeding on phloem sap and vectoring plant pathogens. Chemical insecticides provide an important aphid control strategy, but alternative and sustainable control measures are required to avoid rapidly emerging resistance, environmental contamination, and the risk to humans and beneficial organisms. Aphids are dependent on bacterial symbionts, which enable them to survive on phloem sap lacking essential nutrients, as well as conferring environmental stress tolerance and resistance to parasites. The evolution of aphids has been accompanied by the loss of many immunity-related genes, such as those encoding antibacterial peptides, which are prevalent in other insects, probably because any harm to the bacterial symbionts would inevitably affect the aphids themselves. This suggests that antimicrobial peptides (AMPs) could replace or at least complement conventional insecticides for aphid control. We fed the pea aphids (Acyrthosiphon pisum) with AMPs from the venom glands of scorpions. The AMPs reduced aphid survival, delayed their reproduction, displayed in vitro activity against aphid bacterial symbionts, and reduced the number of symbionts in vivo. Remarkably, we found that some of the scorpion AMPs compromised the aphid bacteriome, a specialized organ that harbours bacterial symbionts. Our data suggest that scorpion AMPs holds the potential to be developed as bio-insecticides, and are promising candidates for the engineering of aphid-resistant crops. PMID:28837113

  4. Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

    PubMed

    Woods, J P; Heinecke, E L; Goldman, W E

    1998-04-01

    We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption

  5. Dynamics of Bacterial Communities in Two Unpolluted Soils after Spiking with Phenanthrene: Soil Type Specific and Common Responders

    PubMed Central

    Ding, Guo-Chun; Heuer, Holger; Smalla, Kornelia

    2012-01-01

    Considering their key role for ecosystem processes, it is important to understand the response of microbial communities in unpolluted soils to pollution with polycyclic aromatic hydrocarbons (PAH). Phenanthrene, a model compound for PAH, was spiked to a Cambisol and a Luvisol soil. Total community DNA from phenanthrene-spiked and control soils collected on days 0, 21, and 63 were analyzed based on PCR-amplified 16S rRNA gene fragments. Denaturing gradient gel electrophoresis (DGGE) fingerprints of bacterial communities increasingly deviated with time between spiked and control soils. In taxon specific DGGE, significant responses of Alphaproteobacteria and Actinobacteria became only detectable after 63 days, while significant effects on Betaproteobacteria were detectable in both soils after 21 days. Comparison of the taxonomic distribution of bacteria in spiked and control soils on day 63 as revealed by pyrosequencing indicated soil type specific negative effects of phenanthrene on several taxa, many of them belonging to the Gamma-, Beta-, or Deltaproteobacteria. Bacterial richness and evenness decreased in spiked soils. Despite the significant differences in the bacterial community structure between both soils on day 0, similar genera increased in relative abundance after PAH spiking, especially Sphingomonas and Polaromonas. However, this did not result in an increased overall similarity of the bacterial communities in both soils. PMID:22934091

  6. Evolvable social agents for bacterial systems modeling.

    PubMed

    Paton, Ray; Gregory, Richard; Vlachos, Costas; Saunders, Jon; Wu, Henry

    2004-09-01

    We present two approaches to the individual-based modeling (IbM) of bacterial ecologies and evolution using computational tools. The IbM approach is introduced, and its important complementary role to biosystems modeling is discussed. A fine-grained model of bacterial evolution is then presented that is based on networks of interactivity between computational objects representing genes and proteins. This is followed by a coarser grained agent-based model, which is designed to explore the evolvability of adaptive behavioral strategies in artificial bacteria represented by learning classifier systems. The structure and implementation of the two proposed individual-based bacterial models are discussed, and some results from simulation experiments are presented, illustrating their adaptive properties.

  7. Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)

    PubMed Central

    Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan

    2016-01-01

    Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188

  8. The intrinsic resistome of bacterial pathogens

    PubMed Central

    Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B. Sanchez, Maria; Martinez, Jose L.

    2013-01-01

    Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice. PMID:23641241

  9. The intrinsic resistome of bacterial pathogens.

    PubMed

    Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B Sanchez, Maria; Martinez, Jose L

    2013-01-01

    Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.

  10. Bacterial Contamination of Hospital Bed-Control Handsets in a Surgical Setting: A Potential Marker of Contamination of the Healthcare Environment

    PubMed Central

    Brady, RRW; Kalima, P; Damani, NN; Wilson, RG; Dunlop, MG

    2007-01-01

    INTRODUCTION Patients undergoing colorectal surgical resections have a high incidence of surgical site infection (SSI). Many patient-specific risk factors have been recognised in association with SSI in such patients, but environmental contamination is increasingly recognised as a contributor to hospital-acquired infection (HAI). This study set out to describe the bacterial contamination of the patient environment, using hospital bed-control handsets, as they are frequently handled by both staff and patients and represent a marker of environmental contamination. PATIENTS AND METHODS On two unannounced sampling events, 1 week apart, 140 bacteriological assessments were made of 70 hospital bed control handsets within a specialist colorectal surgical unit. RESULTS Of the handsets examined, 67 (95.7%) demonstrated at least one bacterial species (52.9% grew 1, 30% grew 2 and 12.9% grew 3 or more bacterial species). Of these, 29 (41.4%) bed-control handsets grew bacteria known to cause nosocomial infection, including 22 (31.4%) handsets which grew Enterococcus spp., 9 (12.9%) which grew MRSA, 2 (2.9%) which grew MSSA, 2 (2.9%) which grew coliforms, and 1 (1.4%) handset which grew anaerobes. At 1-week follow-up, 31 bed-control handsets showed evidence of contamination by the same bacterial species. CONCLUSIONS This study revealed high levels of bacteria known to cause HAI, contaminating hospital bed-control handsets in a surgical setting. Further study is now required to confirm whether hospital environmental contamination is causally involved in SSI. PMID:17959000

  11. Immune subversion by chromatin manipulation: a 'new face' of host-bacterial pathogen interaction.

    PubMed

    Arbibe, Laurence

    2008-08-01

    Bacterial pathogens have evolved various strategies to avoid immune surveillance, depending of their in vivo'lifestyle'. The identification of few bacterial effectors capable to enter the nucleus and modifying chromatin structure in host raises the fascinating questions of how pathogens modulate chromatin structure and why. Chromatin is a dynamic structure that maintains the stability and accessibility of the host DNA genome to the transcription machinery. This review describes the various strategies used by pathogens to interface with host chromatin. In some cases, chromatin injury can be a strategy to take control of major cellular functions, such as the cell cycle. In other cases, manipulation of chromatin structure at specific genomic locations by modulating epigenetic information provides a way for the pathogen to impose its own transcriptional signature onto host cells. This emerging field should strongly influence our understanding of chromatin regulation at interphase nucleus and may provide invaluable openings to the control of immune gene expression in inflammatory and infectious diseases.

  12. Copper effects on bacterial activity of estuarine silty sediments

    NASA Astrophysics Data System (ADS)

    Almeida, Adelaide; Cunha, Ângela; Fernandes, Sandra; Sobral, Paula; Alcântara, Fernanda

    2007-07-01

    Bacteria of silty estuarine sediments were spiked with copper to 200 μg Cu g -1 dry weight sediment in order to assess the impact of copper on bacterial degradation of organic matter and on bacterial biomass production. Bacterial density was determined by direct counting under epifluorescence microscopy and bacterial production by the incorporation of 3H-Leucine. Leucine turnover rate was evaluated by 14C-leucine incorporation and ectoenzymatic activities were estimated as the hydrolysis rate of model substrates for β-glucosidase and leucine-aminopeptidase. The presence of added copper in the microcosms elicited, after 21 days of incubation, generalised anoxia and a decrease in organic matter content. The non-eroded surface of the copper-spiked sediment showed, when compared to the control, a decrease in bacterial abundance and significant lower levels of bacterial production and of leucine turnover rate. Bacterial production and leucine turnover rate decreased to 1.4% and 13% of the control values, respectively. Ectoenzymatic activities were also negatively affected but by smaller factors. After erosion by the water current in laboratory flume conditions, the eroded surface of the control sediment showed a generalised decline in all bacterial activities. The erosion of the copper-spiked sediment showed, however, two types of responses with respect to bacterial activities at the exposed surface: positive responses of bacterial production and leucine turnover rate contrasting with slight negative responses of ectoenzymatic activities. The effects of experimental erosion in the suspended cells were also different in the control and in the copper-spiked sediment. Bacterial cells in the control microcosm exhibited, when compared to the non-eroded sediment cells, decreases in all activities after the 6-h suspension. The response of the average suspended copper-spiked sediment cell differed from the control by a less sharp decrease in ectoenzymatic activities and

  13. Population diversity of bacterial endophytes from jute (Corchorus olitorius) and evaluation of their potential role as bioinoculants.

    PubMed

    Haidar, Badrul; Ferdous, Mahbuba; Fatema, Babry; Ferdous, Ahlan Sabah; Islam, Mohammad Riazul; Khan, Haseena

    2018-03-01

    Endophytes are bacterial or fungal organisms associated with plants in an obligate or facultative manner. In order to maintain a stable symbiosis, many of the endophytes produce compounds that promote plant growth and help them adapt better to the environment. This study was conducted to explore the potential of jute bacterial endophytes for their growth promotion ability in direct and indirect ways. A total of 27 different bacterial species were identified from different varieties of a jute plant (Corchorus olitorius) and different parts of the plant (leaf, root, seed, and seedling) based on 16S rRNA gene sequence. Two of the isolates showed ACC deaminase activity with Staphylococcus pasteuri strain MBL_B3 and Ralstonia solanacearum strain MBL_B6 producing 18.1 and 8.08 μM mg -1  h -1 α-ketobutyrate respectively while eighteen had the ACC deaminase gene (acdS). Fourteen were positive for siderophore activity while Kocuria sp. strain MBL_B19 (133.36 μg/ml) and Bacillus sp. strain MBL_B17 (124.72 μg/ml) showed high IAA production ability. Seven bacterial strains were able to fix nitrogen with only one testing positive for nifH gene. Five isolates exhibited phosphorus utilization ability with Bacillus sp. strain MBL_B17 producing 218.47 μg P/ml. Three bacteria were able to inhibit the growth of a phytopathogen, Macrophomina phaseolina and among them Bacillus subtilis strain MBL_B4 was found to be the most effective, having 82% and 53% of relative inhibition ratio (RIR) and percent growth inhibition (PGI) values respectively. Nine bacteria were tested for their in vivo growth promotion ability and most of these isolates increased seed germination potential and vigour index significantly. Bacillus subtilis strain MBL_B13 showed 26.8% more vigour index than the control in which no bacterial inoculum was used. All inoculants were found to increase the dry weight of jute seedlings in comparison to the control plants and the most increase in fresh weight

  14. Nitric oxide mediates antimicrobial peptide gene expression by activating eicosanoid signaling

    PubMed Central

    Sadekuzzaman, Md.

    2018-01-01

    Nitric oxide (NO) mediates both cellular and humoral immune responses in insects. Its mediation of cellular immune responses uses eicosanoids as a downstream signal. However, the cross-talk with two immune mediators was not known in humoral immune responses. This study focuses on cross-talk between two immune mediators in inducing gene expression of anti-microbial peptides (AMPs) of a lepidopteran insect, Spodoptera exigua. Up-regulation of eight AMPs was observed in S. exigua against bacterial challenge. However, the AMP induction was suppressed by injection of an NO synthase inhibitor, L-NAME, while little expressional change was observed on injecting its enantiomer, D-NAME. The functional association between NO biosynthesis and AMP gene expression was further supported by RNA interference (RNAi) against NO synthase (SeNOS), which suppressed AMP gene expression under the immune challenge. The AMP induction was also mimicked by NO alone because injecting an NO analog, SNAP, without bacterial challenge significantly induced the AMP gene expression. Interestingly, an eicosanoid biosynthesis inhibitor, dexamethasone (DEX), suppressed the NO induction of AMP expression. The inhibitory activity of DEX was reversed by the addition of arachidonic acid, a precursor of eicosanoid biosynthesis. AMP expression of S. exigua was also controlled by the Toll/IMD signal pathway. The RNAi of Toll receptors or Relish suppressed AMP gene expression by suppressing NO levels and subsequently reducing PLA2 enzyme activity. These results suggest that eicosanoids are a downstream signal of NO mediation of AMP expression against bacterial challenge. PMID:29466449

  15. Dynamics of bacterial and fungal communities associated with eggshells during incubation

    PubMed Central

    Grizard, Stéphanie; Dini-Andreote, Francisco; Tieleman, B Irene; Salles, Joana F

    2014-01-01

    Microorganisms are closely associated with eggs and may play a determinant role in embryo survival. Yet, the majority of studies focusing on this association relied on culture-based methodology, eventually leading to a skewed assessment of microbial communities. By targeting the 16S rRNA gene and internal transcribed spacer (ITS) region, we, respectively, described bacterial and fungal communities on eggshells of the homing pigeon Columba livia. We explored their structure, abundance, and composition. Firstly, we showed that sampling technique affected the outcome of the results. While broadly used, the egg swabbing procedure led to a lower DNA extraction efficiency and provided different profiles of bacterial communities than those based on crushed eggshell pieces. Secondly, we observed shifts in bacterial and fungal communities during incubation. At late incubation, bacterial communities showed a reduction in diversity, while their abundance increased, possibly due to the competitive advantage of some species. When compared to their bacterial counterparts, fungal communities also decreased in diversity at late incubation. In that case, however, the decline was associated with a diminution of their overall abundance. Conclusively, our results showed that although incubation might inhibit microbial growth when compared to unincubated eggs, we observed the selective growth of specific bacterial species during incubation. Moreover, we showed that fungi are a substantial component of the microbial communities associated with eggshells and require further investigations in avian ecology. Identifying the functional roles of these microorganisms is likely to provide news insights into the evolutionary strategies that control embryo survival. We aimed to describe the dynamics of bacterial and fungal communities on homing pigeon eggshell surfaces. We investigated these communities at early and late incubation stages. PMID:24772289

  16. Genomic analyses of bacterial porin-cytochrome gene clusters

    DOE PAGES

    Shi, Liang; Fredrickson, James K.; Zachara, John M.

    2014-11-26

    In this study, the porin-cytochrome (Pcc) protein complex is responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III) by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens PCA. The identified and characterized Pcc complex of G. sulfurreducens PCA consists of a porin-like outer-membrane protein, a periplasmic 8-heme c type cytochrome (c-Cyt) and an outer-membrane 12-heme c-Cyt, and the genes encoding the Pcc proteins are clustered in the same regions of genome (i.e., the pcc gene clusters) of G. sulfurreducens PCA. A survey of additionally microbial genomes has identified the pcc gene clusters in all sequenced Geobacter spp. and other bacteriamore » from six different phyla, including Anaeromyxobacter dehalogenans 2CP-1, A. dehalogenans 2CP-C, Anaeromyxobacter sp. K, Candidatus Kuenenia stuttgartiensis, Denitrovibrio acetiphilus DSM 12809, Desulfurispirillum indicum S5, Desulfurivibrio alkaliphilus AHT2, Desulfurobacterium thermolithotrophum DSM 11699, Desulfuromonas acetoxidans DSM 684, Ignavibacterium album JCM 16511, and Thermovibrio ammonificans HB-1. The numbers of genes in the pcc gene clusters vary, ranging from two to nine. Similar to the metal-reducing (Mtr) gene clusters of other Fe(III)-reducing bacteria, such as Shewanella spp., additional genes that encode putative c-Cyts with predicted cellular localizations at the cytoplasmic membrane, periplasm and outer membrane often associate with the pcc gene clusters. This suggests that the Pcc-associated c-Cyts may be part of the pathways for extracellular electron transfer reactions. The presence of pcc gene clusters in the microorganisms that do not reduce solid-phase Fe(III) and Mn(IV) oxides, such as D. alkaliphilus AHT2 and I. album JCM 16511, also suggests that some of the pcc gene clusters may be involved in extracellular electron transfer reactions with the substrates other than Fe(III) and Mn(IV) oxides.« less

  17. Regulation of transcription by eukaryotic-like serine-threonine kinases and phosphatases in Gram-positive bacterial pathogens

    PubMed Central

    Wright, David P; Ulijasz, Andrew T

    2014-01-01

    Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430

  18. Bacterial Community Shift Drives Antibiotic Resistance Promotion during Drinking Water Chlorination.

    PubMed

    Jia, Shuyu; Shi, Peng; Hu, Qing; Li, Bing; Zhang, Tong; Zhang, Xu-Xiang

    2015-10-20

    For comprehensive insights into the effects of chlorination, a widely used disinfection technology, on bacterial community and antibiotic resistome in drinking water, this study applied high-throughput sequencing and metagenomic approaches to investigate the changing patterns of antibiotic resistance genes (ARGs) and bacterial community in a drinking water treatment and distribution system. At genus level, chlorination could effectively remove Methylophilus, Methylotenera, Limnobacter, and Polynucleobacter, while increase the relative abundance of Pseudomonas, Acidovorax, Sphingomonas, Pleomonas, and Undibacterium in the drinking water. A total of 151 ARGs within 15 types were detectable in the drinking water, and chlorination evidently increased their total relative abundance while reduced their diversity in the opportunistic bacteria (p < 0.05). Residual chlorine was identified as the key contributing factor driving the bacterial community shift and resistome alteration. As the dominant persistent ARGs in the treatment and distribution system, multidrug resistance genes (mainly encoding resistance-nodulation-cell division transportation system) and bacitracin resistance gene bacA were mainly carried by chlorine-resistant bacteria Pseudomonas and Acidovorax, which mainly contributed to the ARGs abundance increase. The strong correlation between bacterial community shift and antibiotic resistome alteration observed in this study may shed new light on the mechanism behind the chlorination effects on antibiotic resistance.

  19. Defining the Estimated Core Genome of Bacterial Populations Using a Bayesian Decision Model

    PubMed Central

    van Tonder, Andries J.; Mistry, Shilan; Bray, James E.; Hill, Dorothea M. C.; Cody, Alison J.; Farmer, Chris L.; Klugman, Keith P.; von Gottberg, Anne; Bentley, Stephen D.; Parkhill, Julian; Jolley, Keith A.; Maiden, Martin C. J.; Brueggemann, Angela B.

    2014-01-01

    The bacterial core genome is of intense interest and the volume of whole genome sequence data in the public domain available to investigate it has increased dramatically. The aim of our study was to develop a model to estimate the bacterial core genome from next-generation whole genome sequencing data and use this model to identify novel genes associated with important biological functions. Five bacterial datasets were analysed, comprising 2096 genomes in total. We developed a Bayesian decision model to estimate the number of core genes, calculated pairwise evolutionary distances (p-distances) based on nucleotide sequence diversity, and plotted the median p-distance for each core gene relative to its genome location. We designed visually-informative genome diagrams to depict areas of interest in genomes. Case studies demonstrated how the model could identify areas for further study, e.g. 25% of the core genes with higher sequence diversity in the Campylobacter jejuni and Neisseria meningitidis genomes encoded hypothetical proteins. The core gene with the highest p-distance value in C. jejuni was annotated in the reference genome as a putative hydrolase, but further work revealed that it shared sequence homology with beta-lactamase/metallo-beta-lactamases (enzymes that provide resistance to a range of broad-spectrum antibiotics) and thioredoxin reductase genes (which reduce oxidative stress and are essential for DNA replication) in other C. jejuni genomes. Our Bayesian model of estimating the core genome is principled, easy to use and can be applied to large genome datasets. This study also highlighted the lack of knowledge currently available for many core genes in bacterial genomes of significant global public health importance. PMID:25144616

  20. Automatic Control of Gene Expression in Mammalian Cells.

    PubMed

    Fracassi, Chiara; Postiglione, Lorena; Fiore, Gianfranco; di Bernardo, Diego

    2016-04-15

    Automatic control of gene expression in living cells is paramount importance to characterize both endogenous gene regulatory networks and synthetic circuits. In addition, such a technology can be used to maintain the expression of synthetic circuit components in an optimal range in order to ensure reliable performance. Here we present a microfluidics-based method to automatically control gene expression from the tetracycline-inducible promoter in mammalian cells in real time. Our approach is based on the negative-feedback control engineering paradigm. We validated our method in a monoclonal population of cells constitutively expressing a fluorescent reporter protein (d2EYFP) downstream of a minimal CMV promoter with seven tet-responsive operator motifs (CMV-TET). These cells also constitutively express the tetracycline transactivator protein (tTA). In cells grown in standard growth medium, tTA is able to bind the CMV-TET promoter, causing d2EYFP to be maximally expressed. Upon addition of tetracycline to the culture medium, tTA detaches from the CMV-TET promoter, thus preventing d2EYFP expression. We tested two different model-independent control algorithms (relay and proportional-integral (PI)) to force a monoclonal population of cells to express an intermediate level of d2EYFP equal to 50% of its maximum expression level for up to 3500 min. The control input is either tetracycline-rich or standard growth medium. We demonstrated that both the relay and PI controllers can regulate gene expression at the desired level, despite oscillations (dampened in the case of the PI controller) around the chosen set point.

  1. Nutrient-enhanced n-alkanes biodegradation and succession of bacterial communities

    NASA Astrophysics Data System (ADS)

    Sun, Yanyu; Wang, Hui; Li, Junde; Wang, Bin; Qi, Cancan; Hu, Xiaoke

    2017-11-01

    Bioremediation, is an effective and environment-friendly method of cleaning up crude oil pollution after an oil spill. However, the in situ bioremediation of crude oil is usually inhibited by deficiency of inorganic nutrients. To understand the effects of nutrient addition on the bioremediation of crude oil and the succession of bacterial communities during process of bioremediation, microcosms containing oil-contaminated sediments were constructed and biodegradation of crude oil was assessed based on the depletion of different ingredients. We used two culture-independent methods, denaturing gradient gel electrophoresis and a 16S rRNA gene based clone library, to analyze the succession of bacterial communities. The results suggested n-alkanes were degraded after 30 days and that nutrient amendments significantly improved the efficiency of their biodegradation. Moreover, oil contamination and nutrient amendments could dramatically change bacterial community structures. Lower diversity was detected after being contaminated with oil. For instance, bacterial clones affiliated with the phylum Armatimonadetes, Firmicutes, Gemmatimonadetes, and Planctomycetes and the class Deltaproteobacteria and Epsilonproteobacteria could not be identified after 30 days of incubation with crude oil. However, "professional hydrocarbonocastic bacteria" became abundant in samples treated with oil during the bioremediation period, while these clones were almost completely absent from the control plots. Interestingly, bioinformatics analysis showed that even when dramatic differences in oil biodegradation efficiency were observed, bacterial communities in the plots with nutrient amendments were not significantly different from those in plots treated with oil alone. These findings indicated that nutrient amendments could stimulate the process of biodegradation but had less impact on bacterial communities. Overall, nutrient amendments might be able to stimulate the growth of n-alkane degrading

  2. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  3. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  4. Exploiting Quorum Sensing To Confuse Bacterial Pathogens

    PubMed Central

    LaSarre, Breah

    2013-01-01

    SUMMARY Cell-cell communication, or quorum sensing, is a widespread phenomenon in bacteria that is used to coordinate gene expression among local populations. Its use by bacterial pathogens to regulate genes that promote invasion, defense, and spread has been particularly well documented. With the ongoing emergence of antibiotic-resistant pathogens, there is a current need for development of alternative therapeutic strategies. An antivirulence approach by which quorum sensing is impeded has caught on as a viable means to manipulate bacterial processes, especially pathogenic traits that are harmful to human and animal health and agricultural productivity. The identification and development of chemical compounds and enzymes that facilitate quorum-sensing inhibition (QSI) by targeting signaling molecules, signal biogenesis, or signal detection are reviewed here. Overall, the evidence suggests that QSI therapy may be efficacious against some, but not necessarily all, bacterial pathogens, and several failures and ongoing concerns that may steer future studies in productive directions are discussed. Nevertheless, various QSI successes have rightfully perpetuated excitement surrounding new potential therapies, and this review highlights promising QSI leads in disrupting pathogenesis in both plants and animals. PMID:23471618

  5. Bacterial diversity at different stages of the composting process

    PubMed Central

    2010-01-01

    Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants. PMID:20350306

  6. Obeticholic acid reduces bacterial translocation and inhibits intestinal inflammation in cirrhotic rats.

    PubMed

    Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín

    2016-05-01

    In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  7. Bacterial phylogeny structures soil resistomes across habitats

    NASA Astrophysics Data System (ADS)

    Forsberg, Kevin J.; Patel, Sanket; Gibson, Molly K.; Lauber, Christian L.; Knight, Rob; Fierer, Noah; Dantas, Gautam

    2014-05-01

    Ancient and diverse antibiotic resistance genes (ARGs) have previously been identified from soil, including genes identical to those in human pathogens. Despite the apparent overlap between soil and clinical resistomes, factors influencing ARG composition in soil and their movement between genomes and habitats remain largely unknown. General metagenome functions often correlate with the underlying structure of bacterial communities. However, ARGs are proposed to be highly mobile, prompting speculation that resistomes may not correlate with phylogenetic signatures or ecological divisions. To investigate these relationships, we performed functional metagenomic selections for resistance to 18 antibiotics from 18 agricultural and grassland soils. The 2,895 ARGs we discovered were mostly new, and represent all major resistance mechanisms. We demonstrate that distinct soil types harbour distinct resistomes, and that the addition of nitrogen fertilizer strongly influenced soil ARG content. Resistome composition also correlated with microbial phylogenetic and taxonomic structure, both across and within soil types. Consistent with this strong correlation, mobility elements (genes responsible for horizontal gene transfer between bacteria such as transposases and integrases) syntenic with ARGs were rare in soil by comparison with sequenced pathogens, suggesting that ARGs may not transfer between soil bacteria as readily as is observed between human pathogens. Together, our results indicate that bacterial community composition is the primary determinant of soil ARG content, challenging previous hypotheses that horizontal gene transfer effectively decouples resistomes from phylogeny.

  8. The impact of natural transformation on adaptation in spatially structured bacterial populations.

    PubMed

    Moradigaravand, Danesh; Engelstädter, Jan

    2014-06-20

    Recent studies have demonstrated that natural transformation and the formation of highly structured populations in bacteria are interconnected. In spite of growing evidence about this connection, little is known about the dynamics of natural transformation in spatially structured bacterial populations. In this work, we model the interdependency between the dynamics of the bacterial gene pool and those of environmental DNA in space to dissect the effect of transformation on adaptation. Our model reveals that even with only a single locus under consideration, transformation with a free DNA fragment pool results in complex adaptation dynamics that do not emerge in previous models focusing only on the gene shuffling effect of transformation at multiple loci. We demonstrate how spatial restriction on population growth and DNA diffusion in the environment affect the impact of transformation on adaptation. We found that in structured bacterial populations intermediate DNA diffusion rates predominantly cause transformation to impede adaptation by spreading deleterious alleles in the population. Overall, our model highlights distinctive evolutionary consequences of bacterial transformation in spatially restricted compared to planktonic bacterial populations.

  9. Integrating marker-assisted background analysis with foreground selection for pyramiding bacterial blight resistance genes into Basmati rice.

    PubMed

    Baliyan, Nikita; Malik, Rekha; Rani, Reema; Mehta, Kirti; Vashisth, Urvashi; Dhillon, Santosh; Boora, Khazan Singh

    2018-01-01

    Bacterial leaf blight (BB), caused by the bacterium Xanthomonas oryzae pv. Oryzae (Xoo), is the major constraint amongst rice diseases in India. CSR-30 is a very popular high-yielding, salt-tolerant Basmati variety widely grown in Haryana, India, but highly susceptible to BB. In the present study, we have successfully introgressed three BB resistance genes (Xa21, xa13 and xa5) from BB-resistant donor variety IRBB-60 into the BB-susceptible Basmati variety CSR-30 through marker-assisted selection (MAS) exercised with stringent phenotypic selection without compromising the Basmati traits. Background analysis using 131 polymorphic SSR markers revealed that recurrent parent genome (RPG) recovery ranged up to 97.1% among 15 BC 3 F 1 three-gene-pyramided genotypes. Based on agronomic evaluation, BB reaction, aroma, percentage recovery of RPG, and grain quality evaluation, four genotypes, viz., IC-R28, IC-R68, IC-R32, and IC-R42, were found promising and advanced to BC 3 F 2 generation. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

  10. Novel insights into the response of Atlantic salmon (Salmo salar) to Piscirickettsia salmonis: Interplay of coding genes and lncRNAs during bacterial infection.

    PubMed

    Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian

    2016-12-01

    Despite the high prevalence and impact to Chilean salmon aquaculture of the intracellular bacterium Piscirickettsia salmonis, the molecular underpinnings of host-pathogen interactions remain unclear. Herein, the interplay of coding and non-coding transcripts has been proposed as a key mechanism involved in immune response. Therefore, the aim of this study was to evidence how coding and non-coding transcripts are modulated during the infection process of Atlantic salmon with P. salmonis. For this, RNA-seq was conducted in brain, spleen, and head kidney samples, revealing different transcriptional profiles according to bacterial load. Additionally, while most of the regulated genes annotated for diverse biological processes during infection, a common response associated with clathrin-mediated endocytosis and iron homeostasis was present in all tissues. Interestingly, while endocytosis-promoting factors and clathrin inductions were upregulated, endocytic receptors were mainly downregulated. Furthermore, the regulation of genes related to iron homeostasis suggested an intracellular accumulation of iron, a process in which heme biosynthesis/degradation pathways might play an important role. Regarding the non-coding response, 918 putative long non-coding RNAs were identified, where 425 were newly characterized for S. salar. Finally, co-localization and co-expression analyses revealed a strong correlation between the modulations of long non-coding RNAs and genes associated with endocytosis and iron homeostasis. These results represent the first comprehensive study of putative interplaying mechanisms of coding and non-coding RNAs during bacterial infection in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

    PubMed

    McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

    2013-06-01

    To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

  12. Amplicon sequencing of bacterial microbiota in abortion material from cattle.

    PubMed

    Vidal, Sara; Kegler, Kristel; Posthaus, Horst; Perreten, Vincent; Rodriguez-Campos, Sabrina

    2017-10-10

    Abortions in cattle have a significant economic impact on animal husbandry and require prompt diagnosis for surveillance of epizootic infectious agents. Since most abortions are not epizootic but sporadic with often undetected etiologies, this study examined the bacterial community present in the placenta (PL, n = 32) and fetal abomasal content (AC, n = 49) in 64 cases of bovine abortion by next generation sequencing (NGS) of the 16S rRNA gene. The PL and AC from three fetuses of dams that died from non-infectious reasons were included as controls. All samples were analyzed by bacterial culture, and 17 were examined by histopathology. We observed 922 OTUs overall and 267 taxa at the genus level. No detectable bacterial DNA was present in the control samples. The microbial profiles of the PL and AC differed significantly, both in their composition (PERMANOVA), species richness and Chao-1 (Mann-Whitney test). In both organs, Pseudomonas was the most abundant genus. The combination of NGS and culture identified opportunistic pathogens of interest in placentas with lesions, such as Vibrio metschnikovii, Streptococcus uberis, Lactococcus lactis and Escherichia coli. In placentas with lesions where culturing was unsuccessful, Pseudomonas and unidentified Aeromonadaceae were identified by NGS displaying high number of reads. Three cases with multiple possible etiologies and placentas presenting lesions were detected by NGS. Amplicon sequencing has the potential to uncover unknown etiological agents. These new insights on cattle abortion extend our focus to previously understudied opportunistic abortive bacteria.

  13. Metabolic sensor governing bacterial virulence in Staphylococcus aureus.

    PubMed

    Ding, Yue; Liu, Xing; Chen, Feifei; Di, Hongxia; Xu, Bin; Zhou, Lu; Deng, Xin; Wu, Min; Yang, Cai-Guang; Lan, Lefu

    2014-11-18

    An effective metabolism is essential to all living organisms, including the important human pathogen Staphylococcus aureus. To establish successful infection, S. aureus must scavenge nutrients and coordinate its metabolism for proliferation. Meanwhile, it also must produce an array of virulence factors to interfere with host defenses. However, the ways in which S. aureus ties its metabolic state to its virulence regulation remain largely unknown. Here we show that citrate, the first intermediate of the tricarboxylic acid (TCA) cycle, binds to and activates the catabolite control protein E (CcpE) of S. aureus. Using structural and site-directed mutagenesis studies, we demonstrate that two arginine residues (Arg145 and Arg256) within the putative inducer-binding cavity of CcpE are important for its allosteric activation by citrate. Microarray analysis reveals that CcpE tunes the expression of 126 genes that comprise about 4.7% of the S. aureus genome. Intriguingly, although CcpE is a major positive regulator of the TCA-cycle activity, its regulon consists predominantly of genes involved in the pathogenesis of S. aureus. Moreover, inactivation of CcpE results in increased staphyloxanthin production, improved ability to acquire iron, increased resistance to whole-blood-mediated killing, and enhanced bacterial virulence in a mouse model of systemic infection. This study reveals CcpE as an important metabolic sensor that allows S. aureus to sense and adjust its metabolic state and subsequently to coordinate the expression of virulence factors and bacterial virulence.

  14. Adaptability of non-genetic diversity in bacterial chemotaxis

    PubMed Central

    Frankel, Nicholas W; Pontius, William; Dufour, Yann S; Long, Junjiajia; Hernandez-Nunez, Luis; Emonet, Thierry

    2014-01-01

    Bacterial chemotaxis systems are as diverse as the environments that bacteria inhabit, but how much environmental variation can cells tolerate with a single system? Diversification of a single chemotaxis system could serve as an alternative, or even evolutionary stepping-stone, to switching between multiple systems. We hypothesized that mutations in gene regulation could lead to heritable control of chemotactic diversity. By simulating foraging and colonization of E. coli using a single-cell chemotaxis model, we found that different environments selected for different behaviors. The resulting trade-offs show that populations facing diverse environments would ideally diversify behaviors when time for navigation is limited. We show that advantageous diversity can arise from changes in the distribution of protein levels among individuals, which could occur through mutations in gene regulation. We propose experiments to test our prediction that chemotactic diversity in a clonal population could be a selectable trait that enables adaptation to environmental variability. DOI: http://dx.doi.org/10.7554/eLife.03526.001 PMID:25279698

  15. Gasmin (BV2-5), a polydnaviral-acquired gene in Spodoptera exigua. Trade-off in the defense against bacterial and viral infections.

    PubMed

    Gasmi, Laila; Jakubowska, Agata K; Herrero, Salvador

    2016-03-01

    Thousands of Hymenopteran endoparasitoids have developed a unique symbiotic relationship with viruses named polydnavirus (PDVs). These viruses immunocompromise the lepidopteran host allowing the survival of the wasp eggs. In a previous work, we have shown the horizontal transfer of some polydnaviral genes into the genome of the Lepidoptera, Spodoptera exigua. One of these genes, BV2-5 (named gasmin) interferes with actin polymerization, negatively affecting the multiplication of baculovirus in cell culture. In this work, we have focused in the study of the effect of Gasmin expression on different aspects of the baculovirus production. In addition, and since actin polymerization is crucial for phagocytosis, we have studied the effect of Gasmin expression on the larval interaction with bacterial pathogens. Over-expression of Gasmin on hemocytes significantly reduces their capacity to phagocytize the pathogenic bacteria Bacillus thuringiensis. According to these results, gasmin domestication negatively affects baculovirus replication, but increases larvae susceptibility to bacterial infections as pay off. Although the effect of Gasmin on the insect interaction with other pathogens or parasitoids remain unknown, the opposite effects described here could shape the biological history of this species based on the abundance of certain type of pathogens as suggested by the presence of truncated forms of this protein in several regions of the world. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Initial insights into bacterial succession during human decomposition.

    PubMed

    Hyde, Embriette R; Haarmann, Daniel P; Petrosino, Joseph F; Lynne, Aaron M; Bucheli, Sibyl R

    2015-05-01

    Decomposition is a dynamic ecological process dependent upon many factors such as environment, climate, and bacterial, insect, and vertebrate activity in addition to intrinsic properties inherent to individual cadavers. Although largely attributed to microbial metabolism, very little is known about the bacterial basis of human decomposition. To assess the change in bacterial community structure through time, bacterial samples were collected from several sites across two cadavers placed outdoors to decompose and analyzed through 454 pyrosequencing and analysis of variable regions 3-5 of the bacterial 16S ribosomal RNA (16S rRNA) gene. Each cadaver was characterized by a change in bacterial community structure for all sites sampled as time, and decomposition, progressed. Bacteria community structure is variable at placement and before purge for all body sites. At bloat and purge and until tissues began to dehydrate or were removed, bacteria associated with flies, such as Ignatzschineria and Wohlfahrtimonas, were common. After dehydration and skeletonization, bacteria associated with soil, such as Acinetobacter, were common at most body sites sampled. However, more cadavers sampled through multiple seasons are necessary to assess major trends in bacterial succession.

  17. Identification of regulatory targets for the bacterial Nus factor complex.

    PubMed

    Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

    2017-12-11

    Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

  18. Association of RNA Biosignatures With Bacterial Infections in Febrile Infants Aged 60 Days or Younger

    PubMed Central

    Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T. Charles; Smith, Bennett; Alpern, Elizabeth R.; Anders, Jennifer; Atabaki, Shireen M.; Bennett, Jonathan E.; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M.; Crain, Ellen F.; Cruz, Andrea T.; Dayan, Peter S.; Gattu, Rajender; Greenberg, Richard; Hoyle, John D.; Jaffe, David M.; Levine, Deborah A.; Lillis, Kathleen; Linakis, James G.; Muenzer, Jared; Nigrovic, Lise E.; Powell, Elizabeth C.; Rogers, Alexander J.; Roosevelt, Genie; Ruddy, Richard M.; Saunders, Mary; Tunik, Michael G.; Tzimenatos, Leah; Vitale, Melissa; Dean, J. Michael; Ramilo, Octavio

    2016-01-01

    IMPORTANCE Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns (“RNA biosignatures”) in response to infections may provide an alternative diagnostic approach. OBJECTIVE To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. DESIGN, SETTING, AND PARTICIPANTS Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. EXPOSURE RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. MAIN OUTCOMES AND MEASURES Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. RESULTS Of 1883 febrile infants (median age, 37 days; 55.7%boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections—including 32 with bacteremia and 15 with urinary tract infections—and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87%(95%CI, 73%-95%) sensitivity and 89% (95%CI, 81%-93%) specificity. Ten classifier genes distinguished

  19. The quest for a unified view of bacterial land colonization

    PubMed Central

    Wu, Hao; Fang, Yongjun; Yu, Jun; Zhang, Zhang

    2014-01-01

    Exploring molecular mechanisms underlying bacterial water-to-land transition represents a critical start toward a better understanding of the functioning and stability of the terrestrial ecosystems. Here, we perform comprehensive analyses based on a large variety of bacteria by integrating taxonomic, phylogenetic and metagenomic data, in the quest for a unified view that elucidates genomic, evolutionary and ecological dynamics of the marine progenitors in adapting to nonaquatic environments. We hypothesize that bacterial land colonization is dominated by a single-gene sweep, that is, the emergence of dnaE2 derived from an early duplication event of the primordial dnaE, followed by a series of niche-specific genomic adaptations, including GC content increase, intensive horizontal gene transfer and constant genome expansion. In addition, early bacterial radiation may be stimulated by an explosion of land-borne hosts (for example, plants and animals) after initial land colonization events. PMID:24451209

  20. Environmental safety review of methoprene and bacterially-derived pesticides commonly used for sustained mosquito control.

    PubMed

    Lawler, Sharon P

    2017-05-01

    Some pesticides are applied directly to aquatic systems to reduce numbers of mosquito larvae (larvicides) and thereby reduce transmission of pathogens that mosquitoes vector to humans and wildlife. Sustained, environmentally-safe control of larval mosquitoes is particularly needed for highly productive waters (e.g., catchment basins, water treatment facilities, septic systems), but also for other habitats to maintain control and reduce inspection costs. Common biorational pesticides include the insect juvenile hormone mimic methoprene and pesticides derived from the bacteria Bacillus thuringiensis israelensis, Lysinibacillus sphaericus and Saccharopolyspora spinosa (spinosad). Health agencies, the public and environmental groups have especially debated the use of methoprene because some studies have shown toxic effects on non-target organisms. However, many studies have demonstrated its apparent environmental safety. This review critically evaluates studies pertinent to the environmental safety of using methoprene to control mosquito larvae, and provides concise assessments of the bacterial larvicides that provide sustained control of mosquitoes. The review first outlines the ecological and health effects of mosquitoes, and distinguishes between laboratory toxicity and environmental effects. The article then interprets non-target toxicity findings in light of measured environmental concentrations of methoprene (as used in mosquito control) and field studies of its non-target effects. The final section evaluates information on newer formulations of bacterially-derived pesticides for sustained mosquito control. Results show that realized environmental concentrations of methoprene were usually 2-5µg/kg (range 2-45µg/kg) and that its motility is limited. These levels were not toxic to the vast majority of vertebrates and invertebrates tested in laboratories, except for a few species of zooplankton, larval stages of some other crustaceans, and small Diptera. Studies

  1. Soil bacterial community and functional shifts in response to altered snowpack in moist acidic tundra of northern Alaska

    NASA Astrophysics Data System (ADS)

    Ricketts, Michael P.; Poretsky, Rachel S.; Welker, Jeffrey M.; Gonzalez-Meler, Miquel A.

    2016-09-01

    Soil microbial communities play a central role in the cycling of carbon (C) in Arctic tundra ecosystems, which contain a large portion of the global C pool. Climate change predictions for Arctic regions include increased temperature and precipitation (i.e. more snow), resulting in increased winter soil insulation, increased soil temperature and moisture, and shifting plant community composition. We utilized an 18-year snow fence study site designed to examine the effects of increased winter precipitation on Arctic tundra soil bacterial communities within the context of expected ecosystem response to climate change. Soil was collected from three pre-established treatment zones representing varying degrees of snow accumulation, where deep snow ˜ 100 % and intermediate snow ˜ 50 % increased snowpack relative to the control, and low snow ˜ 25 % decreased snowpack relative to the control. Soil physical properties (temperature, moisture, active layer thaw depth) were measured, and samples were analysed for C concentration, nitrogen (N) concentration, and pH. Soil microbial community DNA was extracted and the 16S rRNA gene was sequenced to reveal phylogenetic community differences between samples and determine how soil bacterial communities might respond (structurally and functionally) to changes in winter precipitation and soil chemistry. We analysed relative abundance changes of the six most abundant phyla (ranging from 82 to 96 % of total detected phyla per sample) and found four (Acidobacteria, Actinobacteria, Verrucomicrobia, and Chloroflexi) responded to deepened snow. All six phyla correlated with at least one of the soil chemical properties (% C, % N, C : N, pH); however, a single predictor was not identified, suggesting that each bacterial phylum responds differently to soil characteristics. Overall, bacterial community structure (beta diversity) was found to be associated with snow accumulation treatment and all soil chemical properties

  2. Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

    PubMed Central

    Murthy, S C; Bhat, G P; Thimmappaya, B

    1985-01-01

    A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

  3. The Differential Effects of Anesthetics on Bacterial Behaviors

    PubMed Central

    Chamberlain, Matthew; Koutsogiannaki, Sophia; Schaefers, Matthew; Babazada, Hasan; Liu, Renyu; Yuki, Koichi

    2017-01-01

    Volatile anesthetics have been in clinical use for a long period of time and are considered to be promiscuous by presumably interacting with several ion channels in the central nervous system to produce anesthesia. Because ion channels and their existing evolutionary analogues, ion transporters, are very important in various organisms, it is possible that volatile anesthetics may affect some bacteria. In this study, we hypothesized that volatile anesthetics could affect bacterial behaviors. We evaluated the impact of anesthetics on bacterial growth, motility (swimming and gliding) and biofilm formation of four common bacterial pathogens in vitro. We found that commonly used volatile anesthetics isoflurane and sevoflurane affected bacterial motility and biofilm formation without any effect on growth of the common bacterial pathogens studied here. Using available Escherichia coli gene deletion mutants of ion transporters and in silico molecular docking, we suggested that these altered behaviors might be at least partly via the interaction of volatile anesthetics with ion transporters. PMID:28099463

  4. Bacterial communities in floral nectar.

    PubMed

    Fridman, Svetlana; Izhaki, Ido; Gerchman, Yoram; Halpern, Malka

    2012-02-01

    Floral nectar is regarded as the most important reward available to animal-pollinated plants to attract pollinators. Despite the vast amount of publications on nectar properties, the role of nectar as a natural bacterial habitat is yet unexplored. To gain a better understanding of bacterial communities inhabiting floral nectar, culture-dependent and -independent (454-pyrosequencing) methods were used. Our findings demonstrate that bacterial communities in nectar are abundant and diverse. Using culture-dependent method we showed that bacterial communities of nectar displayed significant variation among three plant species: Amygdalus communis, Citrus paradisi and Nicotiana glauca. The dominant class in the nectar bacterial communities was Gammaproteobacteria. About half of the isolates were novel species (< 97% similarities of the 16S rRNA gene with known species). Using 454-pyrosequencing we demonstrated that nectar microbial community are distinct for each of the plant species while there are no significant differences between nectar microbial communities within nectars taken from different plants of the same species. Primary selection of the nectar bacteria is unclear; it may be affected by variations in the chemical composition of the nectar in each plant. The role of the rich and diverse nectar microflora in the attraction-repulsion relationships between the plant and its nectar consumers has yet to be explored. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  7. Discovery of novel bacterial toxins by genomics and computational biology.

    PubMed

    Doxey, Andrew C; Mansfield, Michael J; Montecucco, Cesare

    2018-06-01

    Hundreds and hundreds of bacterial protein toxins are presently known. Traditionally, toxin identification begins with pathological studies of bacterial infectious disease. Following identification and cultivation of a bacterial pathogen, the protein toxin is purified from the culture medium and its pathogenic activity is studied using the methods of biochemistry and structural biology, cell biology, tissue and organ biology, and appropriate animal models, supplemented by bioimaging techniques. The ongoing and explosive development of high-throughput DNA sequencing and bioinformatic approaches have set in motion a revolution in many fields of biology, including microbiology. One consequence is that genes encoding novel bacterial toxins can be identified by bioinformatic and computational methods based on previous knowledge accumulated from studies of the biology and pathology of thousands of known bacterial protein toxins. Starting from the paradigmatic cases of diphtheria toxin, tetanus and botulinum neurotoxins, this review discusses traditional experimental approaches as well as bioinformatics and genomics-driven approaches that facilitate the discovery of novel bacterial toxins. We discuss recent work on the identification of novel botulinum-like toxins from genera such as Weissella, Chryseobacterium, and Enteroccocus, and the implications of these computationally identified toxins in the field. Finally, we discuss the promise of metagenomics in the discovery of novel toxins and their ecological niches, and present data suggesting the existence of uncharacterized, botulinum-like toxin genes in insect gut metagenomes. Copyright © 2018. Published by Elsevier Ltd.

  8. Unraveling bacterial fingerprints of city subways from microbiome 16S gene profiles.

    PubMed

    Walker, Alejandro R; Grimes, Tyler L; Datta, Somnath; Datta, Susmita

    2018-05-22

    Microbial communities can be location specific, and the abundance of species within locations can influence our ability to determine whether a sample belongs to one city or another. As part of the 2017 CAMDA MetaSUB Inter-City Challenge, next generation sequencing (NGS) data was generated from swipe samples collected from subway stations in Boston, New York City hereafter New York, and Sacramento. DNA was extracted and Illumina sequenced. Sequencing data was provided for all cities as part of 2017 CAMDA contest challenge dataset. Principal component analysis (PCA) showed clear clustering of the samples for the three cities, with a substantial proportion of the variance explained by the first three components. We ran two different classifiers and results were robust for error rate (< 6%) and accuracy (> 95%). The analysis of variance (ANOVA) demonstrated that overall, bacterial composition across the three cities is significantly different. A similar conclusion was reached using a novel bootstrap based test using diversity indices. Last but not least, a co-abundance association network analyses for the taxonomic levels "order", "family", and "genus" found different patterns of bacterial networks for the three cities. Bacterial fingerprint can be useful to predict sample provenance. In this work prediction of provenance reported with over 95% accuracy. Association based network analysis, emphasized similarities between the closest cities sharing common bacterial composition. ANOVA showed different patterns of bacterial amongst cities, and these findings strongly suggest that bacterial signature across multiple cities are different. This work advocates a data analysis pipeline which could be followed in order to get biological insight from this data. However, the biological conclusions from this analysis is just an early indication out of a pilot microbiome data provided to us through CAMDA 2017 challenge and will be subject to change as we get more complete data

  9. A bacterial view of the periodic table: genes and proteins for toxic inorganic ions.

    PubMed

    Silver, Simon; Phung, Le T

    2005-12-01

    Essentially all bacteria have genes for toxic metal ion resistances and these include those for Ag+, AsO2-, AsO4(3-), Cd2+ Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. The largest group of resistance systems functions by energy-dependent efflux of toxic ions. Fewer involve enzymatic transformations (oxidation, reduction, methylation, and demethylation) or metal-binding proteins (for example, metallothionein SmtA, chaperone CopZ and periplasmic silver binding protein SilE). Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. For example, Cd2+-efflux pumps of bacteria are either inner membrane P-type ATPases or three polypeptide RND chemiosmotic complexes consisting of an inner membrane pump, a periplasmic-bridging protein and an outer membrane channel. In addition to the best studied three-polypeptide chemiosmotic system, Czc (Cd2+, Zn2+, and Co2), others are known that efflux Ag+, Cu+, Ni2+, and Zn2+. Resistance to inorganic mercury, Hg2+ (and to organomercurials, such as CH3Hg+ and phenylmercury) involve a series of metal-binding and membrane transport proteins as well as the enzymes mercuric reductase and organomercurial lyase, which overall convert more toxic to less toxic forms. Arsenic resistance and metabolizing systems occur in three patterns, the widely-found ars operon that is present in most bacterial genomes and many plasmids, the more recently recognized arr genes for the periplasmic arsenate reductase that functions in anaerobic respiration as a terminal electron acceptor, and the aso genes for the periplasmic arsenite oxidase that functions as an initial electron donor in aerobic resistance to arsenite.

  10. The urinary microbiome in women with mixed urinary incontinence compared to similarly aged controls.

    PubMed

    Komesu, Yuko M; Richter, Holly E; Carper, Benjamin; Dinwiddie, Darrell L; Lukacz, Emily S; Siddiqui, Nazema Y; Sung, Vivian W; Zyczynski, Halina M; Ridgeway, Beri; Rogers, Rebecca G; Arya, Lily A; Mazloomdoost, Donna; Gantz, Marie G

    2018-06-16

    Previous studies have suggested that women with urinary incontinence have an altered urinary microbiome. We hypothesized that the microbiome in women with mixed urinary incontinence (MUI) differed from controls and tested this hypothesis using bacterial gene sequencing techniques. This multicenter study compared the urinary microbiome in women with MUI and similarly aged controls. Catheterized urine samples were obtained; v4-6 regions of the 16S rRNA gene were sequenced to identify bacteria. Bacterial predominance (> 50% of an individual's genera) was compared between MUI and controls. Bacterial sequences were categorized into "community types" using Dirichlet multinomial mixture (DMM) methods. Generalized linear mixed models predicted MUI/control status based on clinical characteristics and community type. Post-hoc analyses were performed in women < 51 and ≥ 51 years. Sample size estimates required 200 samples to detect a 20% difference in Lactobacillus predominance with P < 0.05. Of 212 samples, 97.6% were analyzed (123 MUI/84 controls, mean age 53 ± 11 years). Overall Lactobacillus predominance did not differ between MUI and controls (45/123 = 36.6% vs. 36/84 = 42.9%, P = 0.36). DMM analyses revealed six community types; communities differed by age (P = 0.001). A High-Lactobacillus (89.2% Lactobacillus) community had a greater proportion of controls (19/84 = 22.6%, MUI 11/123 = 8.9%). Overall, bacterial community types did not differ in MUI and controls. However, post-hoc analysis of women < 51 years found that bacterial community types distinguished MUI from controls (P = 0.041); Moderate-Lactobacillus (aOR 7.78, CI 1.85-32.62) and Mixed (aOR 7.10, CI 1.32-38.10) community types were associated with MUI. Community types did not differentiate MUI and controls in women ≥ 51 years (P = 0.94). Women with MUI and controls did not differ in overall Lactobacillus predominance. In younger women, urinary bacterial

  11. The best of both worlds: reaping the benefits from mammalian and bacterial therapeutic circuits.

    PubMed

    Bojar, Daniel; Fussenegger, Martin

    2016-10-01

    Synthetic biology has revolutionized the field of biology in the last two decades. By taking apart natural systems and recombining engineered parts in novel constellations, it has not only unlocked a staggering variety of biological control mechanisms but it has also created a panoply of biomedical achievements, such as innovative diagnostics and therapies. The most common mode of action in the field of synthetic biology is mediated by synthetic gene circuits assembled in a systematic and rational manner. This review covers the most recent therapeutic gene circuits implemented in mammalian and bacterial cells designed for the diagnosis and therapy of an extensive array of diseases. Highlighting new tools for therapeutic gene circuits, we describe a future that holds a plethora of potentialities for the medicine of tomorrow. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Handling Gene and Protein Names in the Age of Bioinformatics: The Special Challenge of Secreted Multimodular Bacterial Enzymes such as the cbhA/cbh9A Gene of Clostridium thermocellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brunecky, Roman; Schwarz, Wolfgang H.; Broeker, Jannis

    An increasing number of researchers working in biology, biochemistry, biotechnology, bioengineering, bioinformatics and other related fields of science are using biological molecules. As the scientific background of the members of different scientific communities is more diverse than ever before, the number of scientists not familiar with the rules for non-ambiguous designation of genetic elements is increasing. However, with biological molecules gaining importance through biotechnology, their functional and unambiguous designation is vital. Unfortunately, naming genes and proteins is not an easy task. In addition, the traditional concepts of bioinformatics are challenged with the appearance of proteins comprising different modules with amore » respective function in each module. This article highlights basic rules and novel solutions in designation recently used within the community of bacterial geneticists, and we discuss the present-day handling of gene and protein designations. As an example we will utilize a recent mischaracterization of gene nomenclature. We make suggestions for better handling of names in future literature as well as in databases and annotation projects. Our methodology emphasizes the hydrolytic function of multi-modular genes and extracellular proteins from bacteria.« less

  13. Multiple micro-predators controlling bacterial communities in the environment.

    PubMed

    Johnke, Julia; Cohen, Yossi; de Leeuw, Marina; Kushmaro, Ariel; Jurkevitch, Edouard; Chatzinotas, Antonis

    2014-06-01

    Predator-prey interactions are a main issue in ecological theory, including multispecies predator-prey relationships and intraguild predation. This knowledge is mainly based on the study of plants and animals, while its relevance for microorganisms is not well understood. The three key groups of micro-predators include protists, predatory bacteria and bacteriophages. They greatly differ in size, in prey specificity, in hunting strategies and in the resulting population dynamics. Yet, their potential to jointly control bacterial populations and reducing biomass in complex environments such as wastewater treatment plants is vast. Here, we present relevant ecological concepts and recent findings on micropredators, and propose that an integrative approach to predation at the microscale should be developed enabling the exploitation of this potential. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. The chromosomal organization of horizontal gene transfer in bacteria.

    PubMed

    Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

    2017-10-10

    Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

  15. Drivers of bacterial genomes plasticity and roles they play in pathogen virulence, persistence and drug resistance.

    PubMed

    Patel, Seema

    2016-11-01

    Despite the advent of next-generation sequencing (NGS) technologies, sophisticated data analysis and drug development efforts, bacterial drug resistance persists and is escalating in magnitude. To better control the pathogens, a thorough understanding of their genomic architecture and dynamics is vital. Bacterial genome is extremely complex, a mosaic of numerous co-operating and antagonizing components, altruistic and self-interested entities, behavior of which are predictable and conserved to some extent, yet largely dictated by an array of variables. In this regard, mobile genetic elements (MGE), DNA repair systems, post-segregation killing systems, toxin-antitoxin (TA) systems, restriction-modification (RM) systems etc. are dominant agents and horizontal gene transfer (HGT), gene redundancy, epigenetics, phase and antigenic variation etc. processes shape the genome. By illegitimate recombinations, deletions, insertions, duplications, amplifications, inversions, conversions, translocations, modification of intergenic regions and other alterations, bacterial genome is modified to tackle stressors like drugs, and host immune effectors. Over the years, thousands of studies have investigated this aspect and mammoth amount of insights have been accumulated. This review strives to distillate the existing information, formulate hypotheses and to suggest directions, that might contribute towards improved mitigation of the vicious pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Regulatory states in the developmental control of gene expression.

    PubMed

    Peter, Isabelle S

    2017-09-01

    A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Gene Expression of Lytic Endopeptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonads.

    PubMed

    Tsfasman, Irina M; Lapteva, Yulia S; Krasovskaya, Ludmila A; Kudryakova, Irina V; Vasilyeva, Natalia V; Granovsky, Igor E; Stepnaya, Olga A

    2015-01-01

    Development of an efficient expression system for (especially secreted) bacterial lytic enzymes is a complicated task due to the specificity of their action. The substrate for such enzymes is peptidoglycan, the main structural component of bacterial cell walls. For this reason, expression of recombinant lytic proteins is often accompanied with lysis of the producing bacterium. This paper presents data on the construction of an inducible system for expression of the lytic peptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonas fluorescens Q2-87, which provides for the successful secretion of these proteins into the culture liquid. In this system, the endopeptidase gene under control of the T7lac promoter was integrated into the bacterial chromosome, as well as the Escherichia coli lactose operon repressor protein gene. The T7 pol gene under lac promoter control, which encodes the phage T7 RNA polymerase, is maintained in Pseudomonas cells on the plasmids. Media and cultivation conditions for the recombinant strains were selected to enable the production of AlpA and AlpB by a simple purification protocol. Production of recombinant lytic enzymes should contribute to the development of new-generation antimicrobial drugs whose application will not be accompanied by selection of resistant microorganisms. © 2015 S. Karger AG, Basel.

  18. Combining Shigella Tn-seq data with gold-standard E. coli gene deletion data suggests rare transitions between essential and non-essential gene functionality.

    PubMed

    Freed, Nikki E; Bumann, Dirk; Silander, Olin K

    2016-09-06

    Gene essentiality - whether or not a gene is necessary for cell growth - is a fundamental component of gene function. It is not well established how quickly gene essentiality can change, as few studies have compared empirical measures of essentiality between closely related organisms. Here we present the results of a Tn-seq experiment designed to detect essential protein coding genes in the bacterial pathogen Shigella flexneri 2a 2457T on a genome-wide scale. Superficial analysis of this data suggested that 481 protein-coding genes in this Shigella strain are critical for robust cellular growth on rich media. Comparison of this set of genes with a gold-standard data set of essential genes in the closely related Escherichia coli K12 BW25113 revealed that an excessive number of genes appeared essential in Shigella but non-essential in E. coli. Importantly, and in converse to this comparison, we found no genes that were essential in E. coli and non-essential in Shigella, implying that many genes were artefactually inferred as essential in Shigella. Controlling for such artefacts resulted in a much smaller set of discrepant genes. Among these, we identified three sets of functionally related genes, two of which have previously been implicated as critical for Shigella growth, but which are dispensable for E. coli growth. The data presented here highlight the small number of protein coding genes for which we have strong evidence that their essentiality status differs between the closely related bacterial taxa E. coli and Shigella. A set of genes involved in acetate utilization provides a canonical example. These results leave open the possibility of developing strain-specific antibiotic treatments targeting such differentially essential genes, but suggest that such opportunities may be rare in closely related bacteria.

  19. Dietary and developmental shifts in butterfly-associated bacterial communities

    PubMed Central

    2018-01-01

    Bacterial communities associated with insects can substantially influence host ecology, evolution and behaviour. Host diet is a key factor that shapes bacterial communities, but the impact of dietary transitions across insect development is poorly understood. We analysed bacterial communities of 12 butterfly species across different developmental stages, using amplicon sequencing of the 16S rRNA gene. Butterfly larvae typically consume leaves of a single host plant, whereas adults are more generalist nectar feeders. Thus, we expected bacterial communities to vary substantially across butterfly development. Surprisingly, only few species showed significant dietary and developmental transitions in bacterial communities, suggesting weak impacts of dietary transitions across butterfly development. On the other hand, bacterial communities were strongly influenced by butterfly species and family identity, potentially due to dietary and physiological variation across the host phylogeny. Larvae of most butterfly species largely mirrored bacterial community composition of their diets, suggesting passive acquisition rather than active selection. Overall, our results suggest that although butterflies harbour distinct microbiomes across taxonomic groups and dietary guilds, the dramatic dietary shifts that occur during development do not impose strong selection to maintain distinct bacterial communities across all butterfly hosts. PMID:29892359

  20. Petroleum contamination and bioaugmentation in bacterial rhizosphere communities from Avicennia schaueriana.

    PubMed

    Dealtry, Simone; Ghizelini, Angela Michelato; Mendonça-Hagler, Leda C S; Chaloub, Ricardo Moreira; Reinert, Fernanda; Campos, Tácio M P de; Gomes, Newton C M; Smalla, Kornelia

    2018-06-01

    Anthropogenic activity, such as accidental oil spills, are typical sources of urban mangrove pollution that may affect mangrove bacterial communities as well as their mobile genetic elements. To evaluate remediation strategies, we followed over the time the effects of a petroleum hydrocarbon degrading consortium inoculated on mangrove tree Avicennia schaueriana against artificial petroleum contamination in a phytoremediation greenhouse experiment. Interestingly, despite plant protection due to the inoculation, denaturing gradient gel electrophoresis of the bacterial 16S rRNA gene fragments amplified from the total community DNA indicated that the different treatments did not significantly affect the bacterial community composition. However, while the bacterial community was rather stable, pronounced shifts were observed in the abundance of bacteria carrying plasmids. A PCR-Southern blot hybridization analysis indicated an increase in the abundance of IncP-9 catabolic plasmids. Denaturing gradient gel electrophoresis of naphthalene dioxygenase (ndo) genes amplified from cDNA (RNA) indicated the dominance of a specific ndo gene in the inoculated petroleum amendment treatment. The petroleum hydrocarbon degrading consortium characterization indicated the prevalence of bacteria assigned to Pseudomonas spp., Comamonas spp. and Ochrobactrum spp. IncP-9 plasmids were detected for the first time in Comamonas sp. and Ochrobactrum spp., which is a novelty of this study. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.