Sample records for copy integration events

  1. Enhanced single copy integration events in corn via particle bombardment using low quantities of DNA.


    Lowe, Brenda A; Shiva Prakash, N; Way, Melissa; Mann, Michael T; Spencer, T Michael; Boddupalli, Raghava S


    Transgene copy number is an important criterion for determining the utility of transgenic events. Single copy integration events are highly desirable when the objective is to produce marker free plants through segregation or when it is necessary to introgress different transgenes into commercial cultivars from different transgenic events. In contrast multi-copy events are advocated by several authors for higher expression of the transgene. Till recently, it was thought that employment of the particle gun for transformation results in the production of a high proportion of multi-copy events often with complex integration pattern when compared to Agrobacterium-mediated transformation. However, it has been demonstrated that usage of cassette DNA for bombardment in place of whole plasmids would result in simple insertion pattern of the transgenes. While investigating the effect of varying the cassette DNA amount on stable transformation, the frequency of occurrence of low copy events was observed to increase when lower doses of cassette DNA was employed for bombardment. Large scale experimentation with rigorous statistical analysis performed to verify the above observations employing Helium gun and the Electric discharge gun for gene delivery confirmed the above observations. Helium gun experiments involving production of more than 1,600 corn events consistently yielded single copy events at higher frequencies at lower cassette DNA load (46% at 2.5 ng/shot) as compared to higher cassette DNA load (29% at 25 ng/shot) across 18 independent experiments. Results were nearly identical with the Electric discharge particle gun device where single copy events were recovered at frequencies of 54% at 2.5 ng cassettes DNA per shot as compared to 18% at 25 ng cassette DNA per shot. The transformation frequency declined from 41 to 34% (Helium gun) and from 48 to 31% (Electric discharge gun) with reduction in cassette DNA quantity from 25 to 2.5 ng per shot. This reduction in the


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The present invention provides methods for producing a transgenic cell having a stably integrated, single copy of an exogenous polynucleotide sequence. The method, which resolves repeated insertions of the introduced polynucleotide sequence into a single copy, involves introducing into a genetic loc...

  3. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.


    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard


    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  4. Integrated Reproduction of Human Motion Components by Motion Copying System

    NASA Astrophysics Data System (ADS)

    Tsunashima, Noboru; Katsura, Seiichiro

    Currently, the development of leading-edge technology for recording and loading human motion on the basis of haptic information is required in the field of manufacturing and human support. Human movement is an assembly of motion components. Since human movements should be supported by a robot in real time, it is necessary to integrate the morion components, which were saved earlier. Once such motion integration is realized, future technology for use in daily human life is developed. This paper proposes the integrated reproduction of the decomposed components of human motion by using a motion copying system. This system is the key technology for the realization of the acquisition, saving and reproduction of the real-world haptic information. By the proposed method, it is possible not only to achieve expert skill acquisition, skill transfer to robots, and power assist for each motion component but also to open up new areas of applications.

  5. Strategies to improve low copy transgenic events in Agrobacterium-mediated transformation of maize.


    Sivamani, Elumalai; Li, Xianggan; Nalapalli, Samson; Barron, Yoshimi; Prairie, Anna; Bradley, David; Doyle, Michele; Que, Qiudeng


    Transgenic plants containing low copy transgene insertion free of vector backbone are highly desired for many biotechnological applications. We have investigated two different strategies for increasing the percentage of low copy events in Agrobacterium-mediated transformation experiments in maize. One of the strategies is to use a binary vector with two separate T-DNAs, one T-DNA containing an intact E.coli manA gene encoding phosphomannose isomerase (PMI) as selectable marker gene cassette and another T-DNA containing an RNAi cassette of PMI sequences. By using this strategy, low copy transgenic events containing the transgenes were increased from 43 to 60 % in maize. An alternate strategy is using selectable marker gene cassettes containing regulatory or coding sequences derived from essential plant genes such as 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) or MADS box transcription factor. In this paper we demonstrate that higher percentage of low copy transgenic events can be obtained in Agrobacterium-mediated maize transformation experiments using both strategies. We propose that the above two strategies can be used independently or in combination to increase transgenic events that contain low copy transgene insertion in Agrobacterium-mediated transformation experiments. PMID:26338266

  6. CONSERTING: integrating copy number analysis with structural variation detection

    PubMed Central

    Chen, Xiang; Gupta, Pankaj; Wang, Jianmin; Nakitandwe, Joy; Roberts, Kathryn; Dalton, James D.; Parker, Matthew; Patel, Samir; Holmfeldt, Linda; Payne, Debbie; Easton, John; Ma, Jing; Rusch, Michael; Wu, Gang; Patel, Aman; J. Baker, Suzanne; Dyer, Michael A.; Shurtleff, Sheila; Espy, Stephen; Pounds, Stanley; Downing, James R.; Ellison, David W.; Mullighan, Charles G.; Zhang, Jinghui


    We developed Copy Number Segmentation by Regression Tree in Next Generation Sequencing (CONSERTING), a novel algorithm for detecting somatic copy number alteration (CNA) using whole-genome sequencing (WGS) data. CONSERTING performs iterative analysis of segmentation by read depth change and localized structural variation detection, achieving high accuracy and sensitivity. Analysis of 43 pediatric and adult cancer genomes revealed novel oncogenic CNAs, complex re-arrangements and subclonal CNAs missed by alternative approaches. PMID:25938371

  7. Three Course Connections: Integrated Event Design

    ERIC Educational Resources Information Center

    Johnson, Corey W.; Pate, Joseph A.


    Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

  8. Integrating Events Across Levels of Consciousness

    PubMed Central

    Henke, Katharina; Reber, Thomas P.; Duss, Simone B.


    Our knowledge grows as we integrate events experienced at different points in time. We may or may not become aware of events, their integration, and their impact on our knowledge and decisions. But can we mentally integrate two events, if they are experienced at different time points and at different levels of consciousness? In this study, an event consisted of the presentation of two unrelated words. In the stream of events, half of events shared one component (“tree desk” … “desk fish”) to facilitate event integration. We manipulated the amount of time and trials that separated two corresponding events. The contents of one event were presented subliminally (invisible) and the contents of the corresponding overlapping event supraliminally (visible). Hence, event integration required the binding of contents between consciousness levels and between time points. At the final test of integration, participants judged whether two supraliminal test words (“tree fish”) fit together semantically or not. Unbeknown to participants, half of test words were episodically related through an overlap (“desk”; experimental condition) and half were not (control condition). Participants judged episodically related test words to be closer semantically than unrelated test words. This subjective decrease in the semantic distance between test words was both independent of whether the invisible event was encoded first or second in order and independent of the number of trials and the time that separated two corresponding events. Hence, conscious and unconscious memories were mentally integrated into a linked mnemonic representation. PMID:23785318

  9. Gene copy number variations in the leukocyte genome of hepatocellular carcinoma patients with integrated hepatitis B virus DNA

    PubMed Central

    Xu, Guixia; Cheng, Kai; Cao, Guangwen; Wu, Mengchao; Cheng, Shuqun; Liu, Shanrong


    Integration of hepatitis B virus (HBV) DNA into the human liver cell genome is believed to promote HBV-related carcinogenesis. This study aimed to quantify the integration of HBV DNA into the leukocyte genome in hepatocellular carcinoma (HCC) patients in order to identify potential biomarkers for HBV-related diseases. Whole-genome comparative genomic hybridization (CGH) chip array analyses were performed to screen gene copy number variations (CNV) in the leukocyte genome, and the results were confirmed by quantitative polymerase chain reaction (qPCR). The commonly detected regions included chromosome arms 19p, 5q, 1q and 15p, where 200 copy number gain events and 270 copy number loss events were noted. In particular, gains were observed in 5q35.3 (OR4F3) and 19p13.3 (OR4F17) in 90% of the samples. Successful homologous recombination of OR4F3 and the HBV P gene was demonstrated, and the amplification at 5q35.3 is potentially associated with the integration of HBV P gene into natural killer cells isolated from peripheral blood mononuclear cells (PBMCs). Receiver operating characteristic (ROC) curve analysis indicated that the combination of OR4F3 and OR4F17 a novel potential biomarker of HBV-related diseases. PMID:26769853

  10. Copy number and targeted mutational analysis reveals novel somatic events in metastatic prostate tumors.


    Robbins, Christiane M; Tembe, Waibov A; Baker, Angela; Sinari, Shripad; Moses, Tracy Y; Beckstrom-Sternberg, Stephen; Beckstrom-Sternberg, James; Barrett, Michael; Long, James; Chinnaiyan, Arul; Lowey, James; Suh, Edward; Pearson, John V; Craig, David W; Agus, David B; Pienta, Kenneth J; Carpten, John D


    Advanced prostate cancer can progress to systemic metastatic tumors, which are generally androgen insensitive and ultimately lethal. Here, we report a comprehensive genomic survey for somatic events in systemic metastatic prostate tumors using both high-resolution copy number analysis and targeted mutational survey of 3508 exons from 577 cancer-related genes using next generation sequencing. Focal homozygous deletions were detected at 8p22, 10q23.31, 13q13.1, 13q14.11, and 13q14.12. Key genes mapping within these deleted regions include PTEN, BRCA2, C13ORF15, and SIAH3. Focal high-level amplifications were detected at 5p13.2-p12, 14q21.1, 7q22.1, and Xq12. Key amplified genes mapping within these regions include SKP2, FOXA1, and AR. Furthermore, targeted mutational analysis of normal-tumor pairs has identified somatic mutations in genes known to be associated with prostate cancer including AR and TP53, but has also revealed novel somatic point mutations in genes including MTOR, BRCA2, ARHGEF12, and CHD5. Finally, in one patient where multiple independent metastatic tumors were available, we show common and divergent somatic alterations that occur at both the copy number and point mutation level, supporting a model for a common clonal progenitor with metastatic tumor-specific divergence. Our study represents a deep genomic analysis of advanced metastatic prostate tumors and has revealed candidate somatic alterations, possibly contributing to lethal prostate cancer. PMID:21147910

  11. Copy number and targeted mutational analysis reveals novel somatic events in metastatic prostate tumors

    PubMed Central

    Robbins, Christiane M.; Tembe, Waibov A.; Baker, Angela; Sinari, Shripad; Moses, Tracy Y.; Beckstrom-Sternberg, Stephen; Beckstrom-Sternberg, James; Barrett, Michael; Long, James; Chinnaiyan, Arul; Lowey, James; Suh, Edward; Pearson, John V.; Craig, David W.; Agus, David B.; Pienta, Kenneth J.; Carpten, John D.


    Advanced prostate cancer can progress to systemic metastatic tumors, which are generally androgen insensitive and ultimately lethal. Here, we report a comprehensive genomic survey for somatic events in systemic metastatic prostate tumors using both high-resolution copy number analysis and targeted mutational survey of 3508 exons from 577 cancer-related genes using next generation sequencing. Focal homozygous deletions were detected at 8p22, 10q23.31, 13q13.1, 13q14.11, and 13q14.12. Key genes mapping within these deleted regions include PTEN, BRCA2, C13ORF15, and SIAH3. Focal high-level amplifications were detected at 5p13.2-p12, 14q21.1, 7q22.1, and Xq12. Key amplified genes mapping within these regions include SKP2, FOXA1, and AR. Furthermore, targeted mutational analysis of normal-tumor pairs has identified somatic mutations in genes known to be associated with prostate cancer including AR and TP53, but has also revealed novel somatic point mutations in genes including MTOR, BRCA2, ARHGEF12, and CHD5. Finally, in one patient where multiple independent metastatic tumors were available, we show common and divergent somatic alterations that occur at both the copy number and point mutation level, supporting a model for a common clonal progenitor with metastatic tumor-specific divergence. Our study represents a deep genomic analysis of advanced metastatic prostate tumors and has revealed candidate somatic alterations, possibly contributing to lethal prostate cancer. PMID:21147910

  12. TAGCNA: a method to identify significant consensus events of copy number alterations in cancer.


    Yuan, Xiguo; Zhang, Junying; Yang, Liying; Zhang, Shengli; Chen, Baodi; Geng, Yaojun; Wang, Yue


    Somatic copy number alteration (CNA) is a common phenomenon in cancer genome. Distinguishing significant consensus events (SCEs) from random background CNAs in a set of subjects has been proven to be a valuable tool to study cancer. In order to identify SCEs with an acceptable type I error rate, better computational approaches should be developed based on reasonable statistics and null distributions. In this article, we propose a new approach named TAGCNA for identifying SCEs in somatic CNAs that may encompass cancer driver genes. TAGCNA employs a peel-off permutation scheme to generate a reasonable null distribution based on a prior step of selecting tag CNA markers from the genome being considered. We demonstrate the statistical power of TAGCNA on simulated ground truth data, and validate its applicability using two publicly available cancer datasets: lung and prostate adenocarcinoma. TAGCNA identifies SCEs that are known to be involved with proto-oncogenes (e.g. EGFR, CDK4) and tumor suppressor genes (e.g. CDKN2A, CDKN2B), and provides many additional SCEs with potential biological relevance in these data. TAGCNA can be used to analyze the significance of CNAs in various cancers. It is implemented in R and is freely available at PMID:22815924

  13. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans.

    PubMed Central

    Praitis, V; Casey, E; Collar, D; Austin, J


    In Caenorhabditis elegans, transgenic lines are typically created by injecting DNA into the hermaphrodite germline to form multicopy extrachromosomal DNA arrays. This technique is a reliable means of expressing transgenes in C. elegans, but its use has limitations. Because extrachromosomal arrays are semistable, only a fraction of the animals in a transgenic extrachromosomal array line are transformed. In addition, because extrachromosomal arrays can contain hundreds of copies of the transforming DNA, transgenes may be overexpressed, misexpressed, or silenced. We have developed an alternative method for C. elegans transformation, using microparticle bombardment, that produces single- and low-copy chromosomal insertions. Using this method, we find that it is possible to create integrated transgenic lines that reproducibly express GFP reporter constructs without the variations in expression level and pattern frequently exhibited by extrachromosomal array lines. In addition, we find that low-copy integrated lines can also be used to express transgenes in the C. elegans germline, where conventional extrachromosomal arrays typically fail to express due to germline silencing. PMID:11238406

  14. Integrative Analysis of Transcriptional Regulatory Network and Copy Number Variation in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Li, Ling; Lian, Baofeng; Li, Chao; Li, Wei; Li, Jing; Zhang, Yuannv; He, Xianghuo; Li, Yixue; Xie, Lu


    Background Transcriptional regulatory network (TRN) is used to study conditional regulatory relationships between transcriptional factors and genes. However few studies have tried to integrate genomic variation information such as copy number variation (CNV) with TRN to find causal disturbances in a network. Intrahepatic cholangiocarcinoma (ICC) is the second most common hepatic carcinoma with high malignancy and poor prognosis. Research about ICC is relatively limited comparing to hepatocellular carcinoma, and there are no approved gene therapeutic targets yet. Method We first constructed TRN of ICC (ICC-TRN) using forward-and-reverse combined engineering method, and then integrated copy number variation information with ICC-TRN to select CNV-related modules and constructed CNV-ICC-TRN. We also integrated CNV-ICC-TRN with KEGG signaling pathways to investigate how CNV genes disturb signaling pathways. At last, unsupervised clustering method was applied to classify samples into distinct classes. Result We obtained CNV-ICC-TRN containing 33 modules which were enriched in ICC-related signaling pathways. Integrated analysis of the regulatory network and signaling pathways illustrated that CNV might interrupt signaling through locating on either genomic sites of nodes or regulators of nodes in a signaling pathway. In the end, expression profiles of nodes in CNV-ICC-TRN were used to cluster the ICC patients into two robust groups with distinct biological function features. Conclusion Our work represents a primary effort to construct TRN in ICC, also a primary effort to try to identify key transcriptional modules based on their involvement of genetic variations shown by gene copy number variations (CNV). This kind of approach may bring the traditional studies of TRN based only on expression data one step further to genetic disturbance. Such kind of approach can easily be extended to other disease samples with appropriate data. PMID:24897108

  15. Integrated Historical Tsunami Event and Deposit Database

    NASA Astrophysics Data System (ADS)

    Dunbar, P. K.; McCullough, H. L.


    The National Geophysical Data Center (NGDC) provides integrated access to historical tsunami event, deposit, and proxy data. The NGDC tsunami archive initially listed tsunami sources and locations with observed tsunami effects. Tsunami frequency and intensity are important for understanding tsunami hazards. Unfortunately, tsunami recurrence intervals often exceed the historic record. As a result, NGDC expanded the archive to include the Global Tsunami Deposits Database (GTD_DB). Tsunami deposits are the physical evidence left behind when a tsunami impacts a shoreline or affects submarine sediments. Proxies include co-seismic subsidence, turbidite deposits, changes in biota following an influx of marine water in a freshwater environment, etc. By adding past tsunami data inferred from the geologic record, the GTD_DB extends the record of tsunamis backward in time. Although the best methods for identifying tsunami deposits and proxies in the geologic record remain under discussion, developing an overall picture of where tsunamis have affected coasts, calculating recurrence intervals, and approximating runup height and inundation distance provides a better estimate of a region’s true tsunami hazard. Tsunami deposit and proxy descriptions in the GTD_DB were compiled from published data found in journal articles, conference proceedings, theses, books, conference abstracts, posters, web sites, etc. The database now includes over 1,200 descriptions compiled from over 1,100 citations. Each record in the GTD_DB is linked to its bibliographic citation where more information on the deposit can be found. The GTD_DB includes data for over 50 variables such as: event description (e.g., 2010 Chile Tsunami), geologic time period, year, deposit location name, latitude, longitude, country, associated body of water, setting during the event (e.g., beach, lake, river, deep sea), upper and lower contacts, underlying and overlying material, etc. If known, the tsunami source mechanism

  16. Inverse PCR and Quantitative PCR as Alternative Methods to Southern Blotting Analysis to Assess Transgene Copy Number and Characterize the Integration Site in Transgenic Woody Plants.


    Stefano, Biricolti; Patrizia, Bogani; Matteo, Cerboneschi; Massimo, Gori


    One of the major unanswered questions with respect to the commercial use of genetic transformation in woody plants is the stability of the transgene expression over several decades within the same individual. Gene expression is strongly affected by the copy number which has been integrated into the plant genome and by the local DNA features close to the integration sites. Because woody plants cannot be subjected to selfing or backcrossing to modify the transgenic allelic structure without affecting the valuable traits of the cultivar, molecular characterization of the transformation event is therefore crucial. After assessing the transgene copy number of a set of apple transgenic clones with Southern blotting, we describe two alternative methods: the first is based on inverse PCR (i-PCR) and the second on the quantitative PCR (q-PCR). The methods produced comparable results with the exception of the data regarding a high copy number clone, but while the q-PCR-based system is rapid and easily adaptable to high throughput systems, the i-PCR-based method can provide information regarding the transformation event and the characteristics of the sequences flanking the transgenic construct. PMID:26895172

  17. Integrated analysis of copy number and loss of heterozygosity in primary breast carcinomas using high-density SNP array.


    Ching, Ho Ching; Naidu, Rakesh; Seong, Mun Kein; Har, Yip Cheng; Taib, Nur Aishah Mohd


    Breast cancer is a heterogeneous disease, marked by extensive chromosomal aberrations. In this study, we aimed to explicate the underlying chromosomal copy number (CN) alterations and loss of heterozygosity (LOH) implicated in a cohort of Malaysian hospital-based primary breast carcinoma samples using a single nucleotide polymorphism (SNP) array platform. The analysis was conducted by hybridizing the extracted DNA of 70 primary breast carcinomas and 37 normal peripheral blood samples to the Affymetrix 250K Sty SNP arrays. Locus-specific CN aberrations and LOH were statistically summarized using the binary segmentation algorithm and hidden Markov model. Selected genes from the SNP array analysis were also validated using quantitative real-time PCR. The merging of CN and LOH data fabricated distinctive integrated alteration profiles, which were comprised of finely demarcated minimal sites of aberrations. The most prevalent gains (≥ 30%) were detected at the 8q arm: 8q23.1, 8q23.3, 8q24.11, 8q24.13, 8q24.21, 8q24.22, 8q24.23 and 8q24.3, whilst the most ubiquitous losses (≥ 20%) were noted at the 8p12, 8p21.1, 8p21.2, 8p21.1-p21.2, 8p21.3, 8p22, 8p23.1, 8p23.1‑p23.2, 8p23.3, 17p11.2, 17p12, 17p11.2-p12, 17p13.1 and 17p13.2 regions. Copy-neutral LOH was characterized as the most prevailing LOH event, in which the most frequent distributions (≥ 30%) were revealed at 3p21.31, 5q33.2, 12q24.12, 12q24.12‑q24.13 and 14q23.1. These findings offer compre-hensive genome-wide views on breast cancer genomic changes, where the most recurrent gain, loss and copy-neutral LOH events were harboured within the 8q24.21, 8p21.1 and 14q23.1 loci, respectively. This will facilitate the uncovering of true driver genes pertinent to breast cancer biology and the develop-ment of prospective therapeutics. PMID:21687935

  18. High-level expression and characterization of a novel serine protease in Pichia pastoris by multi-copy integration.


    Shu, Min; Shen, Wei; Yang, Shihui; Wang, Xiaojuan; Wang, Fei; Wang, Yaping; Ma, Lixin


    A novel serine protease from Trichoderma koningii (SPTK) was synthesized and expressed in Pichia pastoris. The recombinant SPTK was completely inhibited by phenyl methyl sulfonyl fluoride (PMSF), suggesting that SPTK belonged to the subgroup of serine proteases. The optimum pH and temperature for the recombinant SPTK reaction were 6.0 and 55°C, respectively. SPTK performed a tolerance to most organic solvents and metal ions, and the addition of Triton X-100 exhibited an activation of SPTK up to 243% of its initial activity but SDS strongly inhibited. Moreover, our study showed that a portion of SPTK was N-glycosylated during fermentation. The activity and thermal stability of the recombinant SPTK were improved after the removal of glycosylation, and the N-glycosylation of SPTK could be efficiently removed through co-culture with P. pastoris strains expressing Endo-β-N-acetylglucosaminidase H. We constructed expression vectors harboring from one to four repeats of Sptk-expressing cassettes via an in vitro BioBrick assembly approach. And the result of quantitative polymerase chain reaction (qPCR) indicated that the tandem expression cassettes were integrated into the genome of P. pastoris through a single recombination event. These strains were used to study the correlation between the gene copy number and the expression level of SPTK. The results of qPCR and enzyme activity assays indicated that the copy number variation of Sptk gene generally had a positive effect on the expression level of SPTK, while an increase in integration of target gene did not guarantee its high expression. The maximum yield and specific activity of SPTK in P. pastoris were obtained from the recombinant yeast strain harboring two-copy tandem Sptk-expressing cassettes, the yield reached 0.48g/l after a 6-d induction using menthol in shake flasks and 3.2g/l in high-density fermentation with specific activity of 5200U/mg. In addition, the recombinant SPTK could efficiently degrade chicken

  19. An integrative segmentation method for detecting germline copy number variations in SNP arrays.


    Shi, Jianxin; Li, Peng


    Germline copy number variations (CNVs) are a major source of genetic variation in humans. In large-scale studies of complex diseases, CNVs are usually detected from data generated by single nucleotide polymorphism (SNP) genotyping arrays. In this paper, we develop an integrative segmentation method, SegCNV, for detecting CNVs integrating both log R ratio (LRR) and B allele frequency (BAF). Based on simulation studies, SegCNV had modestly better power to detect deletions and substantially better power to detect duplications compared with circular binary segmentation (CBS) that relies purely on LRRs; and it had better power to detect deletions and a comparable performance to detect duplications compared with PennCNV and QuantiSNP. In two Hapmap subjects with deep sequence data available as a gold standard, SegCNV detected more true short deletions than PennCNV and QuantiSNP. For 21 short duplications validated experimentally in the AGRE dataset, SegCNV, QuantiSNP, and PennCNV detected all of them while CBS detected only three. SegCNV is much faster than the HMM-based (where HMM is hidden Markov model) methods, taking only several seconds to analyze genome-wide data for one subject. PMID:22539397

  20. Integrated small copy number variations and epigenome maps of disorders of sex development

    PubMed Central

    Amarillo, Ina E; Nievera, Isabelle; Hagan, Andrew; Huchthagowder, Vishwa; Heeley, Jennifer; Hollander, Abby; Koenig, Joel; Austin, Paul; Wang, Ting


    Small copy number variations (CNVs) have typically not been analyzed or reported in clinical settings and hence have remained underrepresented in databases and the literature. Here, we focused our investigations on these small CNVs using chromosome microarray analysis (CMA) data previously obtained from patients with atypical characteristics or disorders of sex development (DSD). Using our customized CMA track targeting 334 genes involved in the development of urogenital and reproductive structures and a less stringent analysis filter, we uncovered small genes with recurrent and overlapping CNVs as small as 1 kb, and small regions of homozygosity (ROHs), imprinting and position effects. Detailed analysis of these high-resolution data revealed CNVs and ROHs involving structural and functional domains, repeat elements, active transcription sites and regulatory regions. Integration of these genomic data with DNA methylation, histone modification and predicted RNA expression profiles in normal testes and ovaries suggested spatiotemporal and tissue-specific gene regulation. This study emphasized a DSD-specific and gene-targeted CMA approach that uncovered previously unanalyzed or unreported small genes and CNVs, contributing to the growing resources on small CNVs and facilitating the narrowing of the genomic gap for identifying candidate genes or regions. This high-resolution analysis tool could improve the diagnostic utility of CMA, not only in patients with DSD but also in other clinical populations. These integrated data provided a better genomic-epigenomic landscape of DSD and greater opportunities for downstream research. PMID:27340555

  1. Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

    PubMed Central

    Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.


    Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

  2. Ploidy status and copy number aberrations in primary glioblastomas defined by integrated analysis of allelic ratios, signal ratios and loss of heterozygosity using 500K SNP Mapping Arrays

    PubMed Central

    Gardina, Paul J; Lo, Ken C; Lee, Walter; Cowell, John K; Turpaz, Yaron


    Background Genomic hybridization platforms, including BAC-CGH and genotyping arrays, have been used to estimate chromosome copy number (CN) in tumor samples by detecting the relative strength of genomic signal. The methods rely on the assumption that the predominant chromosomal background of the samples is diploid, an assumption that is frequently incorrect for tumor samples. In addition to generally greater resolution, an advantage of genotyping arrays over CGH arrays is the ability to detect signals from individual alleles, allowing estimation of loss-of-heterozygosity (LOH) and allelic ratios to enhance the interpretation of copy number alterations. Copy number events associated with LOH potentially have the same genetic consequences as deletions. Results We have utilized allelic ratios to detect patterns that are indicative of higher ploidy levels. An integrated analysis using allelic ratios, total signal and LOH indicates that many or most of the chromosomes from 24 glioblastoma tumors are in fact aneuploid. Some putative whole-chromosome losses actually represent trisomy, and many apparent sub-chromosomal losses are in fact relative losses against a triploid or tetraploid background. Conclusion These results suggest a re-interpretation of previous findings based only on total signal ratios. One interesting observation is that many single or multiple-copy deletions occur at common putative tumor suppressor sites subsequent to chromosomal duplication; these losses do not necessarily result in LOH, but nonetheless occur in conspicuous patterns. The 500 K Mapping array was also capable of detecting many sub-mega base losses and gains that were overlooked by CGH-BAC arrays, and was superior to CGH-BAC arrays in resolving regions of complex CN variation. PMID:18928532

  3. Single Event Transients in Linear Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Buchner, Stephen; McMorrow, Dale


    On November 5, 2001, a processor reset occurred on board the Microwave Anisotropy Probe (MAP), a NASA mission to measure the anisotropy of the microwave radiation left over from the Big Bang. The reset caused the spacecraft to enter a safehold mode from which it took several days to recover. Were that to happen regularly, the entire mission would be compromised, so it was important to find the cause of the reset and, if possible, to mitigate it. NASA assembled a team of engineers that included experts in radiation effects to tackle the problem. The first clue was the observation that the processor reset occurred during a solar event characterized by large increases in the proton and heavy ion fluxes emitted by the sun. To the radiation effects engineers on the team, this strongly suggested that particle radiation might be the culprit, particularly when it was discovered that the reset circuit contained three voltage comparators (LM139). Previous testing revealed that large voltage transients, or glitches appeared at the output of the LM139 when it was exposed to a beam of heavy ions [NI96]. The function of the reset circuit was to monitor the supply voltage and to issue a reset command to the processor should the voltage fall below a reference of 2.5 V [PO02]. Eventually, the team of engineers concluded that ionizing particle radiation from the solar event produced a negative voltage transient on the output of one of the LM139s sufficiently large to reset the processor on MAP. Fortunately, as of the end of 2004, only two such resets have occurred. The reset on MAP was not the first malfunction on a spacecraft attributed to a transient. That occurred shortly after the launch of NASA s TOPEX/Poseidon satellite in 1992. It was suspected, and later confirmed, that an anomaly in the Earth Sensor was caused by a transient in an operational amplifier (OP-15) [KO93]. Over the next few years, problems on TDRS, CASSINI, [PR02] SOHO [HA99,HA01] and TERRA were also attributed

  4. Copy-neutral loss of heterozygosity is prevalent and a late event in the pathogenesis of FLT3/ITD AML.


    Stirewalt, D L; Pogosova-Agadjanyan, E L; Tsuchiya, K; Joaquin, J; Meshinchi, S


    Patients with high FLT3 internal tandem duplication allelic ratios (FLT3/ITD-ARs) have a poor prognosis. Single-nucleotide polymorphism/comparative genomic hybridization, single-cell PCR and colony-forming assays were used to evaluate genotypic evolution of high FLT3/ITD-ARs in 85 acute myeloid leukemia (AML) patients. Microarrays were used to examine molecular pathways disrupted in leukemic blasts with high FLT3/ITD-ARs. Copy-neutral loss of heterozygosity (CN-LOH) was identified at the FLT3 locus in diagnostic samples with high FLT3/ITD-ARs (N=11), but not in samples with low FLT3/ITD-ARs (N=24), FLT3-activating loop mutations (N=11) or wild-type FLT3 (N=39). Single-cell assays showed that homozygous FLT3/ITD genotype was present in subsets of leukemic blasts at diagnosis but became the dominant clone at relapse. Less differentiated CD34(+)/CD33(-) progenitor colonies were heterozygous for FLT3/ITD, whereas more differentiated CD34(+)/CD33(+) progenitor colonies were homozygous for FLT3/ITD. Expression profiling revealed that samples harboring high FLT3/ITD-ARs aberrantly expressed genes within the recombination/DNA repair pathway. Thus, the development of CN-LOH at the FLT3 locus, which results in high FLT3/ITD-ARs, likely represents a late genomic event that occurs after the acquisition of the FLT3/ITD. Although the etiology underlying the development of CN-LOH remains to be clarified, the disruption in recombination/DNA repair pathway, which is present before the development of LOH, may have a role. PMID:24786392

  5. Copy-neutral loss of heterozygosity is prevalent and a late event in the pathogenesis of FLT3/ITD AML

    PubMed Central

    Stirewalt, D L; Pogosova-Agadjanyan, E L; Tsuchiya, K; Joaquin, J; Meshinchi, S


    Patients with high FLT3 internal tandem duplication allelic ratios (FLT3/ITD-ARs) have a poor prognosis. Single-nucleotide polymorphism/comparative genomic hybridization, single-cell PCR and colony-forming assays were used to evaluate genotypic evolution of high FLT3/ITD-ARs in 85 acute myeloid leukemia (AML) patients. Microarrays were used to examine molecular pathways disrupted in leukemic blasts with high FLT3/ITD-ARs. Copy-neutral loss of heterozygosity (CN-LOH) was identified at the FLT3 locus in diagnostic samples with high FLT3/ITD-ARs (N=11), but not in samples with low FLT3/ITD-ARs (N=24), FLT3-activating loop mutations (N=11) or wild-type FLT3 (N=39). Single-cell assays showed that homozygous FLT3/ITD genotype was present in subsets of leukemic blasts at diagnosis but became the dominant clone at relapse. Less differentiated CD34+/CD33− progenitor colonies were heterozygous for FLT3/ITD, whereas more differentiated CD34+/CD33+ progenitor colonies were homozygous for FLT3/ITD. Expression profiling revealed that samples harboring high FLT3/ITD-ARs aberrantly expressed genes within the recombination/DNA repair pathway. Thus, the development of CN-LOH at the FLT3 locus, which results in high FLT3/ITD-ARs, likely represents a late genomic event that occurs after the acquisition of the FLT3/ITD. Although the etiology underlying the development of CN-LOH remains to be clarified, the disruption in recombination/DNA repair pathway, which is present before the development of LOH, may have a role. PMID:24786392

  6. Event-driven neural integration and synchronicity in analog VLSI.


    Yu, Theodore; Park, Jongkil; Joshi, Siddharth; Maier, Christoph; Cauwenberghs, Gert


    Synchrony and temporal coding in the central nervous system, as the source of local field potentials and complex neural dynamics, arises from precise timing relationships between spike action population events across neuronal assemblies. Recently it has been shown that coincidence detection based on spike event timing also presents a robust neural code invariant to additive incoherent noise from desynchronized and unrelated inputs. We present spike-based coincidence detection using integrate-and-fire neural membrane dynamics along with pooled conductance-based synaptic dynamics in a hierarchical address-event architecture. Within this architecture, we encode each synaptic event with parameters that govern synaptic connectivity, synaptic strength, and axonal delay with additional global configurable parameters that govern neural and synaptic temporal dynamics. Spike-based coincidence detection is observed and analyzed in measurements on a log-domain analog VLSI implementation of the integrate-and-fire neuron and conductance-based synapse dynamics. PMID:23366007

  7. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.


    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt


    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

  8. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development.


    Kumar, Rachana A; Oldenburg, Delene J; Bendich, Arnold J


    The amount and structural integrity of organellar DNAs change during plant development, although the mechanisms of change are poorly understood. Using PCR-based methods, we quantified DNA damage, molecular integrity, and genome copy number for plastid and mitochondrial DNAs of maize seedlings. A DNA repair assay was also used to assess DNA impediments. During development, DNA damage increased and molecules with impediments that prevented amplification by Taq DNA polymerase increased, with light causing the greatest change. DNA copy number values depended on the assay method, with standard real-time quantitative PCR (qPCR) values exceeding those determined by long-PCR by 100- to 1000-fold. As the organelles develop, their DNAs may be damaged in oxidative environments created by photo-oxidative reactions and photosynthetic/respiratory electron transfer. Some molecules may be repaired, while molecules with unrepaired damage may be degraded to non-functional fragments measured by standard qPCR but not by long-PCR. PMID:25261192

  9. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development

    PubMed Central

    Kumar, Rachana A.; Oldenburg, Delene J.; Bendich, Arnold J.


    The amount and structural integrity of organellar DNAs change during plant development, although the mechanisms of change are poorly understood. Using PCR-based methods, we quantified DNA damage, molecular integrity, and genome copy number for plastid and mitochondrial DNAs of maize seedlings. A DNA repair assay was also used to assess DNA impediments. During development, DNA damage increased and molecules with impediments that prevented amplification by Taq DNA polymerase increased, with light causing the greatest change. DNA copy number values depended on the assay method, with standard real-time quantitative PCR (qPCR) values exceeding those determined by long-PCR by 100- to 1000-fold. As the organelles develop, their DNAs may be damaged in oxidative environments created by photo-oxidative reactions and photosynthetic/respiratory electron transfer. Some molecules may be repaired, while molecules with unrepaired damage may be degraded to non-functional fragments measured by standard qPCR but not by long-PCR. PMID:25261192

  10. The Influence of Sourcing and Relatedness on Event Integration

    ERIC Educational Resources Information Center

    Kim, Hyun-Jeong Joyce; Millis, Keith


    This study investigated the influence of sourcing and relatedness on the integration of events embedded in simple stories. Participants read pairs of "breaking news stories" from either 1 or 2 news agencies that were believed to be from the Internet. The stories within each pair were either related by virtue of shared situational dimensions (e.g.,…

  11. Discretely Integrated Condition Event (DICE) Simulation for Pharmacoeconomics.


    Caro, J Jaime


    Several decision-analytic modeling techniques are in use for pharmacoeconomic analyses. Discretely integrated condition event (DICE) simulation is proposed as a unifying approach that has been deliberately designed to meet the modeling requirements in a straightforward transparent way, without forcing assumptions (e.g., only one transition per cycle) or unnecessary complexity. At the core of DICE are conditions that represent aspects that persist over time. They have levels that can change and many may coexist. Events reflect instantaneous occurrences that may modify some conditions or the timing of other events. The conditions are discretely integrated with events by updating their levels at those times. Profiles of determinant values allow for differences among patients in the predictors of the disease course. Any number of valuations (e.g., utility, cost, willingness-to-pay) of conditions and events can be applied concurrently in a single run. A DICE model is conveniently specified in a series of tables that follow a consistent format and the simulation can be implemented fully in MS Excel, facilitating review and validation. DICE incorporates both state-transition (Markov) models and non-resource-constrained discrete event simulation in a single formulation; it can be executed as a cohort or a microsimulation; and deterministically or stochastically. PMID:26961779

  12. Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study

    PubMed Central

    Ross-Adams, H.; Lamb, A.D.; Dunning, M.J.; Halim, S.; Lindberg, J.; Massie, C.M.; Egevad, L.A.; Russell, R.; Ramos-Montoya, A.; Vowler, S.L.; Sharma, N.L.; Kay, J.; Whitaker, H.; Clark, J.; Hurst, R.; Gnanapragasam, V.J.; Shah, N.C.; Warren, A.Y.; Cooper, C.S.; Lynch, A.G.; Stark, R.; Mills, I.G.; Grönberg, H.; Neal, D.E.


    Background Understanding the heterogeneous genotypes and phenotypes of prostate cancer is fundamental to improving the way we treat this disease. As yet, there are no validated descriptions of prostate cancer subgroups derived from integrated genomics linked with clinical outcome. Methods In a study of 482 tumour, benign and germline samples from 259 men with primary prostate cancer, we used integrative analysis of copy number alterations (CNA) and array transcriptomics to identify genomic loci that affect expression levels of mRNA in an expression quantitative trait loci (eQTL) approach, to stratify patients into subgroups that we then associated with future clinical behaviour, and compared with either CNA or transcriptomics alone. Findings We identified five separate patient subgroups with distinct genomic alterations and expression profiles based on 100 discriminating genes in our separate discovery and validation sets of 125 and 103 men. These subgroups were able to consistently predict biochemical relapse (p = 0.0017 and p = 0.016 respectively) and were further validated in a third cohort with long-term follow-up (p = 0.027). We show the relative contributions of gene expression and copy number data on phenotype, and demonstrate the improved power gained from integrative analyses. We confirm alterations in six genes previously associated with prostate cancer (MAP3K7, MELK, RCBTB2, ELAC2, TPD52, ZBTB4), and also identify 94 genes not previously linked to prostate cancer progression that would not have been detected using either transcript or copy number data alone. We confirm a number of previously published molecular changes associated with high risk disease, including MYC amplification, and NKX3-1, RB1 and PTEN deletions, as well as over-expression of PCA3 and AMACR, and loss of MSMB in tumour tissue. A subset of the 100 genes outperforms established clinical predictors of poor prognosis (PSA, Gleason score), as well as previously published gene

  13. Single event soft error in advanced integrated circuit

    NASA Astrophysics Data System (ADS)

    Yuanfu, Zhao; Suge, Yue; Xinyuan, Zhao; Shijin, Lu; Qiang, Bian; Liang, Wang; Yongshu, Sun


    As technology feature size decreases, single event upset (SEU), and single event transient (SET) dominate the radiation response of microcircuits. Multiple bit upset (MBU) (or multi cell upset) effects, digital single event transient (DSET) and analogue single event transient (ASET) cause serious problems for advanced integrated circuits (ICs) applied in a radiation environment and have become a pressing issue. To face this challenge, a lot of work has been put into the single event soft error mechanism and mitigation schemes. This paper presents a review of SEU and SET, including: a brief historical overview, which summarizes the historical development of the SEU and SET since their first observation in the 1970's; effects prominent in advanced technology, which reviews the effects such as MBU, MSET as well as SET broadening and quenching with the influence of temperature, device structure etc.; the present understanding of single event soft error mechanisms, which review the basic mechanism of single event generation including various component of charge collection; and a discussion of various SEU and SET mitigation schemes divided as circuit hardening and layout hardening that could help the designer meet his goals.

  14. An integrated approach to reveal miRNAs' impacts on the functional consequence of copy number alterations in cancer.


    Li, Kening; Liu, Yongjing; Zhou, Yuanshuai; Zhang, Rui; Zhao, Ning; Yan, Zichuang; Zhang, Qiang; Zhang, Shujuan; Qiu, Fujun; Xu, Yan


    Copy number alteration (CNA) is known to induce gene expression changes mainly through dosage effect, and therefore affect the initiation and progression of tumor. However, tumor samples exhibit heterogeneity in gene dosage sensitivity due to the complicated mechanisms of transcriptional regulation. Currently, no high-throughput method has been available for identifying the regulatory factors affecting the functional consequences of CNA, and determining their effects on cancer. In view of the important regulatory role of miRNA, we investigated the influence of miRNAs on the dosage sensitivities of genes within the CNA regions. By integrating copy number, mRNA expression, miRNA expression profiles of three kinds of cancer, we observed a tendency for high dosage-sensitivity genes to be more targeted by miRNAs in cancer, and identified the miRNAs regulating the dosage sensitivity of amplified/deleted target genes. The results show that miRNAs can modulate oncogenic biological functions by regulating the genes within the CNA regions, and thus play a role as a trigger or balancer in cancer, affecting cancer processes, even survival. This work provided a framework for analyzing the regulation of dosage effect, which will shed a light on understanding the oncogenic and tumor suppressive mechanisms of CNA. Besides, new cancer-related miRNAs were identified. PMID:26099552

  15. Integrated genomic analyses identify frequent gene fusion events and VHL inactivation in gastrointestinal stromal tumors

    PubMed Central

    Sun, Choong-Hyun; Park, Inho; Lee, Seungmook; Kwon, Jekeun; Do, Ingu; Hong, Min Eui; Van Vrancken, Michael; Lee, Jeeyun; Park, Joon Oh; Cho, Jeonghee; Kim, Kyoung-Mee; Sohn, Tae Sung


    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. We sequenced nine exomes and transcriptomes, and two genomes of GISTs for integrated analyses. We detected 306 somatic variants in nine GISTs and recurrent protein-altering mutations in 29 genes. Transcriptome sequencing revealed 328 gene fusions, and the most frequently involved fusion events were associated with IGF2 fused to several partner genes including CCND1, FUS, and LASP1. We additionally identified three recurrent read-through fusion transcripts: POLA2-CDC42EP2, C8orf42-FBXO25, and STX16-NPEPL1. Notably, we found intragenic deletions in one of three exons of the VHL gene and increased mRNAs of VEGF, PDGF-β, and IGF-1/2 in 56% of GISTs, suggesting a mechanistic link between VHL inactivation and overexpression of hypoxia-inducible factor target genes in the absence of hypoxia. We also identified copy number gain and increased mRNA expression of AMACR, CRIM1, SKP2, and CACNA1E. Mapping of copy number and gene expression results to the KEGG pathways revealed activation of the JAK-STAT pathway in small intestinal GISTs and the MAPK pathway in wild-type GISTs. These observations will allow us to determine the genetic basis of GISTs and will facilitate further investigation to develop new therapeutic options. PMID:25987131

  16. Multiple proviral integration events after virological synapse-mediated HIV-1 spread

    SciTech Connect

    Russell, Rebecca A.; Martin, Nicola; Mitar, Ivonne; Jones, Emma; Sattentau, Quentin J.


    HIV-1 can move directly between T cells via virological synapses (VS). Although aspects of the molecular and cellular mechanisms underlying this mode of spread have been elucidated, the outcomes for infection of the target cell remain incompletely understood. We set out to determine whether HIV-1 transfer via VS results in productive, high-multiplicity HIV-1 infection. We found that HIV-1 cell-to-cell spread resulted in nuclear import of multiple proviruses into target cells as seen by fluorescence in-situ hybridization. Proviral integration into the target cell genome was significantly higher than that seen in a cell-free infection system, and consequent de novo viral DNA and RNA production in the target cell detected by quantitative PCR increased over time. Our data show efficient proviral integration across VS, implying the probability of multiple integration events in target cells that drive productive T cell infection. - Highlights: • Cell-to-cell HIV-1 infection delivers multiple vRNA copies to the target cell. • Cell-to-cell infection results in productive infection of the target cell. • Cell-to-cell transmission is more efficient than cell-free HIV-1 infection. • Suggests a mechanism for recombination in cells infected with multiple viral genomes.

  17. Modeling of single-event upset in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.


    The results of work done on the quantitative characterization of single-event upset (SEU) in bipolar random-access memories (RAMs) have been obtained through computer simulation of SEU in RAM cells that contain circuit models for bipolar transistors. The models include current generators that emulate the charge collected from ion tracks. The computer simulation results are compared with test data obtained from a RAM in a bipolar microprocessor chip. This methodology is applicable to other bipolar integrated circuit constructions in addition to RAM cells.

  18. Early integration of high copy HPV16 detectable in women with normal and low grade cervical cytology and histology

    PubMed Central

    Kulmala, S‐M A; Syrjänen, S M; Gyllensten, U B; Shabalova, I P; Petrovichev, N; Tosi, P; Syrjänen, K J; Johansson, B C


    Background Integration of human papillomavirus (HPV) DNA has been considered a late event in cervical carcinogenesis. However, integrated forms of HPV were recently detected in cancer precursor lesions using a new real time polymerase chain reaction (PCR) to detect the deletions at the 3362–3443 region of HPV16 E2 Objective To study the frequency of HPV16 DNA integration in cervical lesions and compare the sensitivity of an additional upstream region of the E2 ORF (2962–3138) in detecting HPV integration. Methods Using the TaqMan based PCR, HPV16 positive DNA samples were analysed in 164 cervical scrapings from women participating in a multicentre screening trial. Biopsy confirmation was available in 62 cases. Results Primers targeting the 3362–3443 region detected the majority of E2 deletions. In only 23% of the samples was the E2 upstream region equal or better target than the 3362–3443 region. Mixed (episomal/integrated) pattern was the most prevalent physical state of HPV16, also present in PAP smears with normal morphology. Pure integrated form was most prevalent in HSIL and cancer lesions, but also detectable in low grade abnormalities (NSIL, ASC‐US, LSIL). Women with only integrated HPV16 were almost 10 years older than those with episomal HPV16. Viral load of integrated HPV16 was related to cytological abnormality (p = 0.003) but not to histology. Conclusions Integrated HPV16 is present in low grade cervical lesions, mostly mixed with the episomal form. Women with the pure integrated form of HPV16 are older than those with the other forms. PMID:16484445

  19. CLIPS, AppleEvents, and AppleScript: Integrating CLIPS with commercial software

    NASA Technical Reports Server (NTRS)

    Compton, Michael M.; Wolfe, Shawn R.


    Many of today's intelligent systems are comprised of several modules, perhaps written in different tools and languages, that together help solve the user's problem. These systems often employ a knowledge-based component that is not accessed directly by the user, but instead operates 'in the background' offering assistance to the user as necessary. In these types of modular systems, an efficient, flexible, and eady-to-use mechanism for sharing data between programs is crucial. To help permit transparent integration of CLIPS with other Macintosh applications, the AI Research Branch at NASA Ames Research Center has extended CLIPS to allow it to communicate transparently with other applications through two popular data-sharing mechanisms provided by the Macintosh operating system: Apple Events (a 'high-level' event mechanism for program-to-program communication), and AppleScript, a recently-released scripting language for the Macintosh. This capability permits other applications (running on either the same or a remote machine) to send a command to CLIPS, which then responds as if the command were typed into the CLIPS dialog window. Any result returned by the command is then automatically returned to the program that sent it. Likewise, CLIPS can send several types of Apple Events directly to other local or remote applications. This CLIPS system has been successfully integrated with a variety of commercial applications, including data collection programs, electronics forms packages, DBMS's, and email programs. These mechanisms can permit transparent user access to the knowledge base from within a commercial application, and allow a single copy of the knowledge base to service multiple users in a networked environment.

  20. Data integration and analysis using the Heliophysics Event Knowledgebase

    NASA Astrophysics Data System (ADS)

    Hurlburt, Neal; Reardon, Kevin

    The Heliophysics Event Knowledgebase (HEK) system provides an integrated framework for automated data mining using a variety of feature-detection methods; high-performance data systems to cope with over 1TB/day of multi-mission data; and web services and clients for searching the resulting metadata, reviewing results, and efficiently accessing the data products. We have recently enhanced the capabilities of the HEK to support the complex datasets being produced by the Interface Region Imaging Spectrograph (IRIS). We are also developing the mechanisms to incorporate descriptions of coordinated observations from ground-based facilities, including the NSO's Dunn Solar Telescope (DST). We will discuss the system and its recent evolution and demonstrate its ability to support coordinated science investigations.

  1. Chopping Copy.

    ERIC Educational Resources Information Center

    Bush, Don


    Discusses ways an editor can cut out words to help the reader understand quickly. Discusses dead wood, redundancy, redundancy in thought, smothered verbs, false precision, editing and academia, and making copy smoother. (SR)

  2. An integrated system for hydrological analysis of flood events

    NASA Astrophysics Data System (ADS)

    Katsafados, Petros; Chalkias, Christos; Karymbalis, Efthymios; Gaki-Papanastassiou, Kalliopi; Mavromatidis, Elias; Papadopoulos, Anastasios


    The significant increase of extreme flood events during recent decades has led to an urgent social and economic demand for improve prediction and sustainable prevention. Remedial actions require accurate estimation of the spatiotemporal variability of runoff volume and local peaks, which can be analyzed through integrated simulation tools. Despite the fact that such advanced modeling systems allow the investigation of the dynamics controlling the behavior of those complex processes they can also be used as early warning systems. Moreover, simulation is assuming as the appropriate method to derive quantitative estimates of various atmospheric and hydrologic parameters especially in cases of absence reliable and accurate measurements of precipitation and flow rates. Such sophisticated techniques enable the flood risk assessment and improve the decision-making support on protection actions. This study presents an integrated system for the simulation of the essential atmospheric and soil parameters in the context of hydrological flood modeling. The system is consisted of two main cores: a numerical weather prediction model coupled with a geographical information system for the accurate simulation of groundwater advection and rainfall runoff estimation. Synoptic and mesoscale atmospheric motions are simulated with a non-hydrostatic limited area model on a very high resolution domain of integration. The model includes advanced schemes for the microphysics and the surface layer physics description as well as the longwave and sortwave radiation budget estimation. It is also fully coupled with a land-surface model in order to resolve the surface heat fluxes and the simulation of the air-land energy exchange processes. Detailed atmospheric and soil parameters derived from the atmospheric model are used as input data for the GIS-based runoff modeling. Geographical information system (GIS) technology is used for further hydrological analysis and estimation of direct

  3. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.


    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H


    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite. PMID:22614281

  4. Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T; Gibbons, S J; Ringdal, F; Harris, D B


    The principal objective of this two-year study is to develop and test a new advanced, automatic approach to seismic detection/location using array processing. We address a strategy to obtain significantly improved precision in the location of low-magnitude events compared with current fully-automatic approaches, combined with a low false alarm rate. We have developed and evaluated a prototype automatic system which uses as a basis regional array processing with fixed, carefully calibrated, site-specific parameters in conjuction with improved automatic phase onset time estimation. We have in parallel developed tools for Matched Field Processing for optimized detection and source-region identification of seismic signals. This narrow-band procedure aims to mitigate some of the causes of difficulty encountered using the standard array processing system, specifically complicated source-time histories of seismic events and shortcomings in the plane-wave approximation for seismic phase arrivals at regional arrays.

  5. Indico central - events organisation, ergonomics and collaboration tools integration

    NASA Astrophysics Data System (ADS)

    Benito Gonzélez López, José; Ferreira, José Pedro; Baron, Thomas


    While the remote collaboration services at CERN slowly aggregate around the Indico event management software, its new version which is the result of a careful maturation process includes improvements which will set a new reference in its domain. The presentation will focus on the description of the new features of the tool, the user feedback process which resulted in a new record of usability. We will also describe the interactions with the worldwide community of users and server administrators and the impact this has had on our development process, as well as the tools set in place to streamline the work between the different collaborating sites. A last part will be dedicated to the use of Indico as a central hub for operating other local services around the event organisation (registration epayment, audiovisual recording, webcast, room booking, and videoconference support)

  6. Integration of mRNA expression profile, copy number alterations, and microRNA expression levels in breast cancer to improve grade definition.


    Cava, Claudia; Bertoli, Gloria; Ripamonti, Marilena; Mauri, Giancarlo; Zoppis, Italo; Della Rosa, Pasquale Anthony; Gilardi, Maria Carla; Castiglioni, Isabella


    Defining the aggressiveness and growth rate of a malignant cell population is a key step in the clinical approach to treating tumor disease. The correct grading of breast cancer (BC) is a fundamental part in determining the appropriate treatment. Biological variables can make it difficult to elucidate the mechanisms underlying BC development. To identify potential markers that can be used for BC classification, we analyzed mRNAs expression profiles, gene copy numbers, microRNAs expression and their association with tumor grade in BC microarray-derived datasets. From mRNA expression results, we found that grade 2 BC is most likely a mixture of grade 1 and grade 3 that have been misclassified, being described by the gene signature of either grade 1 or grade 3. We assessed the potential of the new approach of integrating mRNA expression profile, copy number alterations, and microRNA expression levels to select a limited number of genomic BC biomarkers. The combination of mRNA profile analysis and copy number data with microRNA expression levels led to the identification of two gene signatures of 42 and 4 altered genes (FOXM1, KPNA4, H2AFV and DDX19A) respectively, the latter obtained through a meta-analytical procedure. The 42-based gene signature identifies 4 classes of up- or down-regulated microRNAs (17 microRNAs) and of their 17 target mRNA, and the 4-based genes signature identified 4 microRNAs (Hsa-miR-320d, Hsa-miR-139-5p, Hsa-miR-567 and Hsa-let-7c). These results are discussed from a biological point of view with respect to pathological features of BC. Our identified mRNAs and microRNAs were validated as prognostic factors of BC disease progression, and could potentially facilitate the implementation of assays for laboratory validation, due to their reduced number. PMID:24866763

  7. Understanding Oceanic Anoxic Events: An Integrated Geochemical Approach

    NASA Astrophysics Data System (ADS)

    Cohen, A. S.; Coe, A. L.; Kemp, D. B.; Pearce, C. R.


    Discrete intervals of widespread organic carbon accumulation, termed Oceanic Anoxic Events (OAEs), occurred at a few relatively brief intervals during the Mesozoic. Recent studies have shown that these events took place at the same time as other substantial environmental changes that included global warming, ocean acidification, and unusually high levels of species extinctions. However, many factors relating to the behaviour of the Earth System during OAEs remain unclear. These include: The primary driving mechanism(s) - was there one common mechanism or were OAEs the result of different processes; the spatial and temporal extent of seawater anoxia during OAEs; the precise effects on marine and terrestrial biota; variations in atmospheric CO2 and global temperature; and the mechanism and timescale of Earth's recovery process. The records of environmental change during OAEs are best preserved in marine deposits, with continental shelf sections being particularly well studied. The combined use of geochemical, sedimentological and palaeontological observations indicates a complex interplay of factors. Significant advances in our understanding of OAEs have taken place in the last decade or so using new geochemical and isotopic proxies and a high- resolution, multidisciplinary approach. For example, Sr- and Os-isotope data indicate that rates of chemical weathering increased markedly during the Toarcian (Early Jurassic) OAE, whilst Mo-isotope data suggest that the areal extent of seawater anoxia fluctuated during the OAE despite the persistence of euxinic conditions in some regions. The pattern of Mo-isotope data for the Toarcian contrasts strongly with new Mo-isotope results from the Kimmeridge Clay Formation (Late Jurassic), when anoxic conditions were confined to European epicontinental seas and were likely to have resulted from very different primary causes. Cyclostratigraphic analysis has been used to provide a temporal framework for the timescale of OAEs at sub

  8. A high-resolution integrated map of copy number polymorphisms within and between breeds of the modern domesticated dog

    PubMed Central


    Background Structural variation contributes to the rich genetic and phenotypic diversity of the modern domestic dog, Canis lupus familiaris, although compared to other organisms, catalogs of canine copy number variants (CNVs) are poorly defined. To this end, we developed a customized high-density tiling array across the canine genome and used it to discover CNVs in nine genetically diverse dogs and a gray wolf. Results In total, we identified 403 CNVs that overlap 401 genes, which are enriched for defense/immunity, oxidoreductase, protease, receptor, signaling molecule and transporter genes. Furthermore, we performed detailed comparisons between CNVs located within versus outside of segmental duplications (SDs) and find that CNVs in SDs are enriched for gene content and complexity. Finally, we compiled all known dog CNV regions and genotyped them with a custom aCGH chip in 61 dogs from 12 diverse breeds. These data allowed us to perform the first population genetics analysis of canine structural variation and identify CNVs that potentially contribute to breed specific traits. Conclusions Our comprehensive analysis of canine CNVs will be an important resource in genetically dissecting canine phenotypic and behavioral variation. PMID:21846351

  9. Competency Based Competitive Events. Integrating DECA into the DE Instructional Program.

    ERIC Educational Resources Information Center

    Cosgrove, Glenna; Moore, Harold W.

    Designed to be integrated into a competency-based distributive education program, these competitive DECA (Distributive Education Clubs of America) events were developed, utilized, and evaluated by distributive education and cooperative education coordinators in Arkansas. These events are organized under the following occupational categories: food…

  10. Identification of Tf1 integration events in S. pombe under nonselective conditions.


    Cherry, Kristina E; Hearn, Willis E; Seshie, Osborne Y K; Singleton, Teresa L


    Integration of retroviral elements into the host genome is a phenomena observed among many classes of retroviruses. Much information concerning the integration of retroviral elements has been documented based on in vitro analysis or expression of selectable markers. To identify possible Tf1 integration events within silent regions of the Schizosaccharomyces pombe genome, we focused on performing an in vivo genome-wide analysis of Tf1 integration events from the nonselective phase of the retrotransposition assay. We analyzed 1000 individual colonies streaked from four independent Tf1 transposed patches under nonselection conditions. Our analysis detected a population of G418(S)/neo(+) Tf1 integration events that would have been overlooked during the selective phase of the assay. Further RNA analysis from the G418(S)/neo(+) clones revealed 50% of clones expressing the neo selectable marker. Our data reveals Tf1's ability to insert within silent regions of S. pombe's genome. PMID:24680781

  11. Single-Event Upset and Snapback in Silicon-on-Insulator Devices and Integrated Circuits

    SciTech Connect



    The characteristics Of ion-induced charge collection and single-event upset are studied in SOI transistors and circuits with various body tie structures. Impact ionization effects including single-event snapback are shown to be very important. Focused ion microbeam experiments are used to find single-event snapback drain voltage thresholds in n-channel SOI transistors as a function of device width. Three-Dimensional device simulations are used to determine single-event upset and snapback thresholds in SOI SRAMS, and to study design tradeoffs for various body-tie structures. A window of vulnerability to single-event snapback is shown to exist below the single-event upset threshold. The presence of single-event snapback in commercial SOI SRAMS is confirmed through broadbeam ion testing, and implications for hardness assurance testing of SOI integrated circuits are discussed.

  12. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.


    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

  13. Integrating optical finger motion tracking with surface touch events.


    MacRitchie, Jennifer; McPherson, Andrew P


    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  14. Integrating optical finger motion tracking with surface touch events

    PubMed Central

    MacRitchie, Jennifer; McPherson, Andrew P.


    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  15. Integrated copy number and gene expression profiling analysis of Epstein-Barr virus-positive diffuse large B-cell lymphoma.


    Yoon, Heejei; Park, Sanghui; Ju, Hyunjeong; Ha, Sang Yun; Sohn, InSuk; Jo, Jisuk; Do, In-Gu; Min, Sookee; Kim, Seok Jin; Kim, Won Seog; Yoo, Hae Yong; Ko, Young Hyeh


    Viral oncogenes and host immunosenescence have been suggested as causes of Epstein-Barr virus-positive diffuse large B-cell lymphoma (EBV + DLBCL) of the elderly. To investigate the molecular genetic basis of immune evasion and tumor outgrowth, we analyzed copy number alterations (CNAs) and gene expression profiles in EBV + DLBCL samples compared with EBV - DLBCL. There were relatively few genomic alterations in EBV + DLBCL compared with those detected in EBV-negative DLBCL. The most frequent CNAs (>30%) in EBV + DLBCLs were gains at 1q23.2-23.3, 1q23.3, 1q32.1, 5p15.3, 8q22.3, 8q24.1-24.2, and 9p24.1; losses at 6q27, 7q11.2, and 7q36.2-36.3 were also recurrent. A gene expression profile analysis identified the host immune response as a key molecular signature in EBV + DLBCL. Antiviral response genes, proinflammatory cytokines, and chemokines associated with the innate immune response were overexpressed, indicating the presence of a virusinduced inflammatory microenvironment. Genes associated with the B-cell receptor signaling pathway were downregulated. An integrated analysis indicated that SLAMF1 and PDL2 were key targets of the gains detected at 1q23.2-23.3 and 9p24.1. The chromosomal gain at 9p24.1 was associated with poor overall survival. Taken together, our results led to the identification of recurrent copy number alterations and distinct gene expression associated with the host immune response in EBV + DLBCL. We suggest that the upregulation of PDL2 on 9p24.1 promotes immune evasion and is associated with poor prognosis in EBV + DLBCL. PMID:25832818

  16. Analysis of sequences flanking the vap regions of Dichelobacter nodosus: evidence for multiple integration events, a killer system, and a new genetic element.


    Bloomfield, G A; Whittle, G; McDonagh, M B; Katz, M E; Cheetham, B F


    Dichelobacter nodosus is the causative agent of ovine footrot. The vap regions of the D. nodosus genome may have arisen by the integration of a genetic element and may have a role in virulence. The virulent D. nodosus strain A198 has multiple copies of the vap regions. In the present study, sequences to the left and right of vap regions 1, 2 and 3 of strain A198 were analysed by Southern blotting and DNa sequencing. The results suggest that vap regions 1 and 2 rose by independent integration events into different tRNA genes. The discovery of a second integrase gene (intB), a gene with similarity to bacteriophage repressor proteins (regA), and a gene similar to an ORF from a conjugative transposon (gepA), suggests that a second genetic element, either a bacteriophage or a conjugative transposon, is integrated next to vap region 3 in the D. nodosus genome. The arrangement of intB and the vap regions in three other virulent strains and one benign strain was determined using using Southern blotting and PCR. One strain, H1215, contained vapE' and not vapE, and thus resembles vap region 3, suggesting that vap region 3 also may have arisen by an independent integration event. In all strains, a copy of intB was found next to the vap regions. The vap regions contain two genes, vapA and toxA, with similarity to the hig genes of the killer plasmid Rts1. Evidence is presented that vapA and toxA have a similar function in D. nodosus. PMID:9043132

  17. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.


    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing


    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates. PMID:19860467

  18. Integrated upstream parasitic event building architecture for BTeV level 1 pixel trigger system

    SciTech Connect

    Wu, Jin-Yuan; Wang, M.; Gottschalk, E.; Christian, D.; Li, X.; Shi, Z.; Pavlicek, V.; Cancelo, G.; /Fermilab


    Contemporary event building approaches use data switches, either homemade or commercial off-the-shelf ones, to merge data from different channels and distribute them among processor nodes. However, in many trigger and DAQ systems, the merging and distributing functions can often be performed in pre-processing stages. By carefully integrating these functions into the upstream pre-processing stages, the events can be built without dedicated switches. In addition to the cost reducing, extra benefits are gain when the event is built early upstream. In this document, an example of the integrated upstream parasitic event building architecture that has been studied for the BTeV level 1 pixel trigger system is described. Several design considerations that experimentalists of other projects might be interested in are also discussed.

  19. Event based self-supervised temporal integration for multimodal sensor data.


    Barakova, Emilia I; Lourens, Tino


    A method for synergistic integration of multimodal sensor data is proposed in this paper. This method is based on two aspects of the integration process: (1) achieving synergistic integration of two or more sensory modalities, and (2) fusing the various information streams at particular moments during processing. Inspired by psychophysical experiments, we propose a self-supervised learning method for achieving synergy with combined representations. Evidence from temporal registration and binding experiments indicates that different cues are processed individually at specific time intervals. Therefore, an event-based temporal co-occurrence principle is proposed for the integration process. This integration method was applied to a mobile robot exploring unfamiliar environments. Simulations showed that integration enhanced route recognition with many perceptual similarities; moreover, they indicate that a perceptual hierarchy of knowledge about instant movement contributes significantly to short-term navigation, but that visual perceptions have bigger impact over longer intervals. PMID:15988800

  20. Analysis of extreme top event frequency percentiles based on fast probability integration

    SciTech Connect

    Staple, B.; Haskin, F.E.


    In risk assessments, a primary objective is to determine the frequency with which a collection of initiating and basic events, E{sub e} leads to some undesired top event, T. Uncertainties in the occurrence rates, x{sub t}, assigned to the initiating and basic events cause uncertainty in the top event frequency, z{sub T}. The quantification of the uncertainty in z{sub T} is an essential part of risk assessment called uncertainty analysis. In the past, it has been difficult to evaluate the extreme percentiles of output variables like z{sub T}. Analytic methods such as the method of moments do not provide estimates of output percentiles and the Monte Carlo (MC) method can be used to estimate extreme output percentiles only by resorting to large sample sizes. A promising altemative to these methods is the fast probability integration (FPI) methods. These methods approximate the integrals of multi-variate functions, representing percentiles of interest, without recourse to multi-dimensional numerical integration. FPI methods give precise results and have been demonstrated to be more efficient than MC methods for estimating extreme output percentiles. FPI allows the analyst to choose extreme percentiles of interest and perform sensitivity analyses in those regions. Such analyses can provide valuable insights as to the events driving the top event frequency response in extreme probability regions. In this paper, FPI methods are adapted a) to precisely estimate extreme top event frequency percentiles and b) to allow the quantification of sensitivity measures at these extreme percentiles. In addition, the relative precision and efficiency of alternative methods for treating lognormally distributed inputs is investigated. The methodology is applied to the top event frequency expression for the dominant accident sequence from a risk assessment of Grand Gulf nuclear power plant.

  1. The COG and COPI Complexes Interact to Control the Abundance of GEARs, a Subset of Golgi Integral Membrane ProteinsD⃞

    PubMed Central

    Oka, Toshihiko; Ungar, Daniel; Hughson, Frederick M.; Krieger, Monty


    The conserved oligomeric Golgi (COG) complex is a soluble hetero-octamer associated with the cytoplasmic surface of the Golgi. Mammalian somatic cell mutants lacking the Cog1 (ldlB) or Cog2 (ldlC) subunits exhibit pleiotropic defects in Golgi-associated glycoprotein and glycolipid processing that suggest COG is involved in the localization, transport, and/or function of multiple Golgi processing proteins. We have identified a set of COG-sensitive, integral membrane Golgi proteins called GEARs (mannosidase II, GOS-28, GS15, GPP130, CASP, giantin, and golgin-84) whose abundances were reduced in the mutant cells and, in some cases, increased in COG-overexpressing cells. In the mutants, some GEARs were abnormally localized in the endoplasmic reticulum and were degraded by proteasomes. The distributions of the GEARs were altered by small interfering RNA depletion of ε-COP in wild-type cells under conditions in which COG-insensitive proteins were unaffected. Furthermore, synthetic phenotypes arose in mutants deficient in both ε-COP and either Cog1 or Cog2. COG and COPI may work in concert to ensure the proper retention or retrieval of a subset of proteins in the Golgi, and COG helps prevent the endoplasmic reticulum accumulation and degradation of some GEARs. PMID:15004235

  2. Novel Candidate Key Drivers in the Integrative Network of Genes, MicroRNAs, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma

    PubMed Central

    Cai, Yu-dong


    The mechanisms of lung cancer are highly complex. Not only mRNA gene expression but also microRNAs, DNA methylation, and copy number variation (CNV) play roles in tumorigenesis. It is difficult to incorporate so much information into a single model that can comprehensively reflect all these lung cancer mechanisms. In this study, we analyzed the 129 TCGA (The Cancer Genome Atlas) squamous cell lung carcinoma samples with gene expression, microRNA expression, DNA methylation, and CNV data. First, we used variance inflation factor (VIF) regression to build the whole genome integrative network. Then, we isolated the lung cancer subnetwork by identifying the known lung cancer genes and their direct regulators. This subnetwork was refined by the Bayesian method, and the directed regulations among mRNA genes, microRNAs, methylations, and CNVs were obtained. The novel candidate key drivers in this refined subnetwork, such as the methylation of ARHGDIB and HOXD3, microRNA let-7a and miR-31, and the CNV of AGAP2, were identified and analyzed. On three large public available lung cancer datasets, the key drivers ARHGDIB and HOXD3 demonstrated significant associations with the overall survival of lung cancer patients. Our results provide new insights into lung cancer mechanisms. PMID:25802847

  3. Rare Copy Number Variants

    PubMed Central

    Grozeva, Detelina; Kirov, George; Ivanov, Dobril; Jones, Ian R.; Jones, Lisa; Green, Elaine K.; St Clair, David M.; Young, Allan H.; Ferrier, Nicol; Farmer, Anne E.; McGuffin, Peter; Holmans, Peter A.; Owen, Michael J.; O’Donovan, Michael C.; Craddock, Nick


    Context Recent studies suggest that copy number variation in the human genome is extensive and may play an important role in susceptibility to disease, including neuropsychiatric disorders such as schizophrenia and autism. The possible involvement of copy number variants (CNVs) in bipolar disorder has received little attention to date. Objectives To determine whether large (>100 000 base pairs) and rare (found in <1% of the population) CNVs are associated with susceptibility to bipolar disorder and to compare with findings in schizophrenia. Design A genome-wide survey of large, rare CNVs in a case-control sample using a high-density microarray. Setting The Wellcome Trust Case Control Consortium. Participants There were 1697 cases of bipolar disorder and 2806 nonpsychiatric controls. All participants were white UK residents. Main Outcome Measures Overall load of CNVs and presence of rare CNVs. Results The burden of CNVs in bipolar disorder was not increased compared with controls and was significantly less than in schizophrenia cases. The CNVs previously implicated in the etiology of schizophrenia were not more common in cases with bipolar disorder. Conclusions Schizophrenia and bipolar disorder differ with respect to CNV burden in general and association with specific CNVs in particular. Our data are consistent with the possibility that possession of large, rare deletions may modify the phenotype in those at risk of psychosis: those possessing such events are more likely to be diagnosed as having schizophrenia, and those without them are more likely to be diagnosed as having bipolar disorder. PMID:20368508

  4. Loss estimation of debris flow events in mountain areas - An integrated tool for local authorities

    NASA Astrophysics Data System (ADS)

    Papathoma-Koehle, M.; Zischg, A.; Fuchs, S.; Keiler, M.; Glade, T.


    Torrents prone to debris flows regularly cause extensive destruction of the built environment, loss of life stock, agricultural land and loss of life in mountain areas. Climate change may increase the frequency and intensity of such events. On the other hand, extensive development of mountain areas is expected to change the spatial pattern of elements at risk exposed and their vulnerability. Consequently, the costs of debris flow events are likely to increase in the coming years. Local authorities responsible for disaster risk reduction are in need of tools that may enable them to assess the future consequences of debris flow events, in particular with respect to the vulnerability of elements at risk. An integrated tool for loss estimation is presented here which is based on a newly developed vulnerability curve and which is applied in test sites in the Province of South Tyrol, Italy. The tool has a dual function: 1) continuous updating of the database regarding damages and process intensities that will eventually improve the existing vulnerability curve and 2) loss estimation of future events and hypothetical events or built environment scenarios by using the existing curve. The tool integrates the vulnerability curve together with new user friendly forms of damage documentation. The integrated tool presented here can be used by local authorities not only for the recording of damage caused by debris flows and the allocation of compensation to the owners of damaged buildings but also for land use planning, cost benefit analysis of structural protection measures and emergency planning.

  5. A spreadable, non-integrative and high copy number shuttle vector for Sulfolobus solfataricus based on the genetic element pSSVx from Sulfolobus islandicus.


    Aucelli, Tiziana; Contursi, Patrizia; Girfoglio, Michele; Rossi, Mosè; Cannio, Raffaele


    The pSSVx genetic element from Sulfolobus islandicus REY15/4 is a hybrid between a plasmid and a fusellovirus, able to be maintained in non-integrative form and to spread when the helper SSV2 virus is present in the cells. In this work, the satellite virus was engineered to obtain an Escherichia coli-Sulfolobus solfataricus shuttle vector for gene transfer and expression in S.solfataricus by fusing site-specifically the pSSVx chromosome with an E.coli plasmid replicon and the ampicillin resistance gene. The pSSVx-based vector was proven functional like the parental virus, namely it was able to spread efficiently through infected S.solfataricus cells. Moreover, the hybrid plasmid stably transformed S.solfataricus and propagated with no rearrangement, recombination or integration into the host chromosome. The high copy number of the artificial genetic element was found comparable with that calculated for the wild-type pSSVx in the new host cells, with no need of genetic markers for vector maintenance in the cells and for transfomant enrichment. The newly constructed vector was also shown to be an efficient cloning vehicle for the expression of passenger genes in S.solfataricus. In fact, a derivative plasmid carrying an expression cassette of the lacS gene encoding the beta-glycosidase from S.solfataricus under the control of the Sulfolobus chaperonine (thermosome tf55) heat shock promoter was also able to drive the expression of a functional enzyme. Complementation of the beta-galactosidase deficiency in a deletion mutant strain of S.solfataricus demonstrated that lacS gene was an efficient marker for selection of single transformants on solid minimal lactose medium. PMID:16971457

  6. Integrated Copy Number and Expression Analysis Identifies Profiles of Whole-Arm Chromosomal Alterations and Subgroups with Favorable Outcome in Ovarian Clear Cell Carcinomas

    PubMed Central

    Uehara, Yuriko; Oda, Katsutoshi; Ikeda, Yuji; Koso, Takahiro; Tsuji, Shingo; Yamamoto, Shogo; Asada, Kayo; Sone, Kenbun; Kurikawa, Reiko; Makii, Chinami; Hagiwara, Otoe; Tanikawa, Michihiro; Maeda, Daichi; Hasegawa, Kosei; Nakagawa, Shunsuke; Wada-Hiraike, Osamu; Kawana, Kei; Fukayama, Masashi; Fujiwara, Keiichi; Yano, Tetsu; Osuga, Yutaka; Fujii, Tomoyuki; Aburatani, Hiroyuki


    Ovarian clear cell carcinoma (CCC) is generally associated with chemoresistance and poor clinical outcome, even with early diagnosis; whereas high-grade serous carcinomas (SCs) and endometrioid carcinomas (ECs) are commonly chemosensitive at advanced stages. Although an integrated genomic analysis of SC has been performed, conclusive views on copy number and expression profiles for CCC are still limited. In this study, we performed single nucleotide polymorphism analysis with 57 epithelial ovarian cancers (31 CCCs, 14 SCs, and 12 ECs) and microarray expression analysis with 55 cancers (25 CCCs, 16 SCs, and 14 ECs). We then evaluated PIK3CA mutations and ARID1A expression in CCCs. SNP array analysis classified 13% of CCCs into a cluster with high frequency and focal range of copy number alterations (CNAs), significantly lower than for SCs (93%, P < 0.01) and ECs (50%, P = 0.017). The ratio of whole-arm to all CNAs was higher in CCCs (46.9%) than SCs (21.7%; P < 0.0001). SCs with loss of heterozygosity (LOH) of BRCA1 (85%) also had LOH of NF1 and TP53, and LOH of BRCA2 (62%) coexisted with LOH of RB1 and TP53. Microarray analysis classified CCCs into three clusters. One cluster (CCC-2, n = 10) showed more favorable prognosis than the CCC-1 and CCC-3 clusters (P = 0.041). Coexistent alterations of PIK3CA and ARID1A were more common in CCC-1 and CCC-3 (7/11, 64%) than in CCC-2 (0/10, 0%; P < 0.01). Being in cluster CCC-2 was an independent favorable prognostic factor in CCC. In conclusion, CCC was characterized by a high ratio of whole-arm CNAs; whereas CNAs in SC were mainly focal, but preferentially caused LOH of well-known tumor suppressor genes. As such, expression profiles might be useful for sub-classification of CCC, and might provide useful information on prognosis. PMID:26043110

  7. Breaking and Entering: Copying and Copy Protection.

    ERIC Educational Resources Information Center

    Westlake, Wayne; And Others


    Describes several commercially-available computer programs which allow users to make copies of "protected" software. Current costs, program features, and ordering information are provided for these "encryption" programs. Also describes a monthly journal (The HARDCORE Computist) which focuses on unlocking copy-protected software. (JN)

  8. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.


    Vazou, Spyridoula; Vlachopoulos, Symeon P


    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants. PMID:25001232

  9. Integral-based event triggering controller design for stochastic LTI systems via convex optimisation

    NASA Astrophysics Data System (ADS)

    Mousavi, S. H.; Marquez, H. J.


    The presence of measurement noise in the event-based systems can lower system efficiency both in terms of data exchange rate and performance. In this paper, an integral-based event triggering control system is proposed for LTI systems with stochastic measurement noise. We show that the new mechanism is robust against noise and effectively reduces the flow of communication between plant and controller, and also improves output performance. Using a Lyapunov approach, stability in the mean square sense is proved. A simulated example illustrates the properties of our approach.

  10. Increased Frequency of De Novo Copy Number Variations in Congenital Heart Disease by Integrative Analysis of SNP Array and Exome Sequence Data

    PubMed Central

    Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R.; Golhar, Ryan; Sanders, Stephan J.; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A. Jeremy; State, Matthew W.; Kaltman, Jonathan R.; White, Peter S.; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D.; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K.


    Rationale Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown etiology. Objective To determine the contribution of de novo copy number variants (CNVs) in the etiology of sporadic CHD. Methods and Results We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism (SNP) arrays and/or whole exome sequencing (WES). Results were experimentally validated using digital droplet PCR. We compared validated CNVs in CHD cases to CNVs in 1,301 healthy control trios. The two complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either SNP array (p=7x10−5, Odds Ratio (OR)=4.6) or WES data (p=6x10−4, OR=3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (p=0.02, OR=2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in WES and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q sub-telomeric deletions. Conclusions We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. PMID:25205790

  11. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.


    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing


    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate. PMID:16302741

  12. Integrated Genomic Analysis of Pancreatic Ductal Adenocarcinomas Reveals Genomic Rearrangement Events as Significant Drivers of Disease.


    Murphy, Stephen J; Hart, Steven N; Halling, Geoffrey C; Johnson, Sarah H; Smadbeck, James B; Drucker, Travis; Lima, Joema Felipe; Rohakhtar, Fariborz Rakhshan; Harris, Faye R; Kosari, Farhad; Subramanian, Subbaya; Petersen, Gloria M; Wiltshire, Timothy D; Kipp, Benjamin R; Truty, Mark J; McWilliams, Robert R; Couch, Fergus J; Vasmatzis, George


    Many somatic mutations have been detected in pancreatic ductal adenocarcinoma (PDAC), leading to the identification of some key drivers of disease progression, but the involvement of large genomic rearrangements has often been overlooked. In this study, we performed mate pair sequencing (MPseq) on genomic DNA from 24 PDAC tumors, including 15 laser-captured microdissected PDAC and 9 patient-derived xenografts, to identify genome-wide rearrangements. Large genomic rearrangements with intragenic breakpoints altering key regulatory genes involved in PDAC progression were detected in all tumors. SMAD4, ZNF521, and FHIT were among the most frequently hit genes. Conversely, commonly reported genes with copy number gains, including MYC and GATA6, were frequently observed in the absence of direct intragenic breakpoints, suggesting a requirement for sustaining oncogenic function during PDAC progression. Integration of data from MPseq, exome sequencing, and transcriptome analysis of primary PDAC cases identified limited overlap in genes affected by both rearrangements and point mutations. However, significant overlap was observed in major PDAC-associated signaling pathways, with all PDAC exhibiting reduced SMAD4 expression, reduced SMAD-dependent TGFβ signaling, and increased WNT and Hedgehog signaling. The frequent loss of SMAD4 and FHIT due to genomic rearrangements strongly implicates these genes as key drivers of PDAC, thus highlighting the strengths of an integrated genomic and transcriptomic approach for identifying mechanisms underlying disease initiation and progression. PMID:26676757

  13. An integrated logit model for contamination event detection in water distribution systems.


    Housh, Mashor; Ostfeld, Avi


    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. PMID:25770443

  14. Modulation of semantic integration as a function of syntactic expectations: event-related brain potential evidence.


    Isel, Frédéric; Shen, Weilin


    This study investigated syntax-semantics interactions during spoken sentence comprehension. We showed that expectations of phrase-structure incongruencies, which were induced by the experimental instructions, although not actually present in the sentences, were able to block the process of semantic integration. Although this process is usually associated with an N400 event-related brain potential component, here we found a P600, that is, an event-related brain potential component that is thought to reflect syntactic revision. This finding lends support to neurophysiological models of sentence interpretation, which postulates that the lexical-semantic integration of a given word can take place only when syntactic analysis has been successfully completed. PMID:21358555

  15. Integrating Memories in the Human Brain: Hippocampal–Midbrain Encoding of Overlapping Events

    PubMed Central

    Shohamy, Daphna; Wagner, Anthony D.


    SUMMARY Decisions are often guided by generalizing from past experiences. Fundamental questions remain regarding the cognitive and neural mechanisms by which generalization takes place. Prior data suggest that generalization may stem from inference-based processes that occur at the time of generalization. By contrast, it has been hypothesized that generalization may emerge from mnemonic processes that occur while premise events are being encoded. Here, participants engaged in a two-phase learning and generalization task, wherein they initially learned a series of overlapping associations, and were subsequently probed to generalize what they learned to novel stimulus combinations. Functional magnetic resonance imaging (fMRI) revealed that subsequent generalization performance was associated with coupled changes in learning-phase activity in the hippocampus and midbrain (ventral tegmental area/substantia nigra). These findings provide novel evidence for generalization based on integrative encoding, whereby overlapping past events are integrated into a linked mnemonic representation. Hippocampal–midbrain interactions support the dynamic integration of experiences, providing a powerful mechanism for building a rich associative history that extends beyond individually experienced events. PMID:18957228

  16. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression.


    Peng, Ting; Sun, Xiaochun; Mumm, Rita H


    From a breeding standpoint, multiple trait integration (MTI) is a four-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) using backcross breeding, ultimately regaining the performance attributes of the target hybrid along with reliable expression of the value-added traits. In the light of the overarching goal of recovering equivalent performance in the finished conversion, this study focuses on the first step of MTI, single event introgression, exploring the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events, incorporating eight events into the female hybrid parent and seven into the male parent. Single event introgression is conducted in parallel streams to convert the recurrent parent (RP) for individual events, with the primary objective of minimizing residual non-recurrent parent (NRP) germplasm, especially in the chromosomal proximity to the event (i.e. linkage drag). In keeping with a defined lower limit of 96.66 % overall RP germplasm recovery (i.e. ≤120 cM NRP germplasm given a genome size of 1,788 cM), a breeding goal for each of the 15 single event conversions was developed: <8 cM of residual NRP germplasm across the genome with ~1 cM in the 20 cM region flanking the event. Using computer simulation, we aimed to identify optimal breeding strategies for single event introgression to achieve this breeding goal, measuring efficiency in terms of number of backcross generations required, marker data points needed, and total population size across generations. Various selection schemes classified as three-stage, modified two-stage, and combined selection conducted from BC1 through BC3, BC4, or BC5 were compared. The breeding goal was achieved with a selection scheme involving five generations of marker-aided backcrossing, with BC1 through BC3 selected for the event of interest and minimal linkage drag at population size of 600, and BC4 and BC5 selected for

  17. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.


    Peng, Ting; Sun, Xiaochun; Mumm, Rita H


    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  18. Analysis on Outcome of 3537 Patients with Coronary Artery Disease: Integrative Medicine for Cardiovascular Events

    PubMed Central

    Gao, Zhu-ye; Qiu, Yu; Jiao, Yang; Shang, Qing-hua; Shi, Da-zhuo


    Aims. To investigate the treatment of hospitalized patients with coronary artery disease (CAD) and the prognostic factors in Beijing, China. Materials and Methods. A multicenter prospective study was conducted through an integrative platform of clinical and research at 12 hospitals in Beijing, China. The clinical information of 3537 hospitalized patients with CAD was collected from September 2009 to May 2011, and the efficacy of secondary prevention during one-year followup was evaluated. In addition, a logistic regression analysis was performed to identify some factors which will have independent impact on the prognosis. Results. The average age of all patients was 64.88 ± 11.97. Of them, 65.42% are males. The medicines for patients were as follows: antiplatelet drugs accounting for 91.97%, statins accounting for 83.66%, β-receptor blockers accounting for 72.55%, ACEI/ARB accounting for 58.92%, and revascularization (including PCI and CABG) accounting for 40.29%. The overall incidence of cardiovascular events was 13.26% (469/3537). The logistic stepwise regression analysis showed that heart failure (OR, 3.707, 95% CI = 2.756–4.986), age ≥ 65 years old (OR, 2.007, 95% CI = 1.587–2.53), and myocardial infarction (OR, 1.649, 95% CI = 1.322–2.057) were the independent risk factors of others factors for cardiovascular events that occurred during followup of one-year period. Integrative medicine (IM) therapy showed the beneficial tendency for decreasing incidence of cardiovascular events, although no statistical significance was found (OR, 0.797, 95% CI = 0.613~1.036). Conclusions. Heart failure, age ≥ 65 years old, and myocardial infarction were associated with an increase in incidence of cardiovascular events, and treatment with IM showed a tendency for decreasing incidence of cardiovascular events. PMID:23983773

  19. Copy-left and Copy-right

    NASA Astrophysics Data System (ADS)

    VanderPlas, Jacob


    Any discussion of open licensing almost invariably devolves into a debate between copy-left licenses and permissive licenses, both sides defending their views with a nearly religious fervor. Copy-left licenses, typified by the GPL family of licenses, require all derived products to maintain the open, GPL license. Permissive licenses, typified by the BSD family of licenses, do not impose such requirements. I'll briefly explore the common arguments put forth in favor of either approach, and discuss some concrete examples of where these approaches have helped or hindered the software packages that used them.

  20. How Distance Affects Semantic Integration in Discourse: Evidence from Event-Related Potentials

    PubMed Central

    Yang, Xiaohong; Chen, Shuang; Chen, Xuhai; Yang, Yufang


    Event-related potentials were used to investigate whether semantic integration in discourse is influenced by the number of intervening sentences between the endpoints of integration. Readers read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the information introduced in the first sentence. Furthermore, for the short discourses, the first and last sentence were intervened by only one sentence while for the long discourses, they were intervened by three sentences. We found that the incongruent words elicited an N400 effect for both the short and long discourses. However, a P600 effect was only observed for the long discourses, but not for the short ones. These results suggest that although readers can successfully integrate upcoming words into the existing discourse representation, the effort required for this integration process is modulated by the number of intervening sentences. Thus, discourse distance as measured by the number of intervening sentences should be taken as an important factor for semantic integration in discourse. PMID:26569606

  1. An integrative genomic and transcriptomic analysis reveals molecular pathways and networks regulated by copy number aberrations in basal-like, HER2 and luminal cancers.


    Natrajan, Rachael; Weigelt, Britta; Mackay, Alan; Geyer, Felipe C; Grigoriadis, Anita; Tan, David S P; Jones, Chris; Lord, Christopher J; Vatcheva, Radost; Rodriguez-Pinilla, Socorro M; Palacios, Jose; Ashworth, Alan; Reis-Filho, Jorge S


    Breast cancer is a heterogeneous disease caused by the accumulation of genetic changes in neoplastic cells. We hypothesised that molecular subtypes of breast cancer may be driven by specific constellations of genes whose expression is regulated by gene copy number aberrations. To address this question, we analysed a series of 48 microdissected grade III ductal carcinomas using high resolution microarray comparative genomic hybridisation and mRNA expression arrays. There were 5,931 genes whose expression significantly correlates with copy number identified; out of these, 1,897 genes were significantly differentially expressed between basal-like, HER2 and luminal tumours. Ingenuity Pathway Analysis (IPA) revealed that 'G1/S cell cycle regulation' and 'BRCA1 in DNA damage control' pathways were significantly enriched for genes whose expression correlates with copy number and are differentially expressed between the molecular subtypes of breast cancer. IPA of genes whose expression significantly correlates with copy number in each molecular subtype individually revealed that canonical pathways involved in oestrogen receptor (ER) signalling and DNA repair are enriched for these genes. We also identified 32, 157 and 265 genes significantly overexpressed when amplified in basal-like, HER2 and luminal cancers, respectively. These lists include known and novel potential therapeutic targets (e.g. HER2 and PPM1D in HER2 cancers). Our results provide strong circumstantial evidence that different patterns of genetic aberrations in distinct molecular subtypes of breast cancer contribute to their specific transcriptomic profiles and that biological phenomena characteristic of each subtype (e.g. proliferation, HER2 and ER signalling) may be driven by specific patterns of copy number aberrations. PMID:19688261

  2. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna


    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  3. Event monitoring of herbicides with naked and membrane-covered Empore disk integrative passive sampling devices.


    Stephens, B Scott; Kapernick, Anita P; Eaglesham, Geoff; Mueller, Jochen F


    Subsequent to an initial wet season flood event in the Brisbane River, Australia, both fast (naked disk) and slow (membrane-covered) variants of SDB-RPS Empore disk passive sampling devices were deployed with an automated grab sampling program. A trend increase in the aquatic dissolved concentrations of diuron and simazine was observed over a 10-day period. Kinetic and equilibrium parameters for each sampler were calculated based on the dynamic concentration. Absolute percent difference for duplicate passive samples was <10% in the fast and <25% in the slow samplers. For kinetic sampling, significantly shortened integrative periods are available with the fast compared with the slow variant, with higher sampling rates offering improved detection limits. The study demonstrates a method for determining kinetic parameters of passive samplers in a variable concentration field deployment, and illustrates the differences in quality between active and passive data, in terms of capturing changes in concentration associated with rainfall events. PMID:19520390

  4. Reprogrammable field programmable gate array with integrated system for mitigating effects of single event upsets

    NASA Technical Reports Server (NTRS)

    Ng, Tak-kwong (Inventor); Herath, Jeffrey A. (Inventor)


    An integrated system mitigates the effects of a single event upset (SEU) on a reprogrammable field programmable gate array (RFPGA). The system includes (i) a RFPGA having an internal configuration memory, and (ii) a memory for storing a configuration associated with the RFPGA. Logic circuitry programmed into the RFPGA and coupled to the memory reloads a portion of the configuration from the memory into the RFPGA's internal configuration memory at predetermined times. Additional SEU mitigation can be provided by logic circuitry on the RFPGA that monitors and maintains synchronized operation of the RFPGA's digital clock managers.

  5. Online integrated solution to collect data, generate information and manage events in the human biomonitoring field.


    Reis, M Fátima; Tedim, João; Aguiar, Pedro; Miguel, J Pereira; Casteleyn, Ludwine; Joas, Reinhard; Van Tongelen, Birgit


    In the ambit of Work Package 1 of the ESBIO Project, an online integrated solution to collect data, to generate information, and to manage mainly information-sharing events related with human biomonitoring within Europe has been designed and is being implemented. The present paper summarises the methodological approaches used by the authors as proposers, general promoters and disseminators of this strategic concept, as well as the first outcomes and future actions to be taken, in the short and longer term, to face present and future challenges to make this innovative solution happen. PMID:17344095

  6. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    SciTech Connect

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.


    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in

  7. Impact of induced seismic events on seal integrity, Texas Gulf Coast


    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.


    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of amore » section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next step

  8. Integrating the Meaning of Person Names into Discourse Context: An Event-Related Potential Study

    PubMed Central

    Wang, Lin; Yang, Yufang


    The meaning of person names is determined by their associated information. This study used event related potentials to investigate the time course of integrating the newly constructed meaning of person names into discourse context. The meaning of person names was built by two-sentence descriptions of the names. Then we manipulated the congruence of person names relative to discourse context in a way that the meaning of person names either matched or did not match the previous context. ERPs elicited by the names were compared between the congruent and the incongruent conditions. We found that the incongruent names elicited a larger N400 as well as a larger P600 compared to the congruent names. The results suggest that the meaning of unknown names can be effectively constructed from short linguistic descriptions and that the established meaning can be rapidly retrieved and integrated into contexts. PMID:24349462

  9. Heavy-ion induced single-event upset in integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.


    The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

  10. INTEGRAL Upper Limits on Gamma-Ray Emission Associated with the Gravitational Wave Event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, V.; Ferrigno, C.; Mereghetti, S.; Natalucci, L.; Bazzano, A.; Bozzo, E.; Brandt, S.; Courvoisier, T. J.-L.; Diehl, R.; Hanlon, L.; von Kienlin, A.; Kuulkers, E.; Laurent, P.; Lebrun, F.; Roques, J. P.; Ubertini, P.; Weidenspointner, G.


    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we place upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, which was discovered by the LIGO/Virgo Collaboration. The omnidirectional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO triggers. Our upper limits on the hard X-ray fluence at the time of the event range from {F}γ =2× {10}-8 erg cm-2 to {F}γ ={10}-6 erg cm-2 in the 75 keV-2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy E{}γ /E{}{GW}\\lt {10}-6. We discuss the implication of gamma-ray limits for the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission.

  11. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, Volodymyr; Ferrigno, Carlo; Mereghetti, Sandro; Natalucci, Lorenzo; Bazzano, Angela; Bozzo, Enrico; Courvoisier, Thierry J.-L.; Brandt, Soren; Hanlon, Lorraine; Kuulkers, Erik; Laurent, Philippe; Lebrun, François; Roques, Jean-Pierre; Ubertini, Pietro; Weidenspointner, Georg


    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from Fγ=2x10-8 erg cm-2 to Fγ=10-6 erg cm-2 in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy Eγ/EGW<10-6. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission.

  12. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, V.; Ferrigno, C.; Mereghetti, S.; Natalucci, L.; Kuulkers, E.


    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from F_{γ}=2 × 10^{-8} erg cm^{-2} to F_{γ}=10^{-6} erg cm^{-2} in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy E_γ/E_{GW}<10^{-6}. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission. This work has been possible thanks to a Memorandum of Understanding with the LIGO-Virgo scientific collaboration and is presented on behalf of a larger collaboration.

  13. Analysis of Severe Weather Events by Integration of Civil Protection Operation Data

    NASA Astrophysics Data System (ADS)

    Heisterkamp, Tobias; Kox, Thomas


    In Germany, winter storms belong to those natural hazards responsible for the largest damages (GDV 2014). This is a huge challenge for the civil protection, especially in metropolitan areas like Berlin. Nowadays, large-scale storm events are generally well predictable, but detailed forecasts on urban district or even street level are still out of range. Fire brigades, as major stakeholder covering severe weather consequences, operate on this small scale and in the whole area due to their juris-diction. For forensic investigation of disasters this presentation offers an additional approach by using the documentation of fire brigade operations as a new data source. Hazard dimensions and conse-quences of severe weather events are reconstructed via GIS-based analyses of these operations. Local case studies of recent storms are used as a comparison and as an additional information to three WMO weather stations in Berlin. Thus, hot spots of these selected events can be identified by operation site accumulations. Further indicators for Berlin are added to detect aspects that de-termine vulnerabilities. The conclusion discusses the potential of this approach as well as possible benefits of integration into warning systems.

  14. Humans can integrate feedback of discrete events in their sensorimotor control of a robotic hand

    PubMed Central

    Segil, Jacob L.; Clemente, Francesco; Weir, Richard F. ff; Edin, Benoni


    Providing functionally effective sensory feedback to users of prosthetics is a largely unsolved challenge. Traditional solutions require high band-widths for providing feedback for the control of manipulation and yet have been largely unsuccessful. In this study, we have explored a strategy that relies on temporally discrete sensory feedback that is technically simple to provide. According to the Discrete Event-driven Sensory feedback Control (DESC) policy, motor tasks in humans are organized in phases delimited by means of sensory encoded discrete mechanical events. To explore the applicability of DESC for control, we designed a paradigm in which healthy humans operated an artificial robot hand to lift and replace an instrumented object, a task that can readily be learned and mastered under visual control. Assuming that the central nervous system of humans naturally organizes motor tasks based on a strategy akin to DESC, we delivered short-lasting vibrotactile feedback related to events that are known to forcefully affect progression of the grasp-lift-and-hold task. After training, we determined whether the artificial feedback had been integrated with the sensorimotor control by introducing short delays and we indeed observed that the participants significantly delayed subsequent phases of the task. This study thus gives support to the DESC policy hypothesis. Moreover, it demonstrates that humans can integrate temporally discrete sensory feedback while controlling an artificial hand and invites further studies in which inexpensive, noninvasive technology could be used in clever ways to provide physiologically appropriate sensory feedback in upper limb prosthetics with much lower band-width requirements than with traditional solutions. PMID:24992899

  15. Humans can integrate feedback of discrete events in their sensorimotor control of a robotic hand.


    Cipriani, Christian; Segil, Jacob L; Clemente, Francesco; ff Weir, Richard F; Edin, Benoni


    Providing functionally effective sensory feedback to users of prosthetics is a largely unsolved challenge. Traditional solutions require high band-widths for providing feedback for the control of manipulation and yet have been largely unsuccessful. In this study, we have explored a strategy that relies on temporally discrete sensory feedback that is technically simple to provide. According to the Discrete Event-driven Sensory feedback Control (DESC) policy, motor tasks in humans are organized in phases delimited by means of sensory encoded discrete mechanical events. To explore the applicability of DESC for control, we designed a paradigm in which healthy humans operated an artificial robot hand to lift and replace an instrumented object, a task that can readily be learned and mastered under visual control. Assuming that the central nervous system of humans naturally organizes motor tasks based on a strategy akin to DESC, we delivered short-lasting vibrotactile feedback related to events that are known to forcefully affect progression of the grasp-lift-and-hold task. After training, we determined whether the artificial feedback had been integrated with the sensorimotor control by introducing short delays and we indeed observed that the participants significantly delayed subsequent phases of the task. This study thus gives support to the DESC policy hypothesis. Moreover, it demonstrates that humans can integrate temporally discrete sensory feedback while controlling an artificial hand and invites further studies in which inexpensive, noninvasive technology could be used in clever ways to provide physiologically appropriate sensory feedback in upper limb prosthetics with much lower band-width requirements than with traditional solutions. PMID:24992899

  16. Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study.


    Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong


    A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190-210 ms, for 1 kHz stimuli from 170-200 ms, for 2.5 kHz stimuli from 140-200 ms, 5 kHz stimuli from 100-200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300-340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies. PMID:26384256

  17. Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study

    PubMed Central

    Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong


    A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190–210 ms, for 1 kHz stimuli from 170–200 ms, for 2.5 kHz stimuli from 140–200 ms, 5 kHz stimuli from 100–200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300–340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies. PMID:26384256

  18. EEG-based event detection using optimized echo state networks with leaky integrator neurons.


    Ayyagari, Sudhanshu S D P; Jones, Richard D; Weddell, Stephen J


    This study investigates the classification ability of linear and nonlinear classifiers on biological signals using the electroencephalogram (EEG) and examines the impact of architectural changes within the classifier in order to enhance the classification. Consequently, artificial events were used to validate a prototype EEG-based microsleep detection system based around an echo state network (ESN) and a linear discriminant analysis (LDA) classifier. The artificial events comprised infrequent 2-s long bursts of 15 Hz sinusoids superimposed on prerecorded 16-channel EEG data which provided a means of determining and optimizing the accuracy of overall classifier on `gold standard' events. The performance of this system was tested on different signal-to-noise amplitude ratios (SNRs) ranging from 16 down to 0.03. Results from several feature selection/reduction and pattern classification modules indicated that training the classifier using a leaky-integrator neuron ESN structure yielded highest classification accuracy. For datasets with a low SNR of 0.3, training the leaky-neuron ESN using only those features which directly correspond to the underlying event, resulted in a phi correlation of 0.92 compared to 0.37 that employed principal component analysis (PCA). On the same datasets, other classifiers such as LDA and simple ESNs using PCA performed weakly with a correlation of 0.05 and 0 respectively. These results suggest that ESNs with leaky neuron architectures have superior pattern recognition properties. This, in turn, may reflect their superior ability to exploit differences in state dynamics and, hence, provide superior temporal characteristics in learning. PMID:25571328

  19. Altered semantic integration in autism beyond language: a cross-modal event-related potentials study.


    Ribeiro, Tatiane C; Valasek, Claudia A; Minati, Ludovico; Boggio, Paulo S


    Autism spectrum disorders (ASDs) are characterized by impaired communication, particularly pragmatic and semantic language, resulting in verbal comprehension deficits. Semantic processing in these conditions has been studied extensively, but mostly limited only to linguistic material. Emerging evidence, however, suggests that semantic integration deficits may extend beyond the verbal domain. Here, we explored cross-modal semantic integration using visual targets preceded by musical and linguistic cues. Particularly, we have recorded the event-related potentials to evaluate whether the N400 and late positive potential (LPP) components, two widely studied electrophysiological markers of semantic processing, are differently sensitive to congruence with respect to typically developing children. Seven ASD patients and seven neurotypical participants matched by age, education and intelligence quotient provided usable data. Neuroelectric activity was recorded in response to visual targets that were related or unrelated to a preceding spoken sentence or musical excerpt. The N400 was sensitive to semantic congruence in the controls but not the patients, whereas the LPP showed a complementary pattern. These results suggest that semantic processing in ASD children is also altered in the context of musical and visual stimuli, and point to a functional decoupling between the generators of the N400 and LPP, which may indicate delayed semantic processing. These novel findings underline the importance of exploring semantic integration across multiple modalities in ASDs and provide motivation for further investigation in large clinical samples. PMID:23629689

  20. Path-independent integrals to identify localized plastic events in two dimensions.


    Talamali, Mehdi; Petäjä, Viljo; Vandembroucq, Damien; Roux, Stéphane


    We use a power expansion representation of plane-elasticity complex potentials due to Kolossov and Muskhelishvili to compute the elastic fields induced by a localized plastic deformation event. Far from its center, the dominant contributions correspond to first-order singularities of quadrupolar and dipolar symmetry which can be associated, respectively, with pure deviatoric and pure volumetric plastic strain of an equivalent circular inclusion. By construction of holomorphic functions from the displacement field and its derivatives, it is possible to define path-independent Cauchy integrals which capture the amplitudes of these singularities. Analytical expressions and numerical tests on simple finite-element data are presented. The development of such numerical tools is of direct interest for the identification of local structural reorganizations, which are believed to be the key mechanisms for plasticity of amorphous materials. PMID:18764022

  1. Integrated survival analysis using an event-time approach in a Bayesian framework.


    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M


    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  2. Integrated survival analysis using an event-time approach in a Bayesian framework

    PubMed Central

    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M


    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  3. iGEMS: an integrated model for identification of alternative exon usage events.


    Sood, Sanjana; Szkop, Krzysztof J; Nakhuda, Asif; Gallagher, Iain J; Murie, Carl; Brogan, Robert J; Kaprio, Jaakko; Kainulainen, Heikki; Atherton, Philip J; Kujala, Urho M; Gustafsson, Thomas; Larsson, Ola; Timmons, James A


    DNA microarrays and RNAseq are complementary methods for studying RNA molecules. Current computational methods to determine alternative exon usage (AEU) using such data require impractical visual inspection and still yield high false-positive rates. Integrated Gene and Exon Model of Splicing (iGEMS) adapts a gene-level residuals model with a gene size adjusted false discovery rate and exon-level analysis to circumvent these limitations. iGEMS was applied to two new DNA microarray datasets, including the high coverage Human Transcriptome Arrays 2.0 and performance was validated using RT-qPCR. First, AEU was studied in adipocytes treated with (n = 9) or without (n = 8) the anti-diabetes drug, rosiglitazone. iGEMS identified 555 genes with AEU, and robust verification by RT-qPCR (∼90%). Second, in a three-way human tissue comparison (muscle, adipose and blood, n = 41) iGEMS identified 4421 genes with at least one AEU event, with excellent RT-qPCR verification (95%, n = 22). Importantly, iGEMS identified a variety of AEU events, including 3'UTR extension, as well as exon inclusion/exclusion impacting on protein kinase and extracellular matrix domains. In conclusion, iGEMS is a robust method for identification of AEU while the variety of exon usage between human tissues is 5-10 times more prevalent than reported by the Genotype-Tissue Expression consortium using RNA sequencing. PMID:27095197

  4. iGEMS: an integrated model for identification of alternative exon usage events

    PubMed Central

    Sood, Sanjana; Szkop, Krzysztof J.; Nakhuda, Asif; Gallagher, Iain J.; Murie, Carl; Brogan, Robert J.; Kaprio, Jaakko; Kainulainen, Heikki; Atherton, Philip J.; Kujala, Urho M.; Gustafsson, Thomas; Larsson, Ola; Timmons, James A.


    DNA microarrays and RNAseq are complementary methods for studying RNA molecules. Current computational methods to determine alternative exon usage (AEU) using such data require impractical visual inspection and still yield high false-positive rates. Integrated Gene and Exon Model of Splicing (iGEMS) adapts a gene-level residuals model with a gene size adjusted false discovery rate and exon-level analysis to circumvent these limitations. iGEMS was applied to two new DNA microarray datasets, including the high coverage Human Transcriptome Arrays 2.0 and performance was validated using RT-qPCR. First, AEU was studied in adipocytes treated with (n = 9) or without (n = 8) the anti-diabetes drug, rosiglitazone. iGEMS identified 555 genes with AEU, and robust verification by RT-qPCR (∼90%). Second, in a three-way human tissue comparison (muscle, adipose and blood, n = 41) iGEMS identified 4421 genes with at least one AEU event, with excellent RT-qPCR verification (95%, n = 22). Importantly, iGEMS identified a variety of AEU events, including 3′UTR extension, as well as exon inclusion/exclusion impacting on protein kinase and extracellular matrix domains. In conclusion, iGEMS is a robust method for identification of AEU while the variety of exon usage between human tissues is 5–10 times more prevalent than reported by the Genotype-Tissue Expression consortium using RNA sequencing. PMID:27095197

  5. Developing clinical competency in crisis event management: an integrated simulation problem-based learning activity.


    Liaw, S Y; Chen, F G; Klainin, P; Brammer, J; O'Brien, A; Samarasekera, D D


    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session would be superior to those who completed the conventional problem-based session. The students were allocated into either simulation with problem-based discussion (SPBD) or problem-based discussion (PBD) for scenarios on respiratory and cardiac distress. Following completion of each scenario, students from both groups were invited to sit an optional individual test involving a systematic assessment and immediate management of a simulated patient facing a crisis event. A total of thirty students participated in the first post test related to a respiratory scenario and thirty-three participated in the second post test related to a cardiac scenario. Their clinical performances were scored using a checklist. Mean test scores for students completing the SPBD were significantly higher than those who completing the PBD for both the first post test (SPBD 20.08, PBD 18.19) and second post test (SPBD 27.56, PBD 23.07). Incorporation of simulation learning activities into problem-based discussion appeared to be an effective educational strategy for teaching nursing students to assess and manage crisis events. PMID:19916052

  6. Double Power Laws in the Event-integrated Solar Energetic Particle Spectrum

    NASA Astrophysics Data System (ADS)

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.


    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon‑1 of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon‑1 is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  7. Non-parametric frequency analysis of extreme values for integrated disaster management considering probable maximum events

    NASA Astrophysics Data System (ADS)

    Takara, K. T.


    This paper describes a non-parametric frequency analysis method for hydrological extreme-value samples with a size larger than 100, verifying the estimation accuracy with a computer intensive statistics (CIS) resampling such as the bootstrap. Probable maximum values are also incorporated into the analysis for extreme events larger than a design level of flood control. Traditional parametric frequency analysis methods of extreme values include the following steps: Step 1: Collecting and checking extreme-value data; Step 2: Enumerating probability distributions that would be fitted well to the data; Step 3: Parameter estimation; Step 4: Testing goodness of fit; Step 5: Checking the variability of quantile (T-year event) estimates by the jackknife resampling method; and Step_6: Selection of the best distribution (final model). The non-parametric method (NPM) proposed here can skip Steps 2, 3, 4 and 6. Comparing traditional parameter methods (PM) with the NPM, this paper shows that PM often underestimates 100-year quantiles for annual maximum rainfall samples with records of more than 100 years. Overestimation examples are also demonstrated. The bootstrap resampling can do bias correction for the NPM and can also give the estimation accuracy as the bootstrap standard error. This NPM has advantages to avoid various difficulties in above-mentioned steps in the traditional PM. Probable maximum events are also incorporated into the NPM as an upper bound of the hydrological variable. Probable maximum precipitation (PMP) and probable maximum flood (PMF) can be a new parameter value combined with the NPM. An idea how to incorporate these values into frequency analysis is proposed for better management of disasters that exceed the design level. The idea stimulates more integrated approach by geoscientists and statisticians as well as encourages practitioners to consider the worst cases of disasters in their disaster management planning and practices.

  8. Event triggered state estimation techniques for power systems with integrated variable energy resources.


    Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal


    For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

  9. BioContext: an integrated text mining system for large-scale extraction and contextualization of biomolecular events

    PubMed Central

    Gerner, Martin; Sarafraz, Farzaneh; Bergman, Casey M.; Nenadic, Goran


    Motivation: Although the amount of data in biology is rapidly increasing, critical information for understanding biological events like phosphorylation or gene expression remains locked in the biomedical literature. Most current text mining (TM) approaches to extract information about biological events are focused on either limited-scale studies and/or abstracts, with data extracted lacking context and rarely available to support further research. Results: Here we present BioContext, an integrated TM system which extracts, extends and integrates results from a number of tools performing entity recognition, biomolecular event extraction and contextualization. Application of our system to 10.9 million MEDLINE abstracts and 234 000 open-access full-text articles from PubMed Central yielded over 36 million mentions representing 11.4 million distinct events. Event participants included over 290 000 distinct genes/proteins that are mentioned more than 80 million times and linked where possible to Entrez Gene identifiers. Over a third of events contain contextual information such as the anatomical location of the event occurrence or whether the event is reported as negated or speculative. Availability: The BioContext pipeline is available for download (under the BSD license) at, along with the extracted data which is also available for online browsing. Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22711795

  10. An Integrated Cyberenvironment for Event-Driven Environmental Observatory Research and Education

    NASA Astrophysics Data System (ADS)

    Myers, J.; Minsker, B.; Butler, R.


    National environmental observatories will soon provide large-scale data from diverse sensor networks and community models. While much attention is focused on piping data from sensors to archives and users, truly integrating these resources into the everyday research activities of scientists and engineers across the community, and enabling their results and innovations to be brought back into the observatory, also critical to long-term success of the observatories, is often neglected. This talk will give an overview of the Environmental Cyberinfrastructure Demonstrator (ECID) Cyberenvironment for observatory-centric environmental research and education, under development at the National Center for Supercomputing Applications (NCSA), which is designed to address these issues. Cyberenvironments incorporate collaboratory and grid technologies, web services, and other cyberinfrastructure into an overall framework that balances needs for efficient coordination and the ability to innovate. They are designed to support the full scientific lifecycle both in terms of individual experiments moving from data to workflows to publication and at the macro level where new discoveries lead to additional data, models, tools, and conceptual frameworks that augment and evolve community-scale systems such as observatories. The ECID cyberenvironment currently integrates five major components a collaborative portal, workflow engine, event manager, metadata repository, and social network personalization capabilities - that have novel features inspired by the Cyberenvironment concept and enabling powerful environmental research scenarios. A summary of these components and the overall cyberenvironment will be given in this talk, while other posters will give details on several of the components. The summary will be presented within the context of environmental use case scenarios created in collaboration with researchers from the WATERS (WATer and Environmental Research Systems) Network, a

  11. Evolutionary diversification of DYX1C1 transcripts via an HERV-H LTR integration event.


    Kim, Yun-Ji; Huh, Jae-Won; Kim, Dae-Soo; Han, Kyudong; Kim, Hwan-Mook; Kim, Heui-Soo


    DYX1C1 is a candidate gene for developmental dyslexia and has three alternative pre-mRNA spliced forms in the human genome. One of the transcripts contains an HERV-H LTR that could affect the expression level of DYX1C1. We speculate that the HERV-H LTR integrated into the DYX1C1 locus in the catarrhine lineage after its divergence from the platyrrhine lineage. Reverse transcription-PCR of the HERV-H LTR-related transcript produced four alternative forms from several human tissues. All of alternative forms were also identified in various rhesus macaque tissues. Through sequencing analysis of various primate DNA samples, we found that a part of the HERV-H LTR sequence was duplicated within the DYX1C1 exon 9 only in catarrhines. However, the duplication event did not cause frameshift mutation of the DYX1C1 transcript. Taken together, this HERV-H LTR insertion into DYX1C1 has contributed to transcript diversification of DYX1C1 during primate evolution. PMID:22214596

  12. The Knowledge-Integrated Network Biomarkers Discovery for Major Adverse Cardiac Events

    PubMed Central

    Jin, Guangxu; Zhou, Xiaobo; Wang, Honghui; Zhao, Hong; Cui, Kemi; Zhang, Xiang-Sun; Chen, Luonan; Hazen, Stanley L.; Li, King; Wong, Stephen T. C.


    The mass spectrometry (MS) technology in clinical proteomics is very promising for discovery of new biomarkers for diseases management. To overcome the obstacles of data noises in MS analysis, we proposed a new approach of knowledge-integrated biomarker discovery using data from Major Adverse Cardiac Events (MACE) patients. We first built up a cardiovascular-related network based on protein information coming from protein annotations in Uniprot, protein–protein interaction (PPI), and signal transduction database. Distinct from the previous machine learning methods in MS data processing, we then used statistical methods to discover biomarkers in cardiovascular-related network. Through the tradeoff between known protein information and data noises in mass spectrometry data, we finally could firmly identify those high-confident biomarkers. Most importantly, aided by protein–protein interaction network, that is, cardiovascular-related network, we proposed a new type of biomarkers, that is, network biomarkers, composed of a set of proteins and the interactions among them. The candidate network biomarkers can classify the two groups of patients more accurately than current single ones without consideration of biological molecular interaction. PMID:18665624

  13. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    de Araújo Lima, Leandro; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T.; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M.A.; Hakonarson, Hakon; Brentani, Helena


    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two “in silico” protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways. PMID:26947246

  14. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder.


    de Araújo Lima, Leandro; Feio-Dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M A; Hakonarson, Hakon; Brentani, Helena


    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two "in silico" protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways. PMID:26947246

  15. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H.


    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC`s PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  16. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H. )


    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  17. Copying could be costly.


    Allen, A


    Thanks to modern technology, photocopying is quick, easy, and inexpensive. Or is it? One of the largest awards ever made for copyright infringement was levied in a case involving the use of material copied from publications without permission. This article presents a short discussion about US and international copyright protection, fair use, and work for hire. Suggestions for additional information are offered. PMID:1735873

  18. Business Process Design Method Based on Business Event Model for Enterprise Information System Integration

    NASA Astrophysics Data System (ADS)

    Kobayashi, Takashi; Komoda, Norihisa

    The traditional business process design methods, in which the usecase is the most typical, have no useful framework to design the activity sequence with. Therefore, the design efficiency and quality vary widely according to the designer’s experience and skill. In this paper, to solve this problem, we propose the business events and their state transition model (a basic business event model) based on the language/action perspective, which is the result in the cognitive science domain. In the business process design, using this model, we decide event occurrence conditions so that every event synchronizes with each other. We also propose the design pattern to decide the event occurrence condition (a business event improvement strategy). Lastly, we apply the business process design method based on the business event model and the business event improvement strategy to the credit card issue process and estimate its effect.

  19. Creating Single-Copy Genetic Circuits.


    Lee, Jeong Wook; Gyorgy, Andras; Cameron, D Ewen; Pyenson, Nora; Choi, Kyeong Rok; Way, Jeffrey C; Silver, Pamela A; Del Vecchio, Domitilla; Collins, James J


    Synthetic biology is increasingly used to develop sophisticated living devices for basic and applied research. Many of these genetic devices are engineered using multi-copy plasmids, but as the field progresses from proof-of-principle demonstrations to practical applications, it is important to develop single-copy synthetic modules that minimize consumption of cellular resources and can be stably maintained as genomic integrants. Here we use empirical design, mathematical modeling, and iterative construction and testing to build single-copy, bistable toggle switches with improved performance and reduced metabolic load that can be stably integrated into the host genome. Deterministic and stochastic models led us to focus on basal transcription to optimize circuit performance and helped to explain the resulting circuit robustness across a large range of component expression levels. The design parameters developed here provide important guidance for future efforts to convert functional multi-copy gene circuits into optimized single-copy circuits for practical, real-world use. PMID:27425413

  20. Integrated stratigraphy of the Cenomanian-Turonian boundary interval: improving understanding of Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Jarvis, Ian


    The Cenomanian-Turonian boundary (CTB) interval ~ 94 Ma represented a period of major global palaeoenvironmental change. Increasingly detailed multidisciplinary studies integrating sedimentological, palaeontological and geochemical data from multiple basins, are enabling the development of refined but complex models that aid understanding of the mechanisms driving changes in ocean productivity and climate. This paper reviews some of the exciting new developments in this field. Facies change characterizes the CTB interval in most areas. In the Chalk seas of northern Europe, a widespead hiatus was followed by the deposition of clay-rich organic-lean beds of the Plenus Marl and its equivalents, and then nodular chalks. In the North Sea basin and its onshore extension in eastern England and northern Germany, black shales of the Black Band (Blodøks Formation, Hasseltal Formation) occur. Similarly, in northern Tethys, a brief interval of black shale accumulation within a predominantly carbonate succession, is exemplified by the Niveau Thomel in the Vocontian Basin (SE France), and the Livello Bonarelli in Italy. Widespread deposition of organic-rich marine sediments during CTB times led to 12C depletion in surface carbon reservoirs (oceans, atmosphere, biosphere), and a large positive global δ13C excursion preserved in marine carbonates and both marine and terrestrial organic matter (Oceanic Anoxic Event 2). Significant biotic turnover characterises the boundary interval, and inter-regional correlation may be achieved at high resolution using integrated biostratigraphy employing macrofossils (ammonites, inoceramid bivalves), microfossils (planktonic foraminifera, dinoflagellate cysts) and calcareous nannofossils. Correlations can be tested against those based on comparison of δ13C profiles - carbon isotope chemostratigraphy, supplemented by oxygen isotope and elemental data. Interpretation of paired carbonate - organic matter δ13C data from multiple CTB sections

  1. 69. Photographic copy of blueprint copy of original elevations drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    69. Photographic copy of blueprint copy of original elevations drawing (C. Howard Crane, Kenneth Franzheim, architects, Chicago: sheet $6, 1922). Blueprint copy located at William J. Bachman & Partners (Architects)), 5930 Hohman Avenue, Hammond, Indiana 46230, (219) 932-6006. - Indiana Hotel, 5116 Hohman Avenue, Hammond, Lake County, IN

  2. Copying Machine Improvement

    NASA Technical Reports Server (NTRS)


    Manufacturer of the Model 2210 copying machine was looking for a plastic valve bushing material that could be produced by a low-cost injection molding process to replace the unsuitable valve bushing they were using. NERAC conducted a computer search of the NASA database and was able to supply Nashua Corporation with several technical reports in their area of interest. Information aided the company's development of a urethane valve bushing which solved the problem and created a dramatic reduction in unit cost.

  3. Variable copy number DNA sequences in rice.


    Kikuchi, S; Takaiwa, F; Oono, K


    We have cloned two types of variable copy number DNA sequences from the rice embryo genome. One of these sequences, which was cloned in pRB301, was amplified about 50-fold during callus formation and diminished in copy number to the embryonic level during regeneration. The other clone, named pRB401, showed the reciprocal pattern. The copy numbers of both sequences were changed even in the early developmental stage and eliminated from nuclear DNA along with growth of the plant. Sequencing analysis of the pRB301 insert revealed some open reading frames and direct repeat structures, but corresponding sequences were not identified in the EMBL and LASL DNA databases. Sequencing of the nuclear genomic fragment cloned in pRB401 revealed the presence of the 3'rps12-rps7 region of rice chloroplast DNA. Our observations suggest that during callus formation (dedifferentiation), regeneration and the growth process the copy numbers of some DNA sequences are variable and that nuclear integrated chloroplast DNA acts as a variable copy number sequence in the rice genome. Based on data showing a common sequence in mitochondria and chloroplast DNA of maize (Stern and Lonsdale 1982) and that the rps12 gene of tobacco chloroplast DNA is a divided gene (Torazawa et al. 1986), it is suggested that the sequence on the inverted repeat structure of chloroplast DNA may have the character of a movable genetic element. PMID:3481021

  4. Increase of integration events and infection loads of human papillomavirus type 52 with lesion severity from low-grade cervical lesion to invasive cancer.


    Cheung, Jo L K; Cheung, T H; Tang, Julian W T; Chan, Paul K S


    Infection load and the integration of human papillomaviruses (HPV) have been implicated as determinants for oncogenesis, but whether variation among different HPV types exists remains unclear. We investigated 91 women infected with HPV type 52 (HPV-52), a type that is rare worldwide but common in East Asia. The median viral load increased with the severity of the lesion (248 copies/cell equivalent for normal/cervical intraepithelial neoplasia [CIN] grade 1, 402 copies/cell equivalent for CIN 2, 523 copies/cell equivalent for CIN 3, and 1,435 copies/cell equivalent for invasive cancer). The proportion of specimens with integration increased significantly with the severity of the lesion (P < 0.001). The viral load was associated with the physical status of the viral genome, with higher levels for the pure episomal form (P = 0.001). Infection status should be considered when interpreting viral load data for HPV-52, as single infections with this HPV type were found to have marginally higher viral loads than coinfections (P = 0.051). All except one sample had E2 disruption restricted to only a part of the gene. Integration is a critical step in HPV-52-induced carcinogenesis. The profile of E2 disruption was different from that described for HPV-16, with the amino-terminal region being most frequently involved. Selecting the appropriate E2 region for amplification is critical in studying the integration of HPV-52. In summary, the HPV-52 viral load and the integrated proportion increased with the severity of the cervical lesions but had a different pattern than that of HPV-16. PMID:18272718

  5. Integrated Data Products to Forecast, Mitigate, and Educate for Natural Hazard Events Based on Recent and Historical Observations

    NASA Astrophysics Data System (ADS)

    McCullough, H. L.; Dunbar, P. K.; Varner, J. D.


    Immediately following a damaging or fatal natural hazard event there is interest to access authoritative data and information. The National Geophysical Data Center (NGDC) maintains and archives a comprehensive collection of natural hazards data. The NGDC global historic event database includes all tsunami events, regardless of intensity, as well as earthquakes and volcanic eruptions that caused fatalities, moderate damage, or generated a tsunami. Examining the past record provides clues to what might happen in the future. NGDC also archives tide gauge data from stations operated by the NOAA/NOS Center for Operational Oceanographic Products and Services and the NOAA Tsunami Warning Centers. In addition to the tide gauge data, NGDC preserves deep-ocean water-level, 15-second sampled data as collected by the Deep-ocean Assessment and Reporting of Tsunami (DART) buoys. Water-level data provide evidence of sea-level fluctuation and possible inundation events. NGDC houses an extensive collection of geologic hazards photographs available online as digital images. Visual media provide invaluable pre- and post-event data for natural hazards. Images can be used to illustrate inundation and possible damage or effects. These images are organized by event or hazard type (earthquake, volcano, tsunami, landslide, etc.), along with description and location. They may be viewed via interactive online maps and are integrated with historic event details. The planning required to achieve collection and dissemination of hazard event data is extensive. After a damaging or fatal event, NGDC begins to collect and integrate data and information from many people and organizations into the hazards databases. Sources of data include the U.S. NOAA Tsunami Warning Centers, the U.S. Geological Survey, the U.S. NOAA National Data Buoy Center, the UNESCO Intergovernmental Oceanographic Commission (IOC), Smithsonian Institution's Global Volcanism Program, news organizations, etc. NGDC then works to

  6. Single event upset (SEU) sensitivity dependence of linear integrated circuits (ICs) on bias conditions

    SciTech Connect

    Koga, R.; Penzin, S.H.; Crawford, K.B.; Crain, W.R.; Moss, S.C.; Pinkerton, S.D.; LaLumondiere, S.D.; Maher, M.C.


    The single event upset (SEU) sensitivity of certain types of linear microcircuits is strongly affected by bias conditions. For these devices, a model of upset mechanism and a method for SEU control have been suggested.

  7. Method for critical software event execution reliability in high integrity software

    SciTech Connect

    Kidd, M.E.


    This report contains viewgraphs on a method called SEER, which provides a high level of confidence that critical software driven event execution sequences faithfully exceute in the face of transient computer architecture failures in both normal and abnormal operating environments.

  8. Temperature control system for the study of single event effects in integrated circuits using a cyclotron accelerator

    NASA Astrophysics Data System (ADS)

    Bakerenkov, A. S.; Belyakov, V. V.; Kozyukov, A. E.; Pershenkov, V. S.; Solomatin, A. V.; Shurenkov, V. V.


    The temperature control system for the study of single event disruptions produced by hard ion impacts in integrated circuits is described. Heating and cooling of the irradiated device are achieved using thermoelectric modules (Peltier modules). The thermodynamic performance of the system is estimated. The technique for the numerical estimation of the main parameters of the temperature control system for cooling and heating is considered. The results of a test of the system in a vacuum cell of an accelerator are presented.

  9. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data

    PubMed Central

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre


    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  10. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data.


    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre


    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  11. Audiovisual Speech Integration in Pervasive Developmental Disorder: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Magnee, Maurice J. C. M.; de Gelder, Beatrice; van Engeland, Herman; Kemner, Chantal


    Background: Integration of information from multiple sensory sources is an important prerequisite for successful social behavior, especially during face-to-face conversation. It has been suggested that communicative impairments among individuals with pervasive developmental disorders (PDD) might be caused by an inability to integrate synchronously…

  12. 12. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  13. 11. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-1950, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF UPSTREAM WING WALLS. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  14. Estimation of integrated public risks for nonseismic external events affecting the Savannah River Site

    SciTech Connect

    Durant, W.S.; robinette, R.J.; Kirchner, J.R.


    In essence, this study was envisioned as the ``combination`` of existing accident dose and risk calculations from safety analyses of individual facilities. However, because of the extended time period over which the safety analyses were prepared, calculational assumptions and methodologies differed between the analyses. The scope of this study therefore included the standardization of assumptions and calculations as necessary to insure that the analytical logic was consistent for all the facilities. Each of the nonseismic external events considered in the analyses are addressed in individual sections in this report. In Section 2, extreme straight-line winds are examined. Section 3 addresses tornadoes, and Section 4 addresses other external events [floods, other extreme weather events (lightning, hail, and extremes in temperature or precipitation), vehicle impact, accidents involving adjacent facilities, aircraft impact, and meteorite impact]. Section 5 provides a summary of the general conclusions of the report.

  15. The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.


    Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning


    The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing. PMID:27392755

  16. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    EPA Science Inventory

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experi...

  17. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.


    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  18. 10. Photographic copy of copy of original construction drawing, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  19. Bayesian Analysis for Risk Assessment of Selected Medical Events in Support of the Integrated Medical Model Effort

    NASA Technical Reports Server (NTRS)

    Gilkey, Kelly M.; Myers, Jerry G.; McRae, Michael P.; Griffin, Elise A.; Kallrui, Aditya S.


    The Exploration Medical Capability project is creating a catalog of risk assessments using the Integrated Medical Model (IMM). The IMM is a software-based system intended to assist mission planners in preparing for spaceflight missions by helping them to make informed decisions about medical preparations and supplies needed for combating and treating various medical events using Probabilistic Risk Assessment. The objective is to use statistical analyses to inform the IMM decision tool with estimated probabilities of medical events occurring during an exploration mission. Because data regarding astronaut health are limited, Bayesian statistical analysis is used. Bayesian inference combines prior knowledge, such as data from the general U.S. population, the U.S. Submarine Force, or the analog astronaut population located at the NASA Johnson Space Center, with observed data for the medical condition of interest. The posterior results reflect the best evidence for specific medical events occurring in flight. Bayes theorem provides a formal mechanism for combining available observed data with data from similar studies to support the quantification process. The IMM team performed Bayesian updates on the following medical events: angina, appendicitis, atrial fibrillation, atrial flutter, dental abscess, dental caries, dental periodontal disease, gallstone disease, herpes zoster, renal stones, seizure, and stroke.

  20. A new diamond biosensor with integrated graphitic microchannels for detecting quantal exocytic events from chromaffin cells.


    Picollo, Federico; Gosso, Sara; Vittone, Ettore; Pasquarelli, Alberto; Carbone, Emilio; Olivero, Paolo; Carabelli, Valentina


    An MeV ion-microbeam lithographic technique can be successfully employed for the fabrication of an all-carbon miniaturized cellular biosensor based on graphitic microchannels embedded in a single-crystal diamond matrix. The device is functionally characterized for the in vitro recording of quantal exocytic events from single chromaffin cells, with high sensitivity and signal-to-noise ratio, opening promising perspectives for the realization of monolithic all-carbon cellular biosensors. PMID:23847004

  1. Detecting specific health-related events using an integrated sensor system for vital sign monitoring.


    Adnane, Mourad; Jiang, Zhongwei; Choi, Samjin; Jang, Hoyoung


    In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC) and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV) for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data. PMID:22399978

  2. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    ERIC Educational Resources Information Center

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.


    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  3. Experimental determination of single-event upset (SEU) as a function of collected charge in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.; Malone, C. J.; Smith, L. S.


    Single-Event Upset (SEU) in bipolar integrated circuits (ICs) is caused by charge collection from ion tracks in various regions of a bipolar transistor. This paper presents experimental data which have been obtained wherein the range-energy characteristics of heavy ions (Br) have been utilized to determine the cross section for soft-error generation as a function of charge collected from single-particle tracks which penetrate a bipolar static RAM. The results of this work provide a basis for the experimental verification of circuit-simulation SEU modeling in bipolar ICs.

  4. Method and apparatus for increasing resistance of bipolar buried layer integrated circuit devices to single-event upsets

    NASA Technical Reports Server (NTRS)

    Zoutendyk, John A. (Inventor)


    Bipolar transistors fabricated in separate buried layers of an integrated circuit chip are electrically isolated with a built-in potential barrier established by doping the buried layer with a polarity opposite doping in the chip substrate. To increase the resistance of the bipolar transistors to single-event upsets due to ionized particle radiation, the substrate is biased relative to the buried layer with an external bias voltage selected to offset the built-in potential just enough (typically between about +0.1 to +0.2 volt) to prevent an accumulation of charge in the buried-layer-substrate junction.

  5. Counting copy number and calories.


    White, Stefan


    Copy number variation (CNV) at several genomic loci has been associated with different human traits and diseases, but in many cases the findings could not be replicated. A new study provides insights into the degree of variation present at the amylase locus and calls into question a previous association between amylase copy number and body mass index. PMID:26220133

  6. Using Discrete Event Simulation to Model Integrated Commodities Consumption for a Launch Campaign of the Space Launch System

    NASA Technical Reports Server (NTRS)

    Leonard, Daniel; Parsons, Jeremy W.; Cates, Grant


    In May 2013, NASA's GSDO Program requested a study to develop a discrete event simulation (DES) model that analyzes the launch campaign process of the Space Launch System (SLS) from an integrated commodities perspective. The scope of the study includes launch countdown and scrub turnaround and focuses on four core launch commodities: hydrogen, oxygen, nitrogen, and helium. Previously, the commodities were only analyzed individually and deterministically for their launch support capability, but this study was the first to integrate them to examine the impact of their interactions on a launch campaign as well as the effects of process variability on commodity availability. The study produced a validated DES model with Rockwell Arena that showed that Kennedy Space Center's ground systems were capable of supporting a 48-hour scrub turnaround for the SLS. The model will be maintained and updated to provide commodity consumption analysis of future ground system and SLS configurations.

  7. Quantitative hazard assessment at Vulcano (Aeolian islands): integration of geology, event statistics and physical modelling

    NASA Astrophysics Data System (ADS)

    Dellino, Pierfrancesco; de Astis, Gianfilippo; La Volpe, Luigi; Mele, Daniela; Sulpizio, Roberto


    The analysis of stratigraphy and of pyroclastic deposits particle features allowed the reconstruction of the volcanic history of La Fossa di Vulcano. An eruptive scenario driven by superficial phreatomagmatic explosions emerged. A statistical analysis of the pyroclastic Successions led to define a repetitive sequence of dilute pyroclastic density currents as the most probable events at short term, followed by fallout of dense ballistic blocks. The scale of such events is related to the amount of magma involved in each explosion. Events involving a million of cubic meters of magma are probable in view of what happened in the most recent eruptions. They led to the formation of hundreds of meters thick dilute pyroclastic density currents, moving down the volcano slope at velocities exceeding 50 m/sec. The dispersion of desnity currents affected the whole Vulcano Porto area, the Vulcanello area and also overrode the Fossa Caldera's rim, spreading over the Piano area. Similarly, older pyroclastic deposits erupted at different times (Piano Grotte dei Rossi formation, ~20-7.7 ka) from vents within La Fossa Caldera and before La Fossa Cone formation. They also were phreatomagmatic in origin and fed dilute pyroclastic density currents (PDC). They represent the eruptions with the highest magnitude on the Island. Therefore, for the aim of hazard assessment, these deposits from La Fossa Cone and La Fossa Caldera were used to depict eruptive scenarios at short term and at long term. On the base of physical models that make use of pyroclastic deposits particle features, the impact parameters for each scenario have been calculated. They are dynamic pressure and particle volumetric concentration of density currents, and impact energy of ballistic blocks. On this base, a quantitative hazard map is presented, which could be of direct use for territory planning and for the calculation of the expected damage.

  8. Ensuring critical event sequences in high integrity software by applying path expressions

    SciTech Connect

    Kidd, M.E.C.


    The goal of this work is to extend the use of existing path expression theory and methodologies to ensure that critical software event sequences are maintained even in the face of malevolent attacks and harsh or unstable operating environments. This will be accomplished by providing dynamic fault management measures directly to the software developer and to their varied development environments. This paper discusses the perceived problems, a brief overview of path expressions, and the author`s proposed extension areas. The authors discuss how the traditional path expression usage and implementation differs from the intended usage and implementation.

  9. Propensity and Risk Assessment for Solar Particle Events: Consideration of Integral Fluence at High Proton Energies

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee; Hayat, Matthew J.; Feiveson, alan H.; Cucinotta, Francis A.


    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The expected SPE propensity for large proton fluence was estimated from a non-homogeneous Poisson model using the historical database for measurements of protons with energy > 30 MeV, Phi(sub 30). The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made including the 95% confidence level. In addition to total particle intensity of SPE, the detailed energy spectra of protons especially at high energy levels were recognized as extremely important parameter for the risk assessment, since there remains a significant cancer risks from those energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Phi(sub 60) and Phi(sub 100), respectively, the expected propensities of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  10. Escherichia coli O157:H7 strains isolated from “High Event Period” beef contamination have strong biofilm forming ability and low sanitizer susceptibility which are associated with high pO157 plasmid copy number

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the meat industry, a “High Event Period” (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by E. coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute...

  11. Event-triggered logical flow control for comprehensive process integration of multi-step assays on centrifugal microfluidic platforms.


    Kinahan, David J; Kearney, Sinéad M; Dimov, Nikolay; Glynn, Macdara T; Ducrée, Jens


    The centrifugal "lab-on-a-disc" concept has proven to have great potential for process integration of bioanalytical assays, in particular where ease-of-use, ruggedness, portability, fast turn-around time and cost efficiency are of paramount importance. Yet, as all liquids residing on the disc are exposed to the same centrifugal field, an inherent challenge of these systems remains the automation of multi-step, multi-liquid sample processing and subsequent detection. In order to orchestrate the underlying bioanalytical protocols, an ample palette of rotationally and externally actuated valving schemes has been developed. While excelling with the level of flow control, externally actuated valves require interaction with peripheral instrumentation, thus compromising the conceptual simplicity of the centrifugal platform. In turn, for rotationally controlled schemes, such as common capillary burst valves, typical manufacturing tolerances tend to limit the number of consecutive laboratory unit operations (LUOs) that can be automated on a single disc. In this paper, a major advancement on recently established dissolvable film (DF) valving is presented; for the very first time, a liquid handling sequence can be controlled in response to completion of preceding liquid transfer event, i.e. completely independent of external stimulus or changes in speed of disc rotation. The basic, event-triggered valve configuration is further adapted to leverage conditional, large-scale process integration. First, we demonstrate a fluidic network on a disc encompassing 10 discrete valving steps including logical relationships such as an AND-conditional as well as serial and parallel flow control. Then we present a disc which is capable of implementing common laboratory unit operations such as metering and selective routing of flows. Finally, as a pilot study, these functions are integrated on a single disc to automate a common, multi-step lab protocol for the extraction of total RNA from

  12. Seamless prevention of adverse events from tattooing: integrated strategy emphasising the customer-tattooist interaction.


    Serup, Jørgen


    The boom in tattooing has been paralleled by more frequent adverse events, which may be localised in the skin or systemic and manifested clinically or latent. Infections, allergic reactions from red-coloured tattoos and papulo-nodular reactions from black tattoos dominate. Mild complaints are very common, with 1/5 of all tattooed individuals having acquired sensitivity to sunlight in the tattooed skin. The potential risk of cancer due to potential carcinogens in some tattoo inks has hitherto not manifested in clinical reports, despite the millions of people who have been tattooed over many decades. A risk of death from tattooing remains associated with severe infection, i.e. sepsis. Preventive strategies may rely on focused preventions, and sterility and preservation of ink is essential, rational and knowledge-based. The chemical and particle contents of ink nanoparticles cannot be unrestricted; however, focused control of ink is facing many uncertainties, including analytical problems, lack of identification of allergens in ink and discrepancies between the content of potential carcinogens and manifestation of cancer in the clinic. The concept of seamless prevention is introduced as a pragmatic strategy that emphasises the customer-tattooist interaction, which is the 'engine' of tattoo safety. This strategy amalgamates the range of narrow-scope preventive instruments and shall ensure that any relevant instrument is used actively and without deficiency or drop out, thus resulting in a complete orchestration of a multi-targeted strategy. High-priority elements of this strategy shall facilitate a qualified 'go' or 'no go' decision by the customer before the tattoo is made and should involve informed consent, qualification of the tattooist and the parlour, including supplies of inks etc., and attention to hygienic security. Records and documentation of tattoo cases with complications and the culprit inks as well as the establishment of national or European

  13. Gene copy number and cell cycle arrest

    NASA Astrophysics Data System (ADS)

    Ghosh, Bhaswar; Bose, Indrani


    The cell cycle is an orderly sequence of events which ultimately lead to the division of a single cell into two daughter cells. In the case of DNA damage by radiation or chemicals, the damage checkpoints in the G1 and G2 phases of the cell cycle are activated. This results in an arrest of the cell cycle so that the DNA damage can be repaired. Once this is done, the cell continues with its usual cycle of activity. We study a mathematical model of the DNA damage checkpoint in the G2 phase which arrests the transition from the G2 to the M (mitotic) phase of the cell cycle. The tumor suppressor protein p53 plays a key role in activating the pathways leading to cell cycle arrest in mammalian systems. If the DNA damage is severe, the p53 proteins activate other pathways which bring about apoptosis, i.e., programmed cell death. Loss of the p53 gene results in the proliferation of cells containing damaged DNA, i.e., in the growth of tumors which may ultimately become cancerous. There is some recent experimental evidence which suggests that the mutation of a single copy of the p53 gene (in the normal cell each gene has two identical copies) is sufficient to trigger the formation of tumors. We study the effect of reducing the gene copy number of the p53 and two other genes on cell cycle arrest and obtain results consistent with experimental observations.

  14. Photographic copy of undated drawing. Printed copy located in plan ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of undated drawing. Printed copy located in plan files at the New Orleans Public Belt Railroad Administration Office at 5100 Jefferson Highway, Jefferson, Louisiana 70123. Draftsman Unknown. DRAWING OF ENTIRE BRIDGE PLAN AND PARTIAL NORTHEAST ELEVATION. PROPERTY OF NEW ORLEANS PUBLIC BELT RAILROAD. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

  15. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  16. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.


    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  17. Integrating Recent Data in Managing Adverse Events in the Treatment of Hepatocellular Carcinoma

    PubMed Central

    Gish, Robert G.; Abou-Alfa, Ghassan K.; Tong, Myron J.


    Hepatocellular carcinoma (HCC) is a major cause of cancer-related morbidity and mortality worldwide. In the United States, HCC is the main cause of death in patients with cirrhosis, and the incidence of this malignancy is on the rise. Because HCC is associated with a particularly poor prognosis, emphasis is placed on surveillance of high-risk patients. Early detection allows a greater chance of diagnosing HCC before it has spread, thus increasing the chances that the patient can be potentially cured with surgical techniques such as resection and transplantation. However, most cases of HCC are not diagnosed until at least some of the cancer has spread or multiple nodules exist. For these patients, treatment options include percutaneous and transarterial ablation, as well as systemic chemotherapy. Systemic therapy is now considered the standard of care for patients with advanced tumors. Traditional treatment was based on cytotoxic chemotherapeutic agents, such as doxorubicin. This approach was associated with minimal benefit and a high rate of toxicity. Recently, targeted agents have proven more effective and safer in this setting. The oral multikinase inhibitor sorafenib is now approved for the treatment of unresectable HCC and is currently the only approved agent for advanced HCC. In order to maximize the benefit of sorafenib and other investigational agents for patients with advanced disease, effective interventions have been designed to mitigate their associated adverse events, such as hand-foot skin reactions and hypertension. PMID:22423222

  18. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.


    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L


    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result. PMID:27327179

  19. Whole transcriptome characterization of aberrant splicing events induced by lentiviral vector integrations

    PubMed Central

    Cesana, Daniela; Sgualdino, Jacopo; Rudilosso, Laura; Merella, Stefania; Naldini, Luigi; Montini, Eugenio


    Gamma-retroviral/lentiviral vectors (γRV/LV) with self-inactivating (SIN) long terminal repeats (LTRs) and internal moderate cellular promoters pose a reduced risk of insertional mutagenesis when compared with vectors with active LTRs. Yet, in a recent LV-based clinical trial for β-thalassemia, vector integration within the HMGA2 gene induced the formation of an aberrantly spliced mRNA form that appeared to cause clonal dominance. Using a method that we developed, cDNA linear amplification-mediated PCR, in combination with high-throughput sequencing, we conducted a whole transcriptome analysis of chimeric LV-cellular fusion transcripts in transduced human lymphoblastoid cells and primary hematopoietic stem/progenitor cells. We observed a surprising abundance of read-through transcription originating outside and inside the provirus and identified the vector sequences contributing to the aberrant splicing process. We found that SIN LV has a sharply reduced propensity to engage in aberrant splicing compared with that of vectors carrying active LTRs. Moreover, by recoding the identified vector splice sites, we reduced residual read-through transcription and demonstrated an effective strategy for improving vectors. Characterization of the mechanisms and genetic features underlying vector-induced aberrant splicing will enable the generation of safer vectors, with low impact on the cellular transcriptome. PMID:22523064

  20. Causal Factors and Adverse Events of Aviation Accidents and Incidents Related to Integrated Vehicle Health Management

    NASA Technical Reports Server (NTRS)

    Reveley, Mary S.; Briggs, Jeffrey L.; Evans, Joni K.; Jones, Sharon M.; Kurtoglu, Tolga; Leone, Karen M.; Sandifer, Carl E.


    Causal factors in aviation accidents and incidents related to system/component failure/malfunction (SCFM) were examined for Federal Aviation Regulation Parts 121 and 135 operations to establish future requirements for the NASA Aviation Safety Program s Integrated Vehicle Health Management (IVHM) Project. Data analyzed includes National Transportation Safety Board (NSTB) accident data (1988 to 2003), Federal Aviation Administration (FAA) incident data (1988 to 2003), and Aviation Safety Reporting System (ASRS) incident data (1993 to 2008). Failure modes and effects analyses were examined to identify possible modes of SCFM. A table of potential adverse conditions was developed to help evaluate IVHM research technologies. Tables present details of specific SCFM for the incidents and accidents. Of the 370 NTSB accidents affected by SCFM, 48 percent involved the engine or fuel system, and 31 percent involved landing gear or hydraulic failure and malfunctions. A total of 35 percent of all SCFM accidents were caused by improper maintenance. Of the 7732 FAA database incidents affected by SCFM, 33 percent involved landing gear or hydraulics, and 33 percent involved the engine and fuel system. The most frequent SCFM found in ASRS were turbine engine, pressurization system, hydraulic main system, flight management system/flight management computer, and engine. Because the IVHM Project does not address maintenance issues, and landing gear and hydraulic systems accidents are usually not fatal, the focus of research should be those SCFMs that occur in the engine/fuel and flight control/structures systems as well as power systems.

  1. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data

    PubMed Central

    Zuo, Yun-juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun


    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  2. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data.


    Zhao, Liang; Jiang, Xi-Wang; Zuo, Yun-Juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun


    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  3. Functionally integrated neural processing of linguistic and talker information: An event-related fMRI and ERP study.


    Zhang, Caicai; Pugh, Kenneth R; Mencl, W Einar; Molfese, Peter J; Frost, Stephen J; Magnuson, James S; Peng, Gang; Wang, William S-Y


    Speech signals contain information of both linguistic content and a talker's voice. Conventionally, linguistic and talker processing are thought to be mediated by distinct neural systems in the left and right hemispheres respectively, but there is growing evidence that linguistic and talker processing interact in many ways. Previous studies suggest that talker-related vocal tract changes are processed integrally with phonetic changes in the bilateral posterior superior temporal gyrus/superior temporal sulcus (STG/STS), because the vocal tract parameter influences the perception of phonetic information. It is yet unclear whether the bilateral STG is also activated by the integral processing of another parameter - pitch, which influences the perception of lexical tone information and is related to talker differences in tone languages. In this study, we conducted separate functional magnetic resonance imaging (fMRI) and event-related potential (ERP) experiments to examine the spatial and temporal loci of interactions of lexical tone and talker-related pitch processing in Cantonese. We found that the STG was activated bilaterally during the processing of talker changes when listeners attended to lexical tone changes in the stimuli and during the processing of lexical tone changes when listeners attended to talker changes, suggesting that lexical tone and talker processing are functionally integrated in the bilateral STG. It extends the previous study, providing evidence for a general neural mechanism of integral phonetic and talker processing in the bilateral STG. The ERP results show interactions of lexical tone and talker processing 500-800ms after auditory word onset (a simultaneous posterior P3b and a frontal negativity). Moreover, there is some asymmetry in the interaction, such that unattended talker changes affect linguistic processing more than vice versa, which may be related to the ambiguity that talker changes cause in speech perception and/or attention bias

  4. Event-related potential indices of congruency sequence effects without feature integration or contingency learning confounds.


    Larson, Michael J; Clayson, Peter E; Kirwan, C Brock; Weissman, Daniel H


    The congruency effect in Stroop-like tasks (i.e., increased response time and reduced accuracy in incongruent relative to congruent trials) is often smaller when the previous trial was incongruent as compared to congruent. This congruency sequence effect (CSE) is thought to reflect cognitive control processes that shift attention to the target and/or modulate the response engendered by the distracter differently after incongruent relative to congruent trials. The neural signatures of CSEs are therefore usually attributed to cognitive control processes that minimize distraction from irrelevant stimuli. However, CSEs in previous functional neuroimaging studies were ubiquitously confounded with feature integration and/or contingency learning processes. We therefore investigated whether a neural CSE can be observed without such confounds in a group of healthy young adults (n = 56). To this end, we combined a prime-probe task that lacks such confounds with high-density ERPs to identify, for the first time, the neural time course of confound-minimized CSEs. Replicating recent behavioral findings, we observed strong CSEs in this task for mean response time and mean accuracy. Critically, conceptually replicating prior ERP results from confounded tasks, we also observed a CSE in both the parietal conflict slow potential (conflict SP) and the frontomedial N450. These findings indicate for the first time that neural CSEs as indexed by ERPs can be observed without the typical confounds. More broadly, the present study provides a confound-minimized protocol that will help future researchers to better isolate the neural bases of control processes that minimize distraction from irrelevant stimuli. PMID:26854028

  5. An integrated model for three-dimensional cohesive sediment transport in storm event and its application on Lianyungang Harbor, China

    NASA Astrophysics Data System (ADS)

    Yang, Xiaochen; Zhang, Qinghe; Zhang, Jinfeng; Tan, Feng; Wu, Yuru; Zhang, Na; Yang, Hua; Pang, Qixiu


    Prediction of cohesive sediment transport in storm process is important for both navigation safety and environment of the coastal zone. The difficulties to simulate cohesive sediment transport for a small-scale area such as around a harbor during storm events mainly include the low spatial resolution of the present reanalysis atmosphere forcing, the complex hydrodynamic and sediment transport processes, and their interactions. In this paper, an integrated atmosphere-wave-3D hydrodynamic and cohesive sediment transport model with unstructured grid, which is comprised of the Weather Research and Forecasting (WRF) model, Simulating WAves Nearshore (SWAN) model, and Finite-Volume Coastal Ocean Model (FVCOM), was developed to solve the abovementioned problems. For cohesive sediment, the flocculation and hindered settling were included, and a self-weight consolidation processes was introduced to the existing FVCOM. Interactions between components were considered by providing data fields to each other in an offline manner. The integrated model was applied to simulate cohesive sediment transport around Lianyungang Harbor, China, during Typhoon Wipha in 2007. Results identify that the atmosphere model WRF performed better in the simulation of wind field during typhoon process compared with QuikSCAT/National Centers for Environmental Prediction (QSCAT/NCEP) data. Simulation of wave model was directly affected by wind results as wave vector field driven by WRF wind field showed anticlockwise vortex while waves driven by QSCAT/NCEP wind field did not. The influence of water elevation and flow field on waves was great at the nearshore area. However, the effect of wave on current was not apparent, while the wind field played a more important role, especially on the current velocity. The cohesive sediment transport was greatly affected by wave due to the combined wave-current-induced shear stress. In general, simulation results of wind, wave, current, and sediment showed

  6. Integrating Remote Sensing Data, Hybrid-Cloud Computing, and Event Notifications for Advanced Rapid Imaging & Analysis (Invited)

    NASA Astrophysics Data System (ADS)

    Hua, H.; Owen, S. E.; Yun, S.; Lundgren, P.; Fielding, E. J.; Agram, P.; Manipon, G.; Stough, T. M.; Simons, M.; Rosen, P. A.; Wilson, B. D.; Poland, M. P.; Cervelli, P. F.; Cruz, J.


    Space-based geodetic measurement techniques such as Interferometric Synthetic Aperture Radar (InSAR) and Continuous Global Positioning System (CGPS) are now important elements in our toolset for monitoring earthquake-generating faults, volcanic eruptions, hurricane damage, landslides, reservoir subsidence, and other natural and man-made hazards. Geodetic imaging's unique ability to capture surface deformation with high spatial and temporal resolution has revolutionized both earthquake science and volcanology. Continuous monitoring of surface deformation and surface change before, during, and after natural hazards improves decision-making from better forecasts, increased situational awareness, and more informed recovery. However, analyses of InSAR and GPS data sets are currently handcrafted following events and are not generated rapidly and reliably enough for use in operational response to natural disasters. Additionally, the sheer data volumes needed to handle a continuous stream of InSAR data sets also presents a bottleneck. It has been estimated that continuous processing of InSAR coverage of California alone over 3-years would reach PB-scale data volumes. Our Advanced Rapid Imaging and Analysis for Monitoring Hazards (ARIA-MH) science data system enables both science and decision-making communities to monitor areas of interest with derived geodetic data products via seamless data preparation, processing, discovery, and access. We will present our findings on the use of hybrid-cloud computing to improve the timely processing and delivery of geodetic data products, integrating event notifications from USGS to improve the timely processing for response, as well as providing browse results for quick looks with other tools for integrative analysis.

  7. LGM hosing approach to Heinrich Event 1: results and perspectives from data-model integration using water isotopes

    NASA Astrophysics Data System (ADS)

    Roche, Didier M.; Paillard, Didier; Caley, Thibaut; Waelbroeck, Claire


    Freshwater hosing has long been used in climate models to represent the perturbation associated with the release of icebergs during Heinrich Events. However, freshwater hosing ignores some of the icebergs-induced feedbacks on climate. It therefore bears the question whether the perturbed climate obtained through classical freshwater hosing experiments is realistic enough to be used as a proxy for a Heinrich Event. Using the fully coupled, water isotope enabled, climate model iLOVECLIM, we conducted a series of freshwater hosing experiments, accounting for the depleted signature of ice-sheet sourced water, under LGM conditions. Using paleoceanographic data, we integrated simulated and measured δ18Ocalcite at the surface and within the ocean column to evaluate whether (i) LGM freshwater hosing is a good proxy for Heinrich Event 1 and whether (ii) different sources for the freshwater in the North Atlantic result in different spatial anomalies that could be used to fingerprint the source of melt water. Results obtained with two sets of experiments indicate that first order simulated δ18Ocalcite anomalies are broadly consistent with the measured anomalies and that a complete shutdown of the thermohaline circulation is not consistent with the reconstructed patterns from foraminiferal calcite. A more detailed statistical analysis of the planktic and benthic δ18Ocalcite anomalies shows that the best experiment is obtained for a severely disturbed thermohaline circulation but not a complete shutdown. With our model sensitivity, this corresponds to a freshwater flux between 0.18 Sv and 0.3 Sv. Our results also indicate a better agreement when the freshwater flux is applied in the Labrador Sea than when directly applied to the Ruddiman Belt.

  8. Integration of sensory information precedes the sensation of vection: a combined behavioral and event-related brain potential (ERP) study.


    Keshavarz, Behrang; Berti, Stefan


    Illusory self-motion (known as vection) describes the sensation of ego-motion in the absence of physical movement. Vection typically occurs in stationary observers being exposed to visual information that suggest self-motion (e.g. simulators, virtual reality). In the present study, we tested whether sensory integration of visual information triggers vection: participants (N=13) perceived patterns of moving altered black-and-white vertical stripes on a screen that was divided into a central and a surrounding peripheral visual field. In both fields the pattern was either moving or stationary, resulting in four combinations of central and peripheral motions: (1) central and peripheral stripes moved into the same direction, (2) central and peripheral stripes moved in opposite directions, or (3) either the central or (4) the peripheral stripes were stable while the other stripes were in motion. This stimulation induced vection: Results showed significantly higher vection ratings when the stationary center of the pattern was surrounded by a moving periphery. Event-related potentials mirrored this finding: The occipital N2 was largest with stationary central and moving peripheral stripes. Our findings suggest that sensory integration of peripheral and central visual information triggers the perception of vection. Furthermore, we found evidence that neural processes precede the subjective perception of vection strength prior to the actual onset of vection. We will discuss our findings with respect to the role of stimulus eccentricity, stimulus' depth, and neural correlates involved during the genesis of vection. PMID:24211538

  9. Zero-Copy Objects System

    NASA Technical Reports Server (NTRS)

    Burleigh, Scott C.


    Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.

  10. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2011 CFR


    ... 26 Internal Revenue 18 2011-04-01 2011-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  11. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2010 CFR


    ... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  12. To Copy-Protect or Not to Copy-Protect?

    ERIC Educational Resources Information Center

    Sacks, Jonathan


    Discusses the issues of software piracy, why people illegally copy software, protection afforded software developers by copyright laws, and current and future methods of disk-based protection built into software by developers and the problems these methods have created. (MBR)

  13. Copy number variation and mutation

    NASA Astrophysics Data System (ADS)

    Clark, Brian; Weidner, Jacob; Wabick, Kevin


    Until very recently, the standard model of DNA included two genes for each trait. This dated model has given way to a model that includes copies of some genes well in excess of the canonical two. Copy number variations in the human genome play critical roles in causing or aggravating a number of syndromes and diseases while providing increased resistance to others. We explore the role of mutation, crossover, inversion, and reproduction in determining copy number variations in a numerical simulation of a population. The numerical model consists of a population of individuals, where each individual is represented by a single strand of DNA with the same number of genes. Each gene is initially assigned to one of two traits. Fitness of the individual is determined by the two most fit genes for trait one, and trait two genetic material is treated as a reservoir of junk DNA. After a sufficient number of generations, during which the genetic distribution is allowed to reach a steady-state, the mean numberof genes per trait and the copy number variation are recorded. Here, we focus on the role of mutation and compare simulation results to theory.

  14. Copying Services and Copyright Infringement

    ERIC Educational Resources Information Center

    College Store Journal (Sec 1), 1977


    The impact of the Copyright Revision Act of 1976 on copying services supplied by many college stores is assessed. It is suggested that even unsupervised photocopying of copyrighted books and periodicals may constitute vicarious infringement by the store, but that in an academic environment, photocopying may constitute defensible "fair use." (LBH)

  15. Efficient Integration of Old and New Research Tools for Automating the Identification and Analysis of Seismic Reference Events

    SciTech Connect

    Wagner, Robert; Rivers, Wilmer


    any single computer program for seismic data analysis will not have all the capabilities needed to study reference events, since hese detailed studies will be highly specialized. It may be necessary to develop and test new algorithms, and then these special ;odes must be integrated with existing software to use their conventional data-processing routines. We have investigated two neans of establishing communications between the legacy and new codes: CORBA and XML/SOAP Web services. We have nvestigated making new Java code communicate with a legacy C-language program, geotool, running under Linux. Both methods vere successful, but both were difficult to implement. C programs on UNIX/Linux are poorly supported for Web services, compared vith the Java and .NET languages and platforms. Easier-to-use middleware will be required for scientists to construct distributed applications as easily as stand-alone ones. Considerable difficulty was encountered in modifying geotool, and this problem shows he need to use component-based user interfaces instead of large C-language codes where changes to one part of the program nay introduce side effects into other parts. We have nevertheless made bug fixes and enhancements to that legacy program, but t remains difficult to expand it through communications with external software.

  16. Integral probability of auroral electron flux events from SSJ/4 DMSP F9 electron measurements. Interim report

    SciTech Connect

    Hardy, D.A.; Bounar, K.H.


    A study has been completed to determine the probability of observing different levels of auroral electron precipitation both within fixed spatial elements in magnetic local time and corrected geomagnetic latitude, and within spatial elements when the magnetic local time is fixed but the latitude range can be varied. The auroral electron precipitation probability is defined for a series of thresholds in electron average energy and electron energy flux as a function of geomagnetic activity. The study provides the capability to determine the probability of observation of an auroral electron precipitation event for any specified threshold in average energy, energy flux, and level of geomagnetic activity for any location in the auroral region or for any line of sight through the auroral region. The input for the study is one year of data from the SSJ/4 electron and proton spectrometer flown on the F9 satellite of the Defense Meteorological Satellite Program (DMSP) comprising approximately 10, 141 hemispheric passes through the auroral region. The binning technique used to determine these probabilities is presented and some results are discussed. The operation of the software package to display the probability results is described. Defense Meteorological Satellite Program (DMSP), Aurora, Precipitating electrons, Geomagnetic Kp index, Integral probability.

  17. Event Analysis of Systemic Teamwork (EAST): a novel integration of ergonomics methods to analyse C4i activity.


    Walker, Guy H; Gibson, Huw; Stanton, Neville A; Baber, Chris; Salmon, Paul; Green, Damian

    C4i is defined as the management infrastructure needed for the execution of a common goal supported by multiple agents in multiple locations and technology. In order to extract data from complex and diverse C4i scenarios a descriptive methodology called Event Analysis for Systemic Teamwork (EAST) has been developed. With over 90 existing ergonomics methodologies already available, the approach taken was to integrate a hierarchical task analysis, a coordination demand analysis, a communications usage diagram, a social network analysis, and the critical decision method. The outputs of these methods provide two summary representations in the form of an enhanced operation sequence diagram and a propositional network. These offer multiple overlapping perspectives on key descriptive constructs including who the agents are in a scenario, when tasks occur, where agents are located, how agents collaborate and communicate, what information is used, and what knowledge is shared. The application of these methods to live data drawn from the UK rail industry demonstrates how alternative scenarios can be compared on key metrics, how multiple perspectives on the same data can be taken, and what further detailed insights can be extracted. The ultimate aim of EAST is, by applying it across a number of scenarios in different civil and military domains, to provide data to develop generic models of C4i activity and to improve the design of systems aimed at enhancing this management infrastructure. PMID:17008260

  18. Using the Integration of Discrete Event and Agent-Based Simulation to Enhance Outpatient Service Quality in an Orthopedic Department.


    Kittipittayakorn, Cholada; Ying, Kuo-Ching


    Many hospitals are currently paying more attention to patient satisfaction since it is an important service quality index. Many Asian countries' healthcare systems have a mixed-type registration, accepting both walk-in patients and scheduled patients. This complex registration system causes a long patient waiting time in outpatient clinics. Different approaches have been proposed to reduce the waiting time. This study uses the integration of discrete event simulation (DES) and agent-based simulation (ABS) to improve patient waiting time and is the first attempt to apply this approach to solve this key problem faced by orthopedic departments. From the data collected, patient behaviors are modeled and incorporated into a massive agent-based simulation. The proposed approach is an aid for analyzing and modifying orthopedic department processes, allows us to consider far more details, and provides more reliable results. After applying the proposed approach, the total waiting time of the orthopedic department fell from 1246.39 minutes to 847.21 minutes. Thus, using the correct simulation model significantly reduces patient waiting time in an orthopedic department. PMID:27195606

  19. Determination of Transgene Copy Number by Real-time Quantitative-PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Efficient methods to characterize transgenic plants are important to quickly understand the state of the transformant. Determining transgene copy number is an important step in transformant characterization and can differentiate between complex and simple transformation events. This knowledge can ...

  20. Using Copy Change with Trade Books to Teach Earth Science

    ERIC Educational Resources Information Center

    Bintz, William P.; Wright, Pam; Sheffer, Julie


    Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

  1. FSHD: copy number variations on the theme of muscular dystrophy

    PubMed Central

    Cabianca, Daphne Selvaggia


    In humans, copy number variations (CNVs) are a common source of phenotypic diversity and disease susceptibility. Facioscapulohumeral muscular dystrophy (FSHD) is an important genetic disease caused by CNVs. It is an autosomal-dominant myopathy caused by a reduction in the copy number of the D4Z4 macrosatellite repeat located at chromosome 4q35. Interestingly, the reduction of D4Z4 copy number is not sufficient by itself to cause FSHD. A number of epigenetic events appear to affect the severity of the disease, its rate of progression, and the distribution of muscle weakness. Indeed, recent findings suggest that virtually all levels of epigenetic regulation, from DNA methylation to higher order chromosomal architecture, are altered at the disease locus, causing the de-regulation of 4q35 gene expression and ultimately FSHD. PMID:21149563

  2. Comparison of Hydrologic Parameter Estimates Using Sequential and Integrated Data Fusion During a GPR Monitored Infiltration Event

    NASA Astrophysics Data System (ADS)

    Sicilia, G. T.; Moysey, S. M.


    Constraining parameters that govern variably saturated flow is important for applications ranging from quantifying water availability for ecosystems to constraining recharge rates and contaminant fluxes to groundwater. In this study we explore the effectiveness of sequential versus integrated data fusion for estimating unsaturated flow parameters using ground penetrating radar (GPR) data. In Sequential Data Fusion (SDF), geophysical imaging is used to create a map of the geophysical properties of the subsurface. Subsequently these properties are transformed to hydrologic properties that can be used to constrain an independent hydrologic inverse problem. In contrast, Integrated Data Fusion (IDF) uses the geophysical data to directly constrain hydrologic properties of interest without performing the intermediate geophysical imaging step. Our comparison of SDF and IDF is performed for a synthetic study of 2D infiltration into a homogeneous soil from a constant flux point source located at the ground surface. Here we focus on results for the estimation of intrinsic permeability (k) from cross- borehole GPR travel times collected throughout the duration of the infiltration event. The target permeability (k=7.4x10-12m2) is uniform over the 20 meter by 20 meter area modeled in this study; though the soil is homogeneous, we emphasize that water content is both spatially variable and transient. We use TOUGH2 to simulate infiltration, MATLAB to simulate GPR travel times, and PEST to perform the parameter estimation. To quantitatively compare SDF and IDF, we calculate the normalized error in estimated permeability for each method. In our study, we investigated the performance of the data fusion methods under varying survey geometries by changing the antenna spacing. In all cases we have found that IDF significantly outperforms SDF. For large antenna separations (1.7-6.7m) SDF produces an average error in estimated permeability of 78.6% while IDF errors are only 35.4%. As ray

  3. The auditory-visual integration of anger is impaired in alcoholism: an event-related potentials study

    PubMed Central

    Maurage, Pierre; Philippot, Pierre; Joassin, Frédéric; Pauwels, Laurie; Pham, Tierry; Prieto, Esther Alonso; Palmero-Soler, Ernesto; Zanow, Franck; Campanella, Salvatore


    Objectives Chronic alcoholism leads to impaired visual and auditory processing of emotions, but the cross-modal (auditory-visual) processing of emotional stimuli has not yet been explored. Our objectives were to describe the electrophysiological correlates of unimodal (visual and auditory) impairments in emotion processing in people suffering from alcoholism, to determine whether this deficit is general or emotion-specific, and to explore potential deterioration in the specific cross-modal integration processes in alcoholism. Methods We used an emotion-detection task, with recording of event-related potentials (ERPs), in which 15 patients suffering from alcoholism and 15 matched healthy control subjects were asked to detect the emotion (angry, happy or neutral) displayed by auditory, visual or auditory-visual stimuli. Behavioural performance and ERP data recorded between June 2005 and April 2006 were analyzed. Results ERPs demonstrated that the deficit in alcoholism originates earlier in the cognitive stream than has previously been described (mainly P300), namely, at the level of specific face (N170) and voice (N2) perceptive processing. Moreover, while patients with alcoholism did not show impaired processing of happy and neutral audio-visual stimuli, they did have a specific impairment in the cross-modal processing of anger. A source location analysis was used to confirm and illustrate the results. Conclusion These results suggest that the specific deficit that people with alcoholism demonstrate in processing anger stimuli, widely described in clinical situations but not clearly identified in earlier studies (using unimodal stimuli), is particularly obvious during cross-modal processing, which is more common than unimodal processing in everyday life. PMID:18330457

  4. Gribov copies and anomalous scaling

    SciTech Connect

    Holdom, B.


    Nonperturbative and lattice methods indicate that Gribov copies modify the infrared behavior of gauge theories and cause a suppression of gluon propagation. We investigate whether this can be implemented in a modified perturbation theory. The minimal modification proceeds via a nonlocal generalization of the Fadeev-Popov ghost that automatically decouples from physical states. The expected scale invariance of the physics associated with Gribov copies leads to the emergence of a nontrivial infrared fixed point. For a range of a scaling exponent the gauge bosons exhibit unparticlelike behavior in the infrared. The confining regime of interest for QCD requires a larger scaling exponent, but then the severity of ghost dominance upsets naive power counting for the infrared scaling behavior of amplitudes.

  5. Multiple functionally divergent and conserved copies of alpha tubulin in bdelloid rotifers

    PubMed Central


    Background Bdelloid rotifers are microscopic animals that have apparently survived without sex for millions of years and are able to survive desiccation at all life stages through a process called anhydrobiosis. Both of these characteristics are believed to have played a role in shaping several unusual features of bdelloid genomes discovered in recent years. Studies into the impact of asexuality and anhydrobiosis on bdelloid genomes have focused on understanding gene copy number. Here we investigate copy number and sequence divergence in alpha tubulin. Alpha tubulin is conserved and normally present in low copy numbers in animals, but multiplication of alpha tubulin copies has occurred in animals adapted to extreme environments, such as cold-adapted Antarctic fish. Using cloning and sequencing we compared alpha tubulin copy variation in four species of bdelloid rotifers and four species of monogonont rotifers, which are facultatively sexual and cannot survive desiccation as adults. Results were verified using transcriptome data from one bdelloid species, Adineta ricciae. Results In common with the typical pattern for animals, monogonont rotifers contain either one or two copies of alpha tubulin, but bdelloid species contain between 11 and 13 different copies, distributed across five classes. Approximately half of the copies form a highly conserved group that vary by only 1.1% amino acid pairwise divergence with each other and with the monogonont copies. The other copies have divergent amino acid sequences that evolved significantly faster between classes than within them, relative to synonymous changes, and vary in predicted biochemical properties. Copies of each class were expressed under the laboratory conditions used to construct the transcriptome. Conclusions Our findings are consistent with recent evidence that bdelloids are degenerate tetraploids and that functional divergence of ancestral copies of genes has occurred, but show how further duplication events

  6. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae


    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  7. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2011 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  8. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2014 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  9. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2010 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  10. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2012 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  11. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2013 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  12. 14 CFR § 1206.207 - Copies.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Copies. § 1206.207 Section § 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  13. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false File copies. 703.20 Section... Is Not a Party § 703.20 File copies. The Office of the General Counsel will maintain the official file of copies of all demands served on the Library and deciding officials' responses....

  14. 48 CFR 2901.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 2901.105-3 Section 2901.105-3 Federal Acquisition Regulations System DEPARTMENT OF LABOR GENERAL DEPARTMENT OF LABOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2901.105-3 Copies. Copies of the DOLAR published in the Federal Register, CD-ROM, or Code...

  15. Patterns, Correlates, and Reduction of Homework Copying

    ERIC Educational Resources Information Center

    Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.


    Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days…

  16. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form...

  17. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR


    ... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form...

  18. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2012 CFR


    ... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form...

  19. Microarray analysis of copy number variation in single cells.


    Konings, Peter; Vanneste, Evelyne; Jackmaert, Sigrun; Ampe, Michèle; Verbeke, Geert; Moreau, Yves; Vermeesch, Joris Robert; Voet, Thierry


    We present a protocol for reliably detecting DNA copy number aberrations in a single human cell. Multiple displacement-amplified DNAs of a cell are hybridized to a 3,000-bacterial artificial chromosome (BAC) array and to an Affymetrix 250,000 (250K)-SNP array. Subsequent copy number calling is based on the integration of BAC probe-specific copy number probabilities that are estimated by comparing probe intensities with a single-cell whole-genome amplification (WGA) reference model for diploid chromosomes, as well as SNP copy number and loss-of-heterozygosity states estimated by hidden Markov models (HMM). All methods for detecting DNA copy number aberrations in single human cells have difficulty in confidently discriminating WGA artifacts from true genetic variants. Furthermore, some methods lack thorough validation for segmental DNA imbalance detection. Our protocol minimizes false-positive variant calling and enables uniparental isodisomy detection in single cells. Additionally, it provides quality assessment, allowing the exclusion of uninterpretable single-cell WGA samples. The protocol takes 5-7 d. PMID:22262009

  20. Generation of Backbone-Free, Low Transgene Copy Plants by Launching T-DNA from the Agrobacterium Chromosome1[W][OA

    PubMed Central

    Oltmanns, Heiko; Frame, Bronwyn; Lee, Lan-Ying; Johnson, Susan; Li, Bo; Wang, Kan; Gelvin, Stanton B.


    In both applied and basic research, Agrobacterium-mediated transformation is commonly used to introduce genes into plants. We investigated the effect of three Agrobacterium tumefaciens strains and five transferred (T)-DNA origins of replication on transformation frequency, transgene copy number, and the frequency of integration of non-T-DNA portions of the T-DNA-containing vector (backbone) into the genome of Arabidopsis (Arabidopsis thaliana) and maize (Zea mays). Launching T-DNA from the picA locus of the Agrobacterium chromosome increases the frequency of single transgene integration events and almost eliminates the presence of vector backbone sequences in transgenic plants. Along with novel Agrobacterium strains we have developed, our findings are useful for improving the quality of T-DNA integration events. PMID:20023148

  1. What Triggered the Recent Melt Event at Summit, Greenland? Insights from an Integrated Suite of Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Miller, N.; Pettersen, C.; Walden, V. P.; Turner, D. D.; Shupe, M.; Bennartz, R.; Neff, W. D.; Cox, C.; Kulie, M.; Castellani, B.


    The melt extent of the Greenland Ice Sheet (GIS) has been increasing in recent decades. According to a NASA press release, satellite observations show that the GIS melt extent was an anomalously high 97% in mid-July 2012, including rare melting at high altitude locations such as Summit, Greenland. This event was also captured by ground-based observations at Summit, collected by the ICECAPS (Integrated Characterization of Energy, Clouds, Atmospheric State, and Precipitation at Summit) project. The observational data also recorded increased variability in the atmospheric state for July 2012 compared to the July 2010 and 2011. One of the outliers on 11 July 2012 produced ice melt temperatures at Summit, Greenland for the first time since observational records began. The origin of the warm airmass that affected Summit on 11 July 2012 was traced to the central United States on 1 July 2012. Instead of flowing around the southern tip of Greenland, the airmass was forced over central Greenland and thus lifted to over 3200m by the thickness of the GIS. Temperature retrievals from a microwave radiometer (MWR) observed a warm front arriving on 10 July 2012, which included RH values close to saturation as recorded by a NOAA met tower. Elevated precipitable water vapor levels suggest ripe conditions for liquid water clouds. A low level liquid cloud was observed by a micropulse lidar (MPL) and a millimeter cloud radar (MMCR) from 10-11 July 2012 with elevated liquid water content retrieved from the MWRs. Observations from an infrared spectrometer (PAERI) instrument indicate increased downwelling longwave fluxes during this time. The liquid water cloud effectively traps the heat thus limiting the surface's ability to cool radiatively. Surface-based inversions are common during clear sky scenes but liquid bearing clouds often weaken these inversions. In combination with solar heating, this can create surface temperatures warmer than the air aloft. A conceptual surface energy

  2. Copying and Evolution of Neuronal Topology

    PubMed Central

    Fernando, Chrisantha; Karishma, K. K.; Szathmáry, Eörs


    We propose a mechanism for copying of neuronal networks that is of considerable interest for neuroscience for it suggests a neuronal basis for causal inference, function copying, and natural selection within the human brain. To date, no model of neuronal topology copying exists. We present three increasingly sophisticated mechanisms to demonstrate how topographic map formation coupled with Spike-Time Dependent Plasticity (STDP) can copy neuronal topology motifs. Fidelity is improved by error correction and activity-reverberation limitation. The high-fidelity topology-copying operator is used to evolve neuronal topologies. Possible roles for neuronal natural selection are discussed. PMID:19020662

  3. Genomic pathology of SLE-associated copy-number variation at the FCGR2C/FCGR3B/FCGR2B locus.


    Mueller, Michael; Barros, Paula; Witherden, Abigail S; Roberts, Amy L; Zhang, Zhou; Schaschl, Helmut; Yu, Chack-Yung; Hurles, Matthew E; Schaffner, Catherine; Floto, R Andres; Game, Laurence; Steinberg, Karyn Meltz; Wilson, Richard K; Graves, Tina A; Eichler, Evan E; Cook, H Terence; Vyse, Timothy J; Aitman, Timothy J


    Reduced FCGR3B copy number is associated with increased risk of systemic lupus erythematosus (SLE). The five FCGR2/FCGR3 genes are arranged across two highly paralogous genomic segments on chromosome 1q23. Previous studies have suggested mechanisms for structural rearrangements at the FCGR2/FCGR3 locus and have proposed mechanisms whereby altered FCGR3B copy number predisposes to autoimmunity, but the high degree of sequence similarity between paralogous segments has prevented precise definition of the molecular events and their functional consequences. To pursue the genomic pathology associated with FCGR3B copy-number variation, we integrated sequencing data from fosmid and bacterial artificial chromosome clones and sequence-captured DNA from FCGR3B-deleted genomes to establish a detailed map of allelic and paralogous sequence variation across the FCGR2/FCGR3 locus. This analysis identified two highly paralogous 24.5 kb blocks within the FCGR2C/FCGR3B/FCGR2B locus that are devoid of nonpolymorphic paralogous sequence variations and that define the limits of the genomic regions in which nonallelic homologous recombination leads to FCGR2C/FCGR3B copy-number variation. Further, the data showed evidence of swapping of haplotype blocks between these highly paralogous blocks that most likely arose from sequential ancestral recombination events across the region. Functionally, we found by flow cytometry, immunoblotting and cDNA sequencing that individuals with FCGR3B-deleted alleles show ectopic presence of FcγRIIb on natural killer (NK) cells. We conclude that FCGR3B deletion juxtaposes the 5'-regulatory sequences of FCGR2C with the coding sequence of FCGR2B, creating a chimeric gene that results in an ectopic accumulation of FcγRIIb on NK cells and provides an explanation for SLE risk associated with reduced FCGR3B gene copy number. PMID:23261299

  4. Low copy number of the salivary amylase gene predisposes to obesity.


    Falchi, Mario; El-Sayed Moustafa, Julia Sarah; Takousis, Petros; Pesce, Francesco; Bonnefond, Amélie; Andersson-Assarsson, Johanna C; Sudmant, Peter H; Dorajoo, Rajkumar; Al-Shafai, Mashael Nedham; Bottolo, Leonardo; Ozdemir, Erdal; So, Hon-Cheong; Davies, Robert W; Patrice, Alexandre; Dent, Robert; Mangino, Massimo; Hysi, Pirro G; Dechaume, Aurélie; Huyvaert, Marlène; Skinner, Jane; Pigeyre, Marie; Caiazzo, Robert; Raverdy, Violeta; Vaillant, Emmanuel; Field, Sarah; Balkau, Beverley; Marre, Michel; Visvikis-Siest, Sophie; Weill, Jacques; Poulain-Godefroy, Odile; Jacobson, Peter; Sjostrom, Lars; Hammond, Christopher J; Deloukas, Panos; Sham, Pak Chung; McPherson, Ruth; Lee, Jeannette; Tai, E Shyong; Sladek, Robert; Carlsson, Lena M S; Walley, Andrew; Eichler, Evan E; Pattou, Francois; Spector, Timothy D; Froguel, Philippe


    Common multi-allelic copy number variants (CNVs) appear enriched for phenotypic associations compared to their biallelic counterparts. Here we investigated the influence of gene dosage effects on adiposity through a CNV association study of gene expression levels in adipose tissue. We identified significant association of a multi-allelic CNV encompassing the salivary amylase gene (AMY1) with body mass index (BMI) and obesity, and we replicated this finding in 6,200 subjects. Increased AMY1 copy number was positively associated with both amylase gene expression (P = 2.31 × 10(-14)) and serum enzyme levels (P < 2.20 × 10(-16)), whereas reduced AMY1 copy number was associated with increased BMI (change in BMI per estimated copy = -0.15 (0.02) kg/m(2); P = 6.93 × 10(-10)) and obesity risk (odds ratio (OR) per estimated copy = 1.19, 95% confidence interval (CI) = 1.13-1.26; P = 1.46 × 10(-10)). The OR value of 1.19 per copy of AMY1 translates into about an eightfold difference in risk of obesity between subjects in the top (copy number > 9) and bottom (copy number < 4) 10% of the copy number distribution. Our study provides a first genetic link between carbohydrate metabolism and BMI and demonstrates the power of integrated genomic approaches beyond genome-wide association studies. PMID:24686848

  5. Patterns, correlates, and reduction of homework copying

    NASA Astrophysics Data System (ADS)

    Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.


    Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days prior to the deadline, whereas repetitive copiers (those who copied >30% of their submitted problems) exerted little effort early. Importantly, copying homework problems that require an analytic answer correlates with a 2(σ) decline over the semester in relative score for similar problems on exams but does not significantly correlate with the amount of conceptual learning as measured by pretesting and post-testing. An anonymous survey containing questions used in many previous studies of self-reported academic dishonesty showed ˜1/3 less copying than actually was detected. The observed patterns of copying, free response questions on the survey, and interview data suggest that time pressure on students who do not start their homework in a timely fashion is the proximate cause of copying. Several measures of initial ability in math or physics correlated with copying weakly or not at all. Changes in course format and instructional practices that previous self-reported academic dishonesty surveys and/or the observed copying patterns suggested would reduce copying have been accompanied by more than a factor of 4 reduction of copying from ˜11% of all electronic problems to less than 3%. As expected (since repetitive copiers have approximately three times the chance of failing), this was accompanied by a reduction in the overall course failure rate. Survey results indicate that students copy almost twice as much written homework as online homework and show that students nationally admit to more academic dishonesty than MIT students.

  6. Deep sequencing of the hepatitis B virus in hepatocellular carcinoma patients reveals enriched integration events, structural alterations and sequence variations.


    Toh, Soo Ting; Jin, Yu; Liu, Lizhen; Wang, Jingbo; Babrzadeh, Farbod; Gharizadeh, Baback; Ronaghi, Mostafa; Toh, Han Chong; Chow, Pierce Kah-Hoe; Chung, Alexander Y-F; Ooi, London L-P-J; Lee, Caroline G-L


    Chronic hepatitis B virus (HBV) infection is epidemiologically associated with hepatocellular carcinoma (HCC), but its role in HCC remains poorly understood due to technological limitations. In this study, we systematically characterize HBV in HCC patients. HBV sequences were enriched from 48 HCC patients using an oligo-bead-based strategy, pooled together and sequenced using the FLX-Genome-Sequencer. In the tumors, preferential integration of HBV into promoters of genes (P < 0.001) and significant enrichment of integration into chromosome 10 (P < 0.01) were observed. Integration into chromosome 10 was significantly associated with poorly differentiated tumors (P < 0.05). Notably, in the tumors, recurrent integration into the promoter of the human telomerase reverse transcriptase (TERT) gene was found to correlate with increased TERT expression. The preferred region within the HBV genome involved in integration and viral structural alteration is at the 3'-end of hepatitis B virus X protein (HBx), where viral replication/transcription initiates. Upon integration, the 3'-end of the HBx is often deleted. HBx-human chimeric transcripts, the most common type of chimeric transcripts, can be expressed as chimeric proteins. Sequence variation resulting in non-conservative amino acid substitutions are commonly observed in HBV genome. This study highlights HBV as highly mutable in HCC patients with preferential regions within the host and virus genome for HBV integration/structural alterations. PMID:23276797

  7. An operational integrated short-term warning solution for solar radiation storms: introducing the Forecasting Solar Particle Events and Flares (FORSPEF) system

    NASA Astrophysics Data System (ADS)

    Anastasiadis, Anastasios; Sandberg, Ingmar; Papaioannou, Athanasios; Georgoulis, Manolis; Tziotziou, Kostas; Jiggens, Piers; Hilgers, Alain


    We present a novel integrated prediction system, of both solar flares and solar energetic particle (SEP) events, which is in place to provide short-term warnings for hazardous solar radiation storms. FORSPEF system provides forecasting of solar eruptive events, such as solar flares with a projection to coronal mass ejections (CMEs) (occurrence and velocity) and the likelihood of occurrence of a SEP event. It also provides nowcasting of SEP events based on actual solar flare and CME near real-time alerts, as well as SEP characteristics (peak flux, fluence, rise time, duration) per parent solar event. The prediction of solar flares relies on a morphological method which is based on the sophisticated derivation of the effective connected magnetic field strength (Beff) of potentially flaring active-region (AR) magnetic configurations and it utilizes analysis of a large number of AR magnetograms. For the prediction of SEP events a new reductive statistical method has been implemented based on a newly constructed database of solar flares, CMEs and SEP events that covers a large time span from 1984-2013. The method is based on flare location (longitude), flare size (maximum soft X-ray intensity), and the occurrence (or not) of a CME. Warnings are issued for all > C1.0 soft X-ray flares. The warning time in the forecasting scheme extends to 24 hours with a refresh rate of 3 hours while the respective warning time for the nowcasting scheme depends on the availability of the near real-time data and falls between 15-20 minutes. We discuss the modules of the FORSPEF system, their interconnection and the operational set up. The dual approach in the development of FORPSEF (i.e. forecasting and nowcasting scheme) permits the refinement of predictions upon the availability of new data that characterize changes on the Sun and the interplanetary space, while the combined usage of solar flare and SEP forecasting methods upgrades FORSPEF to an integrated forecasting solution. This

  8. Aggregate Remote Memory Copy Interface

    Energy Science and Technology Software Center (ESTSC)


    The purpose of the Aggregate Remote Memory Copy (ARMCI) library is to provide a general- purpose, efficient, and Widely portable remote memory access (RMA) operations (one-sided communication) optimized for Contiguous and noncontiguous (strided, scatter/gather, I/O vector) data transfers. In addition, ARMCI includes a set of atomic and mutual exclusion operations. The development ARMCI is driven by the need to support the global-addres space communication model in context of distributed regular or irregular distributed data structures,more » communication libraries, and compilers. ARMCI is a standalone system that could be used to support user-level libraries and applications that use MPI or PVM.« less

  9. Simple approach to soft-copy quality monitoring

    NASA Astrophysics Data System (ADS)

    Reiker, Gregory G.; Gohel, Nilesh R.; Muka, Edward; Blaine, G. James


    As presentation of medical radiographic images on soft-copy displays (cathode ray tubes) becomes increasingly prevalent in electronic radiography, methods of quality assurance must be developed to ensure that radiologists can effectively transfer film-based reading skills. Luminance measurements provide the basis for evaluating the state of soft-copy displays. An integrated approach has been implemented at Mallinckrodt Institute of Radiology (MIR) which facilitates measurement of geographically distributed soft-copy displays with centralized data logging, performance tracking and calibration. MIR''s central radiology image manager (RIM) exercises the display station which drives the monitor, harvests the measurement data, stores the results and submits the resulting data for additional processing. The luminance measurements are collected by a small, portable photometric instrument designed at MIR that includes a serial port which is accessed via local area terminal service (LAT) supported by the RIM. The design details of the photometric instrument and example luminance characteristics of several soft-copy displays used at the Mallinckrodt Institute are presented in this paper.

  10. Copy Number Variation in the Horse Genome

    PubMed Central

    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J.; Fang, Erica; Juras, Rytis; Cothran, E. Gus; McDonell, Sue; Kenney, Daniel G.; Lear, Teri L.; Adelson, David L.; Chowdhary, Bhanu P.; Raudsepp, Terje


    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches. PMID:25340504

  11. A spatio-temporal reconstruction of sea surface temperature during Dansgaard-Oeschger events from model-data integration

    NASA Astrophysics Data System (ADS)

    Jensen, Mari F.; Nummelin, Aleksi; Borg Nielsen, Søren; Sadatzki, Henrik; Sessford, Evangeline; Kleppin, Hannah; Risebrobakken, Bjørg; Born, Andreas


    Proxy data suggests a large variability in the North Atlantic sea surface temperature (SST) and sea ice cover during the Dansgaard Oeschger (DO) events of the last glacial. However, the mechanisms behind these changes are still debated. It is not clear whether the ocean temperatures are controlled by forced changes in the northward ocean heat transport or by local surface fluxes, or if, instead, the SST changes can be explained by internal variability. We address these questions by analyzing a full DO event using proxy-surrogate reconstructions. This method provides a means to extrapolate the temporally accurate information from scarce proxy reconstructions with the spatial and physical consistency of climate models. Model simulations are treated as a pool of possible ocean states from which the closest match to the reconstructions, e.g., one model year, is selected based on an objective cost function. The original chronology of the model is replaced by that of the proxy data. Repeating this algorithm for each proxy time step yields a comprehensive four-dimensional dataset that is consistent with reconstructed data. In addition, the solution also includes variables and locations for which no reconstructions exist. We show that by only using climate model data from the preindustrial control simulations, we are able to reconstruct the SST variability in the subpolar gyre region over the DO event. In the eastern Nordic Seas, on the other hand, we lack the amplitude of the variations while capturing the temporal pattern. Based on our analysis, we suggest that the variability of the subpolar gyre during the analyzed DO event can be explained by internal variability of the climate system alone. Further research is needed to explain whether the lacking amplitude in the Nordic Seas is due to the model deficiencies or if external forcing or some feedback mechanisms could give rise to larger SST variability.

  12. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2010 CFR


    ... revised information. Each licensee shall maintain a copy of the written report of an event submitted under... maintain a current log and record the safeguards events described in paragraphs II (a) and (b) of...

  13. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in CFR form may be purchased from the Superintendent of Documents, Government Printing Office, Washington, D.C. 20402. Requests should reference Chapter 4 of Title 48 CFR....

  14. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13 Copies required. (a) Subject to paragraph (c) of this section, two duplicate originals and fifty...

  15. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2011 CFR


    ... 22 Foreign Relations 2 2011-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13 Copies required. (a) Subject to paragraph (c) of this section, two duplicate originals and fifty...

  16. 14 CFR 249.4 - Photographic copies.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Photographic copies. 249.4 Section 249.4 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS PRESERVATION OF AIR CARRIER RECORDS General Instructions § 249.4 Photographic copies. (a) Any record may be transferred...

  17. The impact of global events in the Deep Sea biosphere: An integrated ichnological, geochemical and stratigraphical approach

    NASA Astrophysics Data System (ADS)

    Cummings, John; Hodgson, David; Jeffery-Abt, Charlotte; Worden, Richard


    Keywords: Ichnology, Palaeocene-Eocene Thermal Maximum, Clay mineralogy, SGR, Basque Basin Here the effects of the K-Pg event and the PETM on benthic macrofauna communities are constrained using an ichnological approach. In most basins, the mass extinction witnessed at the K-Pg boundary is not recognised in deep sea trace fossil communities. On a global scale, trace fossil diversity actually experiences a diversity burst following the K-Pg event, culminating in a Phanerozoic peak in diversity during the earliest Eocene. This diversity peak of deep sea trace fossil communities is inconsistent with the Palaeocene - Eocene boundary extinction of 50% of benthic foraminifera taxa. . Initial climate cooling following the K-Pg event was soon replaced by a disorderly period in the Earth's climate history whereby the background ‘greenhouse' conditions were punctuated by a number of rapid, transient hyperthermal events. The most prominent of these events was the Palaeocene-Eocene Thermal Maximum (PETM). Sea surface temperatures and bottom temperatures soared by as much as 10°C in as little as 1000 years. Extensive research has been published concerning the biotic and geochemical effect of the PETM. Detailed ichnological data obtained from 9 localities in the Basque basin, northeast Spain, spanning the mid Palaeocene-early Eocene is presented here. This data not only allows the effects of the PETM on benthic macrofauna communities to be measured but also allows rigorous testing of the utility of trace fossil assemblages in determining submarine fan environments of deposition during periods of climatic extremes. The Basque Basin provides an ideal natural laboratory to study this period of Earth's history as there are many K-Pg and PETM outcrops, usually rich in trace fossils. High resolution clay mineralogical analyses have been conducted utilising XRD, FT-IR and field based spectral gamma ray (SGR) measurements to provide an insight into weathering patterns on the

  18. A Framework of Knowledge Integration and Discovery for Supporting Pharmacogenomics Target Predication of Adverse Drug Events: A Case Study of Drug-Induced Long QT Syndrome

    PubMed Central

    Jiang, Guoqian; Wang, Chen; Zhu, Qian; Chute, Christopher G.


    Knowledge-driven text mining is becoming an important research area for identifying pharmacogenomics target genes. However, few of such studies have been focused on the pharmacogenomics targets of adverse drug events (ADEs). The objective of the present study is to build a framework of knowledge integration and discovery that aims to support pharmacogenomics target predication of ADEs. We integrate a semantically annotated literature corpus Semantic MEDLINE with a semantically coded ADE knowledgebase known as ADEpedia using a semantic web based framework. We developed a knowledge discovery approach combining a network analysis of a protein-protein interaction (PPI) network and a gene functional classification approach. We performed a case study of drug-induced long QT syndrome for demonstrating the usefulness of the framework in predicting potential pharmacogenomics targets of ADEs. PMID:24303306

  19. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, Lower Eocene, northwest Wyoming, USA)

    USGS Publications Warehouse

    Bown, T.M.; Kraus, M.J.


    An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The reviewed Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain apects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. -from Authors

  20. The oscillatory activities and its synchronization in auditory-visual integration as revealed by event-related potentials to bimodal stimuli

    NASA Astrophysics Data System (ADS)

    Guo, Jia; Xu, Peng; Yao, Li; Shu, Hua; Zhao, Xiaojie


    Neural mechanism of auditory-visual speech integration is always a hot study of multi-modal perception. The articulation conveys speech information that helps detect and disambiguate the auditory speech. As important characteristic of EEG, oscillations and its synchronization have been applied to cognition research more and more. This study analyzed the EEG data acquired by unimodal and bimodal stimuli using time frequency and phase synchrony approach, investigated the oscillatory activities and its synchrony modes behind evoked potential during auditory-visual integration, in order to reveal the inherent neural integration mechanism under these modes. It was found that beta activity and its synchronization differences had relationship with gesture N1-P2, which happened in the earlier stage of speech coding to pronouncing action. Alpha oscillation and its synchronization related with auditory N1-P2 might be mainly responsible for auditory speech process caused by anticipation from gesture to sound feature. The visual gesture changing enhanced the interaction of auditory brain regions. These results provided explanations to the power and connectivity change of event-evoked oscillatory activities which matched ERPs during auditory-visual speech integration.

  1. Reconstruction of multiple tectonic events in continental margins by integrated tectonostratigraphic and geochronological analysis: the Mesozoic to Paleogene Caribbean-South American interaction in northeastern Colombia

    NASA Astrophysics Data System (ADS)

    Cardona, Agustin; Montes, Camilo; Bayona, German; Valencia, Victor; Ramirez, Diego; Zapata, Sebastian; Lara, Mario; Lopez-Martinez, Margarita; Thomson, Stuart; Weber, Marion


    Although the older record and successive tectonic scenarios experienced by a continental margin is commonly fragmentary, integrated field, petrological and geochronological analysis can reconstruct the long term tectonic evolution of continental margins and characterized major controls on the orogenic style. We present new geochronological constraints from igneous and low to very low grade metasedimentary rocks from the Caribbean continental margin of northeastern Colombia (Guajira region) in order to reconstruct the different tectonic events recorded by the margin before, during and following the arc-continent collision with the front of the Caribbean plate. Zircon U-Pb LA-ICP-MS geochronology results from leucogranites associated with garnet amphibolites, tonalites and volcanic rocks that made the continental basement of northeastern Colombia reveals and Early to Middle Mesozoic tectonic activity with peaks at ca. 220-230 Ma and 170-180 Ma. This magmatic record is related to a collisional belt link to the final agglutination of Pangea and was followed by an overimposed far field back-arc setting associated to the subduction of the Pacific (Farrallon) plate under the Pangea supercontinent. Muscovite and biotite Ar-Ar geochronology from basement rocks and low grade Mesozoic metasediments also reveals the existence of Middle Jurassic to Early Cretaceous thermal events link to the final opening of the proto-Caribbean ocean. The South American continental margin was subsequently affected by an arc-continent collisional event with the front of the Caribbean plate. This event is recorded by the growth of a Banda-type collisional melange that mixed South American continental margin sediments with mafic and ultramafic blocks of intra-oceanic arc origin, the formation of a coherent metasedimentary belt also made of South American margin sediments, and the mylonitization of the continental basement. Ar-Ar temporal constraints on the low grade metasedimentary rocks and

  2. Flexible readout and integration sensor (FRIS): a bio-inspired, system-on-chip, event-based readout architecture

    NASA Astrophysics Data System (ADS)

    Lin, Joseph H.; Pouliquen, Philippe O.; Andreou, Andreas G.; Goldberg, Arnold C.; Rizk, Charbel G.


    We present a bio-inspired system-on-chip focal plane readout architecture which at the system level, relies on an event based sampling scheme where only pixels within a programmable range of photon flux rates are output. At the pixel level, a one bit oversampled analog-to-digital converter together with a decimator allows for the quantization of signals up to 26 bits. Furthermore, digital non-uniformity correction of both gain and offset errors is applied at the pixel level prior to readout. We report test results for a prototype array fabricated in a standard 90nm CMOS process. Tests performed at room and cryogenic temperatures demonstrate the capability to operate at a temporal noise ratio as low as 1.5, an electron well capacity over 100Ge-, and an ADC LSB down to 1e-.

  3. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, lower Eocene, northwest Wyoming, USA)

    SciTech Connect

    Brown, T.M. ); Kraus, M.J. )


    Relative paleosol maturities are inversely proportional to the accumulation rates of the sediment upon which they formed, and are therefore excellent relative indicators of how much geologic time elapsed between any two horizons. An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The revised Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain aspects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. The first faunal turnover occurs at the base of the Willwood Formation. It coincides with a major increase in pedogenic maturity, reflecting a major decrease in sediment accumulation rate, and accompanying general climatic warming at about the time of the Paleocene-Eocene boundary. Throughout the remainder of Willwood time, there was a gradual, yet continual, decrease in paleosol maturity and degree of hydromorphy, probably related to the progressive structural elevation of the Owl Creek antiform bounding the south and southeast margins of the Bighorn Basin. This gradual decrease was punctuated by two intervals of more significant decline in paleosol maturity and in the incidence of hydromorphic soils. Both intervals are also marked by faunal turnovers. These sedimentologic and biologic events may reflect tectonic, periods when the rate of basin subsidence increased more rapidly. 58 refs., 7 figs., 2 tabs.

  4. Integration of Harvest and Time-to-Event Data Used to Estimate Demographic Parameters for White-tailed Deer

    NASA Astrophysics Data System (ADS)

    Norton, Andrew S.

    An integral component of managing game species is an understanding of population dynamics and relative abundance. Harvest data are frequently used to estimate abundance of white-tailed deer. Unless harvest age-structure is representative of the population age-structure and harvest vulnerability remains constant from year to year, these data alone are of limited value. Additional model structure and auxiliary information has accommodated this shortcoming. Specifically, integrated age-at-harvest (AAH) state-space population models can formally combine multiple sources of data, and regularization via hierarchical model structure can increase flexibility of model parameters. I collected known fates data, which I evaluated and used to inform trends in survival parameters for an integrated AAH model. I used temperature and snow depth covariates to predict survival outside of the hunting season, and opening weekend temperature and percent of corn harvest covariates to predict hunting season survival. When auxiliary empirical data were unavailable for the AAH model, moderately informative priors provided sufficient information for convergence and parameter estimates. The AAH model was most sensitive to errors in initial abundance, but this error was calibrated after 3 years. Among vital rates, the AAH model was most sensitive to reporting rates (percentage of mortality during the hunting season related to harvest). The AAH model, using only harvest data, was able to track changing abundance trends due to changes in survival rates even when prior models did not inform these changes (i.e. prior models were constant when truth varied). I also compared AAH model results with estimates from the Wisconsin Department of Natural Resources (WIDNR). Trends in abundance estimates from both models were similar, although AAH model predictions were systematically higher than WIDNR estimates in the East study area. When I incorporated auxiliary information (i.e. integrated AAH model

  5. Integrated Analysis of Asian Dust Events from CALIPSO Space Lidar Data in Conjunction with Passive Remote Sensing and Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Choi, H.; Sokolik, I. N.; Winker, D. M.; Kurosaki, Y.


    The vast arid regions of East Asia are active dust sources. Each spring, large amounts of mineral dust are emitted into the atmosphere, affecting the regional air quality, environment and climate. This study presents analyses of Asian dust events by integrating CALIPSO lidar data with A-Train satellite multi-sensor observations (Ozone Monitoring Instrument, OMI, and Moderate-Resolution Imaging Spectroradiometer, MODIS) as well as ground-based observations. We use data from WMO meteorological stations located in China, Mongolia, Korea and Japan that report different present weather types related to dust events. Also, lidar data from Asian network sites were included in the analysis. The focus is on dust events that occurred during the spring seasons of 2006- 2008. The capability of CALIPSO to detect dust was investigated by analyzing the CALIPSO features against independent observations for selected CALPSO overpasses on a case-by-case basis. The changes in the linear depolarization ratio were analyzed in conjunction with T-matrix optical modeling to constrain the particle nonsphericity and size distribution. The dust properties and vertical distribution in different dust sources (the Taklamakan vs. Gobi) were analyzed. The evolution of dust properties during the mid-range transport was also investigated from combined CALIPSO and lidar data.

  6. Integrating Cutting-edge Approaches to Describe and Interpret the Timing of Physical and Biological events: A Leap Forward for Monitoring Global Change Across Scales

    NASA Astrophysics Data System (ADS)

    Sadinski, W.; Gallant, A.; Thompson, D.; Houlahan, J.; Roth, M.; Brisco, B.; Kaya, S.; Gage, S.; Brininger, W.; Mushet, D.; Petersen, D.; Tessler, D.; Snively, M.; Jones, P. M.; Tate, D. P.; Morton, J. M.; Brodman, R.; Muths, E.; Brown, J. F.; Pauli, B.; Rosenberry, D. O.


    Our ability to integrate measures of phenological events across methods and scales has taken a significant step forward with recent advances in recording and analyzing sounds. For example, we now can measure bird and amphibian responses to climate/global change extensively and intensively from the ground and relate them to other landscape responses measured via satellite, airborne, and ground-based sensors. Thus, we can document changes in the timing of related biotic and abiotic events and understand the ramifications for biodiversity-related ecosystem services more fully. We designed and continue to expand the Terrestrial Wetland Global Change Research Network based upon this new potential to describe and interpret the impacts of global change and to provide stakeholders vital information on the specific nature and relevance of those impacts. We began implementing field research in 2008 and continue to add new research nodes across portions of Alaska, Canada, and the conterminous U.S. by leveraging resources across multiple organizations. Our standardized approach enables us to compare phenological responses in wetland-upland landscape matrices across local, regional, and continental scales and along several physical and ecological gradients. The power of this approach is evident in comparisons of calling events for individual species or entire soundscapes with other biotic and abiotic conditions and demonstrates a significant step forward in our ability to describe and interpret the impacts of global change on interconnected wetlands and uplands.

  7. Does testing with feedback improve adult spelling skills relative to copying and reading?


    Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C


    We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading. PMID:26460674

  8. Allele-specific copy number profiling by next-generation DNA sequencing.


    Chen, Hao; Bell, John M; Zavala, Nicolas A; Ji, Hanlee P; Zhang, Nancy R


    The progression and clonal development of tumors often involve amplifications and deletions of genomic DNA. Estimation of allele-specific copy number, which quantifies the number of copies of each allele at each variant loci rather than the total number of chromosome copies, is an important step in the characterization of tumor genomes and the inference of their clonal history. We describe a new method, falcon, for finding somatic allele-specific copy number changes by next generation sequencing of tumors with matched normals. falcon is based on a change-point model on a bivariate mixed Binomial process, which explicitly models the copy numbers of the two chromosome haplotypes and corrects for local allele-specific coverage biases. By using the Binomial distribution rather than a normal approximation, falcon more effectively pools evidence from sites with low coverage. A modified Bayesian information criterion is used to guide model selection for determining the number of copy number events. Falcon is evaluated on in silico spike-in data and applied to the analysis of a pre-malignant colon tumor sample and late-stage colorectal adenocarcinoma from the same individual. The allele-specific copy number estimates obtained by falcon allows us to draw detailed conclusions regarding the clonal history of the individual's colon cancer. PMID:25477383

  9. A "concrete view" of aging: event related potentials reveal age-related changes in basic integrative processes in language.


    Huang, Hsu-Wen; Meyer, Aaron M; Federmeier, Kara D


    Normal aging is accompanied by changes in both structural and functional cerebral organization. Although verbal knowledge seems to be relatively stable across the lifespan, there are age-related changes in the rapid use of that knowledge during on-line language processing. In particular, aging has been linked to reduce effectiveness in preparing for upcoming words and building an integrated sentence-level representation. The current study assessed whether such age-related changes extend even to much simpler language units, such as modification relations between a centrally presented adjective and a lateralized noun. Adjectives were used to elicit concrete and abstract meanings of the same, polysemous lexical items (e.g., "green book" vs. "interesting book"). Consistent with findings that lexical information is preserved with age, older adults, like younger adults, exhibited concreteness effects at the adjectives, with more negative responses to concrete adjectives over posterior (300-500 ms; N400) and frontal (300-900 ms) channels. However, at the noun, younger adults exhibited concreteness-based predictability effects linked to left hemisphere processing and imagery effects linked to right hemisphere processing, contingent on whether the adjectives and nouns formed a cohesive conceptual unit. In contrast, older adults showed neither effect, suggesting that they were less able to rapidly link the adjective-noun meaning to form an integrated conceptual representation. Age-related changes in language processing may thus be more pervasive than previously realized. PMID:22044648

  10. Droplet digital PCR-aided screening and characterization of Pichia pastoris multiple gene copy strains.


    Cámara, Elena; Albiol, Joan; Ferrer, Pau


    Pichia (syn. Komagataella) pastoris is a widely used yeast platform for heterologous protein production. Expression cassettes are usually stably integrated into the genome of this host via homologous recombination. Although increasing gene dosage is a powerful strategy to improve recombinant protein production, an excess in the number of gene copies often leads to decreased product yields and increased metabolic burden, particularly for secreted proteins. We have constructed a series of strains harboring different copy numbers of a Rhizopus oryzae lipase gene (ROL), aiming to find the optimum gene dosage for secreted Rol production. In order to accurately determine ROL gene dosage, we implemented a novel protocol based on droplet digital PCR (ddPCR), and cross validated it with conventional real-time PCR. Gene copy number determination based on ddPCR allowed for an accurate ranking of transformants according to their ROL gene dosage. Results indicated that ddPCR was particularly superior at lower gene dosages (one to five copies) over quantitative real-time PCR (qPCR). This facilitated the determination of the optimal ROL gene dosage as low as two copies. The ranking of ROL gene dosage versus Rol yield was consistent at both small scale and bioreactor chemostat cultures, thereby easing clone characterization in terms of gene dosage dependent physiological effects, which could be discriminated even among strains differing by only one ROL copy. A selected two-copy strain showed twofold increase in Rol specific production in a chemostat culture over the single copy strain. Conversely, strains harboring more than two copies of the ROL gene showed decreased product and biomass yields, as well as altered substrate consumption specific rates, compared to the reference (one-copy) strain. Biotechnol. Bioeng. 2016;113: 1542-1551. © 2015 Wiley Periodicals, Inc. PMID:26704939

  11. Genome Architecture and Its Roles in Human Copy Number Variation

    PubMed Central

    Chen, Lu; Zhou, Weichen; Zhang, Ling


    Besides single-nucleotide variants in the human genome, large-scale genomic variants, such as copy number variations (CNVs), are being increasingly discovered as a genetic source of human diversity and the pathogenic factors of diseases. Recent experimental findings have shed light on the links between different genome architectures and CNV mutagenesis. In this review, we summarize various genomic features and discuss their contributions to CNV formation. Genomic repeats, including both low-copy and high-copy repeats, play important roles in CNV instability, which was initially known as DNA recombination events. Furthermore, it has been found that human genomic repeats can also induce DNA replication errors and consequently result in CNV mutations. Some recent studies showed that DNA replication timing, which reflects the high-order information of genomic organization, is involved in human CNV mutations. Our review highlights that genome architecture, from DNA sequence to high-order genomic organization, is an important molecular factor in CNV mutagenesis and human genomic instability. PMID:25705150

  12. Metastable dark matter mechanisms for INTEGRAL 511 keV γ rays and DAMA/CoGeNT events

    NASA Astrophysics Data System (ADS)

    Cline, James M.; Frey, Andrew R.; Chen, Fang


    We explore dark matter mechanisms that can simultaneously explain the galactic 511 keV gamma rays observed by INTEGRAL/SPI, the DAMA/LIBRA annual modulation, and the excess of low-recoil dark matter candidates observed by CoGeNT. It requires three nearly degenerate states of dark matter in the 4-7 GeV mass range, with splittings, respectively, of order MeV and a few keV. The top two states have the small mass gap and transitions between them, either exothermic or endothermic, and can account for direct detections. Decays from one of the top states to the ground state produce low-energy positrons in the Galaxy whose associated 511 keV gamma rays are seen by INTEGRAL. This decay can happen spontaneously, if the excited state is metastable (longer lived than the age of the Universe), or it can be triggered by inelastic scattering of the metastable states into the shorter-lived ones. We focus on a simple model where the dark matter is a triplet of an SU(2) hidden sector gauge symmetry, broken at the scale of a few GeV, giving masses of order ≲1GeV to the dark gauge bosons, which mix kinetically with the standard model hypercharge. The purely decaying scenario can give the observed angular dependence of the 511 keV signal with no positron diffusion, while the inelastic scattering mechanism requires transport of the positrons over distances ˜1kpc before annihilating. We note that an x-ray line of several keV in energy, due to single-photon decays involving the top dark matter states, could provide an additional component to the diffuse x-ray background. The model is testable by proposed low-energy fixed-target experiments.

  13. GeoMedStat: an integrated spatial surveillance system to track air pollution and associated healthcare events.


    Faruque, Fazlay S; Li, Hui; Williams, Worth B; Waller, Lance A; Brackin, Bruce T; Zhang, Lei; Grimes, Kim A; Finley, Richard W


    Air pollutants, such as particulate matter with a diameter ≤2.5 microns (PM2.5) and ozone (O3), are known to exacerbate asthma and other respiratory diseases. An integrated surveillance system that tracks such air pollutants and associated disease incidence can assist in risk assessment, healthcare preparedness and public awareness. However, the implementation of such an integrated environmental health surveillance system is a challenge due to the disparate sources of many types of data and the implementation becomes even more complicated for a spatial and real-time system due to lack of standardised technological components and data incompatibility. In addition, accessing and utilising health data that are considered as Protected Health Information (PHI) require maintaining stringent protocols, which have to be supported by the system. This paper aims to illustrate the development of a spatial surveillance system (GeoMedStat) that is capable of tracking daily environmental pollutants along with both daily and historical patient encounter data. It utilises satellite data and the groundmonitor data from the US National Aeronautics and Space Administration (NASA) and the US Environemental Protection Agenecy (EPA), rspectively as inputs estimating air pollutants and is linked to hospital information systems for accessing chief complaints and disease classification codes. The components, developmental methods, functionality of GeoMedStat and its use as a real-time environmental health surveillance system for asthma and other respiratory syndromes in connection with with PM2.5 and ozone are described. It is expected that the framework presented will serve as an example to others developing real-time spatial surveillance systems for pollutants and hospital visits. PMID:25599635

  14. Metastable dark matter mechanisms for INTEGRAL 511 keV {gamma} rays and DAMA/CoGeNT events

    SciTech Connect

    Cline, James M.; Frey, Andrew R.; Chen, Fang


    We explore dark matter mechanisms that can simultaneously explain the galactic 511 keV gamma rays observed by INTEGRAL/SPI, the DAMA/LIBRA annual modulation, and the excess of low-recoil dark matter candidates observed by CoGeNT. It requires three nearly degenerate states of dark matter in the 4-7 GeV mass range, with splittings, respectively, of order MeV and a few keV. The top two states have the small mass gap and transitions between them, either exothermic or endothermic, and can account for direct detections. Decays from one of the top states to the ground state produce low-energy positrons in the Galaxy whose associated 511 keV gamma rays are seen by INTEGRAL. This decay can happen spontaneously, if the excited state is metastable (longer lived than the age of the Universe), or it can be triggered by inelastic scattering of the metastable states into the shorter-lived ones. We focus on a simple model where the dark matter is a triplet of an SU(2) hidden sector gauge symmetry, broken at the scale of a few GeV, giving masses of order < or approx. 1 GeV to the dark gauge bosons, which mix kinetically with the standard model hypercharge. The purely decaying scenario can give the observed angular dependence of the 511 keV signal with no positron diffusion, while the inelastic scattering mechanism requires transport of the positrons over distances {approx}1 kpc before annihilating. We note that an x-ray line of several keV in energy, due to single-photon decays involving the top dark matter states, could provide an additional component to the diffuse x-ray background. The model is testable by proposed low-energy fixed-target experiments.

  15. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings.


    Wauthia, Erika; Rossignol, Mandy


    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  16. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings

    PubMed Central

    Wauthia, Erika; Rossignol, Mandy


    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  17. Time-to-event analysis with artificial neural networks: an integrated analytical and rule-based study for breast cancer.


    Lisboa, Paulo J G; Etchells, Terence A; Jarman, Ian H; Hane Aung, M S; Chabaud, Sylvie; Bachelot, Thomas; Perol, David; Gargi, Thérèse; Bourdès, Valérie; Bonnevay, Stéphane; Négrier, Sylvie


    This paper presents an analysis of censored survival data for breast cancer specific mortality and disease-free survival. There are three stages to the process, namely time-to-event modelling, risk stratification by predicted outcome and model interpretation using rule extraction. Model selection was carried out using the benchmark linear model, Cox regression but risk staging was derived with Cox regression and with Partial Logistic Regression Artificial Neural Networks regularised with Automatic Relevance Determination (PLANN-ARD). This analysis compares the two approaches showing the benefit of using the neural network framework especially for patients at high risk. The neural network model also has results in a smooth model of the hazard without the need for limiting assumptions of proportionality. The model predictions were verified using out-of-sample testing with the mortality model also compared with two other prognostic models called TNG and the NPI rule model. Further verification was carried out by comparing marginal estimates of the predicted and actual cumulative hazards. It was also observed that doctors seem to treat mortality and disease-free models as equivalent, so a further analysis was performed to observe if this was the case. The analysis was extended with automatic rule generation using Orthogonal Search Rule Extraction (OSRE). This methodology translates analytical risk scores into the language of the clinical domain, enabling direct validation of the operation of the Cox or neural network model. This paper extends the existing OSRE methodology to data sets that include continuous-valued variables. PMID:18304780

  18. Final Scientific/Technical Report, DE-FG02-06ER64171, Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity – Subproject to Co-PI Eric E. Roden

    SciTech Connect

    Eric E. Roden


    This report summarizes research conducted in conjunction with a project entitled “Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity”, which was funded through the Integrative Studies Element of the former NABIR Program (now the Environmental Remediation Sciences Program) within the Office of Biological and Environmental Research. Dr. Darrell Chandler (originally at Argonne National Laboratory, now with Akonni Biosystems) was the overall PI/PD for the project. The overall project goals were to (1) apply a model iron-reducer and sulfate-reducer microarray and instrumentation systems to sediment and groundwater samples from the Scheibe et al. FRC Area 2 field site, UMTRA sediments, and other DOE contaminated sites; (2) continue development and expansion of a 16S rRNA/rDNA¬-targeted probe suite for microbial community dynamics as new sequences are obtained from DOE-relevant sites; and (3) address the fundamental molecular biology and analytical chemistry associated with the extraction, purification and analysis of functional genes and mRNA in environmental samples. Work on the UW subproject focused on conducting detailed batch and semicontinuous culture reactor experiments with uranium-contaminated FRC Area 2 sediment. The reactor experiments were designed to provide coherent geochemical and microbiological data in support of microarray analyses of microbial communities in Area 2 sediments undergoing biostimulation with ethanol. A total of four major experiments were conducted (one batch and three semicontinuous culture), three of which (the batch and two semicontinuous culture) provided samples for DNA microarray analysis. A variety of other molecular analyses (clone libraries, 16S PhyloChip, RT-PCR, and T-RFLP) were conducted on parallel samples from the various experiments in order to provide independent information on microbial community response to biostimulation.

  19. Integrating data and mashup concepts in Hydro-Meteorological Research: the torrential rainfall event in Genoa (4th November 2011) case study.

    NASA Astrophysics Data System (ADS)

    Bedrina, T.; Parodi, A.; Quarati, A.; Clematis, A.; Rebora, N.; Laiosa, D.


    One of the critical issues in Hydro-Meteorological Research (HMR) is a better exploitation of data archives according to a multidisciplinary perspective. Different Earth science databases offer a huge amount of observational data, which often need to be assembled, processed, combined accordingly HM scientists needs. The cooperation between scientists active in HMR and Information and Communication Technologies (ICT) is essential in the development of innovative tools and applications for manipulating, aggregating and re-arranging heterogeneous information in flexible way. In this paper it is described an application devoted to the collection and integration of HM datasets, originated by public or private sources, freely exposed via Web services API. This application uses the mashup, recently become very popular in many fields, (Chow S.-W., 2007) technology concepts. Such methodology means combination of data and/or programs published by external online sources into an integrated experience. Mashup seems to be a promising methodology to respond to the multiple data-related activities into which HM researchers are daily involved (e.g. finding and retrieving high volume data; learning formats and developing readers; extracting parameters; performing filtering and mask; developing analysis and visualization tools). The specific case study of the recent extreme rainfall event, occurred over Genoa in Italy on the 4th November 2011 is shown through the integration of semi-professional weather observational networks as free available data source in addition to official weather networks.

  20. Kinetic versus Energetic Discrimination in Biological Copying

    NASA Astrophysics Data System (ADS)

    Sartori, Pablo; Pigolotti, Simone


    We study stochastic copying schemes in which discrimination between a right and a wrong match is achieved via different kinetic barriers or different binding energies of the two matches. We demonstrate that, in single-step reactions, the two discrimination mechanisms are strictly alternative and cannot be mixed to further reduce the error fraction. Close to the lowest error limit, kinetic discrimination results in a diverging copying velocity and dissipation per copied bit. On the other hand, energetic discrimination reaches its lowest error limit in an adiabatic regime where dissipation and velocity vanish. By analyzing experimentally measured kinetic rates of two DNA polymerases, T7 and Polγ, we argue that one of them operates in the kinetic and the other in the energetic regime. Finally, we show how the two mechanisms can be combined in copying schemes implementing error correction through a proofreading pathway.

  1. Copy Number Variation across European Populations

    PubMed Central

    Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.


    Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

  2. COPI Budding within the Golgi Stack

    PubMed Central

    Popoff, Vincent; Adolf, Frank; Brügger, Britta; Wieland, Felix


    The Golgi serves as a hub for intracellular membrane traffic in the eukaryotic cell. Transport within the early secretory pathway, that is within the Golgi and from the Golgi to the endoplasmic reticulum, is mediated by COPI-coated vesicles. The COPI coat shares structural features with the clathrin coat, but differs in the mechanisms of cargo sorting and vesicle formation. The small GTPase Arf1 initiates coating on activation and recruits en bloc the stable heptameric protein complex coatomer that resembles the inner and the outer shells of clathrin-coated vesicles. Different binding sites exist in coatomer for membrane machinery and for the sorting of various classes of cargo proteins. During the budding of a COPI vesicle, lipids are sorted to give a liquid-disordered phase composition. For the release of a COPI-coated vesicle, coatomer and Arf cooperate to mediate membrane separation. PMID:21844168

  3. NASA printing, duplicating, and copying management handbook

    NASA Technical Reports Server (NTRS)


    This handbook provides information and procedures for the implementation of NASA policy and applicable laws and regulations relating to printing, duplicating, and copying. The topics addressed include a description of relevant laws and regulations, authorizations required, and responsible entities for NASA printing, duplicating, and copying. The policy of NASA is to ensure understanding and application of authority and responsibility on printing matters. Where necessary, the handbook clarifies the intent of basic laws and regulations applicable to NASA.

  4. COPI Is Required for Enterovirus 71 Replication

    PubMed Central

    Wang, Jianmin; Wu, Zhiqiang; Jin, Qi


    Enterovirus 71 (EV71), a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11), is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies. PMID:22662263

  5. Copy Number Profiling of Brazilian Astrocytomas.


    Bidinotto, Lucas Tadeu; Torrieri, Raul; Mackay, Alan; Almeida, Gisele Caravina; Viana-Pereira, Marta; Cruvinel-Carloni, Adriana; Spina, Maria Luisa; Campanella, Nathalia Cristina; Pereira de Menezes, Weder; Clara, Carlos Afonso; Becker, Aline Paixão; Jones, Chris; Reis, Rui Manuel


    Copy number alterations (CNA) are one of the driving mechanisms of glioma tumorigenesis, and are currently used as important biomarkers in the routine setting. Therefore, we performed CNA profiling of 65 astrocytomas of distinct malignant grades (WHO grade I-IV) of Brazilian origin, using array-CGH and microsatellite instability analysis (MSI), and investigated their correlation with TERT and IDH1 mutational status and clinico-pathological features. Furthermore, in silico analysis using the Oncomine database was performed to validate our findings and extend the findings to gene expression level. We found that the number of genomic alterations increases in accordance with glioma grade. In glioblastomas (GBM), the most common alterations were gene amplifications (PDGFRA, KIT, KDR, EGFR, and MET) and deletions (CDKN2A and PTEN) Log-rank analysis correlated EGFR amplification and/or chr7 gain with better survival of the patients. MSI was observed in 11% of GBMs. A total of 69% of GBMs presented TERT mutation, whereas IDH1 mutation was most frequent in diffuse (85.7%) and anaplastic (100%) astrocytomas. The combination of 1p19q deletion and TERT and IDH1 mutational status separated tumor groups that showed distinct age of diagnosis and outcome. In silico validation pointed to less explored genes that may be worthy of future investigation, such as CDK2, DMRTA1, and MTAP Herein, using an extensive integrated analysis, we indicated potentially important genes, not extensively studied in gliomas, that could be further explored to assess their biological and clinical impact in astrocytomas. PMID:27172220

  6. Copy Number Profiling of Brazilian Astrocytomas

    PubMed Central

    Bidinotto, Lucas Tadeu; Torrieri, Raul; Mackay, Alan; Almeida, Gisele Caravina; Viana-Pereira, Marta; Cruvinel-Carloni, Adriana; Spina, Maria Luisa; Campanella, Nathalia Cristina; Pereira de Menezes, Weder; Clara, Carlos Afonso; Becker, Aline Paixão; Jones, Chris; Reis, Rui Manuel


    Copy number alterations (CNA) are one of the driving mechanisms of glioma tumorigenesis, and are currently used as important biomarkers in the routine setting. Therefore, we performed CNA profiling of 65 astrocytomas of distinct malignant grades (WHO grade I–IV) of Brazilian origin, using array-CGH and microsatellite instability analysis (MSI), and investigated their correlation with TERT and IDH1 mutational status and clinico-pathological features. Furthermore, in silico analysis using the Oncomine database was performed to validate our findings and extend the findings to gene expression level. We found that the number of genomic alterations increases in accordance with glioma grade. In glioblastomas (GBM), the most common alterations were gene amplifications (PDGFRA, KIT, KDR, EGFR, and MET) and deletions (CDKN2A and PTEN). Log-rank analysis correlated EGFR amplification and/or chr7 gain with better survival of the patients. MSI was observed in 11% of GBMs. A total of 69% of GBMs presented TERT mutation, whereas IDH1 mutation was most frequent in diffuse (85.7%) and anaplastic (100%) astrocytomas. The combination of 1p19q deletion and TERT and IDH1 mutational status separated tumor groups that showed distinct age of diagnosis and outcome. In silico validation pointed to less explored genes that may be worthy of future investigation, such as CDK2, DMRTA1, and MTAP. Herein, using an extensive integrated analysis, we indicated potentially important genes, not extensively studied in gliomas, that could be further explored to assess their biological and clinical impact in astrocytomas. PMID:27172220

  7. An exact, closed-form expression of the integral chord-length distribution for the calculation of single-event upsets induced by cosmic rays

    NASA Technical Reports Server (NTRS)

    Luke, Keung L.; Buehler, Martin G.


    This paper presents a derivation of an exact closed-form expression of the integral chord-length distribution for the calculation of single-event upsets (SEUs) in an electronic memory cell, caused by cosmic rays. Results computed for two rectangular parallelepipeds using this exact expression are compared with those computed with Bradford's (1979) semiexact expression of C(x). It is found that the values of C(x) are identical for x equal or smaller than b but are vastly different for x greater than b. Moreover, while C(x) of Bradford gives reasonably accurate values of SEU rate for certain sets of computational parameters, it gives values more than 10 times larger than the correct values for other sets of parameters.

  8. Functional profiling and gene expression analysis of chromosomal copy number alterations

    PubMed Central

    Conde, Lucía; Montaner, David; Burguet-Castell, Jordi; Tárraga, Joaquín; Al-Shahrour, Fátima; Dopazo, Joaquín


    Contrarily to the traditional view in which only one or a few key genes were supposed to be the causative factors of diseases, we discuss the importance of considering groups of functionally related genes in the study of pathologies characterised by chromosomal copy number alterations. Recent observations have reported the existence of regions in higher eukaryotic chromosomes (including humans) containing genes of related function that show a high degree of coregulation. Copy number alterations will consequently affect to clusters of functionally related genes, which will be the final causative agents of the diseased phenotype, in many cases. Therefore, we propose that the functional profiling of the regions affected by copy number alterations must be an important aspect to take into account in the understanding of this type of pathologies. To illustrate this, we present an integrated study of DNA copy number variations, gene expression along with the functional profiling of chromosomal regions in a case of multiple myeloma. PMID:17597935

  9. The physics of a single-event upset in integrated circuits: A review and critique of analytical models for charge collection

    NASA Technical Reports Server (NTRS)

    Vonroos, O.; Zoutendyk, J.


    When an energetic particle (kinetic energy 0.5 MeV) originating from a radioactive decay or a cosmic ray transverse the active regions of semiconductor devices used in integrated circuit (IC) chips, it leaves along its track a high density electron hole plasma. The subsequent decay of this plasma by drift and diffusion leads to charge collection at the electrodes large enough in most cases to engender a false reading, hence the name single-event upset (SEU). The problem of SEU's is particularly severe within the harsh environment of Jupiter's radiation belts and constitutes therefore a matter of concern for the Galileo mission. The physics of an SEU event is analyzed in some detail. Owing to the predominance of nonlinear space charge effects and the fact that positive (holes) and negative (electrons) charges must be treated on an equal footing, analytical models for the ionized-charge collection and their corresponding currents as a function of time prove to be inadequate even in the simplest case of uniformly doped, abrupt p-n junctions in a one-dimensional geometry. The necessity for full-fledged computer simulation of the pertinent equations governing the electron-hole plasma therefore becomes imperative.

  10. A model and method for "making" a Combined-Integrated psychologist: equilintegration (EI) theory and the beliefs, events, and values inventory (BEVI).


    Shealy, Craig N


    Although the Consensus Conference on Combined and Integrated Doctoral Training in Psychology (e.g., Bailey, 2003) generated much content of relevance to the structure and commitments of Combined-Integrated (C-I) programs, faculty, and students-and Competencies 2002: Future Directions in Education and Credentialing in Professional Psychology ( developed language and guidelines regarding the knowledge areas, skills, and values that students in professional psychology programs should acquire and demonstrate-specific models and methods are necessary to translate these professional guidelines and aspirations into reality. This article offers one such model, Equilintegration (EI) Theory, and method, the Beliefs, Events, and Values Inventory (BEVI), that can be used by faculty, training staff, supervisors, and students in C-I programs to operationalize, assess, and cultivate basic values of education and training from a C-I perspective (e.g., self-awareness, self-assessment, and self-reflection). In addition to this model and method, relevant background information, theory, and research are presented along with attendant implications, hypotheses, and principles. PMID:15372462