Science.gov

Sample records for coxsackievirus b3 rna-dependent

  1. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    SciTech Connect

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno; De Palma, Armando M.; Neyts, Johan; Egloff, Marie-Pierre; Grisel, Sacha; Dalle, Karen; Campanacci, Valerie; Spinelli, Silvia; Cambillau, Christian; Canard, Bruno; Gruez, Arnaud

    2007-06-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited to X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination.

  2. ATP Is an Allosteric Inhibitor of Coxsackievirus B3 Polymerase.

    PubMed

    Karr, Jonathan P; Peersen, Olve B

    2016-07-19

    The RNA-dependent RNA polymerases from positive-strand RNA viruses, such as picornaviruses and flaviviruses, close their active sites for catalysis via a unique NTP-induced conformational change in the palm domain. Combined with a fully prepositioned templating nucleotide, this mechanism is error-prone and results in a distribution of random mutations in the viral progeny often described as a quasi-species. Here we examine the extent to which noncognate NTPs competitively inhibit single-cycle elongation by coxsackievirus B3 3D(pol), a polymerase that generates three to four mutations per 10 kb of RNA synthesized during viral infection. Using an RNA with a templating guanosine combined with 2-aminopurine fluorescence as a reporter for elongation, we find that the cognate CTP has a Km of 24 μM and the three noncognate nucleotides competitively inhibit the reaction with Kic values of 500 μM for GTP, 1300 μM for ATP, and 3000 μM for UTP. Unexpectedly, ATP also acted as an uncompetitive inhibitor with a Kiu of 1800 μM, resulting in allosteric modulation of 3D(pol) that slowed the polymerase elongation rate ≈4-fold. ATP uncompetitive inhibition required the β- and γ-phosphates, and its extent was significantly diminished in two previously characterized low-fidelity polymerases. This led to further mutational analysis and the identification of a putative allosteric binding site below the NTP entry channel at the interface of conserved motifs A and D, although cocrystallization failed to reveal any density for bound ATP in this pocket. The potential role of an ATP allosteric effect during the virus life cycle is discussed. PMID:27319576

  3. Coxsackievirus B3 infection reduces female mouse fertility

    PubMed Central

    Shim, Hye Min; Hwang, Ji Young; Lee, Kyung Min; Kim, Yunhwa; Jeong, Daewon; Roh, Jaesook; Choi, Hyeonhae; Hwang, Jung Hye; Park, Hosun

    2015-01-01

    Previously we demonstrated coxsackievirus B3 (CVB3) infection during early gestation as a cause of pregnancy loss. Here, we investigated the impacts of CVB3 infection on female mouse fertility. Coxsackievirus-adenovirus receptor (CAR) expression and CVB3 replication in the ovary were evaluated by immunohistochemistry or reverse transcription-polymerase chain reaction (RT-PCR). CAR was highly expressed in granulosa cells (GCs) and CVB3 replicated in the ovary. Histological analysis showed a significant increase in the number of atretic follicles in the ovaries of CVB3-infected mice (CVBM). Estrous cycle evaluation demonstrated that a higher number of CVBM were in proestrus compared to mock mice (CVBM vs. mock; 61.5%, 28.5%, respectively). Estradiol concentration in GC culture supernatant and serum were measured by an enzyme-linked immunosorbent assay. Baseline and stimulated levels of estradiol in GC were decreased in CVBM, consistent with significantly reduced serum levels in these animals. In addition, aromatase transcript levels in GCs from CVBM were also decreased by 40% relative to the mock. Bone mineral density evaluated by micro-computed tomography was significantly decreased in the CVBM. Moreover, the fertility rate was also significantly decreased for the CVBM compared to the mock (CVBM vs. mock; 20%, 94.7%, respectively). This study suggests that CVB3 infection could interfere with reproduction by disturbing ovarian function and cyclic changes of the uterus. PMID:26062767

  4. A functional nuclear localization sequence in the VP1 capsid protein of coxsackievirus B3

    SciTech Connect

    Wang, Tianying; Yu, Bohai; Lin, Lexun; Zhai, Xia; Han, Yelu; Qin, Ying; Guo, Zhiwei; Wu, Shuo; Zhong, Xiaoyan; Wang, Yan; Tong, Lei; Zhang, Fengmin; Si, Xiaoning; Zhao, Wenran; Zhong, Zhaohua

    2012-11-25

    The capsid proteins of some RNA viruses can translocate to the nucleus and interfere with cellular phenotypes. In this study we found that the VP1 capsid protein of coxsackievirus B3 (CVB3) was dominantly localized in the nucleus of the cells transfected with VP1-expressing plasmid. The VP1 nuclear localization also occurred in the cells infected with CVB3. Truncation analysis indicated that the VP1 nuclear localization sequence located near the C-terminal. The substitution of His220 with threonine completely abolished its translocation. The VP1 proteins of other CVB types might have the nuclear localization potential because this region was highly conserved. Moreover, the VP1 nuclear localization induced cell cycle deregulation, including a prolonged S phase and shortened G2-M phase. Besides these findings, we also found a domain between Ala72 and Phe106 that caused the VP1 truncates dotted distributed in the cytoplasm. Our results suggest a new pathogenic mechanism of CVB. - Highlights: Black-Right-Pointing-Pointer The VP1 protein of coxsackievirus B3 can specifically localize in the nucleus. Black-Right-Pointing-Pointer The nuclear localization signal of coxsackievirus B3 VP1 protein locates near its C-terminal. Black-Right-Pointing-Pointer The VP1 nuclear localization of coxsackievirus B3 can deregulate cell cycle. Black-Right-Pointing-Pointer There is a domain in the VP1 that determines it dotted distributed in the cytoplasm.

  5. Major Persistent 5′ Terminally Deleted Coxsackievirus B3 Populations in Human Endomyocardial Tissues

    PubMed Central

    Bouin, Alexis; Nguyen, Yohan; Wehbe, Michel; Renois, Fanny; Fornes, Paul; Bani-Sadr, Firouze; Metz, Damien

    2016-01-01

    We performed deep sequencing analysis of the enterovirus 5′ noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. Results displayed a mix of deleted and full-length coxsackievirus B3, characterized by a low viral RNA load (8.102 copies/μg of nucleic acids) and a low viral RNA positive-sense to RNA negative-sense ratio of 4.8. PMID:27434549

  6. Major Persistent 5' Terminally Deleted Coxsackievirus B3 Populations in Human Endomyocardial Tissues.

    PubMed

    Bouin, Alexis; Nguyen, Yohan; Wehbe, Michel; Renois, Fanny; Fornes, Paul; Bani-Sadr, Firouze; Metz, Damien; Andreoletti, Laurent

    2016-08-01

    We performed deep sequencing analysis of the enterovirus 5' noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. Results displayed a mix of deleted and full-length coxsackievirus B3, characterized by a low viral RNA load (8.10(2) copies/μg of nucleic acids) and a low viral RNA positive-sense to RNA negative-sense ratio of 4.8. PMID:27434549

  7. Molecular epidemiology of coxsackievirus B3 infection in Spain, 2004-2014.

    PubMed

    Calderón, Katherine I; Díaz-de Cerio, María; Otero, Almudena; Muñoz-Almagro, Carmen; Rabella, Nuria; Martínez-Rienda, Inés; Moreno-Docón, Antonio; Trallero, Gloria; Cabrerizo, María

    2016-05-01

    Epidemiological and clinical characteristics of coxsackievirus B3 infections in Spain were investigated. This enterovirus (EV) type was detected mainly in young children (<6 months) and was associated with neurological (78 %) and respiratory diseases (10 %) but also with myo/pericarditis (10 %). Two myocarditis cases were fatal. Phylogenetic analysis of the VP1 region showed that genotype III circulated in the country between 2004 and 2008 and was replaced by genotype V in 2010. Furthermore, phylogenetic analysis of the 3D region indicated that recombination events have occurred and contributed to the genetic evolution of this EV type. PMID:26898312

  8. Emergence of a Large-Plaque Variant in Mice Infected with Coxsackievirus B3

    PubMed Central

    Wang, Yao

    2016-01-01

    ABSTRACT Coxsackieviruses are enteric viruses that frequently infect humans. To examine coxsackievirus pathogenesis, we orally inoculated mice with the coxsackievirus B3 (CVB3) Nancy strain. Using HeLa cell plaque assays with agar overlays, we noticed that some fecal viruses generated plaques >100 times as large as inoculum viruses. These large-plaque variants emerged following viral replication in several different tissues. We identified a single amino acid change, N63Y, in the VP3 capsid protein that was sufficient to confer the large-plaque phenotype. Wild-type CVB3 and N63Y mutant CVB3 had similar plaque sizes when agarose was used in the overlay instead of agar. We determined that sulfated glycans in agar inhibited plaque formation by wild-type CVB3 but not by N63Y mutant CVB3. Furthermore, N63Y mutant CVB3 bound heparin, a sulfated glycan, less efficiently than wild-type CVB3 did. While N63Y mutant CVB3 had a growth defect in cultured cells and reduced attachment, it had enhanced replication and pathogenesis in mice. Infection with N63Y mutant CVB3 induced more severe hepatic damage than infection with wild-type CVB3, likely because N63Y mutant CVB3 disseminates more efficiently to the liver. Our data reinforce the idea that culture-adapted laboratory virus strains can have reduced fitness in vivo. N63Y mutant CVB3 may be useful as a platform to understand viral adaptation and pathogenesis in animal studies. PMID:27025249

  9. Internalization and trafficking mechanisms of coxsackievirus B3 in HeLa cells

    SciTech Connect

    Chung, Sun-Ku; Kim, Joo-Young; Kim, In-Beom; Park, Sang-Ick; Paek, Kyung-Hee; Nam, Jae-Hwan . E-mail: jnam66@yahoo.com

    2005-03-01

    Coxsackievirus B3 (CVB3) is nonenveloped and has a single-stranded positive-sense RNA genome. CVB3 induces myocarditis and ultimately dilated cardiomyopathy. Although there are mounting evidences of an interaction between CVB3 particles and the cellular receptors, coxsackievirus and adenovirus receptor (CAR) and decay-accelerating factor (DAF), very little is known about the mechanisms of internalization and trafficking. In the present study, we used the CVB3 H3 strain, which is CAR-dependent but DAF-independent Woodruff variant and found that during entry, CVB3 particles were colocalized in clathrin, after interacting primarily with CAR, which was not recycled to the plasma membrane. We also found that CVB3 internalization was dependent on the function of dynamin, a large GTPase that has an essential role in endocytosis. Heat-shock cognate protein, Hsc70, which acts as a chaperone in the release of coat proteins from clathrin-coated vesicles (CCV), played a role in CVB3 trafficking processes. Moreover, endosomal acidification was crucial for CVB3 endocytosis. Finally, CVB3 was colocalized in early endosome autoantigen 1 (EEA1) molecules, which are involved in endosome-endosome tethering and fusion. In conclusion, these data together indicate that CVB3 uses clathrin-mediated endocytosis and is transcytosed to early endosomes.

  10. Coxsackievirus B3 VLPs purified by ion exchange chromatography elicit strong immune responses in mice.

    PubMed

    Koho, Tiia; Koivunen, Minni R L; Oikarinen, Sami; Kummola, Laura; Mäkinen, Selina; Mähönen, Anssi J; Sioofy-Khojine, Amirbabak; Marjomäki, Varpu; Kazmertsuk, Artur; Junttila, Ilkka; Kulomaa, Markku S; Hyöty, Heikki; Hytönen, Vesa P; Laitinen, Olli H

    2014-04-01

    Coxsackievirus B3 (CVB3) is an important cause of acute and chronic viral myocarditis, and dilated cardiomyopathy (DCM). Although vaccination against CVB3 could significantly reduce the incidence of serious or fatal viral myocarditis and various other diseases associated with CVB3 infection, there is currently no vaccine or therapeutic reagent in clinical use. In this study, we contributed towards the development of a CVB3 vaccine by establishing an efficient and scalable ion exchange chromatography-based purification method for CVB3 virus and baculovirus-insect cell-expressed CVB3 virus-like particles (VLPs). This purification system is especially relevant for vaccine development and production on an industrial scale. The produced VLPs were characterized using a number of biophysical methods and exhibited excellent quality and high purity. Immunization of mice with VLPs elicited a strong immune response, demonstrating the excellent vaccine potential of these VLPs. PMID:24485896

  11. Design of a Genetically Stable High Fidelity Coxsackievirus B3 Polymerase That Attenuates Virus Growth in Vivo.

    PubMed

    McDonald, Seth; Block, Andrew; Beaucourt, Stéphanie; Moratorio, Gonzalo; Vignuzzi, Marco; Peersen, Olve B

    2016-07-01

    Positive strand RNA viruses replicate via a virally encoded RNA-dependent RNA polymerase (RdRP) that uses a unique palm domain active site closure mechanism to establish the canonical two-metal geometry needed for catalysis. This mechanism allows these viruses to evolutionarily fine-tune their replication fidelity to create an appropriate distribution of genetic variants known as a quasispecies. Prior work has shown that mutations in conserved motif A drastically alter RdRP fidelity, which can be either increased or decreased depending on the viral polymerase background. In the work presented here, we extend these studies to motif D, a region that forms the outer edge of the NTP entry channel where it may act as a nucleotide sensor to trigger active site closure. Crystallography, stopped-flow kinetics, quench-flow reactions, and infectious virus studies were used to characterize 15 engineered mutations in coxsackievirus B3 polymerase. Mutations that interfere with the transport of the metal A Mg(2+) ion into the active site had only minor effects on RdRP function, but the stacking interaction between Phe(364) and Pro(357), which is absolutely conserved in enteroviral polymerases, was found to be critical for processive elongation and virus growth. Mutating Phe(364) to tryptophan resulted in a genetically stable high fidelity virus variant with significantly reduced pathogenesis in mice. The data further illustrate the importance of the palm domain movement for RdRP active site closure and demonstrate that protein engineering can be used to alter viral polymerase function and attenuate virus growth and pathogenesis. PMID:27137934

  12. Virus-Host Coevolution in a Persistently Coxsackievirus B3-Infected Cardiomyocyte Cell Line ▿

    PubMed Central

    Pinkert, Sandra; Klingel, Karin; Lindig, Vanessa; Dörner, Andrea; Zeichhardt, Heinz; Spiller, O. Brad; Fechner, Henry

    2011-01-01

    Coevolution of virus and host is a process that emerges in persistent virus infections. Here we studied the coevolutionary development of coxsackievirus B3 (CVB3) and cardiac myocytes representing the major target cells of CVB3 in the heart in a newly established persistently CVB3-infected murine cardiac myocyte cell line, HL-1CVB3. CVB3 persistence in HL-1CVB3 cells represented a typical carrier-state infection with high levels (106 to 108 PFU/ml) of infectious virus produced from only a small proportion (approximately 10%) of infected cells. CVB3 persistence was characterized by the evolution of a CVB3 variant (CVB3-HL1) that displayed strongly increased cytotoxicity in the naive HL-1 cell line and showed increased replication rates in cultured primary cardiac myocytes of mouse, rat, and naive HL-1 cells in vitro, whereas it was unable to establish murine cardiac infection in vivo. Resistance of HL-1CVB3 cells to CVB3-HL1 was associated with reduction of coxsackievirus and adenovirus receptor (CAR) expression. Decreasing host cell CAR expression was partially overcome by the CVB3-HL1 variant through CAR-independent entry into resistant cells. Moreover, CVB3-HL1 conserved the ability to infect cells via CAR. The employment of a soluble CAR variant resulted in the complete cure of HL-1CVB3 cells with respect to the adapted virus. In conclusion, this is the first report of a CVB3 carrier-state infection in a cardiomyocyte cell line, revealing natural coevolution of CAR downregulation with CAR-independent viral entry in resistant host cells as an important mechanism of induction of CVB3 persistence. PMID:21976640

  13. Virus-host coevolution in a persistently coxsackievirus B3-infected cardiomyocyte cell line.

    PubMed

    Pinkert, Sandra; Klingel, Karin; Lindig, Vanessa; Dörner, Andrea; Zeichhardt, Heinz; Spiller, O Brad; Fechner, Henry

    2011-12-01

    Coevolution of virus and host is a process that emerges in persistent virus infections. Here we studied the coevolutionary development of coxsackievirus B3 (CVB3) and cardiac myocytes representing the major target cells of CVB3 in the heart in a newly established persistently CVB3-infected murine cardiac myocyte cell line, HL-1(CVB3). CVB3 persistence in HL-1(CVB3) cells represented a typical carrier-state infection with high levels (10(6) to 10(8) PFU/ml) of infectious virus produced from only a small proportion (approximately 10%) of infected cells. CVB3 persistence was characterized by the evolution of a CVB3 variant (CVB3-HL1) that displayed strongly increased cytotoxicity in the naive HL-1 cell line and showed increased replication rates in cultured primary cardiac myocytes of mouse, rat, and naive HL-1 cells in vitro, whereas it was unable to establish murine cardiac infection in vivo. Resistance of HL-1(CVB3) cells to CVB3-HL1 was associated with reduction of coxsackievirus and adenovirus receptor (CAR) expression. Decreasing host cell CAR expression was partially overcome by the CVB3-HL1 variant through CAR-independent entry into resistant cells. Moreover, CVB3-HL1 conserved the ability to infect cells via CAR. The employment of a soluble CAR variant resulted in the complete cure of HL-1(CVB3) cells with respect to the adapted virus. In conclusion, this is the first report of a CVB3 carrier-state infection in a cardiomyocyte cell line, revealing natural coevolution of CAR downregulation with CAR-independent viral entry in resistant host cells as an important mechanism of induction of CVB3 persistence. PMID:21976640

  14. A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells.

    PubMed Central

    Shafren, D R; Williams, D T; Barry, R D

    1997-01-01

    The composition of the cellular receptor complex for coxsackievirus B3 (CVB3) has been an area of much contention for the last 30 years. Recently, two individual components of a putative CVB3 cellular receptor complex have been identified as (i) decay-accelerating factor (DAF) and (ii) the coxsackievirus-adenovirus receptor protein (CAR). The present study elucidates the individual roles of DAF and CAR in cell entry of CVB3 Nancy. First, we confirm that the DAF-binding phenotype of CVB3 correlates to the presence of key amino acids located in the viral capsid protein, VP2. Second, using antibody blockade, we show that complete protection of permissive cells from infection by high input multiplicities of CVB3 requires a combination of both anti-DAF and anti-CAR antibodies. Finally, it is shown that expression of the CAR protein on the surface of nonpermissive DAF-expressing RD cells renders them highly susceptible to CVB3-mediated lytic infection. Therefore, although the majority of CVB3 Nancy attaches to the cell via DAF, only virus directly interacting with the CAR protein mediates lytic infection. The role of DAF in CVB3 cell infection may be analogous to that recently described for coxsackievirus A21 (D. R. Shafren, D. J. Dorahy, R. A. Ingham, G. F. Burns, and R. D. Barry, J. Virol. 71:4736-4743, 1997), in that DAF may act as a CVB3 sequestration site, enhancing viral presentation to the functional CAR protein. PMID:9371658

  15. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo

    PubMed Central

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-01-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3Cpro) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9–11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×106 TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  16. Coxsackievirus B3-Induced Cellular Protrusions: Structural Characteristics and Functional Competence▿†

    PubMed Central

    Paloheimo, Outi; Ihalainen, Teemu O.; Tauriainen, Sisko; Välilehto, Outi; Kirjavainen, Sanna; Niskanen, Einari A.; Laakkonen, Johanna P.; Hyöty, Heikki; Vihinen-Ranta, Maija

    2011-01-01

    Virus-induced alterations in cell morphology play important roles in the viral life cycle. To examine the intracellular events of coxsackievirus B3 (CVB3) infection, green monkey kidney (GMK) cells were either inoculated with the virus or transfected with the viral RNA. Various microscopic and flow cytometric approaches demonstrated the emergence of CVB3 capsid proteins at 8 h posttransfection, followed by morphological transformation of the cells. The morphological changes included formation of membranous protrusions containing viral capsids, together with microtubules and actin. Translocation of viral capsids into these protrusions was sensitive to cytochalasin D, suggesting the importance of actin in the process. Three-dimensional (3D) live-cell imaging demonstrated frequent contacts between cellular protrusions and adjacent cells. Markedly, in spite of an increase in the cellular viral protein content starting 8 h postinfection, no significant decrease in cell viability or increase in the amount of early apoptotic markers was observed by flow cytometry by 28 h postinfection. Comicroinjection of viral RNA and fluorescent dextran in the presence of neutralizing virus antibody suggested that these protrusions mediated the spread of infection from one cell to another prior to virus-induced cell lysis. Altogether, the CVB3-induced cellular protrusions could function as a hitherto-unknown nonlytic mechanism of cell-to-cell transmission exploited by enteroviruses. PMID:21525342

  17. A rapid and quantitative assay for measuring neutralizing antibodies of Coxsackievirus B3.

    PubMed

    Chen, Pan; Wu, Xing; Mao, Qunying; Gao, Fan; Hao, Xiaotian; Bian, Lianlian; Zhu, Fengcai; Li, Wenhui; Xu, Miao; Liang, Zhenglun

    2016-06-01

    Coxsackievirus B3 (CVB3) infection has been found to account for an increasing proportion cases of hand, foot and mouth disease (HFMD) in recent epidemiology studies. CVB3 is a single stranded, non-enveloped RNA virus and the infection can cause prominent health threat to pre-school children. Here, by taking approaches of reverse genetics, we established a single-round infection system for CVB3. The pseudovirus was produced by sequential transfection of CVB3 capsid expresser plasmid and CVB3 replicon RNA bearing firefly luciferase as a reporter. The CVB3 pseudovirus system was used for quantifying neutralizing antibody (NtAb) levels of 720 human serum samples and showed superior specificity and sensitivity comparing traditional cytopathic effect (CPE) assay. Furthermore, we compared the seroprevalence of CVB3 NtAbs in pre-school children and healthy adults, and found that only 11.94% of pre-school children were NtAbs positive which suggested that most children were naive to CVB3 infection; while there is much higher positive rate in adults (60%) indicating that most adults have experienced CVB3 infection during childhood. This rapid and quantitative assay greatly facilitates evaluating the level of NtAbs against CVB3 in populations and will help to advance CVB3 vaccine development. PMID:26947399

  18. Antiviral activity of ginsenosides against coxsackievirus B3, enterovirus 71, and human rhinovirus 3

    PubMed Central

    Song, Jae-Hyoung; Choi, Hwa-Jung; Song, Hyuk-Hwan; Hong, Eun-Hye; Lee, Bo-Ra; Oh, Sei-Ryang; Choi, Kwangman; Yeo, Sang-Gu; Lee, Yong-Pyo; Cho, Sungchan; Ko, Hyun-Jeong

    2014-01-01

    Background Ginsenosides are the major components responsible for the biochemical and pharmacological actions of ginseng, and have been shown to have various biological activities. In this study, we investigated the antiviral activities of seven ginsenosides [protopanaxatriol (PT) type: Re, Rf, and Rg2; protopanaxadiol (PD) type: Rb1, Rb2, Rc, and Rd)] against coxsackievirus B3 (CVB3), enterovirus 71 (EV71), and human rhinovirus 3 (HRV3). Methods Assays of antiviral activity and cytotoxicity were evaluated by the sulforhodamine B method using the cytopathic effect (CPE) reduction assay. Results The antiviral assays demonstrated that, of the seven ginsenosides, the PT-type ginsenosides (Re, Rf, and Rg2) possess significant antiviral activities against CVB3 and HRV3 at a concentration of 100 μg/mL. Among the PT-type ginsenosides, only ginsenoside Rg2 showed significant anti-EV71 activity with no cytotoxicity to cells at 100 μg/mL. The PD-type ginsenosides (Rb1, Rb2, Rc, and Rd), by contrast, did not show any significant antiviral activity against CVB3, EV71, and HRV3, and exhibited cytotoxic effects to virus-infected cells. Notably, the antiviral efficacies of PT-type ginsenosides were comparable to those of ribavirin, a commonly used antiviral drug. Conclusion Collectively, our findings suggest that the ginsenosides Re, Rf, and Rg2 have the potential to be effective in the treatment of CVB3, EV71, and HRV3 infection. PMID:25378991

  19. Coxsackievirus B3 infection induces autophagic flux, and autophagosomes are critical for efficient viral replication.

    PubMed

    Shi, Xiaodan; Chen, Zijian; Tang, Shengjie; Wu, Fei; Xiong, Sidong; Dong, Chunsheng

    2016-08-01

    Autophagy is an intrinsic cellular process that can degrade cytoplasmic components. It has been reported that several pathogens hijack this process to facilitate their replication. Coxsackievirus B3 (CVB3), a member of the family Picornaviridae, induces autophagy upon infection. However, the details of CVB3-induced autophagy remain a subject of debate. This study applied a combination of multiple assays for the measurement of autophagy and demonstrated that CVB3 induces a complete autophagic flux. Experiments with infected HEK293A cells revealed that autophagosomes were induced upon CVB3 infection. Most of these autophagosomes were mCherry positive in mCherry-GFP-LC3 cells. Conversely, mCherry-positive autophagosomes were rescued to green positive when treated with the acidification inhibitors chloroquine (CQ) and bafilomycin A1 (BAF), suggesting that autophagosomes fused with late endosomes or lysosomes. The co-localization of LC3-positive puncta with lysosome-associated membrane protein 1 (LAMP1) or LysoTracker confirmed that the autophagosomes fused primarily with lysosomes. Interestingly, the disruption of autophagosome formation by 3-methyladenine (3-MA) or ATG5 siRNA treatment during viral infection significantly decreased CVB3 replication. However, inhibitors of lysosomal acidification, fusion, or degradation did not affect viral replication. Therefore, autolysosomes may not be critical for viral replication in vitro. PMID:27224983

  20. Antimyocarditic activity of the guanine derivative BIOLF-70 in a coxsackievirus B3 murine model.

    PubMed Central

    Gauntt, C J; Arizpe, H M; Kung, J T; Ogilvie, K K; Cheriyan, U O

    1985-01-01

    Prophylactic administration of a nontoxic dose of 9-[[2-benzyloxyl-1-(benzyloxymethyl)ethoxy]methyl]-6-chlo roguanine (BIOLF-70) to mice reduced the number of myocarditic lesions induced by coxsackievirus B3 (CVB3). BIOLF-70 exhibited minimal antiviral activity against CVB3 in HeLa cells and murine neonatal skin fibroblasts and minimally reduced CVB3 yields in heart tissues. The drug had no effect on serum anti-CVB3 neutralizing antibody titers and did not induce the production of interferon. Flow microfluorometric analyses of splenic lymphocytes taken from BIOLF-70-treated, CVB3-inoculated mice at 7 days postinoculation showed that the proportion of T lymphocytes was increased, as measured by fluorescent staining of Thy-1 and Lyt-2 surface markers, compared with the proportion of T lymphocytes in splenic cells from virus-inoculated or BIOLF-70-treated or normal groups of mice. Splenic lymphocytes from BIOLF-70-treated, CVB3-inoculated mice showed reduced cytotoxic activity against CVB3-infected target fibroblasts. Splenic cells from BIOLF-70-treated, CVB3-inoculated mice had slightly higher natural killer cell activity than did those from the other three groups of mice, which had comparatively similar levels of natural killer cell activity. The data suggest that BIOLF-70 exerts antimyocarditic activity perhaps by some antiviral activity in heart tissues and by immunomodulatory mechanisms which appear to involve T suppressor or T cytotoxic lymphocyte subpopulations and natural killer cells. PMID:2580480

  1. The role of CD8+ T lymphocytes in coxsackievirus B3-induced myocarditis.

    PubMed Central

    Henke, A; Huber, S; Stelzner, A; Whitton, J L

    1995-01-01

    Coxsackievirus infections have previously been shown to cause acute or chronic myocarditis in humans, and several mouse models have been established to study the pathology of this disease. Myocardial injury may result from direct viral effects and/or may be immune mediated. To determine the relative roles of these processes in pathogenesis, we have compared coxsackievirus B3 (CVB3) infections of normal and immuno-compromised transgenic knockout (ko) mice. CVB3 was able to infect all strains used (C57BL/6, CD4ko, and beta-microglobulin ko [beta 2Mko]), and following intraperitoneal injection, two disease processes could be distinguished. First, the virus caused early (3 to 7 days postinfection) death in a viral dose-dependent manner. Immunocompetent C57BL/6 mice were highly susceptible (50% lethal dose = 70 PFU), while immunodeficient transgenic ko mice were less susceptible, showing 10- and 180-fold increases in the 50% lethal dose (for CD4ko and beta 2Mko mice, respectively). Second, a histologic examination of surviving CD4ko mice at 7 days postinfection revealed severe myocarditis; the inflammatory infiltrate comprised 40 to 50% macrophages, 30 to 40% NK cells, and 10 to 20% CD8+ T lymphocytes. The infiltration resolved over the following 2 to 3 weeks, with resultant myocardial fibrosis. In vivo depletion of CD8+ T lymphocytes from these CD4ko mice led to a marked reduction in myocarditis and an increase in myocardial virus titers. beta 2Mko mice, which lack antiviral CD8+ T cells, are much less susceptible to early death and to the development of myocarditis. We conclude that our data support a strong immunopathologic component in CVB3-induced disease and implicate both CD4+ and CD8+ T cells. Compared with immunocompetent animals, (i) mice lacking CD4+ T cells (CD4ko) were more resistant to virus challenge, and (ii) mice lacking CD8+ T cells (beta 2Mko and in vivo-depleted CD4ko) showed enhanced survival and a reduced incidence of the later myocarditis

  2. Reversion to wildtype of a mutated and nonfunctional coxsackievirus B3CRE(2C).

    PubMed

    Smithee, Shane; Tracy, Steven; Chapman, Nora M

    2016-07-15

    The cis-acting replication element (CRE) in the 2C protein coding region [CRE(2C)] of enteroviruses (EV) facilitates the addition of two uridine residues (uridylylation) onto the virus-encoded protein VPg in order for it to serve as the RNA replication primer. We demonstrated that coxsackievirus B3 (CVB3) is replication competent in the absence of a native (uridylylating) CRE(2C) and also demonstrated that lack of a functional CRE(2C) led to generation of 5' terminal genomic deletions in the CVB3 CRE-knock-out (CVB3-CKO) population. We asked whether reversion of the mutated CRE(2C) occurred, thus permitting sustained replication, and when were 5' terminal deletions generated during replication. Virions were isolated from HeLa cells previously electroporated with infectious CVB3-CKO T7 transcribed RNA or from hearts and spleens of mice after transfection with CVB3-CKO RNA. Viral RNA was isolated in order to amplify the CRE(2C) coding region and the genomic 5' terminal sequences. Sequence analysis revealed reversion of the CVB3-CKO sequence to wildtype occurs by 8 days post-electroporation of HeLa cells and by 20days post-transfection in mice. However, 5' terminal deletions evolve prior to these times. Reversion of the CRE(2C) mutations to wildtype despite loss of the genomic 5' termini is consistent with the hypothesis that an intact CRE(2C) is inherently vital to EV replication even when it is not enabling efficient positive strand initiation. PMID:27130630

  3. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo.

    PubMed

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-09-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3C(pro)) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9-11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×10(6) TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  4. Human Cardiac-Derived Adherent Proliferating Cells Reduce Murine Acute Coxsackievirus B3-Induced Myocarditis

    PubMed Central

    Miteva, Kapka; Haag, Marion; Peng, Jun; Savvatis, Kostas; Becher, Peter Moritz; Seifert, Martina; Warstat, Katrin; Westermann, Dirk; Ringe, Jochen; Sittinger, Michael; Schultheiss, Heinz-Peter

    2011-01-01

    Background Under conventional heart failure therapy, inflammatory cardiomyopathy typically has a progressive course, indicating a need for alternative therapeutic strategies to improve long-term outcomes. We recently isolated and identified novel cardiac-derived cells from human cardiac biopsies: cardiac-derived adherent proliferating cells (CAPs). They have similarities with mesenchymal stromal cells, which are known for their anti-apoptotic and immunomodulatory properties. We explored whether CAPs application could be a novel strategy to improve acute Coxsackievirus B3 (CVB3)-induced myocarditis. Methodology/Principal Findings To evaluate the safety of our approach, we first analyzed the expression of the coxsackie- and adenovirus receptor (CAR) and the co-receptor CD55 on CAPs, which are both required for effective CVB3 infectivity. We could demonstrate that CAPs only minimally express both receptors, which translates to minimal CVB3 copy numbers, and without viral particle release after CVB3 infection. Co-culture of CAPs with CVB3-infected HL-1 cardiomyocytes resulted in a reduction of CVB3-induced HL-1 apoptosis and viral progeny release. In addition, CAPs reduced CD4 and CD8 T cell proliferation. All CAPs-mediated protective effects were nitric oxide- and interleukin-10-dependent and required interferon-γ. In an acute murine model of CVB3-induced myocarditis, application of CAPs led to a decrease of cardiac apoptosis, cardiac CVB3 viral load and improved left ventricular contractility parameters. This was associated with a decline in cardiac mononuclear cell activity, an increase in T regulatory cells and T cell apoptosis, and an increase in left ventricular interleukin-10 and interferon-γ mRNA expression. Conclusions We conclude that CAPs are a unique type of cardiac-derived cells and promising tools to improve acute CVB3-induced myocarditis. PMID:22174827

  5. Copper deficiency increases the virulence of amyocarditic and myocarditic strains of coxsackievirus B3 in mice.

    PubMed

    Smith, Allen D; Botero, Sebastian; Levander, Orville A

    2008-05-01

    Deficiency in several trace elements, including copper and selenium, is associated with increased levels of oxidative stress. Copper deficiency also has been shown to impair immune function. Previous work by others demonstrated that passage of an amyocarditic or myocarditic strain of coxsackievirus B3 (CVB3) through selenium- or vitamin E-deficient mice led to increased cardiac pathology. To determine whether a copper deficiency would similarly alter the pathogenesis of CVB3 infections, Swiss outbred dams and their litters were fed copper-deficient diets from birth and received either deionized water or water with 0.315 mmol/L copper as copper sulfate. At 4 wk of age, copper-adequate or -deficient male and female offspring were infected with an amyocarditic or myocarditic strain of CVB3. Heart titers were elevated at d 3 and 7 postinfection in copper-deficient mice infected with the myocarditic CVB3 strain (CVB3/20) but only at d 7 in deficient mice infected with the amyocarditic CVB3 strain (CVB3/0) compared with copper-adequate controls. Copper-deficient mice infected with either strain of CVB3 had increased cardiac pathology compared with copper-adequate controls. Genomic sequences of viruses isolated from copper-adequate and -deficient mice were identical. Heart cytokine expression was elevated in copper-deficient CVB3-infected mice compared with infected controls. Circulating CVB3-specific IgG2a but not IgM levels were decreased in copper-deficient mice. Thus, copper deficiency is associated with an increased inflammatory response but decreased acquired immune response to CVB3 infection that results in increased cardiac pathology, presumably due to increased viral load. PMID:18424590

  6. Comparison of Effects of Ivabradine versus Carvedilol in Murine Model with the Coxsackievirus B3-Induced Viral Myocarditis

    PubMed Central

    Yue-Chun, Li; Teng, Zhang; Na-Dan, Zhou; Li-Sha, Ge; Qin, Luo; Xue-Qiang, Guan; Jia-Feng, Lin

    2012-01-01

    Background Elevated heart rate is associated with increased cardiovascular morbidity. The selective If current inhibitor ivabradine reduces heart rate without affecting cardiac contractility, and has been shown to be cardioprotective in the failing heart. Ivabradine also exerts some of its beneficial effects by decreasing cardiac proinflammatory cytokines and inhibiting peroxidants and collagen accumulation in atherosclerosis or congestive heart failure. However, the effects of ivabradine in the setting of acute viral myocarditis and on the cytokines, oxidative stress and cardiomyocyte apoptosis have not been investigated. Methodology/Principal Findings The study was designed to compare the effects of ivabradine and carvedilol in acute viral myocarditis. In a coxsackievirus B3 murine myocarditis model (Balb/c), effects of ivabradine and carvedilol (a nonselective β-adrenoceptor antagonist) on myocardial histopathological changes, cardiac function, plasma noradrenaline, cytokine levels, cardiomyocyte apoptosis, malondialdehyde and superoxide dismutase contents were studied. Both ivabradine and carvedilol similarly and significantly reduced heart rate, attenuated myocardial lesions and improved the impairment of left ventricular function. In addition, ivabradine treatment as well as carvedilol treatment showed significant effects on altered myocardial cytokines with a decrease in the amount of plasma noradrenaline. The increased myocardial MCP-1, IL-6, and TNF-α. in the infected mice was significantly attenuated in the ivabradine treatment group. Only carvedilol had significant anti-oxidative and anti-apoptoic effects in coxsackievirus B3-infected mice. Conclusions/Significance These results show that the protective effects of heart rate reduction with ivabradine and carvedilol observed in the acute phase of coxsackievirus B3 murine myocarditis may be due not only to the heart rate reduction itself but also to the downregulation of inflammatory cytokines. PMID

  7. An epidemic of coxsackievirus B3 infection in infants and children in Jiangsu Province, China: a prospective cohort study.

    PubMed

    Gao, Fan; Bian, Lian-Lian; Mao, Qun-Ying; Chen, Pan; Yao, Xin; Li, Jing-Xin; Zhu, Feng-Cai; Liang, Zheng-Lun

    2016-07-01

    To investigate the epidemiological data on coxsackievirus B3 (CVB3) infection and its incidence in infants and children, a prospective cohort study was carried out from 2012 to 2014 in Jiangsu Province, China. According to the results of seropositive rates and NTAb titers of CVB3, an epidemic of CVB3 infection was found, and a dynamic change in CVB3 neutralizing antibody was also observed. One case was recorded with CVB3-associated hand, foot and mouth disease (HFMD), and the isolates belonged to the CVB3 D2 subtype. Our data help us to better understand the epidemic characteristics of CVB3 infection in infants and children. PMID:27020571

  8. Induction of cytopathic effect and cytokines in coxsackievirus B3-infected murine astrocytes

    PubMed Central

    2013-01-01

    Background Coxsackievirus commonly infects children and occasionally causes severe meningitis and/or encephalitis in the newborn. The underlying mechanism(s) behind the central nervous system pathology is poorly defined. Methods It is hypothesized that astrocytes may be involved in inflammatory response induced by CVB3 infection. Here we discuss this hypothesis in the context of CVB3 infection and associated inflammatory response in primary mouse astrocytes. Results The results showed that coxsackievirus receptor (CAR) was distributed homogeneously on the astrocytes, and that CVB3 could infect and replicate in astrocytes, with release of infectious virus particles. CVB3 induced cytopathic effect and production of proinflammatory cytokines IL-1β, TNF-α, IL-6, and chemokine CXCL10 from astrocytes. Conclusion These data suggest that direct astrocyte damage and cytokines induction could be a mechanism of virus-induced meningitis and/or encephalitis. PMID:23693026

  9. Genomic characterization of coxsackievirus type B3 strains associated with acute flaccid paralysis in south-western India.

    PubMed

    Laxmivandana, Rongala; Cherian, Sarah S; Yergolkar, Prasanna; Chitambar, Shobha D

    2016-03-01

    Acute flaccid paralysis (AFP) associated with coxsackievirus type B3 (CV-B3) of the species Enterovirus B is an emerging concern worldwide. Although CV-B3-associated AFP in India has been demonstrated previously, the genomic characterization of these strains is unreported. Here, CV-B3 strains detected on the basis of the partial VP1 gene in 10 AFP cases and five asymptomatic contacts identified from different regions of south-western India during 2009-2010 through the Polio Surveillance Project were considered for complete genome sequencing and characterization. Phylogenetic analysis of complete VP1 gene sequences of global CV-B3 strains classified Indian CV-B3 strains into genogroup GVI, along with strains from Uzbekistan and Bangladesh, and into a new genogroup, GVII. Genomic divergence between genogroups of the study strains was 14.4 % with significantly lower divergence (1.8 %) within GVI (n = 12) than that within GVII (8.5 %) (n = 3). The strains from both AFP cases and asymptomatic contacts, identified mainly in coastal Karnataka and Kerala, belonged to the dominant genogroup GVI, while the GVII strains were recovered from AFP cases in north interior Karnataka. All study strains carried inter-genotypic recombination with the structural region similar to reference CV-B3 strains, and 5' non-coding regions and non-structural regions closer to other enterovirus B types. Domain II structures of 5' non-coding regions, described to modulate virus replication, were predicted to have varied structural folds in the two genogroups and were attributed to differing recombination patterns. The results indicate two distinct genomic compositions of CV-B3 strains circulating in India and suggest the need for concurrent analysis of viral and host factors to further understand the varied manifestations of their infections. PMID:26743460

  10. Antiviral Activity of Oroxylin A against Coxsackievirus B3 Alleviates Virus-Induced Acute Pancreatic Damage in Mice

    PubMed Central

    Kang, Ju Won; Hwang, Sam Noh; Rhee, Ki-Jong; Shim, Aeri; Hong, Eun-Hye; Kim, Yeon-Jeong; Jeon, Sang-Min; Chang, Sun-Young; Kim, Dong-Eun; Cho, Sungchan; Ko, Hyun-Jeong

    2016-01-01

    The flavonoids mosloflavone, oroxylin A, and norwogonin, which were purified from Scutellaria baicalensis Georgi, significantly protected Vero cells against Coxsackievirus B3 (CVB3)-induced cell death. To investigate the in vivo antiviral activity of oroxylin A, we intraperitoneally inoculated CVB3 into 4-week-old BALB/c mice. Body weights and blood glucose levels of the mice were decreased after CVB3 infection, and these changes were attenuated by the administration of oroxylin A. Importantly, treatment of mice with oroxylin A reduced viral titers in the pancreas and decreased the serum levels of the inflammatory cytokines including interleukin-6 (IL-6) and tumor necrosis factor (TNF)-α. Additionally, the administration of oroxylin A mitigated the histological pancreatic lesions and apoptotic cell death induced by CVB3 infection and increased the levels of phospho-eIF2α in infected pancreata. The results suggest that oroxylin A may represent a potent antiviral agent against CVB3 infection. PMID:27195463

  11. Protein 2B of Coxsackievirus B3 Induces Autophagy Relying on Its Transmembrane Hydrophobic Sequences.

    PubMed

    Wu, Heng; Zhai, Xia; Chen, Yang; Wang, Ruixue; Lin, Lexun; Chen, Sijia; Wang, Tianying; Zhong, Xiaoyan; Wu, Xiaoyu; Wang, Yan; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2016-01-01

    Coxsackievirus B (CVB) belongs to Enterovirus genus within the Picornaviridae family, and it is one of the most common causative pathogens of viral myocarditis in young adults. The pathogenesis of myocarditis caused by CVB has not been completely elucidated. In CVB infection, autophagy is manipulated to facilitate viral replication. Here we report that protein 2B, one of the non-structural proteins of CVB3, possesses autophagy-inducing capability. The autophagy-inducing motif of protein 2B was identified by the generation of truncated 2B and site-directed mutagenesis. The expression of 2B alone was sufficient to induce the formation of autophagosomes in HeLa cells, while truncated 2B containing the two hydrophobic regions of the protein also induced autophagy. In addition, we demonstrated that a single amino acid substitution (56V→A) in the stem loop in between the two hydrophobic regions of protein 2B abolished the formation of autophagosomes. Moreover, we found that 2B and truncated 2B with autophagy-inducting capability were co-localized with LC3-II. This study indicates that protein 2B relies on its transmembrane hydrophobic regions to induce the formation of autophagosomes, while 56 valine residue in the stem loop of protein 2B might exert critical structural influence on its two hydrophobic regions. These results may provide new insight for understanding the molecular mechanism of autophagy triggered by CVB infection. PMID:27187444

  12. Protein 2B of Coxsackievirus B3 Induces Autophagy Relying on Its Transmembrane Hydrophobic Sequences

    PubMed Central

    Wu, Heng; Zhai, Xia; Chen, Yang; Wang, Ruixue; Lin, Lexun; Chen, Sijia; Wang, Tianying; Zhong, Xiaoyan; Wu, Xiaoyu; Wang, Yan; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2016-01-01

    Coxsackievirus B (CVB) belongs to Enterovirus genus within the Picornaviridae family, and it is one of the most common causative pathogens of viral myocarditis in young adults. The pathogenesis of myocarditis caused by CVB has not been completely elucidated. In CVB infection, autophagy is manipulated to facilitate viral replication. Here we report that protein 2B, one of the non-structural proteins of CVB3, possesses autophagy-inducing capability. The autophagy-inducing motif of protein 2B was identified by the generation of truncated 2B and site-directed mutagenesis. The expression of 2B alone was sufficient to induce the formation of autophagosomes in HeLa cells, while truncated 2B containing the two hydrophobic regions of the protein also induced autophagy. In addition, we demonstrated that a single amino acid substitution (56V→A) in the stem loop in between the two hydrophobic regions of protein 2B abolished the formation of autophagosomes. Moreover, we found that 2B and truncated 2B with autophagy-inducting capability were co-localized with LC3-II. This study indicates that protein 2B relies on its transmembrane hydrophobic regions to induce the formation of autophagosomes, while 56 valine residue in the stem loop of protein 2B might exert critical structural influence on its two hydrophobic regions. These results may provide new insight for understanding the molecular mechanism of autophagy triggered by CVB infection. PMID:27187444

  13. The antiviral effect of jiadifenoic acids C against coxsackievirus B3

    PubMed Central

    Ge, Miao; Wang, Huiqiang; Zhang, Guijie; Yu, Shishan; Li, Yuhuan

    2014-01-01

    Coxsackievirus B type 3 (CVB3) is one of the major causative pathogens associated with viral meningitis and myocarditis, which are widespread in the human population and especially prevalent in neonates and children. These infections can result in dilated cardiomyopathy (DCM) and other severe clinical complications. There are no vaccines or drugs approved for the prevention or therapy of CVB3-induced diseases. During screening for anti-CVB3 candidates in our previous studies, we found that jiadifenoic acids C exhibited strong antiviral activities against CVB3 as well as other strains of Coxsackie B viruses (CVBs). The present studies were carried out to evaluate the antiviral activities of jiadifenoic acids C. Results showed that jiadifenoic acids C could reduce CVB3 RNA and proteins synthesis in a dose-dependent manner. Jiadifenoic acids C also had a similar antiviral effect on the pleconaril-resistant variant of CVB3. We further examined the impact of jiadifenoic acids C on the synthesis of viral structural and non-structural proteins, finding that jiadifenoic acids C could reduce VP1 and 3D protein production. A time-course study with Vero cells showed that jiadifenoic acids C displayed significant antiviral activities at 0–6 h after CVB3 inoculation, indicating that jiadifenoic acids C functioned at an early step of CVB3 replication. However, jiadifenoic acids C had no prophylactic effect against CVB3. Taken together, we show that jiadifenoic acids C exhibit strong antiviral activities against all strains of CVB, including the pleconaril-resistant variant. Our study could provide a significant lead for anti-CVB3 drug development. PMID:26579396

  14. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  15. Panax Notoginseng Saponins Ameliorates Coxsackievirus B3-Induced Myocarditis by Activating the Cystathionine-γ-Lyase/Hydrogen Sulfide Pathway.

    PubMed

    Pan, Lulu; Zhang, Yuanhai; Lu, Jiacheng; Geng, Zhimin; Jia, Lianhong; Rong, Xing; Wang, Zhenquan; Zhao, Qifeng; Wu, Rongzhou; Chu, Maoping; Zhang, Chunxiang

    2015-12-01

    This study is to determine the therapeutic effects of Panax notoginseng saponins (PNSs) on coxsackievirus B3 (CVB3)-induced myocarditis, and whether cystathionine-γ-lyase (CSE)/hydrogen sulfide (H2S) pathway is involved. Mouse model of myocarditis was induced by CVB3 infection, and the mice were subjected to vehicle (saline) or drug treatments (sodium bisulfide (NaHS), propargylglycine (PAG), or PNSs). The results showed that there were inflammatory cell infiltrations, interstitial edemas, and elevated inflammatory cytokines, in CVB3-induced myocarditis. PAG administration increased, whereas NaHS treatment decreased the severity of the myocarditis. PNS treatment dramatically alleviated these myocardial injuries and decreased the viral messenger RNA (mRNA) expression by the enhanced expression of CSE/H2S pathway. Moreover, the therapeutic effects of PNSs on myocarditis were stronger than those of NaHS. Finally, the effect of PNSs on CSE/H2S pathway and cardiac cell protection were verified in cultured cardiac cells. PNSs may be a promising medication for viral myocarditis therapy. PMID:26525047

  16. 2,3,4-Trihydroxybenzyl-hydrazide analogues as novel potent coxsackievirus B3 3C protease inhibitors.

    PubMed

    Kim, Bo-Kyoung; Ko, Hyojin; Jeon, Eun-Seok; Ju, Eun-Seon; Jeong, Lak Shin; Kim, Yong-Chul

    2016-09-14

    Human coxsackievirus B3 (CVB3) 3C protease plays an essential role in the viral replication of CVB3, which is a non-enveloped and positive single-stranded RNA virus belonging to Picornaviridae family, causing acute viral myocarditis mainly in children. During optimization based on SAR studies of benserazide (3), which was reported as a novel anti-CVB3 3C(pro) agent from a screening of compound libraries, the 2,3,4-trihydroxybenzyl moiety of 3 was identified as a key pharmacophore for inhibitory activity against CVB3 3C(pro). Further optimization was performed by the introduction of various aryl-alkyl substituted hydrazide moieties instead of the serine moiety of 3. Among the optimized compounds, 11Q, a 4-hydroxyphenylpentanehydrazide derivative, showed the most potent inhibitory activity (IC50 = 0.07 μM). Enzyme kinetics studies indicated that 11Q exhibited a mixed inhibitory mechanism of action. The antiviral activity against CVB3 was confirmed using the further derived analogue (14b) with more cell permeable valeryl ester group at the 2,3,4-trihydroxy moiety. PMID:27191615

  17. Dose-dependent protective effect of nicotine in a murine model of viral myocarditis induced by coxsackievirus B3

    PubMed Central

    Li-Sha, Ge; Jing-Lin, Zhao; Guang-Yi, Chen; Li, Liu; De-Pu, Zhou; Yue-Chun, Li

    2015-01-01

    The alpha 7 nicotinic acetylcholine receptor (alpha7 nAChR) was recently described as an anti-inflammatory target in various inflammatory diseases. The aim of this study was to investigate the dose-related effects of nicotine, an alpha7 nAChR agonist, in murine model of viral myocarditis. BALB/C mice were infected by an intraperitoneally injection with coxsackievirus B3. Nicotine was administered at doses of 0.1, 0.2 or 0.4 mg/kg three times per day for 7 or 14 consecutive days. The effects of nicotine on survival, myocardial histopathological changes, cardiac function, and cytokine levels were studied. The survival rate on day 14 increased in a dose-dependent fashion and was markedly higher in the 0.2 and 0.4 mg/kg nicotine groups than in the infected untreated group. Treatment with high-dose nicotine reduced the myocardial inflammation and improved the impaired left ventricular function in infected mice. The mRNA expressions and protein levels of TNF-α, IL-1β, IL-6, and IL-17A were significantly downregulated in dose-dependent manners in the nicotine treatment groups compared to the infected untreated group. Nicotine dose-dependently reduced the severity of viral myocarditis through inhibiting the production of proinflammatory cytokines. The findings suggest that alpha7 nAChR agonists may be a promising new strategy for patients with viral myocarditis. PMID:26507386

  18. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis.

    PubMed Central

    Godeny, E. K.; Gauntt, C. J.

    1987-01-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an 35S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice. Images Figure 1 Figure 2 Figure 3 PMID:2823612

  19. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis

    SciTech Connect

    Godeny, E.K.; Gauntt, C.J.

    1987-11-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an /sup 35/S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice.

  20. Caspase Activation and Specific Cleavage of Substrates after Coxsackievirus B3-Induced Cytopathic Effect in HeLa Cells

    PubMed Central

    Carthy, Christopher M.; Granville, David J.; Watson, Kathleen A.; Anderson, Daniel R.; Wilson, Janet E.; Yang, Decheng; Hunt, David W. C.; McManus, Bruce M.

    1998-01-01

    Coxsackievirus B3 (CVB3), an enterovirus in the family Picornaviridae, induces cytopathic changes in cell culture systems and directly injures multiple susceptible organs and tissues in vivo, including the myocardium, early after infection. Biochemical analysis of the cell death pathway in CVB3-infected HeLa cells demonstrated that the 32-kDa proform of caspase 3 is cleaved subsequent to the degenerative morphological changes seen in infected HeLa cells. Caspase activation assays confirm that the cleaved caspase 3 is proteolytically active. The caspase 3 substrates poly(ADP-ribose) polymerase, a DNA repair enzyme, and DNA fragmentation factor, a cytoplasmic inhibitor of an endonuclease responsible for DNA fragmentation, were degraded at 9 h following infection, yielding their characteristic cleavage fragments. Inhibition of caspase activation by benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (ZVAD.fmk) did not inhibit the virus-induced cytopathic effect, while inhibition of caspase activation by ZVAD.fmk in control apoptotic cells induced by treatment with the porphyrin photosensitizer benzoporphyrin derivative monoacid ring A and visible light inhibited the apoptotic phenotype. Caspase activation and cleavage of substrates may not be responsible for the characteristic cytopathic effect produced by picornavirus infection yet may be related to late-stage alterations of cellular homeostatic processes and structural integrity. PMID:9696873

  1. Cyclosporine A Treatment Inhibits Abcc6-Dependent Cardiac Necrosis and Calcification following Coxsackievirus B3 Infection in Mice

    PubMed Central

    Marton, Jennifer; Albert, Danica; Wiltshire, Sean A.; Park, Robin; Bergen, Arthur; Qureshi, Salman; Malo, Danielle; Burelle, Yan; Vidal, Silvia M.

    2015-01-01

    Coxsackievirus type B3 (CVB3) is a cardiotropic enterovirus. Infection causes cardiomyocyte necrosis and myocardial inflammation. The damaged tissue that results is replaced with fibrotic or calcified tissue, which can lead to permanently altered cardiac function. The extent of pathogenesis among individuals exposed to CVB3 is dictated by a combination of host genetics, viral virulence, and the environment. Here, we aimed to identify genes that modulate cardiopathology following CVB3 infection. 129S1 mice infected with CVB3 developed increased cardiac pathology compared to 129X1 substrain mice despite no difference in viral burden. Linkage analysis identified a major locus on chromosome 7 (LOD: 8.307, P<0.0001) that controlled the severity of cardiac calcification and necrosis following infection. Sub-phenotyping and genetic complementation assays identified Abcc6 as the underlying gene. Microarray expression profiling identified genotype-dependent regulation of genes associated with mitochondria. Electron microscopy examination showed elevated deposition of hydroxyapatite-like material in the mitochondrial matrices of infected Abcc6 knockout (Abcc6-/-) mice but not in wildtype littermates. Cyclosporine A (CsA) inhibits mitochondrial permeability transition pore opening by inhibiting cyclophilin D (CypD). Treatment of Abcc6 -/- mice with CsA reduced cardiac necrosis and calcification by more than half. Furthermore, CsA had no effect on the CVB3-induced phenotype of doubly deficient CypD-/-Abcc6-/- mice. Altogether, our work demonstrates that mutations in Abcc6 render mice more susceptible to cardiac calcification following CVB3 infection. Moreover, we implicate CypD in the control of cardiac necrosis and calcification in Abcc6-deficient mice, whereby CypD inhibition is required for cardioprotection. PMID:26375467

  2. Development of an Enzyme-Linked Immunosorbent Spot Assay To Measure Serum-Neutralizing Antibodies against Coxsackievirus B3

    PubMed Central

    Yang, Lisheng; He, Delei; Tang, Min; Li, Zhiqun; Liu, Che; Xu, Longfa; Chen, Yixin; Du, Hailian; Zhao, Qinjian; Zhang, Jun; Xia, Ningshao

    2014-01-01

    Coxsackievirus B3 (CVB3) is the most common pathogen that induces acute and chronic viral myocarditis in children. The cytopathic effect (CPE)-based neutralization test (Nt-CPE) and the plaque reduction neutralization test (PRNT) are the most common methods for measuring neutralizing antibody titers against CVB3 in blood serum samples. However, these two methods are inefficient for CVB3 vaccine clinical trials, which require the testing of a large number of serum specimens. In this study, we developed an efficient neutralization test based on the enzyme-linked immunospot (Nt-ELISPOT) assay for measuring CVB3-neutralizing antibodies. This modified ELISPOT assay was based on the use of a monoclonal antibody against the viral capsid protein VP1 to detect the cells that are infected with CVB3, which, after immunoperoxidase staining, are counted as spots using an automated ELISPOT analyzer. Using the modified ELISPOT assay, we characterized the infection kinetics of CVB3 and divided the infection process of CVB3 on a cluster of cells into four phases. The stability of the Nt-ELISPOT was then evaluated. We found that over a wide range of infectious doses (102 to 106.5× 50% tissue culture infectious dose [TCID50] per well), the neutralizing titers of the sera were steady as long as they were tested during the log phase or the first half of the stationary phase of growth of the spots. We successfully shortened the testing period from 7 days to approximately 20 h. We also found that there was a good correlation (R2 = 0.9462) between the Nt-ELISPOT and the Nt-CPE assays. Overall, the Nt-ELISPOT assay is a reliable and efficient method for measuring neutralizing antibodies in serum. PMID:24391137

  3. GBF1, a Guanine Nucleotide Exchange Factor for Arf, Is Crucial for Coxsackievirus B3 RNA Replication▿

    PubMed Central

    Lanke, Kjerstin H. W.; van der Schaar, Hilde M.; Belov, George A.; Feng, Qian; Duijsings, Daniël; Jackson, Catherine L.; Ehrenfeld, Ellie; van Kuppeveld, Frank J. M.

    2009-01-01

    The replication of enteroviruses is sensitive to brefeldin A (BFA), an inhibitor of endoplasmic reticulum-to-Golgi network transport that blocks activation of guanine exchange factors (GEFs) of the Arf GTPases. Mammalian cells contain three BFA-sensitive Arf GEFs: GBF1, BIG1, and BIG2. Here, we show that coxsackievirus B3 (CVB3) RNA replication is insensitive to BFA in MDCK cells, which contain a BFA-resistant GBF1 due to mutation M832L. Further evidence for a critical role of GBF1 stems from the observations that viral RNA replication is inhibited upon knockdown of GBF1 by RNA interference and that replication in the presence of BFA is rescued upon overexpression of active, but not inactive, GBF1. Overexpression of Arf proteins or Rab1B, a GTPase that induces GBF1 recruitment to membranes, failed to rescue RNA replication in the presence of BFA. Additionally, the importance of the interaction between enterovirus protein 3A and GBF1 for viral RNA replication was investigated. For this, the rescue from BFA inhibition of wild-type (wt) replicons and that of mutant replicons of both CVB3 and poliovirus (PV) carrying a 3A protein that is impaired in binding GBF1 were compared. The BFA-resistant GBF1-M832L protein efficiently rescued RNA replication of both wt and mutant CVB3 and PV replicons in the presence of BFA. However, another BFA-resistant GBF1 protein, GBF1-A795E, also efficiently rescued RNA replication of the wt replicons, but not that of mutant replicons, in the presence of BFA. In conclusion, this study identifies a critical role for GBF1 in CVB3 RNA replication, but the importance of the 3A-GBF1 interaction requires further study. PMID:19740986

  4. Testosterone and interleukin-1β increase cardiac remodeling during coxsackievirus B3 myocarditis via serpin A 3n

    PubMed Central

    Coronado, Michael J.; Brandt, Jessica E.; Kim, Eunyong; Bucek, Adriana; Bedja, Djahida; Abston, Eric D.; Shin, Jaewook; Gabrielson, Kathleen L.; Mitzner, Wayne

    2012-01-01

    Myocarditis and dilated cardiomyopathy (DCM) are often caused by viral infections and occur more frequently in men than in women, but the reasons for the sex difference remain unclear. The aim of this study was to assess whether gene changes in the heart during coxsackievirus B3 (CVB3) myocarditis in male and female BALB/c mice predicted worse DCM in males. Although myocarditis (P = 4.2 × 10−5) and cardiac dilation (P = 0.008) were worse in males, there was no difference in viral replication in the heart. Fibrotic remodeling genes, such as tissue inhibitor of metalloproteinase (TIMP)-1 and serpin A 3n, were upregulated in males during myocarditis rather than during DCM. Using gonadectomy and testosterone replacement, we showed that testosterone increased cardiac TIMP-1 (P = 0.04), serpin A 3n (P = 0.007), and matrix metalloproteinase (MMP)-8 (P = 0.04) during myocarditis. Testosterone increased IL-1β levels in the heart (P = 0.02), a cytokine known to regulate cardiovascular remodeling, and IL-1β in turn increased cardiac serpin A 3n mRNA (P = 0.005). We found that 39 of 118 (33%) genes identified in acute DCM patients were significantly altered in the heart during CVB3 myocarditis in mice, including serpin A 3n (3.3-fold change, P = 0.0001). Recombinant serpin A 3n treatment induced cardiac fibrosis during CVB3 myocarditis (P = 0.0008) while decreasing MMP-3 (P = 0.04) and MMP-9 (P = 0.03) levels in the heart. Thus, serpin A 3n was identified as a gene associated with fibrotic cardiac remodeling and progression to DCM in male myocarditis patients and mice. PMID:22328081

  5. Direct interactions of coxsackievirus B3 with immune cells in the splenic compartment of mice susceptible or resistant to myocarditis.

    PubMed Central

    Anderson, D R; Wilson, J E; Carthy, C M; Yang, D; Kandolf, R; McManus, B M

    1996-01-01

    In vitro replication of coxsackievirus B3 (CVB3) in cells of the immune system derived from uninfected adolescent A/J and C57BL/6J mice and replication of CVB3 in and association with immune cells from spleens of infected animals in vivo were assessed. Nonstimulated or mitogen-stimulated spleen cells were minimally permissive for viral replication during an 8-h period. Three days postinfection (p.i.), CVB3 RNA was localized in vivo to B cells and follicular dendritic cells of germinal centers in both A/J and C57BL/6J mice; however, extrafollicular localization was greater in C57BL/6J mice (P = 0.0054). Although the pattern of CVB3 RNA localization was different, the total load of infections virus (PFU per milligram of tissue) was not different. Splenic CVB3 titers (PFU per milligram of tissue) in both strains were maximal at day 3 or 4 p.i. and were back to baseline by day 7 p.i., with most infectious virus being non-cell associated. CVB3 titers (PFU per milligram of tissue) correlated directly with in situ hybridization positivity in splenic follicles and extrafollicular regions in both murine strains; however, follicular hybridization intensity was greater in A/J mice at day 5 p.i. (P = 0.021). Flow cytometric analysis demonstrated that 50.4% of total spleen cells positive for CVB3 antigen were B cells and 69.6% of positive splenic lymphocytes were B cells. Myocardial virus load in C57BL/6J mice was significantly lower than that in A/J mice at days 4 and 5 p.i. These data indicate that CVB3 replicates in murine splenocytes in vitro and in B cells and extrafollicular cells in vivo. PMID:8676490

  6. Recruitment of PI4KIIIβ to Coxsackievirus B3 Replication Organelles Is Independent of ACBD3, GBF1, and Arf1

    PubMed Central

    Dorobantu, Cristina M.; van der Schaar, Hilde M.; Ford, Lauren A.; Strating, Jeroen R. P. M.; Ulferts, Rachel; Fang, Ying; Belov, George

    2014-01-01

    ABSTRACT Members of the Enterovirus (poliovirus [PV], coxsackieviruses, and human rhinoviruses) and Kobuvirus (Aichi virus) genera in the Picornaviridae family rely on PI4KIIIβ (phosphatidylinositol-4-kinase IIIβ) for efficient replication. The small membrane-anchored enteroviral protein 3A recruits PI4KIIIβ to replication organelles, yet the underlying mechanism has remained elusive. Recently, it was shown that kobuviruses recruit PI4KIIIβ through interaction with ACBD3 (acyl coenzyme A [acyl-CoA]-binding protein domain 3), a novel interaction partner of PI4KIIIβ. Therefore, we investigated a possible role for ACBD3 in recruiting PI4KIIIβ to enterovirus replication organelles. Although ACBD3 interacted directly with coxsackievirus B3 (CVB3) 3A, its depletion from cells by RNA interference did not affect PI4KIIIβ recruitment to replication organelles and did not impair CVB3 RNA replication. Enterovirus 3A was previously also proposed to recruit PI4KIIIβ via GBF1/Arf1, based on the known interaction of 3A with GBF1, an important regulator of secretory pathway transport and a guanine nucleotide exchange factor (GEF) of Arf1. However, our results demonstrate that inhibition of GBF1 or Arf1 either by pharmacological inhibition or depletion with small interfering RNA (siRNA) treatment did not affect the ability of 3A to recruit PI4KIIIβ. Furthermore, we show that a 3A mutant that no longer binds GBF1 was capable of recruiting PI4KIIIβ, even in ACBD3-depleted cells. Together, our findings indicate that unlike originally envisaged, coxsackievirus recruits PI4KIIIβ to replication organelles independently of ACBD3 and GBF1/Arf1. IMPORTANCE A hallmark of enteroviral infection is the generation of new membranous structures to support viral RNA replication. The functionality of these “replication organelles” depends on the concerted actions of both viral nonstructural proteins and co-opted host factors. It is thus essential to understand how these structures are

  7. Effect of T68A/N126Y mutations on the conformational and ligand binding landscape of Coxsackievirus B3 3C protease.

    PubMed

    Bhakat, Soumendranath

    2015-08-01

    3C protease of Coxsackievirus B3 (CVB3) plays an essential role in the viral replication cycle, and therefore, emerged as an attractive therapeutic target for the treatment of human diseases caused by CVB3 infection. In this study, we report the first account of the molecular impact of the T68A/N126Y double mutant (Mutant(Bound)) using an integrated computational approach. Molecular dynamics simulation and post-dynamics binding free energy, principal component analysis (PCA), hydrogen bond occupancy, SASA, R(g) and RMSF confirm that T68A/N126Y instigated an increased conformational flexibility due to the loss of intra- and inter-molecular hydrogen bond interactions and other prominent binding forces, which led to a decreased protease grip on the ligand (3CPI). The double mutations triggered a distortion orientation of 3CPI in the active site and decreases the binding energy, ΔG(bind) (∼3 kcal mol(-1)), compared to the wild type (Wild(Bound)). The van der Waals and electrostatic energy contributions coming from residues 68 and 126 are lower for Mutant(Bound) when compared with Wild(Bound). In addition, variation in the overall enzyme motion as evident from the PCA, distorted hydrogen bonding network and loss of protein-ligand interactions resulted in a loss of inhibitor efficiency. The comprehensive molecular insight gained from this study should be of great importance in understanding the drug resistance against CVB3 3C protease; also, it will assist in the designing of novel Coxsackievirus B3 inhibitors with high ligand efficacy on resistant strains. PMID:26077945

  8. Kinetic and Structural Analysis of Coxsackievirus B3 Receptor Interactions and Formation of the A-Particle

    PubMed Central

    Organtini, Lindsey J.; Makhov, Alexander M.; Conway, James F.

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) has been identified as the cellular receptor for group B coxsackieviruses, including serotype 3 (CVB3). CAR mediates infection by binding to CVB3 and catalyzing conformational changes in the virus that result in formation of the altered, noninfectious A-particle. Kinetic analyses show that the apparent first-order rate constant for the inactivation of CVB3 by soluble CAR (sCAR) at physiological temperatures varies nonlinearly with sCAR concentration. Cryo-electron microscopy (cryo-EM) reconstruction of the CVB3-CAR complex resulted in a 9.0-Å resolution map that was interpreted with the four available crystal structures of CAR, providing a consensus footprint for the receptor binding site. The analysis of the cryo-EM structure identifies important virus-receptor interactions that are conserved across picornavirus species. These conserved interactions map to variable antigenic sites or structurally conserved regions, suggesting a combination of evolutionary mechanisms for receptor site preservation. The CAR-catalyzed A-particle structure was solved to a 6.6-Å resolution and shows significant rearrangement of internal features and symmetric interactions with the RNA genome. IMPORTANCE This report presents new information about receptor use by picornaviruses and highlights the importance of attaining at least an ∼9-Å resolution for the interpretation of cryo-EM complex maps. The analysis of receptor binding elucidates two complementary mechanisms for preservation of the low-affinity (initial) interaction of the receptor and defines the kinetics of receptor-catalyzed conformational change to the A-particle. PMID:24623425

  9. MiR-10a* up-regulates coxsackievirus B3 biosynthesis by targeting the 3D-coding sequence

    PubMed Central

    Tong, Lei; Lin, Lexun; Wu, Shuo; Guo, Zhiwei; Wang, Tianying; Qin, Ying; Wang, Ruixue; Zhong, Xiaoyan; Wu, Xia; Wang, Yan; Luan, Tian; Wang, Qiang; Li, Yunxia; Chen, Xiaofeng; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2013-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that can posttranscriptionally regulate gene expression by targeting messenger RNAs. During miRNA biogenesis, the star strand (miRNA*) is generally degraded to a low level in the cells. However, certain miRNA* express abundantly and can be recruited into the silencing complex to regulate gene expression. Most miRNAs function as suppressive regulators on gene expression. Group B coxsackieviruses (CVB) are the major pathogens of human viral myocarditis and dilated cardiomyopathy. CVB genome is a positive-sense, single-stranded RNA. Our previous study shows that miR-342-5p can suppress CVB biogenesis by targeting its 2C-coding sequence. In this study, we found that the miR-10a duplex could significantly up-regulate the biosynthesis of CVB type 3 (CVB3). Further study showed that it was the miR-10a star strand (miR-10a*) that augmented CVB3 biosynthesis. Site-directed mutagenesis showed that the miR-10a* target was located in the nt6818–nt6941 sequence of the viral 3D-coding region. MiR-10a* was detectable in the cardiac tissues of suckling Balb/c mice, suggesting that miR-10a* may impact CVB3 replication during its cardiac infection. Taken together, these data for the first time show that miRNA* can positively modulate gene expression. MiR-10a* might be involved in the CVB3 cardiac pathogenesis. PMID:23389951

  10. Mucosal immunization with high-mobility group box 1 in chitosan enhances DNA vaccine-induced protection against coxsackievirus B3-induced myocarditis.

    PubMed

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei; Xiong, Sidong

    2013-11-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  11. Complement component 3 interactions with coxsackievirus B3 capsid proteins: innate immunity and the rapid formation of splenic antiviral germinal centers.

    PubMed Central

    Anderson, D R; Carthy, C M; Wilson, J E; Yang, D; Devine, D V; McManus, B M

    1997-01-01

    Innate immunity is central to the clearance of pathogens from hosts as well as to the definition of acquired immune responses (D. T. Fearon, and R. M. Locksley, Science 272:50-53, 1996). Coxsackievirus B3 (CVB3), a human cardiopathic virus, was evaluated for the ability to activate the alternative and classical pathway of complement. CVB3 proteins interact with complement component 3 (C3, a soluble protein effector of innate immunity) after either in vitro exposure to mouse serum or in vivo murine infection and activate the alternative pathway of complement. In addition, we demonstrate that viral antigen retention and localization in germinal centers is dependent on C3, while virus antigen retention in extrafollicular regions in the spleen is not. In vivo depletion of native C3 abolished the rapid formation of virus-specific germinal centers (by day 3 post-CVB3 infection) in the absence of serum anti-CVB3 antibodies. These studies demonstrate that innate immune mechanisms, such as C3 interaction with CVB3, are essential for splenic antiviral germinal center formation in naive (antigen nonsensitized) mice resistant (C57BL/6J strain) and susceptible (A/J strain) to CVB3-induced myocarditis. PMID:9343244

  12. Cellular Proteins Act as Bridge Between 5' and 3' Ends of the Coxsackievirus B3 Mediating Genome Circularization During RNA Translation.

    PubMed

    Souii, Amira; M'hadheb-Gharbi, Manel Ben; Gharbi, Jawhar

    2015-09-01

    The positive single-stranded RNA genome of the Coxsackievirus B3 (CVB3) contains a 5' untranslated region (UTR) which hosts the internal ribosome entry site (IRES) element that governs cap-independent translation initiation and a polyadenylated 3' UTR which is required for stimulating the IRES activity. Viral RNA genomes could circularize to regulate initiation of translation and RNA synthesis at 5' and 3' ends. Interactions could either take place by direct RNA-RNA contacts, through cellular protein bridges mediating RNA circularization or both. Accordingly, we aimed to assess the nature of molecular interactions between these two regions and to evaluate cellular factors required for mRNA 3' end-mediated stimulation of CVB3 IRES-driven translation. By gel shift assays, we have showed that combining, in vitro, 5' and 3' UTR fragments had no discernible effect on the structures of RNAs, arguing against the presence of specific canonical RNA-RNA cyclization sequences between these two regions. Competitive UV crosslinking assays using BHK-21 cell extract showed common cellular proteins eIF3b, PTB, and La binding to both 5'- and 3' end RNAs. PCBP 1-2 and PABP were shown to bind, respectively, to 5' and 3' UTR probes. Taking together, these data suggest that CVB3 5'-3' end bridging occurs through 5' UTR-protein-protein-3' UTR interactions and not through RNA-RNA direct contact. The dual involvement of the 3' and 5' UTRs in controlling viral translation and RNA synthesis highlights the relevance of these regions in the infectious virus life cycle, making them suitable candidates for targeted CVB3 antiviral therapy. PMID:26139182

  13. Mucosal co-immunization with AIM2 enhances protective SIgA response and increases prophylactic efficacy of chitosan-DNA vaccine against coxsackievirus B3-induced myocarditis

    PubMed Central

    Chai, Dafei; Yue, Yan; Xu, Wei; Dong, Chunsheng; Xiong, Sidong

    2014-01-01

    Coxsackievirus B3 (CVB3) infection is considered as the most common cause of viral myocarditis with no available vaccine. Considering that CVB3 mainly invades through the gastrointestinal mucosa, the development of CVB3-specific mucosal vaccine, which is the most efficient way to induce mucosal immune responses, gains more and more attention. In this study, we used absent in melanoma 2 (AIM2) as a mucosal adjuvant to enhance the immunogenicity and immunoprotection of CVB3-specific chitosan-pVP1 vaccine. Mice were intranasally co-immunized with 50 μg chitosan-pAIM2 and equal amount of chitosan-pVP1 vaccine 4 times at 2 week-intervals, and then challenged with CVB3 2 weeks after the last immunization. Compared with chitosan-pVP1 vaccine immunization alone, chitosan-pAIM2 co-immunization enhanced resistance to CVB3-induced myocarditis evidenced by significantly enhanced ejection fractions from 55.40 ± 9.35 to 80.31 ± 11.35, improved myocarditis scores from 1.50 ± 0.45 to 0.30 ± 0.15, reduced viral load from 3.33 ± 0.50 to 0.50 ± 0.65, and increased survival rate from 40.0% to 75.5%. This increased immunoprotection might be attributed to the augmented level of CVB3-specific fecal SIgA with high affinity and neutralizing ability. In addition, co-immunization with chitosan-pAIM2 remarkably facilitated dendritic cells (DCs) recruitment to mesenteric lymph nodes (MLN), and promoted the expression of IgA-inducing factors (BAFF, APRIL, iNOS, RALDH1, IL-6, TGF-β), which might account for its mucosal adjuvant effect. This strategy may represent a promising prophylactic vaccine against CVB3-induced myocarditis. PMID:24614684

  14. Cleavage of DAP5 by coxsackievirus B3 2A protease facilitates viral replication and enhances apoptosis by altering translation of IRES-containing genes.

    PubMed

    Hanson, P J; Ye, X; Qiu, Y; Zhang, H M; Hemida, M G; Wang, F; Lim, T; Gu, A; Cho, B; Kim, H; Fung, G; Granville, D J; Yang, D

    2016-05-01

    Cleavage of eukaryotic translation initiation factor 4G (eIF4G) by enterovirus proteases during infection leads to the shutoff of cellular cap-dependent translation, but does not affect the initiation of cap-independent translation of mRNAs containing an internal ribosome entry site (IRES). Death-associated protein 5 (DAP5), a structural homolog of eIF4G, is a translation initiation factor specific for IRES-containing mRNAs. Coxsackievirus B3 (CVB3) is a positive single-stranded RNA virus and a primary causal agent of human myocarditis. Its RNA genome harbors an IRES within the 5'-untranslated region and is translated by a cap-independent, IRES-driven mechanism. Previously, we have shown that DAP5 is cleaved during CVB3 infection. However, the protease responsible for cleavage, cleavage site and effects on the translation of target genes during CVB3 infection have not been investigated. In the present study, we demonstrated that viral protease 2A but not 3C is responsible for DAP5 cleavage, generating 45- and 52-kDa N- (DAP5-N) and C-terminal (DAP5-C) fragments, respectively. By site-directed mutagenesis, we found that DAP5 is cleaved at amino acid G434. Upon cleavage, DAP5-N largely translocated to the nucleus at the later time points of infection, whereas the DAP5-C largely remained in the cytoplasm. Overexpression of these DAP5 truncates demonstrated that DAP5-N retained the capability of initiating IRES-driven translation of apoptosis-associated p53, but not the prosurvival Bcl-2 (B-cell lymphoma 2) when compared with the full-length DAP5. Similarly, DAP5-N expression promoted CVB3 replication and progeny release; on the other hand, DAP5-C exerted a dominant-negative effect on cap-dependent translation. Taken together, viral protease 2A-mediated cleavage of DAP5 results in the production of two truncates that exert differential effects on protein translation of the IRES-containing genes, leading to enhanced host cell death. PMID:26586572

  15. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3.

    PubMed Central

    Knowlton, K U; Jeon, E S; Berkley, N; Wessely, R; Huber, S

    1996-01-01

    Coxsackievirus B3 (CVB3) infections induce myocarditis in humans and mice. Little is known about the molecular characteristics of CVB3 that activate the cellular immunity responsible for cardiac inflammation. Previous experiments have identified an antibody escape mutant (H310A1) of a myocarditic variant of CVB3 (H3) that attenuates the myocarditic potential of the virus in mice in spite of ongoing viral replication in the heart. We have cloned full-length infectious cDNA copies of the viral genome of both the wild-type myocarditic H3 variant of CVB3 and the antibody escape mutant H310A1. Progeny viruses maintained the myocarditic and attenuated myocarditic potential of the parent viruses, H3 and H310A1. The full sequence of the H3 viral cDNA is reported and compared with those of previously published CVB3 variants. Comparison of the full sequences of H3 and H310A1 viruses identified a single nonconserved mutation (A to G) in the P1 polyprotein region at nucleotide 1442 resulting in an asparagine-to-aspartate mutation in amino acid 165 of VP2. This mutation is in a region that corresponds to the puff region of VP2. Nucleotide 1442 of the H3 and H310A1 cDNA copies of the viral genome was mutated to change amino acid 165 of VP2 to aspartate and asparagine, respectively. The presence of asparagine at amino acid 165 of VP2 is associated with the myocarditic phenotype, while an aspartate at the same site reduces the myocarditic potential of the virus. In addition, high-level production of tumor necrosis factor alpha by infected BALB/c monocytes is associated with asparagine at amino acid 165 of VP2 as has been previously demonstrated for the H3 virus. These findings identify potentially important differences between the H3 variant of CVB3 and other previously published CVB3 variants. In addition, the data demonstrate that a point mutation in the puff region of VP2 can markedly alter the ability of CVB3 to induce myocarditis in mice and tumor necrosis factor alpha

  16. Synthesis of Pyrazine-1,3-thiazine Hybrid Analogues as Antiviral Agent Against HIV-1, Influenza A (H1N1), Enterovirus 71 (EV71), and Coxsackievirus B3 (CVB3).

    PubMed

    Wu, Hong-Min; Zhou, Kuo; Wu, Tao; Cao, Yin-Guang

    2016-09-01

    A novel series of pyrazine-1,3-thiazine hybrid conjugates were synthesized in excellent yield. These derivatives were subsequently tested against human immunodeficiency virus (HIV-1); hemagglutinin type 1 and neuraminidase type 1-'influenza' A (H1N1) virus; enterovirus 71 (EV71); and coxsackievirus B3. The effect of these conjugates on the key enzymes responsible for the progression of these viral infections was also illustrated via enzyme-based assay, such as HIV-1 reverse transcriptase (RT) and neuraminidase, where entire tested molecules showed considerable inhibition. Particularly, among the tested derivatives, compound 3k was identified as most promising inhibitor of HIV-1 with 94% of inhibition (IC50 3.26 ± 0.2 μm). Moreover, the compound 3d was found to be the most potent analogue to inhibit the H1N1 virus with IC50 of 5.32 ± 0.4 μm together with inhibition of the neuraminidase enzyme (IC50 11.24 ± 1.1 μm). In regard to inhibitory activity against enterovirus 71 (EV71) and coxsackievirus B3 (CVB3), the tested derivatives showed considerable inhibition of infection. Molecular docking studies were also performed for the most promising inhibitors with their corresponding target protein to exemplify the structural requirement for better inhibitory activity. The results of inhibitory assay showed that designed molecules possess considerable inhibitory activity against the virus tested. PMID:27062664

  17. Mutations in the 5' NTR and the Non-Structural Protein 3A of the Coxsackievirus B3 Selectively Attenuate Myocarditogenicity.

    PubMed

    Massilamany, Chandirasegaran; Gangaplara, Arunakumar; Basavalingappa, Rakesh H; Rajasekaran, Rajkumar A; Vu, Hiep; Riethoven, Jean-Jack; Steffen, David; Pattnaik, Asit K; Reddy, Jay

    2015-01-01

    The 5' non-translated region (NTR) is an important molecular determinant that controls replication and virulence of coxsackievirus B (CVB)3. Previous studies have reported many nucleotide (nt) sequence differences in the Nancy strain of the virus, including changes in the 5' NTR with varying degrees of disease severity. In our studies of CVB3-induced myocarditis, we sought to generate an infectious clone of the virus for routine in vivo experimentation. By determining the viral nt sequence, we identified three new nt substitutions in the clone that differed from the parental virus strain: C97U in the 5' NTR; a silent mutation, A4327G, in non-structural protein 2C; and C5088U (resulting in P1449L amino acid change) in non-structural protein 3A of the virus leading us to evaluate the role of these changes in the virulence properties of the virus. We noted that the disease-inducing ability of the infectious clone-derived virus in three mouse strains was restricted to pancreatitis alone, and the incidence and severity of myocarditis were significantly reduced. We then reversed the mutations by creating three new clones, representing 1) U97C; 2) G4327A and U5088C; and 3) their combination together in the third clone. The viral titers obtained from all the clones were comparable, but the virions derived from the third clone induced myocarditis comparable to that induced by wild type virus; however, the pancreatitis-inducing ability remained unaltered, suggesting that the mutations described above selectively influence myocarditogenicity. Because the accumulation of mutations during passages is a continuous process in RNA viruses, it is possible that CVB3 viruses containing such altered nts may evolve naturally, thus favoring their survival in the environment. PMID:26098885

  18. Mutations in the 5’ NTR and the Non-Structural Protein 3A of the Coxsackievirus B3 Selectively Attenuate Myocarditogenicity

    PubMed Central

    Basavalingappa, Rakesh H.; Rajasekaran, Rajkumar A.; Vu, Hiep; Riethoven, Jean-Jack; Steffen, David; Pattnaik, Asit K.; Reddy, Jay

    2015-01-01

    The 5’ non-translated region (NTR) is an important molecular determinant that controls replication and virulence of coxsackievirus B (CVB)3. Previous studies have reported many nucleotide (nt) sequence differences in the Nancy strain of the virus, including changes in the 5’ NTR with varying degrees of disease severity. In our studies of CVB3-induced myocarditis, we sought to generate an infectious clone of the virus for routine in vivo experimentation. By determining the viral nt sequence, we identified three new nt substitutions in the clone that differed from the parental virus strain: C97U in the 5’ NTR; a silent mutation, A4327G, in non-structural protein 2C; and C5088U (resulting in P1449L amino acid change) in non-structural protein 3A of the virus leading us to evaluate the role of these changes in the virulence properties of the virus. We noted that the disease-inducing ability of the infectious clone-derived virus in three mouse strains was restricted to pancreatitis alone, and the incidence and severity of myocarditis were significantly reduced. We then reversed the mutations by creating three new clones, representing 1) U97C; 2) G4327A and U5088C; and 3) their combination together in the third clone. The viral titers obtained from all the clones were comparable, but the virions derived from the third clone induced myocarditis comparable to that induced by wild type virus; however, the pancreatitis-inducing ability remained unaltered, suggesting that the mutations described above selectively influence myocarditogenicity. Because the accumulation of mutations during passages is a continuous process in RNA viruses, it is possible that CVB3 viruses containing such altered nts may evolve naturally, thus favoring their survival in the environment. PMID:26098885

  19. Activation of AMP-activated protein kinase reduces collagen production via p38 MAPK in cardiac fibroblasts induced by coxsackievirus B3.

    PubMed

    Jiang, Shengyang; Jiang, Donglin; Zhao, Peng; He, Xinlong; Tian, Shunli; Wu, Xueming; Tao, Yijia

    2016-07-01

    Collagen deposition is the major cause of myocardial fibrosis, contributing to impaired cardiac contractile function in coxsackie virus B3 (CVB3)-infected hearts. Adenosine monophosphate-activated protein kinase (AMPK) has been considered as a cellular fuel gauge and super metabolic regulator, however, whether AMPK has an effect on collagen production in CVB3‑infected heart remains to be elucidated. In the present study, the association between AMPK activation and CVB3‑infected neonatal rat cardiac fibroblasts (NRCFs) was investigated. Collagen production was determined by the hydroxyproline content of the supernatant and by the expression of type I/IV collagen in the cell lysate. Rat hydroxyproline ELISA was used to detect hydroxyproline content in the supernatant. The expression of type I/IV collagen, and the phosphorylation of AMPKα‑Thr172 and p38 in the cell lysate were evaluated using western blotting. As expected, it was found that the hydroxyproline content in the supernatant, and the production of collagen I/IV in the cell lysate were significantly promoted at 48 h post‑CVB3‑infection. However, this effect was inhibited in a dose‑dependent manner when pretreated with 5‑aminoimidazole‑4‑carboxamide‑1‑4‑ribofuranoside (AICAR) for 2 h prior to CVB3‑infection. However, if the cells were preincubated with compound C or SB203580 for 30 min prior the treatment with AICAR, the inhibitive effects of AICAR were reversed. The results of the western blotting indicated that the phosphorylation of AMPKα‑Thr172 and p38 were significantly increased by AICAR in the NRCFs. However, only the phosphorylation of p38 mitogen‑activated protein kinase (MAPK) was inhibited by SB203580. In conclusion, AMPK activation reduced collagen production via the p38 MAPK‑dependent pathway in the cardiac fibroblasts induced by CVB3. The results of the present study may contribute to identifying an effective therapy for CVB3‑induced myocarditis and CVB3

  20. Impaired binding of standard initiation factors eIF3b, eIF4G and eIF4B to domain V of the live-attenuated coxsackievirus B3 Sabin3-like IRES - alternatives for 5′UTR-related cardiovirulence mechanisms

    PubMed Central

    2013-01-01

    Abstract Internal ribosome entry site (IRES) elements fold into highly organized conserved secondary and probably tertiary structures that guide the ribosome to an internal site of the RNA at the IRES 3′end. The composition of the cellular proteome is under the control of multiple processes, one of the most important being translation initiation. In each poliovirus Sabin vaccine strain, a single point mutation in the IRES secondary-structure domain V is a major determinant of neurovirulence and translation attenuation. Here we are extrapolating poliovirus findings to a genomic related virus named coxsackievirus B3 CVB3); a causative agent of viral myocarditis. We have previously reported that Sabin3-like mutation (U473 → C) introduced in the domain V sequence of the CVB3 IRES led to a defective mutant with a serious reduction in translation efficiency and ribosomal initiation complex assembly, besides an impaired RNA-protein binding pattern. With the aim to identify proteins interacting with both CVB3 wild-type and Sabin3-like domain V RNAs and to assess the effect of the Sabin3-like mutation on these potential interactions, we have used a proteomic approach. This procedure allowed the identification of three RNA-binding proteins interacting with the domain V: eIF4G (p220), eIF3b (p116) and eIF4B (p80). Moreover, we report that this single-nucleotide exchange impairs the interaction pattern and the binding affinity of these standard translation initiation factors within the IRES domain V of the mutant strain. Taken together, these data indicate how this decisive Sabin3-like mutation mediates viral translation attenuation; playing a key role in the understanding of the cardiovirulence attenuation within this construct. Hence, these data provide further evidence for the crucial role of RNA structure for the IRES activity, and reinforce the idea of a distribution of function between the different IRES structural domains. Virtual slide The virtual slide(s) for

  1. The RNA template channel of the RNA-dependent RNA polymerase as a target for development of antiviral therapy of multiple genera within a virus family.

    PubMed

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M

    2015-03-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the

  2. The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

    PubMed Central

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria

    2015-01-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the

  3. Development of potent inhibitors of the coxsackievirus 3C protease

    SciTech Connect

    Lee, Eui Seung; Lee, Won Gil; Yun, Soo-Hyeon; Rho, Seong Hwan; Im, Isak; Yang, Sung Tae; Sellamuthu, Saravanan; Lee, Yong Jae; Kwon, Sun Jae; Park, Ohkmae K.; Jeon, Eun-Seok; Park, Woo Jin . E-mail: wjpark@gist.ac.kr; Kim, Yong-Chul . E-mail: yongchul@gist.ac.kr

    2007-06-22

    Coxsackievirus B3 (CVB3) 3C protease (3CP) plays essential roles in the viral replication cycle, and therefore, provides an attractive therapeutic target for treatment of human diseases caused by CVB3 infection. CVB3 3CP and human rhinovirus (HRV) 3CP have a high degree of amino acid sequence similarity. Comparative modeling of these two 3CPs revealed one prominent distinction; an Asn residue delineating the S2' pocket in HRV 3CP is replaced by a Tyr residue in CVB3 3CP. AG7088, a potent inhibitor of HRV 3CP, was modified by substitution of the ethyl group at the P2' position with various hydrophobic aromatic rings that are predicted to interact preferentially with the Tyr residue in the S2' pocket of CVB3 3CP. The resulting derivatives showed dramatically increased inhibitory activities against CVB3 3CP. In addition, one of the derivatives effectively inhibited the CVB3 proliferation in vitro.

  4. Interspecies Differences in Virus Uptake versus Cardiac Function of the Coxsackievirus and Adenovirus Receptor

    PubMed Central

    Freiberg, Fabian; Sauter, Martina; Pinkert, Sandra; Govindarajan, Thirupugal; Kaldrack, Joanna; Thakkar, Meghna; Fechner, Henry; Klingel, Karin

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a cell contact protein with an important role in virus uptake. Its extracellular immunoglobulin domains mediate the binding to coxsackievirus and adenovirus as well as homophilic and heterophilic interactions between cells. The cytoplasmic tail links CAR to the cytoskeleton and intracellular signaling cascades. In the heart, CAR is crucial for embryonic development, electrophysiology, and coxsackievirus B infection. Noncardiac functions are less well understood, in part due to the lack of suitable animal models. Here, we generated a transgenic mouse that rescued the otherwise embryonic-lethal CAR knockout (KO) phenotype by expressing chicken CAR exclusively in the heart. Using this rescue model, we addressed interspecies differences in coxsackievirus uptake and noncardiac functions of CAR. Survival of the noncardiac CAR KO (ncKO) mouse indicates an essential role for CAR in the developing heart but not in other tissues. In adult animals, cardiac activity was normal, suggesting that chicken CAR can replace the physiological functions of mouse CAR in the cardiomyocyte. However, chicken CAR did not mediate virus entry in vivo, so that hearts expressing chicken instead of mouse CAR were protected from infection and myocarditis. Comparison of sequence homology and modeling of the D1 domain indicate differences between mammalian and chicken CAR that relate to the sites important for virus binding but not those involved in homodimerization. Thus, CAR-directed anticoxsackievirus therapy with only minor adverse effects in noncardiac tissue could be further improved by selectively targeting the virus-host interaction while maintaining cardiac function. IMPORTANCE Coxsackievirus B3 (CVB3) is one of the most common human pathogens causing myocarditis. Its receptor, the coxsackievirus and adenovirus receptor (CAR), not only mediates virus uptake but also relates to cytoskeletal organization and intracellular signaling

  5. Evolution of Tertiary Structure of Viral RNA Dependent Polymerases

    PubMed Central

    Černý, Jiří; Černá Bolfíková, Barbora; Valdés, James J.; Grubhoffer, Libor; Růžek, Daniel

    2014-01-01

    Viral RNA dependent polymerases (vRdPs) are present in all RNA viruses; unfortunately, their sequence similarity is too low for phylogenetic studies. Nevertheless, vRdP protein structures are remarkably conserved. In this study, we used the structural similarity of vRdPs to reconstruct their evolutionary history. The major strength of this work is in unifying sequence and structural data into a single quantitative phylogenetic analysis, using powerful a Bayesian approach. The resulting phylogram of vRdPs demonstrates that RNA-dependent DNA polymerases (RdDPs) of viruses within Retroviridae family cluster in a clearly separated group of vRdPs, while RNA-dependent RNA polymerases (RdRPs) of dsRNA and +ssRNA viruses are mixed together. This evidence supports the hypothesis that RdRPs replicating +ssRNA viruses evolved multiple times from RdRPs replicating +dsRNA viruses, and vice versa. Moreover, our phylogram may be presented as a scheme for RNA virus evolution. The results are in concordance with the actual concept of RNA virus evolution. Finally, the methods used in our work provide a new direction for studying ancient virus evolution. PMID:24816789

  6. Autoimmunity in Coxsackievirus B3 induced myocarditis: role of estrogen in suppressing autoimmunity

    PubMed Central

    2010-01-01

    SUMMARY Picornaviruses are small, non-enveloped, single stranded, positive sense RNA viruses which cause multiple diseases including myocarditis/dilated cardiomyopathy, type 1 diabetes, encephalitis, myositis, orchitis and hepatitis. Although picornaviruses directly kill cells, tissue injury primarily results from autoimmunity to self antigens. Viruses induce autoimmunity by: aborting deletion of self-reactive T cells during T cell ontogeny; reversing anergy of peripheral autoimmune T cells; eliminating T regulatory cells; stimulating self-reactive T cells through antigenic mimicry or cryptic epitopes; and acting as an adjuvant for self molecules released during virus infection. Most autoimmune diseases (SLE, rheumatoid arthritis, Grave’s disease) predominate in females, but diseases associated with picornavirus infections predominate in males. T regulatory cells are activated in infected females because of the combined effects of estrogen and innate immunity. PMID:20963181

  7. Coxsackievirus A6 Polymorphic Exanthem in Israeli Children.

    PubMed

    Renert-Yuval, Yael; Marva, Eytan; Weil, Merav; Shulman, Lester M; Gencylmaz, Nilsu; Sheffer, Sivan; Wolf, Dana G; Molho-Pessach, Vered

    2016-04-12

    Hand foot and mouth disease (HFMD) is an acute childhood viral exanthem usually associated with coxsackievirus A16 or enterovirus 71. Atypical HFMD associated with coxsackievirus A6 was reported recently. The aim of the current study was to describe coxsackievirus A6-associated atypical HFMD in a series of 8 toddlers who were referred with idiopathic extensive eruptions. Demographic and clinical characteristics, Reverse transcriptase-real-time PCR (RT-PCR) results for enterovirus and phylogenetic analysis for the coxsackievirus A6 strains were recorded. Morphologically polymorphous (vesicular, erosive, papular, desquamative or purpuric) and extensive eruptions were found. One patient had delayed nail shedding. Enterovirus was positive in all patients. Genotype analysis confirmed coxsackievirus A6 in 6 patients and 5 sequences underwent phylogenetic analysis. This is the first such report in Israeli children. In conclusion, coxsackievirus A6 atypical HFMD should be regarded as a novel childhood viral exanthem. We suggest the term "coxsackievirus A6 polymorphic exanthem" due to the extensive and variable nature of this eruption. PMID:26463513

  8. [Virus demonstration and pathologic changes in different phases of coxsackievirus B myocarditis in mice].

    PubMed

    Rabausch-Starz, I; Neu, N; Müller-Hermelink, H K

    1990-01-01

    A/J mice between 15 days and 10 weeks of age were infected intraperitoneally with Coxsackievirus B3 (CVB3). To search for virus in the myocardium various methods were applied: virus isolation from the myocardium, RNA extraction for dot blot hybridization and in situ hybridization. Two different RNA probes, one specific for CVB3 the other cross-reacting with other enteroviruses, were radioactively labeled with 35S or 32P by in vitro transcription. In paraffin sections histological alterations were assessed semiquantitatively. The animals developed acute myocarditis with myolysis and virus in the myocardium until 14 days after infection. The second stage of the disease was characterized by a persistent inflammatory infiltrate. At this stage no virus could be shown in the myocardium. Antibodies against cardiac myosin appeared 16 days after infection. Autoimmune mechanisms thus seem to be a most relevant factor for persistent inflammation after the acute viral phase of the disease. PMID:1708625

  9. Surface for Catalysis by Poliovirus RNA-Dependent RNA Polymerase

    PubMed Central

    Wang, Jing; Lyle, John M.; Bullitt, Esther

    2013-01-01

    The poliovirus RNA-dependent RNA polymerase, 3Dpol, replicates the viral genomic RNA on the surface of virus-induced intracellular membranes. Macromolecular assemblies of 3Dpol form linear array of subunits that propagate along a strong protein-protein interaction called interface-I, as was observed in the crystal structure of wild-type poliovirus polymerase. These “filaments” recur with slight modifications in planar sheets and, with additional modifications that accommodate curvature, in helical tubes of the polymerase, by packing filaments together via a second set of interactions. Periodic variations of subunit orientations within 3Dpol tubes give rise to “ghost reflections” in diffraction patterns computed from electron cryomicrographs of helical arrays. The ghost reflections reveal that polymerase tubes are formed by bundles of 4–6 interface-I filaments, which are then connected to the next bundle of filaments with a perturbation of interface interactions between bundles. While enzymatically inactive polymerase is also capable of oligomerization, much thinner tubes are formed that lack interface-I interactions between adjacent subunits, suggesting that long-range allostery produces conformational changes that extend from the active site to the protein-protein interface. Macromolecular assemblies of poliovirus polymerase show repeated use of flexible interface interactions for polymerase lattice formation, suggesting that adaptability of polymerase-polymerase interactions facilitates RNA replication. In addition, the presence of a positively charged groove identified in polymerase arrays may help position and stabilize the RNA template during replication. PMID:23583774

  10. The archaeal transamidosome for RNA-dependent glutamine biosynthesis

    PubMed Central

    Rampias, Theodoros; Sheppard, Kelly; Söll, Dieter

    2010-01-01

    Archaea make glutaminyl-tRNA (Gln-tRNAGln) in a two-step process; a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) forms Glu-tRNAGln, while the heterodimeric amidotransferase GatDE converts this mischarged tRNA to Gln-tRNAGln. Many prokaryotes synthesize asparaginyl-tRNA (Asn-tRNAAsn) in a similar manner using a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) and the heterotrimeric amidotransferase GatCAB. The transamidosome, a complex of tRNA synthetase, amidotransferase and tRNA, was first described for the latter system in Thermus thermophilus [Bailly, M., Blaise, M., Lorber, B., Becker, H.D. and Kern, D. (2007) The transamidosome: a dynamic ribonucleoprotein particle dedicated to prokaryotic tRNA-dependent asparagine biosynthesis. Mol. Cell, 28, 228–239.]. Here, we show a similar complex for Gln-tRNAGln formation in Methanothermobacter thermautotrophicus that allows the mischarged Glu-tRNAGln made by the tRNA synthetase to be channeled to the amidotransferase. The association of archaeal ND-GluRS with GatDE (KD = 100 ± 22 nM) sequesters the tRNA synthetase for Gln-tRNAGln formation, with GatDE reducing the affinity of ND-GluRS for tRNAGlu by at least 13-fold. Unlike the T. thermophilus transamidosome, the archaeal complex does not require tRNA for its formation, is not stable through product (Gln-tRNAGln) formation, and has no major effect on the kinetics of tRNAGln glutamylation nor transamidation. The differences between the two transamidosomes may be a consequence of the fact that ND-GluRS is a class I aminoacyl-tRNA synthetase, while ND-AspRS belongs to the class II family. PMID:20457752

  11. Molecular epidemiology of coxsackievirus type B1.

    PubMed

    Abdelkhalek, Ichrak; Seghier, Mohamed; Yahia, Ahlem Ben; Touzi, Henda; Meddeb, Zina; Triki, Henda; Rezig, Dorra

    2015-11-01

    Coxsackievirus type B1 (CVB1) has emerged globally as the predominant enterovirus serotype and is associated with epidemics of meningitis and chronic diseases. In this report, the phylogeny of CVB1 was studied based on the VP1 sequences of 11 North African isolates and 81 published sequences. All CVB1 isolates segregated into four distinct genogroups and 10 genotypes. Most of the identified genotypes of circulating CVB1 strains appear to have a strict geographical specificity. The North African strains were of a single genotype and probably evolved distinctly. Using a relaxed molecular clock model and three different population models (constant population, exponential growth and Bayesian skyline demographic models) in coalescent analysis using the BEAST program, the substitution rate in CVB1 varied between 6.95 × 10(-3) and 7.37 × 10(-3) substitutions/site/year in the VP1 region. This study permits better identification of circulating CVB1, which has become one of the most predominant enterovirus serotypes in humans. PMID:26243282

  12. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  13. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  14. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  15. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  16. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  17. Iron and copper accumulation in the brain of coxsackievirus-infected mice exposed to cadmium

    SciTech Connect

    Ilbaeck, N.-G. . E-mail: nils-gunnar.ilback@slv.se; Lindh, U.; Minqin, R.; Friman, G.; Watt, F.

    2006-11-15

    Cadmium (Cd) is a potentially toxic metal widely distributed in the environment and known to cause adverse health effects in humans. During coxsackievirus infection, the concentrations of essential and nonessential trace elements (e.g., iron (Fe), copper (Cu), and Cd) change in different target organs of the infection. Fe and Cu are recognized cofactors in host defence reactions, and Fe is known to be associated with certain pathological conditions of the brain. However, whether nonessential trace elements could influence the balance of essential trace elements in the brain is unknown. In this study the brain Fe, Cu, and Cd contents were measured through inductively coupled plasma mass spectrometry and their distributions determined by nuclear microscopy in the early phase (day 3) of coxsackievirus B3 (CB3) infection in nonexposed and in Cd-exposed female Balb/c mice. In CB3 infection the brain is a well-known target that has not been studied with regard to trace element balance. The brain concentration of Cu compared with that of noninfected control mice was increased by 9% (P<0.05) in infected mice not exposed to Cd and by 10% (not significant) in infected Cd-exposed mice. A similar response was seen for Fe, which in infected Cd-exposed mice, compared to noninfected control mice, tended to increase by 16%. Cu showed an even tissue distribution, whereas Fe was distributed in focal deposits. Changes in Cd concentration in the brain of infected mice were less consistent but evenly distributed. Further studies are needed to define whether the accumulation and distribution of trace elements in the brain have an impact on brain function.

  18. ORI2 inhibits coxsackievirus replication and myocardial inflammation in experimental murine myocarditis.

    PubMed

    Lim, Byung-Kwan; Kim, Jin Hee

    2014-01-01

    We purified ORI2 [3-(3,4-dihydroxyphenyl)acrylic acid 1-(3,4-dihydroxyphenyl)-2-methoxycarbonylethyl ester] from an extract of the plant Isodon excisus. We tested the antiviral effect of ORI2 in a coxsackievirus-induced myocarditis model. Coxsackievirus B3 (CVB3) is a common cause of myocarditis and dilated cardiomyopathy. Activation of extracellular signal-regulated kinase (ERK) and Akt signaling in virus-infected cells is essential for CVB3 replication. Antiviral compounds were screened by HeLa cell survival assay. Several purified natural compounds were added to HeLa cells cultured in 96-well plates for 30 min after 1 multiplicity of infection (m.o.i) CVB3 infection. ORI2 significantly improved HeLa cell survival in a dose-dependent manner. For in vivo studies, BALB/c mice (n=20) were infected with CVB3, then 10 of the mice were treated by daily intraperitoneal injections of ORI2 (100 mM) for 3 consecutive days. ORI2 treatment significantly improved early survival in the treated mice compared to untreated mice (85% vs. 50%, respectively). Organ virus titers and myocardial damage were significantly lower in the ORI2-treated mice than in untreated mice. These results demonstrate that ORI2, delivered by intraperitoneal injection after CVB3 infection, has a significant antiviral effect by markedly inhibiting virus replication, resulting in a decrease in organ virus titer and myocardial damage. ORI2 may be developed as a potential therapeutic agent for the treatment of CVB3 infections. PMID:25273388

  19. Enzyme-linked immunosorbent assay for detection and identification of coxsackieviruses A.

    PubMed Central

    Yolken, R H; Torsch, V M

    1981-01-01

    Coxsackieviruses A are known to cause a wide range of human disease processes. However, because many coxsackieviruses A present in clinical specimens do not produce a recognizable cytopathic effect in readily available tissue culture systems, infections with coxsackieviruses A are often difficult to diagnose. We have thus developed enzyme-linked immunosorbent assay (ELISA) systems for the detection and serotyping of coxsackievirus A antigens. The assays consist of a double-antibody ELISA which utilizes type-specific monkey and mouse coxsackievirus antisera. Although some cross-reactivity was noted, the ELISA systems correctly identified the serotypes of 22 to 23 coxsackievirus A complement fixation antigens available for testing. Testing of tissue culture fluids revealed that antigen could often be detected by ELISA before the appearance of a cytopathic effect. In addition, the infecting coxsackievirus A antigen could be unequivocally identified in 8 of 11 stool specimens obtained from patients with coxsackievirus A infections. The ELISA system might thus represent an important tool in the diagnosis and study of coxsackievirus A infections. PMID:6260675

  20. Dysferlin deficiency confers increased susceptibility to coxsackievirus-induced cardiomyopathy.

    PubMed

    Wang, Chen; Wong, Jerry; Fung, Gabriel; Shi, Junyan; Deng, Haoyu; Zhang, Jingchun; Bernatchez, Pascal; Luo, Honglin

    2015-10-01

    Coxsackievirus infection can lead to viral myocarditis and its sequela, dilated cardiomyopathy, which represent major causes of cardiovascular mortality worldwide in children. Yet, the host genetic susceptible factors and the underlying mechanisms by which viral infection damages cardiac function remain to be fully resolved. Dysferlin is a transmembrane protein highly expressed in skeletal and cardiac muscles. In humans, mutations in the dysferlin gene can cause limb-girdle muscular dystrophy type 2B and Miyoshi myopathy. Dysferlin deficiency has also been linked to cardiomyopathy. Defective muscle membrane repair has been suggested to be an important mechanism responsible for muscle degeneration in dysferlin-deficient patients and animals. Using both naturally occurring and genetically engineered dysferlin-deficient mice, we demonstrated that loss of dysferlin confers increased susceptibility to coxsackievirus infection and myocardial damage. More interestingly, we found that dysferlin is cleaved following coxsackieviral infection through the proteolytic activity of virally encoded proteinases, suggesting an important mechanism underlying virus-induced cardiac dysfunction. Our results in this study not only identify dysferlin deficiency as a novel host risk factor for viral myocarditis but also reveal a key mechanism by which coxsackievirus infection impairs cardiac function, leading to the development of dilated cardiomyopathy. PMID:26073173

  1. Hand, foot, and mouth disease caused by coxsackievirus A6, Thailand, 2012.

    PubMed

    Puenpa, Jiratchaya; Chieochansin, Thaweesak; Linsuwanon, Piyada; Korkong, Sumeth; Thongkomplew, Siwanat; Vichaiwattana, Preyaporn; Theamboonlers, Apiradee; Poovorawan, Yong

    2013-04-01

    In Thailand, hand, foot, and mouth disease (HFMD) is usually caused by enterovirus 71 or coxsackievirus A16. To determine the cause of a large outbreak of HFMD in Thailand during June-August 2012, we examined patient specimens. Coxsackievirus A6 was the causative agent. To improve prevention and control, causes of HFMD should be monitored. PMID:23631943

  2. Loss of Virus-Specific Memory T. cells in Coxsackievirus B3 and B4 Infected Mice

    EPA Science Inventory

    There are two major types of enteroviruses: polioviruses and non-polio enteroviruses. While vaccines have effectively eliminated poliovirus infections, no vaccine is currently available for the non-polio enteroviruses. Generation of long-term pathogen specific memory cells is cri...

  3. Purification of the putative coxsackievirus B receptor from HeLa cells.

    PubMed

    Carson, S D; Chapman, N N; Tracy, S M

    1997-04-17

    We have identified a protein expressed by human and murine cells susceptible to coxsackievirus B3 (CVB3) infection and purified it from HeLa cells. This protein of approximately 45,000 Mr is expressed by HeLa cells and mouse fetal heart fibroblasts (susceptible to infection), and not by C3H murine fibroblasts or the human RD cell line (resistant). The protein was isolated from Triton X-100- deoxycholate lysates of HeLa cells by chromatography on concanavalin A-Sepharose, Affi-gel Blue, Phenyl Sepharose, and PBE94. The CVB3-binding fraction from PBE94 was blotted from SDS-polyacrylamide gel onto PVDF membrane for amino acid sequencing. Approximately 2 pmoles of CVB3-binding protein provided assignments for 26 consecutive residues: LSITTPEEMIEKAKGETAYLPXKFTL. This sequence corresponds neither to decay accelerating factor nor to nucleolin, both of which have previously been identified as CVB3-binding proteins, but does match two entries in GenBank. These data show that we have purified a novel CVB3-binding protein, the characteristics of which suggest the CVB group receptor has been purified. Identification of 26 amino acid residues in the protein and corresponding GenBank enteries will accelerate study of CVB tropism and the diseases caused by these viruses. PMID:9144533

  4. Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.

    PubMed

    Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng

    2009-09-01

    Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively. PMID:19616030

  5. Ongoing Coxsackievirus Myocarditis Is Associated with Increased Formation and Activity of Myocardial Immunoproteasomes

    PubMed Central

    Szalay, Gudrun; Meiners, Silke; Voigt, Antje; Lauber, Jörg; Spieth, Christian; Speer, Nora; Sauter, Martina; Kuckelkorn, Ulrike; Zell, Andreas; Klingel, Karin; Stangl, Karl; Kandolf, Reinhard

    2006-01-01

    A growing body of evidence indicates that viral infections of the heart contribute to ongoing myocarditis and dilated cardiomyopathy. Murine models of coxsackievirus B3 (CVB3)-induced myocarditis mimic the human disease and allow identification of susceptibility factors that modulate the course of viral myocarditis. Susceptible mouse strains develop chronic myocarditis on the basis of restricted viral replication, whereas resistant strains recover after successful virus elimination. In comparative whole-genome microarray analyses of infected hearts, several genes involved in the processing and presentation of viral epitopes were found to be uniformly up-regulated in acutely CVB3-infected susceptible mice compared with resistant animals. In particular, expression of the catalytic subunits LMP2, LMP7, and MECL-1, immunoproteasome proteins important in the generation of major histocompatibility complex (MHC) class I-restricted peptides, was clearly enhanced in the susceptible host. Increased expression resulted in enhanced formation of immunoproteasomes and altered proteolytic activities of proteasomes in the heart. This was accompanied by a concerted up-regulation of the antigen-presenting machinery in susceptible mice. Thus, we propose that increased formation of immunoproteasomes in susceptible mice affects the generation of antigenic peptides and the subsequent T-cell-mediated immune responses. PMID:16651621

  6. Fluoxetine Is a Potent Inhibitor of Coxsackievirus Replication

    PubMed Central

    Zuo, Jun; Quinn, Kevin K.; Kye, Steve; Cooper, Paige; Damoiseaux, Robert

    2012-01-01

    No antiviral drugs currently exist for the treatment of enterovirus infections, which are often severe and potentially life threatening. Molecular screening of small molecule libraries identified fluoxetine, a selective serotonin reuptake inhibitor, as a potent inhibitor of coxsackievirus replication. Fluoxetine did not interfere with either viral entry or translation of the viral genome. Instead, fluoxetine and its metabolite norfluoxetine markedly reduced the synthesis of viral RNA and protein. In view of its favorable pharmacokinetics and safety profile, fluoxetine warrants additional study as a potential antiviral agent for enterovirus infections. PMID:22751539

  7. Evaluation of Coxsackievirus Infection in Children with Human Immunodeficiency Virus Type 1–Associated Cardiomyopathy

    PubMed Central

    Jenson, Hal B.; Gauntt, Charles J.; Easley, Kirk A.; Pitt, Jane; Lipshultz, Steven E.; McIntosh, Kenneth; Shearer, William T.

    2015-01-01

    In a matched case-control study of the association between coxsackieviruses and cardiac impairment, 24 human immunodeficiency virus (HIV) type 1–infected children with cardiac impairment were compared with 24 HIV-1–infected control subjects. Serologic evidence of coxsackievirus infection was present in all children, with no significant difference in geometric mean antibody titers between case patients and control subjects. Conditional logistic regression to test for an association between coxsackievirus antibody titer and the presence or absence of cardiac impairment, by any indicator, showed an odds ratio of 1.11 (95% confidence interval, 0.58–2.10; P = .75), indicating no association between coxsackievirus infection and cardiac impairment. Coxsackievirus antibody titers correlated positively with total IgG levels in nonrapid progressors but not in rapid progressors. Paired serum samples taken before and after diagnosis of cardiac impairment in 5 patients showed no evidence of intervening coxsackievirus infection. These results do not identify a causal role for coxsackieviruses for cardiomyopathy in HIV-1–infected children. PMID:12085328

  8. Pharmacological and biological antiviral therapeutics for cardiac coxsackievirus infections.

    PubMed

    Fechner, Henry; Pinkert, Sandra; Geisler, Anja; Poller, Wolfgang; Kurreck, Jens

    2011-01-01

    Subtype B coxsackieviruses (CVB) represent the most commonly identified infectious agents associated with acute and chronic myocarditis, with CVB3 being the most common variant. Damage to the heart is induced both directly by virally mediated cell destruction and indirectly due to the immune and autoimmune processes reacting to virus infection. This review addresses antiviral therapeutics for cardiac coxsackievirus infections discovered over the last 25 years. One group represents pharmacologically active low molecular weight substances that inhibit virus uptake by binding to the virus capsid (e.g., pleconaril) or inactivate viral proteins (e.g., NO-metoprolol and ribavirin) or inhibit cellular proteins which are essential for viral replication (e.g., ubiquitination inhibitors). A second important group of substances are interferons. They have antiviral but also immunomodulating activities. The third and most recently discovered group includes biological and cellular therapeutics. Soluble receptor analogues (e.g., sCAR-Fc) bind to the virus capsid and block virus uptake. Small interfering RNAs, short hairpin RNAs and antisense oligonucleotides bind to and led to degradation of the viral RNA genome or cellular RNAs, thereby preventing their translation and viral replication. Most recently mesenchymal stem cell transplantation has been shown to possess antiviral activity in CVB3 infections. Taken together, a number of antiviral therapeutics has been developed for the treatment of myocardial CVB infection in recent years. In addition to low molecular weight inhibitors, biological therapeutics have become promising anti-viral agents. PMID:21989310

  9. STRAIN DIFFERENTIATION AND DETERMINATION OF CAPSID PROTEINS OF COXSACKIEVIRUS BY MALDI-MS

    EPA Science Inventory

    Introduction: Contamination of viruses in water environments (rivers, lakes, sources of drinking water) is a new threat and serious health problem. Amongst organisms discharged from sewage septic systems is the coxsackievirus (single-stranded RNA virus). Differentiation betwee...

  10. Use of guinea pig embryo cell cultures for isolation and propagation of group A coxsackieviruses.

    PubMed Central

    Landry, M L; Madore, H P; Fong, C K; Hsiung, G D

    1981-01-01

    The isolation of group A coxsackieviruses from clinical specimens generally requires the use of suckling mice. By using guinea pig embryo cells, the following coxsackieviruses were isolated from throat swabs and stool samples obtained from patients with a variety of illnesses: two of type A2, one each of types A6 and A8, and four of type 10. Distinct cytopathic effects were produced in 3 to 5 days in the guinea pig embryo cells inoculated with the clinical specimens. In addition, a number of prototype group A coxsackieviruses, including types 2--6, 8, 10, and 12, were readily propagated in guinea pig embryo cell cultures. Thus, guinea pig embryo cells appeared to be a sensitive alternative cell culture system for the isolation and propagation of certain types of group A coxsackieviruses. Images PMID:6263943

  11. Coxsackievirus-positive cervices in women with febrile illnesses during the third trimester in pregnancy.

    PubMed

    Reyes, M P; Zalenski, D; Smith, F; Wilson, F M; Lerner, A M

    1986-07-01

    Coxsackievirus B5 infection was demonstrated in five of seven third-trimester pregnant women with undifferentiated febrile illnesses or aseptic meningitis. Coxsackievirus B5 was recovered from the cervix and throat in four women and from the rectum in three. No obvious illnesses were evident in the babies. These findings suggest that previously unrecognized cervical enterovirus carriage or infection is common in infected pregnant women in the last trimester and that subsequent neonatal infection at delivery may result. PMID:3014880

  12. Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications

    PubMed Central

    Jácome, Rodrigo; Becerra, Arturo; Ponce de León, Samuel; Lazcano, Antonio

    2015-01-01

    The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, “fingertips” that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection. PMID:26397100

  13. Chromatin remodeling complexes in the assembly of long noncoding RNA-dependent nuclear bodies.

    PubMed

    Kawaguchi, Tetsuya; Hirose, Tetsuro

    2015-11-01

    Paraspeckles are subnuclear structures that assemble on nuclear paraspeckle assembly transcript 1 (NEAT1) long noncoding (lnc)RNA. Paraspeckle formation requires appropriate NEAT1 biogenesis and subsequent assembly with multiple prion-like domain (PLD) containing RNA-binding proteins. We found that SWI/SNF chromatin remodeling complexes function as paraspeckle components that interact with paraspeckle proteins (PSPs) and NEAT1. SWI/SNF complexes play an essential role in paraspeckle formation that does not require their ATP-dependent chromatin remodeling activity. Instead, SWI/SNF complexes facilitate organization of the PSP interaction network required for intact paraspeckle assembly. SWI/SNF complexes may collectively bind multiple PSPs to recruit them onto NEAT1. SWI/SNF complexes are also required for Sat III (Satellite III) lncRNA-dependent formation of nuclear stress bodies under heat shock conditions. Organization of the lncRNA-dependent omega speckle in Drosophila also depends on the chromatin remodeling complex. These findings raise the possibility that a common mechanism controls the formation of lncRNA-dependent nuclear body architecture. PMID:26709446

  14. Niacin and niacinamide (Vitamin B3)

    MedlinePlus

    Niacin and niacinamide are forms of Vitamin B3. Vitamin B3 is found in many foods including yeast, meat, fish, milk, eggs, green vegetables, beans, and cereal grains. Niacin and niacinamide are also found in many vitamin B complex ...

  15. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Categorical exclusions. 1b.3 Section 1b.3 Agriculture Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions. (a) The following are categories of activities which have been determined not to have a significant individual or cumulative effect on the...

  16. 7 CFR 15b.3 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 1 2014-01-01 2014-01-01 false Definitions. 15b.3 Section 15b.3 Agriculture Office of the Secretary of Agriculture NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General Provisions § 15b.3 Definitions. As used in this part, the term or phrase: (a) The Act means...

  17. 15 CFR 8b.3 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 15 Commerce and Foreign Trade 1 2014-01-01 2014-01-01 false Definitions. 8b.3 Section 8b.3 Commerce and Foreign Trade Office of the Secretary of Commerce PROHIBITION OF DISCRIMINATION AGAINST THE HANDICAPPED IN FEDERALLY ASSISTED PROGRAMS OPERATED BY THE DEPARTMENT OF COMMERCE General Provisions § 8b.3 Definitions. As used in this part, the...

  18. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 1 2012-10-01 2012-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  19. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  20. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 1 2011-10-01 2011-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  1. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 1 2014-10-01 2014-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare Department of Health and Human Services GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  2. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 45 Public Welfare 1 2013-10-01 2013-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  3. 8 CFR 343b.3 - Interrogation.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Interrogation. 343b.3 Section 343b.3 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY NATIONALITY REGULATIONS SPECIAL CERTIFICATE OF NATURALIZATION FOR RECOGNITION BY A FOREIGN STATE § 343b.3 Interrogation. When Form N-565 presents a prima...

  4. Disseminated coxsackievirus A6 affecting children with atopic dermatitis.

    PubMed

    Lynch, M D; Sears, A; Cookson, H; Lew, T; Laftah, Z; Orrin, L; Zuckerman, M; Creamer, D; Higgins, E

    2015-07-01

    Coxsackievirus A6 (CV-A6) is an emerging pathogen that has in recent years been associated with atypical hand, foot and mouth disease. This manifests as a generalized papular or vesicular eruption, which may be associated with fever and systemic disturbance. We report a series of six children presenting to a single centre in the UK with disseminated CV-A6 infection on a background of atopic dermatitis (AD). Our patients exhibited a widespread papular or vesicular eruption in association with exacerbation of AD. Several of our cases mimicked eczema herpeticum, but the extent was more generalized, and individual lesions were discrete rather than clustered and were less circumscribed in character. This series highlights that CV-A6 infection may be encountered in the UK, and should be considered in the differential diagnosis of an acute exacerbation of AD, particularly in children. PMID:25677678

  5. Coxsackievirus B4 myocarditis and meningoencephalitis in newborn twins

    PubMed Central

    DelTondo, Joseph; Wang, Guoji; Williams, Karl; Wiley, Clayton A.

    2014-01-01

    Coxsackievirus B4 (CB4) is a picornavirus associated with a variety of human diseases, including neonatal meningoencephalitis, myocarditis and type 1 diabetes. We report the pathological findings in twin newborns who died during an acute infection. The twins were born 1 month premature but were well and neurologically intact at birth. After a week they developed acute lethal neonatal sepsis and seizures. Histopathology demonstrated meningoencephalitis and severe myocarditis, as well as pancreatitis, adrenal medullitis and nephritis. Abundant CB4 sequences were identified in nucleic acid extracted from the brain and heart. In situ hybridization with probes to CB4 demonstrated infection of neurons, myocardiocytes, endocrine pancreas and adrenal medulla. The distribution of infected cells and immune response is consistent with reported clinical symptomatology where systemic and neurological diseases are the result of CB4 infection of select target cells. PMID:24702280

  6. Coxsackievirus cloverleaf RNA containing a 5' triphosphate triggers an antiviral response via RIG-I activation.

    PubMed

    Feng, Qian; Langereis, Martijn A; Olagnier, David; Chiang, Cindy; van de Winkel, Roel; van Essen, Peter; Zoll, Jan; Hiscott, John; van Kuppeveld, Frank J M

    2014-01-01

    Upon viral infections, pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) and stimulate an antiviral state associated with the production of type I interferons (IFNs) and inflammatory markers. Type I IFNs play crucial roles in innate antiviral responses by inducing expression of interferon-stimulated genes and by activating components of the adaptive immune system. Although pegylated IFNs have been used to treat hepatitis B and C virus infections for decades, they exert substantial side effects that limit their use. Current efforts are directed toward the use of PRR agonists as an alternative approach to elicit host antiviral responses in a manner similar to that achieved in a natural infection. RIG-I is a cytosolic PRR that recognizes 5' triphosphate (5'ppp)-containing RNA ligands. Due to its ubiquitous expression profile, induction of the RIG-I pathway provides a promising platform for the development of novel antiviral agents and vaccine adjuvants. In this study, we investigated whether structured RNA elements in the genome of coxsackievirus B3 (CVB3), a picornavirus that is recognized by MDA5 during infection, could activate RIG-I when supplied with 5'ppp. We show here that a 5'ppp-containing cloverleaf (CL) RNA structure is a potent RIG-I inducer that elicits an extensive antiviral response that includes induction of classical interferon-stimulated genes, as well as type III IFNs and proinflammatory cytokines and chemokines. In addition, we show that prophylactic treatment with CVB3 CL provides protection against various viral infections including dengue virus, vesicular stomatitis virus and enterovirus 71, demonstrating the antiviral efficacy of this RNA ligand. PMID:24759703

  7. Naturally Occurring Isoleucyl-tRNA Synthetase without tRNA-dependent Pre-transfer Editing*

    PubMed Central

    Cvetesic, Nevena; Dulic, Morana; Bilus, Mirna; Sostaric, Nikolina; Lenhard, Boris; Gruic-Sovulj, Ita

    2016-01-01

    Isoleucyl-tRNA synthetase (IleRS) is unusual among aminoacyl-tRNA synthetases in having a tRNA-dependent pre-transfer editing activity. Alongside the typical bacterial IleRS (such as Escherichia coli IleRS), some bacteria also have the enzymes (eukaryote-like) that cluster with eukaryotic IleRSs and exhibit low sensitivity to the antibiotic mupirocin. Our phylogenetic analysis suggests that the ileS1 and ileS2 genes of contemporary bacteria are the descendants of genes that might have arisen by an ancient duplication event before the separation of bacteria and archaea. We present the analysis of evolutionary constraints of the synthetic and editing reactions in eukaryotic/eukaryote-like IleRSs, which share a common origin but diverged through adaptation to different cell environments. The enzyme from the yeast cytosol exhibits tRNA-dependent pre-transfer editing analogous to E. coli IleRS. This argues for the presence of this proofreading in the common ancestor of both IleRS types and an ancient origin of the synthetic site-based quality control step. Yet surprisingly, the eukaryote-like enzyme from Streptomyces griseus IleRS lacks this capacity; at the same time, its synthetic site displays the 103-fold drop in sensitivity to antibiotic mupirocin relative to the yeast enzyme. The discovery that pre-transfer editing is optional in IleRSs lends support to the notion that the conserved post-transfer editing domain is the main checkpoint in these enzymes. We substantiated this by showing that under error-prone conditions S. griseus IleRS is able to rescue the growth of an E. coli lacking functional IleRS, providing the first evidence that tRNA-dependent pre-transfer editing in IleRS is not essential for cell viability. PMID:26921320

  8. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    PubMed

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  9. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases

    PubMed Central

    Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  10. An Oligonucleotide Affinity Column for RNA-Dependent DNA Polymerase from RNA Tumor Viruses

    PubMed Central

    Gerwin, Brenda I.; Milstien, Julie B.

    1972-01-01

    Columns of (dT)12-18-cellulose provide a one-step enrichment procedure for RNA-dependent DNA polymerase. The enzyme of the virus from RD-114 cells, as well as that from Rauscher murine leukemia virus, have been purified in this way. The preference of viral as compared to cellular DNA polymerases for (dT)12-18 as a primer is reflected in the fact that the DNA polymerases of uninfected cells do not bind to this column. Viral enzymes have been purified and identified from crude cellular extracts. PMID:4506781

  11. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF...

  12. Type B coxsackieviruses and their interactions with the innate and adaptive immune systems

    PubMed Central

    Kemball, Christopher C; Alirezaei, Mehrdad; Whitton, J Lindsay

    2011-01-01

    Coxsackieviruses are important human pathogens, and their interactions with the innate and adaptive immune systems are of particular interest. Many viruses evade some aspects of the innate response, but coxsackieviruses go a step further by actively inducing, and then exploiting, some features of the host cell response. Furthermore, while most viruses encode proteins that hinder the effector functions of adaptive immunity, coxsackieviruses and their cousins demonstrate a unique capacity to almost completely evade the attention of naive CD8+ T cells. In this article, we discuss the above phenomena, describe the current status of research in the field, and present several testable hypotheses regarding possible links between virus infection, innate immune sensing and disease. PMID:20860480

  13. Molecular epidemiology of human coxsackievirus A16 strains

    PubMed Central

    YU, WENMIN; XU, HUANXIN; YIN, CHANGCHANG

    2016-01-01

    The hand, foot and mouth disease (HFMD) epidemics have mainly been caused by human enterovirus 71 and human coxsackievirus A16 (CA16), which circulated alternatively or together in the epidemic area. The aim of the present study was to provide guidance in the prevention and control of HFMD from CA16 infection. The molecular epidemiology of the human CA16 strains was investigated. Overall, 1,151 specimens (throat swabs) were collected from 1,151 patients with HFMD symptoms. The results of the homology comparison in the VP1 of CA16 strains showed that the CA16 strains belonged to the B1b subgenotype. The difference of the 6 CA16 strains analyzed showed that the most prominent strain was the A genotype, and the most close strains were the B1 gene subtype, particularly the B1b gene subtype. With regards to the amino acids, in addition to the A genotype, the differences of amino acids with other gene subtype was not significant. The present data suggest that more effective and highly targeted intervention mechanisms could be developed for the prevention and control of HFMD. PMID:27284420

  14. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms

    PubMed Central

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-01-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  15. Deficient signaling in mice devoid of double-stranded RNA-dependent protein kinase.

    PubMed Central

    Yang, Y L; Reis, L F; Pavlovic, J; Aguzzi, A; Schäfer, R; Kumar, A; Williams, B R; Aguet, M; Weissmann, C

    1995-01-01

    Double-stranded RNA-dependent protein kinase (PKR) has been implicated in interferon (IFN) induction, antiviral response and tumor suppression. We have generated mice devoid of functional PKR (Pkr%). Although the mice are physically normal and the induction of type I IFN genes by poly(I).poly(C) (pIC) and virus is unimpaired, the antiviral response induced by IFN-gamma and pIC was diminished. However, in embryo fibroblasts from Pkr knockout mice, the induction of type I IFN as well as the activation of NF-kappa B by pIC, were strongly impaired but restored by priming with IFN. Thus, PKR is not directly essential for responses to pIC, and a pIC-responsive system independent of PKR is induced by IFN. No evidence of the tumor suppressor activity of PKR was demonstrated. Images PMID:8557029

  16. Structural basis of viral RNA-dependent RNA polymerase catalysis and translocation.

    PubMed

    Shu, Bo; Gong, Peng

    2016-07-12

    Viral RNA-dependent RNA polymerases (RdRPs) play essential roles in viral genome replication and transcription. We previously reported several structural states of the poliovirus RdRP nucleotide addition cycle (NAC) that revealed a unique palm domain-based active site closure mechanism and proposed a six-state NAC model including a hypothetical state representing translocation intermediates. Using the RdRP from another human enterovirus, enterovirus 71, here we report seven RdRP elongation complex structures derived from a crystal lattice that allows three NAC events. These structures suggested a key order of events in initial NTP binding and NTP-induced active site closure and revealed a bona fide translocation intermediate featuring asymmetric movement of the template-product duplex. Our work provides essential missing links in understanding NTP recognition and translocation mechanisms in viral RdRPs and emphasizes the uniqueness of the viral RdRPs compared with other processive polymerases. PMID:27339134

  17. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms.

    PubMed

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-08-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  18. Functional insights from molecular modeling, docking, and dynamics study of a cypoviral RNA dependent RNA polymerase.

    PubMed

    Kundu, Anirban; Dutta, Anirudha; Biswas, Poulomi; Das, Amit Kumar; Ghosh, Ananta Kumar

    2015-09-01

    Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV) contains 11 double stranded RNA genome segments and infects tasar silkworm A. mylitta. RNA-dependent RNA polymerase (RdRp) is reported as a key enzyme responsible for propagation of the virus in the host cell but its structure function relationship still remains elusive. Here a computational approach has been taken to compare sequence and secondary structure of AmCPV RdRp with other viral RdRps to identify consensus motifs. Then a reliable pairwise sequence alignment of AmCPV RdRp with its closest sequence structure homologue λ3 RdRp is done to predict three dimensional structure of AmCPV RdRp. After comparing with other structurally known viral RdRps, important sequence and/or structural features involved in substrate entry or binding, polymerase reaction and the product release events have been identified. A conserved RNA pentanucleotide (5'-AGAGC-3') at the 3'-end of virus genome is predicted as cis-acting signal for RNA synthesis and its docking and simulation study along with the model of AmCPV RdRp has allowed to predict mode of template binding by the viral polymerase. It is found that template RNA enters into the catalytic center through nine sequence-independent and two sequence-dependent interactions with the specific amino acid residues. However, number of sequence dependent interactions remains almost same during 10 nano-second simulation time while total number of interactions decreases. Further, docking of N(7)-methyl-GpppG (mRNA cap) on the model as well as prediction of RNA secondary structure has shown the template entry process in the active site. These findings have led to postulate the mechanism of RNA-dependent RNA polymerization process by AmCPV RdRp. To our knowledge, this is the first report to evaluate structure function relationship of a cypoviral RdRp. PMID:26264734

  19. Enzymatic and nonenzymatic functions of viral RNA-dependent RNA polymerases within oligomeric arrays

    PubMed Central

    Spagnolo, Jeannie F.; Rossignol, Evan; Bullitt, Esther; Kirkegaard, Karla

    2010-01-01

    Few antivirals are effective against positive-strand RNA viruses, primarily because the high error rate during replication of these viruses leads to the rapid development of drug resistance. One of the favored current targets for the development of antiviral compounds is the active site of viral RNA-dependent RNA polymerases. However, like many subcellular processes, replication of the genomes of all positive-strand RNA viruses occurs in highly oligomeric complexes on the cytosolic surfaces of the intracellular membranes of infected host cells. In this study, catalytically inactive polymerases were shown to participate productively in functional oligomer formation and catalysis, as assayed by RNA template elongation. Direct protein transduction to introduce either active or inactive polymerases into cells infected with mutant virus confirmed the structural role for polymerase molecules during infection. Therefore, we suggest that targeting the active sites of polymerase molecules is not likely to be the best antiviral strategy, as inactivated polymerases do not inhibit replication of other viruses in the same cell and can, in fact, be useful in RNA replication complexes. On the other hand, polymerases that could not participate in functional RNA replication complexes were those that contained mutations in the amino terminus, leading to altered contacts in the folded polymerase and mutations in a known polymerase–polymerase interaction in the two-dimensional protein lattice. Thus, the functional nature of multimeric arrays of RNA-dependent RNA polymerase supplies a novel target for antiviral compounds and provides a new appreciation for enzymatic catalysis on membranous surfaces within cells. PMID:20051491

  20. MicroRNA-dependent regulation of transcription in non-small cell lung cancer.

    PubMed

    Molina-Pinelo, Sonia; Gutiérrez, Gabriel; Pastor, Maria Dolores; Hergueta, Marta; Moreno-Bueno, Gema; García-Carbonero, Rocío; Nogal, Ana; Suárez, Rocío; Salinas, Ana; Pozo-Rodríguez, Francisco; Lopez-Rios, Fernando; Agulló-Ortuño, Maria Teresa; Ferrer, Irene; Perpiñá, Asunción; Palacios, José; Carnero, Amancio; Paz-Ares, Luis

    2014-01-01

    Squamous cell lung cancer (SCC) and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC), and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA)-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA)) and mRNA profiling (Whole Genome 44 K array G112A, Agilent) was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708) and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1) were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies. PMID:24625834

  1. Coxsackievirus B Exits the Host Cell in Shed Microvesicles Displaying Autophagosomal Markers

    PubMed Central

    Mangale, Vrushali; Rahawi, Shahad; McIntyre, Laura L.; Williams, Wesley; Kha, Nelson; Cruz, Casey; Hancock, Bryan M.; Nguyen, David P.; Sayen, M. Richard; Hilton, Brett J.; Doran, Kelly S.; Segall, Anca M.; Wolkowicz, Roland; Cornell, Christopher T.; Whitton, J. Lindsay; Gottlieb, Roberta A.; Feuer, Ralph

    2014-01-01

    Coxsackievirus B3 (CVB3), a member of the picornavirus family and enterovirus genus, causes viral myocarditis, aseptic meningitis, and pancreatitis in humans. We genetically engineered a unique molecular marker, “fluorescent timer” protein, within our infectious CVB3 clone and isolated a high-titer recombinant viral stock (Timer-CVB3) following transfection in HeLa cells. “Fluorescent timer” protein undergoes slow conversion of fluorescence from green to red over time, and Timer-CVB3 can be utilized to track virus infection and dissemination in real time. Upon infection with Timer-CVB3, HeLa cells, neural progenitor and stem cells (NPSCs), and C2C12 myoblast cells slowly changed fluorescence from green to red over 72 hours as determined by fluorescence microscopy or flow cytometric analysis. The conversion of “fluorescent timer” protein in HeLa cells infected with Timer-CVB3 could be interrupted by fixation, suggesting that the fluorophore was stabilized by formaldehyde cross-linking reactions. Induction of a type I interferon response or ribavirin treatment reduced the progression of cell-to-cell virus spread in HeLa cells or NPSCs infected with Timer-CVB3. Time lapse photography of partially differentiated NPSCs infected with Timer-CVB3 revealed substantial intracellular membrane remodeling and the assembly of discrete virus replication organelles which changed fluorescence color in an asynchronous fashion within the cell. “Fluorescent timer” protein colocalized closely with viral 3A protein within virus replication organelles. Intriguingly, infection of partially differentiated NPSCs or C2C12 myoblast cells induced the release of abundant extracellular microvesicles (EMVs) containing matured “fluorescent timer” protein and infectious virus representing a novel route of virus dissemination. CVB3 virions were readily observed within purified EMVs by transmission electron microscopy, and infectious virus was identified within low

  2. Spatiotemporal phylogenetic analysis and molecular characterization of coxsackievirus A4.

    PubMed

    Chu, Pei-Yu; Lu, Po-Liang; Tsai, Yu-Ling; Hsi, Edward; Yao, Ching-Yuan; Chen, Yu-Hsien; Hsu, Li-Ching; Wang, Sheng-Yu; Wu, Ho-Sheng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Kuei-Hsiang

    2011-08-01

    Coxsackievirus A4 outbreaks occurred in Taiwan in 2004 and 2006. The spatiotemporal transmission of this error-prone RNA virus involves a continuous interaction between rapid sequence variation and natural selection. To elucidate the molecular characteristics of CV-A4 and the spatiotemporal dynamic changes in CV-A4 transmission, worldwide sequences of the 3' VP1 region (420 nt) obtained from GenBank were analyzed together with sequences isolated in Taiwan from 2002 to 2009. Sequences were characterized in terms of recombination, variability, and selection. Phylogenetic trees were constructed using neighbor-joining, maximum likelihood and Monte Carlo Markov Chain methods. Spatiotemporal dynamics of CV-A4 transmission were further estimated by a Bayesian statistical inference framework. No recombination was detected in the 420 nt region. The estimated evolution rate of CV-A4 was 8.65 × 10(-3) substitutions/site/year, and a purifying selection (d(N)/d(S)=0.032) was noted over the 3' VP1 region. All trees had similar topology: two genotypes (GI and GII), each including two subgenotypes (A and B), with the prototype and a Kenyan strain in separate branches. The results revealed that the virus first appeared in USA in 1950. Since 1998, it has evolved into the Kenya, GI-A (Asia) and GII-A (Asia and Europe) strains. Since 2004, GI-B and GII-B have evolved continuously and have remained prevalent. The co-existence of several positive selection lineages of GI-B in 2006 indicates that the subgenotype might have survived lineage extinction. This study revealed rapid lineage turnover of CV-A4 and the replacement of previously circulating strains by a new dominant variant. Therefore, continuous surveillance for further CV-A4 transmission is essential. PMID:21635970

  3. Transmission and Demographic Dynamics of Coxsackievirus B1.

    PubMed

    Chu, Pei-Yu; Tyan, Yu-Chang; Chen, Yao-Shen; Chen, Hsiu-Lin; Lu, Po-Liang; Chen, Yu-Hsien; Chen, Bao-Chen; Huang, Tsi-Shu; Wang, Chu-Feng; Su, Hui-Ju; Shi, Yong-Ying; Sanno-Duanda, Bintou; Lin, Kuei-Hsiang; Motomura, Kazushi

    2015-01-01

    The infectious activity of coxsackievirus B1 (CV-B1) in Taiwan was high from 2008 to 2010, following an alarming increase in severe neonate disease in the United States (US). To examine the relationship between CV-B1 strains isolated in Taiwan and those from other parts of the world, we performed a phylodynamic study using VP1 and partial 3Dpol (414 nt) sequences from 22 strains of CV-B1 isolated in Taiwan (1989-2010) and compared them to sequences from strains isolated worldwide. Phylogenetic trees were constructed by neighbor-joining, maximum likelihood, and Bayesian Monte Carlo Markov Chain methods. Four genotypes (GI-IV) in the VP1 region of CV-B1 and three genotypes (GA-C) in the 3Dpol region of enterovirus B were identified and had high support values. The phylogenetic analysis indicates that the GI and GIII strains in VP1 were geographically distributed in Taiwan (1993-1994) and in India (2007-2009). On the other hand, the GII and GIV strains appear to have a wider spatiotemporal distribution and ladder-like topology A stair-like phylogeny was observed in the VP1 region indicating that the phylogeny of the virus may be affected by different selection pressures in the specified regions. Further, most of the GI and GII strains in the VP1 tree were clustered together in GA in the 3D tree, while the GIV strains diverged into GB and GC. Taken together, these data provide important insights into the population dynamics of CV-B1 and indicate that incongruencies in specific gene regions may contribute to spatiotemporal patterns of epidemicity for this virus. PMID:26053872

  4. Epididymitis Caused by Coxsackievirus A6 in Association with Hand, Foot, and Mouth Disease

    PubMed Central

    Österback, Riikka; Kuisma, Jani; Ylipalosaari, Pekka

    2014-01-01

    Coxsackievirus A6 (CV-A6) caused hand, foot, and mouth disease (HFMD) with a unique manifestation of epididymitis. The patient underwent operation due to suspicion of testicular torsion. Epididymitis was diagnosed by ultrasound examination. Enterovirus was detected from epididymal fluid by PCR and typed by partial sequencing of viral protein 1 as CV-A6. PMID:25232161

  5. New pseudodimeric aurones as palm pocket inhibitors of Hepatitis C virus RNA-dependent RNA polymerase.

    PubMed

    Meguellati, Amel; Ahmed-Belkacem, Abdelhakim; Nurisso, Alessandra; Yi, Wei; Brillet, Rozenn; Berqouch, Nawel; Chavoutier, Laura; Fortuné, Antoine; Pawlotsky, Jean-Michel; Boumendjel, Ahcène; Peuchmaur, Marine

    2016-06-10

    The NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme for Hepatitis C Virus (HCV) replication. In addition to the catalytic site, this enzyme is characterized by the presence of at least four allosteric pockets making it an interesting target for development of inhibitors as potential anti-HCV drugs. Based on a previous study showing the potential of the naturally occurring aurones as inhibitors of NS5B, we pursued our efforts to focus on pseudodimeric aurones that have never been investigated so far. Hence, 14 original compounds characterized by the presence of a spacer between the benzofuranone moieties were synthesized and investigated as HCV RdRp inhibitors by means of an in vitro assay. The most active inhibitor, pseudodimeric aurone 4, induced high inhibition activity (IC50 = 1.3 μM). Mutagenic and molecular modeling studies reveal that the binding site for the most active derivatives probably is the palm pocket I instead of the thumb pocket I as for the monomeric derivatives. PMID:27017550

  6. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases.

    PubMed

    Qian, Xinlei; Hamid, Fursham M; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V; Lescar, Julien

    2016-04-22

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1(Ncr)) and related fungi, Thielavia terrestris (QDE-1(Tte)) and Myceliophthora thermophila (QDE-1(Mth)), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1(Ncr) counterpart favoring processive RNA synthesis, QDE-1(Tte) and QDE-1(Mth) produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1(Tte) reveals a quasisymmetric dimer similar to QDE-1(Ncr) Further electron microscopy analyses confirm that QDE-1(Tte) occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  7. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases*

    PubMed Central

    Qian, Xinlei; Hamid, Fursham M.; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V.; Lescar, Julien

    2016-01-01

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro. However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1Ncr) and related fungi, Thielavia terrestris (QDE-1Tte) and Myceliophthora thermophila (QDE-1Mth), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1Ncr counterpart favoring processive RNA synthesis, QDE-1Tte and QDE-1Mth produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1Tte reveals a quasisymmetric dimer similar to QDE-1Ncr. Further electron microscopy analyses confirm that QDE-1Tte occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  8. Episodic adaptive diversification of classical swine fever virus RNA-dependent RNA polymerase NS5B.

    PubMed

    Li, Yan; Yang, Zexiao

    2015-12-01

    Classical swine fever virus (CSFV) is the pathogen that causes a highly infectious disease of pigs and has led to disastrous losses to pig farms and related industries. The RNA-dependent RNA polymerase (RdRp) NS5B is a central component of the replicase complex (RC) in some single-stranded RNA viruses, including CSFV. On the basis of genetic variation, the CSFV RdRps could be clearly divided into 2 major groups and a minor group, which is consistent with the phylogenetic relationships and virulence diversification of the CSFV isolates. However, the adaptive signature underlying such an evolutionary profile of the polymerase and the virus is still an interesting open question. We analyzed the evolutionary trajectory of the CSFV RdRps over different timescales to evaluate the potential adaptation. We found that adaptive selection has driven the diversification of the RdRps between, but not within, CSFV major groups. Further, the major adaptive divergence-related sites are located in the surfaces relevant to the interaction with other component(s) of RC and the entrance and exit of the template-binding channel. These results might shed some light on the nature of the RdRp in virulence diversification of CSFV groups. PMID:26485449

  9. Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase

    PubMed Central

    Liu, Xinran; Musser, Derek M.; Lee, Cheri A.; Yang, Xiaorong; Arnold, Jamie J.; Cameron, Craig E.; Boehr, David D.

    2015-01-01

    The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation. PMID:26516899

  10. Phosphorylation at the N-terminal finger subdomain of a viral RNA-dependent RNA polymerase.

    PubMed

    Hernández, Sergio; Figueroa, Daniella; Correa, Simón; Díaz, Ariel; Aguayo, Daniel; Villanueva, Rodrigo A

    2015-10-01

    The RNA-dependent RNA polymerase (RdRP) of the Hepatitis C virus (HCV), named NS5B, is phosphorylated by the cellular protein kinase C-related kinase 2 (PRK2) at two serine residues (Ser29 and Ser42) of the finger subdomain (genotype 1b). Herein, using bioinformatics, we selected four potential phosphorylation residues (Ser46, Ser76, Ser96 and Ser112) of NS5B (genotype 2a) for study. Whereas the NS5B Ser46D and Ser76D substitutions seemed to improve polymerase activity, the Ser96D mutation decreased colony formation efficiency. Active WT NS5B was utilized in in vitro kinase assays, and phosphopeptides were analyzed by mass spectrometry. Interestingly, the data indicated that both the NS5B Ser29 and Ser76 residues resulted phosphorylated. Thus, as Ser76 is absolutely conserved across HCV genotypes, our results confirmed the relevance of these sites for both genotypes and suggested that Ser76 becomes phosphorylated by a cellular kinase different from PRK2. By molecular dynamic simulations, we show that new interactions between space-adjacent amino acid chains could be established by the presence of a di-anionic phosphate group on the analyzed serines to possibly modify RNA polymerase activity. Together, our data present novel evidence on the complex regulation at the finger subdomain of HCV NS5B via phosphorylation. PMID:26301630

  11. Organization, Function, and Therapeutic Targeting of the Morbillivirus RNA-Dependent RNA Polymerase Complex.

    PubMed

    Sourimant, Julien; Plemper, Richard K

    2016-01-01

    The morbillivirus genus comprises major human and animal pathogens, including the highly contagious measles virus. Morbilliviruses feature single stranded negative sense RNA genomes that are wrapped by a plasma membrane-derived lipid envelope. Genomes are encapsidated by the viral nucleocapsid protein forming ribonucleoprotein complexes, and only the encapsidated RNA is transcribed and replicated by the viral RNA-dependent RNA polymerase (RdRp). In this review, we discuss recent breakthroughs towards the structural and functional understanding of the morbillivirus polymerase complex. Considering the clinical burden imposed by members of the morbillivirus genus, the development of novel antiviral therapeutics is urgently needed. The viral polymerase complex presents unique structural and enzymatic properties that can serve as attractive candidates for druggable targets. We evaluate distinct strategies for therapeutic intervention and examine how high-resolution insight into the organization of the polymerase complex may pave the path towards the structure-based design and optimization of next-generation RdRp inhibitors. PMID:27626440

  12. Alfalfa mosaic virus coat protein bridges RNA and RNA-dependent RNA polymerase in vitro.

    PubMed

    Reichert, Vienna L; Choi, Mehee; Petrillo, Jessica E; Gehrke, Lee

    2007-07-20

    Alfalfa mosaic virus (AMV) RNA replication requires the viral coat protein (CP). AMV CP is an integral component of the viral replicase; moreover, it binds to the viral RNA 3'-termini and induces the formation of multiple new base pairs that organize the RNA conformation. The results described here suggest that AMV coat protein binding defines template selection by organizing the 3'-terminal RNA conformation and by positioning the RNA-dependent RNA polymerase (RdRp) at the initiation site for minus strand synthesis. RNA-protein interactions were analyzed by using a modified Northwestern blotting protocol that included both viral coat protein and labeled RNA in the probe solution ("far-Northwestern blotting"). We observed that labeled RNA alone bound the replicase proteins poorly; however, complex formation was enhanced significantly in the presence of AMV CP. The RNA-replicase bridging function of the AMV CP may represent a mechanism for accurate de novo initiation in the absence of canonical 3' transfer RNA signals. PMID:17400272

  13. Subgenomic promoter recognition by the norovirus RNA-dependent RNA polymerases

    PubMed Central

    Lin, Xiaoyan; Thorne, Lucy; Jin, Zhinan; Hammad, Loubna A.; Li, Serena; Deval, Jerome; Goodfellow, Ian G.; Kao, C. Cheng

    2015-01-01

    The replication enzyme of RNA viruses must preferentially recognize their RNAs in an environment that contains an abundance of cellular RNAs. The factors responsible for specific RNA recognition are not well understood, in part because viral RNA synthesis takes place within enzyme complexes associated with modified cellular membrane compartments. Recombinant RNA-dependent RNA polymerases (RdRps) from the human norovirus and the murine norovirus (MNV) were found to preferentially recognize RNA segments that contain the promoter and a short template sequence for subgenomic RNA synthesis. Both the promoter and template sequence contribute to stable RdRp binding, accurate initiation of the subgenomic RNAs and efficient RNA synthesis. Using a method that combines RNA crosslinking and mass spectrometry, residues near the template channel of the MNV RdRp were found to contact the hairpin RNA motif. Mutations in the hairpin contact site in the MNV RdRp reduced MNV replication and virus production in cells. This work demonstrates that the specific recognition of the norovirus subgenomic promoter is through binding by the viral RdRp. PMID:25520198

  14. Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.

    PubMed

    Kalveram, Birte; Ikegami, Tetsuro

    2013-04-01

    Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells. PMID:23325696

  15. Toscana Virus NSs Protein Promotes Degradation of Double-Stranded RNA-Dependent Protein Kinase

    PubMed Central

    Kalveram, Birte

    2013-01-01

    Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses—i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus—has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells. PMID:23325696

  16. Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase.

    PubMed

    Liu, Xinran; Musser, Derek M; Lee, Cheri A; Yang, Xiaorong; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2015-10-01

    The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation. PMID:26516899

  17. Genetic Transformation of Citrus Paradisi with Antisense and untranslatable RNA-dependent RNA Polymerase Genes of Citrus Tristeza Closterovirus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of the RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) was studied in vivo and in vitro using a polyclonal antiserum raised against the recombinant CTV-RdRp protein. Although 56 kDa CTV-RdRp is thought to be expressed by a +1 translational frameshift at the carboxyl te...

  18. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PROCEDURES AND DELEGATIONS OF THE BOARD OF REGENTS OF THE UNIFORMED SERVICES UNIVERSITY OF THE HEALTH SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...) Public announcement of meetings shall conform to the Public Meeting Procedures of the Board of...

  19. Rice RNA-dependent RNA polymerase 6 acts in small RNA biogenesis and spikelet development.

    PubMed

    Song, Xianwei; Wang, Dekai; Ma, Lijia; Chen, Zhiyu; Li, Pingchuan; Cui, Xia; Liu, Chunyan; Cao, Shouyun; Chu, Chengcai; Tao, Yuezhi; Cao, Xiaofeng

    2012-08-01

    Higher plants have evolved multiple RNA-dependent RNA polymerases (RDRs), which work with Dicer-like (DCL) proteins to produce different classes of small RNAs with specialized molecular functions. Here we report that OsRDR6, the rice (Oryza sativa L.) homolog of Arabidopsis RDR6, acts in the biogenesis of various types and sizes of small RNAs. We isolated a rice osrdr6-1 mutant, which was temperature sensitive and showed spikelet defects. This mutant displays reduced accumulation of tasiR-ARFs, the conserved trans-acting siRNAs (tasiRNAs) derived from the TAS3 locus, and ectopic expression of tasiR-ARF target genes, the Auxin Response Factors (including ARF2 and ARF3/ETTIN). The loss of tasiR-mediated repression of ARFs in osrdr6-1 can explain its morphological defects, as expression of two non-targeted ARF3 gene constructs (ARF3muts) in a wild-type background mimics the osrdr6 and osdcl4-1 mutant phenotypes. Small RNA high-throughput sequencing also reveals that besides tasiRNAs, 21-nucleotide (nt) phased small RNAs are also largely dependent on OsRDR6. Unexpectedly, we found that osrdr6-1 has a strong impact on the accumulation of 24-nt phased small RNAs, but not on unphased ones. Our work uncovers the key roles of OsRDR6 in small RNA biogenesis and directly illustrates the crucial functions of tasiR-ARFs in rice development. PMID:22443269

  20. Nonnucleoside Inhibitor of Measles Virus RNA-Dependent RNA Polymerase Complex Activity▿ †

    PubMed Central

    White, Laura K.; Yoon, Jeong-Joong; Lee, Jin K.; Sun, Aiming; Du, Yuhong; Fu, Haian; Snyder, James P.; Plemper, Richard K.

    2007-01-01

    Paramyxoviruses comprise several major human pathogens. Although a live-attenuated vaccine protects against measles virus (MV), a member of the paramyxovirus family, the virus remains a principal cause of worldwide mortality and accounts for approximately 21 million cases and 300,000 to 400,000 deaths annually. The development of novel antivirals that allow improved case management of severe measles and silence viral outbreaks is thus highly desirable. We have previously described the development of novel MV fusion inhibitors. The potential for preexisting or emerging resistance in the field constitutes the rationale for the identification of additional MV inhibitors with a diverse target spectrum. Here, we report the development and implementation of a cell-based assay for high-throughput screening of MV antivirals, which has yielded several hit candidates. Following confirmation by secondary assays and chemical synthesis, the most potent hit was found to act as a target-specific inhibitor of MV replication with desirable drug-like properties. The compound proved highly active against multiple primary isolates of diverse MV genotypes currently circulating worldwide, showing active concentrations of 35 to 145 nM. Significantly, it does not interfere with viral entry and lacks cross-resistance with the MV fusion inhibitor class. Mechanistic characterization on a subinfection level revealed that the compound represents a first-in-class nonnucleoside inhibitor of MV RNA-dependent RNA polymerase complex activity. Singly or in combination with the fusion inhibitors, this novel compound class has high developmental potential as a potent therapeutic against MV and will likely further the mechanistic characterization of the viral polymerase complex. PMID:17470652

  1. Functional expression of double-stranded RNA-dependent protein kinase in rat intestinal epithelial cells.

    PubMed

    Sato, Nagahiro; Morimoto, Hiroyuki; Baba, Ryoko; Nakamata, Junichi; Doi, Yoshiaki; Yamaguchi, Koji

    2010-05-01

    Intestinal epithelial cells (IECs) are exposed to external environment, microbial and viral products, and serve as essential barriers to antigens. Recent studies have shown that IECs express Toll-like receptors (TLRs) and respond to microbial components. The antimicrobial and antiviral barriers consist of many molecules including TLRs. To investigate the further component of this barrier in intestine, we examined the expression of double-stranded RNA-dependent protein kinase (PKR). PKR is a player in the cellular antiviral response and phosphorylates alpha-subunit of the eukaryotic translation initiation factor 2 (eIF-2alpha) to block protein synthesis and induces apoptosis. In this study, we showed that the expression of PKR was restricted to the cytoplasm of absorptive epithelial cells in the intestine of adult rat. We also demonstrated that PKR was expressed in the cultured rat intestinal epithelial cells (IEC-6). The level of PKR protein expression and the activity of alkaline phosphatase (ALP) increased in the cultured IEC-6 cells in a time-dependent manner. Inhibition of PKR by the 2-aminopurine treatment decreased ALP activity in the IEC-6 cells. Treatment of IEC-6 cells with synthetic double-stranded RNA (dsRNA) induced cell death in a dose-dependent manner. The addition of hydrocortisone also provoked suppression of PKR expression and ALP activity. This modulation might be mediated by signal transducers and activators of transcription-1 (STAT-1) protein. We concluded that PKR is expressed in IECs as potent barriers to antigens and is a possible modulator of the differentiation of rat IECs. PMID:20213745

  2. Potent Host-Directed Small-Molecule Inhibitors of Myxovirus RNA-Dependent RNA-Polymerases

    PubMed Central

    Krumm, Stefanie A.; Ndungu, J. Maina; Yoon, Jeong-Joong; Dochow, Melanie; Sun, Aiming; Natchus, Michael; Snyder, James P.; Plemper, Richard K.

    2011-01-01

    Therapeutic targeting of host cell factors required for virus replication rather than of pathogen components opens new perspectives to counteract virus infections. Anticipated advantages of this approach include a heightened barrier against the development of viral resistance and a broadened pathogen target spectrum. Myxoviruses are predominantly associated with acute disease and thus are particularly attractive for this approach since treatment time can be kept limited. To identify inhibitor candidates, we have analyzed hit compounds that emerged from a large-scale high-throughput screen for their ability to block replication of members of both the orthomyxovirus and paramyxovirus families. This has returned a compound class with broad anti-viral activity including potent inhibition of different influenza virus and paramyxovirus strains. After hit-to-lead chemistry, inhibitory concentrations are in the nanomolar range in the context of immortalized cell lines and human PBMCs. The compound shows high metabolic stability when exposed to human S-9 hepatocyte subcellular fractions. Antiviral activity is host-cell species specific and most pronounced in cells of higher mammalian origin, supporting a host-cell target. While the compound induces a temporary cell cycle arrest, host mRNA and protein biosynthesis are largely unaffected and treated cells maintain full metabolic activity. Viral replication is blocked at a post-entry step and resembles the inhibition profile of a known inhibitor of viral RNA-dependent RNA-polymerase (RdRp) activity. Direct assessment of RdRp activity in the presence of the reagent reveals strong inhibition both in the context of viral infection and in reporter-based minireplicon assays. In toto, we have identified a compound class with broad viral target range that blocks host factors required for viral RdRp activity. Viral adaptation attempts did not induce resistance after prolonged exposure, in contrast to rapid adaptation to a pathogen

  3. 216-B-3 expansion ponds closure plan

    SciTech Connect

    Not Available

    1994-10-01

    This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA.

  4. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells

    PubMed Central

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A.; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine

    2015-01-01

    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression. PMID

  5. [ANTIVIRAL ACTIVITY OF THE DIHYDROQUERCETIN DURING THE COXSACKIEVIRUS B4 REPLICATION IN VITRO].

    PubMed

    Galochkina, A V; Zarubaev, V V; Kiselev, O I; Babkin, V A; Ostroukhova, L A

    2016-01-01

    A study of the antiviral activity of antioxidants against viral infections is believed to be essential for creating complex antiviral agents. Dihydroquercetin is considered as the most active antioxidant extracted from Larix gmelinii. In this work, we present results of experiments of the antiviral properties of dihydroquercetin against a member of the family Picarnaviridae--Coxsackievirus B4 in vitro. We have estimated that dihydroquercetin reduces viral titers at 100 µg/ml concentration as compared with control of virus. We have shown using the plaque assay that CPE of virusis reduced in the presence of dihydroquercetin at 100 µg/ml. Study of the phase of viral lifecycle, in which dihydroquercetin acted, demonstrated that the highest efficacy of the antiviral therapy was reached at early stages of virus reproduction (1-3 hours post infection). These results show that dihydroquercetin has antiviralproperty against Coxsackievirus B4. This drug and other antioxidants can be tested as inhibitors of viral replication. PMID:27145597

  6. Coxsackievirus A6: a new emerging pathogen causing hand, foot and mouth disease outbreaks worldwide.

    PubMed

    Bian, Lianlian; Wang, Yiping; Yao, Xin; Mao, Qunying; Xu, Miao; Liang, Zhenglun

    2015-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the predominant pathogens causing outbreaks of hand, foot and mouth disease (HFMD) worldwide. Other human enterovirus A (HEV-A) serotypes tend to cause only sporadic HFMD cases. However, since a HFMD caused by coxsackievirus A6 broke out in Finland in 2008, CA6 has been identified as the responsible pathogen for a series of HFMD outbreaks in Europe, North America and Asia. Because of the severity of the clinical manifestations and the underestimated public health burden, the epidemic of CA6-associated HFMD presents a new challenge to the control of HFMD. This article reviewed the epidemic characteristics, molecular epidemiology, clinical features and laboratory diagnosis of CA6 infection. The genetic evolution of CA6 strains associated with HFMD was also analyzed. It indicated that the development of a multivalent vaccine combining EV71, CA16 and CA6 is an urgent necessity to control HFMD. PMID:26112307

  7. Pemphigus vulgaris after coxsackievirus infection and cephalosporin treatment: a paraviral eruption?

    PubMed

    Ruocco, E; Lo Schiavo, A; Baroni, A; Sangiuliano, S; Puca, R V; Brunetti, G; Ruocco, V

    2008-01-01

    Pemphigus is an autoimmune disease that results from the interaction between predisposing genetic factors and exogenous agents, mainly drugs and viruses. Herein we report the case of a 66-year-old woman referred to our department for the onset of painful oral erosions and bullous lesions on the torso. Clinical, laboratory and histopathological investigations led to the diagnosis of pemphigus vulgaris. Two weeks before the outbreak of the lesions, the patient had suffered from a viral pharyngitis, subsequently diagnosed as herpangina, and had been taking an oral cephalosporin (cefixime) for 1 week to prevent possible bacterial complications. A relationship between the onset of pemphigus and coxsackievirus infection or cefixime administration or both was supposed. The case may represent a peculiar paraviral eruption, where a predisposing pemphigus-prone genetic background paved the way for the acantholytic autoimmune disorder as a consequence of the combined effect of the coxsackievirus infection and the cephalosporin treatment. PMID:18230979

  8. Cellular immune mechanisms in Coxsackievirus group B, type 3 induced myocarditis in Balb/C mice

    SciTech Connect

    Huber, S.A.; Job, L.P.

    1983-01-01

    Coxsackie B viruses are a common cause of viral myocarditis in humans. A murine model of the human disease has been developed using Coxsackievirus group B, type 3 and inbred Balb/c mice. Infection of T lymphocyte deficient mice does not result in significant myocarditis indicating the importance of T cells in this disease. The virus can be isolated from the hearts of T cell deficient and normal mice in equal concentrations. Virus elimination presumably is mediated by virus specific neutralizing antibody induced in both groups. T lymphocytes, natural killer cells and macrophage obtained from normal virus infected mice are all capable of lysing myofibers in vitro. Maximum lysis is obtained with the cytolytic T cells. When these cell populations or Coxsackievirus immune antibody were adoptively transferred into T lymphocyte deficient animals infected with the virus, only animals given T cells developed significant myocarditis.

  9. Initiation of minus-strand RNA synthesis by the brome mosaicvirus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.

    PubMed Central

    Kao, C C; Sun, J H

    1996-01-01

    Various DNA- and RNA-dependent RNA polymerases have been reported to use oligoribonucleotide primers to initiate nucleic acid synthesis. For the brome mosaic virus RNA-dependent RNA polymerase (RdRp), we determined that in reactions performed with limited GTP concentrations, minus-strand RNA synthesis can be stimulated by the inclusion of guanosine monophosphate or specific oligoribonucleotides. Furthermore, guanylyl-3',5'-guanosine (GpG) was incorporated into minus-strand RNA and increased the rate of minus-strand RNA synthesis. In the presence of GpG, RdRp's Km for GTP decreased from 50 microM to approximately 3 microM while the Kms for other nucleotides were unaffected. These results have implications for the mechanism of initiation by RdRp. PMID:8794323

  10. A tumor mRNA-dependent gold nanoparticle-molecular beacon carrier for controlled drug release and intracellular imaging.

    PubMed

    Qiao, Guangming; Zhuo, Linhai; Gao, Yuan; Yu, Lijuan; Li, Na; Tang, Bo

    2011-07-14

    We demonstrate a tumor mRNA-dependent drug carrier for controlled release of doxorubicin (Dox) and intracellular imaging based on gold nanoparticle-molecular beacon. Fluorescent Dox is released effectively and induces apoptosis in breast cancer cells but not in normal cells. Significantly, the release of Dox is correlated positively with the quantities of tumor mRNA, which is according to various stages of tumor progression, and so can decrease effectively side effects of Dox. PMID:21589964

  11. Myocarditis, hepatitis, and pancreatitis in a patient with coxsackievirus A4 infection: a case report

    PubMed Central

    2014-01-01

    Viral myocarditis presents with various symptoms, including fatal arrhythmia and cardiogenic shock, and may develop chronic myocarditis and dilated cardiomyopathy in some patients. We report here a case of viral myocarditis with liver dysfunction and pancreatitis. A 63-year-old man was admitted to our hospital with dyspnea. The initial investigation showed pulmonary congestion, complete atrioventricular block, left ventricular dysfunction, elevated serum troponin I, and elevated liver enzyme levels. He developed pancreatitis five days after admission. Further investigation revealed a high antibody titer against coxsackievirus A4. The patient’s left ventricular dysfunction, pancreatitis, and liver dysfunction had resolved by day 14, but his troponin I levels remained high, and an endomyocardial biopsy showed T-lymphocyte infiltration of the myocardium, confirming acute myocarditis. The patient underwent radical low anterior resection five weeks after admission for advanced rectal cancer found incidentally. His serum troponin I and plasma brain natriuretic peptide levels normalized six months after admission. He has now been followed-up for two years, and his left ventricular ejection fraction is stable. This is the first report of an adult with myocarditis and pancreatitis attributed to coxsackievirus A4. Combined myocarditis and pancreatitis arising from coxsackievirus infection is rare. This patient’s clinical course suggests that changes in his immune response associated with his rectal cancer contributed to the amelioration of his viral myocarditis. PMID:24410962

  12. Domain I of the 5' non-translated genomic region in coxsackievirus B3 RNA is not required for productive replication.

    PubMed

    Jaramillo, L; Smithee, S; Tracy, S; Chapman, N M

    2016-09-01

    Domain I is a cloverleaf-like secondary structure at the 5' termini of all enterovirus genomes, comprising part of a cis-acting replication element essential for efficient enteroviral replication. 5' genomic terminal deletions up to as much as 55% of domain I can occur without lethality following coxsackie B virus infections. We report here that the entire CVB structural domain I can be deleted without lethality. PMID:27289561

  13. Homology modeling, docking, molecular dynamics simulation, and structural analyses of coxsakievirus B3 2A protease: an enzyme involved in the pathogenesis of inflammatory myocarditis.

    PubMed

    Maghsoudi, Amir Hossein; Khodagholi, Fariba; Hadi-Alijanvand, Hamid; Esfandiarei, Mitra; Sabbaghian, Marjan; Zakeri, Zahra; Shaerzadeh, Fatemeh; Abtahi, Shervin; Maghsoudi, Nader

    2011-11-01

    2A protease of the pathogenic coxsackievirus B3 is key to the pathogenesis of inflammatory myocarditis and, therefore, an attractive drug target. However lack of a crystal structure impedes design of inhibitors. Here we predict 3D structure of CVB3 2A(pro) based on sequence comparison and homology modeling with human rhinovirus 2A(pro). The two enzymes are remarkably similar in their core regions. However they have different conformations at the N-terminal. A large number of N-terminal hydrophobic residues reduce the thermal stability of CVB3 2A(pro), as we confirmed by fluorescence, western blot and turbidity measurement. Molecular dynamic simulation revealed that elevated temperature induces protein motion that results in frequent movement of the N-terminal coil. This may therefore induce successive active site changes and thus play an important role in destabilization of CVB3 2A(pro) structure. PMID:21664926

  14. Construction of a subgenomic CV-B3 replicon expressing emerald green fluorescent protein to assess viral replication of a cardiotropic enterovirus strain in cultured human cells.

    PubMed

    Wehbe, Michel; Huguenin, Antoine; Leveque, Nicolas; Semler, Bert L; Hamze, Monzer; Andreoletti, Laurent; Bouin, Alexis

    2016-04-01

    Coxsackieviruses B (CV-B) (Picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (DCM) cases. The mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the DCM clinical stage are not fully understood but are influenced by both viral and host factors. Subgenomic replicons of CV-B can be used to assess viral replication mechanisms in human cardiac cells and evaluate the effects of potential antiviral drugs on viral replication activities. Our objectives were to generate a reporter replicon from a cardiotropic prototype CV-B3/28 strain and to characterize its replication properties into human cardiac primary cells. To obtain this replicon, a cDNA plasmid containing the full CV-B3/28 genome flanked by a hammerhead ribozyme sequence and an MluI restriction site was generated and used as a platform for the insertion of sequences encoding emerald green fluorescent protein (EmGFP) in place of those encoding VP3. In vitro transcribed RNA from this plasmid was transfected into HeLa cells and human primary cardiac cells and was able to produce EmGFP and VP1-containing polypeptides. Moreover, non-structural protein biological activity was assessed by the specific cleavage of eIF4G1 by viral 2A(pro). Viral RNA replication was indirectly demonstrated by inhibition assays, fluoxetine was added to cell culture and prevented the EmGFP synthesis. Our results indicated that the EmGFP CV-B3 replicon was able to replicate and translate as well as the CV-B3/28 prototype strain. Our EmGFP CV-B3 replicon will be a valuable tool to readily investigate CV-B3 replication activities in human target cell models. PMID:26800776

  15. Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA-dependent repair pathways

    PubMed Central

    Crippa, Stefania; Nemir, Mohamed; Ounzain, Samir; Ibberson, Mark; Berthonneche, Corinne; Sarre, Alexandre; Boisset, Gaëlle; Maison, Damien; Harshman, Keith; Xenarios, Ioannis; Diviani, Dario; Schorderet, Daniel; Pedrazzini, Thierry

    2016-01-01

    Aims The adult mammalian heart has poor regenerative capacity. In contrast, the zebrafish heart retains a robust capacity for regeneration into adulthood. These distinct responses are consequences of a differential utilization of evolutionary-conserved gene regulatory networks in the damaged heart. To systematically identify miRNA-dependent networks controlling cardiac repair following injury, we performed comparative gene and miRNA profiling of the cardiac transcriptome in adult mice and zebrafish. Methods and results Using an integrated approach, we show that 45 miRNA-dependent networks, involved in critical biological pathways, are differentially modulated in the injured zebrafish vs. mouse hearts. We study, more particularly, the miR-26a-dependent response. Therefore, miR-26a is down-regulated in the fish heart after injury, whereas its expression remains constant in the mouse heart. Targets of miR-26a involve activators of the cell cycle and Ezh2, a component of the polycomb repressive complex 2 (PRC2). Importantly, PRC2 exerts repressive functions on negative regulators of the cell cycle. In cultured neonatal cardiomyocytes, inhibition of miR-26a stimulates, therefore, cardiomyocyte proliferation. Accordingly, miR-26a knockdown prolongs the proliferative window of cardiomyocytes in the post-natal mouse heart. Conclusions This novel strategy identifies a series of miRNAs and associated pathways, in particular miR-26a, which represent attractive therapeutic targets for inducing repair in the injured heart. PMID:26857418

  16. Activation of innate antiviral immune response via double-stranded RNA-dependent RLR receptor-mediated necroptosis

    PubMed Central

    Wang, Wei; Wang, Wei-Hua; Azadzoi, Kazem M.; Su, Ning; Dai, Peng; Sun, Jianbin; Wang, Qin; Liang, Ping; Zhang, Wentao; Lei, Xiaoying; Yan, Zhen; Yang, Jing-Hua

    2016-01-01

    Viruses induce double-stranded RNA (dsRNA) in the host cells. The mammalian system has developed dsRNA-dependent recognition receptors such as RLRs that recognize the long stretches of dsRNA as PAMPs to activate interferon-mediated antiviral pathways and apoptosis in severe infection. Here we report an efficient antiviral immune response through dsRNA-dependent RLR receptor-mediated necroptosis against infections from different classes of viruses. We demonstrated that virus-infected A549 cells were efficiently killed in the presence of a chimeric RLR receptor, dsCARE. It measurably suppressed the interferon antiviral pathway but promoted IL-1β production. Canonical cell death analysis by morphologic assessment, phosphatidylserine exposure, caspase cleavage and chemical inhibition excluded the involvement of apoptosis and consistently suggested RLR receptor-mediated necroptosis as the underlying mechanism of infected cell death. The necroptotic pathway was augmented by the formation of RIP1-RIP3 necrosome, recruitment of MLKL protein and the activation of cathepsin D. Contributing roles of RIP1 and RIP3 were confirmed by gene knockdown. Furthermore, the necroptosis inhibitor necrostatin-1 but not the pan-caspase inhibitor zVAD impeded dsCARE-dependent infected cell death. Our data provides compelling evidence that the chimeric RLR receptor shifts the common interferon antiviral responses of infected cells to necroptosis and leads to rapid death of the virus-infected cells. This mechanism could be targeted as an efficient antiviral strategy. PMID:26935990

  17. A Quantitative Spectrophotometric Assay to Monitor the tRNA-Dependent Pathway for Lipid Aminoacylation In Vitro.

    PubMed

    Grube, Christopher D; Roy, Hervé

    2016-08-01

    The transfer RNA (tRNA)-dependent pathway for lipid aminoacylation is a two-step pathway composed of (1) a tRNA aminoacylation step catalyzed by an aminoacyl-tRNA synthetase, forming a specific aa-tRNA, and (2) a tRNA-dependent transfer step in which the amino acid acylating the tRNA is transferred to an acceptor lipid. The latter step is catalyzed by a transferase located within the cytoplasmic membrane of certain bacteria. Lipid aminoacylation modifies the biochemical properties of the membrane and enhances resistance of some pathogens to various classes of antimicrobial agents and components of the innate immune response. Lipid aminoacylation has also been linked to increased virulence of various pathogenic bacteria. Inhibition of this mechanism would render pathogens more susceptible to existing drugs or to natural defenses of a host organism. Because lipid aminoacylation is widespread in many bacterial genera and absent from eukaryotes, and because the tRNA aminoacylation step of this pathway is also used in protein biosynthesis (a process essential for bacterial life), this pathway represents an attractive target for drug design. We have reconstituted the lipid aminoacylation pathway in vitro and optimized it for high-throughput screening of libraries of compounds to simultaneously identify inhibitors targeting each step of the pathway in a single assay. PMID:27073192

  18. Hand, foot and mouth disease caused by coxsackievirus A6, Beijing, 2013.

    PubMed

    Hongyan, Gu; Chengjie, Ma; Qiaozhi, Yang; Wenhao, Hua; Juan, Li; Lin, Pang; Yanli, Xu; Hongshan, Wei; Xingwang, Li

    2014-12-01

    Specimens and clinical data were collected from 243 hand, foot and mouth disease patients in Beijing in 2013. In total, 130 stool specimens were genotyped for enterovirus. Hand, foot and mouth disease was mainly detected in suburban areas and at the edges of urban areas between May and August. Coxsackievirus (CV) A6 replaced enterovirus (EV) 71 and CVA16, becoming the main causative agent of hand, foot and mouth disease. CVA6 infection led to significantly reduced fever duration and glucose levels compared with EV71 infection. PMID:25037037

  19. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Conduct of agency business. 261b.3 Section 261b.3 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members...

  20. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  1. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  2. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  3. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  4. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 1 2011-10-01 2011-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  5. 26 CFR 54.4980B-3 - Qualified beneficiaries.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 17 2012-04-01 2012-04-01 false Qualified beneficiaries. 54.4980B-3 Section 54.4980B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) MISCELLANEOUS EXCISE TAXES (CONTINUED) PENSION EXCISE TAXES § 54.4980B-3 Qualified beneficiaries. The determination of who is a qualified beneficiary,...

  6. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations....

  7. Genome Sequence of Coxsackievirus A6, Isolated during a Hand-Foot-and-Mouth Disease Outbreak in Finland in 2008

    PubMed Central

    Koskinen, Satu; Merilahti, Pirjo; Pursiheimo, Juha-Pekka; Blomqvist, Soile; Roivainen, Merja; Laiho, Asta; Susi, Petri; Waris, Matti

    2014-01-01

    Reports of hand-foot-and-mouth disease (HFMD) outbreaks caused by coxsackievirus A6 have increased worldwide after the report of the first outbreak in Finland in 2008. The complete genome of the first outbreak strain from a vesicle fluid specimen was determined. PMID:25323709

  8. Adult-onset Kawasaki disease (mucocutaneous lymph node syndrome) and concurrent Coxsackievirus A4 infection: a case report

    PubMed Central

    Ueda, Yuki; Kenzaka, Tsuneaki; Noda, Ayako; Yamamoto, Yu; Matsumura, Masami

    2015-01-01

    Introduction Kawasaki disease (KD) most commonly develops in infants, although its specific cause is still unclear. We report here a rare case of adult-onset KD which revealed to be concurrently infected by Coxsackievirus A4. Case presentation The patient was a 37-year-old Japanese man who presented with fever, exanthema, changes in the peripheral extremities, bilateral non-exudative conjunctival injection, and changes in the oropharynx, signs that meet the diagnostic criteria for KD defined by the Centers for Disease Control and Prevention. In this case, the patient had a significantly high antibody titer for Coxsackievirus A4, which led us to presume that the occurrence of KD was concurrent Coxsackievirus A4 infection. Conclusion We reported a very rare case of KD which suggests that the disease can be concurrent Coxsackievirus A4 infection. Although KD is an acute childhood disease, with fever as one of the principal features, KD should also be considered in the differential diagnosis when adult patients present with a fever of unknown cause associated with a rash. PMID:26491373

  9. QUANTITATIVE RISK ASSESSMENTS OF THE THREE CONTAMINANT CANDIDATE LIST (CCL) PATHOGENS: COXSACKIEVIRUS, CALICIVIRUS AND MYCOBACTERIUM AVIUM (MAC)

    EPA Science Inventory

    Quantitative dose-response and exposure data for Coxsackievirus and Norovirus (formerly Calicivirus) is limited. Appropriate surrogate data may be limited too. There are few or no animal or human dose-response and disease endpoint (severity, shedding, latency, immunity and susce...

  10. A real-time RT-PCR assay for rapid detection of coxsackievirus A10.

    PubMed

    Mu, C Y; Wang, A Y; Chen, C; Zhao, L; Li, Z

    2015-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) have been the primary causative agents of hand, foot, and mouth disease (HFMD) outbreaks in mainland China in the past. Hence, the surveillance of HFMD has mostly focused on these viruses. However, in recent years, coxsackievirus A10 (CA10) has also been associated with the increasing sporadic HFMD cases and outbreaks. Therefore, a sensitive assay for rapid detection of the CA10 RNA is necessary for disease control. Here, we have developed a specific TaqMan real-time RT-PCR assay by analyzing VP1 gene sequences of CA10 strains from different locations. The assay has been shown to be specific, sensitive, and robust through detection of other related viruses, standard curves, and clinical samples, respectively. This is the first report on development of a VP1 gene-based TaqMan real-time RT-PCR assay for rapid diagnosis of CA10 virus. PMID:26782393

  11. Inflammatory gene expression in Coxsackievirus B-4-infected human islets of Langerhans.

    PubMed

    Olsson, Annika; Johansson, Ulrika; Korsgren, Olle; Frisk, Gun

    2005-05-01

    The event that triggers the autoimmune destruction of insulin-producing beta-cells in type 1 diabetes mellitus (T1DM) is still unknown. Enterovirus, especially Coxsackievirus, infections have long been associated with this disease. Cytokines and chemokines induced by an enterovirus infection may act to trigger the autoimmune reactions that produce T1DM. Gene expression was examined in isolated human islets infected with a Coxsackievirus-B4 (CBV-4) strain causing lytic infection (V89-4557) and in islets infected with a CBV-4 strain establishing persistent infection (VD2921). Microarray analysis indicated that infection with the CBV-4 strains resulted in specific induction of a number of inflammatory genes, including IL-1beta, IL-6, IL-8, MCP-1, and RANTES. Importantly, the inflammatory genes induced by the CBV-4 infections differed in the two strains, with more cytokines being induced by the non-lytic CBV-4 strain than by the lytic strain. These cytokines and chemokines have the potential to rapidly induce inflammatory reactions when expressed in vivo and could contribute to the autoimmune reactions associated with the development of T1DM. PMID:15796921

  12. Recombinant dengue type 1 virus NS5 protein expressed in Escherichia coli exhibits RNA-dependent RNA polymerase activity.

    PubMed

    Tan, B H; Fu, J; Sugrue, R J; Yap, E H; Chan, Y C; Tan, Y H

    1996-02-15

    The complete nonstructural NS5 gene of dengue type 1 virus, Singapore strain S275/90 (D1-S275/90) was expressed in Escherichia coli as a glutathione S-transferase (GST) fusion protein (126 kDa). The GST-NS5 fusion protein was purified and the recombinant NS5 protein released from the fusion protein by thrombin cleavage. The recombinant NS5 had a predicted molecular weight of 100 kDa and reacted with antiserum against D1-S275/90 virus in Western blot analysis. The purified recombinant NS5 protein possessed RNA-dependent RNA polymerase activity which was inhibited (>99%) by antibodies against the recombinant NS5 protein. The polymerase product was shown to be a negative-stranded RNA molecule, of template size, which forms a double-stranded complex with the template RNA. PMID:8607261

  13. PARN deadenylase is involved in miRNA-dependent degradation of TP53 mRNA in mammalian cells

    PubMed Central

    Zhang, Xiaokan; Devany, Emral; Murphy, Michael R.; Glazman, Galina; Persaud, Mirjana; Kleiman, Frida E.

    2015-01-01

    mRNA deadenylation is under the control of cis-acting regulatory elements, which include AU-rich elements (AREs) and microRNA (miRNA) targeting sites, within the 3′ untranslated region (3′ UTRs) of eukaryotic mRNAs. Deadenylases promote miRNA-induced mRNA decay through their interaction with miRNA-induced silencing complex (miRISC). However, the role of poly(A) specific ribonuclease (PARN) deadenylase in miRNA-dependent mRNA degradation has not been elucidated. Here, we present evidence that not only ARE- but also miRNA-mediated pathways are involved in PARN-mediated regulation of the steady state levels of TP53 mRNA, which encodes the tumor suppressor p53. Supporting this, Argonaute-2 (Ago-2), the core component of miRISC, can coexist in complexes with PARN resulting in the activation of its deadenylase activity. PARN regulates TP53 mRNA stability through not only an ARE but also an adjacent miR-504/miR-125b-targeting site in the 3′ UTR. More importantly, we found that miR-125b-loaded miRISC contributes to the specific recruitment of PARN to TP53 mRNA, and that can be reverted by the ARE-binding protein HuR. Together, our studies provide new insights into the role of PARN in miRNA-dependent control of mRNA decay and into the mechanisms behind the regulation of p53 expression. PMID:26400160

  14. 3D Molecular Modelling Study of the H7N9 RNA-Dependent RNA Polymerase as an Emerging Pharmacological Target

    PubMed Central

    Vlachakis, Dimitrios

    2013-01-01

    Currently not much is known about the H7N9 strain, and this is the major drawback for a scientific strategy to tackle this virus. Herein, the 3D complex structure of the H7N9 RNA-dependent RNA polymerase has been established using a repertoire of molecular modelling techniques including homology modelling, molecular docking, and molecular dynamics simulations. Strikingly, it was found that the oligonucleotide cleft and tunnel in the H7N9 RNA-dependent RNA polymerase are structurally very similar to the corresponding region on the hepatitis C virus RNA-dependent RNA polymerase crystal structure. A direct comparison and a 3D postdynamics analysis of the 3D complex of the H7N9 RNA-dependent RNA polymerase provide invaluable clues and insight regarding the role and mode of action of a series of interacting residues on the latter enzyme. Our study provides a novel and efficiently intergraded platform with structural insights for the H7N9 RNA-dependent RNA Polymerase. We propose that future use and exploitation of these insights may prove invaluable in the fight against this lethal, ongoing epidemic. PMID:24187616

  15. Phage Display-Derived Cross-Reactive Neutralizing Antibody against Enterovirus 71 and Coxsackievirus A16.

    PubMed

    Zhang, Xiao; Sun, Chunyun; Xiao, Xiangqian; Pang, Lin; Shen, Sisi; Zhang, Jie; Cen, Shan; Yang, Burton B; Huang, Yuming; Sheng, Wang; Zeng, Yi

    2016-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are members of the Picornaviridae family and are considered the main causative agents of hand, foot and mouth disease (HFMD). In recent decades large HFMD outbreaks caused by EV71 and CVA16 have become significant public health concerns in the Asia-Pacific region. Vaccines and antiviral drugs are unavailable to prevent EV71 and CVA16 infection. In the current study, a chimeric antibody targeting a highly conserved peptide in the EV71 VP4 protein was isolated by using a phage display technique. The antibody showed cross-neutralizing capability against EV71 and CVA16 in vitro. The results suggest that this phage display-derived antibody will have great potential as a broad neutralizing antibody against EV71 and CVA16 after affinity maturation and humanization. PMID:26073737

  16. Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO

    SciTech Connect

    Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico

    2010-01-20

    Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.

  17. Release of Intracellular Calcium Stores Facilitates Coxsackievirus Entry into Polarized Endothelial Cells

    PubMed Central

    Bozym, Rebecca A.; Morosky, Stefanie A.; Kim, Kwang S.; Cherry, Sara; Coyne, Carolyn B.

    2010-01-01

    Group B coxsackieviruses (CVB) are associated with viral-induced heart disease and are among the leading causes of aseptic meningitis worldwide. Here we show that CVB entry into polarized brain microvasculature and aortic endothelial cells triggers a depletion of intracellular calcium stores initiated through viral attachment to the apical attachment factor decay-accelerating factor. Calcium release was dependent upon a signaling cascade that required the activity of the Src family of tyrosine kinases, phospholipase C, and the inositol 1,4,5-trisphosphate receptor isoform 3. CVB-mediated calcium release was required for the activation of calpain-2, a calcium-dependent cysteine protease, which controlled the vesicular trafficking of internalized CVB particles. These data point to a specific role for calcium signaling in CVB entry into polarized endothelial monolayers and highlight the unique signaling mechanisms used by these viruses to cross endothelial barriers. PMID:20949071

  18. Structure and chromosomal localization of the murine coxsackievirus and adenovirus receptor gene.

    PubMed

    Chen, Jin-Wen; Ghosh, Ruma; Finberg, Robert W; Bergelson, Jeffrey M

    2003-04-01

    We analyzed BAC genomic clones encoding the murine coxsackievirus and adenovirus receptor (mCAR). The mCAR gene is situated on the distal portion of murine chromosome 16, and is composed of at least eight exons, with intron-exon boundaries similar to those reported for the human CAR gene. We previously described two cDNAs encoding mCAR isoforms: the extracellular and transmembrane portions of both are encoded by exons 1-6; the cytoplasmic domain of mCAR 1 is encoded by exon 7, whereas mCAR 2 results from an RNA splice linking the proximal portion of exon 7 to an alternative exon 8. RT-PCR analysis of the mCAR RNA 5'-terminus suggests that transcription may begin 141-161 nucleotides upstream of the ATG translational start site. PMID:12823902

  19. MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/β-catenin signal pathways.

    PubMed

    Ye, Xin; Hemida, Maged Gomaa; Qiu, Ye; Hanson, Paul J; Zhang, Huifang Mary; Yang, Decheng

    2013-12-01

    Coxsackievirus B3 (CVB3) is one of the most prevalent causes of viral myocarditis and is associated with many other pathological conditions. CVB3 replication relies on host cellular machineries and causes direct damage to host cells. MicroRNAs have been found to regulate viral infections but their roles in CVB3 infection are still poorly understood. Here we describe a novel mechanism by which miR-126 regulates two signal pathways essential for CVB3 replication. We found that CVB3-induced ERK1/2 activation triggered the phosphorylation of ETS-1 and ETS-2 transcription factors, which induced miR-126 upregulation. By using both microRNA mimics and inhibitors, we proved that the upregulated miR-126 suppressed sprouty-related, EVH1 domain containing 1 (SPRED1) and in turn enhanced ERK1/2 activation. This positive feedback loop of ERK1/2-miR-126-ERK1/2 promoted CVB3 replication. Meanwhile, miR-126 expression stimulated GSK-3β activity and induced degradation of β-catenin through suppressing LRP6 and WRCH1, two newly identified targets in the Wnt/β-catenin pathway, which sensitized the cells to virus-induced cell death and increased viral progeny release to initiate new infections. Our results demonstrate that upregulated miR-126 upon CVB3 infection targets SPRED1, LRP6, and WRCH1 genes, mediating cross-talk between ERK1/2 and Wnt/β-catenin pathways, and thus promoting viral replication and contributes to the viral cytopathogenicity. PMID:23811937

  20. New Coxsackievirus B4 Genotype Circulating in Inner Mongolia Autonomous Region, China

    PubMed Central

    Gu, Suyi; Fan, Yaochun; Sun, Qiang; Zhang, Bo; Yan, Shaohong; Xu, Wenbo; Ma, Xueen; Wang, Wenrui

    2014-01-01

    Hand, foot, and mouth disease (HFMD) surveillance was initiated in the Inner Mongolia Autonomous Region of China in 2007, a crucial scrutiny for monitoring the prevalence of enterovirus serotypes associated with HFMD patients. However, this surveillance mostly focused on enterovirus 71 (EV-A71) and coxsackievirus A16; therefore, information on other enterovirus serotypes is limited. To identify the other circulating enterovirus serotypes in the HFMD outbreaks in Inner Mongolia in 2010, clinical samples from HFMD patients were investigated. Six coxsackievirus B4 (CVB4) strains were isolated and phylogenetic analyses of VP1 sequences were performed. Full-length genome sequences of two representative CVB4 isolates were acquired and similarity plot and bootscanning analyses were performed. The phylogenetic dendrogram indicated that all CVB4 strains could be divided into 5 genotypes (Genotypes I–V) with high bootstrap support (90–100%). The CVB4 prototype strain (JVB) was the sole member of genotype I. CVB4 strains belonging to genotype II, which were once common in Europe and the Americas, seemingly disappeared and gave way to genotype III and IV strains, which appear to be the dominant circulating strains in the world. All Chinese CVB4 strains belonged to Genotype V, a newly identified genotype supported by a high bootstrap value (100%), and are circulating only in mainland of China. Intertypic recombination occurred in the Chinese CVB4 strains with novel unknown serotype EV-B donor sequences. Two Chinese CVB4 strains had a virulent residue at position 129 of VP1, and one strain also had a virulent residue at position 16 of VP4. Increased surveillance is needed to monitor the emergence of new genetic lineages of enteroviruses in areas that are often associated with large-scale outbreaks. In addition, continued monitoring of enteroviruses by clinical surveillance and genetic characterization should be enhanced. PMID:24595311

  1. Immunological and biochemical characterizations of coxsackievirus A6 and A10 viral particles.

    PubMed

    Liu, Chia-Chyi; Guo, Meng-Shin; Wu, Shang-Rung; Lin, Hsiao-Yu; Yang, Ya-Ting; Liu, Wei-Chih; Chow, Yen-Hung; Shieh, Dar-Bin; Wang, Jen-Ren; Chong, Pele

    2016-05-01

    Childhood exanthema caused by different serotypes of coxsackievirus (CV-A) and enterovirus A71 (EV-A71) has become a serious global health problem; it is commonly known as hand, foot, and mouth disease (HFMD). Current EV-A71 vaccine clinical trials have demonstrated that human antibody responses generated by EV-A71 vaccinations do not cross-neutralize coxsackievirus A16 (CV-A16). An effective multivalent HFMD vaccine is urgently needed. From molecular epidemiological studies in Southeast Asia, CV-A6 and CV-A10 are commonly found in HFMD outbreaks. In this study, CV-A6 and CV-A10 were individually cultured in rhabdomyosarcoma (RD) cells grown in medium containing serum, harvested and concentrated. In viral downstream purification, two viral fractions were separated by sucrose gradient zonal ultracentrifugation and detected using a SDS-PAGE analysis and a virus infectivity assay. These two viral fractions were formalin-inactivated, and only the infectious particle fraction was found to be capable of inducing CV-A serotype-specific neutralizing antibody responses in animal immunogenicity studies. These mouse and rabbit antisera also failed to cross-neutralize EV-A71 and CV-A16 infections. Only a combination of formalin-inactivated EV-A71, CV-A6, CV-A10 and CV-A16 multivalent vaccine candidates elicited cross-neutralizing antibody responses in both mouse and rabbit immunogenicity studies. The current results certainly provide important information for multivalent HFMD vaccine development. PMID:26899790

  2. The Intracellular Domain of the Coxsackievirus and Adenovirus Receptor Differentially Influences Adenovirus Entry

    PubMed Central

    Loustalot, Fabien

    2015-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a cell adhesion molecule used as a docking molecule by some adenoviruses (AdVs) and group B coxsackieviruses. We previously proposed that the preferential transduction of neurons by canine adenovirus type 2 (CAV-2) is due to CAR-mediated internalization. Our proposed pathway of CAV-2 entry is in contrast to that of human AdV type 5 (HAdV-C5) in nonneuronal cells, where internalization is mediated by auxiliary receptors such as integrins. We therefore asked if in fibroblast-like cells the intracellular domain (ICD) of CAR plays a role in the internalization of the CAV-2 fiber knob (FKCAV), CAV-2, or HAdV-C5 when the capsid cannot engage integrins. Here, we show that in fibroblast-like cells, the CAR ICD is needed for FKCAV entry and efficient CAV-2 transduction but dispensable for HAdV-C5 and an HAdV-C5 capsid lacking the RGD sequence (an integrin-interacting motif) in the penton. Moreover, the deletion of the CAR ICD further impacts CAV-2 intracellular trafficking, highlighting the crucial role of CAR in CAV-2 intracellular dynamics. These data demonstrate that the CAR ICD contains sequences important for the recruitment of the endocytic machinery that differentially influences AdV cell entry. IMPORTANCE Understanding how viruses interact with the host cell surface and reach the intracellular space is of crucial importance for applied and fundamental virology. Here, we compare the role of a cell adhesion molecule (CAR) in the internalization of adenoviruses that naturally infect humans and Canidae. We show that the intracellular domain of CAR differentially regulates AdV entry and trafficking. Our study highlights the mechanistic differences that a receptor can have for two viruses from the same family. PMID:26136571

  3. Genomic organization and chromosomal localization of the human Coxsackievirus B-adenovirus receptor gene.

    PubMed

    Bowles, K R; Gibson, J; Wu, J; Shaffer, L G; Towbin, J A; Bowles, N E

    1999-10-01

    Myocarditis and dilated cardiomyopathy (DCM) are common causes of morbidity and mortality in children. Many studies have implicated the enteroviruses and, particularly, the Coxsackievirus-B family as etiologic agents of the acquired forms of these diseases. However, we have shown the group-C adenoviruses to be as commonly detected as enteroviruses in the myocardium of children and adults with these diseases. It has remained something of a conundrum why two such divergent virus families cause these diseases. The recent description of the common human Coxsackievirus B-adenovirus receptor (CAR) offers at least a partial explanation. In order to characterize the CAR gene, we screened a bacterial artificial chromosomal (BAC) library (RPCI11) using a polymerase chain reaction (PCR) product derived from the 3' end of the CAR cDNA sequence. This identified 13 BACs that were further characterized by PCR amplification of seven contiguous regions of the entire cDNA sequence. Eleven of the BACs were determined to encode pseudogenes while the other two BACs (131J5 and 246M1) encoded the presumed functional gene. PCR amplification of a monochromosomal hybrid panel indicated the presence of pseudogenes on chromosomes 15, 18, and 21 while the functional gene is encoded on chromosome 21. Fluorescence in situ hybridization analysis indicated that the gene is located at 21q11.2. DNA sequencing of BACs 131J5 and 246M1 revealed the presence of seven exons. The DNA sequences have been determined for each exon-intron boundary, and putative promoter sequences and transcription initiation sites identified. No consensus polyadenylation signal was identified. PMID:10543405

  4. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance with this part....

  5. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 4 2013-01-01 2013-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM (CONTINUED) RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance...

  6. Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway

    PubMed Central

    Vasale, Jessica J.; Gu, Weifeng; Thivierge, Caroline; Batista, Pedro J; Claycomb, Julie M.; Youngman, Elaine M.; Duchaine, Thomas F.; Mello, Craig C.; Conte, Darryl

    2010-01-01

    Argonaute (AGO) proteins interact with distinct classes of small RNAs to direct multiple regulatory outcomes. In many organisms, including plants, fungi, and nematodes, cellular RNA-dependent RNA polymerases (RdRPs) use AGO targets as templates for amplification of silencing signals. Here, we show that distinct RdRPs function sequentially to produce small RNAs that target endogenous loci in Caenorhabditis elegans. We show that DCR-1, the RdRP RRF-3, and the dsRNA-binding protein RDE-4 are required for the biogenesis of 26-nt small RNAs with a 5′ guanine (26G-RNAs) and that 26G-RNAs engage the Piwi-clade AGO, ERGO-1. Our findings support a model in which targeting by ERGO-1 recruits a second RdRP (RRF-1 or EGO-1), which in turn transcribes 22G-RNAs that interact with worm-specific AGOs (WAGOs) to direct gene silencing. ERGO-1 targets exhibit a nonrandom distribution in the genome and appear to include many gene duplications, suggesting that this pathway may control overexpression resulting from gene expansion. PMID:20133583

  7. OsGatB, the Subunit of tRNA-Dependent Amidotransferase, Is Required for Primary Root Development in Rice

    PubMed Central

    Qin, Cheng; Cheng, Linming; Zhang, Huanhuan; He, Meiling; Shen, Jingqin; Zhang, Yunhong; Wu, Ping

    2016-01-01

    A short-root rice mutant was isolated from an ethyl methane sulfonate-mutagenized library. From map-based cloning strategy, a point mutation, resulting in an amino acid change from proline to leucine, was identified in the fourth exon of a glutamyl-tRNA (Gln) amidotransferase B subunit family protein (OsGatB, LOC_Os11g34210). This gene is an ortholog of Arabidopsis GatB and yeast PET112. GatB is a subunit of tRNA-dependent amidotransferase (AdT), an essential enzyme involved in Gln-tRNAGln synthesis in mitochondria. Although previous studies have described that cessation in mitochondrial translation is lethal at very early developmental stages in plants, this point mutation resulted in a non-lethal phenotype of smaller root meristem and shorter root cell length. In the root, OsGatB was predominantly expressed in the root tip and played an important role in cell division and elongation there. OsGatB was localized in the mitochondria, and mitochondrial structure and function were all affected in Osgatb root tip cells. PMID:27200067

  8. Prognostic significance of RNA-dependent protein kinase (PKR) on non-small cell lung cancer patients

    PubMed Central

    Pataer, Abujiang; Raso, Maria Gabriela; Correa, Arlene M; Behrens, Carmen; Tsuta, Koji; Solis, Luisa; Fang, Bingliang; Roth, Jack A.; Wistuba, Ignacio I.; Swisher, Stephen G.

    2011-01-01

    Purpose The role of RNA-dependent protein kinase (PKR) in antiviral defence mechanisms and in cellular differentiation, growth, and apoptosis is well known, but the role of PKR in human lung cancer remains poorly understood. To explore the role of PKR in human lung cancer, we evaluated PKR’s expression in tissue microarray specimens from both non-small cell lung cancer (NSCLC) and normal human bronchial epithelium tissue. Experimental Design Tissue microarray samples (TMA-1) from 231 lung cancers were stained with PKR antibody and validated on TMA-2 from 224 lung cancers. Immunohistochemical expression score was quantified by three pathologists independently. Survival probability was computed by the Kaplan-Meier method. Results The NSCLC cells showed lower levels of PKR expression than normal bronchial epithelium cells did. We also found a significant association between lower levels of PKR expression and lymph node metastasis. We found that loss of PKR expression is correlated with a more aggressive behavior, and that a high PKR expression predicts a subgroup of patients with a favorable outcome. Univariate and multivariate Cox proportional hazards regression models showed that a lower level of PKR expression was significantly associated with shorter survival in NSCLC patients. We further validated and confirmed that PKR to be a powerful prognostic factor in TMA-2 lung cancer (HR=0.22, P<0.0001). Conclusions Our findings first indicate that PKR expression is an independent prognostic variable in NSCLC patients. PMID:20930042

  9. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    PubMed Central

    Ma, Ming-Yue; Lan, Xin-Ran

    2016-01-01

    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  10. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors

    PubMed Central

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G.; Frese, Michael; White, Peter A.; Strive, Tanja

    2016-01-01

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV. PMID:27089358

  11. Purification, crystallization and preliminary X-ray diffraction analysis of the RNA-dependent RNA polymerase from Thosea asigna virus.

    PubMed

    Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F; Verdaguer, Núria

    2012-10-01

    Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P2(1)2(1)2 and diffracts up to 2.1 Å and the RdRp-Lu(3+) derivative co-crystals belong to the C222(1) space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses. PMID:23027763

  12. Purification, crystallization and preliminary X-ray diffraction analysis of the RNA-dependent RNA polymerase from Thosea asigna virus

    PubMed Central

    Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F.; Verdaguer, Núria

    2012-01-01

    Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P21212 and diffracts up to 2.1 Å and the RdRp-Lu3+ derivative co-crystals belong to the C2221 space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses. PMID:23027763

  13. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus.

    PubMed

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A; Corman, Victor M; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  14. Heat shock 70 protein interaction with Turnip mosaic virus RNA-dependent RNA polymerase within virus-induced membrane vesicles

    SciTech Connect

    Dufresne, Philippe J.; Thivierge, Karine; Cotton, Sophie; Beauchemin, Chantal; Ide, Christine; Ubalijoro, Eliane; Laliberte, Jean-Francois Fortin, Marc G.

    2008-04-25

    Tandem affinity purification was used in Arabidopsis thaliana to identify cellular interactors of Turnip mosaic virus (TuMV) RNA-dependent RNA polymerase (RdRp). The heat shock cognate 70-3 (Hsc70-3) and poly(A)-binding (PABP) host proteins were recovered and shown to interact with the RdRp in vitro. As previously shown for PABP, Hsc70-3 was redistributed to nuclear and membranous fractions in infected plants and both RdRp interactors were co-immunoprecipitated from a membrane-enriched extract using RdRp-specific antibodies. Fluorescently tagged RdRp and Hsc70-3 localized to the cytoplasm and the nucleus when expressed alone or in combination in Nicotiana benthamiana. However, they were redistributed to large perinuclear ER-derived vesicles when co-expressed with the membrane binding 6K-VPg-Pro protein of TuMV. The association of Hsc70-3 with the RdRp could possibly take place in membrane-derived replication complexes. Thus, Hsc70-3 and PABP2 are potentially integral components of the replicase complex and could have important roles to play in the regulation of potyviral RdRp functions.

  15. Intronic regions of plant genes potentially encode RDR (RNA-dependent RNA polymerase)-dependent small RNAs

    PubMed Central

    Qin, Jingping; Ma, Xiaoxia; Yi, Zili; Tang, Zhonghai; Meng, Yijun

    2015-01-01

    Recent research has linked the non-coding intronic regions of plant genes to the production of small RNAs (sRNAs). Certain introns, called ‘mirtrons’ and ‘sirtrons’, could serve as the single-stranded RNA precursors for the generation of microRNA and small interfering RNA, respectively. However, whether the intronic regions could serve as the template for double-stranded RNA synthesis and then for sRNA biogenesis through an RDR (RNA-dependent RNA polymerase)-dependent pathway remains unclear. In this study, a genome-wide search was made for the RDR-dependent sRNA loci within the intronic regions of the Arabidopsis genes. Hundreds of intronic regions encoding three or more RDR-dependent sRNAs were found to be covered by dsRNA-seq (double-stranded RNA sequencing) reads, indicating that the intron-derived sRNAs were indeed generated from long double-stranded RNA precursors. More interestingly, phase-distributed sRNAs were discovered on some of the dsRNA-seq read-covered intronic regions, and those sRNAs were largely 24 nt in length. Based on these results, the opinion is put forward that the intronic regions might serve as the genomic origins for the RDR-dependent sRNAs. This opinion might add a novel layer to the current biogenesis model of the intron-derived sRNAs. PMID:25609829

  16. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors.

    PubMed

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G; Frese, Michael; White, Peter A; Strive, Tanja

    2016-04-01

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV. PMID:27089358

  17. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus

    PubMed Central

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A.; Corman, Victor M.; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  18. Backtracking behavior in viral RNA-dependent RNA polymerase provides the basis for a second initiation site

    PubMed Central

    Dulin, David; Vilfan, Igor D.; Berghuis, Bojk A.; Poranen, Minna M.; Depken, Martin; Dekker, Nynke H.

    2015-01-01

    Transcription in RNA viruses is highly dynamic, with a variety of pauses interrupting nucleotide addition by RNA-dependent RNA polymerase (RdRp). For example, rare but lengthy pauses (>20 s) have been linked to backtracking for viral single-subunit RdRps. However, while such backtracking has been well characterized for multi-subunit RNA polymerases (RNAPs) from bacteria and yeast, little is known about the details of viral RdRp backtracking and its biological roles. Using high-throughput magnetic tweezers, we quantify the backtracking by RdRp from the double-stranded (ds) RNA bacteriophage Φ6, a model system for RdRps. We characterize the probability of entering long backtracks as a function of force and propose a model in which the bias toward backtracking is determined by the base paring at the dsRNA fork. We further discover that extensive backtracking provides access to a new 3′-end that allows for the de novo initiation of a second RdRp. This previously unidentified behavior provides a new mechanism for rapid RNA synthesis using coupled RdRps and hints at a possible regulatory pathway for gene expression during viral RNA transcription. PMID:26496948

  19. OsGatB, the Subunit of tRNA-Dependent Amidotransferase, Is Required for Primary Root Development in Rice.

    PubMed

    Qin, Cheng; Cheng, Linming; Zhang, Huanhuan; He, Meiling; Shen, Jingqin; Zhang, Yunhong; Wu, Ping

    2016-01-01

    A short-root rice mutant was isolated from an ethyl methane sulfonate-mutagenized library. From map-based cloning strategy, a point mutation, resulting in an amino acid change from proline to leucine, was identified in the fourth exon of a glutamyl-tRNA (Gln) amidotransferase B subunit family protein (OsGatB, LOC_Os11g34210). This gene is an ortholog of Arabidopsis GatB and yeast PET112. GatB is a subunit of tRNA-dependent amidotransferase (AdT), an essential enzyme involved in Gln-tRNA(Gln) synthesis in mitochondria. Although previous studies have described that cessation in mitochondrial translation is lethal at very early developmental stages in plants, this point mutation resulted in a non-lethal phenotype of smaller root meristem and shorter root cell length. In the root, OsGatB was predominantly expressed in the root tip and played an important role in cell division and elongation there. OsGatB was localized in the mitochondria, and mitochondrial structure and function were all affected in Osgatb root tip cells. PMID:27200067

  20. Specific antigenic relationships between the RNA-dependent DNA polymerases of avian reticuloendotheliosis viruses and mammalian type C retroviruses.

    PubMed Central

    Bauer, G; Temin, H M

    1980-01-01

    Immunoglobulin G directed against the DNA polymerase of Rauscher murine leukemia virus (R-MuLV) could bind to 125I-labeled DNA polymerase of spleen necrosis virus (SNV), a member of the reticuloendotheliosis virus (REV) species. Competition radioimmunoassays showed the specificity of this cross-reaction. The antigenic determinants common to SNV and R-MuLV DNA polymerases were shared completely by the DNA polymerases of Gross MuLV, Moloney MuLV, RD 114 virus, REV-T, and duck infectious anemia virus. Baboon endogenous virus and chicken syncytial virus competed partially for antibodies directed against the common antigenic determinants of SNV and R-MuLV DNA polymerases. DNA polymerases of avian leukosis viruses, pheasant viruses, and mammalian type B and D retroviruses and particles with RNA-dependent DNA polymerase activity from the allantoic fluid of normal chicken eggs and from the medium of a goose cell culture did not compete for the antibodies directed against the common antigenic determinants of SNV and R-MuLV DNA polymerases. We also present data about a factor in normal mammalian immunoglobulin G that specifically inhibits the DNA polymerases of REV and mammalian type C retrovirus DNA polymerases. PMID:6154804

  1. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase.

    PubMed

    Ma, Ming-Yue; Lan, Xin-Ran; Niu, Deng-Ke

    2016-01-01

    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3' splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  2. Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus

    SciTech Connect

    Ghorai, Suvankar; Chakrabarti, Mrinmay; Roy, Sobhan; Chavali, Venkata Ramana Murthy; Bagchi, Abhisek; Ghosh, Ananta Kumar

    2010-08-15

    Genome segment 2 (S2) from Antheraea mylitta cypovirus (AmCPV) was converted into cDNA, cloned and sequenced. S2 consisted of 3798 nucleotides with a long ORF encoding a 1116 amino acid long protein (123 kDa). BLAST and phylogenetic analysis showed 29% sequence identity and close relatedness of AmCPV S2 with RNA dependent RNA polymerase (RdRp) of other insect cypoviruses, suggesting a common origin of all insect cypoviruses. The ORF of S2 was expressed as 123 kDa soluble His-tagged fusion protein in insect cells via baculovirus recombinants which exhibited RdRp activity in an in vitro RNA polymerase assay without any intrinsic terminal transferase activity. Maximum activity was observed at 37 deg. C at pH 6.0 in the presence of 3 mM MgCl{sub 2.} Site directed mutagenesis confirmed the importance of the conserved GDD motif. This is the first report of functional characterization of a cypoviral RdRp which may lead to the development of anti-viral agents.

  3. Identification of dengue viral RNA-dependent RNA polymerase inhibitor using computational fragment-based approaches and molecular dynamics study.

    PubMed

    Anusuya, Shanmugam; Velmurugan, Devadasan; Gromiha, M Michael

    2016-07-01

    Dengue is a major public health concern in tropical and subtropical countries of the world. There are no specific drugs available to treat dengue. Even though several candidates targeted both viral and host proteins to overcome dengue infection, they have not yet entered into the later stages of clinical trials. In order to design a drug for dengue fever, newly emerged fragment-based drug designing technique was applied. RNA-dependent RNA polymerase, which is essential for dengue viral replication is chosen as a drug target for dengue drug discovery. A cascade of methods, fragment screening, fragment growing, and fragment linking revealed the compound [2-(4-carbamoylpiperidin-1-yl)-2-oxoethyl]8-(1,3-benzothiazol-2-yl)naphthalene-1-carboxylate as a potent dengue viral polymerase inhibitor. Both strain energy and binding free energy calculations predicted that this could be a better inhibitor than the existing ones. Molecular dynamics simulation studies showed that the dengue polymerase-lead complex is stable and their interactions are consistent throughout the simulation. The hydrogen-bonded interactions formed by the residues Arg792, Thr794, Ser796, and Asn405 are the primary contributors for the stability and the rigidity of the polymerase-lead complex. This might keep the polymerase in closed conformation and thus inhibits viral replication. Hence, this might be a promising lead molecule for dengue drug designing. Further optimization of this lead molecule would result in a potent drug for dengue. PMID:26262439

  4. Phosphorylation of viral RNA-dependent RNA polymerase and its role in replication of a plus-strand RNA virus.

    PubMed

    Jakubiec, Anna; Tournier, Vincent; Drugeon, Gabrièle; Pflieger, Stéphanie; Camborde, Laurent; Vinh, Joëlle; Héricourt, François; Redeker, Virginie; Jupin, Isabelle

    2006-07-28

    Central to the process of plus-strand RNA virus genome amplification is the viral RNA-dependent RNA polymerase (RdRp). Understanding its regulation is of great importance given its essential function in viral replication and the common architecture and catalytic mechanism of polymerases. Here we show that Turnip yellow mosaic virus (TYMV) RdRp is phosphorylated, when expressed both individually and in the context of viral infection. Using a comprehensive biochemical approach, including metabolic labeling and mass spectrometry analyses, phosphorylation sites were mapped within an N-terminal PEST sequence and within the highly conserved palm subdomain of RNA polymerases. Systematic mutational analysis of the corresponding residues in a reverse genetic system demonstrated their importance for TYMV infectivity. Upon mutation of the phosphorylation sites, distinct steps of the viral cycle appeared affected, but in contrast to other plus-strand RNA viruses, the interaction between viral replication proteins was unaltered. Our results also highlighted the role of another TYMV-encoded replication protein as an antagonistic protein that may prevent the inhibitory effect of RdRp phosphorylation on viral infectivity. Based on these data, we propose that phosphorylation-dependent regulatory mechanisms are essential for viral RdRp function and virus replication. PMID:16717096

  5. dsRNA interference on expression of a RNA-dependent RNA polymerase gene of Bombyx mori cytoplasmic polyhedrosis virus.

    PubMed

    Pan, Zhong-Hua; Gao, Kun; Hou, Cheng-Xiang; Wu, Ping; Qin, Guang-Xing; Geng, Tao; Guo, Xi-Jie

    2015-07-01

    Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is one of the major viral pathogens in silkworm. Its infection often results in significant losses to sericulture. Studies have demonstrated that RNAi is one of the important anti-viral mechanisms in organisms. In this study, three dsRNAs targeting the RNA-dependent RNA polymerase (RDRP) gene of BmCPV were designed and synthesized with 2'-F modification to explore their interference effects on BmCPV replication in silkworm larvae. The results showed that injecting dsRNA in the dosage of 4-6 ng per mg body weight into the 5th instar larvae can interfere with the BmCPV-RDRP expression by 93% after virus infection and by 99.9% before virus infection. In addition, the expression of two viral structural protein genes (genome RNA segments 1 and 5) was also decreased with the decrease of RDRP expression, suggesting that RNAi interference of BmCPV-RDRP expression could affect viral replication. The study provides an effective method for investigating virus replication as well as the virus-host interactions in the silkworm larvae using dsRNA. PMID:25839934

  6. Inhibition of RNA binding to hepatitis C virus RNA-dependent RNA polymerase: a new mechanism for antiviral intervention

    PubMed Central

    Ahmed-Belkacem, Abdelhakim; Guichou, Jean-François; Brillet, Rozenn; Ahnou, Nazim; Hernandez, Eva; Pallier, Coralie; Pawlotsky, Jean-Michel

    2014-01-01

    The hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) is a key target for antiviral intervention. The goal of this study was to identify the binding site and unravel the molecular mechanism by which natural flavonoids efficiently inhibit HCV RdRp. Screening identified the flavonol quercetagetin as the most potent inhibitor of HCV RdRp activity. Quercetagetin was found to inhibit RdRp through inhibition of RNA binding to the viral polymerase, a yet unknown antiviral mechanism. X-ray crystallographic structure analysis of the RdRp-quercetagetin complex identified quercetagetin's binding site at the entrance of the RNA template tunnel, confirming its original mode of action. This antiviral mechanism was associated with a high barrier to resistance in both site-directed mutagenesis and long-term selection experiments. In conclusion, we identified a new mechanism for non-nucleoside inhibition of HCV RdRp through inhibition of RNA binding to the enzyme, a mechanism associated with broad genotypic activity and a high barrier to resistance. Our results open the way to new antiviral approaches for HCV and other viruses that use an RdRp based on RNA binding inhibition, that could prove to be useful in human, animal or plant viral infections. PMID:25053847

  7. Discovery of naturally occurring aurones that are potent allosteric inhibitors of hepatitis C virus RNA-dependent RNA polymerase

    PubMed Central

    Haudecoeur, Romain; Ahmed-Belkacem, Abdelhakim; Yi, Wei; Fortuné, Antoine; Brillet, Rozenn; Belle, Catherine; Nicolle, Edwige; Pallier, Coralie; Pawlotsky, Jean-Michel; Boumendjel, Ahcène

    2011-01-01

    We have identified naturally occurring 2-benzylidenebenzofuran-3-ones (aurones) as new templates for non-nucleoside hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) inhibitors. The aurone target site, identified by site-directed mutagenesis, is located in Thumb Pocket I of HCV RdRp. The RdRp inhibitory activity of 42 aurones was rationally explored in an enzyme assay. Molecular docking studies were used to determine how aurones bind to HCV RdRp and to predict their range of inhibitory activity. Seven aurone derivatives were found to have potent inhibitory effects on HCV RdRp, with IC50s below 5 μM and excellent selectivity. The most active aurone analogue was (Z)-2-((1-butyl-1H-indol-3-yl)methylene)-4,6-dihydroxybenzofuran-3(2H)-one (compound 51), with an IC50 of 2.2 μM. Their potent RdRp inhibitory activity, together with their low toxicity, make these molecules attractive candidate direct-acting anti-HCV agents. PMID:21699179

  8. Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication.

    PubMed

    Hodge, Kenneth; Tunghirun, Chairat; Kamkaew, Maliwan; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai; Chimnaronk, Sarin

    2016-08-12

    Dengue virus, an ∼10.7-kb positive-sense RNA virus, is the most common arthropod-communicated pathogen in the world. Despite dengue's clear epidemiological importance, mechanisms for its replication remain elusive. Here, we probed the entire dengue genome for interactions with viral RNA-dependent RNA polymerase (RdRp), and we identified the dominant interaction as a loop-forming ACAG motif in the 3' positive-stranded terminus, complicating the prevailing model of replication. A subset of interactions coincides with known flaviviral recombination sites inside the viral protein-coding region. Specific recognition of the RNA element occurs via an arginine patch in the C-terminal thumb domain of RdRp. We also show that the highly conserved nature of the consensus RNA motif may relate to its tolerance to various mutations in the interacting region of RdRp. Disruption of the interaction resulted in loss of viral replication ability in cells. This unique RdRp-RNA interface is found throughout flaviviruses, implying possibilities for broad disease interventions. PMID:27334920

  9. Relationships among the positive strand and double-strand RNA viruses as viewed through their RNA-dependent RNA polymerases.

    PubMed Central

    Bruenn, J A

    1991-01-01

    The sequences of 50 RNA-dependent RNA polymerases (RDRPs) from 43 positive strand and 7 double strand RNA (dsRNA) viruses have been compared. The alignment permitted calculation of distances among the 50 viruses and a resultant dendrogram based on every amino acid, rather than just those amino acids in the conserved motifs. Remarkably, a large subgroup of these viruses, including vertebrate, plant, and insect viruses, forms a single cluster whose only common characteristic is exploitation of insect hosts or vectors. This similarity may be due to molecular constraints associated with a present and/or past ability to infect insects and/or to common descent from insect viruses. If common descent is important, as it appears to be, all the positive strand RNA viruses of eucaryotes except for the picornaviruses may have evolved from an ancestral dsRNA virus. Viral RDRPs appear to be inherited as modules rather than as portions of single RNA segments, implying that RNA recombination has played an important role in their dissemination. PMID:2014162

  10. Seroepidemiology of Coxsackievirus A6, Coxsackievirus A16, and Enterovirus 71 Infections among Children and Adolescents in Singapore, 2008-2010

    PubMed Central

    Ang, Li Wei; Tay, Joanne; Phoon, Meng Chee; Hsu, Jung Pu; Cutter, Jeffery; James, Lyn; Goh, Kee Tai; Chow, Vincent Tak-Kwong

    2015-01-01

    Coxsackieviruses A6 (CV-A6) and A16 (CV-A16) and Enterovirus 71 (EV-A71) have caused periodic epidemics of hand, foot and mouth disease (HFMD) among children in Singapore. We conducted a cross-sectional study to estimate the seroprevalence of these enteroviruses among Singapore children and adolescents. The study was conducted between August 2008 and July 2010. It involved 700 Singapore residents aged 1–17 years whose residual sera were obtained following the completion of routine biochemical investigations in two public acute-care hospitals. The levels of neutralizing antibodies (NtAb) against CV-A6, CV-A16 and EV-A71 were analyzed by the microneutralization test. The age-specific geometric mean titer (GMT) of antibodies against each of the three enteroviruses and the 95% confidence intervals (CI) were calculated. The seroprevalence of CV-A6 and CV-A16 was high at 62.7% (95% CI: 59.1–66.2%) and 60.6% (95% CI: 56.9–64.1%), respectively. However, the seroprevalence of EV-A71 was significantly lower at 29.3% (95% CI: 26.0–32.8%). About 89.7% of the children and adolescents had been infected by at least one of the three enteroviruses by 13–17 years of age. About half (52.3%) were seropositive for two or all three enteroviruses, while only 16.1% had no NtAb against any of the three enteroviruses. High NtAb levels were observed in the younger age groups. CV-A6 and CV-A16 infections are very common among Singapore children and adolescents, while EV-A71 infections are less common. Infection is continually acquired from early childhood to adolescent age. PMID:26011735

  11. The Crystal Structure of a Cardiovirus RNA-Dependent RNA Polymerase Reveals an Unusual Conformation of the Polymerase Active Site

    PubMed Central

    Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J. M.

    2014-01-01

    ABSTRACT Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated

  12. CCA initiation boxes without unique promoter elements support in vitro transcription by three viral RNA-dependent RNA polymerases.

    PubMed Central

    Yoshinari, S; Nagy, P D; Simon, A E; Dreher, T W

    2000-01-01

    It has previously been observed that the only specific requirement for transcriptional initiation on viral RNA in vitro by the RNA-dependent RNA polymerase (RdRp) of turnip yellow mosaic virus is the CCA at the 3' end of the genome. We now compare the abilities of this RdRp, turnip crinkle virus RdRp, and Qbeta replicase, an enzyme capable of supporting the complete viral replication cycle in vitro, to transcribe RNA templates containing multiple CCA boxes but lacking specific viral sequences. Each enzyme is able to initiate transcription from several CCA boxes within these RNAs, and no special reaction conditions are required for these activities. The transcriptional yields produced from templates comprised of multiple CCA or CCCA repeats relative to templates derived from native viral RNA sequences vary between 2:1 and 0.1:1 for the different RdRps. Control of initiation by such redundant sequences presents a challenge to the specificity of viral transcription and replication. We identify 3'-preferential initiation and sensitivity to structural presentation as two specificity mechanisms that can limit initiation among potential CCA initiation sites. These two specificity mechanisms are used to different degrees by the three RdRps. The finding that three viral RdRps representing two of the three supergroups within the positive-strand RNA viral RdRp phylogeny support substantial transcription in the absence of unique promoters suggests that this phenomenon may be common among positive-strand viruses. A framework is presented arguing that replication of viral RNA in the absence of unique promoter elements is feasible. PMID:10836791

  13. Inhibitors of Foot and Mouth Disease Virus Targeting a Novel Pocket of the RNA-Dependent RNA Polymerase

    PubMed Central

    Cornelison, Ceili A.; Rai, Devendra K.; Matzek, Kayla B.; Leslie, Maxwell D.; Schafer, Elizabeth; Marchand, Bruno; Adedeji, Adeyemi; Michailidis, Eleftherios; Dorst, Christopher A.; Moran, Jennifer; Pautler, Christie; Rodriguez, Luis L.; McIntosh, Mark A.; Rieder, Elizabeth; Sarafianos, Stefan G.

    2010-01-01

    Background Foot-and-Mouth Disease Virus (FMDV) is a picornavirus that infects cloven-hoofed animals and leads to severe losses in livestock production. In the case of an FMD outbreak, emergency vaccination requires at least 7 days to trigger an effective immune response. There are currently no approved inhibitors for the treatment or prevention of FMDV infections. Methodology/Principal Findings Using a luciferase-based assay we screened a library of compounds and identified seven novel inhibitors of 3Dpol, the RNA-dependent RNA polymerase of FMDV. The compounds inhibited specifically 3Dpol (IC50s from 2-17 µM) and not other viral or bacterial polymerases. Enzyme kinetic studies on the inhibition mechanism by compounds 5D9 and 7F8 showed that they are non-competitive inhibitors with respect to NTP and nucleic acid substrates. Molecular modeling and docking studies into the 3Dpol structure revealed an inhibitor binding pocket proximal to, but distinct from the 3Dpol catalytic site. Residues surrounding this pocket are conserved among all 60 FMDV subtypes. Site directed mutagenesis of two residues located at either side of the pocket caused distinct resistance to the compounds, demonstrating that they indeed bind at this site. Several compounds inhibited viral replication with 5D9 suppressing virus production in FMDV-infected cells with EC50 = 12 µM and EC90 = 20 µM). Significance We identified several non-competitive inhibitors of FMDV 3Dpol that target a novel binding pocket, which can be used for future structure-based drug design studies. Such studies can lead to the discovery of even more potent antivirals that could provide alternative or supplementary options to contain future outbreaks of FMD. PMID:21203539

  14. Activation of double-stranded RNA-dependent protein kinase inhibits proliferation of pancreatic β-cells

    SciTech Connect

    Chen, Shan-Shan; Jiang, Teng; Wang, Yi; Gu, Li-Ze; Wu, Hui-Wen; Tan, Lan; Guo, Jun

    2014-01-17

    Highlights: •PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in β-cells. •Activated PKR inhibited β-cell proliferation by arresting cell cycle at G1 phase. •Activated PKR fully abrogated the pro-proliferative effects of IGF-I on β-cells. -- Abstract: Double-stranded RNA-dependent protein kinase (PKR) is revealed to participate in the development of insulin resistance in peripheral tissues in type 2 diabetes (T2DM). Meanwhile, PKR is also characterized as a critical regulator of cell proliferation. To date, no study has focused on the impact of PKR on the proliferation of pancreatic β-cells. Here, we adopted insulinoma cell lines and mice islet β-cells to investigate: (1) the effects of glucolipotoxicity and pro-inflammatory cytokines on PKR activation; (2) the effects of PKR on proliferation of pancreatic β-cells and its underlying mechanisms; (3) the actions of PKR on pro-proliferative effects of IGF-I and its underlying pathway. Our results provided the first evidence that PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in pancreatic β-cells, and activated PKR significantly inhibited cell proliferation by arresting cell cycle at G1 phase. Reductions in cyclin D1 and D2 as well as increases in p27 and p53 were associated with the anti-proliferative effects of PKR, and proteasome-dependent degradation took part in the reduction of cyclin D1 and D2. Besides, PKR activation abrogated the pro-proliferative effects of IGF-I by activating JNK and disrupting IRS1/PI3K/Akt signaling pathway. These findings indicate that the anti-proliferative actions of PKR on pancreatic β-cells may contribute to the pathogenesis of T2DM.

  15. RNA-dependent protein kinase (PKR) depletes nutrients, inducing phosphorylation of AMP-activated kinase in lung cancer.

    PubMed

    Guo, Chengcheng; Hao, Chuncheng; Shao, RuPing; Fang, Bingliang; Correa, Arlene M; Hofstetter, Wayne L; Roth, Jack A; Behrens, Carmen; Kalhor, Neda; Wistuba, Ignacio I; Swisher, Stephen G; Pataer, Apar

    2015-05-10

    We have demonstrated that RNA-dependent protein kinase (PKR) and its downstream protein p-eIF2α are independent prognostic markers for overall survival in lung cancer. In the current study, we further investigate the interaction between PKR and AMPK in lung tumor tissue and cancer cell lines. We examined PKR protein expression in 55 frozen primary lung tumor tissues by Western blotting and analyzed the association between PKR expression and expression of 139 proteins on tissue samples examined previously by Reverse Phase Protein Array (RPPA) from the same 55 patients. We observed that biomarkers were either positively (phosphorylated AMP-activated kinase(T172) [p-AMPK]) or negatively (insulin receptor substrate 1, meiotic recombination 11, ATR interacting protein, telomerase, checkpoint kinase 1, and cyclin E1) correlated with PKR. We further confirmed that induction of PKR with expression vectors in lung cancer cells causes activation of the AMPK protein independent of the LKB1, TAK1, and CaMKKβ pathway. We found that PKR causes nutrient depletion, which increases AMP levels and decreases ATP levels, causing AMPK phosphorylation. We further demonstrated that inhibiting AMPK expression with compound C or siRNA enhanced PKR-mediated cell death. We next explored the combination of PKR and p-AMPK expression in NSCLC patients and observed that expression of p-AMPK predicted a poor outcome for adenocarcinoma patients with high PKR expression and a better prognosis for those with low PKR expression. These findings were consistent with our in vitro results. AMPK might rescue cells facing metabolic stresses, such as ATP depletion caused by PKR. Our data indicate that PKR causes nutrient depletion, which induces the phosphorylation of AMPK. AMPK might act as a protective response to metabolic stresses, such as nutrient deprivation. PMID:25798539

  16. MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant.

    PubMed

    Lu, Cheng; Kulkarni, Karthik; Souret, Frédéric F; MuthuValliappan, Ramesh; Tej, Shivakundan Singh; Poethig, R Scott; Henderson, Ian R; Jacobsen, Steven E; Wang, Wenzhong; Green, Pamela J; Meyers, Blake C

    2006-10-01

    The Arabidopsis genome contains a highly complex and abundant population of small RNAs, and many of the endogenous siRNAs are dependent on RNA-Dependent RNA Polymerase 2 (RDR2) for their biogenesis. By analyzing an rdr2 loss-of-function mutant using two different parallel sequencing technologies, MPSS and 454, we characterized the complement of miRNAs expressed in Arabidopsis inflorescence to considerable depth. Nearly all known miRNAs were enriched in this mutant and we identified 13 new miRNAs, all of which were relatively low abundance and constitute new families. Trans-acting siRNAs (ta-siRNAs) were even more highly enriched. Computational and gel blot analyses suggested that the minimal number of miRNAs in Arabidopsis is approximately 155. The size profile of small RNAs in rdr2 reflected enrichment of 21-nt miRNAs and other classes of siRNAs like ta-siRNAs, and a significant reduction in 24-nt heterochromatic siRNAs. Other classes of small RNAs were found to be RDR2-independent, particularly those derived from long inverted repeats and a subset of tandem repeats. The small RNA populations in other Arabidopsis small RNA biogenesis mutants were also examined; a dcl2/3/4 triple mutant showed a similar pattern to rdr2, whereas dcl1-7 and rdr6 showed reductions in miRNAs and ta-siRNAs consistent with their activities in the biogenesis of these types of small RNAs. Deep sequencing of mutants provides a genetic approach for the dissection and characterization of diverse small RNA populations and the identification of low abundance miRNAs. PMID:16954541

  17. Cyclic peptides identified by phage display are competitive inhibitors of the tRNA-dependent amidotransferase of Helicobacter pylori.

    PubMed

    Pham, Van Hau; Maaroufi, Halim; Levesque, Roger C; Lapointe, Jacques

    2016-05-01

    In Helicobacter pylori, the heterotrimeric tRNA-dependent amidotransferase (GatCAB) is essential for protein biosynthesis because it catalyzes the conversion of misacylated Glu-tRNA(Gln) and Asp-tRNA(Asn) into Gln-tRNA(Gln) and Asn-tRNA(Asn), respectively. In this study, we used a phage library to identify peptide inhibitors of GatCAB. A library displaying loop-constrained heptapeptides was used to screen for phages binding to the purified GatCAB. To optimize the probability of obtaining competitive inhibitors of GatCAB with respect to its substrate Glu-tRNA(Gln), we used that purified substrate in the biopanning process of the phage-display technique to elute phages bound to GatCAB at the third round of the biopanning process. Among the eluted phages, we identified several that encode cyclic peptides rich in Trp and Pro that inhibit H. pylori GatCAB in vitro. Peptides P10 and P9 were shown to be competitive inhibitors of GatCAB with respect to its substrate Glu-tRNA(Gln), with Ki values of 126 and 392μM, respectively. The docking models revealed that the Trp residues of these peptides form π-π stacking interactions with Tyr81 of the synthetase active site, as does the 3'-terminal A76 of tRNA, supporting their competitive behavior with respect to Glu-tRNA(Gln) in the transamidation reaction. These peptides can be used as scaffolds in the search for novel antibiotics against the pathogenic bacteria that require GatCAB for Gln-tRNA(Gln) and/or Asn-tRNA(Asn) formation. PMID:26976271

  18. Identification of a Pyridoxine-Derived Small-Molecule Inhibitor Targeting Dengue Virus RNA-Dependent RNA Polymerase.

    PubMed

    Xu, Hong-Tao; Colby-Germinario, Susan P; Hassounah, Said; Quashie, Peter K; Han, Yingshan; Oliveira, Maureen; Stranix, Brent R; Wainberg, Mark A

    2016-01-01

    The viral RNA-dependent RNA polymerase (RdRp) activity of the dengue virus (DENV) NS5 protein is an attractive target for drug design. Here, we report the identification of a novel class of inhibitor (i.e., an active-site metal ion chelator) that acts against DENV RdRp activity. DENV RdRp utilizes a two-metal-ion mechanism of catalysis; therefore, we constructed a small library of compounds, through mechanism-based drug design, aimed at chelating divalent metal ions in the catalytic site of DENV RdRp. We now describe a pyridoxine-derived small-molecule inhibitor that targets DENV RdRp and show that 5-benzenesulfonylmethyl-3-hydroxy-4-hydroxymethyl-pyridine-2-carboxylic acid hydroxyamide (termed DMB220) inhibited the RdRp activity of DENV serotypes 1 to 4 at low micromolar 50% inhibitory concentrations (IC50s of 5 to 6.7 μM) in an enzymatic assay. The antiviral activity of DMB220 against DENV infection was also verified in a cell-based assay and showed a 50% effective concentration (EC50) of <3 μM. Enzyme assays proved that DMB220 was competitive with nucleotide incorporation. DMB220 did not inhibit the enzymatic activity of recombinant HIV-1 reverse transcriptase and showed only weak inhibition of HIV-1 integrase strand transfer activity, indicating high specificity for DENV RdRp. S600T substitution in the DENV RdRp, which was previously shown to confer resistance to nucleoside analogue inhibitors (NI), conferred 3-fold hypersusceptibility to DMB220, and enzymatic analyses showed that this hypersusceptibility may arise from the decreased binding/incorporation efficiency of the natural NTP substrate without significantly impacting inhibitor binding. Thus, metal ion chelation at the active site of DENV RdRp represents a viable anti-DENV strategy, and DMB220 is the first of a new class of DENV inhibitor. PMID:26574011

  19. Identification of a Pyridoxine-Derived Small-Molecule Inhibitor Targeting Dengue Virus RNA-Dependent RNA Polymerase

    PubMed Central

    Xu, Hong-Tao; Colby-Germinario, Susan P.; Hassounah, Said; Quashie, Peter K.; Han, Yingshan; Oliveira, Maureen; Stranix, Brent R.

    2015-01-01

    The viral RNA-dependent RNA polymerase (RdRp) activity of the dengue virus (DENV) NS5 protein is an attractive target for drug design. Here, we report the identification of a novel class of inhibitor (i.e., an active-site metal ion chelator) that acts against DENV RdRp activity. DENV RdRp utilizes a two-metal-ion mechanism of catalysis; therefore, we constructed a small library of compounds, through mechanism-based drug design, aimed at chelating divalent metal ions in the catalytic site of DENV RdRp. We now describe a pyridoxine-derived small-molecule inhibitor that targets DENV RdRp and show that 5-benzenesulfonylmethyl-3-hydroxy-4-hydroxymethyl-pyridine-2-carboxylic acid hydroxyamide (termed DMB220) inhibited the RdRp activity of DENV serotypes 1 to 4 at low micromolar 50% inhibitory concentrations (IC50s of 5 to 6.7 μM) in an enzymatic assay. The antiviral activity of DMB220 against DENV infection was also verified in a cell-based assay and showed a 50% effective concentration (EC50) of <3 μM. Enzyme assays proved that DMB220 was competitive with nucleotide incorporation. DMB220 did not inhibit the enzymatic activity of recombinant HIV-1 reverse transcriptase and showed only weak inhibition of HIV-1 integrase strand transfer activity, indicating high specificity for DENV RdRp. S600T substitution in the DENV RdRp, which was previously shown to confer resistance to nucleoside analogue inhibitors (NI), conferred 3-fold hypersusceptibility to DMB220, and enzymatic analyses showed that this hypersusceptibility may arise from the decreased binding/incorporation efficiency of the natural NTP substrate without significantly impacting inhibitor binding. Thus, metal ion chelation at the active site of DENV RdRp represents a viable anti-DENV strategy, and DMB220 is the first of a new class of DENV inhibitor. PMID:26574011

  20. The Application B3LYP to Large Systems

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W.; Arnold, James O. (Technical Monitor)

    1996-01-01

    The application of density functional theory (DFT), using the B3LYP functional, to a series of chemical problems is described. The first involves the calculation of silica-adsorbate bond energies, including both chemical bonds and weak hydrogen bonding. The calculation of vibrational frequencies for large organic systems is discussed. For the closed shell neutral systems, the B3LYP results are similar to the self- consistent- field results, however, for the positive ions, only the B3LYP level of theory is accurate and sufficiently inexpensive to allow the study of large systems. The final application involves the calculation of successive metal-ligand bond energies. The B3LYP bond energies and entropies are shown to be in good agreement with experiment.

  1. Double stranded RNA-dependent protein kinase is involved in osteoclast differentiation of RAW264.7 cells in vitro

    SciTech Connect

    Teramachi, Junpei; Morimoto, Hiroyuki; Baba, Ryoko; Doi, Yoshiaki; Hirashima, Kanji; Haneji, Tatsuji

    2010-11-15

    Double-stranded RNA-dependent protein kinase (PKR) plays a critical role in antiviral defence of the host cells. PKR is also involved in cell cycle progression, cell proliferation, cell differentiation, tumorigenesis, and apoptosis. We previously reported that PKR is required for differentiation and calcification of osteoblasts. However, it is unknown about the role of PKR in osteoclast differentiation. A dominant-negative PKR mutant cDNA, in which the amino acid lysine at 296 was replaced with arginine, was transfected into RAW264.7 cells. We have established the cell line that stably expresses the PKR mutant gene (PKR-K/R). Phosphorylation of PKR and {alpha}-subunit of eukaryotic initiation factor 2 was not stimulated by polyinosic-polycytidylic acid in the PKR-K/R cells. RANKL stimulated the formation of TRAP-positive multinuclear cells in RAW264.7 cells. However, TRAP-positive multinuclear cells were not formed in the PKR-K/R cells even when the cells were stimulated with higher doses of RANKL. A specific inhibitor of PKR, 2-aminopurine, also suppressed the RANKL-induced osteoclast differentiation in RAW264.7 cells. The expression of macrophage fusion receptor and dendritic cell-specific transmembrane protein significantly decreased in the PKR-K/R cells by real time PCR analysis. The results of RT-PCR revealed that the mRNA expression of osteoclast markers (cathepsin K and calcitonin receptor) was suppressed in the PKR-K/R cells and RAW264.7 cells treated with 2-aminopurine. Expression of NF-{kappa}B protein was suppressed in the PKR-K/R cells and 2-aminopurine-treated RAW264.7 cells. The level of STAT1 protein expression was elevated in the PKR-K/R cells compared with that of the wild-type cells. Immunohistochemical study showed that PKR was localized in osteoclasts of metatarsal bone of newborn mouse. The finding that the PKR-positive multinuclear cells should be osteoclasts was confirmed by TRAP-staining. Our present study indicates that PKR plays important

  2. A pyrazolotriazolopyrimidinamine inhibitor of bovine viral diarrhea virus replication that targets the viral RNA-dependent RNA polymerase.

    PubMed

    Paeshuyse, Jan; Letellier, Carine; Froeyen, Matheus; Dutartre, Hélène; Vrancken, Robert; Canard, Bruno; De Clercq, Erik; Gueiffier, Alain; Teulade, Jean-Claude; Herdewijn, Piet; Puerstinger, Gerhard; Koenen, Frank; Kerkhofs, Pierre; Baraldi, Pier Giovanni; Neyts, Johan

    2009-06-01

    [7-[3-(1,3-Benzodioxol-5-yl)propyl]-2-(2-furyl)-7H-pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine] (LZ37) was identified as a selective inhibitor of in vitro bovine viral diarrhea virus (BVDV) replication. The EC(50) values for inhibition of BVDV-induced cytopathic effect (CPE) formation, viral RNA synthesis and production of infectious virus were 4.3+/-0.7microM, 12.9+/-1microM and 5.8+/-0.6microM, respectively. LZ37 proved inactive against the hepatitis C virus and the flavivirus yellow fever. LZ37 inhibits BVDV replication at a time point that coincides with the onset of intracellular viral RNA synthesis. Drug-resistant mutants carried the F224Y mutation in the viral RNA-dependent RNA polymerase (RdRp). LZ37 showed cross-resistance with the imidazopyrrolopyridine AG110 [which selects for the E291G drug resistance mutation] as well as with the imidazopyridine BPIP [which selects for the F224S drug-resistant mutation]. LZ37 did not inhibit the in vitro activity of purified recombinant BVDV RdRp. Molecular modelling revealed that F224 is located near the tip of the finger domain of the RdRp. Docking of LZ37 in the crystal structure of the BVDV RdRp revealed several potential contacts including: (i) hydrophobic contacts of LZ37 with A221, A222, G223, F224 and A392; (ii) a stacking interaction between F224 side chain and the ring system of LZ37 and (iii) a hydrogen bond between the amino function of LZ37 and the O backbone atom of A392. It is concluded that LZ37 interacts with the same binding site as BPIP or VP32947 at the top of the finger domain of the polymerase that is a "hot spot" for inhibition of pestivirus replication. PMID:19428605

  3. Small RNA Deep Sequencing Reveals Role for Arabidopsis thaliana RNA-Dependent RNA Polymerases in Viral siRNA Biogenesis

    PubMed Central

    Qi, Xiaopeng; Bao, Forrest Sheng; Xie, Zhixin

    2009-01-01

    RNA silencing functions as an important antiviral defense mechanism in a broad range of eukaryotes. In plants, biogenesis of several classes of endogenous small interfering RNAs (siRNAs) requires RNA-dependent RNA Polymerase (RDR) activities. Members of the RDR family proteins, including RDR1and RDR6, have also been implicated in antiviral defense, although a direct role for RDRs in viral siRNA biogenesis has yet to be demonstrated. Using a crucifer-infecting strain of Tobacco Mosaic Virus (TMV-Cg) and Arabidopsis thaliana as a model system, we analyzed the viral small RNA profile in wild-type plants as well as rdr mutants by applying small RNA deep sequencing technology. Over 100,000 TMV-Cg-specific small RNA reads, mostly of 21- (78.4%) and 22-nucleotide (12.9%) in size and originating predominately (79.9%) from the genomic sense RNA strand, were captured at an early infection stage, yielding the first high-resolution small RNA map for a plant virus. The TMV-Cg genome harbored multiple, highly reproducible small RNA-generating hot spots that corresponded to regions with no apparent local hairpin-forming capacity. Significantly, both the rdr1 and rdr6 mutants exhibited globally reduced levels of viral small RNA production as well as reduced strand bias in viral small RNA population, revealing an important role for these host RDRs in viral siRNA biogenesis. In addition, an informatics analysis showed that a large set of host genes could be potentially targeted by TMV-Cg-derived siRNAs for posttranscriptional silencing. Two of such predicted host targets, which encode a cleavage and polyadenylation specificity factor (CPSF30) and an unknown protein similar to translocon-associated protein alpha (TRAP α), respectively, yielded a positive result in cleavage validation by 5′RACE assays. Our data raised the interesting possibility for viral siRNA-mediated virus-host interactions that may contribute to viral pathogenicity and host specificity. PMID:19308254

  4. A Novel, Highly Selective Inhibitor of Pestivirus Replication That Targets the Viral RNA-Dependent RNA Polymerase

    PubMed Central

    Paeshuyse, Jan; Leyssen, Pieter; Mabery, Eric; Boddeker, Nina; Vrancken, Robert; Froeyen, Matheus; Ansari, Israrul H.; Dutartre, Hélène; Rozenski, Jef; Gil, Laura H. V. G.; Letellier, Carine; Lanford, Robert; Canard, Bruno; Koenen, Frank; Kerkhofs, Pierre; Donis, Ruben O.; Herdewijn, Piet; Watson, Julia; De Clercq, Erik; Puerstinger, Gerhard; Neyts, Johan

    2006-01-01

    We report on the highly potent and selective antipestivirus activity of 5-[(4-bromophenyl)methyl]-2-phenyl-5H-imidazo[4,5-c]pyridine (BPIP). The 50% effective concentration (EC50) for inhibition of bovine viral diarrhea virus (BVDV)-induced cytopathic effect formation was 0.04 ± 0.01 μM. Comparable reduction of viral RNA synthesis (EC50 = 0.12 ± 0.02 μM) and production of infectious virus (EC50 = 0.074 ± 0.003 μM) were observed. The selectivity index (ratio of 50% cytostatic concentration/EC50) of BPIP was ∼2,000. BPIP was inactive against the hepatitis C virus subgenomic replicon and yellow fever virus but demonstrated weak activity against GB virus. Drug-resistant mutants were at least 300-fold less susceptible to BPIP than wild-type virus; showed cross-resistance to N-propyl-N-[2-(2H-1,2,4-triazino[5,6-b]indol-3-ylthio)ethyl]-1-propanamine (VP32947), and carried the F224S mutation in the viral RNA-dependent RNA polymerase (RdRp). When the F224S mutation was introduced into an infectious clone, the drug-resistant phenotype was obtained. BPIP did not inhibit the in vitro activity of recombinant BVDV RdRp, but did inhibit the activity of replication complexes (RCs). Computational docking revealed that F224 is located at the top of the finger domain of the polymerase. Docking of BPIP in the crystal structure of the BVDV RdRp revealed aromatic ring stacking, some hydrophobic contacts, and a hydrogen bond. Since two structurally unrelated compounds, i.e., BPIP and VP32947, target the same region of the BVDV RdRp, this position may be expected to be critical in the functioning of the polymerase or assembly of the RC. The potential of BPIP for the treatment of pestivirus and hepacivirus infections is discussed. PMID:16352539

  5. The hepatitis C virus core protein can modulate RNA-dependent RNA synthesis by the 2a polymerase

    PubMed Central

    Wen, Y.; Cheng Kao, C.

    2014-01-01

    RNA replication enzymes are multi-subunit protein complexes whose activity can be modulated by other viral and cellular factors. For genotype 1b Hepatitis C virus (HCV), the RNA-dependent RNA polymerase (RdRp) subunit of the replicase, NS5B, has been reported to interact with the HCV Core protein to decrease RNA synthesis (Kang et al., 2009). Here we used a cell-based assay for RNA synthesis to examine the Core–NS5B interaction of genotype 2a HCV. Unlike the 1b NS5B, the activity of the 2a NS5B was stimulated by the Core protein. Using the bimolecular fluorescence complementation assay, the 2a Core co-localized with 2a NS5B when they were transiently expressed in cells. The two proteins can form a coimmunoprecipitable complex. Deletion analysis showed that the N-terminal 75 residues of 2a Core were required to contact 2a NS5B to modulate its activity. The C-terminal transmembrane helix of 2a NS5B also contributes to the interaction with the 2a Core. To determine the basis for the differential effects of the Core–RdRp interaction, we found that the 2a RdRp activity was enhanced by both the 1b Core and 2a Core. However, the 1b NS5B activity was slightly inhibited by either Core protein. The replication of the 2a JFH-1 replicon was increased by co-expressed 2a Core while the genotype 1b Con1 replicon was not significantly affected by the corresponding Core. Mutations in 2a NS5B that affected the closed RdRp structure were found to be less responsive to 2a Core. Finally, we determined that RNA synthesis by the RdRps from genotypes 2a, 3a and 4a HCV were increased by the Core proteins from HCV of genotypes 1–4. These results reveal another difference between RNA syntheses by the different genotype RdRps and add additional examples of a viral structural protein regulating viral RNA synthesis. PMID:24874198

  6. Evaluation of the inactivation of human Coxsackievirus by thermophilic and mesophilic anaerobic digestion using integrated cell culture and reverse transcription real-time quantitative PCR.

    PubMed

    Gao, Tiejun; Tong, Yupin; Cao, Ming; Li, Xiaomei; Pang, Xiaoli

    2013-09-01

    The virucidal effects of anaerobic digestion were evaluated using human Coxsackievirus as a model for the Enterovirus family. Coxsackievirus was inactivated completely by thermophilic anaerobic digestion (TAD). By 4 h no living and infectious virus remained and no detectable viral RNA was present after 2 days in TAD (7.0 log reduction). Compared to TAD, 2.6 log reduction of viral RNA was achieved by 14 days in mesophilic anaerobic digestion (MAD) (p < 0.0001). Although cytopathogenic effect was not observed in the cultured cells, low levels of intracellular viral RNA were detected after one day of MAD treatment indicating that Coxsackievirus had infected the cells but could not replicate. The combination of thermal and biochemical effects in TAD plays a critical role for viral disinfection. The results of this study indicate that selection of the right configuration of anaerobic digestion for treatment of biowaste may reduce the risk of viral contamination to the environment and water source. PMID:23764576

  7. Symmetry Breaking and the B3LYP Functional

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Hudgins, Douglas M.; Allamandola, Louis J.; Arnold, James O. (Technical Monitor)

    1999-01-01

    The infrared spectra of six molecules, each of which contains a five-membered ring, and their cations are determined using density functional theory (DFT); both the B3LYP and BP86 functionals are used. The computed results are compared with the experimental spectra. For the neutral molecules, both methods are in good agreement with experiment. Even the Hartree-Fock (HF) approach is qualitatively correct for the neutrals. For the cations, the HF approach fails, as found for other organic ring systems. The B3LYP and BP86 approaches are in good mutual agreement for five of the six cation spectra, and in good agreement with experiment for four of the five cations where the experimental spectra are available. It is only for the fluoranthene cation, where the BP86 and B3LYP functionals yield different results; the BP86 yields the expected C2v symmetry, while the B3LYP approach breaks symmetry. The experimental spectra supports the BP86 spectra over the B3LYP, but the quality of the experimental spectra does not allow a critical evaluation of the accuracy of the BP86 approach for this difficult system.

  8. Complete genome analysis of coxsackievirus A24 isolated in Yunnan, China, in 2013.

    PubMed

    Zhao, Yilin; Liu, Jiansheng; Zhang, Haihao; Guo, Chen; Xia, Longhui; Yang, Fang; Yang, Huai; Yang, Qinxing; Yang, Zhaoqing; Ma, Shaohui

    2016-06-01

    Human coxsackievirus A24 (CVA24) belongs to the species Enterovirus C, and variants of this virus frequently cause acute hemorrhagic conjunctivitis (AHC). The complete genome of the K282/YN/CHN/2013 strain, isolated from a healthy child in Yunnan, China, in 2013, is reported here for the first time. The strain showed 80.0 % and 79.9 % nucleotide sequence identity to CVA24 prototype strain Joseph and CVA24 variant prototype EH24, respectively. The K282/YN/CHN/2013 strain belongs to the CVA24 serotype. Twelve amino acid differences, most of which are in structural regions, were found between the CVA24 and CVA24v strains. In the whole-length genome sequence, only the structural region of K282/YN/CHN/2013 was similar to that of the CVA24 strains; the other genome regions were more similar to those of other members of the species Enterovirus C. Recombination analysis showed evidence of recombination with other viruses of the same species. PMID:26935916

  9. Protection Against Type 1 Diabetes Upon Coxsackievirus B4 Infection and iNKT-Cell Stimulation

    PubMed Central

    Ghazarian, Liana; Diana, Julien; Beaudoin, Lucie; Larsson, Pär G.; Puri, Raj K.; van Rooijen, Nico; Flodström-Tullberg, Malin; Lehuen, Agnès

    2013-01-01

    Invariant natural killer T (iNKT) cells belong to the innate immune system and exercise a dual role as potent regulators of autoimmunity and participate in responses against different pathogens. They have been shown to prevent type 1 diabetes development and to promote antiviral responses. Many studies in the implication of environmental factors on the etiology of type 1 diabetes have suggested a link between enteroviral infections and the development of this disease. This study of the pancreatropic enterovirus Coxsackievirus B4 (CVB4) shows that although infection accelerated type 1 diabetes development in a subset of proinsulin 2–deficient NOD mice, the activation of iNKT cells by a specific agonist, α-galactosylceramide, at the time of infection inhibited the disease. Diabetes development was associated with the infiltration of pancreatic islets by inflammatory macrophages, producing high levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α and activation of anti-islet T cells. On the contrary, macrophages infiltrating the islets after CVB4 infection and iNKT-cell stimulation expressed a number of suppressive enzymes, among which indoleamine 2,3-dioxygenase was sufficient to inhibit anti-islet T-cell response and to prevent diabetes. This study highlights the critical interaction between virus and the immune system in the acceleration or prevention of type 1 diabetes. PMID:23894189

  10. Optimization and Characterization of Candidate Strain for Coxsackievirus A16 Inactivated Vaccine.

    PubMed

    Li, Jingliang; Liu, Guanchen; Liu, Xin; Yang, Jiaxin; Chang, Junliang; Zhang, Wenyan; Yu, Xiao-Fang

    2015-07-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71), both of which can cause hand, foot and mouth disease (HFMD), are responsible for large epidemics in Asian and Pacific areas. Although inactivated EV71 vaccines have completed testing in phase III clinical trials in Mainland China, CA16 vaccines are still under development. A Vero cell-based inactivated CA16 vaccine was developed by our group. Screening identified a CA16 vaccine strain (CC024) isolated from HFMD patients, which had broad cross-protective abilities and satisfied all requirements for vaccine production. Identification of the biological characteristics showed that the CA16CC024 strain had the highest titer (107.5 CCID50/mL) in Vero cells, which would benefit the development of an EV71/CA16 divalent vaccine. A potential vaccine manufacturing process was established, including the selection of optimal time for virus harvesting, membrane for diafiltration and concentration, gel-filtration chromatography for the down-stream virus purification and virus inactivation method. Altogether, the analyses suggested that the CC-16, a limiting dilution clone of the CC024 strain, with good genetic stability, high titer and broad-spectrum immunogenicity, would be the best candidate strain for a CA16 inactivated vaccine. Therefore, our study provides valuable information for the development of a Vero cell-based CA16 or EV71-CA16 divalent inactivated vaccine. PMID:26193302

  11. [Research progress on seroepidemiological study of enterovirus 71 and coxsackievirus A16 infection among children].

    PubMed

    Luo, Li; Xing, Weijia; Liao, Qiaohong; Yu, Hongjie

    2015-02-01

    Most common causative agents for hand, foot and mouth disease (HFMD) are enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16). The symptomatic and asymptomatic cases could transmit the disease in population. Many sero-epidemiological surveys were launched to estimate the sero-incidence of EV-A71 and CV-A16 enterovirus, the susceptibility of different sub-population, and to observe the dynamics of neutralizing antibody. A literature search of sero-epidemiological study focused on EV-A71 or CV-A16 was conducted via PubMed and China Hospital Knowledge Database. Based on the 20 selected studies, the different age groups' antibody level, the susceptibility, the dynamics of antibody and sero-incidence of EV-A71 or CV-A16 were analyzed. From our results, the antibody level against EV-A71 or CV-A16 in neonates was associated with their mothers, which was similar with that of adults. The antibody level against EV-A71 or CV-A16 in neonates dropped to lowest level at one years-old, and started to dramatically increase until four years-old, and reached a plateau at five years-old. In conclusion, the infants aged 6-12 months were the priority group to receive vaccination when the EV-A71 vaccine is licensed in the future. PMID:26081408

  12. Optimization and Characterization of Candidate Strain for Coxsackievirus A16 Inactivated Vaccine

    PubMed Central

    Li, Jingliang; Liu, Guanchen; Liu, Xin; Yang, Jiaxin; Chang, Junliang; Zhang, Wenyan; Yu, Xiao-Fang

    2015-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71), both of which can cause hand, foot and mouth disease (HFMD), are responsible for large epidemics in Asian and Pacific areas. Although inactivated EV71 vaccines have completed testing in phase III clinical trials in Mainland China, CA16 vaccines are still under development. A Vero cell-based inactivated CA16 vaccine was developed by our group. Screening identified a CA16 vaccine strain (CC024) isolated from HFMD patients, which had broad cross-protective abilities and satisfied all requirements for vaccine production. Identification of the biological characteristics showed that the CA16CC024 strain had the highest titer (107.5 CCID50/mL) in Vero cells, which would benefit the development of an EV71/CA16 divalent vaccine. A potential vaccine manufacturing process was established, including the selection of optimal time for virus harvesting, membrane for diafiltration and concentration, gel-filtration chromatography for the down-stream virus purification and virus inactivation method. Altogether, the analyses suggested that the CC-16, a limiting dilution clone of the CC024 strain, with good genetic stability, high titer and broad-spectrum immunogenicity, would be the best candidate strain for a CA16 inactivated vaccine. Therefore, our study provides valuable information for the development of a Vero cell-based CA16 or EV71-CA16 divalent inactivated vaccine. PMID:26193302

  13. Antiviral Ability of Kalanchoe gracilis Leaf Extract against Enterovirus 71 and Coxsackievirus A16.

    PubMed

    Wang, Ching-Ying; Huang, Shun-Chueh; Zhang, Yongjun; Lai, Zhen-Rung; Kung, Szu-Hao; Chang, Yuan-Shiun; Lin, Cheng-Wen

    2012-01-01

    Pandemic infection or reemergence of Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) occurs in tropical and subtropical regions, being associated with hand-foot-and-mouth disease, herpangina, aseptic meningitis, brain stem encephalitis, pulmonary edema, and paralysis. However, effective therapeutic drugs against EV71 and CVA16 are rare. Kalanchoe gracilis (L.) DC is used for the treatment of injuries, pain, and inflammation. This study investigated antiviral effects of K. gracilis leaf extract on EV71 and CVA16 replications. HPLC analysis with a C-18 reverse phase column showed fingerprint profiles of K. gracilis leaf extract had 15 chromatographic peaks. UV/vis absorption spectra revealed peaks 5, 12, and 15 as ferulic acid, quercetin, and kaempferol, respectively. K. gracilis leaf extract showed little cytotoxicity, but exhibited concentration-dependent antiviral activities including cytopathic effect, plaque, and virus yield reductions. K. gracilis leaf extract was shown to be more potent in antiviral activity than ferulic acid, quercetin, and kaempferol, significantly inhibiting in vitro replication of EV71 (IC(50) = 35.88 μg/mL) and CVA16 (IC(50) = 42.91 μg/mL). Moreover, K. gracilis leaf extract is a safe antienteroviral agent with the inactivation of viral 2A protease and reduction of IL-6 and RANTES expressions. PMID:22666293

  14. Immunologic Characterization of Cytokine Responses to Enterovirus 71 and Coxsackievirus A16 Infection in Children

    PubMed Central

    Zhang, Shu-Yan; Xu, Mei-Yan; Xu, Hong-Mei; Li, Xiu-Jun; Ding, Shu-Jun; Wang, Xian-Jun; Li, Ting-Yu; Lu, Qing-Bin

    2015-01-01

    Abstract Viral encephalitis is a serious complication of hand, foot, and mouth disease (HFMD), but characteristics of cytokines response in enterovirus 71 (EV-71) and/or coxsackievirus A16 (CV-A16) associated HFMD with or without viral encephalitis remained unclear. We performed a multigroup retrospective study and compared the serum cytokines concentrations among 16 encephalitis patients infected with EV-71 and CV-A16, 24 encephalitis patients with single EV-71 infection, 34 mild HFMD patients with EV-71 infection, 18 mild HFMD patients with CV-A16 infection, and 39 healthy control subjects. Serum levels of interleukin (IL)-4, IL-5, IL-22, and IL-23 were significantly higher in encephalitis patients than in HFMD-alone patients when adjusting for age and sex; IL-2, tumor necrosis factor (TNF)-α, IL-4, IL-22, and IL-1β were significantly higher in HFMD-alone patients of EV-71 infection than in CV-A16 infected HFMD patients; cerebrospinal fluid level of IL-6 was lower in the EV-71/CV-A16 associated encephalitis than that in the EV-71 alone associated encephalitis patients. Over or low expression of the cytokines cascade in HFMD patients appears to play an important role in the elicitation of the immune response to EV-71 and CV-A16. These data will be used to define a cytokine profile, which might help to recognize HFMD patients with the high risk of developing encephalitis. PMID:26166120

  15. Coxsackievirus A16 Infection Induces Neural Cell and Non-Neural Cell Apoptosis In Vitro

    PubMed Central

    Liu, Li; Wei, Zhenhong; Ehrlich, Elana S.; Liu, Guanchen; Li, Jingliang; Liu, Xin; Wang, Hong; Yu, Xiao-fang; Zhang, Wenyan

    2014-01-01

    Coxsackievirus A16 (CA16) is one of the main causative pathogens of hand, foot and mouth disease (HFMD). Viral replication typically results in host cell apoptosis. Although CA16 infection has been reported to induce apoptosis in the human rhabdomyosarcoma (RD) cell line, it remains unclear whether CA16 induces apoptosis in diverse cell types, especially neural cells which have important clinical significance. In the current study, CA16 infection was found to induce similar apoptotic responses in both neural cells and non-neural cells in vitro, including nuclear fragmentation, DNA fragmentation and phosphatidylserine translocation. CA16 generally is not known to lead to serious neurological symptoms in vivo. In order to further clarify the correlation between clinical symptoms and cell apoptosis, two CA16 strains from patients with different clinical features were investigated. The results showed that both CA16 strains with or without neurological symptoms in infected patients led to neural and muscle cell apoptosis. Furthermore, mechanistic studies showed that CA16 infection induced apoptosis through the same mechanism in both neural and non-neural cells, namely via activation of both the mitochondrial (intrinsic) pathway-related caspase 9 protein and the Fas death receptor (extrinsic) pathway-related caspase 8 protein. Understanding the mechanisms by which CA16 infection induces apoptosis in both neural and non-neural cells will facilitate a better understanding of CA16 pathogenesis. PMID:25350381

  16. Coxsackievirus B 1-induced polymyositis. Lack of disease expression in nu/nu mice.

    PubMed Central

    Ytterberg, S R; Mahowald, M L; Messner, R P

    1987-01-01

    Chronic inflammatory myositis similar to human polymyositis occurs in mice after infection with a strain of Coxsackievirus B 1 (CVB 1). To investigate the role of T cells in the pathogenesis of this disorder, we compared disease expression in T cell-deficient athymic nude (nu/nu) mice and heterozygotes (nu/+) with normal T cell function. Acute infectious myositis occurred in nu/nu and nu/+ mice. Chronic (greater than 21 d postinfection) weakness and myositis, however, developed only in nu/+. Resistance to disease in nu/nu mice was not explained by insusceptibility to infection; the amount of virus lethal for 50% of mice and virus replication were comparable in both groups. Additionally, anti-CVB 1 antibody production was similar in both groups. Reconstitution of infected nu/nu mice with spleen cells from normal mice resulted in disease. These results demonstrate that chronic weakness after infection with this virus is not simply a sequela of acute myonecrosis and suggest that T cells play a pivotal role in the pathogenesis of chronic myositis. Images PMID:3038960

  17. Antiviral Ability of Kalanchoe gracilis Leaf Extract against Enterovirus 71 and Coxsackievirus A16

    PubMed Central

    Wang, Ching-Ying; Huang, Shun-Chueh; Zhang, Yongjun; Lai, Zhen-Rung; Kung, Szu-Hao; Chang, Yuan-Shiun; Lin, Cheng-Wen

    2012-01-01

    Pandemic infection or reemergence of Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) occurs in tropical and subtropical regions, being associated with hand-foot-and-mouth disease, herpangina, aseptic meningitis, brain stem encephalitis, pulmonary edema, and paralysis. However, effective therapeutic drugs against EV71 and CVA16 are rare. Kalanchoe gracilis (L.) DC is used for the treatment of injuries, pain, and inflammation. This study investigated antiviral effects of K. gracilis leaf extract on EV71 and CVA16 replications. HPLC analysis with a C-18 reverse phase column showed fingerprint profiles of K. gracilis leaf extract had 15 chromatographic peaks. UV/vis absorption spectra revealed peaks 5, 12, and 15 as ferulic acid, quercetin, and kaempferol, respectively. K. gracilis leaf extract showed little cytotoxicity, but exhibited concentration-dependent antiviral activities including cytopathic effect, plaque, and virus yield reductions. K. gracilis leaf extract was shown to be more potent in antiviral activity than ferulic acid, quercetin, and kaempferol, significantly inhibiting in vitro replication of EV71 (IC50 = 35.88 μg/mL) and CVA16 (IC50 = 42.91 μg/mL). Moreover, K. gracilis leaf extract is a safe antienteroviral agent with the inactivation of viral 2A protease and reduction of IL-6 and RANTES expressions. PMID:22666293

  18. Development of sandwich ELISAs that can distinguish different types of coxsackievirus A16 viral particles.

    PubMed

    Ye, Xiangzhong; Yang, Lisheng; Jia, Jizong; Han, Jinle; Li, Shuxuan; Liu, Yajing; Xu, Longfa; Zhao, Huan; Chen, Yixin; Li, Yimin; Cheng, Tong; Xia, Ningshao

    2016-03-01

    Coxsackievirus A16 (CA16) is one of the major causative agents of hand, foot, and mouth disease (HFMD). No CA16 vaccine candidates have progressed to clinical trials so far. Immunogenicity studies indicated that different CA16 particles have much influence on the efficacy of a candidate vaccine. However, there are still no relevant reports on the methods of detecting different CA16 particles. In this study, we screened several monoclonal antibodies (mAbs) specific for different CA16 particles, and several sandwich enzyme-linked immunoassays (ELISAs) were developed to measure the different types of CA16 viral particles. The mAbs that could only bind denatured or empty capsids could not neutralize CA16. In contrast, the mAbs that could bind mature full particles or all types of particles showed obvious neutralizing activity. The thermal stability of different CA16 particles was evaluated using these sandwich ELISAs. The mature full particles were found to be more thermolabile than the other types of particles and could be stabilized by high concentrations of cations. These methods can be used to assist in the potency control of CA16 vaccines and will promote the development of a CA16 vaccine. PMID:26767830

  19. Virus-like particle-based vaccine against coxsackievirus A6 protects mice against lethal infections.

    PubMed

    Shen, Chaoyun; Ku, Zhiqiang; Zhou, Yu; Li, Dapeng; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong

    2016-07-25

    Coxsackievirus A6 (CA6) is emerging as one of the major causative agents of hand, foot, and mouth disease (HFMD) worldwide. However, no vaccine is currently available for preventing CA6 infection. Here, we report the development of a virus-like particle (VLP)-based recombinant vaccine for CA6. We produced CA6 VLPs in insect cells by infecting the cells with a baculovirus coexpressing the genes encoding CA6 P1 and 3CD. Biochemical analyses showed that the produced VLPs consisted of VP0, VP1, and VP3 capsid subunit proteins generated by the cleavage of P1 by 3CD. Mice immunized with these VLPs produced CA6-specific serum antibodies. Passive transfer of antisera from CA6 VLP-immunized mice protected recipient mice from lethal infections caused by homologous and heterologous CA6 strains. Moreover, active immunization of mice with CA6 VLPs efficiently conferred protection against both homologous and heterologous CA6 infections. These results suggested that CA6 VLP-based recombinant vaccine is a promising candidate vaccine for preventing CA6 infection and can be incorporated into a multivalent HFMD vaccine formulation to achieve broad-spectrum and effective prevention of this disease. PMID:27340093

  20. Distinct pathogenic effects of group B coxsackieviruses on human glomerular and tubular kidney cells.

    PubMed Central

    Conaldi, P G; Biancone, L; Bottelli, A; De Martino, A; Camussi, G; Toniolo, A

    1997-01-01

    The six group B coxsackieviruses (CVBs) are highly prevalent human pathogens that cause viremia followed by involvement of different organs. Clinical and experimental evidence suggests that CVBs can induce kidney injury, but the susceptibility of human renal cells to these viruses is unknown. By using pure cultures of human glomerular and tubular cells, we demonstrated that all CVBs are capable of productively infecting renal cells of three different histotypes. Distinct pathogenic effects were observed. Proximal tubular epithelial cells and, to a lesser extent, glomerular podocytes were highly susceptible to CVBs; in both cases, infection led to cytolysis. In contrast, glomerular mesangial cells supported the replication of the six CVBs but failed to develop overt cytopathologic changes. Mesangial cells continued to produce infectious progeny for numerous serial subcultures (i.e., more than 50 days), especially with type 1, 3, 4, and 5 viruses. In the above cells, persistent infection induced the de novo synthesis of platelet-derived growth factor A/B and enhanced the release of transforming growth factor beta1/2. These two factors are important mediators of progression from glomerular inflammation to glomerulosclerosis. CVB replication appeared also to impair the phagocytic and contractile activity of mesangial cells. Loss of these properties--which are important in glomerular physiopathology--may contribute to the development of progressive nephropathy. The results show that CVBs induce distinct effects in different types of cultured renal cells and suggest that CVB infections may be associated with both acute and progressive renal injury. PMID:9371576

  1. Buck-Buck- Boost Regulatr (B3R)

    NASA Astrophysics Data System (ADS)

    Mourra, Olivier; Fernandez, Arturo; Landstroem, Sven; Tonicello, Ferdinando

    2011-10-01

    In a satellite, the main function of a Power Conditioning Unit (PCU) is to manage the energy coming from several power sources (usually solar arrays and battery) and to deliver it continuously to the users in an appropriate form during the overall mission. The objective of this paper is to present an electronic switching DC-DC converter called Buck-Buck-Boost Regulator (B3R) that could be used as a modular and recurrent solution in a PCU for regulated or un- regulated 28Vsatellite power bus classes. The power conversion stages of the B3R topology are first described. Then theoretical equations and practical tests illustrate how the converter operates in term of power conversion, control loops performances and efficiency. The paper finally provides some examples of single point failure tolerant implementation using the B3R.

  2. Reply to criticisms of the B (3) field

    NASA Astrophysics Data System (ADS)

    Evans, M. W.

    1995-12-01

    The confusion and self-contradiction among recent critics of the B (3) (Evans-Vigier) field are analysed. Barron [17] and Buckingham [18] assert that the field is zero by symmetry. Grimes [21] asserts that the field is non-zero but fortuitous. Lakhtakia in one paper [19] asserts that B (3) is non-zero but not fundamental, and in a second paper that it is unknowlable and therefore may as well be zero. A rebuttal is given of each the individual papers, and it is shown that the Evans-Vigier field is the fundamental magnetizing field of electromagnetic radiation.

  3. 26 CFR 48.4161(b)-3 - Use considered sale.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Use considered sale. 48.4161(b)-3 Section 48... sale. For provisions relating to the tax on use of taxable articles by the manufacturer, producer, or importer thereof, see section 4218 relating to use by a manufacturer considered a sale, and the...

  4. A Neonatal Mouse Model of Coxsackievirus A16 for Vaccine Evaluation

    PubMed Central

    Mao, Qunying; Wang, Yiping; Gao, Rong; Shao, Jie; Yao, Xin; Lang, Shuhui; Wang, Chao; Mao, Panyong

    2012-01-01

    To evaluate vaccine efficacy in protecting against coxsackievirus A16 (CA16), which causes human hand, foot, and mouth disease (HFMD), we established the first neonatal mouse model. In this article, we report data concerning CA16-induced pathological changes, and we demonstrate that anti-CA16 antibody can protect mice against lethal challenge and that the neonatal mouse model could be used to evaluate vaccine efficacy. To establish a mouse model, a BJCA08/CA16 strain (at 260 50% lethal doses [LD50]) was isolated from a patient and used to intracerebrally (i.c.) inoculate neonatal mice. The infection resulted in wasting, hind-limb paralysis, and even death. Pathological examination and immunohistochemistry (IHC) staining indicated that BJCA08 had a strong tropism to muscle and caused severe necrosis in skeletal and cardiac muscles. We then found that BJCA08 pretreated with goat anti-G10/CA16 serum could significantly lose its lethal effect in neonatal mice. When the anti-G10 serum was intraperitoneally (i.p.) injected into the neonatal mice and, within 1 h, the same mice were intracerebrally inoculated with BJCA08, there was significant passive immunization protection. In a separate experiment, female mice were immunized with formaldehyde-inactivated G10/CA16 and BJCA08/CA16 and then allowed to mate 1 h after the first immunization. We found that there was significant protection against BJCA08 for neonatal mice born to the immunized dams. These data demonstrated that anti-CA16 antibody may block virus invasion and protect mice against lethal challenge, and that the neonatal mouse model was a viable tool for evaluating vaccine efficacy. PMID:22951825

  5. A murine model of coxsackievirus A16 infection for anti-viral evaluation.

    PubMed

    Liu, Qingwei; Shi, Jinping; Huang, Xulin; Liu, Fei; Cai, Yicun; Lan, Ke; Huang, Zhong

    2014-05-01

    Coxsackievirus A16 (CA16) is one of the main causative agents of hand, foot and mouth disease (HFMD), which is a common infectious disease in children. CA16 infection may lead to severe nervous system damage and even death in humans. However, study of the pathogenesis of CA16 infection and development of vaccines and anti-viral agents are hindered partly by the lack of an appropriate small animal model. In the present study, we developed and characterized a murine model of CA16 infection. We show that neonatal mice are susceptible to CA16 infection via intraperitoneal inoculation. One-day-old mice infected with 2×10(6)TCID50 of CA16/SZ05 strain consistently exhibited clinical signs, including reduced mobility, and limb weakness and paralysis. About 57% of the mice died within 14days after infection. Significant damage in the brainstem, limb muscles and intestines of the infected mice in the moribund state was observed by histological examination, and the presence of CA16 in neurons of the brainstem was demonstrated by immunohistochemical staining with a CA16-specific polyclonal antibody, strongly suggesting the involvement of the central nervous system in CA16 infection. Analysis of virus titers in various organs/tissues collected at 3, 6 and 9days post-infection, showed that skeletal muscle was the major site of virus replication at the early stage of infection, while the virus mainly accumulated in the brain at the late stage. In addition, susceptibility of mice to CA16 infection was found to be age dependent. Moreover, different CA16 strains could exhibit varied virulence in vivo. Importantly, we demonstrated that post-exposure treatment with an anti-CA16 monoclonal antibody fully protected mice against lethal CA16 infection. Collectively, these results indicate the successful development of a CA16 infection mouse model for anti-viral evaluation. PMID:24583030

  6. Phylodynamic Characterization of an Ocular-Tropism Coxsackievirus A24 Variant

    PubMed Central

    Lu, Po-Liang; Lin, Yung-Cheng; Shi, Yong-Ying; Chou, Li-Chiu; Wang, Chu-Feng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Chien-Ching; Zeng, Jing-Yun; Tyan, Yu-Chang; Ke, Guan-Ming

    2016-01-01

    Recent phylodynamic studies have focused on using tree topology patterns to elucidate interactions among the epidemiological, evolutionary, and demographic characteristics of infectious agents. However, because studies of viral phylodynamics tend to focus on epidemic outbreaks, tree topology signatures of tissue-tropism pathogens might not be clearly identified. Therefore, this study used a novel Bayesian evolutionary approach to analyze the A24 variant of coxsackievirus (CV-A24v), an ocular-tropism agent of acute hemorrhagic conjunctivitis. Analyses of the 915-nucleotide VP1 and 690-nt 3Dpol regions of 21 strains isolated in Taiwan and worldwide during 1985–2010 revealed a clear chronological trend in both the VP1 and 3Dpol phylogenetic trees: the emergence of a single dominant cluster in each outbreak. The VP1 sequences included three genotypes: GI (prototype), GIII (isolated 1985–1999), and GIV (isolated after 2000); no VP1 sequences from GII strains have been deposited in GenBank. Another five genotypes identified in the 3Dpol region had support values >0.9. Geographic and demographic transitions among CV-A24v clusters were clearly identified by Bayes algorithm. The transmission route was mapped from India to China and then to Taiwan, and each prevalent viral population declined before new clusters emerged. Notably, the VP1 and 3Dpol genes had high nucleotide sequence similarities (94.1% and 95.2%, respectively). The lack of co-circulating lineages and narrow tissue tropism affected the CV-A24v gene pool. PMID:27529556

  7. Phylodynamic Characterization of an Ocular-Tropism Coxsackievirus A24 Variant.

    PubMed

    Yen, Yung-Chang; Chu, Pei-Huan; Lu, Po-Liang; Lin, Yung-Cheng; Shi, Yong-Ying; Chou, Li-Chiu; Wang, Chu-Feng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Chien-Ching; Zeng, Jing-Yun; Tyan, Yu-Chang; Ke, Guan-Ming; Chu, Pei-Yu

    2016-01-01

    Recent phylodynamic studies have focused on using tree topology patterns to elucidate interactions among the epidemiological, evolutionary, and demographic characteristics of infectious agents. However, because studies of viral phylodynamics tend to focus on epidemic outbreaks, tree topology signatures of tissue-tropism pathogens might not be clearly identified. Therefore, this study used a novel Bayesian evolutionary approach to analyze the A24 variant of coxsackievirus (CV-A24v), an ocular-tropism agent of acute hemorrhagic conjunctivitis. Analyses of the 915-nucleotide VP1 and 690-nt 3Dpol regions of 21 strains isolated in Taiwan and worldwide during 1985-2010 revealed a clear chronological trend in both the VP1 and 3Dpol phylogenetic trees: the emergence of a single dominant cluster in each outbreak. The VP1 sequences included three genotypes: GI (prototype), GIII (isolated 1985-1999), and GIV (isolated after 2000); no VP1 sequences from GII strains have been deposited in GenBank. Another five genotypes identified in the 3Dpol region had support values >0.9. Geographic and demographic transitions among CV-A24v clusters were clearly identified by Bayes algorithm. The transmission route was mapped from India to China and then to Taiwan, and each prevalent viral population declined before new clusters emerged. Notably, the VP1 and 3Dpol genes had high nucleotide sequence similarities (94.1% and 95.2%, respectively). The lack of co-circulating lineages and narrow tissue tropism affected the CV-A24v gene pool. PMID:27529556

  8. Genomic characteristics of coxsackievirus A8 strains associated with hand, foot, and mouth disease and herpangina.

    PubMed

    Chen, Long; Yang, Hong; Wang, Chao; Yao, Xiang-Jie; Zhang, Hai-Long; Zhang, Ren-Li; He, Ya-Qing

    2016-01-01

    Coxsackievirus A8 (CV-A8), a member of the genus Enterovirus of the family Picornaviridae, can cause a variety of infectious diseases, such as hand, foot and mouth disease (HFMD), herpangina (HA), encephalitis, paralysis, myelitis, and meningitis. This is a first report of complete genome sequences of CV-A8 strains associated with HFMD/HA since the prototype strain Donovan was identified in 1949. The complete genome sequences of eight new CV-A8 strains showed 19.2 %-20.6 % nucleotide differences when compared to the prototype strain Donovan, and 81.5 %-99.9 % similarity to each other. The topology of a polyphyletic tree based on complete capsid protein gene sequences indicated that the new CV-A8 strains and Donovan are monophyletic. However, seven CV-A8 strains clustered with CV-A10 and CV-A2 in the 5'UTR and P2 region, respectively. In the P3 region, three and four CV-A8 strains grouped with CV-A6 and CV-A2, respectively. Seven CV-A8 strains segregated from Donovan and grouped in a separate lineage in the 3'UTR. The strain CVA8/SZ266/CHN/2014 was most similar to EV71 in the nonstructural proteins regions. Phylogenetic analysis classified worldwide CV-A8 isolates into four distinct clusters, and almost all Chinese and Thai CV-A8 strains evolved independently in their respective lineages, which indicated geographical evolution of CV-A8. PMID:26483280

  9. Characterizing Enterovirus 71 and Coxsackievirus A16 virus-like particles production in insect cells.

    PubMed

    Somasundaram, Balaji; Chang, Cindy; Fan, Yuan Y; Lim, Pei-Yin; Cardosa, Jane; Lua, Linda

    2016-02-15

    Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are two viruses commonly responsible for hand, foot and mouth disease (HFMD) in children. The lack of prophylactic or therapeutic measures against HFMD is a major public health concern. Insect cell-based EV71 and CVA16 virus-like particles (VLPs) are promising vaccine candidates against HFMD and are currently under development. In this paper, the influence of insect cell line, incubation temperature, and serial passaging effect and stability of budded virus (BV) stocks on EV71 and CVA16 VLP production was investigated. Enhanced EV71 and CVA16 VLP production was observed in Sf9 cells compared to High Five™ cells. Lowering the incubation temperature from the standard 27°C to 21°C increased the production of both VLPs in Sf9 cells. Serial passaging of CVA16 BV stocks in cell culture had a detrimental effect on the productivity of the structural proteins and the effect was observed with only 5 passages of BV stocks. A 2.7× higher production yield was achieved with EV71 compared to CVA16. High-resolution asymmetric flow field-flow fractionation couple with multi-angle light scattering (AF4-MALS) was used for the first time to characterize EV71 and CVA16 VLPs, displaying an average root mean square radius of 15±1nm and 15.3±5.8 nm respectively. This study highlights the need for different approaches in the design of production process to develop a bivalent EV71 and CVA16 vaccine. PMID:26410190

  10. Coxsackievirus counters the host innate immune response by blocking type III interferon expression.

    PubMed

    Lind, Katharina; Svedin, Emma; Domsgen, Erna; Kapell, Sebastian; Laitinen, Olli; Moll, Markus; Flodström-Tullberg, Malin

    2016-06-01

    Type I IFNs play an important role in the immune response to enterovirus infections. Their importance is underscored by observations showing that many enteroviruses including coxsackie B viruses (CVBs) have developed strategies to block type I IFN production. Recent studies have highlighted a role for the type III IFNs (also called IFNλs) in reducing permissiveness to infections with enteric viruses including coxsackievirus. However, whether or not CVBs have measures to evade the effects of type III IFNs remains unknown. By combining virus infection studies and different modes of administrating the dsRNA mimic poly I : C, we discovered that CVBs target both TLR3- and MDA5/RIG-I-mediated type III IFN expression. Consistent with this, the cellular protein expression levels of the signal transduction proteins TRIF and IPS1 were reduced and no hyperphosphorylation of IRF-3 was observed following infection with the virus. Notably, decreased expression of full-length TRIF and IPS1 and the appearance of cleavage products was observed upon both CVB3 infection and in cellular protein extracts incubated with recombinant 2Apro, indicating an important role for the viral protease in subverting the cellular immune system. Collectively, our study reveals that CVBs block the expression of type III IFNs, and that this is achieved by a similar mechanism as the virus uses to block type I IFN production. We also demonstrate that the virus blocks several intracellular viral recognition pathways of importance for both type I and III IFN production. The simultaneous targeting of numerous arms of the host immune response may be required for successful viral replication and dissemination. PMID:26935471