Science.gov

Sample records for coxsackievirus b3 rna-dependent

  1. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    SciTech Connect

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno; De Palma, Armando M.; Neyts, Johan; Egloff, Marie-Pierre; Grisel, Sacha; Dalle, Karen; Campanacci, Valerie; Spinelli, Silvia; Cambillau, Christian; Canard, Bruno; Gruez, Arnaud

    2007-06-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited to X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination.

  2. ATP Is an Allosteric Inhibitor of Coxsackievirus B3 Polymerase.

    PubMed

    Karr, Jonathan P; Peersen, Olve B

    2016-07-19

    The RNA-dependent RNA polymerases from positive-strand RNA viruses, such as picornaviruses and flaviviruses, close their active sites for catalysis via a unique NTP-induced conformational change in the palm domain. Combined with a fully prepositioned templating nucleotide, this mechanism is error-prone and results in a distribution of random mutations in the viral progeny often described as a quasi-species. Here we examine the extent to which noncognate NTPs competitively inhibit single-cycle elongation by coxsackievirus B3 3D(pol), a polymerase that generates three to four mutations per 10 kb of RNA synthesized during viral infection. Using an RNA with a templating guanosine combined with 2-aminopurine fluorescence as a reporter for elongation, we find that the cognate CTP has a Km of 24 μM and the three noncognate nucleotides competitively inhibit the reaction with Kic values of 500 μM for GTP, 1300 μM for ATP, and 3000 μM for UTP. Unexpectedly, ATP also acted as an uncompetitive inhibitor with a Kiu of 1800 μM, resulting in allosteric modulation of 3D(pol) that slowed the polymerase elongation rate ≈4-fold. ATP uncompetitive inhibition required the β- and γ-phosphates, and its extent was significantly diminished in two previously characterized low-fidelity polymerases. This led to further mutational analysis and the identification of a putative allosteric binding site below the NTP entry channel at the interface of conserved motifs A and D, although cocrystallization failed to reveal any density for bound ATP in this pocket. The potential role of an ATP allosteric effect during the virus life cycle is discussed. PMID:27319576

  3. Coxsackievirus B3 infection reduces female mouse fertility

    PubMed Central

    Shim, Hye Min; Hwang, Ji Young; Lee, Kyung Min; Kim, Yunhwa; Jeong, Daewon; Roh, Jaesook; Choi, Hyeonhae; Hwang, Jung Hye; Park, Hosun

    2015-01-01

    Previously we demonstrated coxsackievirus B3 (CVB3) infection during early gestation as a cause of pregnancy loss. Here, we investigated the impacts of CVB3 infection on female mouse fertility. Coxsackievirus-adenovirus receptor (CAR) expression and CVB3 replication in the ovary were evaluated by immunohistochemistry or reverse transcription-polymerase chain reaction (RT-PCR). CAR was highly expressed in granulosa cells (GCs) and CVB3 replicated in the ovary. Histological analysis showed a significant increase in the number of atretic follicles in the ovaries of CVB3-infected mice (CVBM). Estrous cycle evaluation demonstrated that a higher number of CVBM were in proestrus compared to mock mice (CVBM vs. mock; 61.5%, 28.5%, respectively). Estradiol concentration in GC culture supernatant and serum were measured by an enzyme-linked immunosorbent assay. Baseline and stimulated levels of estradiol in GC were decreased in CVBM, consistent with significantly reduced serum levels in these animals. In addition, aromatase transcript levels in GCs from CVBM were also decreased by 40% relative to the mock. Bone mineral density evaluated by micro-computed tomography was significantly decreased in the CVBM. Moreover, the fertility rate was also significantly decreased for the CVBM compared to the mock (CVBM vs. mock; 20%, 94.7%, respectively). This study suggests that CVB3 infection could interfere with reproduction by disturbing ovarian function and cyclic changes of the uterus. PMID:26062767

  4. A functional nuclear localization sequence in the VP1 capsid protein of coxsackievirus B3

    SciTech Connect

    Wang, Tianying; Yu, Bohai; Lin, Lexun; Zhai, Xia; Han, Yelu; Qin, Ying; Guo, Zhiwei; Wu, Shuo; Zhong, Xiaoyan; Wang, Yan; Tong, Lei; Zhang, Fengmin; Si, Xiaoning; Zhao, Wenran; Zhong, Zhaohua

    2012-11-25

    The capsid proteins of some RNA viruses can translocate to the nucleus and interfere with cellular phenotypes. In this study we found that the VP1 capsid protein of coxsackievirus B3 (CVB3) was dominantly localized in the nucleus of the cells transfected with VP1-expressing plasmid. The VP1 nuclear localization also occurred in the cells infected with CVB3. Truncation analysis indicated that the VP1 nuclear localization sequence located near the C-terminal. The substitution of His220 with threonine completely abolished its translocation. The VP1 proteins of other CVB types might have the nuclear localization potential because this region was highly conserved. Moreover, the VP1 nuclear localization induced cell cycle deregulation, including a prolonged S phase and shortened G2-M phase. Besides these findings, we also found a domain between Ala72 and Phe106 that caused the VP1 truncates dotted distributed in the cytoplasm. Our results suggest a new pathogenic mechanism of CVB. - Highlights: Black-Right-Pointing-Pointer The VP1 protein of coxsackievirus B3 can specifically localize in the nucleus. Black-Right-Pointing-Pointer The nuclear localization signal of coxsackievirus B3 VP1 protein locates near its C-terminal. Black-Right-Pointing-Pointer The VP1 nuclear localization of coxsackievirus B3 can deregulate cell cycle. Black-Right-Pointing-Pointer There is a domain in the VP1 that determines it dotted distributed in the cytoplasm.

  5. Major Persistent 5′ Terminally Deleted Coxsackievirus B3 Populations in Human Endomyocardial Tissues

    PubMed Central

    Bouin, Alexis; Nguyen, Yohan; Wehbe, Michel; Renois, Fanny; Fornes, Paul; Bani-Sadr, Firouze; Metz, Damien

    2016-01-01

    We performed deep sequencing analysis of the enterovirus 5′ noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. Results displayed a mix of deleted and full-length coxsackievirus B3, characterized by a low viral RNA load (8.102 copies/μg of nucleic acids) and a low viral RNA positive-sense to RNA negative-sense ratio of 4.8. PMID:27434549

  6. Major Persistent 5' Terminally Deleted Coxsackievirus B3 Populations in Human Endomyocardial Tissues.

    PubMed

    Bouin, Alexis; Nguyen, Yohan; Wehbe, Michel; Renois, Fanny; Fornes, Paul; Bani-Sadr, Firouze; Metz, Damien; Andreoletti, Laurent

    2016-08-01

    We performed deep sequencing analysis of the enterovirus 5' noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. Results displayed a mix of deleted and full-length coxsackievirus B3, characterized by a low viral RNA load (8.10(2) copies/μg of nucleic acids) and a low viral RNA positive-sense to RNA negative-sense ratio of 4.8. PMID:27434549

  7. Molecular epidemiology of coxsackievirus B3 infection in Spain, 2004-2014.

    PubMed

    Calderón, Katherine I; Díaz-de Cerio, María; Otero, Almudena; Muñoz-Almagro, Carmen; Rabella, Nuria; Martínez-Rienda, Inés; Moreno-Docón, Antonio; Trallero, Gloria; Cabrerizo, María

    2016-05-01

    Epidemiological and clinical characteristics of coxsackievirus B3 infections in Spain were investigated. This enterovirus (EV) type was detected mainly in young children (<6 months) and was associated with neurological (78 %) and respiratory diseases (10 %) but also with myo/pericarditis (10 %). Two myocarditis cases were fatal. Phylogenetic analysis of the VP1 region showed that genotype III circulated in the country between 2004 and 2008 and was replaced by genotype V in 2010. Furthermore, phylogenetic analysis of the 3D region indicated that recombination events have occurred and contributed to the genetic evolution of this EV type. PMID:26898312

  8. Emergence of a Large-Plaque Variant in Mice Infected with Coxsackievirus B3

    PubMed Central

    Wang, Yao

    2016-01-01

    ABSTRACT Coxsackieviruses are enteric viruses that frequently infect humans. To examine coxsackievirus pathogenesis, we orally inoculated mice with the coxsackievirus B3 (CVB3) Nancy strain. Using HeLa cell plaque assays with agar overlays, we noticed that some fecal viruses generated plaques >100 times as large as inoculum viruses. These large-plaque variants emerged following viral replication in several different tissues. We identified a single amino acid change, N63Y, in the VP3 capsid protein that was sufficient to confer the large-plaque phenotype. Wild-type CVB3 and N63Y mutant CVB3 had similar plaque sizes when agarose was used in the overlay instead of agar. We determined that sulfated glycans in agar inhibited plaque formation by wild-type CVB3 but not by N63Y mutant CVB3. Furthermore, N63Y mutant CVB3 bound heparin, a sulfated glycan, less efficiently than wild-type CVB3 did. While N63Y mutant CVB3 had a growth defect in cultured cells and reduced attachment, it had enhanced replication and pathogenesis in mice. Infection with N63Y mutant CVB3 induced more severe hepatic damage than infection with wild-type CVB3, likely because N63Y mutant CVB3 disseminates more efficiently to the liver. Our data reinforce the idea that culture-adapted laboratory virus strains can have reduced fitness in vivo. N63Y mutant CVB3 may be useful as a platform to understand viral adaptation and pathogenesis in animal studies. PMID:27025249

  9. Internalization and trafficking mechanisms of coxsackievirus B3 in HeLa cells

    SciTech Connect

    Chung, Sun-Ku; Kim, Joo-Young; Kim, In-Beom; Park, Sang-Ick; Paek, Kyung-Hee; Nam, Jae-Hwan . E-mail: jnam66@yahoo.com

    2005-03-01

    Coxsackievirus B3 (CVB3) is nonenveloped and has a single-stranded positive-sense RNA genome. CVB3 induces myocarditis and ultimately dilated cardiomyopathy. Although there are mounting evidences of an interaction between CVB3 particles and the cellular receptors, coxsackievirus and adenovirus receptor (CAR) and decay-accelerating factor (DAF), very little is known about the mechanisms of internalization and trafficking. In the present study, we used the CVB3 H3 strain, which is CAR-dependent but DAF-independent Woodruff variant and found that during entry, CVB3 particles were colocalized in clathrin, after interacting primarily with CAR, which was not recycled to the plasma membrane. We also found that CVB3 internalization was dependent on the function of dynamin, a large GTPase that has an essential role in endocytosis. Heat-shock cognate protein, Hsc70, which acts as a chaperone in the release of coat proteins from clathrin-coated vesicles (CCV), played a role in CVB3 trafficking processes. Moreover, endosomal acidification was crucial for CVB3 endocytosis. Finally, CVB3 was colocalized in early endosome autoantigen 1 (EEA1) molecules, which are involved in endosome-endosome tethering and fusion. In conclusion, these data together indicate that CVB3 uses clathrin-mediated endocytosis and is transcytosed to early endosomes.

  10. Coxsackievirus B3 VLPs purified by ion exchange chromatography elicit strong immune responses in mice.

    PubMed

    Koho, Tiia; Koivunen, Minni R L; Oikarinen, Sami; Kummola, Laura; Mäkinen, Selina; Mähönen, Anssi J; Sioofy-Khojine, Amirbabak; Marjomäki, Varpu; Kazmertsuk, Artur; Junttila, Ilkka; Kulomaa, Markku S; Hyöty, Heikki; Hytönen, Vesa P; Laitinen, Olli H

    2014-04-01

    Coxsackievirus B3 (CVB3) is an important cause of acute and chronic viral myocarditis, and dilated cardiomyopathy (DCM). Although vaccination against CVB3 could significantly reduce the incidence of serious or fatal viral myocarditis and various other diseases associated with CVB3 infection, there is currently no vaccine or therapeutic reagent in clinical use. In this study, we contributed towards the development of a CVB3 vaccine by establishing an efficient and scalable ion exchange chromatography-based purification method for CVB3 virus and baculovirus-insect cell-expressed CVB3 virus-like particles (VLPs). This purification system is especially relevant for vaccine development and production on an industrial scale. The produced VLPs were characterized using a number of biophysical methods and exhibited excellent quality and high purity. Immunization of mice with VLPs elicited a strong immune response, demonstrating the excellent vaccine potential of these VLPs. PMID:24485896

  11. Design of a Genetically Stable High Fidelity Coxsackievirus B3 Polymerase That Attenuates Virus Growth in Vivo.

    PubMed

    McDonald, Seth; Block, Andrew; Beaucourt, Stéphanie; Moratorio, Gonzalo; Vignuzzi, Marco; Peersen, Olve B

    2016-07-01

    Positive strand RNA viruses replicate via a virally encoded RNA-dependent RNA polymerase (RdRP) that uses a unique palm domain active site closure mechanism to establish the canonical two-metal geometry needed for catalysis. This mechanism allows these viruses to evolutionarily fine-tune their replication fidelity to create an appropriate distribution of genetic variants known as a quasispecies. Prior work has shown that mutations in conserved motif A drastically alter RdRP fidelity, which can be either increased or decreased depending on the viral polymerase background. In the work presented here, we extend these studies to motif D, a region that forms the outer edge of the NTP entry channel where it may act as a nucleotide sensor to trigger active site closure. Crystallography, stopped-flow kinetics, quench-flow reactions, and infectious virus studies were used to characterize 15 engineered mutations in coxsackievirus B3 polymerase. Mutations that interfere with the transport of the metal A Mg(2+) ion into the active site had only minor effects on RdRP function, but the stacking interaction between Phe(364) and Pro(357), which is absolutely conserved in enteroviral polymerases, was found to be critical for processive elongation and virus growth. Mutating Phe(364) to tryptophan resulted in a genetically stable high fidelity virus variant with significantly reduced pathogenesis in mice. The data further illustrate the importance of the palm domain movement for RdRP active site closure and demonstrate that protein engineering can be used to alter viral polymerase function and attenuate virus growth and pathogenesis. PMID:27137934

  12. Virus-Host Coevolution in a Persistently Coxsackievirus B3-Infected Cardiomyocyte Cell Line ▿

    PubMed Central

    Pinkert, Sandra; Klingel, Karin; Lindig, Vanessa; Dörner, Andrea; Zeichhardt, Heinz; Spiller, O. Brad; Fechner, Henry

    2011-01-01

    Coevolution of virus and host is a process that emerges in persistent virus infections. Here we studied the coevolutionary development of coxsackievirus B3 (CVB3) and cardiac myocytes representing the major target cells of CVB3 in the heart in a newly established persistently CVB3-infected murine cardiac myocyte cell line, HL-1CVB3. CVB3 persistence in HL-1CVB3 cells represented a typical carrier-state infection with high levels (106 to 108 PFU/ml) of infectious virus produced from only a small proportion (approximately 10%) of infected cells. CVB3 persistence was characterized by the evolution of a CVB3 variant (CVB3-HL1) that displayed strongly increased cytotoxicity in the naive HL-1 cell line and showed increased replication rates in cultured primary cardiac myocytes of mouse, rat, and naive HL-1 cells in vitro, whereas it was unable to establish murine cardiac infection in vivo. Resistance of HL-1CVB3 cells to CVB3-HL1 was associated with reduction of coxsackievirus and adenovirus receptor (CAR) expression. Decreasing host cell CAR expression was partially overcome by the CVB3-HL1 variant through CAR-independent entry into resistant cells. Moreover, CVB3-HL1 conserved the ability to infect cells via CAR. The employment of a soluble CAR variant resulted in the complete cure of HL-1CVB3 cells with respect to the adapted virus. In conclusion, this is the first report of a CVB3 carrier-state infection in a cardiomyocyte cell line, revealing natural coevolution of CAR downregulation with CAR-independent viral entry in resistant host cells as an important mechanism of induction of CVB3 persistence. PMID:21976640

  13. Virus-host coevolution in a persistently coxsackievirus B3-infected cardiomyocyte cell line.

    PubMed

    Pinkert, Sandra; Klingel, Karin; Lindig, Vanessa; Dörner, Andrea; Zeichhardt, Heinz; Spiller, O Brad; Fechner, Henry

    2011-12-01

    Coevolution of virus and host is a process that emerges in persistent virus infections. Here we studied the coevolutionary development of coxsackievirus B3 (CVB3) and cardiac myocytes representing the major target cells of CVB3 in the heart in a newly established persistently CVB3-infected murine cardiac myocyte cell line, HL-1(CVB3). CVB3 persistence in HL-1(CVB3) cells represented a typical carrier-state infection with high levels (10(6) to 10(8) PFU/ml) of infectious virus produced from only a small proportion (approximately 10%) of infected cells. CVB3 persistence was characterized by the evolution of a CVB3 variant (CVB3-HL1) that displayed strongly increased cytotoxicity in the naive HL-1 cell line and showed increased replication rates in cultured primary cardiac myocytes of mouse, rat, and naive HL-1 cells in vitro, whereas it was unable to establish murine cardiac infection in vivo. Resistance of HL-1(CVB3) cells to CVB3-HL1 was associated with reduction of coxsackievirus and adenovirus receptor (CAR) expression. Decreasing host cell CAR expression was partially overcome by the CVB3-HL1 variant through CAR-independent entry into resistant cells. Moreover, CVB3-HL1 conserved the ability to infect cells via CAR. The employment of a soluble CAR variant resulted in the complete cure of HL-1(CVB3) cells with respect to the adapted virus. In conclusion, this is the first report of a CVB3 carrier-state infection in a cardiomyocyte cell line, revealing natural coevolution of CAR downregulation with CAR-independent viral entry in resistant host cells as an important mechanism of induction of CVB3 persistence. PMID:21976640

  14. A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells.

    PubMed Central

    Shafren, D R; Williams, D T; Barry, R D

    1997-01-01

    The composition of the cellular receptor complex for coxsackievirus B3 (CVB3) has been an area of much contention for the last 30 years. Recently, two individual components of a putative CVB3 cellular receptor complex have been identified as (i) decay-accelerating factor (DAF) and (ii) the coxsackievirus-adenovirus receptor protein (CAR). The present study elucidates the individual roles of DAF and CAR in cell entry of CVB3 Nancy. First, we confirm that the DAF-binding phenotype of CVB3 correlates to the presence of key amino acids located in the viral capsid protein, VP2. Second, using antibody blockade, we show that complete protection of permissive cells from infection by high input multiplicities of CVB3 requires a combination of both anti-DAF and anti-CAR antibodies. Finally, it is shown that expression of the CAR protein on the surface of nonpermissive DAF-expressing RD cells renders them highly susceptible to CVB3-mediated lytic infection. Therefore, although the majority of CVB3 Nancy attaches to the cell via DAF, only virus directly interacting with the CAR protein mediates lytic infection. The role of DAF in CVB3 cell infection may be analogous to that recently described for coxsackievirus A21 (D. R. Shafren, D. J. Dorahy, R. A. Ingham, G. F. Burns, and R. D. Barry, J. Virol. 71:4736-4743, 1997), in that DAF may act as a CVB3 sequestration site, enhancing viral presentation to the functional CAR protein. PMID:9371658

  15. Coxsackievirus B3-Induced Cellular Protrusions: Structural Characteristics and Functional Competence▿†

    PubMed Central

    Paloheimo, Outi; Ihalainen, Teemu O.; Tauriainen, Sisko; Välilehto, Outi; Kirjavainen, Sanna; Niskanen, Einari A.; Laakkonen, Johanna P.; Hyöty, Heikki; Vihinen-Ranta, Maija

    2011-01-01

    Virus-induced alterations in cell morphology play important roles in the viral life cycle. To examine the intracellular events of coxsackievirus B3 (CVB3) infection, green monkey kidney (GMK) cells were either inoculated with the virus or transfected with the viral RNA. Various microscopic and flow cytometric approaches demonstrated the emergence of CVB3 capsid proteins at 8 h posttransfection, followed by morphological transformation of the cells. The morphological changes included formation of membranous protrusions containing viral capsids, together with microtubules and actin. Translocation of viral capsids into these protrusions was sensitive to cytochalasin D, suggesting the importance of actin in the process. Three-dimensional (3D) live-cell imaging demonstrated frequent contacts between cellular protrusions and adjacent cells. Markedly, in spite of an increase in the cellular viral protein content starting 8 h postinfection, no significant decrease in cell viability or increase in the amount of early apoptotic markers was observed by flow cytometry by 28 h postinfection. Comicroinjection of viral RNA and fluorescent dextran in the presence of neutralizing virus antibody suggested that these protrusions mediated the spread of infection from one cell to another prior to virus-induced cell lysis. Altogether, the CVB3-induced cellular protrusions could function as a hitherto-unknown nonlytic mechanism of cell-to-cell transmission exploited by enteroviruses. PMID:21525342

  16. A rapid and quantitative assay for measuring neutralizing antibodies of Coxsackievirus B3.

    PubMed

    Chen, Pan; Wu, Xing; Mao, Qunying; Gao, Fan; Hao, Xiaotian; Bian, Lianlian; Zhu, Fengcai; Li, Wenhui; Xu, Miao; Liang, Zhenglun

    2016-06-01

    Coxsackievirus B3 (CVB3) infection has been found to account for an increasing proportion cases of hand, foot and mouth disease (HFMD) in recent epidemiology studies. CVB3 is a single stranded, non-enveloped RNA virus and the infection can cause prominent health threat to pre-school children. Here, by taking approaches of reverse genetics, we established a single-round infection system for CVB3. The pseudovirus was produced by sequential transfection of CVB3 capsid expresser plasmid and CVB3 replicon RNA bearing firefly luciferase as a reporter. The CVB3 pseudovirus system was used for quantifying neutralizing antibody (NtAb) levels of 720 human serum samples and showed superior specificity and sensitivity comparing traditional cytopathic effect (CPE) assay. Furthermore, we compared the seroprevalence of CVB3 NtAbs in pre-school children and healthy adults, and found that only 11.94% of pre-school children were NtAbs positive which suggested that most children were naive to CVB3 infection; while there is much higher positive rate in adults (60%) indicating that most adults have experienced CVB3 infection during childhood. This rapid and quantitative assay greatly facilitates evaluating the level of NtAbs against CVB3 in populations and will help to advance CVB3 vaccine development. PMID:26947399

  17. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo

    PubMed Central

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-01-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3Cpro) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9–11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×106 TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  18. Antimyocarditic activity of the guanine derivative BIOLF-70 in a coxsackievirus B3 murine model.

    PubMed Central

    Gauntt, C J; Arizpe, H M; Kung, J T; Ogilvie, K K; Cheriyan, U O

    1985-01-01

    Prophylactic administration of a nontoxic dose of 9-[[2-benzyloxyl-1-(benzyloxymethyl)ethoxy]methyl]-6-chlo roguanine (BIOLF-70) to mice reduced the number of myocarditic lesions induced by coxsackievirus B3 (CVB3). BIOLF-70 exhibited minimal antiviral activity against CVB3 in HeLa cells and murine neonatal skin fibroblasts and minimally reduced CVB3 yields in heart tissues. The drug had no effect on serum anti-CVB3 neutralizing antibody titers and did not induce the production of interferon. Flow microfluorometric analyses of splenic lymphocytes taken from BIOLF-70-treated, CVB3-inoculated mice at 7 days postinoculation showed that the proportion of T lymphocytes was increased, as measured by fluorescent staining of Thy-1 and Lyt-2 surface markers, compared with the proportion of T lymphocytes in splenic cells from virus-inoculated or BIOLF-70-treated or normal groups of mice. Splenic lymphocytes from BIOLF-70-treated, CVB3-inoculated mice showed reduced cytotoxic activity against CVB3-infected target fibroblasts. Splenic cells from BIOLF-70-treated, CVB3-inoculated mice had slightly higher natural killer cell activity than did those from the other three groups of mice, which had comparatively similar levels of natural killer cell activity. The data suggest that BIOLF-70 exerts antimyocarditic activity perhaps by some antiviral activity in heart tissues and by immunomodulatory mechanisms which appear to involve T suppressor or T cytotoxic lymphocyte subpopulations and natural killer cells. PMID:2580480

  19. Antiviral activity of ginsenosides against coxsackievirus B3, enterovirus 71, and human rhinovirus 3

    PubMed Central

    Song, Jae-Hyoung; Choi, Hwa-Jung; Song, Hyuk-Hwan; Hong, Eun-Hye; Lee, Bo-Ra; Oh, Sei-Ryang; Choi, Kwangman; Yeo, Sang-Gu; Lee, Yong-Pyo; Cho, Sungchan; Ko, Hyun-Jeong

    2014-01-01

    Background Ginsenosides are the major components responsible for the biochemical and pharmacological actions of ginseng, and have been shown to have various biological activities. In this study, we investigated the antiviral activities of seven ginsenosides [protopanaxatriol (PT) type: Re, Rf, and Rg2; protopanaxadiol (PD) type: Rb1, Rb2, Rc, and Rd)] against coxsackievirus B3 (CVB3), enterovirus 71 (EV71), and human rhinovirus 3 (HRV3). Methods Assays of antiviral activity and cytotoxicity were evaluated by the sulforhodamine B method using the cytopathic effect (CPE) reduction assay. Results The antiviral assays demonstrated that, of the seven ginsenosides, the PT-type ginsenosides (Re, Rf, and Rg2) possess significant antiviral activities against CVB3 and HRV3 at a concentration of 100 μg/mL. Among the PT-type ginsenosides, only ginsenoside Rg2 showed significant anti-EV71 activity with no cytotoxicity to cells at 100 μg/mL. The PD-type ginsenosides (Rb1, Rb2, Rc, and Rd), by contrast, did not show any significant antiviral activity against CVB3, EV71, and HRV3, and exhibited cytotoxic effects to virus-infected cells. Notably, the antiviral efficacies of PT-type ginsenosides were comparable to those of ribavirin, a commonly used antiviral drug. Conclusion Collectively, our findings suggest that the ginsenosides Re, Rf, and Rg2 have the potential to be effective in the treatment of CVB3, EV71, and HRV3 infection. PMID:25378991

  20. Coxsackievirus B3 infection induces autophagic flux, and autophagosomes are critical for efficient viral replication.

    PubMed

    Shi, Xiaodan; Chen, Zijian; Tang, Shengjie; Wu, Fei; Xiong, Sidong; Dong, Chunsheng

    2016-08-01

    Autophagy is an intrinsic cellular process that can degrade cytoplasmic components. It has been reported that several pathogens hijack this process to facilitate their replication. Coxsackievirus B3 (CVB3), a member of the family Picornaviridae, induces autophagy upon infection. However, the details of CVB3-induced autophagy remain a subject of debate. This study applied a combination of multiple assays for the measurement of autophagy and demonstrated that CVB3 induces a complete autophagic flux. Experiments with infected HEK293A cells revealed that autophagosomes were induced upon CVB3 infection. Most of these autophagosomes were mCherry positive in mCherry-GFP-LC3 cells. Conversely, mCherry-positive autophagosomes were rescued to green positive when treated with the acidification inhibitors chloroquine (CQ) and bafilomycin A1 (BAF), suggesting that autophagosomes fused with late endosomes or lysosomes. The co-localization of LC3-positive puncta with lysosome-associated membrane protein 1 (LAMP1) or LysoTracker confirmed that the autophagosomes fused primarily with lysosomes. Interestingly, the disruption of autophagosome formation by 3-methyladenine (3-MA) or ATG5 siRNA treatment during viral infection significantly decreased CVB3 replication. However, inhibitors of lysosomal acidification, fusion, or degradation did not affect viral replication. Therefore, autolysosomes may not be critical for viral replication in vitro. PMID:27224983

  1. The role of CD8+ T lymphocytes in coxsackievirus B3-induced myocarditis.

    PubMed Central

    Henke, A; Huber, S; Stelzner, A; Whitton, J L

    1995-01-01

    Coxsackievirus infections have previously been shown to cause acute or chronic myocarditis in humans, and several mouse models have been established to study the pathology of this disease. Myocardial injury may result from direct viral effects and/or may be immune mediated. To determine the relative roles of these processes in pathogenesis, we have compared coxsackievirus B3 (CVB3) infections of normal and immuno-compromised transgenic knockout (ko) mice. CVB3 was able to infect all strains used (C57BL/6, CD4ko, and beta-microglobulin ko [beta 2Mko]), and following intraperitoneal injection, two disease processes could be distinguished. First, the virus caused early (3 to 7 days postinfection) death in a viral dose-dependent manner. Immunocompetent C57BL/6 mice were highly susceptible (50% lethal dose = 70 PFU), while immunodeficient transgenic ko mice were less susceptible, showing 10- and 180-fold increases in the 50% lethal dose (for CD4ko and beta 2Mko mice, respectively). Second, a histologic examination of surviving CD4ko mice at 7 days postinfection revealed severe myocarditis; the inflammatory infiltrate comprised 40 to 50% macrophages, 30 to 40% NK cells, and 10 to 20% CD8+ T lymphocytes. The infiltration resolved over the following 2 to 3 weeks, with resultant myocardial fibrosis. In vivo depletion of CD8+ T lymphocytes from these CD4ko mice led to a marked reduction in myocarditis and an increase in myocardial virus titers. beta 2Mko mice, which lack antiviral CD8+ T cells, are much less susceptible to early death and to the development of myocarditis. We conclude that our data support a strong immunopathologic component in CVB3-induced disease and implicate both CD4+ and CD8+ T cells. Compared with immunocompetent animals, (i) mice lacking CD4+ T cells (CD4ko) were more resistant to virus challenge, and (ii) mice lacking CD8+ T cells (beta 2Mko and in vivo-depleted CD4ko) showed enhanced survival and a reduced incidence of the later myocarditis

  2. Reversion to wildtype of a mutated and nonfunctional coxsackievirus B3CRE(2C).

    PubMed

    Smithee, Shane; Tracy, Steven; Chapman, Nora M

    2016-07-15

    The cis-acting replication element (CRE) in the 2C protein coding region [CRE(2C)] of enteroviruses (EV) facilitates the addition of two uridine residues (uridylylation) onto the virus-encoded protein VPg in order for it to serve as the RNA replication primer. We demonstrated that coxsackievirus B3 (CVB3) is replication competent in the absence of a native (uridylylating) CRE(2C) and also demonstrated that lack of a functional CRE(2C) led to generation of 5' terminal genomic deletions in the CVB3 CRE-knock-out (CVB3-CKO) population. We asked whether reversion of the mutated CRE(2C) occurred, thus permitting sustained replication, and when were 5' terminal deletions generated during replication. Virions were isolated from HeLa cells previously electroporated with infectious CVB3-CKO T7 transcribed RNA or from hearts and spleens of mice after transfection with CVB3-CKO RNA. Viral RNA was isolated in order to amplify the CRE(2C) coding region and the genomic 5' terminal sequences. Sequence analysis revealed reversion of the CVB3-CKO sequence to wildtype occurs by 8 days post-electroporation of HeLa cells and by 20days post-transfection in mice. However, 5' terminal deletions evolve prior to these times. Reversion of the CRE(2C) mutations to wildtype despite loss of the genomic 5' termini is consistent with the hypothesis that an intact CRE(2C) is inherently vital to EV replication even when it is not enabling efficient positive strand initiation. PMID:27130630

  3. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo.

    PubMed

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-09-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3C(pro)) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9-11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×10(6) TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  4. Human Cardiac-Derived Adherent Proliferating Cells Reduce Murine Acute Coxsackievirus B3-Induced Myocarditis

    PubMed Central

    Miteva, Kapka; Haag, Marion; Peng, Jun; Savvatis, Kostas; Becher, Peter Moritz; Seifert, Martina; Warstat, Katrin; Westermann, Dirk; Ringe, Jochen; Sittinger, Michael; Schultheiss, Heinz-Peter

    2011-01-01

    Background Under conventional heart failure therapy, inflammatory cardiomyopathy typically has a progressive course, indicating a need for alternative therapeutic strategies to improve long-term outcomes. We recently isolated and identified novel cardiac-derived cells from human cardiac biopsies: cardiac-derived adherent proliferating cells (CAPs). They have similarities with mesenchymal stromal cells, which are known for their anti-apoptotic and immunomodulatory properties. We explored whether CAPs application could be a novel strategy to improve acute Coxsackievirus B3 (CVB3)-induced myocarditis. Methodology/Principal Findings To evaluate the safety of our approach, we first analyzed the expression of the coxsackie- and adenovirus receptor (CAR) and the co-receptor CD55 on CAPs, which are both required for effective CVB3 infectivity. We could demonstrate that CAPs only minimally express both receptors, which translates to minimal CVB3 copy numbers, and without viral particle release after CVB3 infection. Co-culture of CAPs with CVB3-infected HL-1 cardiomyocytes resulted in a reduction of CVB3-induced HL-1 apoptosis and viral progeny release. In addition, CAPs reduced CD4 and CD8 T cell proliferation. All CAPs-mediated protective effects were nitric oxide- and interleukin-10-dependent and required interferon-γ. In an acute murine model of CVB3-induced myocarditis, application of CAPs led to a decrease of cardiac apoptosis, cardiac CVB3 viral load and improved left ventricular contractility parameters. This was associated with a decline in cardiac mononuclear cell activity, an increase in T regulatory cells and T cell apoptosis, and an increase in left ventricular interleukin-10 and interferon-γ mRNA expression. Conclusions We conclude that CAPs are a unique type of cardiac-derived cells and promising tools to improve acute CVB3-induced myocarditis. PMID:22174827

  5. Copper deficiency increases the virulence of amyocarditic and myocarditic strains of coxsackievirus B3 in mice.

    PubMed

    Smith, Allen D; Botero, Sebastian; Levander, Orville A

    2008-05-01

    Deficiency in several trace elements, including copper and selenium, is associated with increased levels of oxidative stress. Copper deficiency also has been shown to impair immune function. Previous work by others demonstrated that passage of an amyocarditic or myocarditic strain of coxsackievirus B3 (CVB3) through selenium- or vitamin E-deficient mice led to increased cardiac pathology. To determine whether a copper deficiency would similarly alter the pathogenesis of CVB3 infections, Swiss outbred dams and their litters were fed copper-deficient diets from birth and received either deionized water or water with 0.315 mmol/L copper as copper sulfate. At 4 wk of age, copper-adequate or -deficient male and female offspring were infected with an amyocarditic or myocarditic strain of CVB3. Heart titers were elevated at d 3 and 7 postinfection in copper-deficient mice infected with the myocarditic CVB3 strain (CVB3/20) but only at d 7 in deficient mice infected with the amyocarditic CVB3 strain (CVB3/0) compared with copper-adequate controls. Copper-deficient mice infected with either strain of CVB3 had increased cardiac pathology compared with copper-adequate controls. Genomic sequences of viruses isolated from copper-adequate and -deficient mice were identical. Heart cytokine expression was elevated in copper-deficient CVB3-infected mice compared with infected controls. Circulating CVB3-specific IgG2a but not IgM levels were decreased in copper-deficient mice. Thus, copper deficiency is associated with an increased inflammatory response but decreased acquired immune response to CVB3 infection that results in increased cardiac pathology, presumably due to increased viral load. PMID:18424590

  6. Comparison of Effects of Ivabradine versus Carvedilol in Murine Model with the Coxsackievirus B3-Induced Viral Myocarditis

    PubMed Central

    Yue-Chun, Li; Teng, Zhang; Na-Dan, Zhou; Li-Sha, Ge; Qin, Luo; Xue-Qiang, Guan; Jia-Feng, Lin

    2012-01-01

    Background Elevated heart rate is associated with increased cardiovascular morbidity. The selective If current inhibitor ivabradine reduces heart rate without affecting cardiac contractility, and has been shown to be cardioprotective in the failing heart. Ivabradine also exerts some of its beneficial effects by decreasing cardiac proinflammatory cytokines and inhibiting peroxidants and collagen accumulation in atherosclerosis or congestive heart failure. However, the effects of ivabradine in the setting of acute viral myocarditis and on the cytokines, oxidative stress and cardiomyocyte apoptosis have not been investigated. Methodology/Principal Findings The study was designed to compare the effects of ivabradine and carvedilol in acute viral myocarditis. In a coxsackievirus B3 murine myocarditis model (Balb/c), effects of ivabradine and carvedilol (a nonselective β-adrenoceptor antagonist) on myocardial histopathological changes, cardiac function, plasma noradrenaline, cytokine levels, cardiomyocyte apoptosis, malondialdehyde and superoxide dismutase contents were studied. Both ivabradine and carvedilol similarly and significantly reduced heart rate, attenuated myocardial lesions and improved the impairment of left ventricular function. In addition, ivabradine treatment as well as carvedilol treatment showed significant effects on altered myocardial cytokines with a decrease in the amount of plasma noradrenaline. The increased myocardial MCP-1, IL-6, and TNF-α. in the infected mice was significantly attenuated in the ivabradine treatment group. Only carvedilol had significant anti-oxidative and anti-apoptoic effects in coxsackievirus B3-infected mice. Conclusions/Significance These results show that the protective effects of heart rate reduction with ivabradine and carvedilol observed in the acute phase of coxsackievirus B3 murine myocarditis may be due not only to the heart rate reduction itself but also to the downregulation of inflammatory cytokines. PMID

  7. An epidemic of coxsackievirus B3 infection in infants and children in Jiangsu Province, China: a prospective cohort study.

    PubMed

    Gao, Fan; Bian, Lian-Lian; Mao, Qun-Ying; Chen, Pan; Yao, Xin; Li, Jing-Xin; Zhu, Feng-Cai; Liang, Zheng-Lun

    2016-07-01

    To investigate the epidemiological data on coxsackievirus B3 (CVB3) infection and its incidence in infants and children, a prospective cohort study was carried out from 2012 to 2014 in Jiangsu Province, China. According to the results of seropositive rates and NTAb titers of CVB3, an epidemic of CVB3 infection was found, and a dynamic change in CVB3 neutralizing antibody was also observed. One case was recorded with CVB3-associated hand, foot and mouth disease (HFMD), and the isolates belonged to the CVB3 D2 subtype. Our data help us to better understand the epidemic characteristics of CVB3 infection in infants and children. PMID:27020571

  8. Induction of cytopathic effect and cytokines in coxsackievirus B3-infected murine astrocytes

    PubMed Central

    2013-01-01

    Background Coxsackievirus commonly infects children and occasionally causes severe meningitis and/or encephalitis in the newborn. The underlying mechanism(s) behind the central nervous system pathology is poorly defined. Methods It is hypothesized that astrocytes may be involved in inflammatory response induced by CVB3 infection. Here we discuss this hypothesis in the context of CVB3 infection and associated inflammatory response in primary mouse astrocytes. Results The results showed that coxsackievirus receptor (CAR) was distributed homogeneously on the astrocytes, and that CVB3 could infect and replicate in astrocytes, with release of infectious virus particles. CVB3 induced cytopathic effect and production of proinflammatory cytokines IL-1β, TNF-α, IL-6, and chemokine CXCL10 from astrocytes. Conclusion These data suggest that direct astrocyte damage and cytokines induction could be a mechanism of virus-induced meningitis and/or encephalitis. PMID:23693026

  9. Genomic characterization of coxsackievirus type B3 strains associated with acute flaccid paralysis in south-western India.

    PubMed

    Laxmivandana, Rongala; Cherian, Sarah S; Yergolkar, Prasanna; Chitambar, Shobha D

    2016-03-01

    Acute flaccid paralysis (AFP) associated with coxsackievirus type B3 (CV-B3) of the species Enterovirus B is an emerging concern worldwide. Although CV-B3-associated AFP in India has been demonstrated previously, the genomic characterization of these strains is unreported. Here, CV-B3 strains detected on the basis of the partial VP1 gene in 10 AFP cases and five asymptomatic contacts identified from different regions of south-western India during 2009-2010 through the Polio Surveillance Project were considered for complete genome sequencing and characterization. Phylogenetic analysis of complete VP1 gene sequences of global CV-B3 strains classified Indian CV-B3 strains into genogroup GVI, along with strains from Uzbekistan and Bangladesh, and into a new genogroup, GVII. Genomic divergence between genogroups of the study strains was 14.4 % with significantly lower divergence (1.8 %) within GVI (n = 12) than that within GVII (8.5 %) (n = 3). The strains from both AFP cases and asymptomatic contacts, identified mainly in coastal Karnataka and Kerala, belonged to the dominant genogroup GVI, while the GVII strains were recovered from AFP cases in north interior Karnataka. All study strains carried inter-genotypic recombination with the structural region similar to reference CV-B3 strains, and 5' non-coding regions and non-structural regions closer to other enterovirus B types. Domain II structures of 5' non-coding regions, described to modulate virus replication, were predicted to have varied structural folds in the two genogroups and were attributed to differing recombination patterns. The results indicate two distinct genomic compositions of CV-B3 strains circulating in India and suggest the need for concurrent analysis of viral and host factors to further understand the varied manifestations of their infections. PMID:26743460

  10. Antiviral Activity of Oroxylin A against Coxsackievirus B3 Alleviates Virus-Induced Acute Pancreatic Damage in Mice

    PubMed Central

    Kang, Ju Won; Hwang, Sam Noh; Rhee, Ki-Jong; Shim, Aeri; Hong, Eun-Hye; Kim, Yeon-Jeong; Jeon, Sang-Min; Chang, Sun-Young; Kim, Dong-Eun; Cho, Sungchan; Ko, Hyun-Jeong

    2016-01-01

    The flavonoids mosloflavone, oroxylin A, and norwogonin, which were purified from Scutellaria baicalensis Georgi, significantly protected Vero cells against Coxsackievirus B3 (CVB3)-induced cell death. To investigate the in vivo antiviral activity of oroxylin A, we intraperitoneally inoculated CVB3 into 4-week-old BALB/c mice. Body weights and blood glucose levels of the mice were decreased after CVB3 infection, and these changes were attenuated by the administration of oroxylin A. Importantly, treatment of mice with oroxylin A reduced viral titers in the pancreas and decreased the serum levels of the inflammatory cytokines including interleukin-6 (IL-6) and tumor necrosis factor (TNF)-α. Additionally, the administration of oroxylin A mitigated the histological pancreatic lesions and apoptotic cell death induced by CVB3 infection and increased the levels of phospho-eIF2α in infected pancreata. The results suggest that oroxylin A may represent a potent antiviral agent against CVB3 infection. PMID:27195463

  11. Protein 2B of Coxsackievirus B3 Induces Autophagy Relying on Its Transmembrane Hydrophobic Sequences

    PubMed Central

    Wu, Heng; Zhai, Xia; Chen, Yang; Wang, Ruixue; Lin, Lexun; Chen, Sijia; Wang, Tianying; Zhong, Xiaoyan; Wu, Xiaoyu; Wang, Yan; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2016-01-01

    Coxsackievirus B (CVB) belongs to Enterovirus genus within the Picornaviridae family, and it is one of the most common causative pathogens of viral myocarditis in young adults. The pathogenesis of myocarditis caused by CVB has not been completely elucidated. In CVB infection, autophagy is manipulated to facilitate viral replication. Here we report that protein 2B, one of the non-structural proteins of CVB3, possesses autophagy-inducing capability. The autophagy-inducing motif of protein 2B was identified by the generation of truncated 2B and site-directed mutagenesis. The expression of 2B alone was sufficient to induce the formation of autophagosomes in HeLa cells, while truncated 2B containing the two hydrophobic regions of the protein also induced autophagy. In addition, we demonstrated that a single amino acid substitution (56V→A) in the stem loop in between the two hydrophobic regions of protein 2B abolished the formation of autophagosomes. Moreover, we found that 2B and truncated 2B with autophagy-inducting capability were co-localized with LC3-II. This study indicates that protein 2B relies on its transmembrane hydrophobic regions to induce the formation of autophagosomes, while 56 valine residue in the stem loop of protein 2B might exert critical structural influence on its two hydrophobic regions. These results may provide new insight for understanding the molecular mechanism of autophagy triggered by CVB infection. PMID:27187444

  12. Protein 2B of Coxsackievirus B3 Induces Autophagy Relying on Its Transmembrane Hydrophobic Sequences.

    PubMed

    Wu, Heng; Zhai, Xia; Chen, Yang; Wang, Ruixue; Lin, Lexun; Chen, Sijia; Wang, Tianying; Zhong, Xiaoyan; Wu, Xiaoyu; Wang, Yan; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2016-01-01

    Coxsackievirus B (CVB) belongs to Enterovirus genus within the Picornaviridae family, and it is one of the most common causative pathogens of viral myocarditis in young adults. The pathogenesis of myocarditis caused by CVB has not been completely elucidated. In CVB infection, autophagy is manipulated to facilitate viral replication. Here we report that protein 2B, one of the non-structural proteins of CVB3, possesses autophagy-inducing capability. The autophagy-inducing motif of protein 2B was identified by the generation of truncated 2B and site-directed mutagenesis. The expression of 2B alone was sufficient to induce the formation of autophagosomes in HeLa cells, while truncated 2B containing the two hydrophobic regions of the protein also induced autophagy. In addition, we demonstrated that a single amino acid substitution (56V→A) in the stem loop in between the two hydrophobic regions of protein 2B abolished the formation of autophagosomes. Moreover, we found that 2B and truncated 2B with autophagy-inducting capability were co-localized with LC3-II. This study indicates that protein 2B relies on its transmembrane hydrophobic regions to induce the formation of autophagosomes, while 56 valine residue in the stem loop of protein 2B might exert critical structural influence on its two hydrophobic regions. These results may provide new insight for understanding the molecular mechanism of autophagy triggered by CVB infection. PMID:27187444

  13. The antiviral effect of jiadifenoic acids C against coxsackievirus B3

    PubMed Central

    Ge, Miao; Wang, Huiqiang; Zhang, Guijie; Yu, Shishan; Li, Yuhuan

    2014-01-01

    Coxsackievirus B type 3 (CVB3) is one of the major causative pathogens associated with viral meningitis and myocarditis, which are widespread in the human population and especially prevalent in neonates and children. These infections can result in dilated cardiomyopathy (DCM) and other severe clinical complications. There are no vaccines or drugs approved for the prevention or therapy of CVB3-induced diseases. During screening for anti-CVB3 candidates in our previous studies, we found that jiadifenoic acids C exhibited strong antiviral activities against CVB3 as well as other strains of Coxsackie B viruses (CVBs). The present studies were carried out to evaluate the antiviral activities of jiadifenoic acids C. Results showed that jiadifenoic acids C could reduce CVB3 RNA and proteins synthesis in a dose-dependent manner. Jiadifenoic acids C also had a similar antiviral effect on the pleconaril-resistant variant of CVB3. We further examined the impact of jiadifenoic acids C on the synthesis of viral structural and non-structural proteins, finding that jiadifenoic acids C could reduce VP1 and 3D protein production. A time-course study with Vero cells showed that jiadifenoic acids C displayed significant antiviral activities at 0–6 h after CVB3 inoculation, indicating that jiadifenoic acids C functioned at an early step of CVB3 replication. However, jiadifenoic acids C had no prophylactic effect against CVB3. Taken together, we show that jiadifenoic acids C exhibit strong antiviral activities against all strains of CVB, including the pleconaril-resistant variant. Our study could provide a significant lead for anti-CVB3 drug development. PMID:26579396

  14. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  15. Dose-dependent protective effect of nicotine in a murine model of viral myocarditis induced by coxsackievirus B3

    PubMed Central

    Li-Sha, Ge; Jing-Lin, Zhao; Guang-Yi, Chen; Li, Liu; De-Pu, Zhou; Yue-Chun, Li

    2015-01-01

    The alpha 7 nicotinic acetylcholine receptor (alpha7 nAChR) was recently described as an anti-inflammatory target in various inflammatory diseases. The aim of this study was to investigate the dose-related effects of nicotine, an alpha7 nAChR agonist, in murine model of viral myocarditis. BALB/C mice were infected by an intraperitoneally injection with coxsackievirus B3. Nicotine was administered at doses of 0.1, 0.2 or 0.4 mg/kg three times per day for 7 or 14 consecutive days. The effects of nicotine on survival, myocardial histopathological changes, cardiac function, and cytokine levels were studied. The survival rate on day 14 increased in a dose-dependent fashion and was markedly higher in the 0.2 and 0.4 mg/kg nicotine groups than in the infected untreated group. Treatment with high-dose nicotine reduced the myocardial inflammation and improved the impaired left ventricular function in infected mice. The mRNA expressions and protein levels of TNF-α, IL-1β, IL-6, and IL-17A were significantly downregulated in dose-dependent manners in the nicotine treatment groups compared to the infected untreated group. Nicotine dose-dependently reduced the severity of viral myocarditis through inhibiting the production of proinflammatory cytokines. The findings suggest that alpha7 nAChR agonists may be a promising new strategy for patients with viral myocarditis. PMID:26507386

  16. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis.

    PubMed Central

    Godeny, E. K.; Gauntt, C. J.

    1987-01-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an 35S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice. Images Figure 1 Figure 2 Figure 3 PMID:2823612

  17. Panax Notoginseng Saponins Ameliorates Coxsackievirus B3-Induced Myocarditis by Activating the Cystathionine-γ-Lyase/Hydrogen Sulfide Pathway.

    PubMed

    Pan, Lulu; Zhang, Yuanhai; Lu, Jiacheng; Geng, Zhimin; Jia, Lianhong; Rong, Xing; Wang, Zhenquan; Zhao, Qifeng; Wu, Rongzhou; Chu, Maoping; Zhang, Chunxiang

    2015-12-01

    This study is to determine the therapeutic effects of Panax notoginseng saponins (PNSs) on coxsackievirus B3 (CVB3)-induced myocarditis, and whether cystathionine-γ-lyase (CSE)/hydrogen sulfide (H2S) pathway is involved. Mouse model of myocarditis was induced by CVB3 infection, and the mice were subjected to vehicle (saline) or drug treatments (sodium bisulfide (NaHS), propargylglycine (PAG), or PNSs). The results showed that there were inflammatory cell infiltrations, interstitial edemas, and elevated inflammatory cytokines, in CVB3-induced myocarditis. PAG administration increased, whereas NaHS treatment decreased the severity of the myocarditis. PNS treatment dramatically alleviated these myocardial injuries and decreased the viral messenger RNA (mRNA) expression by the enhanced expression of CSE/H2S pathway. Moreover, the therapeutic effects of PNSs on myocarditis were stronger than those of NaHS. Finally, the effect of PNSs on CSE/H2S pathway and cardiac cell protection were verified in cultured cardiac cells. PNSs may be a promising medication for viral myocarditis therapy. PMID:26525047

  18. 2,3,4-Trihydroxybenzyl-hydrazide analogues as novel potent coxsackievirus B3 3C protease inhibitors.

    PubMed

    Kim, Bo-Kyoung; Ko, Hyojin; Jeon, Eun-Seok; Ju, Eun-Seon; Jeong, Lak Shin; Kim, Yong-Chul

    2016-09-14

    Human coxsackievirus B3 (CVB3) 3C protease plays an essential role in the viral replication of CVB3, which is a non-enveloped and positive single-stranded RNA virus belonging to Picornaviridae family, causing acute viral myocarditis mainly in children. During optimization based on SAR studies of benserazide (3), which was reported as a novel anti-CVB3 3C(pro) agent from a screening of compound libraries, the 2,3,4-trihydroxybenzyl moiety of 3 was identified as a key pharmacophore for inhibitory activity against CVB3 3C(pro). Further optimization was performed by the introduction of various aryl-alkyl substituted hydrazide moieties instead of the serine moiety of 3. Among the optimized compounds, 11Q, a 4-hydroxyphenylpentanehydrazide derivative, showed the most potent inhibitory activity (IC50 = 0.07 μM). Enzyme kinetics studies indicated that 11Q exhibited a mixed inhibitory mechanism of action. The antiviral activity against CVB3 was confirmed using the further derived analogue (14b) with more cell permeable valeryl ester group at the 2,3,4-trihydroxy moiety. PMID:27191615

  19. Caspase Activation and Specific Cleavage of Substrates after Coxsackievirus B3-Induced Cytopathic Effect in HeLa Cells

    PubMed Central

    Carthy, Christopher M.; Granville, David J.; Watson, Kathleen A.; Anderson, Daniel R.; Wilson, Janet E.; Yang, Decheng; Hunt, David W. C.; McManus, Bruce M.

    1998-01-01

    Coxsackievirus B3 (CVB3), an enterovirus in the family Picornaviridae, induces cytopathic changes in cell culture systems and directly injures multiple susceptible organs and tissues in vivo, including the myocardium, early after infection. Biochemical analysis of the cell death pathway in CVB3-infected HeLa cells demonstrated that the 32-kDa proform of caspase 3 is cleaved subsequent to the degenerative morphological changes seen in infected HeLa cells. Caspase activation assays confirm that the cleaved caspase 3 is proteolytically active. The caspase 3 substrates poly(ADP-ribose) polymerase, a DNA repair enzyme, and DNA fragmentation factor, a cytoplasmic inhibitor of an endonuclease responsible for DNA fragmentation, were degraded at 9 h following infection, yielding their characteristic cleavage fragments. Inhibition of caspase activation by benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (ZVAD.fmk) did not inhibit the virus-induced cytopathic effect, while inhibition of caspase activation by ZVAD.fmk in control apoptotic cells induced by treatment with the porphyrin photosensitizer benzoporphyrin derivative monoacid ring A and visible light inhibited the apoptotic phenotype. Caspase activation and cleavage of substrates may not be responsible for the characteristic cytopathic effect produced by picornavirus infection yet may be related to late-stage alterations of cellular homeostatic processes and structural integrity. PMID:9696873

  20. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis

    SciTech Connect

    Godeny, E.K.; Gauntt, C.J.

    1987-11-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an /sup 35/S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice.

  1. GBF1, a Guanine Nucleotide Exchange Factor for Arf, Is Crucial for Coxsackievirus B3 RNA Replication▿

    PubMed Central

    Lanke, Kjerstin H. W.; van der Schaar, Hilde M.; Belov, George A.; Feng, Qian; Duijsings, Daniël; Jackson, Catherine L.; Ehrenfeld, Ellie; van Kuppeveld, Frank J. M.

    2009-01-01

    The replication of enteroviruses is sensitive to brefeldin A (BFA), an inhibitor of endoplasmic reticulum-to-Golgi network transport that blocks activation of guanine exchange factors (GEFs) of the Arf GTPases. Mammalian cells contain three BFA-sensitive Arf GEFs: GBF1, BIG1, and BIG2. Here, we show that coxsackievirus B3 (CVB3) RNA replication is insensitive to BFA in MDCK cells, which contain a BFA-resistant GBF1 due to mutation M832L. Further evidence for a critical role of GBF1 stems from the observations that viral RNA replication is inhibited upon knockdown of GBF1 by RNA interference and that replication in the presence of BFA is rescued upon overexpression of active, but not inactive, GBF1. Overexpression of Arf proteins or Rab1B, a GTPase that induces GBF1 recruitment to membranes, failed to rescue RNA replication in the presence of BFA. Additionally, the importance of the interaction between enterovirus protein 3A and GBF1 for viral RNA replication was investigated. For this, the rescue from BFA inhibition of wild-type (wt) replicons and that of mutant replicons of both CVB3 and poliovirus (PV) carrying a 3A protein that is impaired in binding GBF1 were compared. The BFA-resistant GBF1-M832L protein efficiently rescued RNA replication of both wt and mutant CVB3 and PV replicons in the presence of BFA. However, another BFA-resistant GBF1 protein, GBF1-A795E, also efficiently rescued RNA replication of the wt replicons, but not that of mutant replicons, in the presence of BFA. In conclusion, this study identifies a critical role for GBF1 in CVB3 RNA replication, but the importance of the 3A-GBF1 interaction requires further study. PMID:19740986

  2. Cyclosporine A Treatment Inhibits Abcc6-Dependent Cardiac Necrosis and Calcification following Coxsackievirus B3 Infection in Mice

    PubMed Central

    Marton, Jennifer; Albert, Danica; Wiltshire, Sean A.; Park, Robin; Bergen, Arthur; Qureshi, Salman; Malo, Danielle; Burelle, Yan; Vidal, Silvia M.

    2015-01-01

    Coxsackievirus type B3 (CVB3) is a cardiotropic enterovirus. Infection causes cardiomyocyte necrosis and myocardial inflammation. The damaged tissue that results is replaced with fibrotic or calcified tissue, which can lead to permanently altered cardiac function. The extent of pathogenesis among individuals exposed to CVB3 is dictated by a combination of host genetics, viral virulence, and the environment. Here, we aimed to identify genes that modulate cardiopathology following CVB3 infection. 129S1 mice infected with CVB3 developed increased cardiac pathology compared to 129X1 substrain mice despite no difference in viral burden. Linkage analysis identified a major locus on chromosome 7 (LOD: 8.307, P<0.0001) that controlled the severity of cardiac calcification and necrosis following infection. Sub-phenotyping and genetic complementation assays identified Abcc6 as the underlying gene. Microarray expression profiling identified genotype-dependent regulation of genes associated with mitochondria. Electron microscopy examination showed elevated deposition of hydroxyapatite-like material in the mitochondrial matrices of infected Abcc6 knockout (Abcc6-/-) mice but not in wildtype littermates. Cyclosporine A (CsA) inhibits mitochondrial permeability transition pore opening by inhibiting cyclophilin D (CypD). Treatment of Abcc6 -/- mice with CsA reduced cardiac necrosis and calcification by more than half. Furthermore, CsA had no effect on the CVB3-induced phenotype of doubly deficient CypD-/-Abcc6-/- mice. Altogether, our work demonstrates that mutations in Abcc6 render mice more susceptible to cardiac calcification following CVB3 infection. Moreover, we implicate CypD in the control of cardiac necrosis and calcification in Abcc6-deficient mice, whereby CypD inhibition is required for cardioprotection. PMID:26375467

  3. Development of an Enzyme-Linked Immunosorbent Spot Assay To Measure Serum-Neutralizing Antibodies against Coxsackievirus B3

    PubMed Central

    Yang, Lisheng; He, Delei; Tang, Min; Li, Zhiqun; Liu, Che; Xu, Longfa; Chen, Yixin; Du, Hailian; Zhao, Qinjian; Zhang, Jun; Xia, Ningshao

    2014-01-01

    Coxsackievirus B3 (CVB3) is the most common pathogen that induces acute and chronic viral myocarditis in children. The cytopathic effect (CPE)-based neutralization test (Nt-CPE) and the plaque reduction neutralization test (PRNT) are the most common methods for measuring neutralizing antibody titers against CVB3 in blood serum samples. However, these two methods are inefficient for CVB3 vaccine clinical trials, which require the testing of a large number of serum specimens. In this study, we developed an efficient neutralization test based on the enzyme-linked immunospot (Nt-ELISPOT) assay for measuring CVB3-neutralizing antibodies. This modified ELISPOT assay was based on the use of a monoclonal antibody against the viral capsid protein VP1 to detect the cells that are infected with CVB3, which, after immunoperoxidase staining, are counted as spots using an automated ELISPOT analyzer. Using the modified ELISPOT assay, we characterized the infection kinetics of CVB3 and divided the infection process of CVB3 on a cluster of cells into four phases. The stability of the Nt-ELISPOT was then evaluated. We found that over a wide range of infectious doses (102 to 106.5× 50% tissue culture infectious dose [TCID50] per well), the neutralizing titers of the sera were steady as long as they were tested during the log phase or the first half of the stationary phase of growth of the spots. We successfully shortened the testing period from 7 days to approximately 20 h. We also found that there was a good correlation (R2 = 0.9462) between the Nt-ELISPOT and the Nt-CPE assays. Overall, the Nt-ELISPOT assay is a reliable and efficient method for measuring neutralizing antibodies in serum. PMID:24391137

  4. Testosterone and interleukin-1β increase cardiac remodeling during coxsackievirus B3 myocarditis via serpin A 3n

    PubMed Central

    Coronado, Michael J.; Brandt, Jessica E.; Kim, Eunyong; Bucek, Adriana; Bedja, Djahida; Abston, Eric D.; Shin, Jaewook; Gabrielson, Kathleen L.; Mitzner, Wayne

    2012-01-01

    Myocarditis and dilated cardiomyopathy (DCM) are often caused by viral infections and occur more frequently in men than in women, but the reasons for the sex difference remain unclear. The aim of this study was to assess whether gene changes in the heart during coxsackievirus B3 (CVB3) myocarditis in male and female BALB/c mice predicted worse DCM in males. Although myocarditis (P = 4.2 × 10−5) and cardiac dilation (P = 0.008) were worse in males, there was no difference in viral replication in the heart. Fibrotic remodeling genes, such as tissue inhibitor of metalloproteinase (TIMP)-1 and serpin A 3n, were upregulated in males during myocarditis rather than during DCM. Using gonadectomy and testosterone replacement, we showed that testosterone increased cardiac TIMP-1 (P = 0.04), serpin A 3n (P = 0.007), and matrix metalloproteinase (MMP)-8 (P = 0.04) during myocarditis. Testosterone increased IL-1β levels in the heart (P = 0.02), a cytokine known to regulate cardiovascular remodeling, and IL-1β in turn increased cardiac serpin A 3n mRNA (P = 0.005). We found that 39 of 118 (33%) genes identified in acute DCM patients were significantly altered in the heart during CVB3 myocarditis in mice, including serpin A 3n (3.3-fold change, P = 0.0001). Recombinant serpin A 3n treatment induced cardiac fibrosis during CVB3 myocarditis (P = 0.0008) while decreasing MMP-3 (P = 0.04) and MMP-9 (P = 0.03) levels in the heart. Thus, serpin A 3n was identified as a gene associated with fibrotic cardiac remodeling and progression to DCM in male myocarditis patients and mice. PMID:22328081

  5. Direct interactions of coxsackievirus B3 with immune cells in the splenic compartment of mice susceptible or resistant to myocarditis.

    PubMed Central

    Anderson, D R; Wilson, J E; Carthy, C M; Yang, D; Kandolf, R; McManus, B M

    1996-01-01

    In vitro replication of coxsackievirus B3 (CVB3) in cells of the immune system derived from uninfected adolescent A/J and C57BL/6J mice and replication of CVB3 in and association with immune cells from spleens of infected animals in vivo were assessed. Nonstimulated or mitogen-stimulated spleen cells were minimally permissive for viral replication during an 8-h period. Three days postinfection (p.i.), CVB3 RNA was localized in vivo to B cells and follicular dendritic cells of germinal centers in both A/J and C57BL/6J mice; however, extrafollicular localization was greater in C57BL/6J mice (P = 0.0054). Although the pattern of CVB3 RNA localization was different, the total load of infections virus (PFU per milligram of tissue) was not different. Splenic CVB3 titers (PFU per milligram of tissue) in both strains were maximal at day 3 or 4 p.i. and were back to baseline by day 7 p.i., with most infectious virus being non-cell associated. CVB3 titers (PFU per milligram of tissue) correlated directly with in situ hybridization positivity in splenic follicles and extrafollicular regions in both murine strains; however, follicular hybridization intensity was greater in A/J mice at day 5 p.i. (P = 0.021). Flow cytometric analysis demonstrated that 50.4% of total spleen cells positive for CVB3 antigen were B cells and 69.6% of positive splenic lymphocytes were B cells. Myocardial virus load in C57BL/6J mice was significantly lower than that in A/J mice at days 4 and 5 p.i. These data indicate that CVB3 replicates in murine splenocytes in vitro and in B cells and extrafollicular cells in vivo. PMID:8676490

  6. Recruitment of PI4KIIIβ to Coxsackievirus B3 Replication Organelles Is Independent of ACBD3, GBF1, and Arf1

    PubMed Central

    Dorobantu, Cristina M.; van der Schaar, Hilde M.; Ford, Lauren A.; Strating, Jeroen R. P. M.; Ulferts, Rachel; Fang, Ying; Belov, George

    2014-01-01

    ABSTRACT Members of the Enterovirus (poliovirus [PV], coxsackieviruses, and human rhinoviruses) and Kobuvirus (Aichi virus) genera in the Picornaviridae family rely on PI4KIIIβ (phosphatidylinositol-4-kinase IIIβ) for efficient replication. The small membrane-anchored enteroviral protein 3A recruits PI4KIIIβ to replication organelles, yet the underlying mechanism has remained elusive. Recently, it was shown that kobuviruses recruit PI4KIIIβ through interaction with ACBD3 (acyl coenzyme A [acyl-CoA]-binding protein domain 3), a novel interaction partner of PI4KIIIβ. Therefore, we investigated a possible role for ACBD3 in recruiting PI4KIIIβ to enterovirus replication organelles. Although ACBD3 interacted directly with coxsackievirus B3 (CVB3) 3A, its depletion from cells by RNA interference did not affect PI4KIIIβ recruitment to replication organelles and did not impair CVB3 RNA replication. Enterovirus 3A was previously also proposed to recruit PI4KIIIβ via GBF1/Arf1, based on the known interaction of 3A with GBF1, an important regulator of secretory pathway transport and a guanine nucleotide exchange factor (GEF) of Arf1. However, our results demonstrate that inhibition of GBF1 or Arf1 either by pharmacological inhibition or depletion with small interfering RNA (siRNA) treatment did not affect the ability of 3A to recruit PI4KIIIβ. Furthermore, we show that a 3A mutant that no longer binds GBF1 was capable of recruiting PI4KIIIβ, even in ACBD3-depleted cells. Together, our findings indicate that unlike originally envisaged, coxsackievirus recruits PI4KIIIβ to replication organelles independently of ACBD3 and GBF1/Arf1. IMPORTANCE A hallmark of enteroviral infection is the generation of new membranous structures to support viral RNA replication. The functionality of these “replication organelles” depends on the concerted actions of both viral nonstructural proteins and co-opted host factors. It is thus essential to understand how these structures are

  7. Effect of T68A/N126Y mutations on the conformational and ligand binding landscape of Coxsackievirus B3 3C protease.

    PubMed

    Bhakat, Soumendranath

    2015-08-01

    3C protease of Coxsackievirus B3 (CVB3) plays an essential role in the viral replication cycle, and therefore, emerged as an attractive therapeutic target for the treatment of human diseases caused by CVB3 infection. In this study, we report the first account of the molecular impact of the T68A/N126Y double mutant (Mutant(Bound)) using an integrated computational approach. Molecular dynamics simulation and post-dynamics binding free energy, principal component analysis (PCA), hydrogen bond occupancy, SASA, R(g) and RMSF confirm that T68A/N126Y instigated an increased conformational flexibility due to the loss of intra- and inter-molecular hydrogen bond interactions and other prominent binding forces, which led to a decreased protease grip on the ligand (3CPI). The double mutations triggered a distortion orientation of 3CPI in the active site and decreases the binding energy, ΔG(bind) (∼3 kcal mol(-1)), compared to the wild type (Wild(Bound)). The van der Waals and electrostatic energy contributions coming from residues 68 and 126 are lower for Mutant(Bound) when compared with Wild(Bound). In addition, variation in the overall enzyme motion as evident from the PCA, distorted hydrogen bonding network and loss of protein-ligand interactions resulted in a loss of inhibitor efficiency. The comprehensive molecular insight gained from this study should be of great importance in understanding the drug resistance against CVB3 3C protease; also, it will assist in the designing of novel Coxsackievirus B3 inhibitors with high ligand efficacy on resistant strains. PMID:26077945

  8. Kinetic and Structural Analysis of Coxsackievirus B3 Receptor Interactions and Formation of the A-Particle

    PubMed Central

    Organtini, Lindsey J.; Makhov, Alexander M.; Conway, James F.

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) has been identified as the cellular receptor for group B coxsackieviruses, including serotype 3 (CVB3). CAR mediates infection by binding to CVB3 and catalyzing conformational changes in the virus that result in formation of the altered, noninfectious A-particle. Kinetic analyses show that the apparent first-order rate constant for the inactivation of CVB3 by soluble CAR (sCAR) at physiological temperatures varies nonlinearly with sCAR concentration. Cryo-electron microscopy (cryo-EM) reconstruction of the CVB3-CAR complex resulted in a 9.0-Å resolution map that was interpreted with the four available crystal structures of CAR, providing a consensus footprint for the receptor binding site. The analysis of the cryo-EM structure identifies important virus-receptor interactions that are conserved across picornavirus species. These conserved interactions map to variable antigenic sites or structurally conserved regions, suggesting a combination of evolutionary mechanisms for receptor site preservation. The CAR-catalyzed A-particle structure was solved to a 6.6-Å resolution and shows significant rearrangement of internal features and symmetric interactions with the RNA genome. IMPORTANCE This report presents new information about receptor use by picornaviruses and highlights the importance of attaining at least an ∼9-Å resolution for the interpretation of cryo-EM complex maps. The analysis of receptor binding elucidates two complementary mechanisms for preservation of the low-affinity (initial) interaction of the receptor and defines the kinetics of receptor-catalyzed conformational change to the A-particle. PMID:24623425

  9. MiR-10a* up-regulates coxsackievirus B3 biosynthesis by targeting the 3D-coding sequence

    PubMed Central

    Tong, Lei; Lin, Lexun; Wu, Shuo; Guo, Zhiwei; Wang, Tianying; Qin, Ying; Wang, Ruixue; Zhong, Xiaoyan; Wu, Xia; Wang, Yan; Luan, Tian; Wang, Qiang; Li, Yunxia; Chen, Xiaofeng; Zhang, Fengmin; Zhao, Wenran; Zhong, Zhaohua

    2013-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that can posttranscriptionally regulate gene expression by targeting messenger RNAs. During miRNA biogenesis, the star strand (miRNA*) is generally degraded to a low level in the cells. However, certain miRNA* express abundantly and can be recruited into the silencing complex to regulate gene expression. Most miRNAs function as suppressive regulators on gene expression. Group B coxsackieviruses (CVB) are the major pathogens of human viral myocarditis and dilated cardiomyopathy. CVB genome is a positive-sense, single-stranded RNA. Our previous study shows that miR-342-5p can suppress CVB biogenesis by targeting its 2C-coding sequence. In this study, we found that the miR-10a duplex could significantly up-regulate the biosynthesis of CVB type 3 (CVB3). Further study showed that it was the miR-10a star strand (miR-10a*) that augmented CVB3 biosynthesis. Site-directed mutagenesis showed that the miR-10a* target was located in the nt6818–nt6941 sequence of the viral 3D-coding region. MiR-10a* was detectable in the cardiac tissues of suckling Balb/c mice, suggesting that miR-10a* may impact CVB3 replication during its cardiac infection. Taken together, these data for the first time show that miRNA* can positively modulate gene expression. MiR-10a* might be involved in the CVB3 cardiac pathogenesis. PMID:23389951

  10. Mucosal immunization with high-mobility group box 1 in chitosan enhances DNA vaccine-induced protection against coxsackievirus B3-induced myocarditis.

    PubMed

    Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei; Xiong, Sidong

    2013-11-01

    Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

  11. Complement component 3 interactions with coxsackievirus B3 capsid proteins: innate immunity and the rapid formation of splenic antiviral germinal centers.

    PubMed Central

    Anderson, D R; Carthy, C M; Wilson, J E; Yang, D; Devine, D V; McManus, B M

    1997-01-01

    Innate immunity is central to the clearance of pathogens from hosts as well as to the definition of acquired immune responses (D. T. Fearon, and R. M. Locksley, Science 272:50-53, 1996). Coxsackievirus B3 (CVB3), a human cardiopathic virus, was evaluated for the ability to activate the alternative and classical pathway of complement. CVB3 proteins interact with complement component 3 (C3, a soluble protein effector of innate immunity) after either in vitro exposure to mouse serum or in vivo murine infection and activate the alternative pathway of complement. In addition, we demonstrate that viral antigen retention and localization in germinal centers is dependent on C3, while virus antigen retention in extrafollicular regions in the spleen is not. In vivo depletion of native C3 abolished the rapid formation of virus-specific germinal centers (by day 3 post-CVB3 infection) in the absence of serum anti-CVB3 antibodies. These studies demonstrate that innate immune mechanisms, such as C3 interaction with CVB3, are essential for splenic antiviral germinal center formation in naive (antigen nonsensitized) mice resistant (C57BL/6J strain) and susceptible (A/J strain) to CVB3-induced myocarditis. PMID:9343244

  12. Cellular Proteins Act as Bridge Between 5' and 3' Ends of the Coxsackievirus B3 Mediating Genome Circularization During RNA Translation.

    PubMed

    Souii, Amira; M'hadheb-Gharbi, Manel Ben; Gharbi, Jawhar

    2015-09-01

    The positive single-stranded RNA genome of the Coxsackievirus B3 (CVB3) contains a 5' untranslated region (UTR) which hosts the internal ribosome entry site (IRES) element that governs cap-independent translation initiation and a polyadenylated 3' UTR which is required for stimulating the IRES activity. Viral RNA genomes could circularize to regulate initiation of translation and RNA synthesis at 5' and 3' ends. Interactions could either take place by direct RNA-RNA contacts, through cellular protein bridges mediating RNA circularization or both. Accordingly, we aimed to assess the nature of molecular interactions between these two regions and to evaluate cellular factors required for mRNA 3' end-mediated stimulation of CVB3 IRES-driven translation. By gel shift assays, we have showed that combining, in vitro, 5' and 3' UTR fragments had no discernible effect on the structures of RNAs, arguing against the presence of specific canonical RNA-RNA cyclization sequences between these two regions. Competitive UV crosslinking assays using BHK-21 cell extract showed common cellular proteins eIF3b, PTB, and La binding to both 5'- and 3' end RNAs. PCBP 1-2 and PABP were shown to bind, respectively, to 5' and 3' UTR probes. Taking together, these data suggest that CVB3 5'-3' end bridging occurs through 5' UTR-protein-protein-3' UTR interactions and not through RNA-RNA direct contact. The dual involvement of the 3' and 5' UTRs in controlling viral translation and RNA synthesis highlights the relevance of these regions in the infectious virus life cycle, making them suitable candidates for targeted CVB3 antiviral therapy. PMID:26139182

  13. Mucosal co-immunization with AIM2 enhances protective SIgA response and increases prophylactic efficacy of chitosan-DNA vaccine against coxsackievirus B3-induced myocarditis

    PubMed Central

    Chai, Dafei; Yue, Yan; Xu, Wei; Dong, Chunsheng; Xiong, Sidong

    2014-01-01

    Coxsackievirus B3 (CVB3) infection is considered as the most common cause of viral myocarditis with no available vaccine. Considering that CVB3 mainly invades through the gastrointestinal mucosa, the development of CVB3-specific mucosal vaccine, which is the most efficient way to induce mucosal immune responses, gains more and more attention. In this study, we used absent in melanoma 2 (AIM2) as a mucosal adjuvant to enhance the immunogenicity and immunoprotection of CVB3-specific chitosan-pVP1 vaccine. Mice were intranasally co-immunized with 50 μg chitosan-pAIM2 and equal amount of chitosan-pVP1 vaccine 4 times at 2 week-intervals, and then challenged with CVB3 2 weeks after the last immunization. Compared with chitosan-pVP1 vaccine immunization alone, chitosan-pAIM2 co-immunization enhanced resistance to CVB3-induced myocarditis evidenced by significantly enhanced ejection fractions from 55.40 ± 9.35 to 80.31 ± 11.35, improved myocarditis scores from 1.50 ± 0.45 to 0.30 ± 0.15, reduced viral load from 3.33 ± 0.50 to 0.50 ± 0.65, and increased survival rate from 40.0% to 75.5%. This increased immunoprotection might be attributed to the augmented level of CVB3-specific fecal SIgA with high affinity and neutralizing ability. In addition, co-immunization with chitosan-pAIM2 remarkably facilitated dendritic cells (DCs) recruitment to mesenteric lymph nodes (MLN), and promoted the expression of IgA-inducing factors (BAFF, APRIL, iNOS, RALDH1, IL-6, TGF-β), which might account for its mucosal adjuvant effect. This strategy may represent a promising prophylactic vaccine against CVB3-induced myocarditis. PMID:24614684

  14. Cleavage of DAP5 by coxsackievirus B3 2A protease facilitates viral replication and enhances apoptosis by altering translation of IRES-containing genes.

    PubMed

    Hanson, P J; Ye, X; Qiu, Y; Zhang, H M; Hemida, M G; Wang, F; Lim, T; Gu, A; Cho, B; Kim, H; Fung, G; Granville, D J; Yang, D

    2016-05-01

    Cleavage of eukaryotic translation initiation factor 4G (eIF4G) by enterovirus proteases during infection leads to the shutoff of cellular cap-dependent translation, but does not affect the initiation of cap-independent translation of mRNAs containing an internal ribosome entry site (IRES). Death-associated protein 5 (DAP5), a structural homolog of eIF4G, is a translation initiation factor specific for IRES-containing mRNAs. Coxsackievirus B3 (CVB3) is a positive single-stranded RNA virus and a primary causal agent of human myocarditis. Its RNA genome harbors an IRES within the 5'-untranslated region and is translated by a cap-independent, IRES-driven mechanism. Previously, we have shown that DAP5 is cleaved during CVB3 infection. However, the protease responsible for cleavage, cleavage site and effects on the translation of target genes during CVB3 infection have not been investigated. In the present study, we demonstrated that viral protease 2A but not 3C is responsible for DAP5 cleavage, generating 45- and 52-kDa N- (DAP5-N) and C-terminal (DAP5-C) fragments, respectively. By site-directed mutagenesis, we found that DAP5 is cleaved at amino acid G434. Upon cleavage, DAP5-N largely translocated to the nucleus at the later time points of infection, whereas the DAP5-C largely remained in the cytoplasm. Overexpression of these DAP5 truncates demonstrated that DAP5-N retained the capability of initiating IRES-driven translation of apoptosis-associated p53, but not the prosurvival Bcl-2 (B-cell lymphoma 2) when compared with the full-length DAP5. Similarly, DAP5-N expression promoted CVB3 replication and progeny release; on the other hand, DAP5-C exerted a dominant-negative effect on cap-dependent translation. Taken together, viral protease 2A-mediated cleavage of DAP5 results in the production of two truncates that exert differential effects on protein translation of the IRES-containing genes, leading to enhanced host cell death. PMID:26586572

  15. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3.

    PubMed Central

    Knowlton, K U; Jeon, E S; Berkley, N; Wessely, R; Huber, S

    1996-01-01

    Coxsackievirus B3 (CVB3) infections induce myocarditis in humans and mice. Little is known about the molecular characteristics of CVB3 that activate the cellular immunity responsible for cardiac inflammation. Previous experiments have identified an antibody escape mutant (H310A1) of a myocarditic variant of CVB3 (H3) that attenuates the myocarditic potential of the virus in mice in spite of ongoing viral replication in the heart. We have cloned full-length infectious cDNA copies of the viral genome of both the wild-type myocarditic H3 variant of CVB3 and the antibody escape mutant H310A1. Progeny viruses maintained the myocarditic and attenuated myocarditic potential of the parent viruses, H3 and H310A1. The full sequence of the H3 viral cDNA is reported and compared with those of previously published CVB3 variants. Comparison of the full sequences of H3 and H310A1 viruses identified a single nonconserved mutation (A to G) in the P1 polyprotein region at nucleotide 1442 resulting in an asparagine-to-aspartate mutation in amino acid 165 of VP2. This mutation is in a region that corresponds to the puff region of VP2. Nucleotide 1442 of the H3 and H310A1 cDNA copies of the viral genome was mutated to change amino acid 165 of VP2 to aspartate and asparagine, respectively. The presence of asparagine at amino acid 165 of VP2 is associated with the myocarditic phenotype, while an aspartate at the same site reduces the myocarditic potential of the virus. In addition, high-level production of tumor necrosis factor alpha by infected BALB/c monocytes is associated with asparagine at amino acid 165 of VP2 as has been previously demonstrated for the H3 virus. These findings identify potentially important differences between the H3 variant of CVB3 and other previously published CVB3 variants. In addition, the data demonstrate that a point mutation in the puff region of VP2 can markedly alter the ability of CVB3 to induce myocarditis in mice and tumor necrosis factor alpha

  16. Synthesis of Pyrazine-1,3-thiazine Hybrid Analogues as Antiviral Agent Against HIV-1, Influenza A (H1N1), Enterovirus 71 (EV71), and Coxsackievirus B3 (CVB3).

    PubMed

    Wu, Hong-Min; Zhou, Kuo; Wu, Tao; Cao, Yin-Guang

    2016-09-01

    A novel series of pyrazine-1,3-thiazine hybrid conjugates were synthesized in excellent yield. These derivatives were subsequently tested against human immunodeficiency virus (HIV-1); hemagglutinin type 1 and neuraminidase type 1-'influenza' A (H1N1) virus; enterovirus 71 (EV71); and coxsackievirus B3. The effect of these conjugates on the key enzymes responsible for the progression of these viral infections was also illustrated via enzyme-based assay, such as HIV-1 reverse transcriptase (RT) and neuraminidase, where entire tested molecules showed considerable inhibition. Particularly, among the tested derivatives, compound 3k was identified as most promising inhibitor of HIV-1 with 94% of inhibition (IC50 3.26 ± 0.2 μm). Moreover, the compound 3d was found to be the most potent analogue to inhibit the H1N1 virus with IC50 of 5.32 ± 0.4 μm together with inhibition of the neuraminidase enzyme (IC50 11.24 ± 1.1 μm). In regard to inhibitory activity against enterovirus 71 (EV71) and coxsackievirus B3 (CVB3), the tested derivatives showed considerable inhibition of infection. Molecular docking studies were also performed for the most promising inhibitors with their corresponding target protein to exemplify the structural requirement for better inhibitory activity. The results of inhibitory assay showed that designed molecules possess considerable inhibitory activity against the virus tested. PMID:27062664

  17. Mutations in the 5’ NTR and the Non-Structural Protein 3A of the Coxsackievirus B3 Selectively Attenuate Myocarditogenicity

    PubMed Central

    Basavalingappa, Rakesh H.; Rajasekaran, Rajkumar A.; Vu, Hiep; Riethoven, Jean-Jack; Steffen, David; Pattnaik, Asit K.; Reddy, Jay

    2015-01-01

    The 5’ non-translated region (NTR) is an important molecular determinant that controls replication and virulence of coxsackievirus B (CVB)3. Previous studies have reported many nucleotide (nt) sequence differences in the Nancy strain of the virus, including changes in the 5’ NTR with varying degrees of disease severity. In our studies of CVB3-induced myocarditis, we sought to generate an infectious clone of the virus for routine in vivo experimentation. By determining the viral nt sequence, we identified three new nt substitutions in the clone that differed from the parental virus strain: C97U in the 5’ NTR; a silent mutation, A4327G, in non-structural protein 2C; and C5088U (resulting in P1449L amino acid change) in non-structural protein 3A of the virus leading us to evaluate the role of these changes in the virulence properties of the virus. We noted that the disease-inducing ability of the infectious clone-derived virus in three mouse strains was restricted to pancreatitis alone, and the incidence and severity of myocarditis were significantly reduced. We then reversed the mutations by creating three new clones, representing 1) U97C; 2) G4327A and U5088C; and 3) their combination together in the third clone. The viral titers obtained from all the clones were comparable, but the virions derived from the third clone induced myocarditis comparable to that induced by wild type virus; however, the pancreatitis-inducing ability remained unaltered, suggesting that the mutations described above selectively influence myocarditogenicity. Because the accumulation of mutations during passages is a continuous process in RNA viruses, it is possible that CVB3 viruses containing such altered nts may evolve naturally, thus favoring their survival in the environment. PMID:26098885

  18. Mutations in the 5' NTR and the Non-Structural Protein 3A of the Coxsackievirus B3 Selectively Attenuate Myocarditogenicity.

    PubMed

    Massilamany, Chandirasegaran; Gangaplara, Arunakumar; Basavalingappa, Rakesh H; Rajasekaran, Rajkumar A; Vu, Hiep; Riethoven, Jean-Jack; Steffen, David; Pattnaik, Asit K; Reddy, Jay

    2015-01-01

    The 5' non-translated region (NTR) is an important molecular determinant that controls replication and virulence of coxsackievirus B (CVB)3. Previous studies have reported many nucleotide (nt) sequence differences in the Nancy strain of the virus, including changes in the 5' NTR with varying degrees of disease severity. In our studies of CVB3-induced myocarditis, we sought to generate an infectious clone of the virus for routine in vivo experimentation. By determining the viral nt sequence, we identified three new nt substitutions in the clone that differed from the parental virus strain: C97U in the 5' NTR; a silent mutation, A4327G, in non-structural protein 2C; and C5088U (resulting in P1449L amino acid change) in non-structural protein 3A of the virus leading us to evaluate the role of these changes in the virulence properties of the virus. We noted that the disease-inducing ability of the infectious clone-derived virus in three mouse strains was restricted to pancreatitis alone, and the incidence and severity of myocarditis were significantly reduced. We then reversed the mutations by creating three new clones, representing 1) U97C; 2) G4327A and U5088C; and 3) their combination together in the third clone. The viral titers obtained from all the clones were comparable, but the virions derived from the third clone induced myocarditis comparable to that induced by wild type virus; however, the pancreatitis-inducing ability remained unaltered, suggesting that the mutations described above selectively influence myocarditogenicity. Because the accumulation of mutations during passages is a continuous process in RNA viruses, it is possible that CVB3 viruses containing such altered nts may evolve naturally, thus favoring their survival in the environment. PMID:26098885

  19. Activation of AMP-activated protein kinase reduces collagen production via p38 MAPK in cardiac fibroblasts induced by coxsackievirus B3.

    PubMed

    Jiang, Shengyang; Jiang, Donglin; Zhao, Peng; He, Xinlong; Tian, Shunli; Wu, Xueming; Tao, Yijia

    2016-07-01

    Collagen deposition is the major cause of myocardial fibrosis, contributing to impaired cardiac contractile function in coxsackie virus B3 (CVB3)-infected hearts. Adenosine monophosphate-activated protein kinase (AMPK) has been considered as a cellular fuel gauge and super metabolic regulator, however, whether AMPK has an effect on collagen production in CVB3‑infected heart remains to be elucidated. In the present study, the association between AMPK activation and CVB3‑infected neonatal rat cardiac fibroblasts (NRCFs) was investigated. Collagen production was determined by the hydroxyproline content of the supernatant and by the expression of type I/IV collagen in the cell lysate. Rat hydroxyproline ELISA was used to detect hydroxyproline content in the supernatant. The expression of type I/IV collagen, and the phosphorylation of AMPKα‑Thr172 and p38 in the cell lysate were evaluated using western blotting. As expected, it was found that the hydroxyproline content in the supernatant, and the production of collagen I/IV in the cell lysate were significantly promoted at 48 h post‑CVB3‑infection. However, this effect was inhibited in a dose‑dependent manner when pretreated with 5‑aminoimidazole‑4‑carboxamide‑1‑4‑ribofuranoside (AICAR) for 2 h prior to CVB3‑infection. However, if the cells were preincubated with compound C or SB203580 for 30 min prior the treatment with AICAR, the inhibitive effects of AICAR were reversed. The results of the western blotting indicated that the phosphorylation of AMPKα‑Thr172 and p38 were significantly increased by AICAR in the NRCFs. However, only the phosphorylation of p38 mitogen‑activated protein kinase (MAPK) was inhibited by SB203580. In conclusion, AMPK activation reduced collagen production via the p38 MAPK‑dependent pathway in the cardiac fibroblasts induced by CVB3. The results of the present study may contribute to identifying an effective therapy for CVB3‑induced myocarditis and CVB3

  20. Impaired binding of standard initiation factors eIF3b, eIF4G and eIF4B to domain V of the live-attenuated coxsackievirus B3 Sabin3-like IRES - alternatives for 5′UTR-related cardiovirulence mechanisms

    PubMed Central

    2013-01-01

    Abstract Internal ribosome entry site (IRES) elements fold into highly organized conserved secondary and probably tertiary structures that guide the ribosome to an internal site of the RNA at the IRES 3′end. The composition of the cellular proteome is under the control of multiple processes, one of the most important being translation initiation. In each poliovirus Sabin vaccine strain, a single point mutation in the IRES secondary-structure domain V is a major determinant of neurovirulence and translation attenuation. Here we are extrapolating poliovirus findings to a genomic related virus named coxsackievirus B3 CVB3); a causative agent of viral myocarditis. We have previously reported that Sabin3-like mutation (U473 → C) introduced in the domain V sequence of the CVB3 IRES led to a defective mutant with a serious reduction in translation efficiency and ribosomal initiation complex assembly, besides an impaired RNA-protein binding pattern. With the aim to identify proteins interacting with both CVB3 wild-type and Sabin3-like domain V RNAs and to assess the effect of the Sabin3-like mutation on these potential interactions, we have used a proteomic approach. This procedure allowed the identification of three RNA-binding proteins interacting with the domain V: eIF4G (p220), eIF3b (p116) and eIF4B (p80). Moreover, we report that this single-nucleotide exchange impairs the interaction pattern and the binding affinity of these standard translation initiation factors within the IRES domain V of the mutant strain. Taken together, these data indicate how this decisive Sabin3-like mutation mediates viral translation attenuation; playing a key role in the understanding of the cardiovirulence attenuation within this construct. Hence, these data provide further evidence for the crucial role of RNA structure for the IRES activity, and reinforce the idea of a distribution of function between the different IRES structural domains. Virtual slide The virtual slide(s) for

  1. The RNA template channel of the RNA-dependent RNA polymerase as a target for development of antiviral therapy of multiple genera within a virus family.

    PubMed

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M

    2015-03-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the

  2. The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

    PubMed Central

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria

    2015-01-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the

  3. Development of potent inhibitors of the coxsackievirus 3C protease

    SciTech Connect

    Lee, Eui Seung; Lee, Won Gil; Yun, Soo-Hyeon; Rho, Seong Hwan; Im, Isak; Yang, Sung Tae; Sellamuthu, Saravanan; Lee, Yong Jae; Kwon, Sun Jae; Park, Ohkmae K.; Jeon, Eun-Seok; Park, Woo Jin . E-mail: wjpark@gist.ac.kr; Kim, Yong-Chul . E-mail: yongchul@gist.ac.kr

    2007-06-22

    Coxsackievirus B3 (CVB3) 3C protease (3CP) plays essential roles in the viral replication cycle, and therefore, provides an attractive therapeutic target for treatment of human diseases caused by CVB3 infection. CVB3 3CP and human rhinovirus (HRV) 3CP have a high degree of amino acid sequence similarity. Comparative modeling of these two 3CPs revealed one prominent distinction; an Asn residue delineating the S2' pocket in HRV 3CP is replaced by a Tyr residue in CVB3 3CP. AG7088, a potent inhibitor of HRV 3CP, was modified by substitution of the ethyl group at the P2' position with various hydrophobic aromatic rings that are predicted to interact preferentially with the Tyr residue in the S2' pocket of CVB3 3CP. The resulting derivatives showed dramatically increased inhibitory activities against CVB3 3CP. In addition, one of the derivatives effectively inhibited the CVB3 proliferation in vitro.

  4. Interspecies Differences in Virus Uptake versus Cardiac Function of the Coxsackievirus and Adenovirus Receptor

    PubMed Central

    Freiberg, Fabian; Sauter, Martina; Pinkert, Sandra; Govindarajan, Thirupugal; Kaldrack, Joanna; Thakkar, Meghna; Fechner, Henry; Klingel, Karin

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a cell contact protein with an important role in virus uptake. Its extracellular immunoglobulin domains mediate the binding to coxsackievirus and adenovirus as well as homophilic and heterophilic interactions between cells. The cytoplasmic tail links CAR to the cytoskeleton and intracellular signaling cascades. In the heart, CAR is crucial for embryonic development, electrophysiology, and coxsackievirus B infection. Noncardiac functions are less well understood, in part due to the lack of suitable animal models. Here, we generated a transgenic mouse that rescued the otherwise embryonic-lethal CAR knockout (KO) phenotype by expressing chicken CAR exclusively in the heart. Using this rescue model, we addressed interspecies differences in coxsackievirus uptake and noncardiac functions of CAR. Survival of the noncardiac CAR KO (ncKO) mouse indicates an essential role for CAR in the developing heart but not in other tissues. In adult animals, cardiac activity was normal, suggesting that chicken CAR can replace the physiological functions of mouse CAR in the cardiomyocyte. However, chicken CAR did not mediate virus entry in vivo, so that hearts expressing chicken instead of mouse CAR were protected from infection and myocarditis. Comparison of sequence homology and modeling of the D1 domain indicate differences between mammalian and chicken CAR that relate to the sites important for virus binding but not those involved in homodimerization. Thus, CAR-directed anticoxsackievirus therapy with only minor adverse effects in noncardiac tissue could be further improved by selectively targeting the virus-host interaction while maintaining cardiac function. IMPORTANCE Coxsackievirus B3 (CVB3) is one of the most common human pathogens causing myocarditis. Its receptor, the coxsackievirus and adenovirus receptor (CAR), not only mediates virus uptake but also relates to cytoskeletal organization and intracellular signaling

  5. Evolution of Tertiary Structure of Viral RNA Dependent Polymerases

    PubMed Central

    Černý, Jiří; Černá Bolfíková, Barbora; Valdés, James J.; Grubhoffer, Libor; Růžek, Daniel

    2014-01-01

    Viral RNA dependent polymerases (vRdPs) are present in all RNA viruses; unfortunately, their sequence similarity is too low for phylogenetic studies. Nevertheless, vRdP protein structures are remarkably conserved. In this study, we used the structural similarity of vRdPs to reconstruct their evolutionary history. The major strength of this work is in unifying sequence and structural data into a single quantitative phylogenetic analysis, using powerful a Bayesian approach. The resulting phylogram of vRdPs demonstrates that RNA-dependent DNA polymerases (RdDPs) of viruses within Retroviridae family cluster in a clearly separated group of vRdPs, while RNA-dependent RNA polymerases (RdRPs) of dsRNA and +ssRNA viruses are mixed together. This evidence supports the hypothesis that RdRPs replicating +ssRNA viruses evolved multiple times from RdRPs replicating +dsRNA viruses, and vice versa. Moreover, our phylogram may be presented as a scheme for RNA virus evolution. The results are in concordance with the actual concept of RNA virus evolution. Finally, the methods used in our work provide a new direction for studying ancient virus evolution. PMID:24816789

  6. Autoimmunity in Coxsackievirus B3 induced myocarditis: role of estrogen in suppressing autoimmunity

    PubMed Central

    2010-01-01

    SUMMARY Picornaviruses are small, non-enveloped, single stranded, positive sense RNA viruses which cause multiple diseases including myocarditis/dilated cardiomyopathy, type 1 diabetes, encephalitis, myositis, orchitis and hepatitis. Although picornaviruses directly kill cells, tissue injury primarily results from autoimmunity to self antigens. Viruses induce autoimmunity by: aborting deletion of self-reactive T cells during T cell ontogeny; reversing anergy of peripheral autoimmune T cells; eliminating T regulatory cells; stimulating self-reactive T cells through antigenic mimicry or cryptic epitopes; and acting as an adjuvant for self molecules released during virus infection. Most autoimmune diseases (SLE, rheumatoid arthritis, Grave’s disease) predominate in females, but diseases associated with picornavirus infections predominate in males. T regulatory cells are activated in infected females because of the combined effects of estrogen and innate immunity. PMID:20963181

  7. Coxsackievirus A6 Polymorphic Exanthem in Israeli Children.

    PubMed

    Renert-Yuval, Yael; Marva, Eytan; Weil, Merav; Shulman, Lester M; Gencylmaz, Nilsu; Sheffer, Sivan; Wolf, Dana G; Molho-Pessach, Vered

    2016-04-12

    Hand foot and mouth disease (HFMD) is an acute childhood viral exanthem usually associated with coxsackievirus A16 or enterovirus 71. Atypical HFMD associated with coxsackievirus A6 was reported recently. The aim of the current study was to describe coxsackievirus A6-associated atypical HFMD in a series of 8 toddlers who were referred with idiopathic extensive eruptions. Demographic and clinical characteristics, Reverse transcriptase-real-time PCR (RT-PCR) results for enterovirus and phylogenetic analysis for the coxsackievirus A6 strains were recorded. Morphologically polymorphous (vesicular, erosive, papular, desquamative or purpuric) and extensive eruptions were found. One patient had delayed nail shedding. Enterovirus was positive in all patients. Genotype analysis confirmed coxsackievirus A6 in 6 patients and 5 sequences underwent phylogenetic analysis. This is the first such report in Israeli children. In conclusion, coxsackievirus A6 atypical HFMD should be regarded as a novel childhood viral exanthem. We suggest the term "coxsackievirus A6 polymorphic exanthem" due to the extensive and variable nature of this eruption. PMID:26463513

  8. [Virus demonstration and pathologic changes in different phases of coxsackievirus B myocarditis in mice].

    PubMed

    Rabausch-Starz, I; Neu, N; Müller-Hermelink, H K

    1990-01-01

    A/J mice between 15 days and 10 weeks of age were infected intraperitoneally with Coxsackievirus B3 (CVB3). To search for virus in the myocardium various methods were applied: virus isolation from the myocardium, RNA extraction for dot blot hybridization and in situ hybridization. Two different RNA probes, one specific for CVB3 the other cross-reacting with other enteroviruses, were radioactively labeled with 35S or 32P by in vitro transcription. In paraffin sections histological alterations were assessed semiquantitatively. The animals developed acute myocarditis with myolysis and virus in the myocardium until 14 days after infection. The second stage of the disease was characterized by a persistent inflammatory infiltrate. At this stage no virus could be shown in the myocardium. Antibodies against cardiac myosin appeared 16 days after infection. Autoimmune mechanisms thus seem to be a most relevant factor for persistent inflammation after the acute viral phase of the disease. PMID:1708625

  9. Surface for Catalysis by Poliovirus RNA-Dependent RNA Polymerase

    PubMed Central

    Wang, Jing; Lyle, John M.; Bullitt, Esther

    2013-01-01

    The poliovirus RNA-dependent RNA polymerase, 3Dpol, replicates the viral genomic RNA on the surface of virus-induced intracellular membranes. Macromolecular assemblies of 3Dpol form linear array of subunits that propagate along a strong protein-protein interaction called interface-I, as was observed in the crystal structure of wild-type poliovirus polymerase. These “filaments” recur with slight modifications in planar sheets and, with additional modifications that accommodate curvature, in helical tubes of the polymerase, by packing filaments together via a second set of interactions. Periodic variations of subunit orientations within 3Dpol tubes give rise to “ghost reflections” in diffraction patterns computed from electron cryomicrographs of helical arrays. The ghost reflections reveal that polymerase tubes are formed by bundles of 4–6 interface-I filaments, which are then connected to the next bundle of filaments with a perturbation of interface interactions between bundles. While enzymatically inactive polymerase is also capable of oligomerization, much thinner tubes are formed that lack interface-I interactions between adjacent subunits, suggesting that long-range allostery produces conformational changes that extend from the active site to the protein-protein interface. Macromolecular assemblies of poliovirus polymerase show repeated use of flexible interface interactions for polymerase lattice formation, suggesting that adaptability of polymerase-polymerase interactions facilitates RNA replication. In addition, the presence of a positively charged groove identified in polymerase arrays may help position and stabilize the RNA template during replication. PMID:23583774

  10. The archaeal transamidosome for RNA-dependent glutamine biosynthesis

    PubMed Central

    Rampias, Theodoros; Sheppard, Kelly; Söll, Dieter

    2010-01-01

    Archaea make glutaminyl-tRNA (Gln-tRNAGln) in a two-step process; a non-discriminating glutamyl-tRNA synthetase (ND-GluRS) forms Glu-tRNAGln, while the heterodimeric amidotransferase GatDE converts this mischarged tRNA to Gln-tRNAGln. Many prokaryotes synthesize asparaginyl-tRNA (Asn-tRNAAsn) in a similar manner using a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) and the heterotrimeric amidotransferase GatCAB. The transamidosome, a complex of tRNA synthetase, amidotransferase and tRNA, was first described for the latter system in Thermus thermophilus [Bailly, M., Blaise, M., Lorber, B., Becker, H.D. and Kern, D. (2007) The transamidosome: a dynamic ribonucleoprotein particle dedicated to prokaryotic tRNA-dependent asparagine biosynthesis. Mol. Cell, 28, 228–239.]. Here, we show a similar complex for Gln-tRNAGln formation in Methanothermobacter thermautotrophicus that allows the mischarged Glu-tRNAGln made by the tRNA synthetase to be channeled to the amidotransferase. The association of archaeal ND-GluRS with GatDE (KD = 100 ± 22 nM) sequesters the tRNA synthetase for Gln-tRNAGln formation, with GatDE reducing the affinity of ND-GluRS for tRNAGlu by at least 13-fold. Unlike the T. thermophilus transamidosome, the archaeal complex does not require tRNA for its formation, is not stable through product (Gln-tRNAGln) formation, and has no major effect on the kinetics of tRNAGln glutamylation nor transamidation. The differences between the two transamidosomes may be a consequence of the fact that ND-GluRS is a class I aminoacyl-tRNA synthetase, while ND-AspRS belongs to the class II family. PMID:20457752

  11. Molecular epidemiology of coxsackievirus type B1.

    PubMed

    Abdelkhalek, Ichrak; Seghier, Mohamed; Yahia, Ahlem Ben; Touzi, Henda; Meddeb, Zina; Triki, Henda; Rezig, Dorra

    2015-11-01

    Coxsackievirus type B1 (CVB1) has emerged globally as the predominant enterovirus serotype and is associated with epidemics of meningitis and chronic diseases. In this report, the phylogeny of CVB1 was studied based on the VP1 sequences of 11 North African isolates and 81 published sequences. All CVB1 isolates segregated into four distinct genogroups and 10 genotypes. Most of the identified genotypes of circulating CVB1 strains appear to have a strict geographical specificity. The North African strains were of a single genotype and probably evolved distinctly. Using a relaxed molecular clock model and three different population models (constant population, exponential growth and Bayesian skyline demographic models) in coalescent analysis using the BEAST program, the substitution rate in CVB1 varied between 6.95 × 10(-3) and 7.37 × 10(-3) substitutions/site/year in the VP1 region. This study permits better identification of circulating CVB1, which has become one of the most predominant enterovirus serotypes in humans. PMID:26243282

  12. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  13. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  14. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  15. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  16. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents §...

  17. ORI2 inhibits coxsackievirus replication and myocardial inflammation in experimental murine myocarditis.

    PubMed

    Lim, Byung-Kwan; Kim, Jin Hee

    2014-01-01

    We purified ORI2 [3-(3,4-dihydroxyphenyl)acrylic acid 1-(3,4-dihydroxyphenyl)-2-methoxycarbonylethyl ester] from an extract of the plant Isodon excisus. We tested the antiviral effect of ORI2 in a coxsackievirus-induced myocarditis model. Coxsackievirus B3 (CVB3) is a common cause of myocarditis and dilated cardiomyopathy. Activation of extracellular signal-regulated kinase (ERK) and Akt signaling in virus-infected cells is essential for CVB3 replication. Antiviral compounds were screened by HeLa cell survival assay. Several purified natural compounds were added to HeLa cells cultured in 96-well plates for 30 min after 1 multiplicity of infection (m.o.i) CVB3 infection. ORI2 significantly improved HeLa cell survival in a dose-dependent manner. For in vivo studies, BALB/c mice (n=20) were infected with CVB3, then 10 of the mice were treated by daily intraperitoneal injections of ORI2 (100 mM) for 3 consecutive days. ORI2 treatment significantly improved early survival in the treated mice compared to untreated mice (85% vs. 50%, respectively). Organ virus titers and myocardial damage were significantly lower in the ORI2-treated mice than in untreated mice. These results demonstrate that ORI2, delivered by intraperitoneal injection after CVB3 infection, has a significant antiviral effect by markedly inhibiting virus replication, resulting in a decrease in organ virus titer and myocardial damage. ORI2 may be developed as a potential therapeutic agent for the treatment of CVB3 infections. PMID:25273388

  18. Iron and copper accumulation in the brain of coxsackievirus-infected mice exposed to cadmium

    SciTech Connect

    Ilbaeck, N.-G. . E-mail: nils-gunnar.ilback@slv.se; Lindh, U.; Minqin, R.; Friman, G.; Watt, F.

    2006-11-15

    Cadmium (Cd) is a potentially toxic metal widely distributed in the environment and known to cause adverse health effects in humans. During coxsackievirus infection, the concentrations of essential and nonessential trace elements (e.g., iron (Fe), copper (Cu), and Cd) change in different target organs of the infection. Fe and Cu are recognized cofactors in host defence reactions, and Fe is known to be associated with certain pathological conditions of the brain. However, whether nonessential trace elements could influence the balance of essential trace elements in the brain is unknown. In this study the brain Fe, Cu, and Cd contents were measured through inductively coupled plasma mass spectrometry and their distributions determined by nuclear microscopy in the early phase (day 3) of coxsackievirus B3 (CB3) infection in nonexposed and in Cd-exposed female Balb/c mice. In CB3 infection the brain is a well-known target that has not been studied with regard to trace element balance. The brain concentration of Cu compared with that of noninfected control mice was increased by 9% (P<0.05) in infected mice not exposed to Cd and by 10% (not significant) in infected Cd-exposed mice. A similar response was seen for Fe, which in infected Cd-exposed mice, compared to noninfected control mice, tended to increase by 16%. Cu showed an even tissue distribution, whereas Fe was distributed in focal deposits. Changes in Cd concentration in the brain of infected mice were less consistent but evenly distributed. Further studies are needed to define whether the accumulation and distribution of trace elements in the brain have an impact on brain function.

  19. Enzyme-linked immunosorbent assay for detection and identification of coxsackieviruses A.

    PubMed Central

    Yolken, R H; Torsch, V M

    1981-01-01

    Coxsackieviruses A are known to cause a wide range of human disease processes. However, because many coxsackieviruses A present in clinical specimens do not produce a recognizable cytopathic effect in readily available tissue culture systems, infections with coxsackieviruses A are often difficult to diagnose. We have thus developed enzyme-linked immunosorbent assay (ELISA) systems for the detection and serotyping of coxsackievirus A antigens. The assays consist of a double-antibody ELISA which utilizes type-specific monkey and mouse coxsackievirus antisera. Although some cross-reactivity was noted, the ELISA systems correctly identified the serotypes of 22 to 23 coxsackievirus A complement fixation antigens available for testing. Testing of tissue culture fluids revealed that antigen could often be detected by ELISA before the appearance of a cytopathic effect. In addition, the infecting coxsackievirus A antigen could be unequivocally identified in 8 of 11 stool specimens obtained from patients with coxsackievirus A infections. The ELISA system might thus represent an important tool in the diagnosis and study of coxsackievirus A infections. PMID:6260675

  20. Dysferlin deficiency confers increased susceptibility to coxsackievirus-induced cardiomyopathy.

    PubMed

    Wang, Chen; Wong, Jerry; Fung, Gabriel; Shi, Junyan; Deng, Haoyu; Zhang, Jingchun; Bernatchez, Pascal; Luo, Honglin

    2015-10-01

    Coxsackievirus infection can lead to viral myocarditis and its sequela, dilated cardiomyopathy, which represent major causes of cardiovascular mortality worldwide in children. Yet, the host genetic susceptible factors and the underlying mechanisms by which viral infection damages cardiac function remain to be fully resolved. Dysferlin is a transmembrane protein highly expressed in skeletal and cardiac muscles. In humans, mutations in the dysferlin gene can cause limb-girdle muscular dystrophy type 2B and Miyoshi myopathy. Dysferlin deficiency has also been linked to cardiomyopathy. Defective muscle membrane repair has been suggested to be an important mechanism responsible for muscle degeneration in dysferlin-deficient patients and animals. Using both naturally occurring and genetically engineered dysferlin-deficient mice, we demonstrated that loss of dysferlin confers increased susceptibility to coxsackievirus infection and myocardial damage. More interestingly, we found that dysferlin is cleaved following coxsackieviral infection through the proteolytic activity of virally encoded proteinases, suggesting an important mechanism underlying virus-induced cardiac dysfunction. Our results in this study not only identify dysferlin deficiency as a novel host risk factor for viral myocarditis but also reveal a key mechanism by which coxsackievirus infection impairs cardiac function, leading to the development of dilated cardiomyopathy. PMID:26073173

  1. Hand, foot, and mouth disease caused by coxsackievirus A6, Thailand, 2012.

    PubMed

    Puenpa, Jiratchaya; Chieochansin, Thaweesak; Linsuwanon, Piyada; Korkong, Sumeth; Thongkomplew, Siwanat; Vichaiwattana, Preyaporn; Theamboonlers, Apiradee; Poovorawan, Yong

    2013-04-01

    In Thailand, hand, foot, and mouth disease (HFMD) is usually caused by enterovirus 71 or coxsackievirus A16. To determine the cause of a large outbreak of HFMD in Thailand during June-August 2012, we examined patient specimens. Coxsackievirus A6 was the causative agent. To improve prevention and control, causes of HFMD should be monitored. PMID:23631943

  2. Loss of Virus-Specific Memory T. cells in Coxsackievirus B3 and B4 Infected Mice

    EPA Science Inventory

    There are two major types of enteroviruses: polioviruses and non-polio enteroviruses. While vaccines have effectively eliminated poliovirus infections, no vaccine is currently available for the non-polio enteroviruses. Generation of long-term pathogen specific memory cells is cri...

  3. Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.

    PubMed

    Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng

    2009-09-01

    Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively. PMID:19616030

  4. Purification of the putative coxsackievirus B receptor from HeLa cells.

    PubMed

    Carson, S D; Chapman, N N; Tracy, S M

    1997-04-17

    We have identified a protein expressed by human and murine cells susceptible to coxsackievirus B3 (CVB3) infection and purified it from HeLa cells. This protein of approximately 45,000 Mr is expressed by HeLa cells and mouse fetal heart fibroblasts (susceptible to infection), and not by C3H murine fibroblasts or the human RD cell line (resistant). The protein was isolated from Triton X-100- deoxycholate lysates of HeLa cells by chromatography on concanavalin A-Sepharose, Affi-gel Blue, Phenyl Sepharose, and PBE94. The CVB3-binding fraction from PBE94 was blotted from SDS-polyacrylamide gel onto PVDF membrane for amino acid sequencing. Approximately 2 pmoles of CVB3-binding protein provided assignments for 26 consecutive residues: LSITTPEEMIEKAKGETAYLPXKFTL. This sequence corresponds neither to decay accelerating factor nor to nucleolin, both of which have previously been identified as CVB3-binding proteins, but does match two entries in GenBank. These data show that we have purified a novel CVB3-binding protein, the characteristics of which suggest the CVB group receptor has been purified. Identification of 26 amino acid residues in the protein and corresponding GenBank enteries will accelerate study of CVB tropism and the diseases caused by these viruses. PMID:9144533

  5. Ongoing Coxsackievirus Myocarditis Is Associated with Increased Formation and Activity of Myocardial Immunoproteasomes

    PubMed Central

    Szalay, Gudrun; Meiners, Silke; Voigt, Antje; Lauber, Jörg; Spieth, Christian; Speer, Nora; Sauter, Martina; Kuckelkorn, Ulrike; Zell, Andreas; Klingel, Karin; Stangl, Karl; Kandolf, Reinhard

    2006-01-01

    A growing body of evidence indicates that viral infections of the heart contribute to ongoing myocarditis and dilated cardiomyopathy. Murine models of coxsackievirus B3 (CVB3)-induced myocarditis mimic the human disease and allow identification of susceptibility factors that modulate the course of viral myocarditis. Susceptible mouse strains develop chronic myocarditis on the basis of restricted viral replication, whereas resistant strains recover after successful virus elimination. In comparative whole-genome microarray analyses of infected hearts, several genes involved in the processing and presentation of viral epitopes were found to be uniformly up-regulated in acutely CVB3-infected susceptible mice compared with resistant animals. In particular, expression of the catalytic subunits LMP2, LMP7, and MECL-1, immunoproteasome proteins important in the generation of major histocompatibility complex (MHC) class I-restricted peptides, was clearly enhanced in the susceptible host. Increased expression resulted in enhanced formation of immunoproteasomes and altered proteolytic activities of proteasomes in the heart. This was accompanied by a concerted up-regulation of the antigen-presenting machinery in susceptible mice. Thus, we propose that increased formation of immunoproteasomes in susceptible mice affects the generation of antigenic peptides and the subsequent T-cell-mediated immune responses. PMID:16651621

  6. Fluoxetine Is a Potent Inhibitor of Coxsackievirus Replication

    PubMed Central

    Zuo, Jun; Quinn, Kevin K.; Kye, Steve; Cooper, Paige; Damoiseaux, Robert

    2012-01-01

    No antiviral drugs currently exist for the treatment of enterovirus infections, which are often severe and potentially life threatening. Molecular screening of small molecule libraries identified fluoxetine, a selective serotonin reuptake inhibitor, as a potent inhibitor of coxsackievirus replication. Fluoxetine did not interfere with either viral entry or translation of the viral genome. Instead, fluoxetine and its metabolite norfluoxetine markedly reduced the synthesis of viral RNA and protein. In view of its favorable pharmacokinetics and safety profile, fluoxetine warrants additional study as a potential antiviral agent for enterovirus infections. PMID:22751539

  7. Evaluation of Coxsackievirus Infection in Children with Human Immunodeficiency Virus Type 1–Associated Cardiomyopathy

    PubMed Central

    Jenson, Hal B.; Gauntt, Charles J.; Easley, Kirk A.; Pitt, Jane; Lipshultz, Steven E.; McIntosh, Kenneth; Shearer, William T.

    2015-01-01

    In a matched case-control study of the association between coxsackieviruses and cardiac impairment, 24 human immunodeficiency virus (HIV) type 1–infected children with cardiac impairment were compared with 24 HIV-1–infected control subjects. Serologic evidence of coxsackievirus infection was present in all children, with no significant difference in geometric mean antibody titers between case patients and control subjects. Conditional logistic regression to test for an association between coxsackievirus antibody titer and the presence or absence of cardiac impairment, by any indicator, showed an odds ratio of 1.11 (95% confidence interval, 0.58–2.10; P = .75), indicating no association between coxsackievirus infection and cardiac impairment. Coxsackievirus antibody titers correlated positively with total IgG levels in nonrapid progressors but not in rapid progressors. Paired serum samples taken before and after diagnosis of cardiac impairment in 5 patients showed no evidence of intervening coxsackievirus infection. These results do not identify a causal role for coxsackieviruses for cardiomyopathy in HIV-1–infected children. PMID:12085328

  8. Pharmacological and biological antiviral therapeutics for cardiac coxsackievirus infections.

    PubMed

    Fechner, Henry; Pinkert, Sandra; Geisler, Anja; Poller, Wolfgang; Kurreck, Jens

    2011-01-01

    Subtype B coxsackieviruses (CVB) represent the most commonly identified infectious agents associated with acute and chronic myocarditis, with CVB3 being the most common variant. Damage to the heart is induced both directly by virally mediated cell destruction and indirectly due to the immune and autoimmune processes reacting to virus infection. This review addresses antiviral therapeutics for cardiac coxsackievirus infections discovered over the last 25 years. One group represents pharmacologically active low molecular weight substances that inhibit virus uptake by binding to the virus capsid (e.g., pleconaril) or inactivate viral proteins (e.g., NO-metoprolol and ribavirin) or inhibit cellular proteins which are essential for viral replication (e.g., ubiquitination inhibitors). A second important group of substances are interferons. They have antiviral but also immunomodulating activities. The third and most recently discovered group includes biological and cellular therapeutics. Soluble receptor analogues (e.g., sCAR-Fc) bind to the virus capsid and block virus uptake. Small interfering RNAs, short hairpin RNAs and antisense oligonucleotides bind to and led to degradation of the viral RNA genome or cellular RNAs, thereby preventing their translation and viral replication. Most recently mesenchymal stem cell transplantation has been shown to possess antiviral activity in CVB3 infections. Taken together, a number of antiviral therapeutics has been developed for the treatment of myocardial CVB infection in recent years. In addition to low molecular weight inhibitors, biological therapeutics have become promising anti-viral agents. PMID:21989310

  9. Use of guinea pig embryo cell cultures for isolation and propagation of group A coxsackieviruses.

    PubMed Central

    Landry, M L; Madore, H P; Fong, C K; Hsiung, G D

    1981-01-01

    The isolation of group A coxsackieviruses from clinical specimens generally requires the use of suckling mice. By using guinea pig embryo cells, the following coxsackieviruses were isolated from throat swabs and stool samples obtained from patients with a variety of illnesses: two of type A2, one each of types A6 and A8, and four of type 10. Distinct cytopathic effects were produced in 3 to 5 days in the guinea pig embryo cells inoculated with the clinical specimens. In addition, a number of prototype group A coxsackieviruses, including types 2--6, 8, 10, and 12, were readily propagated in guinea pig embryo cell cultures. Thus, guinea pig embryo cells appeared to be a sensitive alternative cell culture system for the isolation and propagation of certain types of group A coxsackieviruses. Images PMID:6263943

  10. STRAIN DIFFERENTIATION AND DETERMINATION OF CAPSID PROTEINS OF COXSACKIEVIRUS BY MALDI-MS

    EPA Science Inventory

    Introduction: Contamination of viruses in water environments (rivers, lakes, sources of drinking water) is a new threat and serious health problem. Amongst organisms discharged from sewage septic systems is the coxsackievirus (single-stranded RNA virus). Differentiation betwee...

  11. Coxsackievirus-positive cervices in women with febrile illnesses during the third trimester in pregnancy.

    PubMed

    Reyes, M P; Zalenski, D; Smith, F; Wilson, F M; Lerner, A M

    1986-07-01

    Coxsackievirus B5 infection was demonstrated in five of seven third-trimester pregnant women with undifferentiated febrile illnesses or aseptic meningitis. Coxsackievirus B5 was recovered from the cervix and throat in four women and from the rectum in three. No obvious illnesses were evident in the babies. These findings suggest that previously unrecognized cervical enterovirus carriage or infection is common in infected pregnant women in the last trimester and that subsequent neonatal infection at delivery may result. PMID:3014880

  12. Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications

    PubMed Central

    Jácome, Rodrigo; Becerra, Arturo; Ponce de León, Samuel; Lazcano, Antonio

    2015-01-01

    The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, “fingertips” that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection. PMID:26397100

  13. Niacin and niacinamide (Vitamin B3)

    MedlinePlus

    Niacin and niacinamide are forms of Vitamin B3. Vitamin B3 is found in many foods including yeast, meat, fish, milk, eggs, green vegetables, beans, and cereal grains. Niacin and niacinamide are also found in many vitamin B complex ...

  14. Chromatin remodeling complexes in the assembly of long noncoding RNA-dependent nuclear bodies.

    PubMed

    Kawaguchi, Tetsuya; Hirose, Tetsuro

    2015-11-01

    Paraspeckles are subnuclear structures that assemble on nuclear paraspeckle assembly transcript 1 (NEAT1) long noncoding (lnc)RNA. Paraspeckle formation requires appropriate NEAT1 biogenesis and subsequent assembly with multiple prion-like domain (PLD) containing RNA-binding proteins. We found that SWI/SNF chromatin remodeling complexes function as paraspeckle components that interact with paraspeckle proteins (PSPs) and NEAT1. SWI/SNF complexes play an essential role in paraspeckle formation that does not require their ATP-dependent chromatin remodeling activity. Instead, SWI/SNF complexes facilitate organization of the PSP interaction network required for intact paraspeckle assembly. SWI/SNF complexes may collectively bind multiple PSPs to recruit them onto NEAT1. SWI/SNF complexes are also required for Sat III (Satellite III) lncRNA-dependent formation of nuclear stress bodies under heat shock conditions. Organization of the lncRNA-dependent omega speckle in Drosophila also depends on the chromatin remodeling complex. These findings raise the possibility that a common mechanism controls the formation of lncRNA-dependent nuclear body architecture. PMID:26709446

  15. 7 CFR 15b.3 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 1 2014-01-01 2014-01-01 false Definitions. 15b.3 Section 15b.3 Agriculture Office of the Secretary of Agriculture NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General Provisions § 15b.3 Definitions. As used in this part, the term or phrase: (a) The Act means...

  16. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Categorical exclusions. 1b.3 Section 1b.3 Agriculture Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions. (a) The following are categories of activities which have been determined not to have a significant individual or cumulative effect on the...

  17. 15 CFR 8b.3 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 15 Commerce and Foreign Trade 1 2014-01-01 2014-01-01 false Definitions. 8b.3 Section 8b.3 Commerce and Foreign Trade Office of the Secretary of Commerce PROHIBITION OF DISCRIMINATION AGAINST THE HANDICAPPED IN FEDERALLY ASSISTED PROGRAMS OPERATED BY THE DEPARTMENT OF COMMERCE General Provisions § 8b.3 Definitions. As used in this part, the...

  18. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 1 2012-10-01 2012-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  19. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  20. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 1 2011-10-01 2011-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  1. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 1 2014-10-01 2014-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare Department of Health and Human Services GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  2. 45 CFR 5b.3 - Policy.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 45 Public Welfare 1 2013-10-01 2013-10-01 false Policy. 5b.3 Section 5b.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PRIVACY ACT REGULATIONS § 5b.3 Policy. It is the policy of the Department to protect the privacy of individuals to the fullest extent...

  3. 8 CFR 343b.3 - Interrogation.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Interrogation. 343b.3 Section 343b.3 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY NATIONALITY REGULATIONS SPECIAL CERTIFICATE OF NATURALIZATION FOR RECOGNITION BY A FOREIGN STATE § 343b.3 Interrogation. When Form N-565 presents a prima...

  4. Coxsackievirus B4 myocarditis and meningoencephalitis in newborn twins

    PubMed Central

    DelTondo, Joseph; Wang, Guoji; Williams, Karl; Wiley, Clayton A.

    2014-01-01

    Coxsackievirus B4 (CB4) is a picornavirus associated with a variety of human diseases, including neonatal meningoencephalitis, myocarditis and type 1 diabetes. We report the pathological findings in twin newborns who died during an acute infection. The twins were born 1 month premature but were well and neurologically intact at birth. After a week they developed acute lethal neonatal sepsis and seizures. Histopathology demonstrated meningoencephalitis and severe myocarditis, as well as pancreatitis, adrenal medullitis and nephritis. Abundant CB4 sequences were identified in nucleic acid extracted from the brain and heart. In situ hybridization with probes to CB4 demonstrated infection of neurons, myocardiocytes, endocrine pancreas and adrenal medulla. The distribution of infected cells and immune response is consistent with reported clinical symptomatology where systemic and neurological diseases are the result of CB4 infection of select target cells. PMID:24702280

  5. Disseminated coxsackievirus A6 affecting children with atopic dermatitis.

    PubMed

    Lynch, M D; Sears, A; Cookson, H; Lew, T; Laftah, Z; Orrin, L; Zuckerman, M; Creamer, D; Higgins, E

    2015-07-01

    Coxsackievirus A6 (CV-A6) is an emerging pathogen that has in recent years been associated with atypical hand, foot and mouth disease. This manifests as a generalized papular or vesicular eruption, which may be associated with fever and systemic disturbance. We report a series of six children presenting to a single centre in the UK with disseminated CV-A6 infection on a background of atopic dermatitis (AD). Our patients exhibited a widespread papular or vesicular eruption in association with exacerbation of AD. Several of our cases mimicked eczema herpeticum, but the extent was more generalized, and individual lesions were discrete rather than clustered and were less circumscribed in character. This series highlights that CV-A6 infection may be encountered in the UK, and should be considered in the differential diagnosis of an acute exacerbation of AD, particularly in children. PMID:25677678

  6. Coxsackievirus cloverleaf RNA containing a 5' triphosphate triggers an antiviral response via RIG-I activation.

    PubMed

    Feng, Qian; Langereis, Martijn A; Olagnier, David; Chiang, Cindy; van de Winkel, Roel; van Essen, Peter; Zoll, Jan; Hiscott, John; van Kuppeveld, Frank J M

    2014-01-01

    Upon viral infections, pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) and stimulate an antiviral state associated with the production of type I interferons (IFNs) and inflammatory markers. Type I IFNs play crucial roles in innate antiviral responses by inducing expression of interferon-stimulated genes and by activating components of the adaptive immune system. Although pegylated IFNs have been used to treat hepatitis B and C virus infections for decades, they exert substantial side effects that limit their use. Current efforts are directed toward the use of PRR agonists as an alternative approach to elicit host antiviral responses in a manner similar to that achieved in a natural infection. RIG-I is a cytosolic PRR that recognizes 5' triphosphate (5'ppp)-containing RNA ligands. Due to its ubiquitous expression profile, induction of the RIG-I pathway provides a promising platform for the development of novel antiviral agents and vaccine adjuvants. In this study, we investigated whether structured RNA elements in the genome of coxsackievirus B3 (CVB3), a picornavirus that is recognized by MDA5 during infection, could activate RIG-I when supplied with 5'ppp. We show here that a 5'ppp-containing cloverleaf (CL) RNA structure is a potent RIG-I inducer that elicits an extensive antiviral response that includes induction of classical interferon-stimulated genes, as well as type III IFNs and proinflammatory cytokines and chemokines. In addition, we show that prophylactic treatment with CVB3 CL provides protection against various viral infections including dengue virus, vesicular stomatitis virus and enterovirus 71, demonstrating the antiviral efficacy of this RNA ligand. PMID:24759703

  7. Naturally Occurring Isoleucyl-tRNA Synthetase without tRNA-dependent Pre-transfer Editing*

    PubMed Central

    Cvetesic, Nevena; Dulic, Morana; Bilus, Mirna; Sostaric, Nikolina; Lenhard, Boris; Gruic-Sovulj, Ita

    2016-01-01

    Isoleucyl-tRNA synthetase (IleRS) is unusual among aminoacyl-tRNA synthetases in having a tRNA-dependent pre-transfer editing activity. Alongside the typical bacterial IleRS (such as Escherichia coli IleRS), some bacteria also have the enzymes (eukaryote-like) that cluster with eukaryotic IleRSs and exhibit low sensitivity to the antibiotic mupirocin. Our phylogenetic analysis suggests that the ileS1 and ileS2 genes of contemporary bacteria are the descendants of genes that might have arisen by an ancient duplication event before the separation of bacteria and archaea. We present the analysis of evolutionary constraints of the synthetic and editing reactions in eukaryotic/eukaryote-like IleRSs, which share a common origin but diverged through adaptation to different cell environments. The enzyme from the yeast cytosol exhibits tRNA-dependent pre-transfer editing analogous to E. coli IleRS. This argues for the presence of this proofreading in the common ancestor of both IleRS types and an ancient origin of the synthetic site-based quality control step. Yet surprisingly, the eukaryote-like enzyme from Streptomyces griseus IleRS lacks this capacity; at the same time, its synthetic site displays the 103-fold drop in sensitivity to antibiotic mupirocin relative to the yeast enzyme. The discovery that pre-transfer editing is optional in IleRSs lends support to the notion that the conserved post-transfer editing domain is the main checkpoint in these enzymes. We substantiated this by showing that under error-prone conditions S. griseus IleRS is able to rescue the growth of an E. coli lacking functional IleRS, providing the first evidence that tRNA-dependent pre-transfer editing in IleRS is not essential for cell viability. PMID:26921320

  8. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    PubMed

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  9. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases

    PubMed Central

    Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  10. An Oligonucleotide Affinity Column for RNA-Dependent DNA Polymerase from RNA Tumor Viruses

    PubMed Central

    Gerwin, Brenda I.; Milstien, Julie B.

    1972-01-01

    Columns of (dT)12-18-cellulose provide a one-step enrichment procedure for RNA-dependent DNA polymerase. The enzyme of the virus from RD-114 cells, as well as that from Rauscher murine leukemia virus, have been purified in this way. The preference of viral as compared to cellular DNA polymerases for (dT)12-18 as a primer is reflected in the fact that the DNA polymerases of uninfected cells do not bind to this column. Viral enzymes have been purified and identified from crude cellular extracts. PMID:4506781

  11. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF...

  12. Type B coxsackieviruses and their interactions with the innate and adaptive immune systems

    PubMed Central

    Kemball, Christopher C; Alirezaei, Mehrdad; Whitton, J Lindsay

    2011-01-01

    Coxsackieviruses are important human pathogens, and their interactions with the innate and adaptive immune systems are of particular interest. Many viruses evade some aspects of the innate response, but coxsackieviruses go a step further by actively inducing, and then exploiting, some features of the host cell response. Furthermore, while most viruses encode proteins that hinder the effector functions of adaptive immunity, coxsackieviruses and their cousins demonstrate a unique capacity to almost completely evade the attention of naive CD8+ T cells. In this article, we discuss the above phenomena, describe the current status of research in the field, and present several testable hypotheses regarding possible links between virus infection, innate immune sensing and disease. PMID:20860480

  13. Molecular epidemiology of human coxsackievirus A16 strains

    PubMed Central

    YU, WENMIN; XU, HUANXIN; YIN, CHANGCHANG

    2016-01-01

    The hand, foot and mouth disease (HFMD) epidemics have mainly been caused by human enterovirus 71 and human coxsackievirus A16 (CA16), which circulated alternatively or together in the epidemic area. The aim of the present study was to provide guidance in the prevention and control of HFMD from CA16 infection. The molecular epidemiology of the human CA16 strains was investigated. Overall, 1,151 specimens (throat swabs) were collected from 1,151 patients with HFMD symptoms. The results of the homology comparison in the VP1 of CA16 strains showed that the CA16 strains belonged to the B1b subgenotype. The difference of the 6 CA16 strains analyzed showed that the most prominent strain was the A genotype, and the most close strains were the B1 gene subtype, particularly the B1b gene subtype. With regards to the amino acids, in addition to the A genotype, the differences of amino acids with other gene subtype was not significant. The present data suggest that more effective and highly targeted intervention mechanisms could be developed for the prevention and control of HFMD. PMID:27284420

  14. Deficient signaling in mice devoid of double-stranded RNA-dependent protein kinase.

    PubMed Central

    Yang, Y L; Reis, L F; Pavlovic, J; Aguzzi, A; Schäfer, R; Kumar, A; Williams, B R; Aguet, M; Weissmann, C

    1995-01-01

    Double-stranded RNA-dependent protein kinase (PKR) has been implicated in interferon (IFN) induction, antiviral response and tumor suppression. We have generated mice devoid of functional PKR (Pkr%). Although the mice are physically normal and the induction of type I IFN genes by poly(I).poly(C) (pIC) and virus is unimpaired, the antiviral response induced by IFN-gamma and pIC was diminished. However, in embryo fibroblasts from Pkr knockout mice, the induction of type I IFN as well as the activation of NF-kappa B by pIC, were strongly impaired but restored by priming with IFN. Thus, PKR is not directly essential for responses to pIC, and a pIC-responsive system independent of PKR is induced by IFN. No evidence of the tumor suppressor activity of PKR was demonstrated. Images PMID:8557029

  15. Structural basis of viral RNA-dependent RNA polymerase catalysis and translocation.

    PubMed

    Shu, Bo; Gong, Peng

    2016-07-12

    Viral RNA-dependent RNA polymerases (RdRPs) play essential roles in viral genome replication and transcription. We previously reported several structural states of the poliovirus RdRP nucleotide addition cycle (NAC) that revealed a unique palm domain-based active site closure mechanism and proposed a six-state NAC model including a hypothetical state representing translocation intermediates. Using the RdRP from another human enterovirus, enterovirus 71, here we report seven RdRP elongation complex structures derived from a crystal lattice that allows three NAC events. These structures suggested a key order of events in initial NTP binding and NTP-induced active site closure and revealed a bona fide translocation intermediate featuring asymmetric movement of the template-product duplex. Our work provides essential missing links in understanding NTP recognition and translocation mechanisms in viral RdRPs and emphasizes the uniqueness of the viral RdRPs compared with other processive polymerases. PMID:27339134

  16. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms

    PubMed Central

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-01-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  17. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms.

    PubMed

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-08-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  18. Functional insights from molecular modeling, docking, and dynamics study of a cypoviral RNA dependent RNA polymerase.

    PubMed

    Kundu, Anirban; Dutta, Anirudha; Biswas, Poulomi; Das, Amit Kumar; Ghosh, Ananta Kumar

    2015-09-01

    Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV) contains 11 double stranded RNA genome segments and infects tasar silkworm A. mylitta. RNA-dependent RNA polymerase (RdRp) is reported as a key enzyme responsible for propagation of the virus in the host cell but its structure function relationship still remains elusive. Here a computational approach has been taken to compare sequence and secondary structure of AmCPV RdRp with other viral RdRps to identify consensus motifs. Then a reliable pairwise sequence alignment of AmCPV RdRp with its closest sequence structure homologue λ3 RdRp is done to predict three dimensional structure of AmCPV RdRp. After comparing with other structurally known viral RdRps, important sequence and/or structural features involved in substrate entry or binding, polymerase reaction and the product release events have been identified. A conserved RNA pentanucleotide (5'-AGAGC-3') at the 3'-end of virus genome is predicted as cis-acting signal for RNA synthesis and its docking and simulation study along with the model of AmCPV RdRp has allowed to predict mode of template binding by the viral polymerase. It is found that template RNA enters into the catalytic center through nine sequence-independent and two sequence-dependent interactions with the specific amino acid residues. However, number of sequence dependent interactions remains almost same during 10 nano-second simulation time while total number of interactions decreases. Further, docking of N(7)-methyl-GpppG (mRNA cap) on the model as well as prediction of RNA secondary structure has shown the template entry process in the active site. These findings have led to postulate the mechanism of RNA-dependent RNA polymerization process by AmCPV RdRp. To our knowledge, this is the first report to evaluate structure function relationship of a cypoviral RdRp. PMID:26264734

  19. Enzymatic and nonenzymatic functions of viral RNA-dependent RNA polymerases within oligomeric arrays

    PubMed Central

    Spagnolo, Jeannie F.; Rossignol, Evan; Bullitt, Esther; Kirkegaard, Karla

    2010-01-01

    Few antivirals are effective against positive-strand RNA viruses, primarily because the high error rate during replication of these viruses leads to the rapid development of drug resistance. One of the favored current targets for the development of antiviral compounds is the active site of viral RNA-dependent RNA polymerases. However, like many subcellular processes, replication of the genomes of all positive-strand RNA viruses occurs in highly oligomeric complexes on the cytosolic surfaces of the intracellular membranes of infected host cells. In this study, catalytically inactive polymerases were shown to participate productively in functional oligomer formation and catalysis, as assayed by RNA template elongation. Direct protein transduction to introduce either active or inactive polymerases into cells infected with mutant virus confirmed the structural role for polymerase molecules during infection. Therefore, we suggest that targeting the active sites of polymerase molecules is not likely to be the best antiviral strategy, as inactivated polymerases do not inhibit replication of other viruses in the same cell and can, in fact, be useful in RNA replication complexes. On the other hand, polymerases that could not participate in functional RNA replication complexes were those that contained mutations in the amino terminus, leading to altered contacts in the folded polymerase and mutations in a known polymerase–polymerase interaction in the two-dimensional protein lattice. Thus, the functional nature of multimeric arrays of RNA-dependent RNA polymerase supplies a novel target for antiviral compounds and provides a new appreciation for enzymatic catalysis on membranous surfaces within cells. PMID:20051491

  20. MicroRNA-dependent regulation of transcription in non-small cell lung cancer.

    PubMed

    Molina-Pinelo, Sonia; Gutiérrez, Gabriel; Pastor, Maria Dolores; Hergueta, Marta; Moreno-Bueno, Gema; García-Carbonero, Rocío; Nogal, Ana; Suárez, Rocío; Salinas, Ana; Pozo-Rodríguez, Francisco; Lopez-Rios, Fernando; Agulló-Ortuño, Maria Teresa; Ferrer, Irene; Perpiñá, Asunción; Palacios, José; Carnero, Amancio; Paz-Ares, Luis

    2014-01-01

    Squamous cell lung cancer (SCC) and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC), and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA)-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA)) and mRNA profiling (Whole Genome 44 K array G112A, Agilent) was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708) and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1) were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies. PMID:24625834

  1. Coxsackievirus B Exits the Host Cell in Shed Microvesicles Displaying Autophagosomal Markers

    PubMed Central

    Mangale, Vrushali; Rahawi, Shahad; McIntyre, Laura L.; Williams, Wesley; Kha, Nelson; Cruz, Casey; Hancock, Bryan M.; Nguyen, David P.; Sayen, M. Richard; Hilton, Brett J.; Doran, Kelly S.; Segall, Anca M.; Wolkowicz, Roland; Cornell, Christopher T.; Whitton, J. Lindsay; Gottlieb, Roberta A.; Feuer, Ralph

    2014-01-01

    Coxsackievirus B3 (CVB3), a member of the picornavirus family and enterovirus genus, causes viral myocarditis, aseptic meningitis, and pancreatitis in humans. We genetically engineered a unique molecular marker, “fluorescent timer” protein, within our infectious CVB3 clone and isolated a high-titer recombinant viral stock (Timer-CVB3) following transfection in HeLa cells. “Fluorescent timer” protein undergoes slow conversion of fluorescence from green to red over time, and Timer-CVB3 can be utilized to track virus infection and dissemination in real time. Upon infection with Timer-CVB3, HeLa cells, neural progenitor and stem cells (NPSCs), and C2C12 myoblast cells slowly changed fluorescence from green to red over 72 hours as determined by fluorescence microscopy or flow cytometric analysis. The conversion of “fluorescent timer” protein in HeLa cells infected with Timer-CVB3 could be interrupted by fixation, suggesting that the fluorophore was stabilized by formaldehyde cross-linking reactions. Induction of a type I interferon response or ribavirin treatment reduced the progression of cell-to-cell virus spread in HeLa cells or NPSCs infected with Timer-CVB3. Time lapse photography of partially differentiated NPSCs infected with Timer-CVB3 revealed substantial intracellular membrane remodeling and the assembly of discrete virus replication organelles which changed fluorescence color in an asynchronous fashion within the cell. “Fluorescent timer” protein colocalized closely with viral 3A protein within virus replication organelles. Intriguingly, infection of partially differentiated NPSCs or C2C12 myoblast cells induced the release of abundant extracellular microvesicles (EMVs) containing matured “fluorescent timer” protein and infectious virus representing a novel route of virus dissemination. CVB3 virions were readily observed within purified EMVs by transmission electron microscopy, and infectious virus was identified within low

  2. Spatiotemporal phylogenetic analysis and molecular characterization of coxsackievirus A4.

    PubMed

    Chu, Pei-Yu; Lu, Po-Liang; Tsai, Yu-Ling; Hsi, Edward; Yao, Ching-Yuan; Chen, Yu-Hsien; Hsu, Li-Ching; Wang, Sheng-Yu; Wu, Ho-Sheng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Kuei-Hsiang

    2011-08-01

    Coxsackievirus A4 outbreaks occurred in Taiwan in 2004 and 2006. The spatiotemporal transmission of this error-prone RNA virus involves a continuous interaction between rapid sequence variation and natural selection. To elucidate the molecular characteristics of CV-A4 and the spatiotemporal dynamic changes in CV-A4 transmission, worldwide sequences of the 3' VP1 region (420 nt) obtained from GenBank were analyzed together with sequences isolated in Taiwan from 2002 to 2009. Sequences were characterized in terms of recombination, variability, and selection. Phylogenetic trees were constructed using neighbor-joining, maximum likelihood and Monte Carlo Markov Chain methods. Spatiotemporal dynamics of CV-A4 transmission were further estimated by a Bayesian statistical inference framework. No recombination was detected in the 420 nt region. The estimated evolution rate of CV-A4 was 8.65 × 10(-3) substitutions/site/year, and a purifying selection (d(N)/d(S)=0.032) was noted over the 3' VP1 region. All trees had similar topology: two genotypes (GI and GII), each including two subgenotypes (A and B), with the prototype and a Kenyan strain in separate branches. The results revealed that the virus first appeared in USA in 1950. Since 1998, it has evolved into the Kenya, GI-A (Asia) and GII-A (Asia and Europe) strains. Since 2004, GI-B and GII-B have evolved continuously and have remained prevalent. The co-existence of several positive selection lineages of GI-B in 2006 indicates that the subgenotype might have survived lineage extinction. This study revealed rapid lineage turnover of CV-A4 and the replacement of previously circulating strains by a new dominant variant. Therefore, continuous surveillance for further CV-A4 transmission is essential. PMID:21635970

  3. Transmission and Demographic Dynamics of Coxsackievirus B1.

    PubMed

    Chu, Pei-Yu; Tyan, Yu-Chang; Chen, Yao-Shen; Chen, Hsiu-Lin; Lu, Po-Liang; Chen, Yu-Hsien; Chen, Bao-Chen; Huang, Tsi-Shu; Wang, Chu-Feng; Su, Hui-Ju; Shi, Yong-Ying; Sanno-Duanda, Bintou; Lin, Kuei-Hsiang; Motomura, Kazushi

    2015-01-01

    The infectious activity of coxsackievirus B1 (CV-B1) in Taiwan was high from 2008 to 2010, following an alarming increase in severe neonate disease in the United States (US). To examine the relationship between CV-B1 strains isolated in Taiwan and those from other parts of the world, we performed a phylodynamic study using VP1 and partial 3Dpol (414 nt) sequences from 22 strains of CV-B1 isolated in Taiwan (1989-2010) and compared them to sequences from strains isolated worldwide. Phylogenetic trees were constructed by neighbor-joining, maximum likelihood, and Bayesian Monte Carlo Markov Chain methods. Four genotypes (GI-IV) in the VP1 region of CV-B1 and three genotypes (GA-C) in the 3Dpol region of enterovirus B were identified and had high support values. The phylogenetic analysis indicates that the GI and GIII strains in VP1 were geographically distributed in Taiwan (1993-1994) and in India (2007-2009). On the other hand, the GII and GIV strains appear to have a wider spatiotemporal distribution and ladder-like topology A stair-like phylogeny was observed in the VP1 region indicating that the phylogeny of the virus may be affected by different selection pressures in the specified regions. Further, most of the GI and GII strains in the VP1 tree were clustered together in GA in the 3D tree, while the GIV strains diverged into GB and GC. Taken together, these data provide important insights into the population dynamics of CV-B1 and indicate that incongruencies in specific gene regions may contribute to spatiotemporal patterns of epidemicity for this virus. PMID:26053872

  4. Epididymitis Caused by Coxsackievirus A6 in Association with Hand, Foot, and Mouth Disease

    PubMed Central

    Österback, Riikka; Kuisma, Jani; Ylipalosaari, Pekka

    2014-01-01

    Coxsackievirus A6 (CV-A6) caused hand, foot, and mouth disease (HFMD) with a unique manifestation of epididymitis. The patient underwent operation due to suspicion of testicular torsion. Epididymitis was diagnosed by ultrasound examination. Enterovirus was detected from epididymal fluid by PCR and typed by partial sequencing of viral protein 1 as CV-A6. PMID:25232161

  5. Episodic adaptive diversification of classical swine fever virus RNA-dependent RNA polymerase NS5B.

    PubMed

    Li, Yan; Yang, Zexiao

    2015-12-01

    Classical swine fever virus (CSFV) is the pathogen that causes a highly infectious disease of pigs and has led to disastrous losses to pig farms and related industries. The RNA-dependent RNA polymerase (RdRp) NS5B is a central component of the replicase complex (RC) in some single-stranded RNA viruses, including CSFV. On the basis of genetic variation, the CSFV RdRps could be clearly divided into 2 major groups and a minor group, which is consistent with the phylogenetic relationships and virulence diversification of the CSFV isolates. However, the adaptive signature underlying such an evolutionary profile of the polymerase and the virus is still an interesting open question. We analyzed the evolutionary trajectory of the CSFV RdRps over different timescales to evaluate the potential adaptation. We found that adaptive selection has driven the diversification of the RdRps between, but not within, CSFV major groups. Further, the major adaptive divergence-related sites are located in the surfaces relevant to the interaction with other component(s) of RC and the entrance and exit of the template-binding channel. These results might shed some light on the nature of the RdRp in virulence diversification of CSFV groups. PMID:26485449

  6. Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase

    PubMed Central

    Liu, Xinran; Musser, Derek M.; Lee, Cheri A.; Yang, Xiaorong; Arnold, Jamie J.; Cameron, Craig E.; Boehr, David D.

    2015-01-01

    The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation. PMID:26516899

  7. Phosphorylation at the N-terminal finger subdomain of a viral RNA-dependent RNA polymerase.

    PubMed

    Hernández, Sergio; Figueroa, Daniella; Correa, Simón; Díaz, Ariel; Aguayo, Daniel; Villanueva, Rodrigo A

    2015-10-01

    The RNA-dependent RNA polymerase (RdRP) of the Hepatitis C virus (HCV), named NS5B, is phosphorylated by the cellular protein kinase C-related kinase 2 (PRK2) at two serine residues (Ser29 and Ser42) of the finger subdomain (genotype 1b). Herein, using bioinformatics, we selected four potential phosphorylation residues (Ser46, Ser76, Ser96 and Ser112) of NS5B (genotype 2a) for study. Whereas the NS5B Ser46D and Ser76D substitutions seemed to improve polymerase activity, the Ser96D mutation decreased colony formation efficiency. Active WT NS5B was utilized in in vitro kinase assays, and phosphopeptides were analyzed by mass spectrometry. Interestingly, the data indicated that both the NS5B Ser29 and Ser76 residues resulted phosphorylated. Thus, as Ser76 is absolutely conserved across HCV genotypes, our results confirmed the relevance of these sites for both genotypes and suggested that Ser76 becomes phosphorylated by a cellular kinase different from PRK2. By molecular dynamic simulations, we show that new interactions between space-adjacent amino acid chains could be established by the presence of a di-anionic phosphate group on the analyzed serines to possibly modify RNA polymerase activity. Together, our data present novel evidence on the complex regulation at the finger subdomain of HCV NS5B via phosphorylation. PMID:26301630

  8. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases.

    PubMed

    Qian, Xinlei; Hamid, Fursham M; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V; Lescar, Julien

    2016-04-22

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1(Ncr)) and related fungi, Thielavia terrestris (QDE-1(Tte)) and Myceliophthora thermophila (QDE-1(Mth)), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1(Ncr) counterpart favoring processive RNA synthesis, QDE-1(Tte) and QDE-1(Mth) produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1(Tte) reveals a quasisymmetric dimer similar to QDE-1(Ncr) Further electron microscopy analyses confirm that QDE-1(Tte) occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  9. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases*

    PubMed Central

    Qian, Xinlei; Hamid, Fursham M.; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V.; Lescar, Julien

    2016-01-01

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro. However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1Ncr) and related fungi, Thielavia terrestris (QDE-1Tte) and Myceliophthora thermophila (QDE-1Mth), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1Ncr counterpart favoring processive RNA synthesis, QDE-1Tte and QDE-1Mth produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1Tte reveals a quasisymmetric dimer similar to QDE-1Ncr. Further electron microscopy analyses confirm that QDE-1Tte occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  10. Toscana virus NSs protein promotes degradation of double-stranded RNA-dependent protein kinase.

    PubMed

    Kalveram, Birte; Ikegami, Tetsuro

    2013-04-01

    Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses-i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus-has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells. PMID:23325696

  11. Toscana Virus NSs Protein Promotes Degradation of Double-Stranded RNA-Dependent Protein Kinase

    PubMed Central

    Kalveram, Birte

    2013-01-01

    Toscana virus (TOSV), which is transmitted by Phlebotomus spp. sandflies, is a major etiologic agent of aseptic meningitis and encephalitis in the Mediterranean. Like other members of the genus Phlebovirus of the family Bunyaviridae, TOSV encodes a nonstructural protein (NSs) in its small RNA segment. Although the NSs of Rift Valley fever virus (RVFV) has been identified as an important virulence factor, which suppresses host general transcription, inhibits transcription from the beta interferon promoter, and promotes the proteasomal degradation of double-stranded RNA-dependent protein kinase (PKR), little is known about the functions of NSs proteins encoded by less-pathogenic members of this genus. In this study we report that TOSV is able to downregulate PKR with similar efficiency as RVFV, while infection with the other phleboviruses—i.e., Punta Toro virus, sandfly fever Sicilian virus, or Frijoles virus—has no effect on cellular PKR levels. In contrast to RVFV, however, cellular transcription remains unaffected during TOSV infection. TOSV NSs protein promotes the proteasome-dependent downregulation of PKR and is able to interact with kinase-inactive PKR in infected cells. PMID:23325696

  12. Subgenomic promoter recognition by the norovirus RNA-dependent RNA polymerases

    PubMed Central

    Lin, Xiaoyan; Thorne, Lucy; Jin, Zhinan; Hammad, Loubna A.; Li, Serena; Deval, Jerome; Goodfellow, Ian G.; Kao, C. Cheng

    2015-01-01

    The replication enzyme of RNA viruses must preferentially recognize their RNAs in an environment that contains an abundance of cellular RNAs. The factors responsible for specific RNA recognition are not well understood, in part because viral RNA synthesis takes place within enzyme complexes associated with modified cellular membrane compartments. Recombinant RNA-dependent RNA polymerases (RdRps) from the human norovirus and the murine norovirus (MNV) were found to preferentially recognize RNA segments that contain the promoter and a short template sequence for subgenomic RNA synthesis. Both the promoter and template sequence contribute to stable RdRp binding, accurate initiation of the subgenomic RNAs and efficient RNA synthesis. Using a method that combines RNA crosslinking and mass spectrometry, residues near the template channel of the MNV RdRp were found to contact the hairpin RNA motif. Mutations in the hairpin contact site in the MNV RdRp reduced MNV replication and virus production in cells. This work demonstrates that the specific recognition of the norovirus subgenomic promoter is through binding by the viral RdRp. PMID:25520198

  13. Organization, Function, and Therapeutic Targeting of the Morbillivirus RNA-Dependent RNA Polymerase Complex.

    PubMed

    Sourimant, Julien; Plemper, Richard K

    2016-01-01

    The morbillivirus genus comprises major human and animal pathogens, including the highly contagious measles virus. Morbilliviruses feature single stranded negative sense RNA genomes that are wrapped by a plasma membrane-derived lipid envelope. Genomes are encapsidated by the viral nucleocapsid protein forming ribonucleoprotein complexes, and only the encapsidated RNA is transcribed and replicated by the viral RNA-dependent RNA polymerase (RdRp). In this review, we discuss recent breakthroughs towards the structural and functional understanding of the morbillivirus polymerase complex. Considering the clinical burden imposed by members of the morbillivirus genus, the development of novel antiviral therapeutics is urgently needed. The viral polymerase complex presents unique structural and enzymatic properties that can serve as attractive candidates for druggable targets. We evaluate distinct strategies for therapeutic intervention and examine how high-resolution insight into the organization of the polymerase complex may pave the path towards the structure-based design and optimization of next-generation RdRp inhibitors. PMID:27626440

  14. Alfalfa mosaic virus coat protein bridges RNA and RNA-dependent RNA polymerase in vitro.

    PubMed

    Reichert, Vienna L; Choi, Mehee; Petrillo, Jessica E; Gehrke, Lee

    2007-07-20

    Alfalfa mosaic virus (AMV) RNA replication requires the viral coat protein (CP). AMV CP is an integral component of the viral replicase; moreover, it binds to the viral RNA 3'-termini and induces the formation of multiple new base pairs that organize the RNA conformation. The results described here suggest that AMV coat protein binding defines template selection by organizing the 3'-terminal RNA conformation and by positioning the RNA-dependent RNA polymerase (RdRp) at the initiation site for minus strand synthesis. RNA-protein interactions were analyzed by using a modified Northwestern blotting protocol that included both viral coat protein and labeled RNA in the probe solution ("far-Northwestern blotting"). We observed that labeled RNA alone bound the replicase proteins poorly; however, complex formation was enhanced significantly in the presence of AMV CP. The RNA-replicase bridging function of the AMV CP may represent a mechanism for accurate de novo initiation in the absence of canonical 3' transfer RNA signals. PMID:17400272

  15. New pseudodimeric aurones as palm pocket inhibitors of Hepatitis C virus RNA-dependent RNA polymerase.

    PubMed

    Meguellati, Amel; Ahmed-Belkacem, Abdelhakim; Nurisso, Alessandra; Yi, Wei; Brillet, Rozenn; Berqouch, Nawel; Chavoutier, Laura; Fortuné, Antoine; Pawlotsky, Jean-Michel; Boumendjel, Ahcène; Peuchmaur, Marine

    2016-06-10

    The NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme for Hepatitis C Virus (HCV) replication. In addition to the catalytic site, this enzyme is characterized by the presence of at least four allosteric pockets making it an interesting target for development of inhibitors as potential anti-HCV drugs. Based on a previous study showing the potential of the naturally occurring aurones as inhibitors of NS5B, we pursued our efforts to focus on pseudodimeric aurones that have never been investigated so far. Hence, 14 original compounds characterized by the presence of a spacer between the benzofuranone moieties were synthesized and investigated as HCV RdRp inhibitors by means of an in vitro assay. The most active inhibitor, pseudodimeric aurone 4, induced high inhibition activity (IC50 = 1.3 μM). Mutagenic and molecular modeling studies reveal that the binding site for the most active derivatives probably is the palm pocket I instead of the thumb pocket I as for the monomeric derivatives. PMID:27017550

  16. Nucleobase but not Sugar Fidelity is Maintained in the Sabin I RNA-Dependent RNA Polymerase.

    PubMed

    Liu, Xinran; Musser, Derek M; Lee, Cheri A; Yang, Xiaorong; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2015-10-01

    The Sabin I poliovirus live, attenuated vaccine strain encodes for four amino acid changes (i.e., D53N, Y73H, K250E, and T362I) in the RNA-dependent RNA polymerase (RdRp). We have previously shown that the T362I substitution leads to a lower fidelity RdRp, and viruses encoding this variant are attenuated in a mouse model of poliovirus. Given these results, it was surprising that the nucleotide incorporation rate and nucleobase fidelity of the Sabin I RdRp is similar to that of wild-type enzyme, although the Sabin I RdRp is less selective against nucleotides with modified sugar groups. We suggest that the other Sabin amino acid changes (i.e., D53N, Y73H, K250E) help to re-establish nucleotide incorporation rates and nucleotide discrimination near wild-type levels, which may be a requirement for the propagation of the virus and its efficacy as a vaccine strain. These results also suggest that the nucleobase fidelity of the Sabin I RdRp likely does not contribute to viral attenuation. PMID:26516899

  17. Genetic Transformation of Citrus Paradisi with Antisense and untranslatable RNA-dependent RNA Polymerase Genes of Citrus Tristeza Closterovirus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of the RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) was studied in vivo and in vitro using a polyclonal antiserum raised against the recombinant CTV-RdRp protein. Although 56 kDa CTV-RdRp is thought to be expressed by a +1 translational frameshift at the carboxyl te...

  18. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PROCEDURES AND DELEGATIONS OF THE BOARD OF REGENTS OF THE UNIFORMED SERVICES UNIVERSITY OF THE HEALTH SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...) Public announcement of meetings shall conform to the Public Meeting Procedures of the Board of...

  19. Nonnucleoside Inhibitor of Measles Virus RNA-Dependent RNA Polymerase Complex Activity▿ †

    PubMed Central

    White, Laura K.; Yoon, Jeong-Joong; Lee, Jin K.; Sun, Aiming; Du, Yuhong; Fu, Haian; Snyder, James P.; Plemper, Richard K.

    2007-01-01

    Paramyxoviruses comprise several major human pathogens. Although a live-attenuated vaccine protects against measles virus (MV), a member of the paramyxovirus family, the virus remains a principal cause of worldwide mortality and accounts for approximately 21 million cases and 300,000 to 400,000 deaths annually. The development of novel antivirals that allow improved case management of severe measles and silence viral outbreaks is thus highly desirable. We have previously described the development of novel MV fusion inhibitors. The potential for preexisting or emerging resistance in the field constitutes the rationale for the identification of additional MV inhibitors with a diverse target spectrum. Here, we report the development and implementation of a cell-based assay for high-throughput screening of MV antivirals, which has yielded several hit candidates. Following confirmation by secondary assays and chemical synthesis, the most potent hit was found to act as a target-specific inhibitor of MV replication with desirable drug-like properties. The compound proved highly active against multiple primary isolates of diverse MV genotypes currently circulating worldwide, showing active concentrations of 35 to 145 nM. Significantly, it does not interfere with viral entry and lacks cross-resistance with the MV fusion inhibitor class. Mechanistic characterization on a subinfection level revealed that the compound represents a first-in-class nonnucleoside inhibitor of MV RNA-dependent RNA polymerase complex activity. Singly or in combination with the fusion inhibitors, this novel compound class has high developmental potential as a potent therapeutic against MV and will likely further the mechanistic characterization of the viral polymerase complex. PMID:17470652

  20. Functional expression of double-stranded RNA-dependent protein kinase in rat intestinal epithelial cells.

    PubMed

    Sato, Nagahiro; Morimoto, Hiroyuki; Baba, Ryoko; Nakamata, Junichi; Doi, Yoshiaki; Yamaguchi, Koji

    2010-05-01

    Intestinal epithelial cells (IECs) are exposed to external environment, microbial and viral products, and serve as essential barriers to antigens. Recent studies have shown that IECs express Toll-like receptors (TLRs) and respond to microbial components. The antimicrobial and antiviral barriers consist of many molecules including TLRs. To investigate the further component of this barrier in intestine, we examined the expression of double-stranded RNA-dependent protein kinase (PKR). PKR is a player in the cellular antiviral response and phosphorylates alpha-subunit of the eukaryotic translation initiation factor 2 (eIF-2alpha) to block protein synthesis and induces apoptosis. In this study, we showed that the expression of PKR was restricted to the cytoplasm of absorptive epithelial cells in the intestine of adult rat. We also demonstrated that PKR was expressed in the cultured rat intestinal epithelial cells (IEC-6). The level of PKR protein expression and the activity of alkaline phosphatase (ALP) increased in the cultured IEC-6 cells in a time-dependent manner. Inhibition of PKR by the 2-aminopurine treatment decreased ALP activity in the IEC-6 cells. Treatment of IEC-6 cells with synthetic double-stranded RNA (dsRNA) induced cell death in a dose-dependent manner. The addition of hydrocortisone also provoked suppression of PKR expression and ALP activity. This modulation might be mediated by signal transducers and activators of transcription-1 (STAT-1) protein. We concluded that PKR is expressed in IECs as potent barriers to antigens and is a possible modulator of the differentiation of rat IECs. PMID:20213745

  1. Rice RNA-dependent RNA polymerase 6 acts in small RNA biogenesis and spikelet development.

    PubMed

    Song, Xianwei; Wang, Dekai; Ma, Lijia; Chen, Zhiyu; Li, Pingchuan; Cui, Xia; Liu, Chunyan; Cao, Shouyun; Chu, Chengcai; Tao, Yuezhi; Cao, Xiaofeng

    2012-08-01

    Higher plants have evolved multiple RNA-dependent RNA polymerases (RDRs), which work with Dicer-like (DCL) proteins to produce different classes of small RNAs with specialized molecular functions. Here we report that OsRDR6, the rice (Oryza sativa L.) homolog of Arabidopsis RDR6, acts in the biogenesis of various types and sizes of small RNAs. We isolated a rice osrdr6-1 mutant, which was temperature sensitive and showed spikelet defects. This mutant displays reduced accumulation of tasiR-ARFs, the conserved trans-acting siRNAs (tasiRNAs) derived from the TAS3 locus, and ectopic expression of tasiR-ARF target genes, the Auxin Response Factors (including ARF2 and ARF3/ETTIN). The loss of tasiR-mediated repression of ARFs in osrdr6-1 can explain its morphological defects, as expression of two non-targeted ARF3 gene constructs (ARF3muts) in a wild-type background mimics the osrdr6 and osdcl4-1 mutant phenotypes. Small RNA high-throughput sequencing also reveals that besides tasiRNAs, 21-nucleotide (nt) phased small RNAs are also largely dependent on OsRDR6. Unexpectedly, we found that osrdr6-1 has a strong impact on the accumulation of 24-nt phased small RNAs, but not on unphased ones. Our work uncovers the key roles of OsRDR6 in small RNA biogenesis and directly illustrates the crucial functions of tasiR-ARFs in rice development. PMID:22443269

  2. Potent Host-Directed Small-Molecule Inhibitors of Myxovirus RNA-Dependent RNA-Polymerases

    PubMed Central

    Krumm, Stefanie A.; Ndungu, J. Maina; Yoon, Jeong-Joong; Dochow, Melanie; Sun, Aiming; Natchus, Michael; Snyder, James P.; Plemper, Richard K.

    2011-01-01

    Therapeutic targeting of host cell factors required for virus replication rather than of pathogen components opens new perspectives to counteract virus infections. Anticipated advantages of this approach include a heightened barrier against the development of viral resistance and a broadened pathogen target spectrum. Myxoviruses are predominantly associated with acute disease and thus are particularly attractive for this approach since treatment time can be kept limited. To identify inhibitor candidates, we have analyzed hit compounds that emerged from a large-scale high-throughput screen for their ability to block replication of members of both the orthomyxovirus and paramyxovirus families. This has returned a compound class with broad anti-viral activity including potent inhibition of different influenza virus and paramyxovirus strains. After hit-to-lead chemistry, inhibitory concentrations are in the nanomolar range in the context of immortalized cell lines and human PBMCs. The compound shows high metabolic stability when exposed to human S-9 hepatocyte subcellular fractions. Antiviral activity is host-cell species specific and most pronounced in cells of higher mammalian origin, supporting a host-cell target. While the compound induces a temporary cell cycle arrest, host mRNA and protein biosynthesis are largely unaffected and treated cells maintain full metabolic activity. Viral replication is blocked at a post-entry step and resembles the inhibition profile of a known inhibitor of viral RNA-dependent RNA-polymerase (RdRp) activity. Direct assessment of RdRp activity in the presence of the reagent reveals strong inhibition both in the context of viral infection and in reporter-based minireplicon assays. In toto, we have identified a compound class with broad viral target range that blocks host factors required for viral RdRp activity. Viral adaptation attempts did not induce resistance after prolonged exposure, in contrast to rapid adaptation to a pathogen

  3. 216-B-3 expansion ponds closure plan

    SciTech Connect

    Not Available

    1994-10-01

    This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA.

  4. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells

    PubMed Central

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A.; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine

    2015-01-01

    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression. PMID

  5. Pemphigus vulgaris after coxsackievirus infection and cephalosporin treatment: a paraviral eruption?

    PubMed

    Ruocco, E; Lo Schiavo, A; Baroni, A; Sangiuliano, S; Puca, R V; Brunetti, G; Ruocco, V

    2008-01-01

    Pemphigus is an autoimmune disease that results from the interaction between predisposing genetic factors and exogenous agents, mainly drugs and viruses. Herein we report the case of a 66-year-old woman referred to our department for the onset of painful oral erosions and bullous lesions on the torso. Clinical, laboratory and histopathological investigations led to the diagnosis of pemphigus vulgaris. Two weeks before the outbreak of the lesions, the patient had suffered from a viral pharyngitis, subsequently diagnosed as herpangina, and had been taking an oral cephalosporin (cefixime) for 1 week to prevent possible bacterial complications. A relationship between the onset of pemphigus and coxsackievirus infection or cefixime administration or both was supposed. The case may represent a peculiar paraviral eruption, where a predisposing pemphigus-prone genetic background paved the way for the acantholytic autoimmune disorder as a consequence of the combined effect of the coxsackievirus infection and the cephalosporin treatment. PMID:18230979

  6. Coxsackievirus A6: a new emerging pathogen causing hand, foot and mouth disease outbreaks worldwide.

    PubMed

    Bian, Lianlian; Wang, Yiping; Yao, Xin; Mao, Qunying; Xu, Miao; Liang, Zhenglun

    2015-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the predominant pathogens causing outbreaks of hand, foot and mouth disease (HFMD) worldwide. Other human enterovirus A (HEV-A) serotypes tend to cause only sporadic HFMD cases. However, since a HFMD caused by coxsackievirus A6 broke out in Finland in 2008, CA6 has been identified as the responsible pathogen for a series of HFMD outbreaks in Europe, North America and Asia. Because of the severity of the clinical manifestations and the underestimated public health burden, the epidemic of CA6-associated HFMD presents a new challenge to the control of HFMD. This article reviewed the epidemic characteristics, molecular epidemiology, clinical features and laboratory diagnosis of CA6 infection. The genetic evolution of CA6 strains associated with HFMD was also analyzed. It indicated that the development of a multivalent vaccine combining EV71, CA16 and CA6 is an urgent necessity to control HFMD. PMID:26112307

  7. [ANTIVIRAL ACTIVITY OF THE DIHYDROQUERCETIN DURING THE COXSACKIEVIRUS B4 REPLICATION IN VITRO].

    PubMed

    Galochkina, A V; Zarubaev, V V; Kiselev, O I; Babkin, V A; Ostroukhova, L A

    2016-01-01

    A study of the antiviral activity of antioxidants against viral infections is believed to be essential for creating complex antiviral agents. Dihydroquercetin is considered as the most active antioxidant extracted from Larix gmelinii. In this work, we present results of experiments of the antiviral properties of dihydroquercetin against a member of the family Picarnaviridae--Coxsackievirus B4 in vitro. We have estimated that dihydroquercetin reduces viral titers at 100 µg/ml concentration as compared with control of virus. We have shown using the plaque assay that CPE of virusis reduced in the presence of dihydroquercetin at 100 µg/ml. Study of the phase of viral lifecycle, in which dihydroquercetin acted, demonstrated that the highest efficacy of the antiviral therapy was reached at early stages of virus reproduction (1-3 hours post infection). These results show that dihydroquercetin has antiviralproperty against Coxsackievirus B4. This drug and other antioxidants can be tested as inhibitors of viral replication. PMID:27145597

  8. Cellular immune mechanisms in Coxsackievirus group B, type 3 induced myocarditis in Balb/C mice

    SciTech Connect

    Huber, S.A.; Job, L.P.

    1983-01-01

    Coxsackie B viruses are a common cause of viral myocarditis in humans. A murine model of the human disease has been developed using Coxsackievirus group B, type 3 and inbred Balb/c mice. Infection of T lymphocyte deficient mice does not result in significant myocarditis indicating the importance of T cells in this disease. The virus can be isolated from the hearts of T cell deficient and normal mice in equal concentrations. Virus elimination presumably is mediated by virus specific neutralizing antibody induced in both groups. T lymphocytes, natural killer cells and macrophage obtained from normal virus infected mice are all capable of lysing myofibers in vitro. Maximum lysis is obtained with the cytolytic T cells. When these cell populations or Coxsackievirus immune antibody were adoptively transferred into T lymphocyte deficient animals infected with the virus, only animals given T cells developed significant myocarditis.

  9. Initiation of minus-strand RNA synthesis by the brome mosaicvirus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.

    PubMed Central

    Kao, C C; Sun, J H

    1996-01-01

    Various DNA- and RNA-dependent RNA polymerases have been reported to use oligoribonucleotide primers to initiate nucleic acid synthesis. For the brome mosaic virus RNA-dependent RNA polymerase (RdRp), we determined that in reactions performed with limited GTP concentrations, minus-strand RNA synthesis can be stimulated by the inclusion of guanosine monophosphate or specific oligoribonucleotides. Furthermore, guanylyl-3',5'-guanosine (GpG) was incorporated into minus-strand RNA and increased the rate of minus-strand RNA synthesis. In the presence of GpG, RdRp's Km for GTP decreased from 50 microM to approximately 3 microM while the Kms for other nucleotides were unaffected. These results have implications for the mechanism of initiation by RdRp. PMID:8794323

  10. Myocarditis, hepatitis, and pancreatitis in a patient with coxsackievirus A4 infection: a case report

    PubMed Central

    2014-01-01

    Viral myocarditis presents with various symptoms, including fatal arrhythmia and cardiogenic shock, and may develop chronic myocarditis and dilated cardiomyopathy in some patients. We report here a case of viral myocarditis with liver dysfunction and pancreatitis. A 63-year-old man was admitted to our hospital with dyspnea. The initial investigation showed pulmonary congestion, complete atrioventricular block, left ventricular dysfunction, elevated serum troponin I, and elevated liver enzyme levels. He developed pancreatitis five days after admission. Further investigation revealed a high antibody titer against coxsackievirus A4. The patient’s left ventricular dysfunction, pancreatitis, and liver dysfunction had resolved by day 14, but his troponin I levels remained high, and an endomyocardial biopsy showed T-lymphocyte infiltration of the myocardium, confirming acute myocarditis. The patient underwent radical low anterior resection five weeks after admission for advanced rectal cancer found incidentally. His serum troponin I and plasma brain natriuretic peptide levels normalized six months after admission. He has now been followed-up for two years, and his left ventricular ejection fraction is stable. This is the first report of an adult with myocarditis and pancreatitis attributed to coxsackievirus A4. Combined myocarditis and pancreatitis arising from coxsackievirus infection is rare. This patient’s clinical course suggests that changes in his immune response associated with his rectal cancer contributed to the amelioration of his viral myocarditis. PMID:24410962

  11. A tumor mRNA-dependent gold nanoparticle-molecular beacon carrier for controlled drug release and intracellular imaging.

    PubMed

    Qiao, Guangming; Zhuo, Linhai; Gao, Yuan; Yu, Lijuan; Li, Na; Tang, Bo

    2011-07-14

    We demonstrate a tumor mRNA-dependent drug carrier for controlled release of doxorubicin (Dox) and intracellular imaging based on gold nanoparticle-molecular beacon. Fluorescent Dox is released effectively and induces apoptosis in breast cancer cells but not in normal cells. Significantly, the release of Dox is correlated positively with the quantities of tumor mRNA, which is according to various stages of tumor progression, and so can decrease effectively side effects of Dox. PMID:21589964

  12. Domain I of the 5' non-translated genomic region in coxsackievirus B3 RNA is not required for productive replication.

    PubMed

    Jaramillo, L; Smithee, S; Tracy, S; Chapman, N M

    2016-09-01

    Domain I is a cloverleaf-like secondary structure at the 5' termini of all enterovirus genomes, comprising part of a cis-acting replication element essential for efficient enteroviral replication. 5' genomic terminal deletions up to as much as 55% of domain I can occur without lethality following coxsackie B virus infections. We report here that the entire CVB structural domain I can be deleted without lethality. PMID:27289561

  13. Homology modeling, docking, molecular dynamics simulation, and structural analyses of coxsakievirus B3 2A protease: an enzyme involved in the pathogenesis of inflammatory myocarditis.

    PubMed

    Maghsoudi, Amir Hossein; Khodagholi, Fariba; Hadi-Alijanvand, Hamid; Esfandiarei, Mitra; Sabbaghian, Marjan; Zakeri, Zahra; Shaerzadeh, Fatemeh; Abtahi, Shervin; Maghsoudi, Nader

    2011-11-01

    2A protease of the pathogenic coxsackievirus B3 is key to the pathogenesis of inflammatory myocarditis and, therefore, an attractive drug target. However lack of a crystal structure impedes design of inhibitors. Here we predict 3D structure of CVB3 2A(pro) based on sequence comparison and homology modeling with human rhinovirus 2A(pro). The two enzymes are remarkably similar in their core regions. However they have different conformations at the N-terminal. A large number of N-terminal hydrophobic residues reduce the thermal stability of CVB3 2A(pro), as we confirmed by fluorescence, western blot and turbidity measurement. Molecular dynamic simulation revealed that elevated temperature induces protein motion that results in frequent movement of the N-terminal coil. This may therefore induce successive active site changes and thus play an important role in destabilization of CVB3 2A(pro) structure. PMID:21664926

  14. Construction of a subgenomic CV-B3 replicon expressing emerald green fluorescent protein to assess viral replication of a cardiotropic enterovirus strain in cultured human cells.

    PubMed

    Wehbe, Michel; Huguenin, Antoine; Leveque, Nicolas; Semler, Bert L; Hamze, Monzer; Andreoletti, Laurent; Bouin, Alexis

    2016-04-01

    Coxsackieviruses B (CV-B) (Picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (DCM) cases. The mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the DCM clinical stage are not fully understood but are influenced by both viral and host factors. Subgenomic replicons of CV-B can be used to assess viral replication mechanisms in human cardiac cells and evaluate the effects of potential antiviral drugs on viral replication activities. Our objectives were to generate a reporter replicon from a cardiotropic prototype CV-B3/28 strain and to characterize its replication properties into human cardiac primary cells. To obtain this replicon, a cDNA plasmid containing the full CV-B3/28 genome flanked by a hammerhead ribozyme sequence and an MluI restriction site was generated and used as a platform for the insertion of sequences encoding emerald green fluorescent protein (EmGFP) in place of those encoding VP3. In vitro transcribed RNA from this plasmid was transfected into HeLa cells and human primary cardiac cells and was able to produce EmGFP and VP1-containing polypeptides. Moreover, non-structural protein biological activity was assessed by the specific cleavage of eIF4G1 by viral 2A(pro). Viral RNA replication was indirectly demonstrated by inhibition assays, fluoxetine was added to cell culture and prevented the EmGFP synthesis. Our results indicated that the EmGFP CV-B3 replicon was able to replicate and translate as well as the CV-B3/28 prototype strain. Our EmGFP CV-B3 replicon will be a valuable tool to readily investigate CV-B3 replication activities in human target cell models. PMID:26800776

  15. Hand, foot and mouth disease caused by coxsackievirus A6, Beijing, 2013.

    PubMed

    Hongyan, Gu; Chengjie, Ma; Qiaozhi, Yang; Wenhao, Hua; Juan, Li; Lin, Pang; Yanli, Xu; Hongshan, Wei; Xingwang, Li

    2014-12-01

    Specimens and clinical data were collected from 243 hand, foot and mouth disease patients in Beijing in 2013. In total, 130 stool specimens were genotyped for enterovirus. Hand, foot and mouth disease was mainly detected in suburban areas and at the edges of urban areas between May and August. Coxsackievirus (CV) A6 replaced enterovirus (EV) 71 and CVA16, becoming the main causative agent of hand, foot and mouth disease. CVA6 infection led to significantly reduced fever duration and glucose levels compared with EV71 infection. PMID:25037037

  16. Activation of innate antiviral immune response via double-stranded RNA-dependent RLR receptor-mediated necroptosis

    PubMed Central

    Wang, Wei; Wang, Wei-Hua; Azadzoi, Kazem M.; Su, Ning; Dai, Peng; Sun, Jianbin; Wang, Qin; Liang, Ping; Zhang, Wentao; Lei, Xiaoying; Yan, Zhen; Yang, Jing-Hua

    2016-01-01

    Viruses induce double-stranded RNA (dsRNA) in the host cells. The mammalian system has developed dsRNA-dependent recognition receptors such as RLRs that recognize the long stretches of dsRNA as PAMPs to activate interferon-mediated antiviral pathways and apoptosis in severe infection. Here we report an efficient antiviral immune response through dsRNA-dependent RLR receptor-mediated necroptosis against infections from different classes of viruses. We demonstrated that virus-infected A549 cells were efficiently killed in the presence of a chimeric RLR receptor, dsCARE. It measurably suppressed the interferon antiviral pathway but promoted IL-1β production. Canonical cell death analysis by morphologic assessment, phosphatidylserine exposure, caspase cleavage and chemical inhibition excluded the involvement of apoptosis and consistently suggested RLR receptor-mediated necroptosis as the underlying mechanism of infected cell death. The necroptotic pathway was augmented by the formation of RIP1-RIP3 necrosome, recruitment of MLKL protein and the activation of cathepsin D. Contributing roles of RIP1 and RIP3 were confirmed by gene knockdown. Furthermore, the necroptosis inhibitor necrostatin-1 but not the pan-caspase inhibitor zVAD impeded dsCARE-dependent infected cell death. Our data provides compelling evidence that the chimeric RLR receptor shifts the common interferon antiviral responses of infected cells to necroptosis and leads to rapid death of the virus-infected cells. This mechanism could be targeted as an efficient antiviral strategy. PMID:26935990

  17. A Quantitative Spectrophotometric Assay to Monitor the tRNA-Dependent Pathway for Lipid Aminoacylation In Vitro.

    PubMed

    Grube, Christopher D; Roy, Hervé

    2016-08-01

    The transfer RNA (tRNA)-dependent pathway for lipid aminoacylation is a two-step pathway composed of (1) a tRNA aminoacylation step catalyzed by an aminoacyl-tRNA synthetase, forming a specific aa-tRNA, and (2) a tRNA-dependent transfer step in which the amino acid acylating the tRNA is transferred to an acceptor lipid. The latter step is catalyzed by a transferase located within the cytoplasmic membrane of certain bacteria. Lipid aminoacylation modifies the biochemical properties of the membrane and enhances resistance of some pathogens to various classes of antimicrobial agents and components of the innate immune response. Lipid aminoacylation has also been linked to increased virulence of various pathogenic bacteria. Inhibition of this mechanism would render pathogens more susceptible to existing drugs or to natural defenses of a host organism. Because lipid aminoacylation is widespread in many bacterial genera and absent from eukaryotes, and because the tRNA aminoacylation step of this pathway is also used in protein biosynthesis (a process essential for bacterial life), this pathway represents an attractive target for drug design. We have reconstituted the lipid aminoacylation pathway in vitro and optimized it for high-throughput screening of libraries of compounds to simultaneously identify inhibitors targeting each step of the pathway in a single assay. PMID:27073192

  18. Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA-dependent repair pathways

    PubMed Central

    Crippa, Stefania; Nemir, Mohamed; Ounzain, Samir; Ibberson, Mark; Berthonneche, Corinne; Sarre, Alexandre; Boisset, Gaëlle; Maison, Damien; Harshman, Keith; Xenarios, Ioannis; Diviani, Dario; Schorderet, Daniel; Pedrazzini, Thierry

    2016-01-01

    Aims The adult mammalian heart has poor regenerative capacity. In contrast, the zebrafish heart retains a robust capacity for regeneration into adulthood. These distinct responses are consequences of a differential utilization of evolutionary-conserved gene regulatory networks in the damaged heart. To systematically identify miRNA-dependent networks controlling cardiac repair following injury, we performed comparative gene and miRNA profiling of the cardiac transcriptome in adult mice and zebrafish. Methods and results Using an integrated approach, we show that 45 miRNA-dependent networks, involved in critical biological pathways, are differentially modulated in the injured zebrafish vs. mouse hearts. We study, more particularly, the miR-26a-dependent response. Therefore, miR-26a is down-regulated in the fish heart after injury, whereas its expression remains constant in the mouse heart. Targets of miR-26a involve activators of the cell cycle and Ezh2, a component of the polycomb repressive complex 2 (PRC2). Importantly, PRC2 exerts repressive functions on negative regulators of the cell cycle. In cultured neonatal cardiomyocytes, inhibition of miR-26a stimulates, therefore, cardiomyocyte proliferation. Accordingly, miR-26a knockdown prolongs the proliferative window of cardiomyocytes in the post-natal mouse heart. Conclusions This novel strategy identifies a series of miRNAs and associated pathways, in particular miR-26a, which represent attractive therapeutic targets for inducing repair in the injured heart. PMID:26857418

  19. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations....

  20. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  1. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  2. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  3. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  4. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 1 2011-10-01 2011-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for...

  5. 26 CFR 54.4980B-3 - Qualified beneficiaries.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 17 2012-04-01 2012-04-01 false Qualified beneficiaries. 54.4980B-3 Section 54.4980B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) MISCELLANEOUS EXCISE TAXES (CONTINUED) PENSION EXCISE TAXES § 54.4980B-3 Qualified beneficiaries. The determination of who is a qualified beneficiary,...

  6. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Conduct of agency business. 261b.3 Section 261b.3 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members...

  7. Genome Sequence of Coxsackievirus A6, Isolated during a Hand-Foot-and-Mouth Disease Outbreak in Finland in 2008

    PubMed Central

    Koskinen, Satu; Merilahti, Pirjo; Pursiheimo, Juha-Pekka; Blomqvist, Soile; Roivainen, Merja; Laiho, Asta; Susi, Petri; Waris, Matti

    2014-01-01

    Reports of hand-foot-and-mouth disease (HFMD) outbreaks caused by coxsackievirus A6 have increased worldwide after the report of the first outbreak in Finland in 2008. The complete genome of the first outbreak strain from a vesicle fluid specimen was determined. PMID:25323709

  8. Adult-onset Kawasaki disease (mucocutaneous lymph node syndrome) and concurrent Coxsackievirus A4 infection: a case report

    PubMed Central

    Ueda, Yuki; Kenzaka, Tsuneaki; Noda, Ayako; Yamamoto, Yu; Matsumura, Masami

    2015-01-01

    Introduction Kawasaki disease (KD) most commonly develops in infants, although its specific cause is still unclear. We report here a rare case of adult-onset KD which revealed to be concurrently infected by Coxsackievirus A4. Case presentation The patient was a 37-year-old Japanese man who presented with fever, exanthema, changes in the peripheral extremities, bilateral non-exudative conjunctival injection, and changes in the oropharynx, signs that meet the diagnostic criteria for KD defined by the Centers for Disease Control and Prevention. In this case, the patient had a significantly high antibody titer for Coxsackievirus A4, which led us to presume that the occurrence of KD was concurrent Coxsackievirus A4 infection. Conclusion We reported a very rare case of KD which suggests that the disease can be concurrent Coxsackievirus A4 infection. Although KD is an acute childhood disease, with fever as one of the principal features, KD should also be considered in the differential diagnosis when adult patients present with a fever of unknown cause associated with a rash. PMID:26491373

  9. QUANTITATIVE RISK ASSESSMENTS OF THE THREE CONTAMINANT CANDIDATE LIST (CCL) PATHOGENS: COXSACKIEVIRUS, CALICIVIRUS AND MYCOBACTERIUM AVIUM (MAC)

    EPA Science Inventory

    Quantitative dose-response and exposure data for Coxsackievirus and Norovirus (formerly Calicivirus) is limited. Appropriate surrogate data may be limited too. There are few or no animal or human dose-response and disease endpoint (severity, shedding, latency, immunity and susce...

  10. A real-time RT-PCR assay for rapid detection of coxsackievirus A10.

    PubMed

    Mu, C Y; Wang, A Y; Chen, C; Zhao, L; Li, Z

    2015-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) have been the primary causative agents of hand, foot, and mouth disease (HFMD) outbreaks in mainland China in the past. Hence, the surveillance of HFMD has mostly focused on these viruses. However, in recent years, coxsackievirus A10 (CA10) has also been associated with the increasing sporadic HFMD cases and outbreaks. Therefore, a sensitive assay for rapid detection of the CA10 RNA is necessary for disease control. Here, we have developed a specific TaqMan real-time RT-PCR assay by analyzing VP1 gene sequences of CA10 strains from different locations. The assay has been shown to be specific, sensitive, and robust through detection of other related viruses, standard curves, and clinical samples, respectively. This is the first report on development of a VP1 gene-based TaqMan real-time RT-PCR assay for rapid diagnosis of CA10 virus. PMID:26782393

  11. Inflammatory gene expression in Coxsackievirus B-4-infected human islets of Langerhans.

    PubMed

    Olsson, Annika; Johansson, Ulrika; Korsgren, Olle; Frisk, Gun

    2005-05-01

    The event that triggers the autoimmune destruction of insulin-producing beta-cells in type 1 diabetes mellitus (T1DM) is still unknown. Enterovirus, especially Coxsackievirus, infections have long been associated with this disease. Cytokines and chemokines induced by an enterovirus infection may act to trigger the autoimmune reactions that produce T1DM. Gene expression was examined in isolated human islets infected with a Coxsackievirus-B4 (CBV-4) strain causing lytic infection (V89-4557) and in islets infected with a CBV-4 strain establishing persistent infection (VD2921). Microarray analysis indicated that infection with the CBV-4 strains resulted in specific induction of a number of inflammatory genes, including IL-1beta, IL-6, IL-8, MCP-1, and RANTES. Importantly, the inflammatory genes induced by the CBV-4 infections differed in the two strains, with more cytokines being induced by the non-lytic CBV-4 strain than by the lytic strain. These cytokines and chemokines have the potential to rapidly induce inflammatory reactions when expressed in vivo and could contribute to the autoimmune reactions associated with the development of T1DM. PMID:15796921

  12. Recombinant dengue type 1 virus NS5 protein expressed in Escherichia coli exhibits RNA-dependent RNA polymerase activity.

    PubMed

    Tan, B H; Fu, J; Sugrue, R J; Yap, E H; Chan, Y C; Tan, Y H

    1996-02-15

    The complete nonstructural NS5 gene of dengue type 1 virus, Singapore strain S275/90 (D1-S275/90) was expressed in Escherichia coli as a glutathione S-transferase (GST) fusion protein (126 kDa). The GST-NS5 fusion protein was purified and the recombinant NS5 protein released from the fusion protein by thrombin cleavage. The recombinant NS5 had a predicted molecular weight of 100 kDa and reacted with antiserum against D1-S275/90 virus in Western blot analysis. The purified recombinant NS5 protein possessed RNA-dependent RNA polymerase activity which was inhibited (>99%) by antibodies against the recombinant NS5 protein. The polymerase product was shown to be a negative-stranded RNA molecule, of template size, which forms a double-stranded complex with the template RNA. PMID:8607261

  13. PARN deadenylase is involved in miRNA-dependent degradation of TP53 mRNA in mammalian cells

    PubMed Central

    Zhang, Xiaokan; Devany, Emral; Murphy, Michael R.; Glazman, Galina; Persaud, Mirjana; Kleiman, Frida E.

    2015-01-01

    mRNA deadenylation is under the control of cis-acting regulatory elements, which include AU-rich elements (AREs) and microRNA (miRNA) targeting sites, within the 3′ untranslated region (3′ UTRs) of eukaryotic mRNAs. Deadenylases promote miRNA-induced mRNA decay through their interaction with miRNA-induced silencing complex (miRISC). However, the role of poly(A) specific ribonuclease (PARN) deadenylase in miRNA-dependent mRNA degradation has not been elucidated. Here, we present evidence that not only ARE- but also miRNA-mediated pathways are involved in PARN-mediated regulation of the steady state levels of TP53 mRNA, which encodes the tumor suppressor p53. Supporting this, Argonaute-2 (Ago-2), the core component of miRISC, can coexist in complexes with PARN resulting in the activation of its deadenylase activity. PARN regulates TP53 mRNA stability through not only an ARE but also an adjacent miR-504/miR-125b-targeting site in the 3′ UTR. More importantly, we found that miR-125b-loaded miRISC contributes to the specific recruitment of PARN to TP53 mRNA, and that can be reverted by the ARE-binding protein HuR. Together, our studies provide new insights into the role of PARN in miRNA-dependent control of mRNA decay and into the mechanisms behind the regulation of p53 expression. PMID:26400160

  14. 3D Molecular Modelling Study of the H7N9 RNA-Dependent RNA Polymerase as an Emerging Pharmacological Target

    PubMed Central

    Vlachakis, Dimitrios

    2013-01-01

    Currently not much is known about the H7N9 strain, and this is the major drawback for a scientific strategy to tackle this virus. Herein, the 3D complex structure of the H7N9 RNA-dependent RNA polymerase has been established using a repertoire of molecular modelling techniques including homology modelling, molecular docking, and molecular dynamics simulations. Strikingly, it was found that the oligonucleotide cleft and tunnel in the H7N9 RNA-dependent RNA polymerase are structurally very similar to the corresponding region on the hepatitis C virus RNA-dependent RNA polymerase crystal structure. A direct comparison and a 3D postdynamics analysis of the 3D complex of the H7N9 RNA-dependent RNA polymerase provide invaluable clues and insight regarding the role and mode of action of a series of interacting residues on the latter enzyme. Our study provides a novel and efficiently intergraded platform with structural insights for the H7N9 RNA-dependent RNA Polymerase. We propose that future use and exploitation of these insights may prove invaluable in the fight against this lethal, ongoing epidemic. PMID:24187616

  15. Release of Intracellular Calcium Stores Facilitates Coxsackievirus Entry into Polarized Endothelial Cells

    PubMed Central

    Bozym, Rebecca A.; Morosky, Stefanie A.; Kim, Kwang S.; Cherry, Sara; Coyne, Carolyn B.

    2010-01-01

    Group B coxsackieviruses (CVB) are associated with viral-induced heart disease and are among the leading causes of aseptic meningitis worldwide. Here we show that CVB entry into polarized brain microvasculature and aortic endothelial cells triggers a depletion of intracellular calcium stores initiated through viral attachment to the apical attachment factor decay-accelerating factor. Calcium release was dependent upon a signaling cascade that required the activity of the Src family of tyrosine kinases, phospholipase C, and the inositol 1,4,5-trisphosphate receptor isoform 3. CVB-mediated calcium release was required for the activation of calpain-2, a calcium-dependent cysteine protease, which controlled the vesicular trafficking of internalized CVB particles. These data point to a specific role for calcium signaling in CVB entry into polarized endothelial monolayers and highlight the unique signaling mechanisms used by these viruses to cross endothelial barriers. PMID:20949071

  16. Phage Display-Derived Cross-Reactive Neutralizing Antibody against Enterovirus 71 and Coxsackievirus A16.

    PubMed

    Zhang, Xiao; Sun, Chunyun; Xiao, Xiangqian; Pang, Lin; Shen, Sisi; Zhang, Jie; Cen, Shan; Yang, Burton B; Huang, Yuming; Sheng, Wang; Zeng, Yi

    2016-01-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are members of the Picornaviridae family and are considered the main causative agents of hand, foot and mouth disease (HFMD). In recent decades large HFMD outbreaks caused by EV71 and CVA16 have become significant public health concerns in the Asia-Pacific region. Vaccines and antiviral drugs are unavailable to prevent EV71 and CVA16 infection. In the current study, a chimeric antibody targeting a highly conserved peptide in the EV71 VP4 protein was isolated by using a phage display technique. The antibody showed cross-neutralizing capability against EV71 and CVA16 in vitro. The results suggest that this phage display-derived antibody will have great potential as a broad neutralizing antibody against EV71 and CVA16 after affinity maturation and humanization. PMID:26073737

  17. Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO

    SciTech Connect

    Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico

    2010-01-20

    Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.

  18. Structure and chromosomal localization of the murine coxsackievirus and adenovirus receptor gene.

    PubMed

    Chen, Jin-Wen; Ghosh, Ruma; Finberg, Robert W; Bergelson, Jeffrey M

    2003-04-01

    We analyzed BAC genomic clones encoding the murine coxsackievirus and adenovirus receptor (mCAR). The mCAR gene is situated on the distal portion of murine chromosome 16, and is composed of at least eight exons, with intron-exon boundaries similar to those reported for the human CAR gene. We previously described two cDNAs encoding mCAR isoforms: the extracellular and transmembrane portions of both are encoded by exons 1-6; the cytoplasmic domain of mCAR 1 is encoded by exon 7, whereas mCAR 2 results from an RNA splice linking the proximal portion of exon 7 to an alternative exon 8. RT-PCR analysis of the mCAR RNA 5'-terminus suggests that transcription may begin 141-161 nucleotides upstream of the ATG translational start site. PMID:12823902

  19. MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/β-catenin signal pathways.

    PubMed

    Ye, Xin; Hemida, Maged Gomaa; Qiu, Ye; Hanson, Paul J; Zhang, Huifang Mary; Yang, Decheng

    2013-12-01

    Coxsackievirus B3 (CVB3) is one of the most prevalent causes of viral myocarditis and is associated with many other pathological conditions. CVB3 replication relies on host cellular machineries and causes direct damage to host cells. MicroRNAs have been found to regulate viral infections but their roles in CVB3 infection are still poorly understood. Here we describe a novel mechanism by which miR-126 regulates two signal pathways essential for CVB3 replication. We found that CVB3-induced ERK1/2 activation triggered the phosphorylation of ETS-1 and ETS-2 transcription factors, which induced miR-126 upregulation. By using both microRNA mimics and inhibitors, we proved that the upregulated miR-126 suppressed sprouty-related, EVH1 domain containing 1 (SPRED1) and in turn enhanced ERK1/2 activation. This positive feedback loop of ERK1/2-miR-126-ERK1/2 promoted CVB3 replication. Meanwhile, miR-126 expression stimulated GSK-3β activity and induced degradation of β-catenin through suppressing LRP6 and WRCH1, two newly identified targets in the Wnt/β-catenin pathway, which sensitized the cells to virus-induced cell death and increased viral progeny release to initiate new infections. Our results demonstrate that upregulated miR-126 upon CVB3 infection targets SPRED1, LRP6, and WRCH1 genes, mediating cross-talk between ERK1/2 and Wnt/β-catenin pathways, and thus promoting viral replication and contributes to the viral cytopathogenicity. PMID:23811937

  20. New Coxsackievirus B4 Genotype Circulating in Inner Mongolia Autonomous Region, China

    PubMed Central

    Gu, Suyi; Fan, Yaochun; Sun, Qiang; Zhang, Bo; Yan, Shaohong; Xu, Wenbo; Ma, Xueen; Wang, Wenrui

    2014-01-01

    Hand, foot, and mouth disease (HFMD) surveillance was initiated in the Inner Mongolia Autonomous Region of China in 2007, a crucial scrutiny for monitoring the prevalence of enterovirus serotypes associated with HFMD patients. However, this surveillance mostly focused on enterovirus 71 (EV-A71) and coxsackievirus A16; therefore, information on other enterovirus serotypes is limited. To identify the other circulating enterovirus serotypes in the HFMD outbreaks in Inner Mongolia in 2010, clinical samples from HFMD patients were investigated. Six coxsackievirus B4 (CVB4) strains were isolated and phylogenetic analyses of VP1 sequences were performed. Full-length genome sequences of two representative CVB4 isolates were acquired and similarity plot and bootscanning analyses were performed. The phylogenetic dendrogram indicated that all CVB4 strains could be divided into 5 genotypes (Genotypes I–V) with high bootstrap support (90–100%). The CVB4 prototype strain (JVB) was the sole member of genotype I. CVB4 strains belonging to genotype II, which were once common in Europe and the Americas, seemingly disappeared and gave way to genotype III and IV strains, which appear to be the dominant circulating strains in the world. All Chinese CVB4 strains belonged to Genotype V, a newly identified genotype supported by a high bootstrap value (100%), and are circulating only in mainland of China. Intertypic recombination occurred in the Chinese CVB4 strains with novel unknown serotype EV-B donor sequences. Two Chinese CVB4 strains had a virulent residue at position 129 of VP1, and one strain also had a virulent residue at position 16 of VP4. Increased surveillance is needed to monitor the emergence of new genetic lineages of enteroviruses in areas that are often associated with large-scale outbreaks. In addition, continued monitoring of enteroviruses by clinical surveillance and genetic characterization should be enhanced. PMID:24595311

  1. Genomic organization and chromosomal localization of the human Coxsackievirus B-adenovirus receptor gene.

    PubMed

    Bowles, K R; Gibson, J; Wu, J; Shaffer, L G; Towbin, J A; Bowles, N E

    1999-10-01

    Myocarditis and dilated cardiomyopathy (DCM) are common causes of morbidity and mortality in children. Many studies have implicated the enteroviruses and, particularly, the Coxsackievirus-B family as etiologic agents of the acquired forms of these diseases. However, we have shown the group-C adenoviruses to be as commonly detected as enteroviruses in the myocardium of children and adults with these diseases. It has remained something of a conundrum why two such divergent virus families cause these diseases. The recent description of the common human Coxsackievirus B-adenovirus receptor (CAR) offers at least a partial explanation. In order to characterize the CAR gene, we screened a bacterial artificial chromosomal (BAC) library (RPCI11) using a polymerase chain reaction (PCR) product derived from the 3' end of the CAR cDNA sequence. This identified 13 BACs that were further characterized by PCR amplification of seven contiguous regions of the entire cDNA sequence. Eleven of the BACs were determined to encode pseudogenes while the other two BACs (131J5 and 246M1) encoded the presumed functional gene. PCR amplification of a monochromosomal hybrid panel indicated the presence of pseudogenes on chromosomes 15, 18, and 21 while the functional gene is encoded on chromosome 21. Fluorescence in situ hybridization analysis indicated that the gene is located at 21q11.2. DNA sequencing of BACs 131J5 and 246M1 revealed the presence of seven exons. The DNA sequences have been determined for each exon-intron boundary, and putative promoter sequences and transcription initiation sites identified. No consensus polyadenylation signal was identified. PMID:10543405

  2. The Intracellular Domain of the Coxsackievirus and Adenovirus Receptor Differentially Influences Adenovirus Entry

    PubMed Central

    Loustalot, Fabien

    2015-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a cell adhesion molecule used as a docking molecule by some adenoviruses (AdVs) and group B coxsackieviruses. We previously proposed that the preferential transduction of neurons by canine adenovirus type 2 (CAV-2) is due to CAR-mediated internalization. Our proposed pathway of CAV-2 entry is in contrast to that of human AdV type 5 (HAdV-C5) in nonneuronal cells, where internalization is mediated by auxiliary receptors such as integrins. We therefore asked if in fibroblast-like cells the intracellular domain (ICD) of CAR plays a role in the internalization of the CAV-2 fiber knob (FKCAV), CAV-2, or HAdV-C5 when the capsid cannot engage integrins. Here, we show that in fibroblast-like cells, the CAR ICD is needed for FKCAV entry and efficient CAV-2 transduction but dispensable for HAdV-C5 and an HAdV-C5 capsid lacking the RGD sequence (an integrin-interacting motif) in the penton. Moreover, the deletion of the CAR ICD further impacts CAV-2 intracellular trafficking, highlighting the crucial role of CAR in CAV-2 intracellular dynamics. These data demonstrate that the CAR ICD contains sequences important for the recruitment of the endocytic machinery that differentially influences AdV cell entry. IMPORTANCE Understanding how viruses interact with the host cell surface and reach the intracellular space is of crucial importance for applied and fundamental virology. Here, we compare the role of a cell adhesion molecule (CAR) in the internalization of adenoviruses that naturally infect humans and Canidae. We show that the intracellular domain of CAR differentially regulates AdV entry and trafficking. Our study highlights the mechanistic differences that a receptor can have for two viruses from the same family. PMID:26136571

  3. Immunological and biochemical characterizations of coxsackievirus A6 and A10 viral particles.

    PubMed

    Liu, Chia-Chyi; Guo, Meng-Shin; Wu, Shang-Rung; Lin, Hsiao-Yu; Yang, Ya-Ting; Liu, Wei-Chih; Chow, Yen-Hung; Shieh, Dar-Bin; Wang, Jen-Ren; Chong, Pele

    2016-05-01

    Childhood exanthema caused by different serotypes of coxsackievirus (CV-A) and enterovirus A71 (EV-A71) has become a serious global health problem; it is commonly known as hand, foot, and mouth disease (HFMD). Current EV-A71 vaccine clinical trials have demonstrated that human antibody responses generated by EV-A71 vaccinations do not cross-neutralize coxsackievirus A16 (CV-A16). An effective multivalent HFMD vaccine is urgently needed. From molecular epidemiological studies in Southeast Asia, CV-A6 and CV-A10 are commonly found in HFMD outbreaks. In this study, CV-A6 and CV-A10 were individually cultured in rhabdomyosarcoma (RD) cells grown in medium containing serum, harvested and concentrated. In viral downstream purification, two viral fractions were separated by sucrose gradient zonal ultracentrifugation and detected using a SDS-PAGE analysis and a virus infectivity assay. These two viral fractions were formalin-inactivated, and only the infectious particle fraction was found to be capable of inducing CV-A serotype-specific neutralizing antibody responses in animal immunogenicity studies. These mouse and rabbit antisera also failed to cross-neutralize EV-A71 and CV-A16 infections. Only a combination of formalin-inactivated EV-A71, CV-A6, CV-A10 and CV-A16 multivalent vaccine candidates elicited cross-neutralizing antibody responses in both mouse and rabbit immunogenicity studies. The current results certainly provide important information for multivalent HFMD vaccine development. PMID:26899790

  4. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance with this part....

  5. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 4 2013-01-01 2013-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM (CONTINUED) RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance...

  6. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors.

    PubMed

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G; Frese, Michael; White, Peter A; Strive, Tanja

    2016-04-01

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV. PMID:27089358

  7. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus

    PubMed Central

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A.; Corman, Victor M.; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  8. Backtracking behavior in viral RNA-dependent RNA polymerase provides the basis for a second initiation site

    PubMed Central

    Dulin, David; Vilfan, Igor D.; Berghuis, Bojk A.; Poranen, Minna M.; Depken, Martin; Dekker, Nynke H.

    2015-01-01

    Transcription in RNA viruses is highly dynamic, with a variety of pauses interrupting nucleotide addition by RNA-dependent RNA polymerase (RdRp). For example, rare but lengthy pauses (>20 s) have been linked to backtracking for viral single-subunit RdRps. However, while such backtracking has been well characterized for multi-subunit RNA polymerases (RNAPs) from bacteria and yeast, little is known about the details of viral RdRp backtracking and its biological roles. Using high-throughput magnetic tweezers, we quantify the backtracking by RdRp from the double-stranded (ds) RNA bacteriophage Φ6, a model system for RdRps. We characterize the probability of entering long backtracks as a function of force and propose a model in which the bias toward backtracking is determined by the base paring at the dsRNA fork. We further discover that extensive backtracking provides access to a new 3′-end that allows for the de novo initiation of a second RdRp. This previously unidentified behavior provides a new mechanism for rapid RNA synthesis using coupled RdRps and hints at a possible regulatory pathway for gene expression during viral RNA transcription. PMID:26496948

  9. OsGatB, the Subunit of tRNA-Dependent Amidotransferase, Is Required for Primary Root Development in Rice.

    PubMed

    Qin, Cheng; Cheng, Linming; Zhang, Huanhuan; He, Meiling; Shen, Jingqin; Zhang, Yunhong; Wu, Ping

    2016-01-01

    A short-root rice mutant was isolated from an ethyl methane sulfonate-mutagenized library. From map-based cloning strategy, a point mutation, resulting in an amino acid change from proline to leucine, was identified in the fourth exon of a glutamyl-tRNA (Gln) amidotransferase B subunit family protein (OsGatB, LOC_Os11g34210). This gene is an ortholog of Arabidopsis GatB and yeast PET112. GatB is a subunit of tRNA-dependent amidotransferase (AdT), an essential enzyme involved in Gln-tRNA(Gln) synthesis in mitochondria. Although previous studies have described that cessation in mitochondrial translation is lethal at very early developmental stages in plants, this point mutation resulted in a non-lethal phenotype of smaller root meristem and shorter root cell length. In the root, OsGatB was predominantly expressed in the root tip and played an important role in cell division and elongation there. OsGatB was localized in the mitochondria, and mitochondrial structure and function were all affected in Osgatb root tip cells. PMID:27200067

  10. Specific antigenic relationships between the RNA-dependent DNA polymerases of avian reticuloendotheliosis viruses and mammalian type C retroviruses.

    PubMed Central

    Bauer, G; Temin, H M

    1980-01-01

    Immunoglobulin G directed against the DNA polymerase of Rauscher murine leukemia virus (R-MuLV) could bind to 125I-labeled DNA polymerase of spleen necrosis virus (SNV), a member of the reticuloendotheliosis virus (REV) species. Competition radioimmunoassays showed the specificity of this cross-reaction. The antigenic determinants common to SNV and R-MuLV DNA polymerases were shared completely by the DNA polymerases of Gross MuLV, Moloney MuLV, RD 114 virus, REV-T, and duck infectious anemia virus. Baboon endogenous virus and chicken syncytial virus competed partially for antibodies directed against the common antigenic determinants of SNV and R-MuLV DNA polymerases. DNA polymerases of avian leukosis viruses, pheasant viruses, and mammalian type B and D retroviruses and particles with RNA-dependent DNA polymerase activity from the allantoic fluid of normal chicken eggs and from the medium of a goose cell culture did not compete for the antibodies directed against the common antigenic determinants of SNV and R-MuLV DNA polymerases. We also present data about a factor in normal mammalian immunoglobulin G that specifically inhibits the DNA polymerases of REV and mammalian type C retrovirus DNA polymerases. PMID:6154804

  11. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase.

    PubMed

    Ma, Ming-Yue; Lan, Xin-Ran; Niu, Deng-Ke

    2016-01-01

    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3' splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  12. Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus

    SciTech Connect

    Ghorai, Suvankar; Chakrabarti, Mrinmay; Roy, Sobhan; Chavali, Venkata Ramana Murthy; Bagchi, Abhisek; Ghosh, Ananta Kumar

    2010-08-15

    Genome segment 2 (S2) from Antheraea mylitta cypovirus (AmCPV) was converted into cDNA, cloned and sequenced. S2 consisted of 3798 nucleotides with a long ORF encoding a 1116 amino acid long protein (123 kDa). BLAST and phylogenetic analysis showed 29% sequence identity and close relatedness of AmCPV S2 with RNA dependent RNA polymerase (RdRp) of other insect cypoviruses, suggesting a common origin of all insect cypoviruses. The ORF of S2 was expressed as 123 kDa soluble His-tagged fusion protein in insect cells via baculovirus recombinants which exhibited RdRp activity in an in vitro RNA polymerase assay without any intrinsic terminal transferase activity. Maximum activity was observed at 37 deg. C at pH 6.0 in the presence of 3 mM MgCl{sub 2.} Site directed mutagenesis confirmed the importance of the conserved GDD motif. This is the first report of functional characterization of a cypoviral RdRp which may lead to the development of anti-viral agents.

  13. Prognostic significance of RNA-dependent protein kinase (PKR) on non-small cell lung cancer patients

    PubMed Central

    Pataer, Abujiang; Raso, Maria Gabriela; Correa, Arlene M; Behrens, Carmen; Tsuta, Koji; Solis, Luisa; Fang, Bingliang; Roth, Jack A.; Wistuba, Ignacio I.; Swisher, Stephen G.

    2011-01-01

    Purpose The role of RNA-dependent protein kinase (PKR) in antiviral defence mechanisms and in cellular differentiation, growth, and apoptosis is well known, but the role of PKR in human lung cancer remains poorly understood. To explore the role of PKR in human lung cancer, we evaluated PKR’s expression in tissue microarray specimens from both non-small cell lung cancer (NSCLC) and normal human bronchial epithelium tissue. Experimental Design Tissue microarray samples (TMA-1) from 231 lung cancers were stained with PKR antibody and validated on TMA-2 from 224 lung cancers. Immunohistochemical expression score was quantified by three pathologists independently. Survival probability was computed by the Kaplan-Meier method. Results The NSCLC cells showed lower levels of PKR expression than normal bronchial epithelium cells did. We also found a significant association between lower levels of PKR expression and lymph node metastasis. We found that loss of PKR expression is correlated with a more aggressive behavior, and that a high PKR expression predicts a subgroup of patients with a favorable outcome. Univariate and multivariate Cox proportional hazards regression models showed that a lower level of PKR expression was significantly associated with shorter survival in NSCLC patients. We further validated and confirmed that PKR to be a powerful prognostic factor in TMA-2 lung cancer (HR=0.22, P<0.0001). Conclusions Our findings first indicate that PKR expression is an independent prognostic variable in NSCLC patients. PMID:20930042

  14. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    PubMed Central

    Ma, Ming-Yue; Lan, Xin-Ran

    2016-01-01

    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  15. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors

    PubMed Central

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G.; Frese, Michael; White, Peter A.; Strive, Tanja

    2016-01-01

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV. PMID:27089358

  16. Purification, crystallization and preliminary X-ray diffraction analysis of the RNA-dependent RNA polymerase from Thosea asigna virus.

    PubMed

    Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F; Verdaguer, Núria

    2012-10-01

    Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P2(1)2(1)2 and diffracts up to 2.1 Å and the RdRp-Lu(3+) derivative co-crystals belong to the C222(1) space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses. PMID:23027763

  17. Purification, crystallization and preliminary X-ray diffraction analysis of the RNA-dependent RNA polymerase from Thosea asigna virus

    PubMed Central

    Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F.; Verdaguer, Núria

    2012-01-01

    Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P21212 and diffracts up to 2.1 Å and the RdRp-Lu3+ derivative co-crystals belong to the C2221 space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses. PMID:23027763

  18. An RNA-dependent RNA polymerase gene in bat genomes derived from an ancient negative-strand RNA virus.

    PubMed

    Horie, Masayuki; Kobayashi, Yuki; Honda, Tomoyuki; Fujino, Kan; Akasaka, Takumi; Kohl, Claudia; Wibbelt, Gudrun; Mühldorfer, Kristin; Kurth, Andreas; Müller, Marcel A; Corman, Victor M; Gillich, Nadine; Suzuki, Yoshiyuki; Schwemmle, Martin; Tomonaga, Keizo

    2016-01-01

    Endogenous bornavirus-like L (EBLL) elements are inheritable sequences derived from ancient bornavirus L genes that encode a viral RNA-dependent RNA polymerase (RdRp) in many eukaryotic genomes. Here, we demonstrate that bats of the genus Eptesicus have preserved for more than 11.8 million years an EBLL element named eEBLL-1, which has an intact open reading frame of 1,718 codons. The eEBLL-1 coding sequence revealed that functional motifs essential for mononegaviral RdRp activity are well conserved in the EBLL-1 genes. Genetic analyses showed that natural selection operated on eEBLL-1 during the evolution of Eptesicus. Notably, we detected efficient transcription of eEBLL-1 in tissues from Eptesicus bats. To the best of our knowledge, this study is the first report showing that the eukaryotic genome has gained a riboviral polymerase gene from an ancient virus that has the potential to encode a functional RdRp. PMID:27174689

  19. Relationships among the positive strand and double-strand RNA viruses as viewed through their RNA-dependent RNA polymerases.

    PubMed Central

    Bruenn, J A

    1991-01-01

    The sequences of 50 RNA-dependent RNA polymerases (RDRPs) from 43 positive strand and 7 double strand RNA (dsRNA) viruses have been compared. The alignment permitted calculation of distances among the 50 viruses and a resultant dendrogram based on every amino acid, rather than just those amino acids in the conserved motifs. Remarkably, a large subgroup of these viruses, including vertebrate, plant, and insect viruses, forms a single cluster whose only common characteristic is exploitation of insect hosts or vectors. This similarity may be due to molecular constraints associated with a present and/or past ability to infect insects and/or to common descent from insect viruses. If common descent is important, as it appears to be, all the positive strand RNA viruses of eucaryotes except for the picornaviruses may have evolved from an ancestral dsRNA virus. Viral RDRPs appear to be inherited as modules rather than as portions of single RNA segments, implying that RNA recombination has played an important role in their dissemination. PMID:2014162

  20. Discovery of naturally occurring aurones that are potent allosteric inhibitors of hepatitis C virus RNA-dependent RNA polymerase

    PubMed Central

    Haudecoeur, Romain; Ahmed-Belkacem, Abdelhakim; Yi, Wei; Fortuné, Antoine; Brillet, Rozenn; Belle, Catherine; Nicolle, Edwige; Pallier, Coralie; Pawlotsky, Jean-Michel; Boumendjel, Ahcène

    2011-01-01

    We have identified naturally occurring 2-benzylidenebenzofuran-3-ones (aurones) as new templates for non-nucleoside hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) inhibitors. The aurone target site, identified by site-directed mutagenesis, is located in Thumb Pocket I of HCV RdRp. The RdRp inhibitory activity of 42 aurones was rationally explored in an enzyme assay. Molecular docking studies were used to determine how aurones bind to HCV RdRp and to predict their range of inhibitory activity. Seven aurone derivatives were found to have potent inhibitory effects on HCV RdRp, with IC50s below 5 μM and excellent selectivity. The most active aurone analogue was (Z)-2-((1-butyl-1H-indol-3-yl)methylene)-4,6-dihydroxybenzofuran-3(2H)-one (compound 51), with an IC50 of 2.2 μM. Their potent RdRp inhibitory activity, together with their low toxicity, make these molecules attractive candidate direct-acting anti-HCV agents. PMID:21699179

  1. Identification of dengue viral RNA-dependent RNA polymerase inhibitor using computational fragment-based approaches and molecular dynamics study.

    PubMed

    Anusuya, Shanmugam; Velmurugan, Devadasan; Gromiha, M Michael

    2016-07-01

    Dengue is a major public health concern in tropical and subtropical countries of the world. There are no specific drugs available to treat dengue. Even though several candidates targeted both viral and host proteins to overcome dengue infection, they have not yet entered into the later stages of clinical trials. In order to design a drug for dengue fever, newly emerged fragment-based drug designing technique was applied. RNA-dependent RNA polymerase, which is essential for dengue viral replication is chosen as a drug target for dengue drug discovery. A cascade of methods, fragment screening, fragment growing, and fragment linking revealed the compound [2-(4-carbamoylpiperidin-1-yl)-2-oxoethyl]8-(1,3-benzothiazol-2-yl)naphthalene-1-carboxylate as a potent dengue viral polymerase inhibitor. Both strain energy and binding free energy calculations predicted that this could be a better inhibitor than the existing ones. Molecular dynamics simulation studies showed that the dengue polymerase-lead complex is stable and their interactions are consistent throughout the simulation. The hydrogen-bonded interactions formed by the residues Arg792, Thr794, Ser796, and Asn405 are the primary contributors for the stability and the rigidity of the polymerase-lead complex. This might keep the polymerase in closed conformation and thus inhibits viral replication. Hence, this might be a promising lead molecule for dengue drug designing. Further optimization of this lead molecule would result in a potent drug for dengue. PMID:26262439

  2. dsRNA interference on expression of a RNA-dependent RNA polymerase gene of Bombyx mori cytoplasmic polyhedrosis virus.

    PubMed

    Pan, Zhong-Hua; Gao, Kun; Hou, Cheng-Xiang; Wu, Ping; Qin, Guang-Xing; Geng, Tao; Guo, Xi-Jie

    2015-07-01

    Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is one of the major viral pathogens in silkworm. Its infection often results in significant losses to sericulture. Studies have demonstrated that RNAi is one of the important anti-viral mechanisms in organisms. In this study, three dsRNAs targeting the RNA-dependent RNA polymerase (RDRP) gene of BmCPV were designed and synthesized with 2'-F modification to explore their interference effects on BmCPV replication in silkworm larvae. The results showed that injecting dsRNA in the dosage of 4-6 ng per mg body weight into the 5th instar larvae can interfere with the BmCPV-RDRP expression by 93% after virus infection and by 99.9% before virus infection. In addition, the expression of two viral structural protein genes (genome RNA segments 1 and 5) was also decreased with the decrease of RDRP expression, suggesting that RNAi interference of BmCPV-RDRP expression could affect viral replication. The study provides an effective method for investigating virus replication as well as the virus-host interactions in the silkworm larvae using dsRNA. PMID:25839934

  3. Inhibition of RNA binding to hepatitis C virus RNA-dependent RNA polymerase: a new mechanism for antiviral intervention

    PubMed Central

    Ahmed-Belkacem, Abdelhakim; Guichou, Jean-François; Brillet, Rozenn; Ahnou, Nazim; Hernandez, Eva; Pallier, Coralie; Pawlotsky, Jean-Michel

    2014-01-01

    The hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) is a key target for antiviral intervention. The goal of this study was to identify the binding site and unravel the molecular mechanism by which natural flavonoids efficiently inhibit HCV RdRp. Screening identified the flavonol quercetagetin as the most potent inhibitor of HCV RdRp activity. Quercetagetin was found to inhibit RdRp through inhibition of RNA binding to the viral polymerase, a yet unknown antiviral mechanism. X-ray crystallographic structure analysis of the RdRp-quercetagetin complex identified quercetagetin's binding site at the entrance of the RNA template tunnel, confirming its original mode of action. This antiviral mechanism was associated with a high barrier to resistance in both site-directed mutagenesis and long-term selection experiments. In conclusion, we identified a new mechanism for non-nucleoside inhibition of HCV RdRp through inhibition of RNA binding to the enzyme, a mechanism associated with broad genotypic activity and a high barrier to resistance. Our results open the way to new antiviral approaches for HCV and other viruses that use an RdRp based on RNA binding inhibition, that could prove to be useful in human, animal or plant viral infections. PMID:25053847

  4. Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway

    PubMed Central

    Vasale, Jessica J.; Gu, Weifeng; Thivierge, Caroline; Batista, Pedro J; Claycomb, Julie M.; Youngman, Elaine M.; Duchaine, Thomas F.; Mello, Craig C.; Conte, Darryl

    2010-01-01

    Argonaute (AGO) proteins interact with distinct classes of small RNAs to direct multiple regulatory outcomes. In many organisms, including plants, fungi, and nematodes, cellular RNA-dependent RNA polymerases (RdRPs) use AGO targets as templates for amplification of silencing signals. Here, we show that distinct RdRPs function sequentially to produce small RNAs that target endogenous loci in Caenorhabditis elegans. We show that DCR-1, the RdRP RRF-3, and the dsRNA-binding protein RDE-4 are required for the biogenesis of 26-nt small RNAs with a 5′ guanine (26G-RNAs) and that 26G-RNAs engage the Piwi-clade AGO, ERGO-1. Our findings support a model in which targeting by ERGO-1 recruits a second RdRP (RRF-1 or EGO-1), which in turn transcribes 22G-RNAs that interact with worm-specific AGOs (WAGOs) to direct gene silencing. ERGO-1 targets exhibit a nonrandom distribution in the genome and appear to include many gene duplications, suggesting that this pathway may control overexpression resulting from gene expansion. PMID:20133583

  5. OsGatB, the Subunit of tRNA-Dependent Amidotransferase, Is Required for Primary Root Development in Rice

    PubMed Central

    Qin, Cheng; Cheng, Linming; Zhang, Huanhuan; He, Meiling; Shen, Jingqin; Zhang, Yunhong; Wu, Ping

    2016-01-01

    A short-root rice mutant was isolated from an ethyl methane sulfonate-mutagenized library. From map-based cloning strategy, a point mutation, resulting in an amino acid change from proline to leucine, was identified in the fourth exon of a glutamyl-tRNA (Gln) amidotransferase B subunit family protein (OsGatB, LOC_Os11g34210). This gene is an ortholog of Arabidopsis GatB and yeast PET112. GatB is a subunit of tRNA-dependent amidotransferase (AdT), an essential enzyme involved in Gln-tRNAGln synthesis in mitochondria. Although previous studies have described that cessation in mitochondrial translation is lethal at very early developmental stages in plants, this point mutation resulted in a non-lethal phenotype of smaller root meristem and shorter root cell length. In the root, OsGatB was predominantly expressed in the root tip and played an important role in cell division and elongation there. OsGatB was localized in the mitochondria, and mitochondrial structure and function were all affected in Osgatb root tip cells. PMID:27200067

  6. Phosphorylation of viral RNA-dependent RNA polymerase and its role in replication of a plus-strand RNA virus.

    PubMed

    Jakubiec, Anna; Tournier, Vincent; Drugeon, Gabrièle; Pflieger, Stéphanie; Camborde, Laurent; Vinh, Joëlle; Héricourt, François; Redeker, Virginie; Jupin, Isabelle

    2006-07-28

    Central to the process of plus-strand RNA virus genome amplification is the viral RNA-dependent RNA polymerase (RdRp). Understanding its regulation is of great importance given its essential function in viral replication and the common architecture and catalytic mechanism of polymerases. Here we show that Turnip yellow mosaic virus (TYMV) RdRp is phosphorylated, when expressed both individually and in the context of viral infection. Using a comprehensive biochemical approach, including metabolic labeling and mass spectrometry analyses, phosphorylation sites were mapped within an N-terminal PEST sequence and within the highly conserved palm subdomain of RNA polymerases. Systematic mutational analysis of the corresponding residues in a reverse genetic system demonstrated their importance for TYMV infectivity. Upon mutation of the phosphorylation sites, distinct steps of the viral cycle appeared affected, but in contrast to other plus-strand RNA viruses, the interaction between viral replication proteins was unaltered. Our results also highlighted the role of another TYMV-encoded replication protein as an antagonistic protein that may prevent the inhibitory effect of RdRp phosphorylation on viral infectivity. Based on these data, we propose that phosphorylation-dependent regulatory mechanisms are essential for viral RdRp function and virus replication. PMID:16717096

  7. Heat shock 70 protein interaction with Turnip mosaic virus RNA-dependent RNA polymerase within virus-induced membrane vesicles

    SciTech Connect

    Dufresne, Philippe J.; Thivierge, Karine; Cotton, Sophie; Beauchemin, Chantal; Ide, Christine; Ubalijoro, Eliane; Laliberte, Jean-Francois Fortin, Marc G.

    2008-04-25

    Tandem affinity purification was used in Arabidopsis thaliana to identify cellular interactors of Turnip mosaic virus (TuMV) RNA-dependent RNA polymerase (RdRp). The heat shock cognate 70-3 (Hsc70-3) and poly(A)-binding (PABP) host proteins were recovered and shown to interact with the RdRp in vitro. As previously shown for PABP, Hsc70-3 was redistributed to nuclear and membranous fractions in infected plants and both RdRp interactors were co-immunoprecipitated from a membrane-enriched extract using RdRp-specific antibodies. Fluorescently tagged RdRp and Hsc70-3 localized to the cytoplasm and the nucleus when expressed alone or in combination in Nicotiana benthamiana. However, they were redistributed to large perinuclear ER-derived vesicles when co-expressed with the membrane binding 6K-VPg-Pro protein of TuMV. The association of Hsc70-3 with the RdRp could possibly take place in membrane-derived replication complexes. Thus, Hsc70-3 and PABP2 are potentially integral components of the replicase complex and could have important roles to play in the regulation of potyviral RdRp functions.

  8. Intronic regions of plant genes potentially encode RDR (RNA-dependent RNA polymerase)-dependent small RNAs

    PubMed Central

    Qin, Jingping; Ma, Xiaoxia; Yi, Zili; Tang, Zhonghai; Meng, Yijun

    2015-01-01

    Recent research has linked the non-coding intronic regions of plant genes to the production of small RNAs (sRNAs). Certain introns, called ‘mirtrons’ and ‘sirtrons’, could serve as the single-stranded RNA precursors for the generation of microRNA and small interfering RNA, respectively. However, whether the intronic regions could serve as the template for double-stranded RNA synthesis and then for sRNA biogenesis through an RDR (RNA-dependent RNA polymerase)-dependent pathway remains unclear. In this study, a genome-wide search was made for the RDR-dependent sRNA loci within the intronic regions of the Arabidopsis genes. Hundreds of intronic regions encoding three or more RDR-dependent sRNAs were found to be covered by dsRNA-seq (double-stranded RNA sequencing) reads, indicating that the intron-derived sRNAs were indeed generated from long double-stranded RNA precursors. More interestingly, phase-distributed sRNAs were discovered on some of the dsRNA-seq read-covered intronic regions, and those sRNAs were largely 24 nt in length. Based on these results, the opinion is put forward that the intronic regions might serve as the genomic origins for the RDR-dependent sRNAs. This opinion might add a novel layer to the current biogenesis model of the intron-derived sRNAs. PMID:25609829

  9. Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication.

    PubMed

    Hodge, Kenneth; Tunghirun, Chairat; Kamkaew, Maliwan; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai; Chimnaronk, Sarin

    2016-08-12

    Dengue virus, an ∼10.7-kb positive-sense RNA virus, is the most common arthropod-communicated pathogen in the world. Despite dengue's clear epidemiological importance, mechanisms for its replication remain elusive. Here, we probed the entire dengue genome for interactions with viral RNA-dependent RNA polymerase (RdRp), and we identified the dominant interaction as a loop-forming ACAG motif in the 3' positive-stranded terminus, complicating the prevailing model of replication. A subset of interactions coincides with known flaviviral recombination sites inside the viral protein-coding region. Specific recognition of the RNA element occurs via an arginine patch in the C-terminal thumb domain of RdRp. We also show that the highly conserved nature of the consensus RNA motif may relate to its tolerance to various mutations in the interacting region of RdRp. Disruption of the interaction resulted in loss of viral replication ability in cells. This unique RdRp-RNA interface is found throughout flaviviruses, implying possibilities for broad disease interventions. PMID:27334920

  10. Seroepidemiology of Coxsackievirus A6, Coxsackievirus A16, and Enterovirus 71 Infections among Children and Adolescents in Singapore, 2008-2010

    PubMed Central

    Ang, Li Wei; Tay, Joanne; Phoon, Meng Chee; Hsu, Jung Pu; Cutter, Jeffery; James, Lyn; Goh, Kee Tai; Chow, Vincent Tak-Kwong

    2015-01-01

    Coxsackieviruses A6 (CV-A6) and A16 (CV-A16) and Enterovirus 71 (EV-A71) have caused periodic epidemics of hand, foot and mouth disease (HFMD) among children in Singapore. We conducted a cross-sectional study to estimate the seroprevalence of these enteroviruses among Singapore children and adolescents. The study was conducted between August 2008 and July 2010. It involved 700 Singapore residents aged 1–17 years whose residual sera were obtained following the completion of routine biochemical investigations in two public acute-care hospitals. The levels of neutralizing antibodies (NtAb) against CV-A6, CV-A16 and EV-A71 were analyzed by the microneutralization test. The age-specific geometric mean titer (GMT) of antibodies against each of the three enteroviruses and the 95% confidence intervals (CI) were calculated. The seroprevalence of CV-A6 and CV-A16 was high at 62.7% (95% CI: 59.1–66.2%) and 60.6% (95% CI: 56.9–64.1%), respectively. However, the seroprevalence of EV-A71 was significantly lower at 29.3% (95% CI: 26.0–32.8%). About 89.7% of the children and adolescents had been infected by at least one of the three enteroviruses by 13–17 years of age. About half (52.3%) were seropositive for two or all three enteroviruses, while only 16.1% had no NtAb against any of the three enteroviruses. High NtAb levels were observed in the younger age groups. CV-A6 and CV-A16 infections are very common among Singapore children and adolescents, while EV-A71 infections are less common. Infection is continually acquired from early childhood to adolescent age. PMID:26011735

  11. The Crystal Structure of a Cardiovirus RNA-Dependent RNA Polymerase Reveals an Unusual Conformation of the Polymerase Active Site

    PubMed Central

    Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J. M.

    2014-01-01

    ABSTRACT Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated

  12. CCA initiation boxes without unique promoter elements support in vitro transcription by three viral RNA-dependent RNA polymerases.

    PubMed Central

    Yoshinari, S; Nagy, P D; Simon, A E; Dreher, T W

    2000-01-01

    It has previously been observed that the only specific requirement for transcriptional initiation on viral RNA in vitro by the RNA-dependent RNA polymerase (RdRp) of turnip yellow mosaic virus is the CCA at the 3' end of the genome. We now compare the abilities of this RdRp, turnip crinkle virus RdRp, and Qbeta replicase, an enzyme capable of supporting the complete viral replication cycle in vitro, to transcribe RNA templates containing multiple CCA boxes but lacking specific viral sequences. Each enzyme is able to initiate transcription from several CCA boxes within these RNAs, and no special reaction conditions are required for these activities. The transcriptional yields produced from templates comprised of multiple CCA or CCCA repeats relative to templates derived from native viral RNA sequences vary between 2:1 and 0.1:1 for the different RdRps. Control of initiation by such redundant sequences presents a challenge to the specificity of viral transcription and replication. We identify 3'-preferential initiation and sensitivity to structural presentation as two specificity mechanisms that can limit initiation among potential CCA initiation sites. These two specificity mechanisms are used to different degrees by the three RdRps. The finding that three viral RdRps representing two of the three supergroups within the positive-strand RNA viral RdRp phylogeny support substantial transcription in the absence of unique promoters suggests that this phenomenon may be common among positive-strand viruses. A framework is presented arguing that replication of viral RNA in the absence of unique promoter elements is feasible. PMID:10836791

  13. Inhibitors of Foot and Mouth Disease Virus Targeting a Novel Pocket of the RNA-Dependent RNA Polymerase

    PubMed Central

    Cornelison, Ceili A.; Rai, Devendra K.; Matzek, Kayla B.; Leslie, Maxwell D.; Schafer, Elizabeth; Marchand, Bruno; Adedeji, Adeyemi; Michailidis, Eleftherios; Dorst, Christopher A.; Moran, Jennifer; Pautler, Christie; Rodriguez, Luis L.; McIntosh, Mark A.; Rieder, Elizabeth; Sarafianos, Stefan G.

    2010-01-01

    Background Foot-and-Mouth Disease Virus (FMDV) is a picornavirus that infects cloven-hoofed animals and leads to severe losses in livestock production. In the case of an FMD outbreak, emergency vaccination requires at least 7 days to trigger an effective immune response. There are currently no approved inhibitors for the treatment or prevention of FMDV infections. Methodology/Principal Findings Using a luciferase-based assay we screened a library of compounds and identified seven novel inhibitors of 3Dpol, the RNA-dependent RNA polymerase of FMDV. The compounds inhibited specifically 3Dpol (IC50s from 2-17 µM) and not other viral or bacterial polymerases. Enzyme kinetic studies on the inhibition mechanism by compounds 5D9 and 7F8 showed that they are non-competitive inhibitors with respect to NTP and nucleic acid substrates. Molecular modeling and docking studies into the 3Dpol structure revealed an inhibitor binding pocket proximal to, but distinct from the 3Dpol catalytic site. Residues surrounding this pocket are conserved among all 60 FMDV subtypes. Site directed mutagenesis of two residues located at either side of the pocket caused distinct resistance to the compounds, demonstrating that they indeed bind at this site. Several compounds inhibited viral replication with 5D9 suppressing virus production in FMDV-infected cells with EC50 = 12 µM and EC90 = 20 µM). Significance We identified several non-competitive inhibitors of FMDV 3Dpol that target a novel binding pocket, which can be used for future structure-based drug design studies. Such studies can lead to the discovery of even more potent antivirals that could provide alternative or supplementary options to contain future outbreaks of FMD. PMID:21203539

  14. Activation of double-stranded RNA-dependent protein kinase inhibits proliferation of pancreatic β-cells

    SciTech Connect

    Chen, Shan-Shan; Jiang, Teng; Wang, Yi; Gu, Li-Ze; Wu, Hui-Wen; Tan, Lan; Guo, Jun

    2014-01-17

    Highlights: •PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in β-cells. •Activated PKR inhibited β-cell proliferation by arresting cell cycle at G1 phase. •Activated PKR fully abrogated the pro-proliferative effects of IGF-I on β-cells. -- Abstract: Double-stranded RNA-dependent protein kinase (PKR) is revealed to participate in the development of insulin resistance in peripheral tissues in type 2 diabetes (T2DM). Meanwhile, PKR is also characterized as a critical regulator of cell proliferation. To date, no study has focused on the impact of PKR on the proliferation of pancreatic β-cells. Here, we adopted insulinoma cell lines and mice islet β-cells to investigate: (1) the effects of glucolipotoxicity and pro-inflammatory cytokines on PKR activation; (2) the effects of PKR on proliferation of pancreatic β-cells and its underlying mechanisms; (3) the actions of PKR on pro-proliferative effects of IGF-I and its underlying pathway. Our results provided the first evidence that PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in pancreatic β-cells, and activated PKR significantly inhibited cell proliferation by arresting cell cycle at G1 phase. Reductions in cyclin D1 and D2 as well as increases in p27 and p53 were associated with the anti-proliferative effects of PKR, and proteasome-dependent degradation took part in the reduction of cyclin D1 and D2. Besides, PKR activation abrogated the pro-proliferative effects of IGF-I by activating JNK and disrupting IRS1/PI3K/Akt signaling pathway. These findings indicate that the anti-proliferative actions of PKR on pancreatic β-cells may contribute to the pathogenesis of T2DM.

  15. RNA-dependent protein kinase (PKR) depletes nutrients, inducing phosphorylation of AMP-activated kinase in lung cancer.

    PubMed

    Guo, Chengcheng; Hao, Chuncheng; Shao, RuPing; Fang, Bingliang; Correa, Arlene M; Hofstetter, Wayne L; Roth, Jack A; Behrens, Carmen; Kalhor, Neda; Wistuba, Ignacio I; Swisher, Stephen G; Pataer, Apar

    2015-05-10

    We have demonstrated that RNA-dependent protein kinase (PKR) and its downstream protein p-eIF2α are independent prognostic markers for overall survival in lung cancer. In the current study, we further investigate the interaction between PKR and AMPK in lung tumor tissue and cancer cell lines. We examined PKR protein expression in 55 frozen primary lung tumor tissues by Western blotting and analyzed the association between PKR expression and expression of 139 proteins on tissue samples examined previously by Reverse Phase Protein Array (RPPA) from the same 55 patients. We observed that biomarkers were either positively (phosphorylated AMP-activated kinase(T172) [p-AMPK]) or negatively (insulin receptor substrate 1, meiotic recombination 11, ATR interacting protein, telomerase, checkpoint kinase 1, and cyclin E1) correlated with PKR. We further confirmed that induction of PKR with expression vectors in lung cancer cells causes activation of the AMPK protein independent of the LKB1, TAK1, and CaMKKβ pathway. We found that PKR causes nutrient depletion, which increases AMP levels and decreases ATP levels, causing AMPK phosphorylation. We further demonstrated that inhibiting AMPK expression with compound C or siRNA enhanced PKR-mediated cell death. We next explored the combination of PKR and p-AMPK expression in NSCLC patients and observed that expression of p-AMPK predicted a poor outcome for adenocarcinoma patients with high PKR expression and a better prognosis for those with low PKR expression. These findings were consistent with our in vitro results. AMPK might rescue cells facing metabolic stresses, such as ATP depletion caused by PKR. Our data indicate that PKR causes nutrient depletion, which induces the phosphorylation of AMPK. AMPK might act as a protective response to metabolic stresses, such as nutrient deprivation. PMID:25798539

  16. Identification of a Pyridoxine-Derived Small-Molecule Inhibitor Targeting Dengue Virus RNA-Dependent RNA Polymerase

    PubMed Central

    Xu, Hong-Tao; Colby-Germinario, Susan P.; Hassounah, Said; Quashie, Peter K.; Han, Yingshan; Oliveira, Maureen; Stranix, Brent R.

    2015-01-01

    The viral RNA-dependent RNA polymerase (RdRp) activity of the dengue virus (DENV) NS5 protein is an attractive target for drug design. Here, we report the identification of a novel class of inhibitor (i.e., an active-site metal ion chelator) that acts against DENV RdRp activity. DENV RdRp utilizes a two-metal-ion mechanism of catalysis; therefore, we constructed a small library of compounds, through mechanism-based drug design, aimed at chelating divalent metal ions in the catalytic site of DENV RdRp. We now describe a pyridoxine-derived small-molecule inhibitor that targets DENV RdRp and show that 5-benzenesulfonylmethyl-3-hydroxy-4-hydroxymethyl-pyridine-2-carboxylic acid hydroxyamide (termed DMB220) inhibited the RdRp activity of DENV serotypes 1 to 4 at low micromolar 50% inhibitory concentrations (IC50s of 5 to 6.7 μM) in an enzymatic assay. The antiviral activity of DMB220 against DENV infection was also verified in a cell-based assay and showed a 50% effective concentration (EC50) of <3 μM. Enzyme assays proved that DMB220 was competitive with nucleotide incorporation. DMB220 did not inhibit the enzymatic activity of recombinant HIV-1 reverse transcriptase and showed only weak inhibition of HIV-1 integrase strand transfer activity, indicating high specificity for DENV RdRp. S600T substitution in the DENV RdRp, which was previously shown to confer resistance to nucleoside analogue inhibitors (NI), conferred 3-fold hypersusceptibility to DMB220, and enzymatic analyses showed that this hypersusceptibility may arise from the decreased binding/incorporation efficiency of the natural NTP substrate without significantly impacting inhibitor binding. Thus, metal ion chelation at the active site of DENV RdRp represents a viable anti-DENV strategy, and DMB220 is the first of a new class of DENV inhibitor. PMID:26574011

  17. Cyclic peptides identified by phage display are competitive inhibitors of the tRNA-dependent amidotransferase of Helicobacter pylori.

    PubMed

    Pham, Van Hau; Maaroufi, Halim; Levesque, Roger C; Lapointe, Jacques

    2016-05-01

    In Helicobacter pylori, the heterotrimeric tRNA-dependent amidotransferase (GatCAB) is essential for protein biosynthesis because it catalyzes the conversion of misacylated Glu-tRNA(Gln) and Asp-tRNA(Asn) into Gln-tRNA(Gln) and Asn-tRNA(Asn), respectively. In this study, we used a phage library to identify peptide inhibitors of GatCAB. A library displaying loop-constrained heptapeptides was used to screen for phages binding to the purified GatCAB. To optimize the probability of obtaining competitive inhibitors of GatCAB with respect to its substrate Glu-tRNA(Gln), we used that purified substrate in the biopanning process of the phage-display technique to elute phages bound to GatCAB at the third round of the biopanning process. Among the eluted phages, we identified several that encode cyclic peptides rich in Trp and Pro that inhibit H. pylori GatCAB in vitro. Peptides P10 and P9 were shown to be competitive inhibitors of GatCAB with respect to its substrate Glu-tRNA(Gln), with Ki values of 126 and 392μM, respectively. The docking models revealed that the Trp residues of these peptides form π-π stacking interactions with Tyr81 of the synthetase active site, as does the 3'-terminal A76 of tRNA, supporting their competitive behavior with respect to Glu-tRNA(Gln) in the transamidation reaction. These peptides can be used as scaffolds in the search for novel antibiotics against the pathogenic bacteria that require GatCAB for Gln-tRNA(Gln) and/or Asn-tRNA(Asn) formation. PMID:26976271

  18. Identification of a Pyridoxine-Derived Small-Molecule Inhibitor Targeting Dengue Virus RNA-Dependent RNA Polymerase.

    PubMed

    Xu, Hong-Tao; Colby-Germinario, Susan P; Hassounah, Said; Quashie, Peter K; Han, Yingshan; Oliveira, Maureen; Stranix, Brent R; Wainberg, Mark A

    2016-01-01

    The viral RNA-dependent RNA polymerase (RdRp) activity of the dengue virus (DENV) NS5 protein is an attractive target for drug design. Here, we report the identification of a novel class of inhibitor (i.e., an active-site metal ion chelator) that acts against DENV RdRp activity. DENV RdRp utilizes a two-metal-ion mechanism of catalysis; therefore, we constructed a small library of compounds, through mechanism-based drug design, aimed at chelating divalent metal ions in the catalytic site of DENV RdRp. We now describe a pyridoxine-derived small-molecule inhibitor that targets DENV RdRp and show that 5-benzenesulfonylmethyl-3-hydroxy-4-hydroxymethyl-pyridine-2-carboxylic acid hydroxyamide (termed DMB220) inhibited the RdRp activity of DENV serotypes 1 to 4 at low micromolar 50% inhibitory concentrations (IC50s of 5 to 6.7 μM) in an enzymatic assay. The antiviral activity of DMB220 against DENV infection was also verified in a cell-based assay and showed a 50% effective concentration (EC50) of <3 μM. Enzyme assays proved that DMB220 was competitive with nucleotide incorporation. DMB220 did not inhibit the enzymatic activity of recombinant HIV-1 reverse transcriptase and showed only weak inhibition of HIV-1 integrase strand transfer activity, indicating high specificity for DENV RdRp. S600T substitution in the DENV RdRp, which was previously shown to confer resistance to nucleoside analogue inhibitors (NI), conferred 3-fold hypersusceptibility to DMB220, and enzymatic analyses showed that this hypersusceptibility may arise from the decreased binding/incorporation efficiency of the natural NTP substrate without significantly impacting inhibitor binding. Thus, metal ion chelation at the active site of DENV RdRp represents a viable anti-DENV strategy, and DMB220 is the first of a new class of DENV inhibitor. PMID:26574011

  19. MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant.

    PubMed

    Lu, Cheng; Kulkarni, Karthik; Souret, Frédéric F; MuthuValliappan, Ramesh; Tej, Shivakundan Singh; Poethig, R Scott; Henderson, Ian R; Jacobsen, Steven E; Wang, Wenzhong; Green, Pamela J; Meyers, Blake C

    2006-10-01

    The Arabidopsis genome contains a highly complex and abundant population of small RNAs, and many of the endogenous siRNAs are dependent on RNA-Dependent RNA Polymerase 2 (RDR2) for their biogenesis. By analyzing an rdr2 loss-of-function mutant using two different parallel sequencing technologies, MPSS and 454, we characterized the complement of miRNAs expressed in Arabidopsis inflorescence to considerable depth. Nearly all known miRNAs were enriched in this mutant and we identified 13 new miRNAs, all of which were relatively low abundance and constitute new families. Trans-acting siRNAs (ta-siRNAs) were even more highly enriched. Computational and gel blot analyses suggested that the minimal number of miRNAs in Arabidopsis is approximately 155. The size profile of small RNAs in rdr2 reflected enrichment of 21-nt miRNAs and other classes of siRNAs like ta-siRNAs, and a significant reduction in 24-nt heterochromatic siRNAs. Other classes of small RNAs were found to be RDR2-independent, particularly those derived from long inverted repeats and a subset of tandem repeats. The small RNA populations in other Arabidopsis small RNA biogenesis mutants were also examined; a dcl2/3/4 triple mutant showed a similar pattern to rdr2, whereas dcl1-7 and rdr6 showed reductions in miRNAs and ta-siRNAs consistent with their activities in the biogenesis of these types of small RNAs. Deep sequencing of mutants provides a genetic approach for the dissection and characterization of diverse small RNA populations and the identification of low abundance miRNAs. PMID:16954541

  20. The Application B3LYP to Large Systems

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W.; Arnold, James O. (Technical Monitor)

    1996-01-01

    The application of density functional theory (DFT), using the B3LYP functional, to a series of chemical problems is described. The first involves the calculation of silica-adsorbate bond energies, including both chemical bonds and weak hydrogen bonding. The calculation of vibrational frequencies for large organic systems is discussed. For the closed shell neutral systems, the B3LYP results are similar to the self- consistent- field results, however, for the positive ions, only the B3LYP level of theory is accurate and sufficiently inexpensive to allow the study of large systems. The final application involves the calculation of successive metal-ligand bond energies. The B3LYP bond energies and entropies are shown to be in good agreement with experiment.

  1. A pyrazolotriazolopyrimidinamine inhibitor of bovine viral diarrhea virus replication that targets the viral RNA-dependent RNA polymerase.

    PubMed

    Paeshuyse, Jan; Letellier, Carine; Froeyen, Matheus; Dutartre, Hélène; Vrancken, Robert; Canard, Bruno; De Clercq, Erik; Gueiffier, Alain; Teulade, Jean-Claude; Herdewijn, Piet; Puerstinger, Gerhard; Koenen, Frank; Kerkhofs, Pierre; Baraldi, Pier Giovanni; Neyts, Johan

    2009-06-01

    [7-[3-(1,3-Benzodioxol-5-yl)propyl]-2-(2-furyl)-7H-pyrazolo[4,3-e][1,2,4]triazolo[1,5-c]pyrimidin-5-amine] (LZ37) was identified as a selective inhibitor of in vitro bovine viral diarrhea virus (BVDV) replication. The EC(50) values for inhibition of BVDV-induced cytopathic effect (CPE) formation, viral RNA synthesis and production of infectious virus were 4.3+/-0.7microM, 12.9+/-1microM and 5.8+/-0.6microM, respectively. LZ37 proved inactive against the hepatitis C virus and the flavivirus yellow fever. LZ37 inhibits BVDV replication at a time point that coincides with the onset of intracellular viral RNA synthesis. Drug-resistant mutants carried the F224Y mutation in the viral RNA-dependent RNA polymerase (RdRp). LZ37 showed cross-resistance with the imidazopyrrolopyridine AG110 [which selects for the E291G drug resistance mutation] as well as with the imidazopyridine BPIP [which selects for the F224S drug-resistant mutation]. LZ37 did not inhibit the in vitro activity of purified recombinant BVDV RdRp. Molecular modelling revealed that F224 is located near the tip of the finger domain of the RdRp. Docking of LZ37 in the crystal structure of the BVDV RdRp revealed several potential contacts including: (i) hydrophobic contacts of LZ37 with A221, A222, G223, F224 and A392; (ii) a stacking interaction between F224 side chain and the ring system of LZ37 and (iii) a hydrogen bond between the amino function of LZ37 and the O backbone atom of A392. It is concluded that LZ37 interacts with the same binding site as BPIP or VP32947 at the top of the finger domain of the polymerase that is a "hot spot" for inhibition of pestivirus replication. PMID:19428605

  2. Small RNA Deep Sequencing Reveals Role for Arabidopsis thaliana RNA-Dependent RNA Polymerases in Viral siRNA Biogenesis

    PubMed Central

    Qi, Xiaopeng; Bao, Forrest Sheng; Xie, Zhixin

    2009-01-01

    RNA silencing functions as an important antiviral defense mechanism in a broad range of eukaryotes. In plants, biogenesis of several classes of endogenous small interfering RNAs (siRNAs) requires RNA-dependent RNA Polymerase (RDR) activities. Members of the RDR family proteins, including RDR1and RDR6, have also been implicated in antiviral defense, although a direct role for RDRs in viral siRNA biogenesis has yet to be demonstrated. Using a crucifer-infecting strain of Tobacco Mosaic Virus (TMV-Cg) and Arabidopsis thaliana as a model system, we analyzed the viral small RNA profile in wild-type plants as well as rdr mutants by applying small RNA deep sequencing technology. Over 100,000 TMV-Cg-specific small RNA reads, mostly of 21- (78.4%) and 22-nucleotide (12.9%) in size and originating predominately (79.9%) from the genomic sense RNA strand, were captured at an early infection stage, yielding the first high-resolution small RNA map for a plant virus. The TMV-Cg genome harbored multiple, highly reproducible small RNA-generating hot spots that corresponded to regions with no apparent local hairpin-forming capacity. Significantly, both the rdr1 and rdr6 mutants exhibited globally reduced levels of viral small RNA production as well as reduced strand bias in viral small RNA population, revealing an important role for these host RDRs in viral siRNA biogenesis. In addition, an informatics analysis showed that a large set of host genes could be potentially targeted by TMV-Cg-derived siRNAs for posttranscriptional silencing. Two of such predicted host targets, which encode a cleavage and polyadenylation specificity factor (CPSF30) and an unknown protein similar to translocon-associated protein alpha (TRAP α), respectively, yielded a positive result in cleavage validation by 5′RACE assays. Our data raised the interesting possibility for viral siRNA-mediated virus-host interactions that may contribute to viral pathogenicity and host specificity. PMID:19308254

  3. A Novel, Highly Selective Inhibitor of Pestivirus Replication That Targets the Viral RNA-Dependent RNA Polymerase

    PubMed Central

    Paeshuyse, Jan; Leyssen, Pieter; Mabery, Eric; Boddeker, Nina; Vrancken, Robert; Froeyen, Matheus; Ansari, Israrul H.; Dutartre, Hélène; Rozenski, Jef; Gil, Laura H. V. G.; Letellier, Carine; Lanford, Robert; Canard, Bruno; Koenen, Frank; Kerkhofs, Pierre; Donis, Ruben O.; Herdewijn, Piet; Watson, Julia; De Clercq, Erik; Puerstinger, Gerhard; Neyts, Johan

    2006-01-01

    We report on the highly potent and selective antipestivirus activity of 5-[(4-bromophenyl)methyl]-2-phenyl-5H-imidazo[4,5-c]pyridine (BPIP). The 50% effective concentration (EC50) for inhibition of bovine viral diarrhea virus (BVDV)-induced cytopathic effect formation was 0.04 ± 0.01 μM. Comparable reduction of viral RNA synthesis (EC50 = 0.12 ± 0.02 μM) and production of infectious virus (EC50 = 0.074 ± 0.003 μM) were observed. The selectivity index (ratio of 50% cytostatic concentration/EC50) of BPIP was ∼2,000. BPIP was inactive against the hepatitis C virus subgenomic replicon and yellow fever virus but demonstrated weak activity against GB virus. Drug-resistant mutants were at least 300-fold less susceptible to BPIP than wild-type virus; showed cross-resistance to N-propyl-N-[2-(2H-1,2,4-triazino[5,6-b]indol-3-ylthio)ethyl]-1-propanamine (VP32947), and carried the F224S mutation in the viral RNA-dependent RNA polymerase (RdRp). When the F224S mutation was introduced into an infectious clone, the drug-resistant phenotype was obtained. BPIP did not inhibit the in vitro activity of recombinant BVDV RdRp, but did inhibit the activity of replication complexes (RCs). Computational docking revealed that F224 is located at the top of the finger domain of the polymerase. Docking of BPIP in the crystal structure of the BVDV RdRp revealed aromatic ring stacking, some hydrophobic contacts, and a hydrogen bond. Since two structurally unrelated compounds, i.e., BPIP and VP32947, target the same region of the BVDV RdRp, this position may be expected to be critical in the functioning of the polymerase or assembly of the RC. The potential of BPIP for the treatment of pestivirus and hepacivirus infections is discussed. PMID:16352539

  4. Double stranded RNA-dependent protein kinase is involved in osteoclast differentiation of RAW264.7 cells in vitro

    SciTech Connect

    Teramachi, Junpei; Morimoto, Hiroyuki; Baba, Ryoko; Doi, Yoshiaki; Hirashima, Kanji; Haneji, Tatsuji

    2010-11-15

    Double-stranded RNA-dependent protein kinase (PKR) plays a critical role in antiviral defence of the host cells. PKR is also involved in cell cycle progression, cell proliferation, cell differentiation, tumorigenesis, and apoptosis. We previously reported that PKR is required for differentiation and calcification of osteoblasts. However, it is unknown about the role of PKR in osteoclast differentiation. A dominant-negative PKR mutant cDNA, in which the amino acid lysine at 296 was replaced with arginine, was transfected into RAW264.7 cells. We have established the cell line that stably expresses the PKR mutant gene (PKR-K/R). Phosphorylation of PKR and {alpha}-subunit of eukaryotic initiation factor 2 was not stimulated by polyinosic-polycytidylic acid in the PKR-K/R cells. RANKL stimulated the formation of TRAP-positive multinuclear cells in RAW264.7 cells. However, TRAP-positive multinuclear cells were not formed in the PKR-K/R cells even when the cells were stimulated with higher doses of RANKL. A specific inhibitor of PKR, 2-aminopurine, also suppressed the RANKL-induced osteoclast differentiation in RAW264.7 cells. The expression of macrophage fusion receptor and dendritic cell-specific transmembrane protein significantly decreased in the PKR-K/R cells by real time PCR analysis. The results of RT-PCR revealed that the mRNA expression of osteoclast markers (cathepsin K and calcitonin receptor) was suppressed in the PKR-K/R cells and RAW264.7 cells treated with 2-aminopurine. Expression of NF-{kappa}B protein was suppressed in the PKR-K/R cells and 2-aminopurine-treated RAW264.7 cells. The level of STAT1 protein expression was elevated in the PKR-K/R cells compared with that of the wild-type cells. Immunohistochemical study showed that PKR was localized in osteoclasts of metatarsal bone of newborn mouse. The finding that the PKR-positive multinuclear cells should be osteoclasts was confirmed by TRAP-staining. Our present study indicates that PKR plays important

  5. The hepatitis C virus core protein can modulate RNA-dependent RNA synthesis by the 2a polymerase

    PubMed Central

    Wen, Y.; Cheng Kao, C.

    2014-01-01

    RNA replication enzymes are multi-subunit protein complexes whose activity can be modulated by other viral and cellular factors. For genotype 1b Hepatitis C virus (HCV), the RNA-dependent RNA polymerase (RdRp) subunit of the replicase, NS5B, has been reported to interact with the HCV Core protein to decrease RNA synthesis (Kang et al., 2009). Here we used a cell-based assay for RNA synthesis to examine the Core–NS5B interaction of genotype 2a HCV. Unlike the 1b NS5B, the activity of the 2a NS5B was stimulated by the Core protein. Using the bimolecular fluorescence complementation assay, the 2a Core co-localized with 2a NS5B when they were transiently expressed in cells. The two proteins can form a coimmunoprecipitable complex. Deletion analysis showed that the N-terminal 75 residues of 2a Core were required to contact 2a NS5B to modulate its activity. The C-terminal transmembrane helix of 2a NS5B also contributes to the interaction with the 2a Core. To determine the basis for the differential effects of the Core–RdRp interaction, we found that the 2a RdRp activity was enhanced by both the 1b Core and 2a Core. However, the 1b NS5B activity was slightly inhibited by either Core protein. The replication of the 2a JFH-1 replicon was increased by co-expressed 2a Core while the genotype 1b Con1 replicon was not significantly affected by the corresponding Core. Mutations in 2a NS5B that affected the closed RdRp structure were found to be less responsive to 2a Core. Finally, we determined that RNA synthesis by the RdRps from genotypes 2a, 3a and 4a HCV were increased by the Core proteins from HCV of genotypes 1–4. These results reveal another difference between RNA syntheses by the different genotype RdRps and add additional examples of a viral structural protein regulating viral RNA synthesis. PMID:24874198

  6. Symmetry Breaking and the B3LYP Functional

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Hudgins, Douglas M.; Allamandola, Louis J.; Arnold, James O. (Technical Monitor)

    1999-01-01

    The infrared spectra of six molecules, each of which contains a five-membered ring, and their cations are determined using density functional theory (DFT); both the B3LYP and BP86 functionals are used. The computed results are compared with the experimental spectra. For the neutral molecules, both methods are in good agreement with experiment. Even the Hartree-Fock (HF) approach is qualitatively correct for the neutrals. For the cations, the HF approach fails, as found for other organic ring systems. The B3LYP and BP86 approaches are in good mutual agreement for five of the six cation spectra, and in good agreement with experiment for four of the five cations where the experimental spectra are available. It is only for the fluoranthene cation, where the BP86 and B3LYP functionals yield different results; the BP86 yields the expected C2v symmetry, while the B3LYP approach breaks symmetry. The experimental spectra supports the BP86 spectra over the B3LYP, but the quality of the experimental spectra does not allow a critical evaluation of the accuracy of the BP86 approach for this difficult system.

  7. Evaluation of the inactivation of human Coxsackievirus by thermophilic and mesophilic anaerobic digestion using integrated cell culture and reverse transcription real-time quantitative PCR.

    PubMed

    Gao, Tiejun; Tong, Yupin; Cao, Ming; Li, Xiaomei; Pang, Xiaoli

    2013-09-01

    The virucidal effects of anaerobic digestion were evaluated using human Coxsackievirus as a model for the Enterovirus family. Coxsackievirus was inactivated completely by thermophilic anaerobic digestion (TAD). By 4 h no living and infectious virus remained and no detectable viral RNA was present after 2 days in TAD (7.0 log reduction). Compared to TAD, 2.6 log reduction of viral RNA was achieved by 14 days in mesophilic anaerobic digestion (MAD) (p < 0.0001). Although cytopathogenic effect was not observed in the cultured cells, low levels of intracellular viral RNA were detected after one day of MAD treatment indicating that Coxsackievirus had infected the cells but could not replicate. The combination of thermal and biochemical effects in TAD plays a critical role for viral disinfection. The results of this study indicate that selection of the right configuration of anaerobic digestion for treatment of biowaste may reduce the risk of viral contamination to the environment and water source. PMID:23764576

  8. Optimization and Characterization of Candidate Strain for Coxsackievirus A16 Inactivated Vaccine

    PubMed Central

    Li, Jingliang; Liu, Guanchen; Liu, Xin; Yang, Jiaxin; Chang, Junliang; Zhang, Wenyan; Yu, Xiao-Fang

    2015-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71), both of which can cause hand, foot and mouth disease (HFMD), are responsible for large epidemics in Asian and Pacific areas. Although inactivated EV71 vaccines have completed testing in phase III clinical trials in Mainland China, CA16 vaccines are still under development. A Vero cell-based inactivated CA16 vaccine was developed by our group. Screening identified a CA16 vaccine strain (CC024) isolated from HFMD patients, which had broad cross-protective abilities and satisfied all requirements for vaccine production. Identification of the biological characteristics showed that the CA16CC024 strain had the highest titer (107.5 CCID50/mL) in Vero cells, which would benefit the development of an EV71/CA16 divalent vaccine. A potential vaccine manufacturing process was established, including the selection of optimal time for virus harvesting, membrane for diafiltration and concentration, gel-filtration chromatography for the down-stream virus purification and virus inactivation method. Altogether, the analyses suggested that the CC-16, a limiting dilution clone of the CC024 strain, with good genetic stability, high titer and broad-spectrum immunogenicity, would be the best candidate strain for a CA16 inactivated vaccine. Therefore, our study provides valuable information for the development of a Vero cell-based CA16 or EV71-CA16 divalent inactivated vaccine. PMID:26193302

  9. Antiviral Ability of Kalanchoe gracilis Leaf Extract against Enterovirus 71 and Coxsackievirus A16.

    PubMed

    Wang, Ching-Ying; Huang, Shun-Chueh; Zhang, Yongjun; Lai, Zhen-Rung; Kung, Szu-Hao; Chang, Yuan-Shiun; Lin, Cheng-Wen

    2012-01-01

    Pandemic infection or reemergence of Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) occurs in tropical and subtropical regions, being associated with hand-foot-and-mouth disease, herpangina, aseptic meningitis, brain stem encephalitis, pulmonary edema, and paralysis. However, effective therapeutic drugs against EV71 and CVA16 are rare. Kalanchoe gracilis (L.) DC is used for the treatment of injuries, pain, and inflammation. This study investigated antiviral effects of K. gracilis leaf extract on EV71 and CVA16 replications. HPLC analysis with a C-18 reverse phase column showed fingerprint profiles of K. gracilis leaf extract had 15 chromatographic peaks. UV/vis absorption spectra revealed peaks 5, 12, and 15 as ferulic acid, quercetin, and kaempferol, respectively. K. gracilis leaf extract showed little cytotoxicity, but exhibited concentration-dependent antiviral activities including cytopathic effect, plaque, and virus yield reductions. K. gracilis leaf extract was shown to be more potent in antiviral activity than ferulic acid, quercetin, and kaempferol, significantly inhibiting in vitro replication of EV71 (IC(50) = 35.88 μg/mL) and CVA16 (IC(50) = 42.91 μg/mL). Moreover, K. gracilis leaf extract is a safe antienteroviral agent with the inactivation of viral 2A protease and reduction of IL-6 and RANTES expressions. PMID:22666293

  10. Immunologic Characterization of Cytokine Responses to Enterovirus 71 and Coxsackievirus A16 Infection in Children

    PubMed Central

    Zhang, Shu-Yan; Xu, Mei-Yan; Xu, Hong-Mei; Li, Xiu-Jun; Ding, Shu-Jun; Wang, Xian-Jun; Li, Ting-Yu; Lu, Qing-Bin

    2015-01-01

    Abstract Viral encephalitis is a serious complication of hand, foot, and mouth disease (HFMD), but characteristics of cytokines response in enterovirus 71 (EV-71) and/or coxsackievirus A16 (CV-A16) associated HFMD with or without viral encephalitis remained unclear. We performed a multigroup retrospective study and compared the serum cytokines concentrations among 16 encephalitis patients infected with EV-71 and CV-A16, 24 encephalitis patients with single EV-71 infection, 34 mild HFMD patients with EV-71 infection, 18 mild HFMD patients with CV-A16 infection, and 39 healthy control subjects. Serum levels of interleukin (IL)-4, IL-5, IL-22, and IL-23 were significantly higher in encephalitis patients than in HFMD-alone patients when adjusting for age and sex; IL-2, tumor necrosis factor (TNF)-α, IL-4, IL-22, and IL-1β were significantly higher in HFMD-alone patients of EV-71 infection than in CV-A16 infected HFMD patients; cerebrospinal fluid level of IL-6 was lower in the EV-71/CV-A16 associated encephalitis than that in the EV-71 alone associated encephalitis patients. Over or low expression of the cytokines cascade in HFMD patients appears to play an important role in the elicitation of the immune response to EV-71 and CV-A16. These data will be used to define a cytokine profile, which might help to recognize HFMD patients with the high risk of developing encephalitis. PMID:26166120

  11. Coxsackievirus A16 Infection Induces Neural Cell and Non-Neural Cell Apoptosis In Vitro

    PubMed Central

    Liu, Li; Wei, Zhenhong; Ehrlich, Elana S.; Liu, Guanchen; Li, Jingliang; Liu, Xin; Wang, Hong; Yu, Xiao-fang; Zhang, Wenyan

    2014-01-01

    Coxsackievirus A16 (CA16) is one of the main causative pathogens of hand, foot and mouth disease (HFMD). Viral replication typically results in host cell apoptosis. Although CA16 infection has been reported to induce apoptosis in the human rhabdomyosarcoma (RD) cell line, it remains unclear whether CA16 induces apoptosis in diverse cell types, especially neural cells which have important clinical significance. In the current study, CA16 infection was found to induce similar apoptotic responses in both neural cells and non-neural cells in vitro, including nuclear fragmentation, DNA fragmentation and phosphatidylserine translocation. CA16 generally is not known to lead to serious neurological symptoms in vivo. In order to further clarify the correlation between clinical symptoms and cell apoptosis, two CA16 strains from patients with different clinical features were investigated. The results showed that both CA16 strains with or without neurological symptoms in infected patients led to neural and muscle cell apoptosis. Furthermore, mechanistic studies showed that CA16 infection induced apoptosis through the same mechanism in both neural and non-neural cells, namely via activation of both the mitochondrial (intrinsic) pathway-related caspase 9 protein and the Fas death receptor (extrinsic) pathway-related caspase 8 protein. Understanding the mechanisms by which CA16 infection induces apoptosis in both neural and non-neural cells will facilitate a better understanding of CA16 pathogenesis. PMID:25350381

  12. Coxsackievirus B 1-induced polymyositis. Lack of disease expression in nu/nu mice.

    PubMed Central

    Ytterberg, S R; Mahowald, M L; Messner, R P

    1987-01-01

    Chronic inflammatory myositis similar to human polymyositis occurs in mice after infection with a strain of Coxsackievirus B 1 (CVB 1). To investigate the role of T cells in the pathogenesis of this disorder, we compared disease expression in T cell-deficient athymic nude (nu/nu) mice and heterozygotes (nu/+) with normal T cell function. Acute infectious myositis occurred in nu/nu and nu/+ mice. Chronic (greater than 21 d postinfection) weakness and myositis, however, developed only in nu/+. Resistance to disease in nu/nu mice was not explained by insusceptibility to infection; the amount of virus lethal for 50% of mice and virus replication were comparable in both groups. Additionally, anti-CVB 1 antibody production was similar in both groups. Reconstitution of infected nu/nu mice with spleen cells from normal mice resulted in disease. These results demonstrate that chronic weakness after infection with this virus is not simply a sequela of acute myonecrosis and suggest that T cells play a pivotal role in the pathogenesis of chronic myositis. Images PMID:3038960

  13. Antiviral Ability of Kalanchoe gracilis Leaf Extract against Enterovirus 71 and Coxsackievirus A16

    PubMed Central

    Wang, Ching-Ying; Huang, Shun-Chueh; Zhang, Yongjun; Lai, Zhen-Rung; Kung, Szu-Hao; Chang, Yuan-Shiun; Lin, Cheng-Wen

    2012-01-01

    Pandemic infection or reemergence of Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) occurs in tropical and subtropical regions, being associated with hand-foot-and-mouth disease, herpangina, aseptic meningitis, brain stem encephalitis, pulmonary edema, and paralysis. However, effective therapeutic drugs against EV71 and CVA16 are rare. Kalanchoe gracilis (L.) DC is used for the treatment of injuries, pain, and inflammation. This study investigated antiviral effects of K. gracilis leaf extract on EV71 and CVA16 replications. HPLC analysis with a C-18 reverse phase column showed fingerprint profiles of K. gracilis leaf extract had 15 chromatographic peaks. UV/vis absorption spectra revealed peaks 5, 12, and 15 as ferulic acid, quercetin, and kaempferol, respectively. K. gracilis leaf extract showed little cytotoxicity, but exhibited concentration-dependent antiviral activities including cytopathic effect, plaque, and virus yield reductions. K. gracilis leaf extract was shown to be more potent in antiviral activity than ferulic acid, quercetin, and kaempferol, significantly inhibiting in vitro replication of EV71 (IC50 = 35.88 μg/mL) and CVA16 (IC50 = 42.91 μg/mL). Moreover, K. gracilis leaf extract is a safe antienteroviral agent with the inactivation of viral 2A protease and reduction of IL-6 and RANTES expressions. PMID:22666293

  14. Complete genome analysis of coxsackievirus A24 isolated in Yunnan, China, in 2013.

    PubMed

    Zhao, Yilin; Liu, Jiansheng; Zhang, Haihao; Guo, Chen; Xia, Longhui; Yang, Fang; Yang, Huai; Yang, Qinxing; Yang, Zhaoqing; Ma, Shaohui

    2016-06-01

    Human coxsackievirus A24 (CVA24) belongs to the species Enterovirus C, and variants of this virus frequently cause acute hemorrhagic conjunctivitis (AHC). The complete genome of the K282/YN/CHN/2013 strain, isolated from a healthy child in Yunnan, China, in 2013, is reported here for the first time. The strain showed 80.0 % and 79.9 % nucleotide sequence identity to CVA24 prototype strain Joseph and CVA24 variant prototype EH24, respectively. The K282/YN/CHN/2013 strain belongs to the CVA24 serotype. Twelve amino acid differences, most of which are in structural regions, were found between the CVA24 and CVA24v strains. In the whole-length genome sequence, only the structural region of K282/YN/CHN/2013 was similar to that of the CVA24 strains; the other genome regions were more similar to those of other members of the species Enterovirus C. Recombination analysis showed evidence of recombination with other viruses of the same species. PMID:26935916

  15. Protection Against Type 1 Diabetes Upon Coxsackievirus B4 Infection and iNKT-Cell Stimulation

    PubMed Central

    Ghazarian, Liana; Diana, Julien; Beaudoin, Lucie; Larsson, Pär G.; Puri, Raj K.; van Rooijen, Nico; Flodström-Tullberg, Malin; Lehuen, Agnès

    2013-01-01

    Invariant natural killer T (iNKT) cells belong to the innate immune system and exercise a dual role as potent regulators of autoimmunity and participate in responses against different pathogens. They have been shown to prevent type 1 diabetes development and to promote antiviral responses. Many studies in the implication of environmental factors on the etiology of type 1 diabetes have suggested a link between enteroviral infections and the development of this disease. This study of the pancreatropic enterovirus Coxsackievirus B4 (CVB4) shows that although infection accelerated type 1 diabetes development in a subset of proinsulin 2–deficient NOD mice, the activation of iNKT cells by a specific agonist, α-galactosylceramide, at the time of infection inhibited the disease. Diabetes development was associated with the infiltration of pancreatic islets by inflammatory macrophages, producing high levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α and activation of anti-islet T cells. On the contrary, macrophages infiltrating the islets after CVB4 infection and iNKT-cell stimulation expressed a number of suppressive enzymes, among which indoleamine 2,3-dioxygenase was sufficient to inhibit anti-islet T-cell response and to prevent diabetes. This study highlights the critical interaction between virus and the immune system in the acceleration or prevention of type 1 diabetes. PMID:23894189

  16. Optimization and Characterization of Candidate Strain for Coxsackievirus A16 Inactivated Vaccine.

    PubMed

    Li, Jingliang; Liu, Guanchen; Liu, Xin; Yang, Jiaxin; Chang, Junliang; Zhang, Wenyan; Yu, Xiao-Fang

    2015-07-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71), both of which can cause hand, foot and mouth disease (HFMD), are responsible for large epidemics in Asian and Pacific areas. Although inactivated EV71 vaccines have completed testing in phase III clinical trials in Mainland China, CA16 vaccines are still under development. A Vero cell-based inactivated CA16 vaccine was developed by our group. Screening identified a CA16 vaccine strain (CC024) isolated from HFMD patients, which had broad cross-protective abilities and satisfied all requirements for vaccine production. Identification of the biological characteristics showed that the CA16CC024 strain had the highest titer (107.5 CCID50/mL) in Vero cells, which would benefit the development of an EV71/CA16 divalent vaccine. A potential vaccine manufacturing process was established, including the selection of optimal time for virus harvesting, membrane for diafiltration and concentration, gel-filtration chromatography for the down-stream virus purification and virus inactivation method. Altogether, the analyses suggested that the CC-16, a limiting dilution clone of the CC024 strain, with good genetic stability, high titer and broad-spectrum immunogenicity, would be the best candidate strain for a CA16 inactivated vaccine. Therefore, our study provides valuable information for the development of a Vero cell-based CA16 or EV71-CA16 divalent inactivated vaccine. PMID:26193302

  17. [Research progress on seroepidemiological study of enterovirus 71 and coxsackievirus A16 infection among children].

    PubMed

    Luo, Li; Xing, Weijia; Liao, Qiaohong; Yu, Hongjie

    2015-02-01

    Most common causative agents for hand, foot and mouth disease (HFMD) are enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16). The symptomatic and asymptomatic cases could transmit the disease in population. Many sero-epidemiological surveys were launched to estimate the sero-incidence of EV-A71 and CV-A16 enterovirus, the susceptibility of different sub-population, and to observe the dynamics of neutralizing antibody. A literature search of sero-epidemiological study focused on EV-A71 or CV-A16 was conducted via PubMed and China Hospital Knowledge Database. Based on the 20 selected studies, the different age groups' antibody level, the susceptibility, the dynamics of antibody and sero-incidence of EV-A71 or CV-A16 were analyzed. From our results, the antibody level against EV-A71 or CV-A16 in neonates was associated with their mothers, which was similar with that of adults. The antibody level against EV-A71 or CV-A16 in neonates dropped to lowest level at one years-old, and started to dramatically increase until four years-old, and reached a plateau at five years-old. In conclusion, the infants aged 6-12 months were the priority group to receive vaccination when the EV-A71 vaccine is licensed in the future. PMID:26081408

  18. Distinct pathogenic effects of group B coxsackieviruses on human glomerular and tubular kidney cells.

    PubMed Central

    Conaldi, P G; Biancone, L; Bottelli, A; De Martino, A; Camussi, G; Toniolo, A

    1997-01-01

    The six group B coxsackieviruses (CVBs) are highly prevalent human pathogens that cause viremia followed by involvement of different organs. Clinical and experimental evidence suggests that CVBs can induce kidney injury, but the susceptibility of human renal cells to these viruses is unknown. By using pure cultures of human glomerular and tubular cells, we demonstrated that all CVBs are capable of productively infecting renal cells of three different histotypes. Distinct pathogenic effects were observed. Proximal tubular epithelial cells and, to a lesser extent, glomerular podocytes were highly susceptible to CVBs; in both cases, infection led to cytolysis. In contrast, glomerular mesangial cells supported the replication of the six CVBs but failed to develop overt cytopathologic changes. Mesangial cells continued to produce infectious progeny for numerous serial subcultures (i.e., more than 50 days), especially with type 1, 3, 4, and 5 viruses. In the above cells, persistent infection induced the de novo synthesis of platelet-derived growth factor A/B and enhanced the release of transforming growth factor beta1/2. These two factors are important mediators of progression from glomerular inflammation to glomerulosclerosis. CVB replication appeared also to impair the phagocytic and contractile activity of mesangial cells. Loss of these properties--which are important in glomerular physiopathology--may contribute to the development of progressive nephropathy. The results show that CVBs induce distinct effects in different types of cultured renal cells and suggest that CVB infections may be associated with both acute and progressive renal injury. PMID:9371576

  19. Virus-like particle-based vaccine against coxsackievirus A6 protects mice against lethal infections.

    PubMed

    Shen, Chaoyun; Ku, Zhiqiang; Zhou, Yu; Li, Dapeng; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong

    2016-07-25

    Coxsackievirus A6 (CA6) is emerging as one of the major causative agents of hand, foot, and mouth disease (HFMD) worldwide. However, no vaccine is currently available for preventing CA6 infection. Here, we report the development of a virus-like particle (VLP)-based recombinant vaccine for CA6. We produced CA6 VLPs in insect cells by infecting the cells with a baculovirus coexpressing the genes encoding CA6 P1 and 3CD. Biochemical analyses showed that the produced VLPs consisted of VP0, VP1, and VP3 capsid subunit proteins generated by the cleavage of P1 by 3CD. Mice immunized with these VLPs produced CA6-specific serum antibodies. Passive transfer of antisera from CA6 VLP-immunized mice protected recipient mice from lethal infections caused by homologous and heterologous CA6 strains. Moreover, active immunization of mice with CA6 VLPs efficiently conferred protection against both homologous and heterologous CA6 infections. These results suggested that CA6 VLP-based recombinant vaccine is a promising candidate vaccine for preventing CA6 infection and can be incorporated into a multivalent HFMD vaccine formulation to achieve broad-spectrum and effective prevention of this disease. PMID:27340093

  20. Development of sandwich ELISAs that can distinguish different types of coxsackievirus A16 viral particles.

    PubMed

    Ye, Xiangzhong; Yang, Lisheng; Jia, Jizong; Han, Jinle; Li, Shuxuan; Liu, Yajing; Xu, Longfa; Zhao, Huan; Chen, Yixin; Li, Yimin; Cheng, Tong; Xia, Ningshao

    2016-03-01

    Coxsackievirus A16 (CA16) is one of the major causative agents of hand, foot, and mouth disease (HFMD). No CA16 vaccine candidates have progressed to clinical trials so far. Immunogenicity studies indicated that different CA16 particles have much influence on the efficacy of a candidate vaccine. However, there are still no relevant reports on the methods of detecting different CA16 particles. In this study, we screened several monoclonal antibodies (mAbs) specific for different CA16 particles, and several sandwich enzyme-linked immunoassays (ELISAs) were developed to measure the different types of CA16 viral particles. The mAbs that could only bind denatured or empty capsids could not neutralize CA16. In contrast, the mAbs that could bind mature full particles or all types of particles showed obvious neutralizing activity. The thermal stability of different CA16 particles was evaluated using these sandwich ELISAs. The mature full particles were found to be more thermolabile than the other types of particles and could be stabilized by high concentrations of cations. These methods can be used to assist in the potency control of CA16 vaccines and will promote the development of a CA16 vaccine. PMID:26767830

  1. Buck-Buck- Boost Regulatr (B3R)

    NASA Astrophysics Data System (ADS)

    Mourra, Olivier; Fernandez, Arturo; Landstroem, Sven; Tonicello, Ferdinando

    2011-10-01

    In a satellite, the main function of a Power Conditioning Unit (PCU) is to manage the energy coming from several power sources (usually solar arrays and battery) and to deliver it continuously to the users in an appropriate form during the overall mission. The objective of this paper is to present an electronic switching DC-DC converter called Buck-Buck-Boost Regulator (B3R) that could be used as a modular and recurrent solution in a PCU for regulated or un- regulated 28Vsatellite power bus classes. The power conversion stages of the B3R topology are first described. Then theoretical equations and practical tests illustrate how the converter operates in term of power conversion, control loops performances and efficiency. The paper finally provides some examples of single point failure tolerant implementation using the B3R.

  2. Reply to criticisms of the B (3) field

    NASA Astrophysics Data System (ADS)

    Evans, M. W.

    1995-12-01

    The confusion and self-contradiction among recent critics of the B (3) (Evans-Vigier) field are analysed. Barron [17] and Buckingham [18] assert that the field is zero by symmetry. Grimes [21] asserts that the field is non-zero but fortuitous. Lakhtakia in one paper [19] asserts that B (3) is non-zero but not fundamental, and in a second paper that it is unknowlable and therefore may as well be zero. A rebuttal is given of each the individual papers, and it is shown that the Evans-Vigier field is the fundamental magnetizing field of electromagnetic radiation.

  3. 26 CFR 48.4161(b)-3 - Use considered sale.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Use considered sale. 48.4161(b)-3 Section 48... sale. For provisions relating to the tax on use of taxable articles by the manufacturer, producer, or importer thereof, see section 4218 relating to use by a manufacturer considered a sale, and the...

  4. Phylodynamic Characterization of an Ocular-Tropism Coxsackievirus A24 Variant.

    PubMed

    Yen, Yung-Chang; Chu, Pei-Huan; Lu, Po-Liang; Lin, Yung-Cheng; Shi, Yong-Ying; Chou, Li-Chiu; Wang, Chu-Feng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Chien-Ching; Zeng, Jing-Yun; Tyan, Yu-Chang; Ke, Guan-Ming; Chu, Pei-Yu

    2016-01-01

    Recent phylodynamic studies have focused on using tree topology patterns to elucidate interactions among the epidemiological, evolutionary, and demographic characteristics of infectious agents. However, because studies of viral phylodynamics tend to focus on epidemic outbreaks, tree topology signatures of tissue-tropism pathogens might not be clearly identified. Therefore, this study used a novel Bayesian evolutionary approach to analyze the A24 variant of coxsackievirus (CV-A24v), an ocular-tropism agent of acute hemorrhagic conjunctivitis. Analyses of the 915-nucleotide VP1 and 690-nt 3Dpol regions of 21 strains isolated in Taiwan and worldwide during 1985-2010 revealed a clear chronological trend in both the VP1 and 3Dpol phylogenetic trees: the emergence of a single dominant cluster in each outbreak. The VP1 sequences included three genotypes: GI (prototype), GIII (isolated 1985-1999), and GIV (isolated after 2000); no VP1 sequences from GII strains have been deposited in GenBank. Another five genotypes identified in the 3Dpol region had support values >0.9. Geographic and demographic transitions among CV-A24v clusters were clearly identified by Bayes algorithm. The transmission route was mapped from India to China and then to Taiwan, and each prevalent viral population declined before new clusters emerged. Notably, the VP1 and 3Dpol genes had high nucleotide sequence similarities (94.1% and 95.2%, respectively). The lack of co-circulating lineages and narrow tissue tropism affected the CV-A24v gene pool. PMID:27529556

  5. A murine model of coxsackievirus A16 infection for anti-viral evaluation.

    PubMed

    Liu, Qingwei; Shi, Jinping; Huang, Xulin; Liu, Fei; Cai, Yicun; Lan, Ke; Huang, Zhong

    2014-05-01

    Coxsackievirus A16 (CA16) is one of the main causative agents of hand, foot and mouth disease (HFMD), which is a common infectious disease in children. CA16 infection may lead to severe nervous system damage and even death in humans. However, study of the pathogenesis of CA16 infection and development of vaccines and anti-viral agents are hindered partly by the lack of an appropriate small animal model. In the present study, we developed and characterized a murine model of CA16 infection. We show that neonatal mice are susceptible to CA16 infection via intraperitoneal inoculation. One-day-old mice infected with 2×10(6)TCID50 of CA16/SZ05 strain consistently exhibited clinical signs, including reduced mobility, and limb weakness and paralysis. About 57% of the mice died within 14days after infection. Significant damage in the brainstem, limb muscles and intestines of the infected mice in the moribund state was observed by histological examination, and the presence of CA16 in neurons of the brainstem was demonstrated by immunohistochemical staining with a CA16-specific polyclonal antibody, strongly suggesting the involvement of the central nervous system in CA16 infection. Analysis of virus titers in various organs/tissues collected at 3, 6 and 9days post-infection, showed that skeletal muscle was the major site of virus replication at the early stage of infection, while the virus mainly accumulated in the brain at the late stage. In addition, susceptibility of mice to CA16 infection was found to be age dependent. Moreover, different CA16 strains could exhibit varied virulence in vivo. Importantly, we demonstrated that post-exposure treatment with an anti-CA16 monoclonal antibody fully protected mice against lethal CA16 infection. Collectively, these results indicate the successful development of a CA16 infection mouse model for anti-viral evaluation. PMID:24583030

  6. Phylodynamic Characterization of an Ocular-Tropism Coxsackievirus A24 Variant

    PubMed Central

    Lu, Po-Liang; Lin, Yung-Cheng; Shi, Yong-Ying; Chou, Li-Chiu; Wang, Chu-Feng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Chien-Ching; Zeng, Jing-Yun; Tyan, Yu-Chang; Ke, Guan-Ming

    2016-01-01

    Recent phylodynamic studies have focused on using tree topology patterns to elucidate interactions among the epidemiological, evolutionary, and demographic characteristics of infectious agents. However, because studies of viral phylodynamics tend to focus on epidemic outbreaks, tree topology signatures of tissue-tropism pathogens might not be clearly identified. Therefore, this study used a novel Bayesian evolutionary approach to analyze the A24 variant of coxsackievirus (CV-A24v), an ocular-tropism agent of acute hemorrhagic conjunctivitis. Analyses of the 915-nucleotide VP1 and 690-nt 3Dpol regions of 21 strains isolated in Taiwan and worldwide during 1985–2010 revealed a clear chronological trend in both the VP1 and 3Dpol phylogenetic trees: the emergence of a single dominant cluster in each outbreak. The VP1 sequences included three genotypes: GI (prototype), GIII (isolated 1985–1999), and GIV (isolated after 2000); no VP1 sequences from GII strains have been deposited in GenBank. Another five genotypes identified in the 3Dpol region had support values >0.9. Geographic and demographic transitions among CV-A24v clusters were clearly identified by Bayes algorithm. The transmission route was mapped from India to China and then to Taiwan, and each prevalent viral population declined before new clusters emerged. Notably, the VP1 and 3Dpol genes had high nucleotide sequence similarities (94.1% and 95.2%, respectively). The lack of co-circulating lineages and narrow tissue tropism affected the CV-A24v gene pool. PMID:27529556

  7. Coxsackievirus counters the host innate immune response by blocking type III interferon expression.

    PubMed

    Lind, Katharina; Svedin, Emma; Domsgen, Erna; Kapell, Sebastian; Laitinen, Olli; Moll, Markus; Flodström-Tullberg, Malin

    2016-06-01

    Type I IFNs play an important role in the immune response to enterovirus infections. Their importance is underscored by observations showing that many enteroviruses including coxsackie B viruses (CVBs) have developed strategies to block type I IFN production. Recent studies have highlighted a role for the type III IFNs (also called IFNλs) in reducing permissiveness to infections with enteric viruses including coxsackievirus. However, whether or not CVBs have measures to evade the effects of type III IFNs remains unknown. By combining virus infection studies and different modes of administrating the dsRNA mimic poly I : C, we discovered that CVBs target both TLR3- and MDA5/RIG-I-mediated type III IFN expression. Consistent with this, the cellular protein expression levels of the signal transduction proteins TRIF and IPS1 were reduced and no hyperphosphorylation of IRF-3 was observed following infection with the virus. Notably, decreased expression of full-length TRIF and IPS1 and the appearance of cleavage products was observed upon both CVB3 infection and in cellular protein extracts incubated with recombinant 2Apro, indicating an important role for the viral protease in subverting the cellular immune system. Collectively, our study reveals that CVBs block the expression of type III IFNs, and that this is achieved by a similar mechanism as the virus uses to block type I IFN production. We also demonstrate that the virus blocks several intracellular viral recognition pathways of importance for both type I and III IFN production. The simultaneous targeting of numerous arms of the host immune response may be required for successful viral replication and dissemination. PMID:26935471

  8. A Neonatal Mouse Model of Coxsackievirus A16 for Vaccine Evaluation

    PubMed Central

    Mao, Qunying; Wang, Yiping; Gao, Rong; Shao, Jie; Yao, Xin; Lang, Shuhui; Wang, Chao; Mao, Panyong

    2012-01-01

    To evaluate vaccine efficacy in protecting against coxsackievirus A16 (CA16), which causes human hand, foot, and mouth disease (HFMD), we established the first neonatal mouse model. In this article, we report data concerning CA16-induced pathological changes, and we demonstrate that anti-CA16 antibody can protect mice against lethal challenge and that the neonatal mouse model could be used to evaluate vaccine efficacy. To establish a mouse model, a BJCA08/CA16 strain (at 260 50% lethal doses [LD50]) was isolated from a patient and used to intracerebrally (i.c.) inoculate neonatal mice. The infection resulted in wasting, hind-limb paralysis, and even death. Pathological examination and immunohistochemistry (IHC) staining indicated that BJCA08 had a strong tropism to muscle and caused severe necrosis in skeletal and cardiac muscles. We then found that BJCA08 pretreated with goat anti-G10/CA16 serum could significantly lose its lethal effect in neonatal mice. When the anti-G10 serum was intraperitoneally (i.p.) injected into the neonatal mice and, within 1 h, the same mice were intracerebrally inoculated with BJCA08, there was significant passive immunization protection. In a separate experiment, female mice were immunized with formaldehyde-inactivated G10/CA16 and BJCA08/CA16 and then allowed to mate 1 h after the first immunization. We found that there was significant protection against BJCA08 for neonatal mice born to the immunized dams. These data demonstrated that anti-CA16 antibody may block virus invasion and protect mice against lethal challenge, and that the neonatal mouse model was a viable tool for evaluating vaccine efficacy. PMID:22951825

  9. Coxsackievirus and Adenovirus Receptor, a Tight Junction Protein, in Peri-Implantation Mouse Embryos.

    PubMed

    Oh, Yeong Seok; Nah, Won Heum; Choi, Bomi; Kim, Seok Hyun; Gye, Myung Chan

    2016-07-01

    To understand the role of Coxsackievirus and adenovirus receptor (CAR), a tight junction (TJ) protein, in peri-implantation embryos, developmental expression of CAR and its role in paracellular permeability were examined in mouse embryos. Splice variants for transmembrane CAR, Car1, Car2, and Car3 mRNA, were expressed from 2-cell, morula, and blastocyst stages onward, respectively, whereas mRNA for soluble CAR was expressed in MII oocytes and 4-cell stage onward. On Western blot, ∼46 kDa CAR proteins were detected in blastocysts. During the 4-cell embryos to morula stage, CAR was gradually concentrated at the contacts between blastomeres. In blastocysts, CAR was expressed at the cell contacts within the inner cell mass as well as in the trophectoderm (TE) where CAR was found together with ZO1 at the apical contacts, suggesting that CAR builds up apical TJs in TE and mediates cell adhesion in TE and inner cell mass. In blastocysts, CAR-blocking antibodies under Ca(2+) switching increased the dextran permeability and decreased the volume of blastocoel and H19 and Cdx2 mRNA, suggesting the pivotal role of CAR in the blastocyst development and paracellular permeability barrier in TE. CAR was expressed in TE of implanting embryos as well as endometrial epithelium, suggesting the involvement of CAR in the interaction between implanting embryos and endometrium. At 5-6 days postcoitum, CAR was expressed together with ZO1 in the primitive endoderm, visceral endoderm, and epiblasts facing the pro-amniotic cavity, suggesting that CAR TJs contribute to the separation of epiblast from the blastocoel and development of the pro-amniotic cavity within epiblasts. PMID:27226313

  10. Genomic characteristics of coxsackievirus A8 strains associated with hand, foot, and mouth disease and herpangina.

    PubMed

    Chen, Long; Yang, Hong; Wang, Chao; Yao, Xiang-Jie; Zhang, Hai-Long; Zhang, Ren-Li; He, Ya-Qing

    2016-01-01

    Coxsackievirus A8 (CV-A8), a member of the genus Enterovirus of the family Picornaviridae, can cause a variety of infectious diseases, such as hand, foot and mouth disease (HFMD), herpangina (HA), encephalitis, paralysis, myelitis, and meningitis. This is a first report of complete genome sequences of CV-A8 strains associated with HFMD/HA since the prototype strain Donovan was identified in 1949. The complete genome sequences of eight new CV-A8 strains showed 19.2 %-20.6 % nucleotide differences when compared to the prototype strain Donovan, and 81.5 %-99.9 % similarity to each other. The topology of a polyphyletic tree based on complete capsid protein gene sequences indicated that the new CV-A8 strains and Donovan are monophyletic. However, seven CV-A8 strains clustered with CV-A10 and CV-A2 in the 5'UTR and P2 region, respectively. In the P3 region, three and four CV-A8 strains grouped with CV-A6 and CV-A2, respectively. Seven CV-A8 strains segregated from Donovan and grouped in a separate lineage in the 3'UTR. The strain CVA8/SZ266/CHN/2014 was most similar to EV71 in the nonstructural proteins regions. Phylogenetic analysis classified worldwide CV-A8 isolates into four distinct clusters, and almost all Chinese and Thai CV-A8 strains evolved independently in their respective lineages, which indicated geographical evolution of CV-A8. PMID:26483280

  11. Characterizing Enterovirus 71 and Coxsackievirus A16 virus-like particles production in insect cells.

    PubMed

    Somasundaram, Balaji; Chang, Cindy; Fan, Yuan Y; Lim, Pei-Yin; Cardosa, Jane; Lua, Linda

    2016-02-15

    Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are two viruses commonly responsible for hand, foot and mouth disease (HFMD) in children. The lack of prophylactic or therapeutic measures against HFMD is a major public health concern. Insect cell-based EV71 and CVA16 virus-like particles (VLPs) are promising vaccine candidates against HFMD and are currently under development. In this paper, the influence of insect cell line, incubation temperature, and serial passaging effect and stability of budded virus (BV) stocks on EV71 and CVA16 VLP production was investigated. Enhanced EV71 and CVA16 VLP production was observed in Sf9 cells compared to High Five™ cells. Lowering the incubation temperature from the standard 27°C to 21°C increased the production of both VLPs in Sf9 cells. Serial passaging of CVA16 BV stocks in cell culture had a detrimental effect on the productivity of the structural proteins and the effect was observed with only 5 passages of BV stocks. A 2.7× higher production yield was achieved with EV71 compared to CVA16. High-resolution asymmetric flow field-flow fractionation couple with multi-angle light scattering (AF4-MALS) was used for the first time to characterize EV71 and CVA16 VLPs, displaying an average root mean square radius of 15±1nm and 15.3±5.8 nm respectively. This study highlights the need for different approaches in the design of production process to develop a bivalent EV71 and CVA16 vaccine. PMID:26410190

  12. Coxsackievirus A6 and Hand, Foot and Mouth Disease: Three Case Reports of Familial Child-to-Immunocompetent Adult Transmission and a Literature Review.

    PubMed

    Kaminska, Karolina; Martinetti, Gladys; Lucchini, Renzo; Kaya, Gürkan; Mainetti, Carlo

    2013-01-01

    Hand, foot and mouth disease (HFMD) is a highly contagious viral infection characterized by typical maculopapular or vesicular eruptions on the hands and feet and in the oral cavity. It affects predominantly children and/or immunocompromised adults. It usually follows a benign and self-limiting course. However, HFMD cases with severe or lethal complications such as encephalitis, meningitis, pulmonary edema and myocarditis have also been reported, mostly in children, but also in adults. High infectivity of HFMD has contributed to several large outbreaks of this disease in recent decades in East and Southeast Asia, the United States and Finland. The most common pathogens were Coxsackievirus A16, Enterovirus 71 and, recently, also Coxsackieviruses A6 and A10. Differences in the course of HFMD have been observed, depending on the virus type. Recently, many cases of atypical HFMD have been described in the literature with unusual morphology and/or localization of skin lesions. Atypical HFMD manifestations including vesiculobullous exanthema, often on the trunk or extremities, and perioral zone involvement were often caused by Coxsackievirus A6 infections. We present 3 cases of familial transmission of HFMD caused by Coxsackievirus A6 with some atypical features, benign course and complete recovery among immunocompetent adults. PMID:24019771

  13. Potassium zinc borate, KZnB(3)O(6).

    PubMed

    Wu, Yang; Yao, Ji-Yong; Zhang, Jian-Xiu; Fu, Pei-Zhen; Wu, Yi-Cheng

    2010-01-01

    The title compound, KZnB(3)O(6) contains a remarkable [B(6)O(12)](6-) group ( symmetry) formed by two rings linked by edge-sharing BO(4) tetra-hedra, a feature that has only been observed previously under high pressure conditions. These borate groups are connected through distorted ZnO(4) tetra-hedra in edge-shared pairs ( symmetry), forming a three-dimensional network whose cavities are filled by K(+) cations. PMID:21578991

  14. Outbreak of hand, foot and mouth disease/herpangina associated with coxsackievirus A6 and A10 infections in 2010, France: a large citywide, prospective observational study.

    PubMed

    Mirand, A; Henquell, C; Archimbaud, C; Ughetto, S; Antona, D; Bailly, J-L; Peigue-Lafeuille, H

    2012-05-01

    Hand, foot and mouth disease (HFMD) and herpangina (HA) are frequently caused by several distinct serotypes belonging to the human enterovirus A species (HEVA). Enterovirus 71 is considered as a significant public health threat because of rare but fatal neurological complications. A sentinel surveillance system involving paediatricians from Clermont-Ferrand (France) was set up to determine the clinical and epidemiological characteristics of HFMD/HA associated with enterovirus infections. A standardized report form was used to collect demographic and clinical data. Throat or buccal specimens were obtained prospectively and tested for the presence of enteroviruses. The frequency of HEVA serotypes was determined by genotyping. Phylogenetic relationships were analysed to identify potential new virus variants. From 1 April to 31 December 2010, a total of 222 children were enrolled. The predominant clinical presentation was HA (63.8%) and this was frequently associated with clinical signs of HFMD (48%). An enterovirus infection was diagnosed in 143 (64.4%) patients and serotype identification was achieved in 141/143 (98.6%). The predominant serotypes were coxsackievirus A10 (39.9%) and A6 (28%), followed by coxsackievirus A16 (17.5%) and enterovirus 71 (6.3%). Fever was observed in 115 (80.4%) children. No patient had neurological complications. Coxsackievirus A10 and A6 strains involved in the outbreak were consistently genetically related with those detected earlier in Finland and constituted distinct European lineages. Although several enterovirus serotypes have been involved in HFMD/HA cases, the outbreak described in this population survey was caused by coxsackievirus A6 and coxsackievirus A10, the third dual outbreak in Europe in the last 3 years. PMID:22404077

  15. Anisotropic elastic and vibrational properties of Ru2B3 and Os2B3: a first-principles investigation

    NASA Astrophysics Data System (ADS)

    Ozisik, Haci; Deligoz, Engin; Surucu, Gokhan; Bogaz Ozisik, Havva

    2016-07-01

    The structural, mechanical and lattice dynamical properties of Ru2B3 and Os2B3 have been investigated by using a first-principles method based on the density functional theory within the generalized gradient approximation. The single crystal elastic constants are numerically estimated using strain–stress approach. The polycrystalline aggregate elastic parameters are calculated from the single elastic constants via the Voigt–Reuss–Hill approximations. Subsequently, the ductility and brittleness are characterized with the estimation from Pugh’s rule (B/G) and Cauchy pressure. Additionally, the Debye temperature is calculated from the average elastic wave velocity obtained from bulk and shear moduli. The calculated parameters are consistent with the previous experimental and theoretical data. These borides are both mechanically and dynamically stable in the considered structure.

  16. A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

    SciTech Connect

    Yap, Thai Leong; Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G.; Lescar, Julien

    2007-02-01

    Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.

  17. Whole Genome and Transcriptome Sequencing of a B3 Thymoma

    PubMed Central

    Petrini, Iacopo; Rajan, Arun; Pham, Trung; Voeller, Donna; Davis, Sean; Gao, James; Wang, Yisong; Giaccone, Giuseppe

    2013-01-01

    Molecular pathology of thymomas is poorly understood. Genomic aberrations are frequently identified in tumors but no extensive sequencing has been reported in thymomas. Here we present the first comprehensive view of a B3 thymoma at whole genome and transcriptome levels. A 55-year-old Caucasian female underwent complete resection of a stage IVA B3 thymoma. RNA and DNA were extracted from a snap frozen tumor sample with a fraction of cancer cells over 80%. We performed array comparative genomic hybridization using Agilent platform, transcriptome sequencing using HiSeq 2000 (Illumina) and whole genome sequencing using Complete Genomics Inc platform. Whole genome sequencing determined, in tumor and normal, the sequence of both alleles in more than 95% of the reference genome (NCBI Build 37). Copy number (CN) aberrations were comparable with those previously described for B3 thymomas, with CN gain of chromosome 1q, 5, 7 and X and CN loss of 3p, 6, 11q42.2-qter and q13. One translocation t(11;X) was identified by whole genome sequencing and confirmed by PCR and Sanger sequencing. Ten single nucleotide variations (SNVs) and 2 insertion/deletions (INDELs) were identified; these mutations resulted in non-synonymous amino acid changes or affected splicing sites. The lack of common cancer-associated mutations in this patient suggests that thymomas may evolve through mechanisms distinctive from other tumor types, and supports the rationale for additional high-throughput sequencing screens to better understand the somatic genetic architecture of thymoma. PMID:23577124

  18. Environmental survey of the B-3 and Ford's Farm ranges.

    SciTech Connect

    Stoetzel, G.A.; Waite, D.A.; Gilchrist, R.L.

    1983-08-01

    The Army has been firing depleted-uranium (DU) projectiles into targets on the Aberdeen Proving Ground, Maryland. An environmental survey was conducted of two areas known as the B-3 range and the Ford's Farm range to determine the location of DU in their environments. The survey included ground survey measurements and some environmental sampling. Several special studies were also conducted, including analyses of the isotopic composition of uranium in a limited number of samples and a dissolution rate study to estimate the solubility of DU dust in sea and river water.

  19. 16 CFR Appendix B3 to Part 305 - Chest Freezers and All Other Freezers

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Chest Freezers and All Other Freezers B3 Appendix B3 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF... (âENERGY LABELING RULEâ) Pt. 305, App. B3 Appendix B3 to Part 305—Chest Freezers and All...

  20. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    DOEpatents

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  1. Properties of the deoxycholate-solubilized HeLa cell plasma membrane receptor for binding group B coxsackieviruses.

    PubMed Central

    Krah, D L; Crowell, R L

    1985-01-01

    Physical and chemical properties of deoxycholate-solubilized HeLa cell plasma membrane receptors for binding group B coxsackieviruses were determined. Receptors eluted from Sepharose 4B with an apparent molecular weight of 275,000 and sedimented with an S value of between 14.7 and 4.9 and a buoyant density of 1.06 to 1.10 g/cm3. Virus-binding activity was destroyed after treatment with proteases, glycosidases, and periodate but was unaffected by lipases or reducing or alkylating agents. Additionally, lectins, including concanavalin A, adsorbed receptors and inhibited virus attachment. The composite data suggested that glycoprotein is an integral part of the receptors for binding virus. PMID:2983096

  2. Yeast-produced recombinant virus-like particles of coxsackievirus A6 elicited protective antibodies in mice.

    PubMed

    Zhou, Yu; Shen, Chaoyun; Zhang, Chao; Zhang, Wei; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong

    2016-08-01

    Coxsackievirus A6 (CA6) has recently emerged as the predominant pathogen of hand, foot and mouth disease (HFMD), causing significant morbidity in children and adults. The increasing prevalence of CA6 infection and its associated disease burden underscore the need for effective CA6 vaccines. However, CA6 grows poorly in cultured cells, making it difficult to develop inactivated whole-virus or live attenuated vaccines. Here we report the development of a recombinant virus-like particle (VLP) based CA6 vaccine. CA6 VLPs were produced in Pichia pastoris yeast transformed with a vector encoding both P1 and 3CD proteins of CA6. Immunization with CA6 VLPs elicited CA6-specific serum antibodies in mice. Passive transfer of anti-VLP antisera protected recipient mice against lethal CA6 challenge. Collectively, these results demonstrate that CA6 VLPs represent a viable CA6 vaccine candidate which warrants further preclinical and clinical development. PMID:27315772

  3. Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat-induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells

    PubMed Central

    Wang, S; Huang, J; Lyu, H; Lee, C-K; Tan, J; Wang, J; Liu, B

    2013-01-01

    We reported that the class I HDAC inhibitor entinostat induced apoptosis in erbB2-overexpressing breast cancer cells via downregulation of erbB2 and erbB3. Here, we study the molecular mechanism by which entinostat dual-targets erbB2/erbB3. Treatment with entinostat had no effect on erbB2/erbB3 mRNA, suggesting a transcription-independent mechanism. Entinostat decreased endogenous but not exogenous erbB2/erbB3, indicating it did not alter their protein stability. We hypothesized that entinostat might inhibit erbB2/erbB3 protein translation via specific miRNAs. Indeed, entinostat significantly upregulated miR-125a, miR-125b, and miR-205, that have been reported to target erbB2 and/or erbB3. Specific inhibitors were then used to determine whether these miRNAs had a causal role in entinostat-induced downregulation of erbB2/erbB3 and apoptosis. Transfection with a single inhibitor dramatically abrogated entinostat induction of miR-125a, miR-125b, or miR-205; however, none of the inhibitors blocked entinostat action on erbB2/erbB3. In contrast, co-transfection with two inhibitors not only reduced their corresponding miRNAs, but also significantly abrogated entinostat-mediated reduction of erbB2/erbB3. Moreover, simultaneous inhibition of two, but not one miRNA significantly attenuated entinostat-induced apoptosis. Interestingly, although the other HDAC inhibitors, such as SAHA and panobinostat, exhibited activity as potent as entinostat to induce growth inhibition and apoptosis in erbB2-overexpressing breast cancer cells, they had no significant effects on the three miRNAs. Instead, both SAHA- and panobinostat-decreased erbB2/erbB3 expression correlated with the reduction of their mRNA levels. Collectively, we demonstrate that entinostat specifically induces expression of miR-125a, miR-125b, and miR-205, which act in concert to downregulate erbB2/erbB3 in breast cancer cells. Our data suggest that epigenetic regulation via miRNA-dependent or -independent mechanisms may

  4. Planar B3S2H3(-) and B3S2H3 clusters with a five-membered B3S2 ring: boron-sulfur hydride analogues of cyclopentadiene.

    PubMed

    Li, Da-Zhi; Li, Rui; Zhang, Li-Juan; Ou, Ting; Zhai, Hua-Jin

    2016-08-21

    Boron clusters can serve as inorganic analogues of hydrocarbons or polycyclic aromatic hydrocarbons (PAHs). We present herein, based upon global searches and electronic structural calculations at the B3LYP and CCSD(T) levels, the global-minimum structures of two boron-sulfur hydride clusters: C2v B3S2H3(-) (1, (2)B1) and C2v B3S2H3 (2, (1)A1). Both species are perfectly planar and feature a five-membered B3S2 ring as the structural core, with three H atoms attached terminally to the B sites. Chemical bonding analysis shows that C2v B3S2H3(-) (1) has a delocalized 5π system within a heteroatomic B3S2 ring, analogous to the π bonding in cyclopentadiene, D5h C5H5. The corresponding closed-shell C2v B3S2H3(2-) (3, (1)A1) dianion is only a local minimum. At the single-point CCSD(T) level, it is 5.7 kcal mol(-1) above the chain-like C1 ((1)A) open structure. This situation is in contrast to the cyclopentadienyl anion, C5H5(-), a prototypical aromatic hydrocarbon with a π sextet. The C2v B3S2H3 (2) neutral cluster is readily obtained upon removal of one π electron from C2v B3S2H3(-) (1). The anion photoelectron spectrum of C2v B3S2H3(-) (1) and the infrared absorption spectrum of C2v B3S2H3 (2) are predicted. The C2v B3S2H3(-) (1) species can be stabilized in sandwich-type C2h [(B3S2H3)2Fe](2-) and salt C2h [(B3S2H3)2Fe]Li2 complexes. An intriguing difference is observed between the pattern of π sextet in C2v B3S2H3(2-) (3) dianion and that in cyclopentadienyl anion. The present work also sheds light on the mechanism of structural evolution in the B3S2H3(0/-/2-) series with charge states. PMID:27424889

  5. Nonequilibrium dynamics in amorphous Si3B3N7.

    PubMed

    Hannemann, A; Schön, J C; Jansen, M; Sibani, P

    2005-06-16

    We present extensive numerical investigations of the structural relaxation dynamics of a realistic model of the amorphous high-temperature ceramic a-Si3B3N7, probing the mean-square displacement of the atoms, the bond survival probability, the average energy, the specific heat, and the two-point energy average. Combining the information from these different sources, we identify a transition temperature Tc approximately 2000 K below which the system is no longer ergodic and physical quantities observed over a time t(obs) show a systematic parametric dependence on the waiting time t(w), or age, elapsed after the quench. The aging dynamics "stiffens" as the system becomes older, which is similar to the behavior of highly idealized models such as Ising spin glasses and Lennard-Jones glasses. PMID:16852445

  6. Discovery of Potent Non-Nucleoside Inhibitors of Dengue Viral RNA-Dependent RNA Polymerase from a Fragment Hit Using Structure-Based Drug Design.

    PubMed

    Yokokawa, Fumiaki; Nilar, Shahul; Noble, Christian G; Lim, Siew Pheng; Rao, Ranga; Tania, Stefani; Wang, Gang; Lee, Gladys; Hunziker, Jürg; Karuna, Ratna; Manjunatha, Ujjini; Shi, Pei-Yong; Smith, Paul W

    2016-04-28

    The discovery and optimization of non-nucleoside dengue viral RNA-dependent-RNA polymerase (RdRp) inhibitors are described. An X-ray-based fragment screen of Novartis' fragment collection resulted in the identification of a biphenyl acetic acid fragment 3, which bound in the palm subdomain of RdRp. Subsequent optimization of the fragment hit 3, relying on structure-based design, resulted in a >1000-fold improvement in potency in vitro and acquired antidengue activity against all four serotypes with low micromolar EC50 in cell-based assays. The lead candidate 27 interacts with a novel binding pocket in the palm subdomain of the RdRp and exerts a promising activity against all clinically relevant dengue serotypes. PMID:26984786

  7. Optimization of Potent and Selective Quinazolinediones: Inhibitors of Respiratory Syncytial Virus That Block RNA-Dependent RNA-Polymerase Complex Activity

    PubMed Central

    2015-01-01

    A quinazolinedione-derived screening hit 2 was discovered with cellular antiviral activity against respiratory syncytial virus (CPE EC50 = 2.1 μM), moderate efficacy in reducing viral progeny (4.2 log at 10 μM), and marginal cytotoxic liability (selectivity index, SI ∼ 24). Scaffold optimization delivered analogs with improved potency and selectivity profiles. Most notable were compounds 15 and 19 (EC50 = 300–500 nM, CC50 > 50 μM, SI > 100), which significantly reduced viral titer (>400,000-fold), and several analogs were shown to block the activity of the RNA-dependent RNA-polymerase complex of RSV. PMID:25399509

  8. A single RNA-dependent RNA polymerase assembles with mutually exclusive nucleotidyl transferase subunits to direct different pathways of small RNA biogenesis.

    PubMed

    Lee, Suzanne Rebecca; Talsky, Kristin Benjamin; Collins, Kathleen

    2009-07-01

    Members of the conserved family of eukaryotic RNA-dependent RNA polymerases (Rdrs) synthesize double-stranded RNA (dsRNA) intermediates in diverse pathways of small RNA (sRNA) biogenesis and RNA-mediated silencing. Rdr-dependent pathways of sRNA production are poorly characterized relative to Rdr-independent pathways, and the Rdr enzymes themselves are poorly characterized relative to their viral RNA-dependent RNA polymerase counterparts. We previously described a physical and functional coupling of the Tetrahymena thermophila Rdr, Rdr1, and a Dicer enzyme, Dcr2, in the production of approximately 24-nucleotide (nt) sRNA in vitro. Here we characterize the endogenous complexes that harbor Rdr1, termed RDRCs. Distinct RDRCs assemble to contain Rdr1 and subsets of the total of four tightly Rdr1-associated proteins. Of particular interest are two RDRC subunits, Rdn1 and Rdn2, which possess noncanonical ribonucleotidyl transferase motifs. We show that the two Rdn proteins are uridine-specific polymerases of separate RDRCs. Two additional RDRC subunits, Rdf1 and Rdf2, are present only in RDRCs containing Rdn1. Rdr1 catalytic activity is retained in RDRCs purified from cell extracts lacking any of the nonessential RDRC subunits (Rdn2, Rdf1, Rdf2) or if the RDRC harbors a catalytically inactive Rdn. However, specific disruption of each RDRC imposes distinct loss-of-function consequences at the cellular level and has a differential impact on the accumulation of specific 23-24-nt sRNA sequences in vivo. The biochemical and biological phenotypes of RDRC subunit disruption reveal a previously unanticipated complexity of Rdr-dependent sRNA biogenesis in vivo. PMID:19451546

  9. Photoelectron spectroscopy of boron-gold alloy clusters and boron boronyl clusters: B3Au(n)(-) and B3(BO)n(-) (n = 1, 2).

    PubMed

    Chen, Qiang; Bai, Hui; Zhai, Hua-Jin; Li, Si-Dian; Wang, Lai-Sheng

    2013-07-28

    Photoelectron spectroscopy and density-functional theory are combined to study the structures and chemical bonding in boron-gold alloy clusters and boron boronyl clusters: B3Au(n)(-) and B3(BO)n(-) (n = 1, 2). Vibrationally resolved photoelectron spectra are obtained for all four species and the B-Au and B-BO clusters exhibit similar spectral patterns, with the latter species having higher electron binding energies. The electron affinities of B3Au, B3Au2, B3(BO), and B3(BO)2 are determined to be 2.29 ± 0.02, 3.17 ± 0.03, 2.71 ± 0.02, and 4.44 ± 0.02 eV, respectively. The anion and neutral clusters turn out to be isostructural and isovalent to the B3H(n)(-)∕B3H(n) (n = 1, 2) species, which are similar in bonding owing to the fact that Au, BO, and H are monovalent σ ligands. All B3Au(n)(-) and B3(BO)n(-) (n = 1, 2) clusters are aromatic with 2π electrons. The current results provide new examples for the Au∕H and BO∕H isolobal analogy and enrich the chemistry of boronyl and gold. PMID:23901981

  10. The G2(B3LYP/MP2/CC) Approach: A Modification of the G2(MP2) Approach and a Comparison with B3LYP Results

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    The quadratic configuration interaction calculation in the G2(MP2) approach is replaced by a coupled-cluster singles and doubles calculation including a perturbational estimate of the triples excitations. In addition, the SCF and MP2 geometry optimizations and SCF frequency calculation in the G2(MP2) approach are replaced by a B3LYP geometry optimization and frequency calculation in the proposed G2(B3LYP/MP2/CC) approach. This simplification does not affect the average absolute deviation from experiment, but decreases the maximum error compared with the G2(MP2) approach. The G2(B3LYP/MP2/CC) results are compared with those obtained using the B3LYP approach, and the G2(B3LYP/MP2/CC) model is found to be more reliable, even if the B3LYP calculations are performed using a large basis set.

  11. PTBP1 is required for glucose-stimulated cap-independent translation of insulin granule proteins and Coxsackieviruses in beta cells.

    PubMed

    Knoch, Klaus-Peter; Nath-Sain, Suchita; Petzold, Antje; Schneider, Hendryk; Beck, Mike; Wegbrod, Carolin; Sönmez, Anke; Münster, Carla; Friedrich, Anne; Roivainen, Merja; Solimena, Michele

    2014-08-01

    Glucose and GLP-1 stimulate not only insulin secretion, but also the post-transcriptional induction of insulin granule biogenesis. This process involves the nucleocytoplasmic translocation of the RNA binding protein PTBP1. Binding of PTBP1 to the 3'-UTRs of mRNAs for insulin and other cargoes of beta cell granules increases their stability. Here we show that glucose enhances also the binding of PTBP1 to the 5'-UTRs of these transcripts, which display IRES activity, and their translation exclusively in a cap-independent fashion. Accordingly, glucose-induced biosynthesis of granule cargoes was unaffected by pharmacological, genetic or Coxsackievirus-mediated inhibition of cap-dependent translation. Infection with Coxsackieviruses, which also depend on PTBP1 for their own cap-independent translation, reduced instead granule stores and insulin release. These findings provide insight into the mechanism for glucose-induction of insulin granule production and on how Coxsackieviruses, which have been implicated in the pathogenesis of type 1 diabetes, can foster beta cell failure. PMID:25061557

  12. Neonatal coxsackievirus group B infections: experience of a single department of neonatology.

    PubMed

    Isacsohn, M; Eidelman, A I; Kaplan, M; Goren, A; Rudensky, B; Handsher, R; Barak, Y

    1994-01-01

    Coxsackie infections in 14 infants born in a single neonatal unit were studied. The clinical presentation was mild nonspecific disease in eight infants and an overwhelming multiorgan disease in six. Three infants with systemic disease died. Vertical transmission of the virus from a colonized mother was documented in five mothers who infected seven infants. The remaining seven infants were infected horizontally, presumably from infected personnel. Coxsackie B1 was isolated in four of the cases and type B3 in two cases of systemic disease. Intravenous gammaglobulin combined with human leukocyte interferon was utilized in three cases of overwhelming disease and two infants of these infants survived. PMID:7518424

  13. Two Membrane-Associated Regions within the Nodamura Virus RNA-Dependent RNA Polymerase Are Critical for both Mitochondrial Localization and RNA Replication

    PubMed Central

    Gant, Vincent U.; Moreno, Stephanie; Varela-Ramirez, Armando

    2014-01-01

    ABSTRACT Viruses with positive-strand RNA genomes amplify their genomes in replication complexes associated with cellular membranes. Little is known about the mechanism of replication complex formation in cells infected with Nodamura virus. This virus is unique in its ability to lethally infect both mammals and insects. In mice and in larvae of the greater wax moth (Galleria mellonella), Nodamura virus-infected muscle cells exhibit mitochondrial aggregation and membrane rearrangement, leading to disorganization of the muscle fibrils on the tissue level and ultimately in hind limb/segment paralysis. However, the molecular basis for this pathogenesis and the role of mitochondria in Nodamura virus infection remains unclear. Here, we tested the hypothesis that Nodamura virus establishes RNA replication complexes that associate with mitochondria in mammalian cells. Our results showed that Nodamura virus replication complexes are targeted to mitochondria, as evidenced in biochemical, molecular, and confocal microscopy studies. More specifically, we show that the Nodamura virus RNA-dependent RNA polymerase interacts with the outer mitochondrial membranes as an integral membrane protein and ultimately becomes associated with functional replication complexes. These studies will help us to understand the mechanism of replication complex formation and the pathogenesis of Nodamura virus for mammals. IMPORTANCE This study will further our understanding of Nodamura virus (NoV) genome replication and its pathogenesis for mice. NoV is unique among the Nodaviridae in its ability to infect mammals. Here we show that NoV establishes RNA replication complexes (RCs) in association with mitochondria in mammalian cells. These RCs contain newly synthesized viral RNA and feature a physical interaction between mitochondrial membranes and the viral RNA-dependent RNA polymerase (RdRp), which is mediated by two membrane-associated regions. While the nature of the interaction needs to be

  14. 46 CFR 153.352 - B/3 and 4 m venting system outlets.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false B/3 and 4 m venting system outlets. 153.352 Section 153... Cargo Venting Systems § 153.352 B/3 and 4 m venting system outlets. A B/3 or 4 m venting system outlet must: (a) Discharge vertically upwards; and (b) Prevent precipitation from entering the vent system....

  15. 22 CFR 9b.3 - Press correspondents employed by foreign media organizations.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Press correspondents employed by foreign media organizations. 9b.3 Section 9b.3 Foreign Relations DEPARTMENT OF STATE GENERAL REGULATIONS GOVERNING DEPARTMENT OF STATE PRESS BUILDING PASSES § 9b.3 Press correspondents employed by foreign media organizations. In order to obtain a Department...

  16. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 15 2012-04-01 2012-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship...

  17. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 15 2013-04-01 2013-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship...

  18. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 15 2014-04-01 2014-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship...

  19. 22 CFR 9b.3 - Press correspondents employed by foreign media organizations.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Press correspondents employed by foreign media organizations. 9b.3 Section 9b.3 Foreign Relations DEPARTMENT OF STATE GENERAL REGULATIONS GOVERNING DEPARTMENT OF STATE PRESS BUILDING PASSES § 9b.3 Press correspondents employed by foreign media organizations. In order to obtain a Department...

  20. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... and its officers or directors. 240.16b-3 Section 240.16b-3 Commodity and Securities Exchanges... Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A... conversion) or its underlying equity security. (e) Dispositions to the issuer. Any transaction, other than...

  1. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... and its officers or directors. 240.16b-3 Section 240.16b-3 Commodity and Securities Exchanges... Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A... conversion) or its underlying equity security. (e) Dispositions to the issuer. Any transaction, other than...

  2. 22 CFR 9b.3 - Press correspondents employed by foreign media organizations.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Press correspondents employed by foreign media organizations. 9b.3 Section 9b.3 Foreign Relations DEPARTMENT OF STATE GENERAL REGULATIONS GOVERNING DEPARTMENT OF STATE PRESS BUILDING PASSES § 9b.3 Press correspondents employed by foreign media organizations. In order to obtain a Department...

  3. 26 CFR 1.468B-3 - Rules applicable to the transferor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) A legend, “§ 1.468B-3 Statement”, at the top of the first page; (B) The transferor's name, address... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Rules applicable to the transferor. 1.468B-3 Section 1.468B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED)...

  4. 46 CFR 153.352 - B/3 and 4 m venting system outlets.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 5 2011-10-01 2011-10-01 false B/3 and 4 m venting system outlets. 153.352 Section 153.352 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES... Cargo Venting Systems § 153.352 B/3 and 4 m venting system outlets. A B/3 or 4 m venting system...

  5. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... and its officers or directors. 240.16b-3 Section 240.16b-3 Commodity and Securities Exchanges... Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A... conversion) or its underlying equity security. (e) Dispositions to the issuer. Any transaction, other than...

  6. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... and its officers or directors. 240.16b-3 Section 240.16b-3 Commodity and Securities Exchanges... Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A... conversion) or its underlying equity security. (e) Dispositions to the issuer. Any transaction, other than...

  7. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... and its officers or directors. 240.16b-3 Section 240.16b-3 Commodity and Securities Exchanges... Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A... conversion) or its underlying equity security. (e) Dispositions to the issuer. Any transaction, other than...

  8. 22 CFR 9b.3 - Press correspondents employed by foreign media organizations.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Press correspondents employed by foreign media organizations. 9b.3 Section 9b.3 Foreign Relations DEPARTMENT OF STATE GENERAL REGULATIONS GOVERNING DEPARTMENT OF STATE PRESS BUILDING PASSES § 9b.3 Press correspondents employed by foreign media organizations. In order to obtain a Department...

  9. Development of a challenge-protective vaccine concept by modification of the viral RNA-dependent RNA polymerase of canine distemper virus.

    PubMed

    Silin, D; Lyubomska, O; Ludlow, M; Duprex, W P; Rima, B K

    2007-12-01

    We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a "quick response" in vaccine development against well-known and "new" viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems. PMID:17898047

  10. Development of a Challenge-Protective Vaccine Concept by Modification of the Viral RNA-Dependent RNA Polymerase of Canine Distemper Virus▿

    PubMed Central

    Silin, D.; Lyubomska, O.; Ludlow, M.; Duprex, W. P.; Rima, B. K.

    2007-01-01

    We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a “quick response” in vaccine development against well-known and “new” viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems. PMID:17898047

  11. Aubergine iCLIP Reveals piRNA-Dependent Decay of mRNAs Involved in Germ Cell Development in the Early Embryo

    PubMed Central

    Barckmann, Bridlin; Pierson, Stéphanie; Dufourt, Jérémy; Papin, Catherine; Armenise, Claudia; Port, Fillip; Grentzinger, Thomas; Chambeyron, Séverine; Baronian, Grégory; Desvignes, Jean-Pierre; Curk, Tomaz; Simonelig, Martine

    2015-01-01

    Summary The Piwi-interacting RNA (piRNA) pathway plays an essential role in the repression of transposons in the germline. Other functions of piRNAs such as post-transcriptional regulation of mRNAs are now emerging. Here, we perform iCLIP with the PIWI protein Aubergine (Aub) and identify hundreds of maternal mRNAs interacting with Aub in the early Drosophila embryo. Gene expression profiling reveals that a proportion of these mRNAs undergo Aub-dependent destabilization during the maternal-to-zygotic transition. Strikingly, Aub-dependent unstable mRNAs encode germ cell determinants. iCLIP with an Aub mutant that is unable to bind piRNAs confirms piRNA-dependent binding of Aub to mRNAs. Base pairing between piRNAs and mRNAs can induce mRNA cleavage and decay that are essential for embryonic development. These results suggest general regulation of maternal mRNAs by Aub and piRNAs, which plays a key developmental role in the embryo through decay and localization of mRNAs encoding germ cell determinants. PMID:26257181

  12. Use of DNA, RNA, and Chimeric Templates by a Viral RNA-Dependent RNA Polymerase: Evolutionary Implications for the Transition from the RNA to the DNA World

    PubMed Central

    Siegel, Robert W.; Bellon, Laurent; Beigelman, Leonid; Kao, C. Cheng

    1999-01-01

    All polynucleotide polymerases have a similar structure and mechanism of catalysis, consistent with their evolution from one progenitor polymerase. Viral RNA-dependent RNA polymerases (RdRp) are expected to have properties comparable to those from this progenitor and therefore may offer insight into the commonalities of all classes of polymerases. We examined RNA synthesis by the brome mosaic virus RdRp on DNA, RNA, and hybrid templates and found that precise initiation of RNA synthesis can take place from all of these templates. Furthermore, initiation can take place from either internal or penultimate initiation sites. Using a template competition assay, we found that the BMV RdRp interacts with DNA only three- to fourfold less well than it interacts with RNA. Moreover, a DNA molecule with a ribonucleotide at position −11 relative to the initiation nucleotide was able to interact with RdRp at levels comparable to that observed with RNA. These results suggest that relatively few conditions were needed for an ancestral RdRp to replicate DNA genomes. PMID:10400735

  13. Simple but highly effective three-dimensional chemical-feature-based pharmacophore model for diketo acid derivatives as hepatitis C virus RNA-dependent RNA polymerase inhibitors.

    PubMed

    Di Santo, Roberto; Fermeglia, Maurizio; Ferrone, Marco; Paneni, Maria Silvia; Costi, Roberta; Artico, Marino; Roux, Alessandra; Gabriele, Mirko; Tardif, Keith D; Siddiqui, Aleem; Pricl, Sabrina

    2005-10-01

    A molecular modeling strategy using aryl diketo acid (ADK) derivatives recently reported in the literature as hepatitis C virus (HCV) polymerase inhibitors was designed. A 3D chemical-feature-based pharmacophore model was developed using Catalyst software, which produced 10 pharmacophore hypotheses. The top-ranked one (Hypo 1), characterized by a high correlation coefficient (r = 0.965), consisted of two hydrogen bond acceptors, one negative ionizable moiety, and two hydrophobic aromatics. This model was used to predict the anti-RNA-dependent RNA polymerase (anti-RdRp) activity of 6-(1-arylmethylpyrrol-2-yl)-1,4-dioxo-5-hexenoic acids and other ADK derivatives previously synthesized in our laboratories as HIV-1 integrase inhibitors. Furthermore, the experimental IC50 values of 9 compounds, tested in vitro against recombinant HCV polymerase, were compared with the corresponding values predicted using Hypo1. A good agreement between experimental and simulated data was obtained. The results demonstrate that the hypothesis derived in this study can be considered to be a useful tool in designing new leads based on ADK scaffolds as HCV RdRp inhibitors. PMID:16190757

  14. Pepino mosaic virus RNA-Dependent RNA Polymerase POL Domain Is a Hypersensitive Response-Like Elicitor Shared by Necrotic and Mild Isolates.

    PubMed

    Sempere, Raquel N; Gómez-Aix, Cristina; Ruíz-Ramón, Fabiola; Gómez, Pedro; Hasiów-Jaroszewska, Beata; Sánchez-Pina, María Amelia; Aranda, Miguel A

    2016-04-01

    Pepino mosaic virus (PepMV) is an emerging pathogen that represents a serious threat to tomato production worldwide. PepMV-induced diseases manifest with a wide range of symptoms, including systemic necrosis. Our results showed that PepMV accumulation depends on the virus isolate, tomato cultivar, and environmental conditions, and associates with the development of necrosis. Substitution of lysine for glutamic acid at position 67 in the triple gene block 3 (TGB3) protein, previously described as a necrosis determinant, led to increased virus accumulation and was necessary but not sufficient to induce systemic necrosis. Systemic necrosis both in tomato and Nicotiana benthamiana shared hypersensitive response (HR) features, allowing the assessment of the role of different genomic regions on necrosis induction. Overexpression of both TGB3 and the polymerase domain (POL) of the RNA-dependent RNA polymerase (RdRp) resulted in necrosis, although only local expression of POL triggered HR-like symptoms. Our results also indicated that the necrosis-eliciting activity of POL resides in its highly conserved "palm" domain, and that necrosis was jasmonic acid-dependent but not salicylic acid-dependent. Altogether, our data suggest that the RdRp-POL domain plays an important role in PepMV necrosis induction, with necrosis development depending on the virus accumulation level, which can be modulated by the nature of TGB3, host genotype and environmental conditions. PMID:26667188

  15. Endogenous short RNAs generated by Dicer 2 and RNA-dependent RNA polymerase 1 regulate mRNAs in the basal fungus Mucor circinelloides

    SciTech Connect

    Grigoriev, Igor; Nicolas, Francisco; Moxon, Simon; Haro, Juan de; Calo, Silvia; Torres-Martinez, Santiago; Moulton, Vincent; Ruiz-Vazquez, Rosa; Dalmay, Tamas

    2011-09-01

    Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi

  16. Hydrogen/Deuterium Exchange Kinetics Demonstrate Long Range Allosteric Effects of Thumb Site 2 Inhibitors of Hepatitis C Viral RNA-dependent RNA Polymerase.

    PubMed

    Deredge, Daniel; Li, Jiawen; Johnson, Kenneth A; Wintrode, Patrick L

    2016-05-01

    New nonnucleoside analogs are being developed as part of a multi-drug regimen to treat hepatitis C viral infections. Particularly promising are inhibitors that bind to the surface of the thumb domain of the viral RNA-dependent RNA polymerase (NS5B). Numerous crystal structures have been solved showing small molecule non-nucleoside inhibitors bound to the hepatitis C viral polymerase, but these structures alone do not define the mechanism of inhibition. Our prior kinetic analysis showed that nonnucleoside inhibitors binding to thumb site-2 (NNI2) do not block initiation or elongation of RNA synthesis; rather, they block the transition from the initiation to elongation, which is thought to proceed with significant structural rearrangement of the enzyme-RNA complex. Here we have mapped the effect of three NNI2 inhibitors on the conformational dynamics of the enzyme using hydrogen/deuterium exchange kinetics. All three inhibitors rigidify an extensive allosteric network extending >40 Å from the binding site, thus providing a structural rationale for the observed disruption of the transition from distributive initiation to processive elongation. The two more potent inhibitors also suppress slow cooperative unfolding in the fingers extension-thumb interface and primer grip, which may contribute their stronger inhibition. These results establish that NNI2 inhibitors act through long range allosteric effects, reveal important conformational changes underlying normal polymerase function, and point the way to the design of more effective allosteric inhibitors that exploit this new information. PMID:27006396

  17. Distinct RNA-dependent RNA polymerases are required for RNAi triggered by double-stranded RNA versus truncated transgenes in Paramecium tetraurelia

    PubMed Central

    Marker, Simone; Le Mouël, Anne; Meyer, Eric; Simon, Martin

    2010-01-01

    In many eukaryotes, RNA-dependent RNA polymerases (RdRPs) play key roles in the RNAi pathway. They have been implicated in the recognition and processing of aberrant transcripts triggering the process, and in amplification of the silencing response. We have tested the functions of RdRP genes from the ciliate Paramecium tetraurelia in experimentally induced and endogenous mechanisms of gene silencing. In this organism, RNAi can be triggered either by high-copy, truncated transgenes or by directly feeding cells with double-stranded RNA (dsRNA). Surprisingly, dsRNA-induced silencing depends on the putatively functional RDR1 and RDR2 genes, which are required for the accumulation of both primary siRNAs and a distinct class of small RNAs suggestive of secondary siRNAs. In contrast, a third gene with a highly divergent catalytic domain, RDR3, is required for siRNA accumulation when RNAi is triggered by truncated transgenes. Our data further implicate RDR3 in the accumulation of previously described endogenous siRNAs and in the regulation of the surface antigen gene family. While only one of these genes is normally expressed in any clonal cell line, the knockdown of RDR3 leads to co-expression of multiple antigens. These results provide evidence for a functional specialization of Paramecium RdRP genes in distinct RNAi pathways operating during vegetative growth. PMID:20200046

  18. Distinct RNA-dependent RNA polymerases are required for RNAi triggered by double-stranded RNA versus truncated transgenes in Paramecium tetraurelia.

    PubMed

    Marker, Simone; Le Mouël, Anne; Meyer, Eric; Simon, Martin

    2010-07-01

    In many eukaryotes, RNA-dependent RNA polymerases (RdRPs) play key roles in the RNAi pathway. They have been implicated in the recognition and processing of aberrant transcripts triggering the process, and in amplification of the silencing response. We have tested the functions of RdRP genes from the ciliate Paramecium tetraurelia in experimentally induced and endogenous mechanisms of gene silencing. In this organism, RNAi can be triggered either by high-copy, truncated transgenes or by directly feeding cells with double-stranded RNA (dsRNA). Surprisingly, dsRNA-induced silencing depends on the putatively functional RDR1 and RDR2 genes, which are required for the accumulation of both primary siRNAs and a distinct class of small RNAs suggestive of secondary siRNAs. In contrast, a third gene with a highly divergent catalytic domain, RDR3, is required for siRNA accumulation when RNAi is triggered by truncated transgenes. Our data further implicate RDR3 in the accumulation of previously described endogenous siRNAs and in the regulation of the surface antigen gene family. While only one of these genes is normally expressed in any clonal cell line, the knockdown of RDR3 leads to co-expression of multiple antigens. These results provide evidence for a functional specialization of Paramecium RdRP genes in distinct RNAi pathways operating during vegetative growth. PMID:20200046

  19. EGO-1, a Putative RNA-Dependent RNA Polymerase, Is Required for Heterochromatin Assembly on Unpaired DNA during C. elegans Meiosis

    PubMed Central

    Maine, Eleanor M.; Hauth, Jessica; Ratliff, Thomas; Vought, Valarie E.; She, Xingyu; Kelly, William G.

    2014-01-01

    Summary During meiosis in C. elegans, unpaired chromosomes and chromosomal regions accumulate high levels of histone H3 lysine 9 dimethylation (H3K9me2), a modification associated with facultative heterochromatin assembly and the resulting transcriptional silencing [1, 2]. Meiotic silencing of unpaired DNA may be a widely conserved genome defense mechanism [3–5]. The mechanisms of meiotic silencing remain unclear, although both transcriptional and posttranscriptional processes are implicated [3–5]. Cellular RNA-dependent RNA polymerases (RdRPs) function in development and RNA-mediated silencing in many species [3, 6, 7] and in heterochromatin assembly in S. pombe [3, 8]. There are four C. elegans RdRPs, including two with known germline functions. EGO-1 is required for fertility and robust germline RNAi [9–11]. RRF-3 acts genetically to repress RNAi and is required for normal meiosis and spermatogenesis at elevated temperatures [12] (S. L’Hernault, personal communication). Among C. elegans RdRPs, we find that only EGO-1 is required for H3K9me2 enrichment on unpaired chromosomal regions during meiosis. This H3K9me2 enrichment does not require Dicer or Drosha nuclease or any of several other proteins required for RNAi. ego-1 interacts genetically with him-17, another regulator of chromatin and meiosis [13], to promote germ-line development. We conclude that EGO-1 is an essential component of meiotic silencing in C. elegans. PMID:16271877

  20. EGO-1, a putative RNA-dependent RNA polymerase, is required for heterochromatin assembly on unpaired dna during C. elegans meiosis.

    PubMed

    Maine, Eleanor M; Hauth, Jessica; Ratliff, Thomas; Vought, Valarie E; She, Xingyu; Kelly, William G

    2005-11-01

    During meiosis in C. elegans, unpaired chromosomes and chromosomal regions accumulate high levels of histone H3 lysine 9 dimethylation (H3K9me2), a modification associated with facultative heterochromatin assembly and the resulting transcriptional silencing. Meiotic silencing of unpaired DNA may be a widely conserved genome defense mechanism. The mechanisms of meiotic silencing remain unclear, although both transcriptional and posttranscriptional processes are implicated. Cellular RNA-dependent RNA polymerases (RdRPs) function in development and RNA-mediated silencing in many species and in heterochromatin assembly in S. pombe. There are four C. elegans RdRPs, including two with known germline functions. EGO-1 is required for fertility and robust germline RNAi. RRF-3 acts genetically to repress RNAi and is required for normal meiosis and spermatogenesis at elevated temperatures (S. L'Hernault, personal communication). Among C. elegans RdRPs, we find that only EGO-1 is required for H3K9me2 enrichment on unpaired chromosomal regions during meiosis. This H3K9me2 enrichment does not require Dicer or Drosha nuclease or any of several other proteins required for RNAi. ego-1 interacts genetically with him-17, another regulator of chromatin and meiosis, to promote germline development. We conclude that EGO-1 is an essential component of meiotic silencing in C. elegans. PMID:16271877

  1. Isolation of a novel RNA-dependent RNA polymerase 6 from Nicotiana glutinosa, NgRDR6, and analysis of its response to biotic and abiotic stresses.

    PubMed

    Yang, Haifang; Wang, Mian; Gao, Zheng; Zhu, Changxiang; Guo, Xingqi

    2011-02-01

    RNA-dependent RNA polymerases (RDRs) play an important role in RNA silencing, antiviral and developmental progress. Here, we firstly isolated the full-length cDNA, genomic DNA and 5'-flanking region of RDR6 from Nicotiana glutinosa (NgRDR6). Sequences analysis revealed that the cDNA of NgRDR6 was 3,921 bp in length, and the deduced protein consisted of 1,197 amino acids, containing all highly conserved sequence motifs that are present among all RDRs families. Moreover, two introns were detected in the genomic sequences. We also firstly investigated the expression profiles of plant RDR6 under the treatments of gibberellin A (GA), H(2)O(2,) methyl jasmonate (MeJA), Potato virus Y (PVY), Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Rhizoctonia Solani and Colletotrichum nicotianae. In addition, the expression patterns of RDR6 in Nicotiana glutinosa under the treatments of salicylic acid (SA) and abscisic acid (ABA) were also been analyzed. The results indicated that the NgRDR6 mRNA accumulation could be induced by ABA, GA, MeJA, CMV, Rhizoctonia Solani and Colletotrichum nicotianae. In contrast, the expression level of NgRDR6 exhibited no remarkable difference under the treatments of PVY, TMV, H(2)O(2) and SA. Further investigation suggested several potential cis-acting elements were found in the 5'-flanking sequence of NgRDR6, which might be responsible for the enhanced response to phytohormones. PMID:20495874

  2. Permutation of the active site of putative RNA-dependent RNA polymerase in a newly identified species of plant alpha-like virus.

    PubMed

    Sabanadzovic, Sead; Ghanem-Sabanadzovic, Nina Abou; Gorbalenya, Alexander E

    2009-11-10

    To direct the genome synthesis, RNA viruses without a DNA stage in the replication cycle use RNA-dependent RNA polymerase (RdRp). All RdRps have conserved right hand-like shape that includes characteristic A-->B-->C sequence motifs forming the active site. Recently, the structural permutation of the RdRp active site (C-->A-->B) has been described in few double-stranded RNA birnaviruses and a subset of positive-stranded RNA tetraviruses distantly related to Picorna-like viruses. Here we describe a permuted RdRp in the newly identified plant alpha-like virus with 6.5 kb-long polyadenylated genome, dubbed Grapevine virus Q (GVQ). The multi-domain layout and sequence similarities place GVQ into the genus Marafivirus of the family Tymoviridae. In contrast to other tymovirids, GVQ has 21 amino acid residues corresponding to the motif C relocated upstream of the motif A in the putative RdRp. This unique sequence characteristic was extensively verified and identified in several GVQ isolates infecting wild and cultivated Vitis and Rubus spp. PMID:19793602

  3. An updated evolutionary study of Flaviviridae NS3 helicase and NS5 RNA-dependent RNA polymerase reveals novel invariable motifs as potential pharmacological targets.

    PubMed

    Papageorgiou, Louis; Loukatou, Styliani; Sofia, Kossida; Maroulis, Dimitrios; Vlachakis, Dimitrios

    2016-06-21

    The rate of Flaviviridae family virus infections worldwide has increased dramatically in the last few years. In addition, infections caused by arthropod vector viruses including Hepatitis C, West Nile, Dengue fever, Yellow fever and Japanese encephalitis are emerging throughout the world. Based on a recent taxon update, the Flaviviridae family comprises four main genera; Flavivirus, Hepacivirus, Pestivirus and a recent genus Pegivirus. Although the new scientific classification plays a key role in providing useful information about the relationships between viruses, many new documented viruses remain unclassified. Furthermore, based on the different results of several studies the classification is unclear. In an effort to provide more insights into the classification of viruses, a holistic evolutionary study of the two viral enzymes NS3 helicase and NS5 RNA-dependent RNA polymerase (RdRp) has been conducted in this study. These two viral enzymes are very crucial for the inhibition of viruses due to the fact that they are involved in the survival, proliferation and transmission of viruses. The main goal of this study is the presentation of two novel updated phylogenetic trees of the enzymes NS3 helicase and NS5 RdRp as a reliable phylogeny "map" to correlate the information of the closely related viruses and identify new possible targets for the Flaviviridae family virus inhibition. Despite the earliest trials for drugs against Flaviviridae related viruses, no antiviral drug vaccine has been available to date. Therefore there is an urgent need for research towards the development of efficient antiviral agents. PMID:26864387

  4. Reconstitution of the RNA-dependent RNA polymerase activity of Antheraea mylitta cypovirus in vitro using separately expressed different functional domains of the enzyme.

    PubMed

    Kundu, Anirban; Roychowdhury, Amlan; Bose, Madhuparna; Das, Amit Kumar; Ghosh, Ananta K

    2016-07-01

    Antheraea mylitta cytoplasmic polyhedrosis virus is a segmented dsRNA virus of the family Reoviridae. Segment 2 (S2)-encoded RNA-dependent RNA polymerase (RdRp) helps the virus to propagate its genome in the host cell of the silkworm, Antheraea mylitta. Cloning, expression, purification and functional analysis of individual domains of RdRp have demonstrated that the purified domains interact in vitro. The central polymerase domain (PD) shows nucleotide binding properties, but neither the N-terminal domain (NTD) nor the C-terminal domain (CTD). Isolated PD does not exhibit RdRp activity but this activity can be reconstituted when all three domains are included in the reaction mixture. Molecular dynamics simulation suggests that the isolated PD has increased internal motions in comparison to when it is associated with the NTD and CTD. The motions of the separated PD may lead to the formation of a less accessible RNA template-binding channel and, thus, impair RdRp activity. PMID:27008451

  5. The Crystal Structure of the RNA-Dependent RNA Polymerase from Human Rhinovirus: A Dual Function Target for Common Cold Antiviral Therapy

    SciTech Connect

    Love, Robert A.; Maegley, Karen A.; Yu, Xiu; Ferre, RoseAnn; Lingardo, Laura K.; Diehl, Wade; Parge, Hans E.; Dragovich, Peter S.; Fuhrman, Shella A.

    2010-11-16

    Human rhinoviruses (HRV), the predominant members of the Picornaviridae family of positive-strand RNA viruses, are the major causative agents of the common cold. Given the lack of effective treatments for rhinoviral infections, virally encoded proteins have become attractive therapeutic targets. The HRV genome encodes an RNA-dependent RNA polymerase (RdRp) denoted 3D{sup pol}, which is responsible for replicating the viral genome and for synthesizing a protein primer used in the replication. Here the crystal structures for three viral serotypes (1B, 14, and 16) of HRV 3D{sup pol} have been determined. The three structures are very similar to one another, and to the closely related poliovirus (PV) 3D{sup pol} enzyme. Because the reported PV crystal structure shows significant disorder, HRV 3D{sup pol} provides the first complete view of a picornaviral RdRp. The folding topology of HRV 3D{sup pol} also resembles that of RdRps from hepatitis C virus (HCV) and rabbit hemorrhagic disease virus (RHDV) despite very low sequence homology.

  6. Increased expression of phosphorylated forms of RNA-dependent protein kinase and eukaryotic initiation factor 2alpha may signal skeletal muscle atrophy in weight-losing cancer patients.

    PubMed

    Eley, H L; Skipworth, R J E; Deans, D A C; Fearon, K C H; Tisdale, M J

    2008-01-29

    Previous studies suggest that the activation (autophosphorylation) of dsRNA-dependent protein kinase (PKR) can stimulate protein degradation, and depress protein synthesis in skeletal muscle through phosphorylation of the translation initiation factor 2 (eIF2) on the alpha-subunit. To understand whether these mediators are important in muscle wasting in cancer patients, levels of the phospho forms of PKR and eIF2alpha have been determined in rectus abdominus muscle of weight losing patients with oesophago-gastric cancer, in comparison with healthy controls. Levels of both phospho PKR and phospho eIF2alpha were significantly enhanced in muscle of cancer patients with weight loss irrespective of the amount and there was a linear relationship between phosphorylation of PKR and phosphorylation of eIF2alpha (correlation coefficient 0.76, P=0.005). This suggests that phosphorylation of PKR led to phosphorylation of eIF2alpha. Myosin levels decreased as the weight loss increased, and there was a linear relationship between myosin expression and the extent of phosphorylation of eIF2alpha (correlation coefficient 0.77, P=0.004). These results suggest that phosphorylation of PKR may be an important initiator of muscle wasting in cancer patients. PMID:18087277

  7. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  8. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.

    PubMed

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  9. Arabidopsis RNA-dependent RNA polymerases and dicer-like proteins in antiviral defense and small interfering RNA biogenesis during Turnip Mosaic Virus infection.

    PubMed

    Garcia-Ruiz, Hernan; Takeda, Atsushi; Chapman, Elisabeth J; Sullivan, Christopher M; Fahlgren, Noah; Brempelis, Katherine J; Carrington, James C

    2010-02-01

    Plants respond to virus infections by activation of RNA-based silencing, which limits infection at both the single-cell and system levels. Viruses encode RNA silencing suppressor proteins that interfere with this response. Wild-type Arabidopsis thaliana is immune to silencing suppressor (HC-Pro)-deficient Turnip mosaic virus, but immunity was lost in the absence of DICER-LIKE proteins DCL4 and DCL2. Systematic analysis of susceptibility and small RNA formation in Arabidopsis mutants lacking combinations of RNA-dependent RNA polymerase (RDR) and DCL proteins revealed that the vast majority of virus-derived small interfering RNAs (siRNAs) were dependent on DCL4 and RDR1, although full antiviral defense also required DCL2 and RDR6. Among the DCLs, DCL4 was sufficient for antiviral silencing in inoculated leaves, but DCL2 and DCL4 were both involved in silencing in systemic tissues (inflorescences). Basal levels of antiviral RNA silencing and siRNA biogenesis were detected in mutants lacking RDR1, RDR2, and RDR6, indicating an alternate route to form double-stranded RNA that does not depend on the three previously characterized RDR proteins. PMID:20190077

  10. Endogenous short RNAs generated by Dicer 2 and RNA-dependent RNA polymerase 1 regulate mRNAs in the basal fungus Mucor circinelloides.

    PubMed

    Nicolas, Francisco Esteban; Moxon, Simon; de Haro, Juan P; Calo, Silvia; Grigoriev, Igor V; Torres-Martínez, Santiago; Moulton, Vincent; Ruiz-Vázquez, Rosa M; Dalmay, Tamas

    2010-09-01

    Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi. PMID:20427422

  11. Coxsackievirus and Adenovirus Receptor (CAR) Mediates Trafficking of Acid-Sensing Ion Channel 3 (ASIC3) via PSD-95

    PubMed Central

    Excoffon, Katherine J.D.A.; Kolawole, Abimbola O.; Kusama, Nobuyoshi; Gansemer, Nicholas D.; Sharma, Priyanka; Hruska-Hageman, Alesia M.; Petroff, Elena; Benson, Christopher J.

    2012-01-01

    We have previously shown that the Coxsackievirus and adenovirus receptor (CAR) can interact with post-synaptic density 95 (PSD-95) and localize PSD-95 to cell-cell junctions. We have also shown that activity of the acid-sensing ion channel (ASIC3), a H+-gated cation channel that plays a role in mechanosensation and pain signaling, is negatively modulated by PSD-95 through a PDZ-based interaction. We asked whether CAR and ASIC3 simultaneously interact with PSD-95, and if so, whether co-expression of these proteins alters their cellular distribution and localization. Results indicate that CAR and ASIC3 co-immunoprecipitate only when co-expressed with PSD-95. CAR also brings both PSD-95 and ASIC3 to the junctions of heterologous cells. Moreover, CAR rescues PSD-95-mediated inhibition of ASIC3 currents. These data suggest that, in addition to activity as a viral receptor and adhesion molecule, CAR can play a role in trafficking proteins, including ion channels, in a PDZ-based scaffolding complex. PMID:22809504

  12. A major outbreak of conjunctivitis caused by coxsackievirus A24, Réunion, January to April 2015.

    PubMed

    Marguerite, Nadège; Brottet, Elise; Pagès, Frédéric; Jaffar-Bandjee, Marie Christine; Schuffenecker, Isabelle; Josset, Laurence; Vilain, Pascal; Filleul, Laurent

    2016-06-30

    From January to April 2015, Réunion experienced a major outbreak of acute haemorrhagic conjunctivitis (AHC) caused by coxsackievirus A24, which heavily impacted the healthcare system. According to the general practitioners' (GP) sentinel network, the number of medical consultations due to conjunctivitis during this period was estimated at ca 100,000. This report describes the characteristics of the outbreak, which were obtained through several different yet complementary surveillance systems on the island. These included the network of hospital emergency departments (OSCOUR network), the GPs' sentinel network, an Internet-based population cohort ('Koman i lé') participating in a survey on distinct symptoms including 'red eyes' and the monitoring of eye drop sales. Overall the results of the different surveillance approaches were in good agreement regarding the outbreak dynamic. A peak of patients with conjunctivitis was detected in the first 15 days of March (week 10 and 11), coinciding with increased eye drop sales on the island. Strains recovered from outbreak cases belonged to genotype IV and were most closely related to strains identified in AHC outbreaks in China, Egypt and Japan since 2010. Continued surveillance of AHC in Réunion remains important not only locally, but also because frequent exchanges between the island and mainland France may lead to introduction of this virus in Europe. PMID:27387200

  13. Complete Sequence Analysis and Antiviral Screening of Medicinal Plants for Human Coxsackievirus A16 Isolated in Korea

    PubMed Central

    Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong

    2015-01-01

    Objectives Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Methods Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Results Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Conclusion Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient. PMID:25737832

  14. Development of a Coxsackievirus A16 neutralization assay based on pseudoviruses for measurement of neutralizing antibody titer in human serum.

    PubMed

    Jin, Jun; Ma, Hongxia; Xu, Lin; An, Dong; Sun, Shiyang; Huang, Xueyong; Kong, Wei; Jiang, Chunlai

    2013-02-01

    Serum neutralizing antibody titers are indicative of protective immunity against Coxsackievirus A16 (CV-A16) and Enterovirus 71 (EV71), the two main etiological agents of hand, foot and mouth disease (HFMD), and provide the basis for evaluating vaccine efficacy. The current CV-A16 neutralization assay based on inhibition of cytopathic effects requires manual microscopic examination, which is time-consuming and labor-intensive. In this study, a high-throughput neutralization assay was developed by employing CV-A16 pseudoviruses expressing luciferase for detecting infectivity in rhabdomyosarcoma (RD) cells and measuring serum viral neutralizing antibodies. Without the need to use infectious CV-A16 strains, the neutralizing antibody titer against CV-A16 could be determined within 15h by measuring luciferase signals by this assay. The pseudovirus CV-A16 neutralization assay (pCNA) was validated by comparison with a conventional CV-A16 neutralization assay (cCNA) in testing 174 human serum samples collected from children (age <5 years). The neutralizing antibody titers determined by these two assays were well correlated (R(2)=0.7689). These results suggest that the pCNA can serve as a rapid and objective procedure for the measurement of neutralizing antibodies against CV-A16. PMID:23178532

  15. Construction and characterization of an infectious clone of coxsackievirus A6 that showed high virulence in neonatal mice.

    PubMed

    Yang, Lisheng; Li, Shuxuan; Liu, Yajing; Hou, Wangheng; Lin, Qiaona; Zhao, Huan; Xu, Longfa; He, Delei; Ye, Xiangzhong; Zhu, Hua; Cheng, Tong; Xia, Ningshao

    2015-12-01

    Atypical hand, foot, and mouth disease (aHFMD) outbreaks have been frequently reported worldwide in recent years. It is believed that coxsackievirus A6 (CA6) is the major pathogen for aHFMD. Studies regarding CA6 infection are limited and the genetic mechanism for the high pathogenicity of some new CA6 variants is still unclear. Infectious clones are powerful tools for studying the genetic mechanisms of RNA viruses. In this study, we describe the construction of a full-length cDNA clone of CA6 strain TW-2007-00141. The whole genome of CA6 was amplified in a single step and ligated into a plasmid vector through an efficient cloning method, Gibson assembly. The whole genome sequence of CA6 strain TW-2007-00141 was determined and phylogenetic analysis indicated that it shared a high degree of similarity (≥94%) with the CA6 strains found in Taiwan in 2009. The infectious clone of CA6 viruses were recovered by transfection into 293FT cells and showed similar biological properties to the parental virus. Viral particles were purified by CsCl isopycnic centrifugation, and two types of viral particles were observed under transmission electron microscopy. The rescued virus showed high virulence in one-day-old suckling mice. This clone may be useful for establishing animal models for the evaluation of CA6 vaccine efficiency in future. PMID:26272672

  16. Sialic Acid Is a Cellular Receptor for Coxsackievirus A24 Variant, an Emerging Virus with Pandemic Potential▿

    PubMed Central

    Nilsson, Emma C.; Jamshidi, Fariba; Johansson, Susanne M. C.; Oberste, M. Steven; Arnberg, Niklas

    2008-01-01

    Binding to target cell receptors is a critical step in the virus life cycle. Coxsackievirus A24 variant (CVA24v) has pandemic potential and is a major cause of acute hemorrhagic conjunctivitis, but its cellular receptor has hitherto been unknown. Here we show that CVA24v fails to bind to and infect CHO cells defective in sialic acid expression. Binding of CVA24v to and infection of corneal epithelial cells are efficiently inhibited by treating cells with a sialic acid-cleaving enzyme or sialic acid-binding lectins and by treatment of the virus with soluble, multivalent sialic acid. Protease treatment of cells efficiently inhibited virus binding, suggesting that the receptor is a sialylated glycoprotein. Like enterovirus type 70 and influenza A virus, CVA24v can cause pandemics. Remarkably, all three viruses use the same receptor. Since several unrelated viruses with tropism for the eye use this receptor, sialic acid-based antiviral drugs that prevent virus entry may be useful for topical treatment of such infections. PMID:18184708

  17. Potent antiviral agents fail to elicit genetically-stable resistance mutations in either enterovirus 71 or Coxsackievirus A16.

    PubMed

    Kelly, James T; De Colibus, Luigi; Elliott, Lauren; Fry, Elizabeth E; Stuart, David I; Rowlands, David J; Stonehouse, Nicola J

    2015-12-01

    Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are the two major causative agents of hand, foot and mouth disease (HFMD), for which there are currently no licenced treatments. Here, the acquisition of resistance towards two novel capsid-binding compounds, NLD and ALD, was studied and compared to the analogous compound GPP3. During serial passage, EV71 rapidly became resistant to each compound and mutations at residues I113 and V123 in VP1 were identified. A mutation at residue 113 was also identified in CVA16 after passage with GPP3. The mutations were associated with reduced thermostability and were rapidly lost in the absence of inhibitors. In silico modelling suggested that the mutations prevented the compounds from binding the VP1 pocket in the capsid. Although both viruses developed resistance to these potent pocket-binding compounds, the acquired mutations were associated with large fitness costs and reverted to WT phenotype and sequence rapidly in the absence of inhibitors. The most effective inhibitor, NLD, had a very large selectivity index, showing interesting pharmacological properties as a novel anti-EV71 agent. PMID:26522770

  18. The role of Coxsackievirus A16 in a case of sudden unexplained death in an infant - A SUDI case.

    PubMed

    Astrup, B S; Johnsen, I B G; Engsbro, A L

    2016-02-01

    The Coxsackievirus A16 (CV-A16) is one of the main pathogens causing hand-foot-and-mouth disease in young children. It is a low-virulence virus rarely involved in serious illness. It is seen sporadically or in outbreaks all over the world. We report a case of sudden unexplained death in infancy, SUDI, in a 3 and 1/2 months old infant, in which a thorough post mortem investigation pointed at a fatal infection with CV-A16 as the most likely cause of death. Only five cases of fatal CV-A16 infection have been published and none of these presented as sudden death. The fatal cases involved two infants, two young children and an elderly man. Post mortem, pre-autopsy CT-scan and C-reactive protein analysis allowed for an autopsy procedure targeted at a microbiological cause of death. The case illustrates the usefulness of supplementary testing during autopsy. PMID:26747753

  19. Antiviral effects of Phyllanthus urinaria containing corilagin against human enterovirus 71 and Coxsackievirus A16 in vitro.

    PubMed

    Yeo, Sang-Gu; Song, Jae Hyoung; Hong, Eun-Hye; Lee, Bo-Ra; Kwon, Yong Soo; Chang, Sun-Young; Kim, Seung Hyun; Lee, Sang Won; Park, Jae-Hak; Ko, Hyun-Jeong

    2015-02-01

    Human enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) are major causative agents of hand, foot, and mouth disease (HFMD) especially in infants and children under 5 years of age. Despite recent outbreaks of HFMD, there are no approved therapeutics against EV71 and CA16 infection. Moreover, in a small percentage of cases, the disease progression can lead to serious complications of the central nervous system. In this study, we investigated the antiviral effect of corilagin and Phyllanthus urinaria extract, which contains corilagin as a major component, on EV71 and CA16 infection in vitro. Our results indicate that corilagin reduces the cytotoxicity induced by EV71 or CA16 on Vero cells with and IC50 value of 5.6 and 32.33 μg/mL, respectively. We confirmed the presence of corilagin in EtOAc and BuOH fractions from P. urinaria extract and this correlated with antiviral activity of the fractions against EV71 or CA16. Future studies will be required to confirm the antiviral activity of corilagin and P. urinaria extract in vivo. Challenging a model with a lethal dose of viral infection will be required to test this. Collectively, our work provides potential candidates for the development of novel drugs to treat HFMD. PMID:24752860

  20. Hexon-modified recombinant E1-deleted adenoviral vectors as bivalent vaccine carriers for Coxsackievirus A16 and Enterovirus 71.

    PubMed

    Zhang, Chao; Yang, Yong; Chi, Yudan; Yin, Jieyun; Yan, Lijun; Ku, Zhiqiang; Liu, Qingwei; Huang, Zhong; Zhou, Dongming

    2015-09-22

    Hand, foot and mouth disease (HFMD) is a major public health concern in Asia; more efficient vaccines against HFMD are urgently required. Adenoviral (Ad) capsids have been used widely for the presentation of foreign antigens to induce specific immune responses in the host. Here, we describe a novel bivalent vaccine for HFMD based on the hexon-modified, E1-deleted chimpanzee adenovirus serotype 68 (AdC68). The novel vaccine candidate was generated by incorporating the neutralising epitope of Coxsackievirus A16 (CA16), PEP71, into hypervariable region 1 (HVR1), and a shortened neutralising epitope of Enterovirus 71 (EV71), sSP70, into HVR2 of the AdC68 hexon. In order to enhance the immunogenicity of EV71, VP1 of EV71 was cloned into the E1-region of the AdC68 vectors. The results demonstrated that these two epitopes were well presented on the virion surface and had high affinity towards specific antibodies, and VP1 of EV71 was also significantly expressed. In pre-clinical mouse models, the hexon-modified AdC68 elicited neutralising antibodies against both CA16 and EV71, which conferred protection to suckling mice against a lethal challenge of CA16 and EV71. In summary, this study demonstrates that the hexon-modified AdC68 may represent a promising bivalent vaccine carrier against EV71 and CA16 and an epitope-display platform for other pathogens. PMID:26296491

  1. Expression of an engineered soluble coxsackievirus and adenovirus receptor by a dimeric AAV9 vector inhibits adenovirus infection in mice.

    PubMed

    Röger, C; Pozzuto, T; Klopfleisch, R; Kurreck, J; Pinkert, S; Fechner, H

    2015-06-01

    Immunosuppressed (IS) patients, such as recipients of hematopoietic stem cell transplantation, occasionally develop severe and fatal adenovirus (Ad) infections. Here, we analyzed the potential of a virus receptor trap based on a soluble coxsackievirus and Ad receptor (sCAR) for inhibition of Ad infection. In vitro, a dimeric fusion protein, sCAR-Fc, consisting of the extracellular domain of CAR and the Fc portion of human IgG1 and a monomeric sCAR lacking the Fc domain, were expressed in cell culture. More sCAR was secreted into the cell culture supernatant than sCAR-Fc, but it had lower Ad neutralization activity than sCAR-Fc. Further investigations showed that sCAR-Fc reduced the Ad infection by a 100-fold and Ad-induced cytotoxicity by ~20-fold. Not only was Ad infection inhibited by sCAR-Fc applied prior to infection, it also inhibited infection when used to treat ongoing Ad infection. In vivo, sCAR-Fc was delivered to IS mice by an AAV9 vector, resulting in persistent and high (>40 μg ml(-1)) sCAR-Fc serum levels. The sCAR-Fc serum concentration was sufficient to significantly inhibit hepatic and cardiac wild-type Ad5 infection. Treatment with sCAR-Fc did not induce side effects. Thus, sCAR-Fc virus receptor trap may be a promising novel therapeutic for treatment of Ad infections. PMID:25786873

  2. Coxsackievirus and adenovirus receptor (CAR) mediates atrioventricular-node function and connexin 45 localization in the murine heart

    PubMed Central

    Lim, Byung-Kwan; Xiong, Dingding; Dorner, Andrea; Youn, Tae-Jin; Yung, Aaron; Liu, Taylor I.; Gu, Yusu; Dalton, Nancy D.; Wright, Adam T.; Evans, Sylvia M.; Chen, Ju; Peterson, Kirk L.; McCulloch, Andrew D.; Yajima, Toshitaka; Knowlton, Kirk U.

    2008-01-01

    The coxsackievirus and adenovirus receptor (CAR) is a transmembrane protein that belongs to the family of adhesion molecules. In the postnatal heart, it is localized predominantly at the intercalated disc, where its function is not known. Here, we demonstrate that a first degree or complete block of atrioventricular (AV) conduction developed in the absence of CAR in the adult mouse heart and that prolongation of AV conduction occurred in the embryonic heart of the global CAR-KO mouse. In the cardiac-specific CAR-KO (CAR-cKO) mouse, we observed the loss of connexin 45 localization to the cell-cell junctions of the AV node but preservation of connexin 40 and 43 in contracting myocardial cells and connexin 30.2 in the AV node. There was also a marked decrease in β-catenin and zonula occludens-1 (ZO-1) localization to the intercalated discs of CAR-cKO mouse hearts at 8 weeks before the mice developed cardiomyopathy at 21 weeks of age. We also found that CAR formed a complex with connexin 45 via its PSD-95/DigA/ZO-1–binding (PDZ-binding) motifs. We conclude that CAR expression is required for normal AV-node conduction and cardiac function. Furthermore, localization of connexin 45 at the AV-node cell-cell junction and of β-catenin and ZO-1 at the ventricular intercalated disc are dependent on CAR. PMID:18636119

  3. Differential cell autonomous responses determine the outcome of coxsackievirus infections in murine pancreatic α and β cells

    PubMed Central

    Marroqui, Laura; Lopes, Miguel; dos Santos, Reinaldo S; Grieco, Fabio A; Roivainen, Merja; Richardson, Sarah J; Morgan, Noel G; Op de beeck, Anne; Eizirik, Decio L

    2015-01-01

    Type 1 diabetes (T1D) is an autoimmune disease caused by loss of pancreatic β cells via apoptosis while neighboring α cells are preserved. Viral infections by coxsackieviruses (CVB) may contribute to trigger autoimmunity in T1D. Cellular permissiveness to viral infection is modulated by innate antiviral responses, which vary among different cell types. We presently describe that global gene expression is similar in cytokine-treated and virus-infected human islet cells, with up-regulation of gene networks involved in cell autonomous immune responses. Comparison between the responses of rat pancreatic α and β cells to infection by CVB5 and 4 indicate that α cells trigger a more efficient antiviral response than β cells, including higher basal and induced expression of STAT1-regulated genes, and are thus better able to clear viral infections than β cells. These differences may explain why pancreatic β cells, but not α cells, are targeted by an autoimmune response during T1D. DOI: http://dx.doi.org/10.7554/eLife.06990.001 PMID:26061776

  4. The long non-coding RNA expression profile of Coxsackievirus A16 infected RD cells identified by RNA-seq.

    PubMed

    Shi, Yingying; Tu, Huilin; Chen, Xiong; Zhang, Yingying; Chen, Liujun; Liu, Zhongchun; Sheng, Jiqun; Han, Song; Yin, Jun; Peng, Biwen; He, Xiaohua; Liu, Wanhong

    2016-04-01

    Coxsackievirus A16 (CVA16) is one of major pathogens of hand, foot and mouth disease (HFMD) in children. Long non-coding RNAs (IncRNAs) have been implicated in various biological processes, but they have not been associated with CVA16 infection. In this study, we comprehensively characterized the landscape of IncRNAs of normal and CVA16 infected rhabdomyosarcoma (RD) cells using RNA-Seq to investigate the functional relevance of IncRNAs. We showed that a total of 760 IncRNAs were upregulated and 1210 IncRNAs were downregulated. Out of these dysregulated IncRNAs, 43.64% were intergenic, 22.31% were sense, 15.89% were intronic, 8.67% were bidirectional, 5.59% were antisense, 3.85% were sRNA host IncRNAs and 0.05% were enhancer. Six dysregulated IncRNAs were validated by quantitative PCR assays and the secondary structures of these IncRNAs were projected. Moreover, we conducted a bioinformatics analysis of an IncRNAs (ENST00000602478) to elucidate the diversity of modification and functions of IncRNAs. In summary, the current study compared the dysregulated IncRNAs profile upon CVA16 challenge and illustrated the intricate relationship between coding and IncRNAs transcripts. These results may not only provide a complete picture of transcription in CVA16 infected cells but also provide novel molecular targets for treatments of HFMD. PMID:27060091

  5. Circulating HFMD-Associated Coxsackievirus A16 Is Genetically and Phenotypically Distinct from the Prototype CV-A16

    PubMed Central

    Li, Jingliang; Ren, Sangsang; Wei, Zhenhong; Bao, Wanguo; Hu, Xiaoming; Zhao, Ke; Zhang, Wenyan; Zhou, Yulai; Sun, Fei; Markham, Richard; Yu, Xiao-Fang

    2014-01-01

    Human enteroviruses (HEV) have been linked to hand, foot, and mouth disease (HFMD) in the Pacific and Southeast Asia for decades. Many cases of HFMD have been attributed to coxsackievirus A16 (CV-A16, CA16), based on only partial viral genome determination. Viral phenotypes are also poorly defined. Herein, we have genetically and phenotypically characterized multiple circulating CV-A16 viruses from HFMD patients and determined multiple full-length sequences of these circulating viruses. We discovered that the circulating CV-A16 viruses from HFMD patients are genetically distinct from the proto-type CV-A16 G10. We have also isolated circulating CV-A16 viruses from hospitalized HFMD patients and compared their virological differences. Interestingly, circulating CV-A16 viruses are more pathogenic in a neonatal mouse model than is CV-A16 G10. Thus, we have found circulating recombinant forms of CV-A16 (CRF CV-A16) that are related to, but different from, the prototype CV-A16 G10 that have distinct biological phenotypes. PMID:24736564

  6. The Epidemiological Study of Coxsackievirus A6 revealing Hand, Foot and Mouth Disease Epidemic patterns in Guangdong, China

    PubMed Central

    Zeng, Hanri; Lu, Jing; Zheng, Huanying; Yi, Lina; Guo, Xue; Liu, Leng; Rutherford, Shannon; Sun, Limei; Tan, Xiaohua; Li, Hui; Ke, Changwen; Lin, Jinyan

    2015-01-01

    Enterovirus A71 (EVA71) and Coxsackievirus A16 (CVA16) are regarded as the two major causative pathogens in hand, foot and mouth disease (HFMD) epidemics. However, CVA6, previously largely ignored, became the predominant pathogen in China in 2013. In this study, we describe the epidemiological trendsofCVA6 during the annual HFMD outbreaks from 2008 to 2013 in Guangdong, China. The study results show that CVA6 has been one of three major causative agents of HFMD epidemics since 2009. The periodic rotation and dominance of the three pathogens, EVA71, CVA16 and CVA6, may have contributed to the continuously increasing HFMD epidemics. Moreover, phylogenetic analysis of the VP1 gene shows that major circulating CVA6 strains collected from 2009 to 2013 are distinct from the earlier strains collected before 2009. In conclusion, the discovery from this research investigating epidemiological trends of CVA6 from 2008 to 2013 explains the possible pattern of the continuous HFMD epidemic in China. The etiological change pattern also highlights the need for improvement for pathogen surveillance and vaccine strategies for HFMD control in China. PMID:25993899

  7. Coxsackievirus A21 binds to decay-accelerating factor but requires intercellular adhesion molecule 1 for cell entry.

    PubMed Central

    Shafren, D R; Dorahy, D J; Ingham, R A; Burns, G F; Barry, R D

    1997-01-01

    It is becoming increasingly apparent that many viruses employ multiple receptor molecules in their cell entry mechanisms. The human enterovirus coxsackievirus A21 (CAV21) has been reported to bind to the N-terminal domain of intercellular adhesion molecule 1 (ICAM-1) and undergo limited replication in ICAM-1-expressing murine L cells. In this study, we show that in addition to binding to ICAM-1, CAV21 binds to the first short consensus repeat (SCR) of decay-accelerating factor (DAF). Dual antibody blockade using both anti-ICAM-1 (domain 1) and anti-DAF (SCR1) monoclonal antibodies (MAbs) is required to completely abolish binding and replication of high-titered CAV21. However, the binding of CAV21 to DAF, unlike that to ICAM-1, does not initiate a productive cell infection. The capacity of an anti-DAF (SCR3) MAb to block CAV21 infection but not binding, coupled with immunoprecipitation data from chemical cross-linking studies, indicates that DAF and ICAM-1 are closely associated on the cell surface. It is therefore suggested that DAF may function as a low-affinity attachment receptor either enhancing viral presentation or providing a viral sequestration site for subsequent high-affinity binding to ICAM-1. PMID:9151867

  8. Potent antiviral agents fail to elicit genetically-stable resistance mutations in either enterovirus 71 or Coxsackievirus A16

    PubMed Central

    Kelly, James T.; De Colibus, Luigi; Elliott, Lauren; Fry, Elizabeth E.; Stuart, David I.; Rowlands, David J.; Stonehouse, Nicola J.

    2015-01-01

    Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are the two major causative agents of hand, foot and mouth disease (HFMD), for which there are currently no licenced treatments. Here, the acquisition of resistance towards two novel capsid-binding compounds, NLD and ALD, was studied and compared to the analogous compound GPP3. During serial passage, EV71 rapidly became resistant to each compound and mutations at residues I113 and V123 in VP1 were identified. A mutation at residue 113 was also identified in CVA16 after passage with GPP3. The mutations were associated with reduced thermostability and were rapidly lost in the absence of inhibitors. In silico modelling suggested that the mutations prevented the compounds from binding the VP1 pocket in the capsid. Although both viruses developed resistance to these potent pocket-binding compounds, the acquired mutations were associated with large fitness costs and reverted to WT phenotype and sequence rapidly in the absence of inhibitors. The most effective inhibitor, NLD, had a very large selectivity index, showing interesting pharmacological properties as a novel anti-EV71 agent. PMID:26522770

  9. Identification of a nucleotide in 5' untranslated region contributing to virus replication and virulence of Coxsackievirus A16.

    PubMed

    Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

    2016-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5' untranslated region (5'UTR), have not been investigated until now. Here, a series of nucleotides present in 5'UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5'UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5'UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5'UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5'UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

  10. Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

    PubMed Central

    Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

    2016-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

  11. [Genetic Characteristics of Coxsackievirus Group A Type 4 Isolated from Patients with Acute Flaccid Paralysis in Shaanxi, China].

    PubMed

    Wang, Dongyan; Xu, Yi; Zhang, Yong; Zhu, Shuangli; Si, Yuan; Yan, Dongmei; Zhu, Hui; Yang, Qian; Ji, Tianjiao; Xu, Wenbo

    2016-03-01

    We analyzed the genetic characteristics of coxsackievirus A4 (CV-A4) based on the entire VP1 coding region. Samples were isolated from patients with acute flaccid paralysis (AFP) in Shaanxi, China from 2006 to 2010. We wished to ascertain the predominant genotype and the relationship between CV-A4 infection and AFP. Sixty-eight non-polio enteroviruses were inoculated onto RD cells (to increase the virus titer) and molecular typing was undertaken. The entire VP1 coding region was amplified. Percentage of CV-A4 was 10.3% (7/68). Analyses of genetic identify and creation of phylogenetic trees revealed that CV-A4 could be classified into A, B and C genotypes. Seven CV-A4 strains from Shaanxi and other CV-A4 strains from China formed an independent evolution lineage located in group 4 and belonged to the C2 sub-genotype. These data suggested that CV-A4 strains of sub-genotype C2 were the predominant genotypes in China. These strains co-evolved and co-circulated with those from other provinces in China, so continued monitoring of CV-A4 (by clinical and genetic surveillance) should be enhanced. PMID:27396156

  12. Structures and chemical bonding of B3O3-/0 and B3O3H-/0: A combined photoelectron spectroscopy and first-principles theory study

    NASA Astrophysics Data System (ADS)

    Zhao, Li-Juan; Tian, Wen-Juan; Ou, Ting; Xu, Hong-Guang; Feng, Gang; Xu, Xi-Ling; Zhai, Hua-Jin; Li, Si-Dian; Zheng, Wei-Jun

    2016-03-01

    We present a combined photoelectron spectroscopy and first-principles theory study on the structural and electronic properties and chemical bonding of B3O3-/0 and B3O3H-/0 clusters. The concerted experimental and theoretical data show that the global-minimum structures of B3O3 and B3O3H neutrals are very different from those of their anionic counterparts. The B3O3- anion is characterized to possess a V-shaped OB-B-BO chain with overall C2v symmetry (1A), in which the central B atom interacts with two equivalent boronyl (B≡O) terminals via B-B single bonds as well as with one O atom via a B=O double bond. The B3O3H- anion has a Cs (2A) structure, containing an asymmetric OB-B-OBO zig-zag chain and a terminal H atom interacting with the central B atom. In contrast, the C2v (1a) global minimum of B3O3 neutral contains a rhombic B2O2 ring with one B atom bonded to a BO terminal and that of neutral B3O3H (2a) is also of C2v symmetry, which is readily constructed from C2v (1a) by attaching a H atom to the opposite side of the BO group. The H atom in B3O3H-/0 (2A and 2a) prefers to interact terminally with a B atom, rather than with O. Chemical bonding analyses reveal a three-center four-electron (3c-4e) π hyperbond in the B3O3H- (2A) cluster and a four-center four-electron (4c-4e) π bond (that is, the so-called o-bond) in B3O3 (1a) and B3O3H (2a) neutral clusters.

  13. Structures and chemical bonding of B3O3 (-/0) and B3O3H(-/0): A combined photoelectron spectroscopy and first-principles theory study.

    PubMed

    Zhao, Li-Juan; Tian, Wen-Juan; Ou, Ting; Xu, Hong-Guang; Feng, Gang; Xu, Xi-Ling; Zhai, Hua-Jin; Li, Si-Dian; Zheng, Wei-Jun

    2016-03-28

    We present a combined photoelectron spectroscopy and first-principles theory study on the structural and electronic properties and chemical bonding of B3O3 (-/0) and B3O3H(-/0) clusters. The concerted experimental and theoretical data show that the global-minimum structures of B3O3 and B3O3H neutrals are very different from those of their anionic counterparts. The B3O3 (-) anion is characterized to possess a V-shaped OB-B-BO chain with overall C2 v symmetry (1A), in which the central B atom interacts with two equivalent boronyl (B≡O) terminals via B-B single bonds as well as with one O atom via a B=O double bond. The B3O3H(-) anion has a Cs (2A) structure, containing an asymmetric OB-B-OBO zig-zag chain and a terminal H atom interacting with the central B atom. In contrast, the C2 v (1a) global minimum of B3O3 neutral contains a rhombic B2O2 ring with one B atom bonded to a BO terminal and that of neutral B3O3H (2a) is also of C2 v symmetry, which is readily constructed from C2 v (1a) by attaching a H atom to the opposite side of the BO group. The H atom in B3O3H(-/0) (2A and 2a) prefers to interact terminally with a B atom, rather than with O. Chemical bonding analyses reveal a three-center four-electron (3c-4e) π hyperbond in the B3O3H(-) (2A) cluster and a four-center four-electron (4c-4e) π bond (that is, the so-called o-bond) in B3O3 (1a) and B3O3H (2a) neutral clusters. PMID:27036442

  14. Activation of Tomato Bushy Stunt Virus RNA-Dependent RNA Polymerase by Cellular Heat Shock Protein 70 Is Enhanced by Phospholipids In Vitro

    PubMed Central

    Pogany, Judit

    2015-01-01

    ABSTRACT Similar to other positive-strand RNA viruses, tombusviruses are replicated by the membrane-bound viral replicase complex (VRC). The VRC consists of the p92 virus-coded RNA-dependent RNA polymerase (RdRp), the viral p33 RNA chaperone, and several co-opted host proteins. In order to become a functional RdRp after its translation, the p92 replication protein should be incorporated into the VRC, followed by its activation. We have previously shown in a cell-free yeast extract-based assay that the activation of the Tomato bushy stunt virus (TBSV) RdRp requires a soluble host factor(s). In this article, we identify the cellular heat shock protein 70 (Hsp70) as the co-opted host factor required for the activation of an N-terminally truncated recombinant TBSV RdRp. In addition, small-molecule-based blocking of Hsp70 function inhibits RNA synthesis by the tombusvirus RdRp in vitro. Furthermore, we show that neutral phospholipids, namely, phosphatidylethanolamine (PE) and phosphatidylcholine (PC), enhance RdRp activation in vitro. In contrast, phosphatidylglycerol (PG) shows a strong and dominant inhibitory effect on in vitro RdRp activation. We also demonstrate that PE and PC stimulate RdRp-viral plus-strand RNA [(+)RNA] interaction, while PG inhibits the binding of the viral RNA to the RdRp. Based on the stimulatory versus inhibitory roles of various phospholipids in tombusvirus RdRp activation, we propose that the lipid composition of targeted subcellular membranes might be utilized by tombusviruses to regulate new VRC assembly during the course of infection. IMPORTANCE The virus-coded RNA-dependent RNA polymerase (RdRp), which is responsible for synthesizing the viral RNA progeny in infected cells of several positive-strand RNA viruses, is initially inactive. This strategy is likely to avoid viral RNA synthesis in the cytosol that would rapidly lead to induction of RNA-triggered cellular antiviral responses. During the assembly of the membrane-bound replicase

  15. RNA-dependent association with myosin IIA promotes F-actin-guided trafficking of the ELAV-like protein HuR to polysomes

    PubMed Central

    Doller, Anke; Schulz, Sebastian; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-01-01

    The role of the mRNA-binding protein human antigen R (HuR) in stabilization and translation of AU-rich elements (ARE) containing mRNAs is well established. However, the trafficking of HuR and bound mRNA cargo, which comprises a fundamental requirement for the aforementioned HuR functions is only poorly understood. By administering different cytoskeletal inhibitors, we found that the protein kinase Cδ (PKCδ)-triggered accumulation of cytoplasmic HuR by Angiotensin II (AngII) is an actin-myosin driven process functionally relevant for stabilization of ARE-bearing mRNAs. Furthermore, we show that the AngII-induced recruitment of HuR and its bound mRNA from ribonucleoprotein particles to free and cytoskeleton bound polysomes strongly depended on an intact actomyosin cytoskeleton. In addition, HuR allocation to free and cytoskeletal bound polysomes is highly sensitive toward RNase and PPtase and structurally depends on serine 318 (S318) located within the C-terminal RNA recognition motif (RRM3). Conversely, the trafficking of the phosphomimetic HuRS318D, mimicking HuR phosphorylation at S318 by the PKCδ remained PPtase resistant. Co-immunoprecipitation experiments with truncated HuR proteins revealed that the stimulus-induced association of HuR with myosin IIA is strictly RNA dependent and mediated via the RRM3. Our data implicate a microfilament dependent transport of HuR, which is relevant for stimulus-induced targeting of ARE-bearing mRNAs from translational inactive ribonucleoprotein particles to polysomes. PMID:23921630

  16. Control of translation and miRNA-dependent repression by a novel poly(A) binding protein, hnRNP-Q.

    PubMed

    Svitkin, Yuri V; Yanagiya, Akiko; Karetnikov, Alexey E; Alain, Tommy; Fabian, Marc R; Khoutorsky, Arkady; Perreault, Sandra; Topisirovic, Ivan; Sonenberg, Nahum

    2013-01-01

    Translation control often operates via remodeling of messenger ribonucleoprotein particles. The poly(A) binding protein (PABP) simultaneously interacts with the 3' poly(A) tail of the mRNA and the eukaryotic translation initiation factor 4G (eIF4G) to stimulate translation. PABP also promotes miRNA-dependent deadenylation and translational repression of target mRNAs. We demonstrate that isoform 2 of the mouse heterogeneous nuclear protein Q (hnRNP-Q2/SYNCRIP) binds poly(A) by default when PABP binding is inhibited. In addition, hnRNP-Q2 competes with PABP for binding to poly(A) in vitro. Depleting hnRNP-Q2 from translation extracts stimulates cap-dependent and IRES-mediated translation that is dependent on the PABP/poly(A) complex. Adding recombinant hnRNP-Q2 to the extracts inhibited translation in a poly(A) tail-dependent manner. The displacement of PABP from the poly(A) tail by hnRNP-Q2 impaired the association of eIF4E with the 5' m(7)G cap structure of mRNA, resulting in the inhibition of 48S and 80S ribosome initiation complex formation. In mouse fibroblasts, silencing of hnRNP-Q2 stimulated translation. In addition, hnRNP-Q2 impeded let-7a miRNA-mediated deadenylation and repression of target mRNAs, which require PABP. Thus, by competing with PABP, hnRNP-Q2 plays important roles in the regulation of global translation and miRNA-mediated repression of specific mRNAs. PMID:23700384

  17. Double-stranded RNA-dependent protein kinase is required for bone calcification in MC3T3-E1 cells in vitro.

    PubMed

    Yoshida, Kaya; Okamura, Hirohiko; Amorim, Bruna Rabelo; Ozaki, Akiko; Tanaka, Hiroaki; Morimoto, Hiroyuki; Haneji, Tatsuji

    2005-11-15

    In this study, we demonstrated that double-stranded RNA-dependent protein kinase (PKR) is required for the calcification of osteoblasts via the signal transducers and activators of transcription 1alpha (STAT1alpha) signaling in vitro. A dominant-negative mutant PKR cDNA, in which the amino acid lysine at 296 was replaced with arginine and which does not have catalytic activity, was transfected into mouse osteoblastic MC3T3-E1 cells; thereby, we established cells that stably expressed the PKR mutant gene (PKR-K/R). Phosphorylation of PKR was not stimulated by polyinosic-polycytidylic acid in the mutant cells. The PKR-K/R mutant cells exhibited up-regulated cell growth and had low alkaline phosphatase (ALP) activity. The PKR-K/R mutant cells were not able to form bone nodules in vitro. In the PKR-K/R mutant cells, runt-related gene 2 (Runx2)-mediated transcription decreased compared with the levels in the control cells. The expression of STAT1alpha protein increased and the protein was translocated to the nucleus in the PKR-K/R mutant cells. When the expression of STAT1alpha protein in PKR mutant cells was suppressed using RNAi, the activity of Runx2-mediated transcription recovered to the control level. Our results indicate that PKR is a stimulator of Runx2 transcription and is a negative modulator of STAT1alpha expression. Our findings also suggest that PKR plays important roles in the differentiation and calcification of osteoblasts by modulating STAT1alpha and/or Runx2 expression. PMID:16216244

  18. Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

    DOE PAGESBeta

    Jacewicz, Agata; Schwer, Beate; Smith, Paul; Shuman, Stewart

    2014-10-10

    Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) to themore » adenine nucleobase. The triphosphate moiety of AMPPNP•Mg2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less

  19. Thumb Site 2 Inhibitors of Hepatitis C Viral RNA-dependent RNA Polymerase Allosterically Block the Transition from Initiation to Elongation.

    PubMed

    Li, Jiawen; Johnson, Kenneth A

    2016-05-01

    Replication of the hepatitis C viral genome is catalyzed by the NS5B (nonstructural protein 5B) RNA-dependent RNA polymerase, which is a major target of antiviral drugs currently in the clinic. Prior studies established that initiation of RNA replication could be facilitated by starting with a dinucleotide (pGG). Here we establish conditions for efficient initiation from GTP to form the dinucleotide and subsequent intermediates leading to highly processive elongation, and we examined the effects of four classes of nonnucleoside inhibitors on each step of the reaction. We show that palm site inhibitors block initiation starting from GTP but not when starting from pGG. In addition we show that nonnucleoside inhibitors binding to thumb site-2 (NNI2) lead to the accumulation of abortive intermediates three-five nucleotides in length. Our kinetic analysis shows that NNI2 do not significantly block initiation or elongation of RNA synthesis; rather, they block the transition from initiation to elongation, which is thought to proceed with significant structural rearrangement of the enzyme-RNA complex including displacement of the β-loop from the active site. Direct measurement in single turnover kinetic studies show that pyrophosphate release is faster than the chemistry step, which appears to be rate-limiting during processive synthesis. These results reveal important new details to define the steps involved in initiation and elongation during viral RNA replication, establish the allosteric mechanisms by which NNI2 inhibitors act, and point the way to the design of more effective allosteric inhibitors that exploit this new information. PMID:26851276

  20. Plasma DCLK1 is a marker of hepatocellular carcinoma (HCC): Targeting DCLK1 prevents HCC tumor xenograft growth via a microRNA-dependent mechanism

    PubMed Central

    May, Randal; Qu, Dongfeng; Ali, Naushad; Fazili, Javid; Weygant, Nathaniel; Chandrakesan, Parthasarathy; Ding, Kai; Lightfoot, Stanley A.; Houchen, Courtney W.

    2015-01-01

    Tumor stem cell marker Doublecortin-like kinase1 (DCLK1) is upregulated in several solid tumors. The role of DCLK1 in hepatocellular carcinoma (HCC) is unclear. We immunostained tissues from human livers with HCC, cirrhosis controls (CC), and non-cirrhosis controls (NCC) for DCLK1. Western blot and ELISA analyses for DCLK1 were performed with stored plasma samples. We observed increased immunoreactive DCLK1 in epithelia and stroma in HCC and CCs compared with NCCs, and observed a marked increase in plasma DCLK1 from patients with HCC compared with CC and NCC. Analysis of the Cancer Genome Atlas’ HCC dataset revealed that DCLK1 is overexpressed in HCC tumors relative to adjacent normal tissues. High DCLK1-expressing cells had more epithelial-mesenchymal transition (EMT). Various tumor suppressor miRNAs were also downregulated in HCC tumors. We evaluated the effects of DCLK1 knockdown on Huh7.5-derived tumor xenograft growth. This was associated with growth arrest and a marked downregulation of cMYC, and EMT transcription factors ZEB1, ZEB2, SNAIL, and SLUG via let-7a and miR-200 miRNA-dependent mechanisms. Furthermore, upregulation of miR-143/145, a corresponding decrease in pluripotency factors OCT4, NANOG, KLF4, and LIN28, and a reduction of let-7a, miR-143/145, and miR-200-specific luciferase activity was observed. These findings suggest that the detection of elevated plasma DCLK1 may provide a cost-effective, less invasive tool for confirmation of clinical signs of cirrhosis, and a potential companion diagnostic marker for patients with cirrhosis and HCC. Our results support evaluating DCLK1 as a biomarker for detection and as a therapeutic target for eradicating HCC. PMID:26468984

  1. The Structure of the RNA-Dependent RNA Polymerase of a Permutotetravirus Suggests a Link between Primer-Dependent and Primer-Independent Polymerases.

    PubMed

    Ferrero, Diego S; Buxaderas, Mònica; Rodríguez, José F; Verdaguer, Núria

    2015-12-01

    Thosea asigna virus (TaV), an insect virus belonging to the Permutatetraviridae family, has a positive-sense single-stranded RNA (ssRNA) genome with two overlapping open reading frames, encoding for the replicase and capsid proteins. The particular TaV replicase includes a structurally unique RNA-dependent RNA polymerase (RdRP) with a sequence permutation in the palm sub-domain, where the active site is anchored. This non-canonical arrangement of the RdRP palm is also found in double-stranded RNA viruses of the Birnaviridae family. Both virus families also share a conserved VPg sequence motif at the polymerase N-terminus which in birnaviruses appears to be used to covalently link a fraction of the replicase molecules to the 5'-end of the genomic segments. Birnavirus VPgs are presumed to be used as primers for replication initiation. Here we have solved the crystal structure of the TaV RdRP, the first non-canonical RdRP of a ssRNA virus, in its apo- form and bound to different substrates. The enzyme arranges as a stable dimer maintained by mutual interactions between the active site cleft of one molecule and the flexible N-terminal tail of the symmetrically related RdRP. The latter, partially mimicking the RNA template backbone, is involved in regulating the polymerization activity. As expected from previous sequence-based bioinformatics predictions, the overall architecture of the TaV enzyme shows important resemblances with birnavirus polymerases. In addition, structural comparisons and biochemical analyses reveal unexpected similarities between the TaV RdRP and those of Flaviviruses. In particular, a long loop protruding from the thumb domain towards the central enzyme cavity appears to act as a platform for de novo initiation of RNA replication. Our findings strongly suggest an unexpected evolutionary relationship between the RdRPs encoded by these distant ssRNA virus groups. PMID:26625123

  2. Dominant CD4-dependent RNA-dependent RNA polymerase-specific T-cell responses in children acutely infected with human enterovirus 71 and healthy adult controls

    PubMed Central

    Dang, Shuangsuo; Gao, Ning; Li, Yaping; Li, Mei; Wang, Xiufang; Jia, Xiaoli; Zhai, Song; Zhang, Xin; Liu, Jingkun; Deng, Huiling; Dong, Tao

    2014-01-01

    Human enterovirus 71 (EV71) is one of the major causes of hand, foot and mouth disease (HFMD), which leads to significant mortality in infected children. A prophylactic vaccine is urgently needed. However, little is known about the protective T-cell immunity in individuals infected with the EV71 virus. In this study, we performed a comprehensive ex vivo interferon-γ ELISPOT analysis in 31 children infected with EV71 as well as in 40 healthy adult controls of the CD4+ and CD8+ T-cell responses to overlapping peptides spanning the VP1 structural protein and RNA-dependent RNA polymerase (RdRp) non-structural protein. EV71-specific CD4 T-cell responses were detected in most of the acute patients and were mostly CD4-dependent RdRp-specific responses. CD8-dependent VP1 and RdRp-specific responses were also detected in a small proportion of recently infected children. There was no significant association between the strength of the T-cell responses and disease severity observed during the acute EV71 infection phase. Interestingly, an RdRp-specific, but no VP1-specific, CD4-dependent T-cell response was detected in 30% of the adult controls, and no T-cell responses were detected in healthy children. In addition, 24 individual peptides containing potential T-cell epitope regions were identified. The data suggest that CD4-dependent RdRp-specific T-cell responses may play an important role in protective immunity, and the epitopes identified in this study should provide valuable information for future therapeutic and prophylactic vaccine design as well as basic research. PMID:24329688

  3. Development of robust in vitro RNA-dependent RNA polymerase assay as a possible platform for antiviral drug testing against dengue.

    PubMed

    Amraiz, Deeba; Zaidi, Najam-Us-Sahar Sadaf; Fatima, Munazza

    2016-10-01

    NS5 is the largest and most conserved protein among the four dengue virus (DENV) serotypes. It has been the target of interest for antiviral drug development due to its major role in replication. NS5 consists of two domains, the N-terminal methyltransferase domain and C-terminal catalytic RNA-dependent RNA polymerase (RdRp) domain. It is an unstable protein and is prone to inactivation upon prolonged incubation at room temperature, thus affecting the inhibitor screening assays. In the current study, we expressed and purified DENV RdRp alone in Esherichia coli (E. coli) cells. The N-terminally His-tagged construct of DENV RdRp was transformed into E. coli expression strain BL-21 (DE3) pLysS cells. Protein expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.4mM. The induced cultures were then grown for 20h at 18°C and cells were harvested by centrifugation at 6000xg for 15min at 4°C. The recombinant protein was purified using HisTrap affinity column (Ni-NTA) and then the sample was subjected to size exclusion chromatography, which successfully removed the degradation product obtained during the previous purification step. The in vitro polymerase activity of RdRp was successfully demonstrated using homopolymeric polycytidylic acid (poly(rC)) RNA template. This study describes the high level production of enzymatically active DENV RdRp protein which can be used to develop assays for testing large number of compounds in a high-throughput manner. RdRp has the de novo initiation activity and the in vitro polymerase assays for the protein provide a platform for highly robust and efficient antiviral compound screening systems. PMID:27542741

  4. Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

    SciTech Connect

    Jacewicz, Agata; Schwer, Beate; Smith, Paul; Shuman, Stewart

    2014-10-10

    Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) to the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.

  5. The Genome Sequence of Streptomyces lividans 66 Reveals a Novel tRNA-Dependent Peptide Biosynthetic System within a Metal-Related Genomic Island

    PubMed Central

    Cruz-Morales, Pablo; Vijgenboom, Erik; Iruegas-Bocardo, Fernanda; Girard, Geneviève; Yáñez-Guerra, Luis Alfonso; Ramos-Aboites, Hilda E.; Pernodet, Jean-Luc; Anné, Jozef; van Wezel, Gilles P.; Barona-Gómez, Francisco

    2013-01-01

    The complete genome sequence of the original isolate of the model actinomycete Streptomyces lividans 66, also referred to as 1326, was deciphered after a combination of next-generation sequencing platforms and a hybrid assembly pipeline. Comparative analysis of the genomes of S. lividans 66 and closely related strains, including S. coelicolor M145 and S. lividans TK24, was used to identify strain-specific genes. The genetic diversity identified included a large genomic island with a mosaic structure, present in S. lividans 66 but not in the strain TK24. Sequence analyses showed that this genomic island has an anomalous (G + C) content, suggesting recent acquisition and that it is rich in metal-related genes. Sequences previously linked to a mobile conjugative element, termed plasmid SLP3 and defined here as a 94 kb region, could also be identified within this locus. Transcriptional analysis of the response of S. lividans 66 to copper was used to corroborate a role of this large genomic island, including two SLP3-borne “cryptic” peptide biosynthetic gene clusters, in metal homeostasis. Notably, one of these predicted biosynthetic systems includes an unprecedented nonribosomal peptide synthetase—tRNA-dependent transferase biosynthetic hybrid organization. This observation implies the recruitment of members of the leucyl/phenylalanyl-tRNA-protein transferase family to catalyze peptide bond formation within the biosynthesis of natural products. Thus, the genome sequence of S. lividans 66 not only explains long-standing genetic and phenotypic differences but also opens the door for further in-depth comparative genomic analyses of model Streptomyces strains, as well as for the discovery of novel natural products following genome-mining approaches. PMID:23709624

  6. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    SciTech Connect

    Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C

    2010-11-29

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitate the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected

  7. Activation of macrophages by an exopolysaccharide isolated from Antarctic Psychrobacter sp. B-3

    NASA Astrophysics Data System (ADS)

    Yu, Leiye; Sun, Guojie; Wei, Jingfang; Wang, Yingze; Du, Chao; Li, Jiang

    2016-09-01

    An exopolysaccharide (EPS) was isolated and purified from an Antarctic psychrophilic bacterium B-3, identified as Psychrobacter sp., and the activation of RAW264.7 cells by B-3 EPS was investigated. The results show that B-3 EPS, over a certain concentration range, promoted cell viability, nitric oxide production, tumor necrosis factor (TNF)α secretion, and phagocytic ability. Furthermore, TAK-242, an inhibitor of the toll-like receptor 4 (TLR4) significantly reduced nitric oxide production by these cells after stimulation with B-3 EPS. Moreover, B-3 EPS induced p65 phosphorylation and IκBα degradation in these cells. In conclusion, B-3 EPS might have activated RAW264.7 cells by combining with TLR4 on cell surface and triggering activation of NF-κB signaling pathways, implying that this EPS could activate macrophages and regulate initial immune response.

  8. Activation of macrophages by an exopolysaccharide isolated from Antarctic Psychrobacter sp. B-3

    NASA Astrophysics Data System (ADS)

    Yu, Leiye; Sun, Guojie; Wei, Jingfang; Wang, Yingze; Du, Chao; Li, Jiang

    2016-01-01

    An exopolysaccharide (EPS) was isolated and purified from an Antarctic psychrophilic bacterium B-3, identified as Psychrobacter sp., and the activation of RAW264.7 cells by B-3 EPS was investigated. The results show that B-3 EPS, over a certain concentration range, promoted cell viability, nitric oxide production, tumor necrosis factor (TNF)α secretion, and phagocytic ability. Furthermore, TAK-242, an inhibitor of the toll-like receptor 4 (TLR4) significantly reduced nitric oxide production by these cells after stimulation with B-3 EPS. Moreover, B-3 EPS induced p65 phosphorylation and IκBα degradation in these cells. In conclusion, B-3 EPS might have activated RAW264.7 cells by combining with TLR4 on cell surface and triggering activation of NF-κB signaling pathways, implying that this EPS could activate macrophages and regulate initial immune response.

  9. 26 CFR 1.167(b)-3 - Sum of the years-digits method.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Sum of the years-digits method. 1.167(b)-3 Section 1.167(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(b)-3 Sum of the years-digits method....

  10. 26 CFR 1.167(b)-3 - Sum of the years-digits method.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Sum of the years-digits method. 1.167(b)-3 Section 1.167(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Itemized Deductions for Individuals and Corporations § 1.167(b)-3 Sum of the years-digits method....

  11. Notes from the field: severe hand, foot, and mouth disease associated with coxsackievirus A6 - Alabama, Connecticut, California, and Nevada, November 2011-February 2012.

    PubMed

    2012-03-30

    Hand, foot, and mouth disease (HFMD) is a common viral illness caused by enteroviruses that predominantly affects children aged <5 years. In the United States, outbreaks of HFMD typically occur during summer and autumn months. The most common cause of HFMD in the United States has been enterovirus serotype coxsackievirus A16. Most infections are asymptomatic; persons with signs and symptoms typically have a mild febrile illness with rash on the palms of the hands and soles of the feet, and sores in the mouth. HFMD also has been associated, often weeks after initial symptom onset, with nail dystrophies (e.g., Beau's lines or nail shedding). PMID:22456122

  12. erbB3 Is an Active Tyrosine Kinase Capable of Homo- and Heterointeractions

    PubMed Central

    Steinkamp, Mara P.; Low-Nam, Shalini T.; Yang, Shujie; Lidke, Keith A.; Lidke, Diane S.

    2014-01-01

    Often considered to be a “dead” kinase, erbB3 is implicated in escape from erbB-targeted cancer therapies. Here, heregulin stimulation is shown to markedly upregulate kinase activity in erbB3 immunoprecipitates. Intact, activated erbB3 phosphorylates tyrosine sites in an exogenous peptide substrate, and this activity is abolished by mutagenesis of lysine 723 in the catalytic domain. Enhanced erbB3 kinase activity is linked to heterointeractions with catalytically active erbB2, since it is largely blocked in cells pretreated with lapatinib or pertuzumab. erbB2 activation of erbB3 is not dependent on equal surface levels of these receptors, since it occurs even in erbB3-transfected CHO cells with disproportionally small amounts of erbB2. We tested a model in which transient erbB3/erbB2 heterointeractions set the stage for erbB3 homodimers to be signaling competent. erbB3 homo- and heterodimerization events were captured in real time on live cells using single-particle tracking of quantum dot probes bound to ligand or hemagglutinin tags on recombinant receptors. PMID:24379439

  13. Probing the binding of procyanidin B3 to human serum albumin by isothermal titration calorimetry

    NASA Astrophysics Data System (ADS)

    Li, Xiangrong; Yan, Yunhui

    2015-02-01

    Proanthocyanidins are a mixture of monomers, oligomers, and polymers of flavan-3-ols that are widely distributed in the plant kingdom. One of the most widely studied proanthocyanidins is procyanidin B3. In this study, the interaction between procyanidin B3 and human serum albumin (HSA) was investigated using isothermal titration calorimetry (ITC). Thermodynamic investigations reveal that the hydrogen bond and van der Waals force are the major binding forces in the binding of procyanidin B3 to HSA. The binding of procyanidin B3 to HSA is driven by favorable enthalpy and unfavorable entropy. The obtained binding constant for procyanidin B3 with HSA is in the intermediate range and the equilibrium fraction of unbound procyanidin B3 fu > 90% at the physiological concentration of HSA shows that procyanidin B3 can be stored and transported from the circulatory system to reach its target site. The stoichiometric binding number n approximately equals to 1, suggesting that one molecule of procyanidin B3 combines with one molecule of HSA and no more procyanidin B3 binding to HSA occurs at the concentration used in this study.

  14. Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent RNA polymerase gene sequences.

    PubMed

    Drexler, Jan Felix; Gloza-Rausch, Florian; Glende, Jörg; Corman, Victor Max; Muth, Doreen; Goettsche, Matthias; Seebens, Antje; Niedrig, Matthias; Pfefferle, Susanne; Yordanov, Stoian; Zhelyazkov, Lyubomir; Hermanns, Uwe; Vallo, Peter; Lukashev, Alexander; Müller, Marcel Alexander; Deng, Hongkui; Herrler, Georg; Drosten, Christian

    2010-11-01

    Bats may host emerging viruses, including coronaviruses (CoV). We conducted an evaluation of CoV in rhinolophid and vespertilionid bat species common in Europe. Rhinolophids carried severe acute respiratory syndrome (SARS)-related CoV at high frequencies and concentrations (26% of animals are positive; up to 2.4×10(8) copies per gram of feces), as well as two Alphacoronavirus clades, one novel and one related to the HKU2 clade. All three clades present in Miniopterus bats in China (HKU7, HKU8, and 1A related) were also present in European Miniopterus bats. An additional novel Alphacoronavirus clade (bat CoV [BtCoV]/BNM98-30) was detected in Nyctalus leisleri. A CoV grouping criterion was developed by comparing amino acid identities across an 816-bp fragment of the RNA-dependent RNA polymerases (RdRp) of all accepted mammalian CoV species (RdRp-based grouping units [RGU]). Criteria for defining separate RGU in mammalian CoV were a >4.8% amino acid distance for alphacoronaviruses and a >6.3% distance for betacoronaviruses. All the above-mentioned novel clades represented independent RGU. Strict associations between CoV RGU and host bat genera were confirmed for six independent RGU represented simultaneously in China and Europe. A SARS-related virus (BtCoV/BM48-31/Bulgaria/2008) from a Rhinolophus blasii (Rhi bla) bat was fully sequenced. It is predicted that proteins 3b and 6 were highly divergent from those proteins in all known SARS-related CoV. Open reading frame 8 (ORF8) was surprisingly absent. Surface expression of spike and staining with sera of SARS survivors suggested low antigenic overlap with SARS CoV. However, the receptor binding domain of SARS CoV showed higher similarity with that of BtCoV/BM48-31/Bulgaria/2008 than with that of any Chinese bat-borne CoV. Critical spike domains 472 and 487 were identical and similar, respectively. This study underlines the importance of assessments of the zoonotic potential of widely distributed bat-borne CoV. PMID

  15. Characterizing the Roles of Cryphonectria parasitica RNA-Dependent RNA Polymerase-Like Genes in Antiviral Defense, Viral Recombination and Transposon Transcript Accumulation

    PubMed Central

    Zhang, Dong-Xiu; Spiering, Martin J.; Nuss, Donald L.

    2014-01-01

    An inducible RNA-silencing pathway, involving a single Dicer protein, DCL2, and a single Argonaute protein, AGL2, was recently shown to serve as an effective antiviral defense response in the chestnut blight fungus Cryphonectria parasitica. Eukaryotic RNA-dependent RNA polymerases (RdRPs) are frequently involved in transcriptional and posttranscriptional gene silencing and antiviral defense. We report here the identification and characterization of four RdRP genes (rdr1–4) in the C. parasitica genome. Sequence relationships with other eukaryotic RdRPs indicated that RDR1 and RDR2 were closely related to QDE-1, an RdRP involved in RNA silencing (“quelling”) in Neurospora crassa, whereas RDR3 was more closely related to the meiotic silencing gene SAD-1 in N. crassa. The RdRP domain of RDR4, related to N. crassa RRP-3 of unknown function, was truncated and showed evidence of alternative splicing. Similar to reports for dcl2 and agl2, the expression levels for rdr3 and rdr4 increased after hypovirus CHV-1/EP713 infection, while expression levels of rdr1 and rdr2 were unchanged. The virus-responsive induction patterns for rdr3 and rdr4 were altered in the Δdcl2 and Δagl2 strains, suggesting some level of interaction between rdr3 and rdr4 and the dcl2/agl2 silencing pathway. Single rdr gene knockouts Δrdr1–4, double knockouts Δrdr1/2, Δrdr2/3, Δrdr1/3, and a triple knockout, Δrdr1/2/3, were generated and evaluated for effects on fungal phenotype, the antiviral defense response, viral RNA recombination activity and transposon expression. None of the single or multiple rdr knockout strains displayed any phenotypic differences from the parental strains with or without viral infection or any significant changes in viral RNA accumulation or recombination activity or transposon RNA accumulation, indicating no detectable contribution by the C. parasitica rdr genes to these processes. PMID:25268858

  16. Polycistronic Expression of the Influenza A Virus RNA-Dependent RNA Polymerase by Using the Thosea asigna Virus 2A-Like Self-Processing Sequence

    PubMed Central

    Momose, Fumitaka; Morikawa, Yuko

    2016-01-01

    The RNA-dependent RNA polymerase (RdRp) of influenza A virus consists of three subunits, PB2, PB1, and PA, and catalyses both viral RNA genome replication and transcription. Cotransfection of four monocistronic expression vectors for these subunits and nucleoprotein with an expression vector for viral RNA reconstitutes functional viral ribonucleoprotein complex (vRNP). However, the specific activity of reconstituted RdRp is usually very low since the expression level and the ratio of the three subunits by transfection are uncontrollable at single-cell levels. For efficient reconstitution of RdRp and vRNP, their levels need to be at least comparable. We constructed polycistronic expression vectors in which the coding sequences of the three subunits were joined with the 2A-like self-processing sequence of Thosea asigna virus (TaV2A) in various orders. The level of PB1 protein, even when it was placed at the most downstream, was comparable with that expressed from the monocistronic PB1 vector. In contrast, the levels of PB2 and PA were very low, the latter of which was most likely due to proteasomal degradation caused by the TaV2A-derived sequences attached to the amino- and/or carboxyl-terminal ends in this expression system. Interestingly, two of the constructs, in which the PB1 coding sequence was placed at the most upstream, showed much higher reporter activity in a luciferase-based mini-genome assay than that observed by cotransfection of the monocistronic vectors. When the coding sequence of selective antibiotic marker was further placed at the most downstream of the PB1-PA-PB2 open reading frame, stable cells expressing RdRp were easily established, indicating that acquisition of antibiotic resistance assured the expression of upstream RdRp. The addition of an affinity tag to the carboxyl-terminal end of PB2 allowed us to isolate reconstituted vRNP. Taken together, the polycistronic expression system for influenza virus RdRp may be available for functional and

  17. The Structure of the RNA-Dependent RNA Polymerase of a Permutotetravirus Suggests a Link between Primer-Dependent and Primer-Independent Polymerases

    PubMed Central

    Ferrero, Diego S.; Buxaderas, Mònica; Rodríguez, José F.; Verdaguer, Núria

    2015-01-01

    Thosea asigna virus (TaV), an insect virus belonging to the Permutatetraviridae family, has a positive-sense single-stranded RNA (ssRNA) genome with two overlapping open reading frames, encoding for the replicase and capsid proteins. The particular TaV replicase includes a structurally unique RNA-dependent RNA polymerase (RdRP) with a sequence permutation in the palm sub-domain, where the active site is anchored. This non-canonical arrangement of the RdRP palm is also found in double-stranded RNA viruses of the Birnaviridae family. Both virus families also share a conserved VPg sequence motif at the polymerase N-terminus which in birnaviruses appears to be used to covalently link a fraction of the replicase molecules to the 5’-end of the genomic segments. Birnavirus VPgs are presumed to be used as primers for replication initiation. Here we have solved the crystal structure of the TaV RdRP, the first non-canonical RdRP of a ssRNA virus, in its apo- form and bound to different substrates. The enzyme arranges as a stable dimer maintained by mutual interactions between the active site cleft of one molecule and the flexible N-terminal tail of the symmetrically related RdRP. The latter, partially mimicking the RNA template backbone, is involved in regulating the polymerization activity. As expected from previous sequence-based bioinformatics predictions, the overall architecture of the TaV enzyme shows important resemblances with birnavirus polymerases. In addition, structural comparisons and biochemical analyses reveal unexpected similarities between the TaV RdRP and those of Flaviviruses. In particular, a long loop protruding from the thumb domain towards the central enzyme cavity appears to act as a platform for de novo initiation of RNA replication. Our findings strongly suggest an unexpected evolutionary relationship between the RdRPs encoded by these distant ssRNA virus groups. PMID:26625123

  18. Characterizing the roles of Cryphonectria parasitica RNA-dependent RNA polymerase-like genes in antiviral defense, viral recombination and transposon transcript accumulation.

    PubMed

    Zhang, Dong-Xiu; Spiering, Martin J; Nuss, Donald L

    2014-01-01

    An inducible RNA-silencing pathway, involving a single Dicer protein, DCL2, and a single Argonaute protein, AGL2, was recently shown to serve as an effective antiviral defense response in the chestnut blight fungus Cryphonectria parasitica. Eukaryotic RNA-dependent RNA polymerases (RdRPs) are frequently involved in transcriptional and posttranscriptional gene silencing and antiviral defense. We report here the identification and characterization of four RdRP genes (rdr1-4) in the C. parasitica genome. Sequence relationships with other eukaryotic RdRPs indicated that RDR1 and RDR2 were closely related to QDE-1, an RdRP involved in RNA silencing ("quelling") in Neurospora crassa, whereas RDR3 was more closely related to the meiotic silencing gene SAD-1 in N. crassa. The RdRP domain of RDR4, related to N. crassa RRP-3 of unknown function, was truncated and showed evidence of alternative splicing. Similar to reports for dcl2 and agl2, the expression levels for rdr3 and rdr4 increased after hypovirus CHV-1/EP713 infection, while expression levels of rdr1 and rdr2 were unchanged. The virus-responsive induction patterns for rdr3 and rdr4 were altered in the Δdcl2 and Δagl2 strains, suggesting some level of interaction between rdr3 and rdr4 and the dcl2/agl2 silencing pathway. Single rdr gene knockouts Δrdr1-4, double knockouts Δrdr1/2, Δrdr2/3, Δrdr1/3, and a triple knockout, Δrdr1/2/3, were generated and evaluated for effects on fungal phenotype, the antiviral defense response, viral RNA recombination activity and transposon expression. None of the single or multiple rdr knockout strains displayed any phenotypic differences from the parental strains with or without viral infection or any significant changes in viral RNA accumulation or recombination activity or transposon RNA accumulation, indicating no detectable contribution by the C. parasitica rdr genes to these processes. PMID:25268858

  19. Molecular epidemiology of coxsackievirus A6 associated with outbreaks of hand, foot, and mouth disease in Tianjin, China, in 2013

    PubMed Central

    Tan, Xiaojuan; Li, Li; Zhang, Baomin; Jorba, Jaume; Su, Xu; Ji, Tianjiao; Yang, Dongjing; Lv, Likun; Li, Jiameng

    2015-01-01

    Since 2008, Mainland China has undergone widespread outbreaks of hand, foot, and mouth disease (HFMD). In order to determine the characteristics of epidemics and enteroviruses (EV) associated with HFMD in Tianjin, in northern China, epidemiological and virological data from routine surveillance were collected and analyzed. In Tianjin, a persistent epidemic of HFMD was demonstrated during 2008–2013, involving 102,705 mild, 179 severe, and 16 fatal cases. Overall, 8234 specimens were collected from 7829 HFMD patients for EV detection during 2008–2013. Enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) were the dominant serotypes during 2008–2012, and they were replaced by CV-A6 as the major causative agent in 2013. Phylogenetic analysis based on complete VP1 nucleotide sequences revealed that multiple CV-A6 lineages co-circulated in Tianjin, which grouped together with strains from China and other countries and split into two distinct clusters (clusters 1 and 2). Most Tianjin strains grouped in cluster 1 and were closely related to strains from several eastern and southern provinces of China during 2012 and 2013. Estimates from Bayesian MCMC analysis suggested that multiple lineages had been transmitted silently before the outbreaks at an estimated evolutionary rate of 4.10 × 10−3 substitutions per site per year without a specific distribution of rate variances among lineages. The sudden outbreak of CV-A6 in Tianjin during 2013 is attributed to indigenous CV-A6 lineages, which were linked to the wide spread of endemic strains around eastern and southern China. PMID:25680566

  20. Development and evaluation of a real-time method for testing human enteroviruses and coxsackievirus A16.

    PubMed

    Chen, Qian; Hu, Zheng; Zhang, Qihua; Yu, Minghui

    2016-05-01

    Hand, foot, and mouth disease (HFMD) is a common infectious disease caused by a group of the human enteroviruses (HEV), including coxsackievirus A16 (CA16) and enterovirus 71 (EV71). In recent years, another HEV-A serotype, CA6 or CA10, has emerged to be one of the major etiologic agents that can induce HFMD worldwide. The objective of this study is to develop specific, sensitive, and rapid methods to help diagnose HEV and CA16 specifically by using simultaneous amplification testing (SAT) based on isothermal amplification of RNA and real-time detection of fluorescence technique, which were named as SAT-HEV and SAT-CA16, respectively (SAT-HEV/SAT-CA16). The specificity and sensitivity of SAT were tested here. SAT-HEV/SAT-CA16 could measure viral titers that were at least 10-fold lower than those measured by real-time PCR. Non-false cross-reactive amplification indicated that SAT-HEV/SAT-CA16 were highly specific with the addition of internal control (IC) RNA (5000 copies/reaction). A total of 198 clinical specimens were assayed by SAT comparing with real-time PCR. The statistically robust assessment of SAT-HEV and HEV-specific real-time PCR plus sequencing reached 99.0% (196/198), with a kappa value of 0.97, and 99.5% (197/198) and a kappa value of 0.99 for CA16, respectively. Additionally, IC prevented false-negative readings and assured the SAT-HEV/SAT-CA16 method's accuracy. Overall, SAT-HEV/SAT-CA16 method may serve as a platform for the simple and rapid detection of HEV/CA16 in time of HFMD outbreak. PMID:26971632

  1. Virological and epidemiological analysis of coxsackievirus A24 variant epidemic of acute hemorrhagic conjunctivitis in Okinawa, Japan, in 2011

    PubMed Central

    Harada, Kazuhiro; Fujimoto, Tsuguto; Asato, Yoshimori; Uchio, Eiichi

    2015-01-01

    Background Acute hemorrhagic conjunctivitis (AHC) is a highly contagious enterovirus infection of the conjunctiva and cornea. Coxsackievirus A24 variant (CA24v) is one of its etiological agents. We report a clinical, epidemiological, and virological analysis of a large epidemic of AHC that occurred from May to September, 2011, in Okinawa, Japan. Methods Clinical and epidemic aspects were evaluated for 435 AHC patients (348 bilateral and 87 unilateral, 783 eyes). Virological studies were carried out on nine isolates from ten patients. Virus isolation and direct detection of the enterovirus genome by the reverse transcription polymerase chain reaction method and complete nucleotide sequencing of the VP1 gene and phylogeny-based classification using the VP4 sequences were carried out. Results The 11–15-year age group comprised the highest (62.0%) proportion of cases among all age groups. Conjunctival hyperemia was present in all patients, and subconjunctival hemorrhage, superficial punctate keratitis, and preauricular lymphadenopathy were present in 25.4%, 10.3%, and 7.8% of eyes, respectively. CA24v was isolated from the epidemic strain, and phylogenetic analysis based on a fragment of the VP1 gene showed 96%–97% identity between the current strain and the recent China/GD01/2010 strain. Conclusion These findings demonstrate that the clinical and epidemiological features of AHC observed in this study were similar to those of the past epidemic in the same region. It should be noted that sequential outbreaks of AHC due to CA24v might occur in the same location after a considerable period of time, and public health precautions are necessary to control this explosive epidemic. PMID:26109843

  2. The PDZ3 domain of the cellular scaffolding protein MAGI-1 interacts with the Coxsackievirus and adenovirus receptor (CAR)

    PubMed Central

    Yan, Ran; Sharma, Priyanka; Kolawole, Abimbola O.; Martin, Sterling C. T.; Readler, James M.; Kotha, Poornima L.N.; Hostetler, Heather A.; Excoffon, Katherine J.D.A.

    2015-01-01

    The Coxsackievirus and adenovirus receptor (CAR) is an essential cellular protein that is involved in cell-cell adhesion, protein trafficking, and viral infection. The major isoform of CAR is selectively sorted to the basolateral membrane of polarized epithelial cells where it co-localizes with the cellular scaffolding protein membrane-associated guanylate kinase with inverted domain structure-1 (MAGI-1). Previously, we demonstrated CAR interacts with MAGI-1 through a PDZ–domain dependent interaction. Here, we show that the PDZ3 domain of MAGI-1 is exclusively responsible for the high affinity interaction between the seven exon isoform of CAR and MAGI-1 using yeast-two-hybrid analysis and confirming this interaction biochemically and in cellular lysates by in vitro pull down assay and co-immunoprecipitation. The high affinity interaction between the PDZ3 domain and CAR C-terminus was measured by fluorescence resonance energy transfer. Further, we investigated the biological relevance of this high affinity interaction between CAR and the PDZ3 domain of MAGI-1 and found that it does not alter CAR-mediated adenovirus infection. By contrast, interruption of this high affinity interaction altered the localization of MAGI-1 indicating that CAR is able to traffic MAGI-1 to cell junctions. These data deepen the molecular understanding of the interaction between CAR and MAGI-1 and indicate that although CAR plays a role in trafficking PDZ-based scaffolding proteins to cellular junctions, association with a high affinity intracellular binding partner does not significantly alter adenovirus binding and entry via CAR. PMID:25622559

  3. The compatibility of inactivated-Enterovirus 71 vaccination with Coxsackievirus A16 and Poliovirus immunizations in humans and animals

    PubMed Central

    Mao, Qunying; Wang, Yiping; Shao, Jie; Ying, Zhifang; Gao, Fan; Yao, Xin; Li, Changgui; Ye, Qiang; Xu, Miao; Li, Rongcheng; Zhu, Fengcai; Liang, Zhenglun

    2015-01-01

    Enterovirus 71 (EV71) is the key pathogen for Hand, Foot, and Mouth Disease (HFMD) and can result in severe neurological complications and death among young children. Three inactivated-EV71 vaccines have gone through phase III clinical trials and have demonstrated good safety and efficacy. These vaccines will benefit young children under the threat of severe HFMD. However, the potential immunization-related compatibility for different enterovirus vaccines remains unclear, making it hard to include the EV71 vaccine in Expanded Program on Immunization (EPI). Here, we measured the neutralizing antibodies (NTAbs) against EV71, Coxsackievirus A16 (CA16) and Poliovirus from infants enrolled in those EV71 vaccine clinical trials. The results indicated that the levels of NTAb GMTs for EV71 increased significantly in all 3 vaccine groups (high, middle and low dosages, respectively) post-vaccination. Seroconversion ratios and Geometric mean fold increase were significantly higher in the vaccine groups (≥7/9 and 8.9~228.1) than in the placebo group (≤1/10 and 0.8~1.7, P < 0.05). But no similar NTAb response trends were found in CA16 and 3 types of Poliovirus. The decrease of 3 types of Poliovirus NTAb GMTs and an increase of CA16 GMTs post-EV71-vaccination were found in vaccine and placebo groups. Further animal study on CA16 and poliovirus vaccine co-immunization or pre-immunization with EV71 vaccine in mice indicated that there was no NTAb cross-activity between EV71 and CA16/Poliovirus. Our research showed that inactivated-EV71 vaccine has good specific-neutralizing capacity and can be included in EPI. PMID:25715318

  4. Comparative pathogenicity of Coxsackievirus A16 circulating and noncirculating strains in vitro and in a neonatal mouse model.

    PubMed

    Huang, L; Liu, X; Li, J L; Chang, J L; Liu, G C; Yu, X F; Zhang, W Y

    2015-05-01

    An enterovirus 71 (EV71) vaccine for the prevention of hand, foot, and mouth disease (HMFD) is available, but it is not known whether the EV71 vaccine cross-protects against Coxsackievirus (CV) infection. Furthermore, although an inactivated circulating CVA16 Changchun 024 (CC024) strain vaccine candidate is effective in newborn mice, the CC024 strain causes severe lesions in muscle and lung tissues. Therefore, an effective CV vaccine with improved pathogenic safety is needed. The aim of this study was to evaluate the in vivo safety and in vitro replication capability of a noncirculating CVA16 SHZH05 strain. The replication capacity of circulating CVA16 strains CC024, CC045, CC090 and CC163 and the noncirculating SHZH05 strain was evaluated by cytopathic effect in different cell lines. The replication capacity and pathogenicity of the CC024 and SHZH05 strains were also evaluated in a neonatal mouse model. Histopathological and viral load analyses demonstrated that the SHZH05 strain had an in vitro replication capacity comparable to the four CC strains. The CC024, but not the SHZH05 strain, became distributed in a variety of tissues and caused severe lesions and mortality in neonatal mice. The differences in replication capacity and in vivo pathogenicity of the CC024 and SHZH05 strains may result from differences in the nucleotide and amino acid sequences of viral functional polyproteins P1, P2 and P3. Our findings suggest that the noncirculating SHZH05 strain may be a safer CV vaccine candidate than the CC024 strain. PMID:25831207

  5. Different Antibody Response against the Coxsackievirus A16 VP1 Capsid Protein: Specific or Non-Specific.

    PubMed

    Ding, Yingying; Wang, Zhihong; Zhang, Xi; Teng, Zheng; Gao, Caixia; Qian, Baohua; Wang, Lili; Feng, Jiaojiao; Wang, Jinhong; Zhao, Chunyan; Guo, Cunjiu; Pan, Wei

    2016-01-01

    Coxsackievirus A16 (CA16) is one of the major causative agents of hand, foot, and mouth disease worldwide. The non-neutralizing antibody response that targets CA16 VP1 remains poorly elucidated. In the present study, antibody responses against CA16 VP1 in Shanghai blood donors and Shanxi individuals were analyzed by ELISA and inhibitory ELISA using five CA16 VP1 antigens: VP11-297, VP141-297, VP11-60, VP145-58 and VP161-297. The correlation coefficients for most of the reactions against each of the five antigens and the inhibition of the anti-CA16 VP1 antibody response produced by the various antigens were higher in Shanghai blood donors compared to those in Shanxi individuals. VP11-297 and VP141-297 strongly inhibited the anti-CA16 VP1 response in serum samples from both populations, while VP145-58 and VP161-297 intermediately and weakly inhibited the anti-CA16 VP1 response, respectively, in only Shanghai group. A specific type of inhibition (anti-CA16 VP1 was completely inhibited by both VP11-60 and VP141-297) characterized by high neutralizing antibody titers was identified and accounted for 71.4% of the strongly reactive samples from the Shanghai group. These results indicate that the Shanghai blood donors exhibited a consistent and specific antibody response, while the Shanxi individuals showed an inconsistent and non-specific antibody response. These findings may improve the understanding of host humoral immunity against CA16 and help to identify an effective approach for seroepidemiological surveillance and specific diagnosis of CA16 infection based on normal and competitive ELISA. PMID:27622652

  6. Toll-Like Receptor 3 Is Critical for Coxsackievirus B4-Induced Type 1 Diabetes in Female NOD Mice

    PubMed Central

    Thuma, Jean R.; Courreges, Maria C.; Benencia, Fabian; James, Calvin B.L.; Malgor, Ramiro; Kantake, Noriko; Mudd, William; Denlinger, Nathan; Nolan, Bret; Wen, Li; Schwartz, Frank L.

    2015-01-01

    Group B coxsackieviruses (CVBs) are involved in triggering some cases of type 1 diabetes mellitus (T1DM). However, the molecular mechanism(s) responsible for this remain elusive. Toll-like receptor 3 (TLR3), a receptor that recognizes viral double-stranded RNA, is hypothesized to play a role in virus-induced T1DM, although this hypothesis is yet to be substantiated. The objective of this study was to directly investigate the role of TLR3 in CVB-triggered T1DM in nonobese diabetic (NOD) mice, a mouse model of human T1DM that is widely used to study both spontaneous autoimmune and viral-induced T1DM. As such, we infected female wild-type (TLR3+/+) and TLR3 knockout (TLR3−/−) NOD mice with CVB4 and compared the incidence of diabetes in CVB4-infected mice with that of uninfected counterparts. We also evaluated the islets of uninfected and CVB4-infected wild-type and TLR3 knockout NOD mice by immunohistochemistry and insulitis scoring. TLR3 knockout mice were markedly protected from CVB4-induced diabetes compared with CVB4-infected wild-type mice. CVB4-induced T-lymphocyte-mediated insulitis was also significantly less severe in TLR3 knockout mice compared with wild-type mice. No differences in insulitis were observed between uninfected animals, either wild-type or TLR3 knockout mice. These data demonstrate for the first time that TLR3 is 1) critical for CVB4-induced T1DM, and 2) modulates CVB4-induced insulitis in genetically prone NOD mice. PMID:25422874

  7. Evolutionary connection between the catalytic subunits of DNA-dependent RNA polymerases and eukaryotic RNA-dependent RNA polymerases and the origin of RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Koonin, Eugene V; Aravind, L

    2003-01-01

    Background The eukaryotic RNA-dependent RNA polymerase (RDRP) is involved in the amplification of regulatory microRNAs during post-transcriptional gene silencing. This enzyme is highly conserved in most eukaryotes but is missing in archaea and bacteria. No evolutionary relationship between RDRP and other polymerases has been reported so far, hence the origin of this eukaryote-specific polymerase remains a mystery. Results Using extensive sequence profile searches, we identified bacteriophage homologs of the eukaryotic RDRP. The comparison of the eukaryotic RDRP and their homologs from bacteriophages led to the delineation of the conserved portion of these enzymes, which is predicted to harbor the catalytic site. Further, detailed sequence comparison, aided by examination of the crystal structure of the DNA-dependent RNA polymerase (DDRP), showed that the RDRP and the β' subunit of DDRP (and its orthologs in archaea and eukaryotes) contain a conserved double-psi β-barrel (DPBB) domain. This DPBB domain contains the signature motif DbDGD (b is a bulky residue), which is conserved in all RDRPs and DDRPs and contributes to catalysis via a coordinated divalent cation. Apart from the DPBB domain, no similarity was detected between RDRP and DDRP, which leaves open two scenarios for the origin of RDRP: i) RDRP evolved at the onset of the evolution of eukaryotes via a duplication of the DDRP β' subunit followed by dramatic divergence that obliterated the sequence similarity outside the core catalytic domain and ii) the primordial RDRP, which consisted primarily of the DPBB domain, evolved from a common ancestor with the DDRP at a very early stage of evolution, during the RNA world era. The latter hypothesis implies that RDRP had been subsequently eliminated from cellular life forms and might have been reintroduced into the eukaryotic genomes through a bacteriophage. Sequence and structure analysis of the DDRP led to further insights into the evolution of RNA polymerases

  8. 26 CFR 1.468B-3 - Rules applicable to the transferor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Rules applicable to the transferor. 1.468B-3 Section 1.468B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME... qualified settlement fund and the Internal Revenue Service—(1) In general. A transferor must provide...

  9. 26 CFR 1.468B-3 - Rules applicable to the transferor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Rules applicable to the transferor. 1.468B-3 Section 1.468B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME... qualified settlement fund and the Internal Revenue Service—(1) In general. A transferor must provide...

  10. 26 CFR 1.468B-3 - Rules applicable to the transferor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Rules applicable to the transferor. 1.468B-3 Section 1.468B-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME... qualified settlement fund and the Internal Revenue Service—(1) In general. A transferor must provide...

  11. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 15 2012-04-01 2012-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  12. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 15 2013-04-01 2013-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  13. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  14. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 15 2011-04-01 2011-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  15. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 15 2014-04-01 2014-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  16. 29 CFR 2550.408b-3 - Loans to Employee Stock Ownership Plans.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 9 2012-07-01 2012-07-01 false Loans to Employee Stock Ownership Plans. 2550.408b-3 Section 2550.408b-3 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR FIDUCIARY RESPONSIBILITY UNDER THE EMPLOYEE RETIREMENT INCOME SECURITY ACT OF 1974 RULES AND REGULATIONS FOR...

  17. HBx sensitizes hepatocellular carcinoma cells to lapatinib by up-regulating ErbB3

    PubMed Central

    Yen, Chia-Jui; Chen, Wen-Shu; Huang, Wei-Chien

    2016-01-01

    Poor prognosis of hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC) involves HBV X protein (HBx)-induced tumor progression. HBx also contributes to chemo-resistance via inducing the expressions of anti-apoptosis and multiple drug resistance genes. However, the impact of HBx expression on the therapeutic efficacy of various receptor tyrosine kinase inhibitors remains unknown. In this study, our data showed that HBx overexpression did not alter the cellular sensitivity of HCC cell lines to sorafenib but unexpectedly enhanced the cell death induced by EGFR family inhibitors, including gefitinib, erlotinib, and lapatinib due to ErbB3 up-regulation. Mechanistically, HBx transcriptionally up-regulates ErbB3 expression in a NF-κB dependent manner. In addition, HBx also physically interacts with ErbB2 and ErbB3 proteins and enhances the formation of ErbB2/ErbB3 heterodimeric complex. The cell viability of HBx-overexpressing cells was decreased by silencing ErbB3 expression, further revealing the pivotal role of ErbB3 in HBx-mediated cell survival. Our data suggest that HBx shifts the oncogenic addiction of HCC cells to ErbB2/ErbB3 signaling pathway via inducing ErbB3 expression and thereby enhances their sensitivity to EGFR/ErbB2 inhibitors. PMID:26595522

  18. 16 CFR Appendix B3 to Part 305 - Chest Freezers and All Other Freezers

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Chest Freezers and All Other Freezers B3 Appendix B3 to Part 305 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULE CONCERNING DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME...

  19. 26 CFR 53.4942(b)-3 - Determination of compliance with operating foundation tests.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... foundation tests. 53.4942(b)-3 Section 53.4942(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) MISCELLANEOUS EXCISE TAXES (CONTINUED) FOUNDATION AND SIMILAR EXCISE TAXES... foundation tests. (a) In general. A foundation may satisfy the income test and either the assets,...

  20. 26 CFR 53.4942(b)-3 - Determination of compliance with operating foundation tests.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... foundation tests. 53.4942(b)-3 Section 53.4942(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) MISCELLANEOUS EXCISE TAXES (CONTINUED) FOUNDATION AND SIMILAR EXCISE TAXES... foundation tests. (a) In general. A foundation may satisfy the income test and either the assets,...

  1. 26 CFR 48.4061(b)-3 - Rebuilt, reconditioned, or repaired parts or accessories.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Rebuilt, reconditioned, or repaired parts or accessories. 48.4061(b)-3 Section 48.4061(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) MISCELLANEOUS EXCISE TAXES MANUFACTURERS AND RETAILERS EXCISE TAXES Motor Vehicles, Tires, Tubes, Tread Rubber, and...

  2. 26 CFR 48.6416(b)(3)-2 - Further manufacture included.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Further manufacture included. 48.6416(b)(3)-2... of Special Application to Retailers and Manufacturers Taxes § 48.6416(b)(3)-2 Further manufacture... overpayment by reason of any use in further manufacture, or sale as part of a second manufactured...

  3. 26 CFR 48.6416(b)(3)-2 - Further manufacture included.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 16 2013-04-01 2013-04-01 false Further manufacture included. 48.6416(b)(3)-2... of Special Application to Retailers and Manufacturers Taxes § 48.6416(b)(3)-2 Further manufacture... overpayment by reason of any use in further manufacture, or sale as part of a second manufactured...

  4. 26 CFR 48.6416(b)(3)-2 - Further manufacture included.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 16 2011-04-01 2011-04-01 false Further manufacture included. 48.6416(b)(3)-2... of Special Application to Retailers and Manufacturers Taxes § 48.6416(b)(3)-2 Further manufacture... overpayment by reason of any use in further manufacture, or sale as part of a second manufactured...

  5. 26 CFR 48.6416(b)(3)-2 - Further manufacture included.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 16 2012-04-01 2012-04-01 false Further manufacture included. 48.6416(b)(3)-2... of Special Application to Retailers and Manufacturers Taxes § 48.6416(b)(3)-2 Further manufacture... overpayment by reason of any use in further manufacture, or sale as part of a second manufactured...

  6. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. PMID:25953405

  7. A novel recombinant lineage’s contribution to the outbreak of coxsackievirus A6-associated hand, foot and mouth disease in Shanghai, China, 2012-2013

    PubMed Central

    Feng, Xiaobo; Guan, Wencai; Guo, Yifeng; Yu, Huiju; Zhang, Xiaoling; Cheng, Ruhong; Wang, Zhen; Zhang, Zhen; Zhang, Jia; Li, Huaguo; Zhuang, Yin; Zhang, Hui; Lu, Zhiyong; Li, Ming; Yu, Hong; Bao, Yixiao; Hu, Yunwen; Yao, Zhirong

    2015-01-01

    Since late 2012, coxsackievirus A6 (CVA6) has gradually become the predominant pathogen responsible for hand-foot-mouth disease (HFMD) in several provinces of China. A total of 626 patients diagnosed with HFMD in Shanghai, China from January 2012 to September 2013 were enrolled in this study. Of these, 292 CVA6 infected cases were subjected to clinical analyses. Whole-genome sequencing, recombination and phylogenetic analyses were also performed. A recombinant CVA6 monophyletic lineage was found during an outbreak of CVA6-associated HFMDs in Shanghai, China in November 2012, and accounted for 21.9% (64/292) of the CVA6 strains during the study period. Recombination analyses showed that the 2C gene of the novel CVA6 virus was probably derived from a coxsackievirus A4 (CVA4) strain circulating in the population. Clinical observation showed that this recombinant CVA6 virus led to a more generalized rash than did the non-recombinant CVA6 virus. This newly emerged CVA6 lineage was associated with a considerable proportion of HFMD cases from 2012 to 2013 in Shanghai, and poses a potential threat to public health. PMID:26121916

  8. Genetic loss of SH2B3 in acute lymphoblastic leukemia

    PubMed Central

    Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A.; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M.; Tallman, Martin S.; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K.

    2013-01-01

    The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis. PMID:23908464

  9. Performance of Diesel Engine Using Diesel B3 Mixed with Crude Palm Oil

    PubMed Central

    Namliwan, Nattapong; Wongwuttanasatian, Tanakorn

    2014-01-01

    The objective of this study was to test the performance of diesel engine using diesel B3 mixed with crude palm oil in ratios of 95 : 5, 90 : 10, and 85 : 15, respectively, and to compare the results with diesel B3. According to the tests, they showed that the physical properties of the mixed fuel in the ratio of 95 : 5 were closest to those of diesel B3. The performance of the diesel engine that used mixed fuels had 5–17% lower torque and power than that of diesel B3. The specific fuel consumption of mixed fuels was 7–33% higher than using diesel B3. The components of gas emissions by using mixed fuel had 1.6–52% fewer amount of carbon monoxide (CO), carbon dioxide (CO2), sulfur dioxide (SO2), and oxygen (O2) than those of diesel B3. On the other hand, nitric oxide (NO) and nitrogen oxides (NOX) emissions when using mixed fuels were 10–39% higher than diesel B3. By comparing the physical properties, the performance of the engine, and the amount of gas emissions of mixed fuel, we found out that the 95 : 5 ratio by volume was a suitable ratio for agricultural diesel engine (low-speed diesel engine). PMID:24688402

  10. Performance of diesel engine using diesel B3 mixed with crude palm oil.

    PubMed

    Namliwan, Nattapong; Wongwuttanasatian, Tanakorn

    2014-01-01

    The objective of this study was to test the performance of diesel engine using diesel B3 mixed with crude palm oil in ratios of 95 : 5, 90 : 10, and 85 : 15, respectively, and to compare the results with diesel B3. According to the tests, they showed that the physical properties of the mixed fuel in the ratio of 95 : 5 were closest to those of diesel B3. The performance of the diesel engine that used mixed fuels had 5-17% lower torque and power than that of diesel B3. The specific fuel consumption of mixed fuels was 7-33% higher than using diesel B3. The components of gas emissions by using mixed fuel had 1.6-52% fewer amount of carbon monoxide (CO), carbon dioxide (CO2), sulfur dioxide (SO2), and oxygen (O2) than those of diesel B3. On the other hand, nitric oxide (NO) and nitrogen oxides (NO X ) emissions when using mixed fuels were 10-39% higher than diesel B3. By comparing the physical properties, the performance of the engine, and the amount of gas emissions of mixed fuel, we found out that the 95 : 5 ratio by volume was a suitable ratio for agricultural diesel engine (low-speed diesel engine). PMID:24688402

  11. Nuclear envelope remodeling during mouse spermiogenesis: Postmeiotic expression and redistribution of germline lamin B3

    SciTech Connect

    Schuetz, Wolfgang; Alsheimer, Manfred; Oellinger, Rupert; Benavente, Ricardo . E-mail: benavente@biozentrum.uni-wuerzburg.de

    2005-07-15

    Lamins are members of a multigene family of structural nuclear envelope (NE) proteins. Differentiated mammalian somatic cells express lamins A, C, B1, and B2. The composition and organization of the nuclear lamina of mammalian spermatogenic cells differ significantly from that of somatic cells as they express lamin B1 as well as two short germ line-specific isoforms, namely lamins B3 and C2. Here we describe in detail the expression pattern and localization of lamin B3 during mouse spermatogenesis. By combining RT-PCR, immunoblotting, and immunofluorescence microscopy, we show that lamin B3 is selectively expressed during spermiogenesis (i.e., postmeiotic stages of spermatogenesis). In round spermatids, lamin B3 is distributed in the nuclear periphery and, notably, also in the nucleoplasm. In the course of spermiogenesis, lamin B3 becomes redistributed as it concentrates progressively to the posterior pole of spermatid nuclei. Our results show that during mammalian spermiogenesis the nuclear lamina is composed of B-type isoforms only, namely the ubiquitous lamin B1 and the germline-specific lamin B3. Lamin B3 is the first example of a mammalian lamin that is selectively expressed during postmeiotic stages of spermatogenesis.

  12. Antibody-mediated neutralization of myelin-associated EphrinB3 accelerates CNS remyelination.

    PubMed

    Syed, Yasir A; Zhao, Chao; Mahad, Don; Möbius, Wiebke; Altmann, Friedrich; Foss, Franziska; Sentürk, Aycan; Acker-Palmer, Amparo; Lubec, Gert; Lilley, Kathryn; Franklin, Robin J M; Nave, Klaus-A; Kotter, Mark R N

    2016-02-01

    Remyelination in multiple sclerosis (MS) lesions often remains incomplete despite the presence of oligodendrocyte progenitor cells (OPCs). Amongst other factors, successful remyelination depends on the phagocytic clearance of myelin debris. However, the proteins in myelin debris that act as potent and selective inhibitors on OPC differentiation and inhibit CNS remyelination remain unknown. Here, we identify the transmembrane signalling protein EphrinB3 as important mediator of this inhibition, using a protein analytical approach in combination with a primary rodent OPC assay. In the presence of EphrinB3, OPCs fail to differentiate. In a rat model of remyelination, infusion of EphrinB3 inhibits remyelination. In contrast, masking EphrinB3 epitopes using antibodies promotes remyelination. Finally, we identify EphrinB3 in MS lesions and demonstrate that MS lesion extracts inhibit OPC differentiation while antibody-mediated masking of EphrinB3 epitopes promotes it. Our findings suggest that EphrinB3 could be a target for therapies aiming at promoting remyelination in demyelinating disease. PMID:26687980

  13. SerpinB3 and Yap Interplay Increases Myc Oncogenic Activity

    PubMed Central

    Turato, Cristian; Cannito, Stefania; Simonato, Davide; Villano, Gianmarco; Morello, Elisabetta; Terrin, Liliana; Quarta, Santina; Biasiolo, Alessandra; Ruvoletto, Mariagrazia; Martini, Andrea; Fasolato, Silvano; Zanus, Giacomo; Cillo, Umberto; Gatta, Angelo; Parola, Maurizio; Pontisso, Patrizia

    2015-01-01

    SerpinB3 has been recently described as an early marker of liver carcinogenesis, but the potential mechanistic role of this serpin in tumor development is still poorly understood. Overexpression of Myc often correlates with more aggressive tumour forms, supporting its involvement in carcinogenesis. Yes-associated protein (Yap), the main effector of the Hippo pathway, is a central regulator of proliferation and it has been found up-regulated in hepatocellular carcinomas. The study has been designed to investigate and characterize the interplay and functional modulation of Myc by SerpinB3 in liver cancer. Results from this study indicate that Myc was up-regulated by SerpinB3 through calpain and Hippo-dependent molecular mechanisms in transgenic mice and hepatoma cells overexpressing human SerpinB3, and also in human hepatocellular carcinomas. Human recombinant SerpinB3 was capable to inhibit the activity of Calpain in vitro, likely reducing its ability to cleave Myc in its non oncogenic Myc-nick cytoplasmic form. SerpinB3 indirectly increased the transcription of Myc through the induction of Yap pathway. These findings provide for the first time evidence that SerpinB3 can improve the production of Myc through direct and indirect mechanisms that include the inhibition of generation of its cytoplasmic form and the activation of Yap pathway. PMID:26634820

  14. B3-lesions of the breast and cancer risk - an analysis of mammography screening patients

    PubMed Central

    HOFFMANN, OLIVER; STAMATIS, GESINA ATHINA; BITTNER, ANN-KATHRIN; ARNOLD, GEORG; SCHNABEL, ROLF; KRÜGER, KARLGEORG; KIMMIG, RAINER; HEUBNER, MARTIN

    2016-01-01

    The use of mammography screening, followed by needle core biopsy (NCB), is associated with an increasing amount of invasive procedures. A considerable amount of specimens must be classified as lesions with uncertain malignant potential (B3-lesion). In these cases, an open biopsy is indicated for further diagnosis. We evaluated patients with B3-lesions to determine the risk of malignancy corresponding to the histopathological NCB results and the type of radiological lesion identified. A total of 95 patients participating in the German mammography screening program with a B3-lesion following NCB (104 B3-lesions in total) were included in our analysis. We analyzed the correlation between the initial histopathological findings from the NCB specimen and cancer risk. We further analyzed the correlations of malignant results with the type of mammographic lesion. In 23 cases (22%), histopathological examination following excision revealed a malignant lesion, including invasive and in situ carcinoma. The positive predictive value of the subgroups of B3-lesions ranged between 0.11 and 0.31; the B3-lesion associated with the highest cancer risk was the atypical ductal hyperplasia; however, no significant difference was observed between the B3-lesion subgroups (P=0.309) regarding the risk of malignancy. Comparing the different types of mammographic findings, such as radiological mass or microcalcifications, there was no significant difference in the risk for malignancy (P=0.379). The different types of B3-lesions did not exhibit differences in the risk for malignancy, and the morphological type of mammographic lesion does not appear to be correlated with cancer risk; therefore, our results underline the need for open biopsy in patients with B3-lesions following NCB. PMID:27123266

  15. Human SCARB2-dependent infection by coxsackievirus A7, A14, and A16 and enterovirus 71.

    PubMed

    Yamayoshi, Seiya; Iizuka, Setsuko; Yamashita, Teruo; Minagawa, Hiroko; Mizuta, Katsumi; Okamoto, Michiko; Nishimura, Hidekazu; Sanjoh, Kanako; Katsushima, Noriko; Itagaki, Tsutomu; Nagai, Yukio; Fujii, Ken; Koike, Satoshi

    2012-05-01

    Human enterovirus species A (HEV-A) consists of at least 16 members of different serotypes that are known to be the causative agents of hand, foot, and mouth disease (HFMD), herpangina, and other diseases, such as respiratory disease and polio-like flaccid paralysis. Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are the major causative agents of HFMD. CVA5, CVA6, CVA10, and CVA12 mainly cause herpangina or are occasionally involved with sporadic cases of HFMD. We have previously shown that human scavenger receptor class B, member 2 (SCARB2) is a cellular receptor for EV71 and CVA16. Using a large number of clinical isolates of HEV-A, we explored whether all clinical isolates of EV71 and other serotypes of HEV-A infected cells via SCARB2. We tested this possibility by infecting L-SCARB2 cells, which are L929 cells expressing human SCARB2, by infecting human RD cells that had been treated with small interfering RNAs for SCARB2 and by directly binding the viruses to a soluble SCARB2 protein. We showed that all 162 clinical isolates of EV71 propagated in L-SCARB2 cells, suggesting that SCARB2 is the critical receptor common to all EV71 strains. In addition, CVA7, CVA14, and CVA16, which are most closely related to each other, also utilized SCARB2 for infection. EV71, CVA14, and CVA16 are highly associated with HFMD, and EV71 and CVA7 are occasionally associated with neurological diseases, suggesting that SCARB2 plays important roles in the development of these diseases. In contrast, another group of viruses, such as CVA2, CVA3, CVA4, CVA5, CVA6, CVA8, CVA10, and CVA12, which are relatively distant from the EV71 group, is associated mainly with herpangina. None of these clinical isolates infected via the SCARB2-dependent pathway. HEV-A viruses can be divided into at least two groups depending on the use of SCARB2, and the receptor usage plays an important role in developing the specific diseases for each group. PMID:22438546

  16. Role of Heparan Sulfate in Cellular Infection of Integrin-Binding Coxsackievirus A9 and Human Parechovirus 1 Isolates

    PubMed Central

    Merilahti, Pirjo; Karelehto, Eveliina; Susi, Petri

    2016-01-01

    Heparan sulfate/heparin class of proteoglycans (HSPG) have been shown to function in cellular attachment and infection of numerous viruses including picornaviruses. Coxsackievirus A9 (CV-A9) and human parechovirus 1 (HPeV-1) are integrin-binding members in the family Picornaviridae. CV-A9 Griggs and HPeV-1 Harris (prototype) strains have been reported not to bind to heparin, but it was recently shown that some CV-A9 isolates interact with heparin in vitro via VP1 protein with a specific T132R/K mutation. We found that the infectivity of both CV-A9 Griggs and HPeV-1 Harris was reduced by sodium chlorate and heparinase suggestive of HSPG interactions. We analyzed the T132 site in fifty-four (54) CV-A9 clinical isolates and found that only one of them possessed T132/R mutation while the other nine (9) had T132K. We then treated CV-A9 Griggs and HPeV-1 Harris and eight CV-A9 and six HPeV-1 clinical isolates with heparin and protamine. Although infectivity of Griggs strain was slightly reduced (by 25%), heparin treatment did not affect the infectivity of the CV-A9 isolates that do not possess the T132R/K mutation, which is in line with the previous findings. Some of the HPeV-1 isolates were also affected by heparin treatment, which suggested that there may be a specific heparin binding site in HPeV-1. In contrast, protamine (a specific inhibitor of heparin) completely inhibited the infection of both prototypes and clinical CV-A9 and HPeV-1 isolates. We conclude that T132R/K mutation has a role in heparin binding of CV-A9, but we also show data, which suggest that there are other HSPG binding sites in CV-A9. In all, we suggest that HSPGs play a general role in both CV-A9 and HPeV-1 infections. PMID:26785353

  17. Structures of Coxsackievirus A16 Capsids with Native Antigenicity: Implications for Particle Expansion, Receptor Binding, and Immunogenicity

    PubMed Central

    Ren, Jingshan; Wang, Xiangxi; Zhu, Ling; Hu, Zhongyu; Gao, Qiang; Yang, Pan; Li, Xuemei; Wang, Junzhi; Shen, Xinliang; Fry, Elizabeth E.

    2015-01-01

    ABSTRACT Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are the primary causes of the epidemics of hand-foot-and-mouth disease (HFMD) that affect more than a million children in China each year and lead to hundreds of deaths. Although there has been progress with vaccines for EV71, the development of a CVA16 vaccine has proved more challenging, and the EV71 vaccine does not give useful cross-protection, despite the capsid proteins of the two viruses sharing about 80% sequence identity. The structural details of the expanded forms of the capsids, which possess nonnative antigenicity, are now well understood, but high resolution information for the native antigenic form of CVA16 has been missing. Here, we remedy this with high resolution X-ray structures of both mature and natural empty CVA16 particles and also of empty recombinant viruslike particles of CVA16 produced in insect cells, a potential vaccine antigen. All three structures are unexpanded native particles and antigenically identical. The recombinant particles have recruited a lipid moiety to stabilize the native antigenic state that is different from the one used in a natural virus infection. As expected, the mature CVA16 virus is similar to EV71; however, structural and immunogenic comparisons highlight differences that may have implications for vaccine production. IMPORTANCE Hand-foot-and-mouth disease is a serious public health threat to children in Asian-Pacific countries, resulting in millions of cases. EV71 and CVA16 are the two dominant causative agents of the disease that, while usually mild, can cause severe neurological complications, leading to hundreds of deaths. EV71 vaccines do not provide protection against CVA16. A CVA16 vaccine or bivalent EV71/CVA16 vaccine is therefore urgently needed. We report atomic structures for the mature CVA16 virus, a natural empty particle, and a recombinant CVA16 virus-like particle that does not contain the viral genome. All three particles have similar

  18. Acute hemorrhagic conjunctivitis: anti-coxsackievirus A24 variant secretory immunoglobulin A in acute and convalescent tear

    PubMed Central

    Langford, Marlyn P; Anders, Edwin A; Burch, Maxwell A

    2015-01-01

    Purpose The purpose of this paper is to present the clinical course of a laboratory-acquired case of acute hemorrhagic conjunctivitis (AHC) caused by coxsackievirus A24 variant (CA24v). Also, the anti-CA24v neutralizing activity and anti-CA24v immunoglobulin (Ig) G and secretory IgA (sIgA) in acute and convalescent tears and/or sera are presented. Case A 60-year-old male presented with acute-onset left eyelid edema, tearing, conjunctival erythema, pain, foreign body sensation, and subconjunctival hemorrhage 24 hours after suspected laboratory exposure. Bilateral conjunctivitis presented 24 hours later and resolved in 10 days. Methods Tear and blood samples were collected for virus isolation and neutralizing assays. CA24v-reactive IgG and sIgA in tear and/or serum samples were detected by immunofluorescent antibody analysis of ethanol-fixed virus-infected cells. Results Peak tear neutralization titers (1,000–1,500 U/mL) against the isolated virus occurred 1 day post-onset (po) of AHC. Tear neutralization titers became undetectable by the sixth day as serum neutralization titers became detectable on the ninth day po (60 U/mL), peaked by 21 days (3,000 U/mL), declined by 1 year to 200 U/mL, and remained at 30 U/mL 5 years po. Antibody to human IgG, IgA, and secretory component (sIgA) reacted with CA24v-infected cells treated with pooled acute tears collected 1–4 days po. Predominantly, sIgA was detected in CA24v-infected cells treated with tears collected 4 years and 5 years post-AHC, while convalescent serum contained predominantly anti-CA24v IgG. Conclusion AHC was confirmed by CA24v isolation, tear anti-CA24v neutralizing activity, and seroconversion. The detection of CA24v-reactive IgG, sIgA, and neutralizing activity in tears collected 1–4 days po of AHC supports plasma extravasation of IgG and suggests a defensive role for tear anti-CA24v sIgA. The results suggest that immunofluorescent antibody analysis of tears for persistent anti-CA24v sIgA may be

  19. Linear optical properties of γ-modification of bismuth borate BiB3O6

    NASA Astrophysics Data System (ADS)

    Melnikova, S. V.; Isaenko, L. I.

    2012-10-01

    The refractive index dispersion of the γ-BiB3O6 crystal in the wavelength range 0.43-0.81 μm has been measured. It has been shown that the principal refractive indices n 1, n 2, and n 3 are on average higher than those of α-BiB3O6, but are slightly lower than those of δ-BiB3O6. The temperature dependences of the rotation angle φ( T) of the optical indicatrix and birefringence Δ n 2( T) = ( n 1 - n 3)( T) have been studied in the temperature range 100-963 K. It has been shown that the γ-BiB3O6 crystal is stable in this temperature region.

  20. 2. NORTH SIDE OF B BLOCK, FROM B3 (RIGHT) TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. NORTH SIDE OF B BLOCK, FROM B-3 (RIGHT) TO B-7 (LEFT), VIEW SOUTH - Colgate & Company Jersey City Plant, Between 1931 Pierhead Line, Essex, York, & Montgomery Streets, Jersey City, Hudson County, NJ

  1. 14. View of south side of Building B3, from southwest ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View of south side of Building B-3, from southwest facing northeast. Replicates historic view at GA-2309-3. - Clark Howell Homes (Public Housing), Bounded by North Avenue, Lovejoy Street, Mills Street & Luckie Street, Atlanta, Fulton County, GA

  2. Compartment B3, boiler room; showing boiler facing of boiler #5 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Compartment B-3, boiler room; showing boiler facing of boiler #5 aft to forward from passing room B-25. (030A) - USS Olympia, Penn's Landing, 211 South Columbus Boulevard, Philadelphia, Philadelphia County, PA

  3. Metabolic Profiling Reveals PAFAH1B3 as a Critical Driver of Breast Cancer Pathogenicity

    PubMed Central

    Mulvihill, Melinda M.; Benjamin, Daniel I.; Ji, Xiaodan; Le Scolan, Erwan; Louie, Sharon M.; Shieh, Alice; Green, McKenna; Narasimhalu, Tara; Morris, Patrick J.; Luo, Kunxin; Nomura, Daniel K.

    2014-01-01

    Many studies have identified metabolic pathways that underlie cellular transformation, but the metabolic drivers of cancer progression remain less well understood. The Hippo transducer pathway has been shown to confer malignant traits on breast cancer cells. In this study, we used metabolic mapping platforms to identify biochemical drivers of cellular transformation and malignant progression driven through RAS and the Hippo pathway in breast cancer, and identified platelet activating factor acetylhydrolase 1B3 (PAFAH1B3) as a key metabolic driver of breast cancer pathogenicity that is upregulated in primary human breast tumors and correlated with poor prognosis. Metabolomic profiling suggests that PAFAH1B3 inactivation attenuates cancer pathogenicity through enhancing tumor-suppressing signaling lipids. Our studies provide a map of altered metabolism that underlies breast cancer progression and put forth PAFAH1B3 as a critical metabolic node in breast cancer. PMID:24954006

  4. Development of Specific, Irreversible Inhibitors for a Receptor Tyrosine Kinase EphB3.

    PubMed

    Kung, Alvin; Chen, Ying-Chu; Schimpl, Marianne; Ni, Feng; Zhu, Jianfa; Turner, Maurice; Molina, Henrik; Overman, Ross; Zhang, Chao

    2016-08-24

    Erythropoietin-producing human hepatocellular carcinoma (Eph) receptor tyrosine kinases (RTKs) regulate a variety of dynamic cellular events, including cell protrusion, migration, proliferation, and cell-fate determination. Small-molecule inhibitors of Eph kinases are valuable tools for dissecting the physiological and pathological roles of Eph. However, there is a lack of small-molecule inhibitors that are selective for individual Eph isoforms due to the high homology within the family. Herein, we report the development of the first potent and specific inhibitors of a single Eph isoform, EphB3. Through structural bioinformatic analysis, we identified a cysteine in the hinge region of the EphB3 kinase domain, a feature that is not shared with any other human kinases. We synthesized and characterized a series of electrophilic quinazolines to target this unique, reactive feature in EphB3. Some of the electrophilic quinazolines selectively and potently inhibited EphB3 both in vitro and in cells. Cocrystal structures of EphB3 in complex with two quinazolines confirmed the covalent linkage between the protein and the inhibitors. A "clickable" version of an optimized inhibitor was created and employed to verify specific target engagement in the whole proteome and to probe the extent and kinetics of target engagement of existing EphB3 inhibitors. Furthermore, we demonstrate that the autophosphorylation of EphB3 within the juxtamembrane region occurs in trans using a specific inhibitor. These exquisitely specific inhibitors will facilitate the dissection of EphB3's role in various biological processes and disease contribution. PMID:27478969

  5. Protective role of miR-23b-3p in kainic acid-induced seizure.

    PubMed

    Zhan, Lianbo; Yao, Yi; Fu, Huajun; Li, Zhenghui; Wang, Fengpeng; Zhang, Xiaobin; He, Wencan; Zheng, Weihong; Zhang, Yunwu; Zheng, Honghua

    2016-07-01

    Dysregulation of microRNAs has been proposed to contribute toward epilepsy. The miRNA miR-23b-3p has been found to protect against neuronal apoptosis and the production of reactive oxygen species. In this study, we assessed the potential role of miR-23b-3p in the kainic acid (KA)-induced seizure model. We found that miR-23b-3p levels were significantly decreased in the brain cortex of mice and in cultured mouse primary neurons treated with KA. Importantly, supplement of miR-23b-3p agomir by an intacerebroventricular injection alleviated seizure behaviors and abnormal cortical electroencephalogram recordings in KA-treated mice. Together, these results indicate that miR-23b-3p plays a crucial role in suppressing seizure formation in experimental models of epilepsy and that miR-23b-3p supplement may be a potential anabolic strategy for ameliorating seizure. PMID:27232518

  6. Structure Elucidation of Coxsackievirus A16 in Complex with GPP3 Informs a Systematic Review of Highly Potent Capsid Binders to Enteroviruses

    PubMed Central

    Tijsma, Aloys; Neyts, Johan; Spyrou, John A. B.; Ren, Jingshan; Grimes, Jonathan M.; Puerstinger, Gerhard; Leyssen, Pieter; Fry, Elizabeth E.; Rao, Zihe; Stuart, David I.

    2015-01-01

    The replication of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16), which are the major cause of hand, foot and mouth disease (HFMD) in children, can be inhibited by the capsid binder GPP3. Here, we present the crystal structure of CVA16 in complex with GPP3, which clarifies the role of the key residues involved in interactions with the inhibitor. Based on this model, in silico docking was performed to investigate the interactions with the two next-generation capsid binders NLD and ALD, which we show to be potent inhibitors of a panel of enteroviruses with potentially interesting pharmacological properties. A meta-analysis was performed using the available structural information to obtain a deeper insight into those structural features required for capsid binders to interact effectively and also those that confer broad-spectrum anti-enterovirus activity. PMID:26485389

  7. Characterization of VP1 gene of coxsackievirus A16 prevalent among hand foot mouth disease suffered children in Taizhou, P. R. China, between 2010 and 2013.

    PubMed

    Ma, Zhilong; Zha, Jie

    2016-02-01

    A total of 453 strains of Coxsackievirus A16 (CV-A16) were screened out of 1,509 hand-foot-mouth disease (HFMD) samples collected in Taizhou during the period from 2010 to 2013. And between first quarter of 2011 and first quarter of 2013, an outbreak of CV-A16 was found among the HFMD sufferers in Taizhou. Phylogenic analysis of VP1 sequences indicated a major CV-A16 sub-group in Taizhou, whose change pattern of effective population sizes was found to be similar to the pattern of the actual percentage changes of CV-A16 during the outbreak over the same period. More importantly, the sub-group all displayed a Leu (L) to Met (M) mutation at site-23 of capsid VP1 which might be correlated with the outbreak of CV-A16 in Taizhou. PMID:26174468

  8. Efficacy of a Trivalent Hand, Foot, and Mouth Disease Vaccine against Enterovirus 71 and Coxsackieviruses A16 and A6 in Mice.

    PubMed

    Caine, Elizabeth A; Fuchs, Jeremy; Das, Subash C; Partidos, Charalambos D; Osorio, Jorge E

    2015-11-01

    Hand, foot, and mouth disease (HFMD) has recently emerged as a major public health concern across the Asian-Pacific region. Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are the primary causative agents of HFMD, but other members of the Enterovirus A species, including Coxsackievirus A6 (CVA6), can cause disease. The lack of small animal models for these viruses have hampered the development of a licensed HFMD vaccine or antivirals. We have previously reported on the development of a mouse model for EV71 and demonstrated the protective efficacy of an inactivated EV71 vaccine candidate. Here, mouse-adapted strains of CVA16 and CVA6 were produced by sequential passage of the viruses through mice deficient in interferon (IFN) α/β (A129) and α/β and γ (AG129) receptors. Adapted viruses were capable of infecting 3 week-old A129 (CVA6) and 12 week-old AG129 (CVA16) mice. Accordingly, these models were used in active and passive immunization studies to test the efficacy of a trivalent vaccine candidate containing inactivated EV71, CVA16, and CVA6. Full protection from lethal challenge against EV71 and CVA16 was observed in trivalent vaccinated groups. In contrast, monovalent vaccinated groups with non-homologous challenges failed to cross protect. Protection from CVA6 challenge was accomplished through a passive transfer study involving serum raised against the trivalent vaccine. These animal models will be useful for future studies on HFMD related pathogenesis and the efficacy of vaccine candidates. PMID:26593938

  9. Efficacy of a Trivalent Hand, Foot, and Mouth Disease Vaccine against Enterovirus 71 and Coxsackieviruses A16 and A6 in Mice

    PubMed Central

    Caine, Elizabeth A.; Fuchs, Jeremy; Das, Subash C.; Partidos, Charalambos D.; Osorio, Jorge E.

    2015-01-01

    Hand, foot, and mouth disease (HFMD) has recently emerged as a major public health concern across the Asian-Pacific region. Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are the primary causative agents of HFMD, but other members of the Enterovirus A species, including Coxsackievirus A6 (CVA6), can cause disease. The lack of small animal models for these viruses have hampered the development of a licensed HFMD vaccine or antivirals. We have previously reported on the development of a mouse model for EV71 and demonstrated the protective efficacy of an inactivated EV71 vaccine candidate. Here, mouse-adapted strains of CVA16 and CVA6 were produced by sequential passage of the viruses through mice deficient in interferon (IFN) α/β (A129) and α/β and γ (AG129) receptors. Adapted viruses were capable of infecting 3 week-old A129 (CVA6) and 12 week-old AG129 (CVA16) mice. Accordingly, these models were used in active and passive immunization studies to test the efficacy of a trivalent vaccine candidate containing inactivated EV71, CVA16, and CVA6. Full protection from lethal challenge against EV71 and CVA16 was observed in trivalent vaccinated groups. In contrast, monovalent vaccinated groups with non-homologous challenges failed to cross protect. Protection from CVA6 challenge was accomplished through a passive transfer study involving serum raised against the trivalent vaccine. These animal models will be useful for future studies on HFMD related pathogenesis and the efficacy of vaccine candidates. PMID:26593938

  10. Mutations in B3GALNT2 Cause Congenital Muscular Dystrophy and Hypoglycosylation of α-Dystroglycan

    PubMed Central

    Stevens, Elizabeth; Carss, Keren J.; Cirak, Sebahattin; Foley, A. Reghan; Torelli, Silvia; Willer, Tobias; Tambunan, Dimira E.; Yau, Shu; Brodd, Lina; Sewry, Caroline A.; Feng, Lucy; Haliloglu, Goknur; Orhan, Diclehan; Dobyns, William B.; Enns, Gregory M.; Manning, Melanie; Krause, Amanda; Salih, Mustafa A.; Walsh, Christopher A.; Hurles, Matthew; Campbell, Kevin P.; Manzini, M. Chiara; Stemple, Derek; Lin, Yung-Yao; Muntoni, Francesco

    2013-01-01

    Mutations in several known or putative glycosyltransferases cause glycosylation defects in α-dystroglycan (α-DG), an integral component of the dystrophin glycoprotein complex. The hypoglycosylation reduces the ability of α-DG to bind laminin and other extracellular matrix ligands and is responsible for the pathogenesis of an inherited subset of muscular dystrophies known as the dystroglycanopathies. By exome and Sanger sequencing we identified two individuals affected by a dystroglycanopathy with mutations in β-1,3-N-acetylgalactosaminyltransferase 2 (B3GALNT2). B3GALNT2 transfers N-acetyl galactosamine (GalNAc) in a β-1,3 linkage to N-acetyl glucosamine (GlcNAc). A subsequent study of a separate cohort of individuals identified recessive mutations in four additional cases that were all affected by dystroglycanopathy with structural brain involvement. We show that functional dystroglycan glycosylation was reduced in the fibroblasts and muscle (when available) of these individuals via flow cytometry, immunoblotting, and immunocytochemistry. B3GALNT2 localized to the endoplasmic reticulum, and this localization was perturbed by some of the missense mutations identified. Moreover, knockdown of b3galnt2 in zebrafish recapitulated the human congenital muscular dystrophy phenotype with reduced motility, brain abnormalities, and disordered muscle fibers with evidence of damage to both the myosepta and the sarcolemma. Functional dystroglycan glycosylation was also reduced in the b3galnt2 knockdown zebrafish embryos. Together these results demonstrate a role for B3GALNT2 in the glycosylation of α-DG and show that B3GALNT2 mutations can cause dystroglycanopathy with muscle and brain involvement. PMID:23453667

  11. In vivo knockdown of ErbB3 in mice inhibits Schwann cell precursor migration.

    PubMed

    Torii, Tomohiro; Miyamoto, Yuki; Takada, Shuji; Tsumura, Hideki; Arai, Miyuki; Nakamura, Kazuaki; Ohbuchi, Katsuya; Yamamoto, Masahiro; Tanoue, Akito; Yamauchi, Junji

    2014-09-26

    The myelin sheath insulates neuronal axons and markedly increases the nerve conduction velocity. In the peripheral nervous system (PNS), Schwann cell precursors migrate along embryonic neuronal axons to their final destinations, where they eventually wrap around individual axons to form the myelin sheath after birth. ErbB2 and ErbB3 tyrosine kinase receptors form a heterodimer and are extensively expressed in Schwann lineage cells. ErbB2/3 is thought to be one of the primary regulators controlling the entire Schwann cell development. ErbB3 is the bona fide Schwann cell receptor for the neuronal ligand neuregulin-1. Although ErbB2/3 is well known to regulate both Schwann cell precursor migration and myelination by Schwann cells in fishes, it still remains unclear whether in mammals, ErbB2/3 actually regulates Schwann cell precursor migration. Here, we show that knockdown of ErbB3 using a Schwann cell-specific promoter in mice causes delayed migration of Schwann cell precursors. In contrast, littermate control mice display normal migration. Similar results are seen in an in vitro migration assay using reaggregated Schwann cell precursors. Also, ErbB3 knockdown in mice reduces myelin thickness in sciatic nerves, consistent with the established role of ErbB3 in myelination. Thus, ErbB3 plays a key role in migration, as well as in myelination, in mouse Schwann lineage cells, presenting a genetically conservative role of ErbB3 in Schwann cell precursor migration. PMID:25204498

  12. Bone Morphogenetic Proteins Regulate Enteric Gliogenesis by Modulating ErbB3 Signaling

    PubMed Central

    Chalazonitis, Alcmène; D’Autréaux, Fabien; Pham, Tuan D.; Kessler, John A.; Gershon, Michael D.

    2010-01-01

    The neural crest-derived cell population that colonizes the bowel (ENCDC) contains proliferating neural/glial progenitors. We tested the hypothesis that bone morphogenetic proteins (BMPs 2 and 4), which are known to promote enteric neuronal differentiation at the expense of proliferation, function similarly in gliogenesis. Enteric gliogenesis was analyzed in mice that overexpress the BMP antagonist, noggin, or BMP4 in the primordial ENS. Noggin-induced loss-of-function decreased, while BMP4-induced gain-of-function increased the glial density and glia/neuron ratio. When added to immunoisolated ENCDC, BMPs provoked nuclear translocation of phosphorylated SMAD proteins and enhanced both glial differentiation and expression of the neuregulin receptor ErbB3. ErbB3 transcripts were detected in E12 rat gut, before glial markers are expressed; moreover, expression of the ErbB3 ligand, glial growth factor 2 (GGF2) escalated rapidly after its first detection at E14. ErbB3-immunoreactive cells were located in the ENS of fetal and adult mice. GGF2 stimulated gliogenesis and proliferation and inhibited glial cell derived neurotrophic factor (GDNF)-promoted neurogenesis. Enhanced glial apoptosis occurred following GGF2 withdrawal; BMPs intensified this GGF2-dependence and reduced GGF2-stimulated proliferation. These observations support the hypotheses that BMPs are required for enteric gliogenesis and act by promoting responsiveness of ENCDC to ErbB3 ligands such as GGF2. PMID:21094638

  13. Marine microbial biodiversity, bioinformatics and biotechnology (M2B3) data reporting and service standards

    PubMed Central

    2015-01-01

    Contextual data collected concurrently with molecular samples are critical to the use of metagenomics in the fields of marine biodiversity, bioinformatics and biotechnology. We present here Marine Microbial Biodiversity, Bioinformatics and Biotechnology (M2B3) standards for “Reporting” and “Serving” data. The M2B3 Reporting Standard (1) describes minimal mandatory and recommended contextual information for a marine microbial sample obtained in the epipelagic zone, (2) includes meaningful information for researchers in the oceanographic, biodiversity and molecular disciplines, and (3) can easily be adopted by any marine laboratory with minimum sampling resources. The M2B3 Service Standard defines a software interface through which these data can be discovered and explored in data repositories. The M2B3 Standards were developed by the European project Micro B3, funded under 7th Framework Programme “Ocean of Tomorrow”, and were first used with the Ocean Sampling Day initiative. We believe that these standards have value in broader marine science. PMID:26203332

  14. Pseudomonas aeruginosa transposable bacteriophages D3112 and B3 require pili and surface growth for adsorption.

    PubMed Central

    Roncero, C; Darzins, A; Casadaban, M J

    1990-01-01

    Pseudomonas aeruginosa transposable bacteriophages D3112 and B3 were found to require pili for infection. Seventy mutants of P. aeruginosa PAO selected by resistance to D3112 or B3 were also resistant to the phage not used in the selection and suggested that the receptors of these two phages are identical. Of five resistant mutants examined, all were defective in the production of pili and did not adsorb either phage. P. aeruginosa PAK strains altered in pilus expression, such as hyperpiliated or nonpiliated mutants, adsorbed the phage but were not productively infected, implying that an additional host function was required for infection. The cell-associated lipopolysaccharide was not required for D3112 or B3 infection, since mutants deficient in O side-chain and core biosynthesis were still capable of adsorption and productive infection. This is in contrast to Escherichia coli mutator phages Mu and D108, which are dependent on lipopolysaccharide for adsorption. The P. aeruginosa phages adsorbed only to cells grown on solid media or in liquid media supplemented with agents that increase the macroviscosity, such as polyvinylpyrrolidone. Adsorption time course studies of D3112 and B3 using cells grown in solid media revealed similar but not identical adsorption patterns. These studies suggested that expression of the D3112 and B3 cell receptor is induced by growth on solid media. Images FIG. 2 PMID:1969404

  15. Genome-wide identification of Dicer-like, Argonaute and RNA-dependent RNA polymerase gene families and their expression analyses in response to viral infection and abiotic stresses in Solanum lycopersicum.

    PubMed

    Bai, Miao; Yang, Guo-Shun; Chen, Wen-Ting; Mao, Zhen-Chuan; Kang, Hou-Xiang; Chen, Guo-Hua; Yang, Yu-Hong; Xie, Bing-Yan

    2012-06-10

    Dicer, Argonaute and RNA-dependent RNA polymerase form the core components to trigger RNA silencing. Although tomato (Solanum lycopersicum) is a dicotyledon model plant, no systematic analysis and expression profiling of these genes in tomato has been undertaken previously. In this study, seven Dicer-like (SlDCLs), 15 Argonaute (SlAGOs) and six RNA-dependent RNA polymerase (SlRDRs) genes were identified in tomato. These genes were categorized into four subgroups based on phylogenetic analyses. Comprehensive analyses of gene structure, genomic localization and similarity among these genes were performed. Their expression patterns were investigated by means of expression models in different tissues and organs using online data and semi-quantitative RT-PCR. Many of the candidate genes were up-regulated in response to Tomato yellow leaf curl virus infection and abiotic stresses. The expression models of tandem gene duplications among SlDCL2s indicated the DCL2 family plays an important role in the evolution of tomato. PMID:22406496

  16. The Anti-Prion Antibody 15B3 Detects Toxic Amyloid-β Oligomers.

    PubMed

    Stravalaci, Matteo; Tapella, Laura; Beeg, Marten; Rossi, Alessandro; Joshi, Pooja; Pizzi, Erika; Mazzanti, Michele; Balducci, Claudia; Forloni, Gianluigi; Biasini, Emiliano; Salmona, Mario; Diomede, Luisa; Chiesa, Roberto; Gobbi, Marco

    2016-07-01

    15B3 is a monoclonal IgM antibody that selectively detects pathological aggregates of the prion protein (PrP). We report the unexpected finding that 15B3 also recognizes oligomeric but not monomeric forms of amyloid-β (Aβ)42, an aggregating peptide implicated in the pathogenesis of Alzheimer's disease (AD). The 15B3 antibody: i) inhibits the binding of synthetic Aβ42 oligomers to recombinant PrP and neuronal membranes; ii) prevents oligomer-induced membrane depolarization; iii) antagonizes the inhibitory effects of oligomers on the physiological pharyngeal contractions of the nematode Caenorhabditis elegans; and iv) counteracts the memory deficits induced by intracerebroventricular injection of Aβ42 oligomers in mice. Thus this antibody binds to pathologically relevant forms of Aβ, and offers a potential research, diagnostic, and therapeutic tool for AD. PMID:27392850

  17. A qualitative failure of B3LYP for textbook organic reactions.

    PubMed

    Chéron, Nicolas; Jacquemin, Denis; Fleurat-Lessard, Paul

    2012-05-21

    Depending on the selected DFT functional, two different mechanisms are found for two organic reactions (an intramolecular nucleophilic aromatic substitution and a nucleophilic addition on a carbonyl moiety). Indeed, B3LYP predicts a concerted mechanism whereas M06-2X foresees a multistep one. Calculations at the MP4(SDQ) level proved the mechanisms to be stepwise. We studied these reactions with a large panel of exchange-correlation functionals and demonstrated that the amount of exact exchange is of first importance. For some borderline cases, the form of the functional has also an impact, e.g. the Meisenheimer σ-adduct of the intramolecular nucleophilic aromatic substitution can be located with B3PW91 but not with B3LYP. These results stress the need to use recently proposed functionals to investigate chemical reactivity. PMID:22491187

  18. Distrontium lithium beryllium triborate, Sr2LiBeB3O8

    PubMed Central

    Yu, Na; Ye, Ning

    2012-01-01

    Single crystals of distrontium lithium beryllium triborate, Sr2LiBeB3O8, were obtained by spontaneous nucleation from a high-temperature melt. In the Sr2Li[BeB3O8] structure, [BeB2O7]6− rings, made up from one BeO4 tetra­hedron and two BO3 triangles, are connected to each other by [BO3] triangles to form the smallest repeat unit {[BeB3O8]8−} and then form chains along the b axis. The Sr2+ cations are seven- or eight-­coordinated and Li+ cations are tetra-­coordinated and lie between the chains. PMID:22590052

  19. 17 CFR 275.203(b)(3)-2 - Methods for counting clients in certain private funds.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... in certain private funds. 275.203(b)(3)-2 Section 275.203(b)(3)-2 Commodity and Securities Exchanges....203(b)(3)-2 Methods for counting clients in certain private funds. (a) For purposes of section 203(b..., members, or beneficiaries (any of which are referred to hereinafter as an “owner”) of a private fund...

  20. 17 CFR 270.5b-3 - Acquisition of repurchase agreement or refunded security treated as acquisition of underlying...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Acquisition of repurchase agreement or refunded security treated as acquisition of underlying securities. 270.5b-3 Section 270.5b-3..., INVESTMENT COMPANY ACT OF 1940 § 270.5b-3 Acquisition of repurchase agreement or refunded security treated...

  1. 17 CFR 275.203(b)(3)-1 - Definition of “client” of an investment adviser.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... generally to the public as an investment adviser, within the meaning of section 203(b)(3) of the Act (15 U.S... than the United States, and is regulated as a public investment company under the laws of the country... investment adviser. 275.203(b)(3)-1 Section 275.203(b)(3)-1 Commodity and Securities Exchanges SECURITIES...

  2. Concise synthesis of calystegines B2 and B3via intramolecular Nozaki-Hiyama-Kishi reaction.

    PubMed

    Wang, Hong-Yao; Kato, Atsushi; Kinami, Kyoko; Li, Yi-Xian; Fleet, George W J; Yu, Chu-Yi

    2016-06-01

    The key step in the concise syntheses of calystegine B2 and its C-2 epimer calystegine B3 was the construction of cycloheptanone 8via an intramolecular Nozaki-Hiyama-Kishi (NHK) reaction of 9, an aldehyde containing a Z-vinyl iodide. Vinyl iodide 9 was obtained by the Stork olefination of aldehyde 10, derived from carbohydrate starting materials. Calystegines B2 (3) and B3 (4) were synthesized from d-xylose and l-arabinose derivatives respectively in 11 steps in excellent overall yields (27% and 19%). PMID:27161660

  3. Electronic structure of a LiB 3 O 5 nonlinear optical crystal

    NASA Astrophysics Data System (ADS)

    Kuznetsov, A. Yu; Sobolev, A. B.; Ogorodnikov, I. N.; Kruzhalov, A. V.

    1995-12-01

    The electronic bands of a LiB 3 O 5 (LBO) crystal with excellent nonlinear optical properties have been studied using the scattered-wave method in embedded-cluster model. Calculations were carried out for a [B 3 O 7]5? cluster, as this anionic group is the crystal basic structural unit. The interpretation of experimental photoemission spectra is based on electronic structure cluster calculations. From calculation performed, it follows that the contribution of trigonal and tetrahedral boron-oxygen groups dominates in the electronic structure of LBO, the contribution of 2p-boron states is immaterial.

  4. Coxsackievirus Infections (For Parents)

    MedlinePlus

    ... to normal within 24 hours, although the average fever lasts 3 to 4 days. Hand, foot, and mouth disease usually lasts for 2 or 3 days; viral ... Kids For Parents MORE ON THIS TOPIC Hand, Foot, and Mouth Disease Why Is Hand Washing So Important? Vomiting Fever and Taking Your Child's Temperature Why Do I ...

  5. Ephrin-B3 coordinates timed axon targeting and amygdala spinogenesis for innate fear behaviour

    PubMed Central

    Zhu, Xiao-Na; Liu, Xian-Dong; Sun, Suya; Zhuang, Hanyi; Yang, Jing-Yu; Henkemeyer, Mark; Xu, Nan-Jie

    2016-01-01

    Innate emotion response to environmental stimuli is a fundamental brain function that is controlled by specific neural circuits. Dysfunction of early emotional circuits may lead to neurodevelopmental disorders such as autism and schizophrenia. However, how the functional circuits are formed to prime initial emotional behaviours remain elusive. We reveal here using gene-targeted mutations an essential role for ephrin-B3 ligand-like activity in the development of innate fear in the neonatal brain. We further demonstrate that ephrin-B3 controls axon targeting and coordinates spinogenesis and neuronal activity within the amygdala. The morphological and behavioural abnormalities in ephrin-B3 mutant mice are rescued by conditional knock-in of wild-type ephrin-B3 during the critical period when axon targeting and fear responses are initiated. Our results thus define a key axonal molecule that participates in the wiring of amygdala circuits and helps bring about fear emotion during the important adolescence period. PMID:27008987

  6. First International Consensus Conference on lesions of uncertain malignant potential in the breast (B3 lesions).

    PubMed

    Rageth, Christoph J; O'Flynn, Elizabeth Am; Comstock, Christopher; Kurtz, Claudia; Kubik, Rahel; Madjar, Helmut; Lepori, Domenico; Kampmann, Gert; Mundinger, Alexander; Baege, Astrid; Decker, Thomas; Hosch, Stefanie; Tausch, Christoph; Delaloye, Jean-François; Morris, Elisabeth; Varga, Zsuzsanna

    2016-09-01

    The purpose of this study is to obtain a consensus for the therapy of B3 lesions. The first International Consensus Conference on lesions of uncertain malignant potential in the breast (B3 lesions) including atypical ductal hyperplasia (ADH), flat epithelial atypia (FEA), classical lobular neoplasia (LN), papillary lesions (PL), benign phyllodes tumors (PT), and radial scars (RS) took place in January 2016 in Zurich, Switzerland organized by the International Breast Ultrasound School and the Swiss Minimally Invasive Breast Biopsy group-a subgroup of the Swiss Society of Senology. Consensus recommendations for the management and follow-up surveillance of these B3 lesions were developed and areas of research priorities were identified. The consensus recommendation for FEA, LN, PL, and RS diagnosed on core needle biopsy or vacuum-assisted biopsy (VAB) is to therapeutically excise the lesion seen on imaging by VAB and no longer by open surgery, with follow-up surveillance imaging for 5 years. The consensus recommendation for ADH and PT is, with some exceptions, therapeutic first-line open surgical excision. Minimally invasive management of selected B3 lesions with therapeutic VAB is acceptable as an alternative to first-line surgical excision. PMID:27522516

  7. 26 CFR 1.367(b)-3 - Repatriation of foreign corporate assets in certain nonrecognition transactions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Repatriation of foreign corporate assets in... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Effects on Corporation § 1.367(b)-3 Repatriation of foreign corporate assets in certain nonrecognition transactions....

  8. Unidirectional thermal expansion in KZnB3O6: role of alkali metals.

    PubMed

    Lou, Yanfang; Li, Dandan; Li, Zhilin; Zhang, Han; Jin, Shifeng; Chen, Xiaolong

    2015-12-14

    The driving force of the unidirectional thermal expansion in KZnB3O6 has been studied experimentally and theoretically. Our results show that the low-energy vibrational modes of alkali metals play a crucial role in this unusual thermal behavior. PMID:26515521

  9. Identical Genotype B3 Sequences from Measles Patients in 4 Countries, 2005

    PubMed Central

    Lowe, Luis; Rota, Paul; Bellini, William; Redd, Susan; Dayan, Gustavo; van Binnendijk, Rob; Hahné, Susan; Tipples, Graham; Macey, Jeannette; Espinoza, Rita; Posey, Drew; Plummer, Andrew; Bateman, John; Gudiño, José; Cruz-Ramirez, Edith; Lopez-Martinez, Irma; Anaya-Lopez, Luis; Akwar, Teneg Holy; Giffin, Scott; Carrión, Verónica; Bispo de Filippis, Ana Maria; Vicari, Andrea; Tan, Christina; Wolf, Bruce; Wytovich, Katherine; Borus, Peter; Mbugua, Francis; Chege, Paul; Kombich, Janeth; Akoua-Koffi, Chantal; Smit, Sheilagh; Bukenya, Henry; Bwogi, Josephine; Baliraine, Frederick Ndhoga; Kremer, Jacques; Muller, Claude; Santibanez, Sabine

    2006-01-01

    Surveillance of measles virus detected an epidemiologic link between a refugee from Kenya and a Dutch tourist in New Jersey, USA. Identical genotype B3 sequences from patients with contemporaneous cases in the United States, Canada, and Mexico in November and December 2005 indicate that Kenya was likely to have been the common source of virus. PMID:17283637

  10. EphB3 signaling propagates synaptic dysfunction in the traumatic injured brain.

    PubMed

    Perez, Enmanuel J; Cepero, Maria L; Perez, Sebastian U; Coyle, Joseph T; Sick, Thomas J; Liebl, Daniel J

    2016-10-01

    Traumatic brain injury (TBI), ranging from mild concussion to severe penetrating wounds, can involve brain regions that contain damaged or lost synapses in the absence of neuronal death. These affected regions significantly contribute to sensory, motor and/or cognitive deficits. Thus, studying the mechanisms responsible for synaptic instability and dysfunction is important for protecting the nervous system from the consequences of progressive TBI. Our controlled cortical impact (CCI) injury produces ~20% loss of synapses and mild changes in synaptic protein levels in the CA3-CA1 hippocampus without neuronal losses. These synaptic changes are associated with functional deficits, indicated by >50% loss in synaptic plasticity and impaired learning behavior. We show that the receptor tyrosine kinase EphB3 participates in CCI injury-induced synaptic damage, where EphB3(-/-) mice show preserved long-term potentiation and hippocampal-dependent learning behavior as compared with wild type (WT) injured mice. Improved synaptic function in the absence of EphB3 results from attenuation in CCI injury-induced synaptic losses and reduced d-serine levels compared with WT injured mice. Together, these findings suggest that EphB3 signaling plays a deleterious role in synaptic stability and plasticity after TBI. PMID:27317833

  11. 46 CFR 153.350 - Location of B/3 vent discharges.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 5 2013-10-01 2013-10-01 false Location of B/3 vent discharges. 153.350 Section 153.350 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Design and Equipment Cargo Venting Systems § 153.350 Location of...

  12. 46 CFR 153.350 - Location of B/3 vent discharges.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Location of B/3 vent discharges. 153.350 Section 153.350 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Design and Equipment Cargo Venting Systems § 153.350 Location of...

  13. EphB2 and EphB3 forward signalling are required for palate development.

    PubMed

    Risley, Michael; Garrod, David; Henkemeyer, Mark; McLean, William

    2009-01-01

    Ephs and ephrins are cell surface receptors that bind to each other and initiate distinct, bidirectional signalling pathways in processes known as forward (Eph) and reverse (ephrin) signalling. Previous work had shown that the loss of ephrinB1 protein alone or compound loss of EphB2 and EphB3 leads to cleft palate. Because of the bidirectional signalling capability of these molecules, it was not clear whether forward or reverse signalling caused the cleft palate in the ephrinB1 protein null or EphB2 and EphB3 compound null mice. We demonstrate that forward signalling is essential for palatogenesis. Foetuses with a cytoplasmically truncated EphB2 protein, which could initiate reverse but not forward signalling, and were protein null for EphB3 had a cleft palate. This happened because their palatal shelves, which could elevate in vivo and adhere and fuse in culture, were too small to contact one another. Small shelf size was due to reduced proliferation in the palatal mesenchyme. The reduced proliferation was not the result of abnormal vascular development within the palate. In conclusion, strong evidence is provided for specific and co-operative roles of EphB2 and EphB3 in palate development. PMID:19032981

  14. 17 CFR 270.24b-3 - Sales literature deemed filed.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Sales literature deemed filed... (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.24b-3 Sales literature deemed filed. Any advertisement, pamphlet, circular, form letter or other sales literature addressed to or...

  15. 26 CFR 1.403(b)-3 - Exclusion for contributions to purchase section 403(b) contracts.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 5 2012-04-01 2011-04-01 true Exclusion for contributions to purchase section..., Stock Bonus Plans, Etc. § 1.403(b)-3 Exclusion for contributions to purchase section 403(b) contracts... purchase of an annuity contract for an employee are excluded from the gross income of the employee...

  16. 29 CFR 2530.200b-3 - Determination of service to be credited to employees.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... weeks, under § 2530.200b-2(b)(3) the emmployee is not required to be credited with more than 120 hours... working 5 shifts per week. A plan maintained by the employer uses the equivalency based on shifts....200b-2; (ii) On the basis of weeks of employment, if an employee is credited with 45 hours of...

  17. 29 CFR 2530.200b-3 - Determination of service to be credited to employees.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... weeks, under § 2530.200b-2(b)(3) the emmployee is not required to be credited with more than 120 hours... working 5 shifts per week. A plan maintained by the employer uses the equivalency based on shifts....200b-2; (ii) On the basis of weeks of employment, if an employee is credited with 45 hours of...

  18. Crystal structure of bovine CD1b3 with endogenously bound ligands1,2

    PubMed Central

    Girardi, Enrico; Wang, Jing; Mac, Thien-Thi; Versluis, Cees; Bhowruth, Veemal; Besra, Gurdyal; Heck, Albert JR; Van Rhijn, Ildiko; Zajonc, Dirk M.

    2010-01-01

    The CD1 family of antigen-presenting molecules is able to display lipids to T cells by binding them within a hydrophobic groove connected to the protein surface. In particular, the CD1b isotype is capable of binding ligands with greatly varying alkyl chain lengths through a complex network of interconnected hydrophobic pockets. Interestingly, mycobacterial lipids, such as glucose monomycolate (GMM) exclusively bind to CD1b. We determined the crystal structure of one of the three expressed bovine CD1b proteins, CD1b3, in complex with endogenous ligands, identified by mass spectrometry as a mixture of phosphatidylcholine and phosphatidylethanolamine, and analyzed the ability of the protein to bind glycolipids in vitro. The structure reveals a complex binding groove architecture, similar to the human ortholog but with consequential differences. Intriguingly, in bovine CD1b3 only the A’, C’ and F’ pockets are present while the T’ pocket previously described in human CD1b is closed. This different pocket conformation could affect the ability of boCD1b3 to recognize lipids with long acyl chains such as GMM. However, even in the absence of a T’ tunnel, bovine CD1b3 is able to bind mycolates from Rhodococcus ruber in vitro. PMID:20519644

  19. Expression of c-erbB3 protein in primary breast carcinomas.

    PubMed Central

    Naidu, R.; Yadav, M.; Nair, S.; Kutty, M. K.

    1998-01-01

    Expression of c-erbB3 protein was investigated in 104 primary breast carcinomas comprising nine comedo ductal carcinoma in situ (DCIS), 91 invasive ductal carcinomas and four invasive lobular carcinomas using two monoclonal antibodies, RTJ1 and RTJ2. Of the 91 invasive ductal carcinomas, seven contained the comedo DCIS component adjacent to the invasive component. An immunohistochemical technique was used to evaluate the association between expression of c-erbB3 and clinical parameters and tumour markers such as epidermal growth factor receptor (EGFR), c-erbB2, cathepsin-D and p53 in archival formalin-fixed paraffin-embedded tumour tissues. Our results indicated that RTJ1 and RTJ2 gave identical staining patterns and concordant results. It was found that the overexpression of c-erbB3 protein was observed in 67% (6/9) of comedo DCIS, 52% (44/84) of invasive ductal carcinomas, 71% (5/7) of carcinomas containing both the in situ and invasive lesions and 25% (1/4) of invasive lobular carcinomas. A significant relationship (P < 0.05) was observed between strong immunoreactivity of c-erbB3 protein and histological grade, EGFR and cathepsin-D, but not with expression of c-erbB2, p53, oestrogen receptor status, lymph node metastases or age of patient. However, we noted that a high percentage of oestrogen receptor-negative tumours (59%), lymph node-positive tumours (63%) and c-erbB2 (63%) were strongly positive for c-erbB3 protein. We have also documented that a high percentage of EGFR (67%), c-erbB2 (67%), p53 (75%) and cathepsin-D-positive DCIS (60%) were strongly positive for c-erbB3. These observations suggest that overexpression of c-erbB3 protein could play an important role in tumour progression from non-invasive to invasive and, also, that it may have the potential to be used as a marker for poor prognosis of breast cancer. Images Figure 1 Figure 2 PMID:9823984

  20. Isoliquiritigenin (ISL) inhibits ErbB3 signaling in prostate cancer cells.

    PubMed

    Jung, Jae In; Chung, Eunkyung; Seon, Mi Ra; Shin, Hyun-Kyung; Kim, Eun Ji; Lim, Soon Sung; Chung, Won-Yoon; Park, Kwang-Kyun; Park, Jung Han Yoon

    2006-01-01

    Isoliquiritigenin (ISL), a flavonoid found in licorice, shallot, and bean sprouts, has been identified as a potent anti-tumor promoting agent. We previously demonstrated that ISL reduces cell proliferation and induces apoptosis in DU145 human prostate cancer cells and MAT-LyLu (MLL) rat prostate cancer cells. Overexpression of members of the ErbB receptor family is a frequently observed event in several human cancers, and ErbB receptors currently constitute the primary targets of anticancer strategies. In order to elucidate the mechanisms underlying the ISL regulation of prostate cancer cell proliferation, the present study attempted to determine whether ISL inhibits heregulin (HRG)-beta-induced ErbB3 signaling. DU145 and MLL cells were cultured in serum-free medium with ISL and/or HRG-beta. Exogenous HRG-beta alone was shown to effect an increase in the numbers of viable cells, whereas HRG-beta did not counteract the ISL-induced growth inhibition. ISL reduced the protein and mRNA levels of ErbB3 in a dose-dependent manner, but exerted no effect on HRG protein levels. Immunoprecipitation/Western blot studies indicated that ISL inhibited the HRG-beta-induced tyrosine phosphorylation of ErbB3, the recruitment of the p85 regulatory subunit of phosphatidylinositol 3-kinase (PI3K) to ErbB3, and Akt phosphorylation in DU145 cells. These results indicate that ISL inhibits the proliferation of prostate cancer cells, at least in part, via the inhibition of ErbB3 signaling and the PI3K/Akt pathway. PMID:17473376

  1. Characterization of Coxsackievirus A6- and Enterovirus 71-Associated Hand Foot and Mouth Disease in Beijing, China, from 2013 to 2015

    PubMed Central

    Li, Jie; Sun, Ying; Du, Yiwei; Yan, Yuxiang; Huo, Da; Liu, Yuan; Peng, Xiaoxia; Yang, Yang; Liu, Fen; Lin, Changying; Liang, Zhichao; Jia, Lei; Chen, Lijuan; Wang, Quanyi; He, Yan

    2016-01-01

    Background: Etiology surveillance of Hand Foot and Mouth disease (HFMD) in Beijing showed that Coxsackievirus A6 (CVA6) became the major pathogen of HFMD in 2013 and 2015. In order to understand the epidemiological characteristics and clinical manifestations of CVA6-associated HFMD, a comparison study among CVA6-, EV71- (Enterovirus 71), and CVA16- (Coxsackievirus A16) associated HFMD was performed. Methods: Epidemiological characteristics and clinical manifestations among CVA6-, EV71- and CVA16-associated mild or severe cases were compared from 2013 to 2015. VP1 gene of CVA6 and EV71 from mild cases, severe cases were sequenced, aligned, and compared with strains from 2009 to 2015 in Beijing and strains available in GenBank. Phylogenetic tree was constructed by neighbor-joining method. Results: CVA6 became the predominant causative agent of HFMD and accounted for 35.4 and 36.9% of total positive cases in 2013 and 2015, respectively. From 2013 to 2015, a total of 305 severe cases and 7 fatal cases were reported. CVA6 and EV71 were responsible for 57.5% of the severe cases. Five out six samples from fatal cases were identified as EV71. High fever, onychomadesis, and decrustation were the typical symptoms of CVA6-associated mild HFMD. CVA6-associated severe cases were characterized by high fever with shorter duration and twitch compared with EV71-associated severe cases which were characterized by poor mental condition, abnormal pupil, and vomiting. Poor mental condition, lung wet rales, abnormal pupil, and tachycardia were the most common clinical features of fatal cases. The percentage of lymphocyte in CVA6-associated cases was significantly lower than that of EV71. High percentage of lymphocyte and low percentage of neutrophils were the typical characteristics of fatal cases. VP1 sequences between CVA6- or EV71-associated mild and severe cases were highly homologous. Conclusion: CVA6 became one of the major pathogens of HFMD in 2013 and 2015 in Beijing

  2. Novel Mechanism of Impaired Function of Organic Anion-Transporting Polypeptide 1B3 in Human Hepatocytes: Post-Translational Regulation of OATP1B3 by Protein Kinase C Activation

    PubMed Central

    Powell, John; Farasyn, Taleah; Köck, Kathleen; Meng, Xiaojie; Pahwa, Sonia; Brouwer, Kim L. R.

    2014-01-01

    The organic anion-transporting polypeptide (OATP) 1B3 is a membrane transport protein that mediates hepatic uptake of many drugs and endogenous compounds. Currently, determination of OATP-mediated drug-drug interactions in vitro is focused primarily on direct substrate inhibition. Indirect inhibition of OATP1B3 activity is under-appreciated. OATP1B3 has putative protein kinase C (PKC) phosphorylation sites. Studies were designed to determine the effect of PKC activation on OATP1B3-mediated transport in human hepatocytes using cholecystokinin-8 (CCK-8), a specific OATP1B3 substrate, as the probe. A PKC activator, phorbol-12-myristate-13-acetate (PMA), did not directly inhibit [3H]CCK-8 accumulation in human sandwich-cultured hepatocytes (SCH). However, pretreatment with PMA for as little as 10 minutes rapidly decreased [3H]CCK-8 accumulation. Treatment with a PKC inhibitor bisindolylmaleimide (BIM) I prior to PMA treatment blocked the inhibitory effect of PMA, indicating PKC activation is essential for downregulating OATP1B3 activity. PMA pretreatment did not affect OATP1B3 mRNA or total protein levels. To determine the mechanism(s) underlying the indirect inhibition of OATP1B3 activity upon PKC activation, adenoviral vectors expressing FLAG-Myc-tagged OATP1B3 (Ad-OATP1B3) were transduced into human hepatocytes; surface expression and phosphorylation of OATP1B3 were determined by biotinylation and by an anti–phosphor-Ser/Thr/Tyr antibody, respectively. PMA pretreatment markedly increased OATP1B3 phosphorylation without affecting surface or total OATP1B3 protein levels. In conclusion, PKC activation rapidly decreases OATP1B3 transport activity by post-translational regulation of OATP1B3. These studies elucidate a novel indirect inhibitory mechanism affecting hepatic uptake mediated by OATP1B3, and provide new insights into predicting OATP-mediated drug interactions between OATP substrates and kinase modulator drugs/endogenous compounds. PMID:25200870

  3. THE ABC TRANSPORTER, AbcB3, MEDIATES cAMP EXPORT IN D. DISCOIDEUM DEVELOPMENT

    PubMed Central

    Miranda, Edward Roshan; Nam, Edward A.; Kuspa, Adam; Shaulsky, Gad

    2014-01-01

    Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development. PMID:25448698

  4. 12q24 locus association with type 1 diabetes: SH2B3 or ATXN2?

    PubMed Central

    Auburger, Georg; Gispert, Suzana; Lahut, Suna; Ömür, Özgür; Damrath, Ewa; Heck, Melanie; Başak, Nazlı

    2014-01-01

    Genetic linkage analyses, genome-wide association studies of single nucleotide polymorphisms, copy number variation surveys, and mutation screenings found the human chromosomal 12q24 locus, with the genes SH2B3 and ATXN2 in its core, to be associated with an exceptionally wide spectrum of disease susceptibilities. Hematopoietic traits of red and white blood cells (like erythrocytosis and myeloproliferative disease), autoimmune disorders (like type 1 diabetes, coeliac disease, juvenile idiopathic arthritis, rheumatoid arthritis, thrombotic antiphospholipid syndrome, lupus erythematosus, multiple sclerosis, hypothyroidism and vitiligo), also vascular pathology (like kidney glomerular filtration rate deficits, serum urate levels, plasma beta-2-microglobulin levels, retinal microcirculation problems, diastolic and systolic blood pressure and hypertension, cardiovascular infarction), furthermore obesity, neurodegenerative conditions (like the polyglutamine-expansion disorder spinocerebellar ataxia type 2, Parkinson’s disease, the motor-neuron disease amyotrophic lateral sclerosis, and progressive supranuclear palsy), and finally longevity were reported. Now it is important to clarify, in which ways the loss or gain of function of the locally encoded proteins SH2B3/LNK and ataxin-2, respectively, contribute to these polygenic health problems. SH2B3/LNK is known to repress the JAK2/ABL1 dependent proliferation of white blood cells. Its null mutations in human and mouse are triggers of autoimmune traits and leukemia (acute lymphoblastic leukemia or chronic myeloid leukemia-like), while missense mutations were found in erythrocytosis-1 patients. Ataxin-2 is known to act on RNA-processing and trophic receptor internalization. While its polyglutamine-expansion mediated gain-of-function causes neuronal atrophy in human and mouse, its deletion leads to obesity and insulin resistance in mice. Thus, it is conceivable that the polygenic pathogenesis of type 1 diabetes is

  5. Interaction study between wheat-derived peptides and procyanidin B3 by mass spectrometry.

    PubMed

    Dias, Ricardo; Perez-Gregorio, Maria Rosa; Mateus, Nuno; De Freitas, Victor

    2016-03-01

    Tannins have the ability to complex and precipitate proteins, being particularly reactive towards the proline-rich ones. The main structural feature of the wheat peptides responsible for the onset of Celiac Disease (CD) is their high content in proline residues. The aim of this work was to characterize the binding between a common food tannin (procyanidin B3) and different wheat-derived peptidic fractions. For this, seven peptide mixtures were obtained after in vitro digestion of a wheat gliadins crude extract and further characterized by LC-ESI-MS/MS. Several soluble B3-peptide complexes were identified by ESI-MS. The peptides involved in complex formation varied in terms of their size and diversity in CD epitopes. Although binding selectivity of procyanidin B3 towards peptides containing CD epitopes was not found, the major complexes contained or could contain immunoreactive peptides. This study highlights the potential beneficial effects of food polyphenols as a nutritional approach in the modulation of CD. PMID:26471686

  6. LiB 3O 5 crystal structure at 20, 227 and 377 °C

    NASA Astrophysics Data System (ADS)

    Shepelev, Yu. F.; Bubnova, R. S.; Filatov, S. K.; Sennova, N. A.; Pilneva, N. A.

    2005-10-01

    Crystal structure of LiB 3O 5 (a framework of [B 3O 5] - rings and Li atoms located in interspaces) was refined at high temperatures using single-crystal X-ray diffraction, Mo Kα-radiation, anharmonic approximation, orthorhombic; Pna2 1; Z=4; 20 °C ( a=8.444, b=7.378, c=5.146 Å, 1411 F( hkl), R=0.022); 227 °C ( a=8.616, b=7.433, c=5.063 Å, 1336 F( hkl), R=0.026), 377 °C ( a=8.746, b=7.480, c=5.013 Å, 1193 F( hkl), R=0.035). A high mobility of Li atoms and their highly asymmetric vibrations are revealed. Ellipsoid of Li thermal vibrations is oviform. Li is shifted on heating to 0.26 Å mainly along a-axis causing high thermal expansion in this direction; Li temperature factors are multiplied by 4 on heating. Rigid boron-oxygen groups in LiB 3O 5 remain practically stable on heating similar to α-Na 2B 8O 13 and α-CsB 5O 8. At the same time these groups rotate relative to each other like hinges leading to extremely anisotropic thermal expansion ( α a=101, α b=31, α c=-71, α v=60×10 -6 °C -1, 20-530 °C, HTXRPD data).

  7. Optical spectroscopy of Pr3+-doped γ-BiB3O6 crystals

    NASA Astrophysics Data System (ADS)

    Yelisseyev, A.; Isaenko, L.; Korolev, V.; Stoyanovsky, V.; Gets, V.; Naumov, D.; Ilyina, O.

    2013-12-01

    Single crystals of Pr3+-doped γ-BiB3O6 of optical quality were grown. Band gap is 4.16 eV at 80 K, which differs only slightly from that for undoped samples. Pr concentration is 2 × 1020 cm-3 and the dopant is distributed uniformly along the crystal. Absorption cross-section for Pr3+ was estimated to be ˜1 × 10-20 cm2. At X-ray and UV, band-to-band excitation the Pr:γ-BiB3O6 crystals demonstrate an intense emission in the 450 nm broad band, which is related mainly to recombination of self-trapped excitons (STE). A part of energy is transferred radiatively to Pr3+ ions. The STE emission quenches as temperature increases to 250 K with simultaneous decrease of the decay time from 11 μs to 17 ns. Intensity and decay time of the Pr3+ intracenter luminescence with τ ˜ 50 μs at 450 nm excitation do not depend on temperature. Intensity of thermoluminescence in the 150-400 K range quenches 2 orders at Pr doping, and parameters of the traps were estimated. As a result of relatively narrow band gap in γ-BiB3O6:Pr3+, there is no cascade luminescence typical of many wide-band-gap matrices.

  8. Inner shell excitation spectroscopy of transient molecules: HBS, HBO, and H3B3O3

    NASA Astrophysics Data System (ADS)

    Ennis, L. E.; Hitchcock, A. P.

    1999-08-01

    Inner shell electron energy spectroscopy (ISEELS) was used to study HBS, HBO, and H3B3O3, reactive, transient species generated in situ. The reaction of H2S with crystalline boron in a quartz tube was used to produce thioborine (HBS) at ˜1100 °C, and borine (HBO) at ˜1200 °C. The reaction of H2O vapor with crystalline boron in a quartz tube at ˜1200 °C was used to produce boroxine (H3B3O3). These species were identified from their inner shell excitation spectra and mass spectrometry. The B 1s, S 2s, and S 2p ISEEL spectra of HBS, and the B 1s and O 1s spectra of HBO and H3B3O3 are reported and analyzed with the help of GSCF3 ab initio calculations. A reaction scheme is proposed for the generation of HBO from the reaction of H2S and boron in a heated quartz tube.

  9. Orchestration of ErbB3 signaling through heterointeractions and homointeractions.

    PubMed

    McCabe Pryor, Meghan; Steinkamp, Mara P; Halasz, Adam M; Chen, Ye; Yang, Shujie; Smith, Marilyn S; Zahoransky-Kohalmi, Gergely; Swift, Mark; Xu, Xiao-Ping; Hanien, Dorit; Volkmann, Niels; Lidke, Diane S; Edwards, Jeremy S; Wilson, Bridget S

    2015-11-01

    Members of the ErbB family of receptor tyrosine kinases are capable of both homointeractions and heterointeractions. Because each receptor has a unique set of binding sites for downstream signaling partners and differential catalytic activity, subtle shifts in their combinatorial interplay may have a large effect on signaling outcomes. The overexpression and mutation of ErbB family members are common in numerous human cancers and shift the balance of activation within the signaling network. Here we report the development of a spatial stochastic model that addresses the dynamics of ErbB3 homodimerization and heterodimerization with ErbB2. The model is based on experimental measures for diffusion, dimer off-rates, kinase activity, and dephosphorylation. We also report computational analysis of ErbB3 mutations, generating the prediction that activating mutations in the intracellular and extracellular domains may be subdivided into classes with distinct underlying mechanisms. We show experimental evidence for an ErbB3 gain-of-function point mutation located in the C-lobe asymmetric dimerization interface, which shows enhanced phosphorylation at low ligand dose associated with increased kinase activity. PMID:26378253

  10. Thermochemical properties of polycyclic aromatic hydrocarbons (PAH) from G3MP2B3 calculations.

    PubMed

    Blanquart, Guillaume; Pitsch, Heinz

    2007-07-19

    In this article, we present a new database of thermodynamic properties for polycyclic aromatic hydrocarbons (PAH). These large aromatic species are formed in very rich premixed flames and in diffusion flames as part of the gas-phase chemistry. PAH are commonly assumed to be the intermediates leading to soot formation. Therefore, accurate prediction of their thermodynamic properties is required for modeling soot formation. The present database consists of 46 species ranging from benzene (C6H6) to coronene (C24H12) and includes all the species usually present in chemical mechanisms for soot formation. Geometric molecular structures are optimized at the B3LYP/6-31++G(d,p) level of theory. Heat capacity, entropy, and energy content are calculated from these optimized structures. Corrections for hindered rotor are applied on the basis of torsional potentials obtained from second-order Møller-Plesset perturbation (MP2) and Dunning's consistent basis sets (cc-pVDZ). Enthalpies of formation are calculated using the mixed G3MP2//B3 method. Finally, a group correction is applied to account for systematic errors in the G3MP2//B3 computations. The thermodynamic properties for all species are available in NASA polynomial form at the following address: http://www.stanford.edu/group/pitsch/. PMID:17595062

  11. Structure-activity relationship study of EphB3 receptor tyrosine kinase inhibitors

    PubMed Central

    Qiao, Lixin; Choi, Sungwoon; Case, April; Gainer, Thomas G.; Seyb, Kathleen; Glicksman, Marcie A.; Lo, Donald C.; Stein, Ross L.; Cuny, Gregory D.

    2009-01-01

    A structure-activity relationship study for a 2-chloroanilide derivative of pyrazolo[1,5-a]pyridine revealed that increased EphB3 kinase inhibitory activity could be accomplished by retaining the 2-chloroanilide and introducing a phenyl or small electron donating substituents to the 5-position of the pyrazolo[1,5-a]pyridine. In addition, replacement of the pyrazolo[1,5-a]pyridine with imidazo[1,2-a]pyridine was well tolerated and resulted in enhanced mouse liver microsome stability. The structure-activity relationship for EphB3 inhibition of both heterocyclic series was similar. Kinase inhibitory activity was also demonstrated for representative analogs in cell culture. An analog (32, LDN-211904) was also profiled for inhibitory activity against a panel of two hundred and eighty eight kinases and found to be quite selective for tyrosine kinases. Overall, these studies provide useful molecular probes for examining the in vitro, cellular and potentially in vivo kinase-dependent function of EphB3 receptor. PMID:19783434

  12. 26 CFR 1.668(b)-3A - Computation of the beneficiary's income and tax for a prior taxable year.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... for a prior taxable year. 1.668(b)-3A Section 1.668(b)-3A Internal Revenue INTERNAL REVENUE SERVICE... Distributions of Trusts Applicable to Taxable Years Beginning Before January 1, 1969 § 1.668(b)-3A Computation... required to be furnished by him under § 1.668(b)- 4A(a). The gross income, related deductions, and...

  13. 17 CFR 275.203(b)(3)-1 - Definition of “client” of an investment adviser.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definition of âclientâ of an investment adviser. 275.203(b)(3)-1 Section 275.203(b)(3)-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT ADVISERS ACT OF 1940 § 275.203(b)(3)-1 Definition of “client” of...

  14. 17 CFR 275.203(b)(3)-2 - Methods for counting clients in certain private funds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Methods for counting clients in certain private funds. 275.203(b)(3)-2 Section 275.203(b)(3)-2 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT ADVISERS ACT OF 1940 § 275.203(b)(3)-2 Methods for counting...

  15. 7 CFR Exhibit B-3 to Subpart B of... - Letter for Notifying Applicants, Lender, Holders and Borrowers of Adverse Decisions Where the...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Farmer Program Primary Loan Servicing Actions) B Exhibit B-3 to Subpart B of Part 1900 Agriculture... GENERAL Adverse Decisions and Administrative Appeals Pt. 1900, Subpt. B, Exh. B-3 Exhibit B-3 to Subpart...

  16. 7 CFR Exhibit B-3 to Subpart B of... - Letter for Notifying Applicants, Lender, Holders and Borrowers of Adverse Decisions Where the...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Farmer Program Primary Loan Servicing Actions) B Exhibit B-3 to Subpart B of Part 1900 Agriculture... GENERAL Adverse Decisions and Administrative Appeals Pt. 1900, Subpt. B, Exh. B-3 Exhibit B-3 to Subpart...

  17. EphB3 receptors function as dependence receptors to mediate oligodendrocyte cell death following contusive spinal cord injury

    PubMed Central

    Tsenkina, Y; Ricard, J; Runko, E; Quiala- Acosta, M M; Mier, J; Liebl, D J

    2015-01-01

    We demonstrate that EphB3 receptors mediate oligodendrocyte (OL) cell death in the injured spinal cord through dependence receptor mechanism. OLs in the adult spinal cord express EphB3 as well as other members of the Eph receptor family. Spinal cord injury (SCI) is associated with tissue damage, cellular loss and disturbances in EphB3-ephrinB3 protein balance acutely (days) after the initial impact creating an environment for a dependence receptor-mediated cell death to occur. Genetic ablation of EphB3 promotes OL survival associated with increased expression of myelin basic protein and improved locomotor function in mice after SCI. Moreover, administration of its ephrinB3 ligand to the spinal cord after injury also promotes OL survival. Our in vivo findings are supported by in vitro studies showing that ephrinB3 administration promotes the survival of both oligodendroglial progenitor cells and mature OLs cultured under pro-apoptotic conditions. In conclusion, the present study demonstrates a novel dependence receptor role of EphB3 in OL cell death after SCI, and supports further development of ephrinB3-based therapies to promote recovery. PMID:26469970

  18. Optical spectroscopy and decoherence studies of Y b3 + :YAG at 968 nm

    NASA Astrophysics Data System (ADS)

    Böttger, Thomas; Thiel, C. W.; Cone, R. L.; Sun, Y.; Faraon, A.

    2016-07-01

    The 7/2 2F ↔ 5/2 2F optical transitions of Y b3 + doped into Y3A l5O12 (YAG) were studied for potential quantum information and photonic signal processing applications. Absorption and fluorescence spectroscopy located the energy levels of the ground >7/2 2F and excited 5/2 2F manifolds, allowing inconsistencies between previous assignments of crystal field splittings in the literature to be resolved. These measurements reveal an unusually large splitting between the first and second levels in both the ground and excited multiplets, potentially providing for reduced sensitivity to thermally induced decoherence and spin-lattice relaxation. Spectral hole burning through two-level saturation was observed, determining the excited state lifetime to be 860 μs and resolving ambiguities in previous fluorescence measurements that were caused by the large radiation trapping effects in this material. Optical decoherence measurements using two-pulse photon echoes gave a homogeneous linewidth of 18 kHz for an applied magnetic field of 1 T, narrowing to 5 kHz at 2.5 T. The observed decoherence was described by spectral diffusion attributed to Y b3 +- Y b3 + magnetic dipole interactions. Laser absorption determined an inhomogeneous linewidth of 3.6 GHz for this transition in this 0.05%-doped crystal, which is narrower than for any other rare-earth-ion transition previously studied in the YAG host. The temperature dependence of the transition energy and linewidth of the lowest 7/2 2F to lowest 5/2 2F transition centered at 968.571 nm measured from 4 K to 300 K was well described by phonon scattering at higher temperatures, with an additional anomalous linear temperature-dependent broadening at temperatures below 80 K. Two magnetically inequivalent subgroups of Y b3 + ions were identified when a magnetic field was applied along the <111 > axis, as expected for the D2 sites in the cubic symmetry crystal, with ground and excited state effective g -values of gg=3.40 (3.34) and ge=1

  19. Coxsackievirus B5 Infection Induces Dysregulation of microRNAs Predicted to Target Known Type 1 Diabetes Risk Genes in Human Pancreatic Islets.

    PubMed

    Kim, Ki Wook; Ho, Andy; Alshabee-Akil, Ammira; Hardikar, Anandwardhan A; Kay, Thomas W H; Rawlinson, William D; Craig, Maria E

    2016-04-01

    Extensive research has identified enterovirus (EV) infections as key environmental triggers of type 1 diabetes. However, the underlying molecular mechanisms via which EVs contribute to the pathogenesis of type 1 diabetes remain unclear. Given that EVs dysregulate host microRNAs (miRNAs), which function as key regulators of β-cell biology, we investigated the impact of coxsackievirus B5 (CVB5) infection on the cellular expression of miRNAs within human islets. Using high-throughput quantitative PCR nanofluidics arrays, the expression of 754 miRNAs was examined in CVB5-infected human pancreatic islets. In total, 33 miRNAs were significantly dysregulated (≥ threefold difference) in the infected compared with control islets (P < 0.05). Subsequently, these differentially expressed miRNAs were predicted to target mRNAs of 57 known type 1 diabetes risk genes that collectively mediate various biological processes, including the regulation of cell proliferation, cytokine production, the innate immune response, and apoptosis. In conclusion, we report the first global miRNA expression profiling of CVB5-infected human pancreatic islets. We propose that EVs disrupt the miRNA-directed suppression of proinflammatory factors within β-cells, thereby resulting in an exacerbated antiviral immune response that promotes β-cell destruction and eventual type 1 diabetes. PMID:26558682

  20. Coxsackievirus A24 Variant Uses Sialic Acid-Containing O-Linked Glycoconjugates as Cellular Receptors on Human Ocular Cells ▿

    PubMed Central

    Mistry, Nitesh; Inoue, Hirotoshi; Jamshidi, Fariba; Storm, Rickard J.; Oberste, M. Steven; Arnberg, Niklas

    2011-01-01

    Coxsackievirus A24 variant (CVA24v) is a main causative agent of acute hemorrhagic conjunctivitis (AHC), which is a highly contagious eye infection. Previously it has been suggested that CVA24v uses sialic acid-containing glycoconjugates as attachment receptors on corneal cells, but the nature of these receptors is poorly described. Here, we set out to characterize and identify the cellular components serving as receptors for CVA24v. Binding and infection experiments using corneal cells treated with deglycosylating enzymes or metabolic inhibitors of de novo glycosylation suggested that the receptor(s) used by CVA24v are constituted by sialylated O-linked glycans that are linked to one or more cell surface proteins but not to lipids. CVA24v bound better to mouse L929 cells overexpressing human P-selectin glycoprotein ligand-1 (PSGL-1) than to mock-transfected cells, suggesting that PSGL-1 is a candidate receptor for CVA24v. Finally, binding competition experiments using a library of mono- and oligosaccharides mimicking known PSGL-1 glycans suggested that CVA24v binds to Neu5Acα2,3Gal disaccharides (Neu5Ac is N-acetylneuraminic acid). These results provide further insights into the early steps of the CVA24v life cycle. PMID:21880775

  1. An Adenovirus Vector with Genetically Modified Fibers Demonstrates Expanded Tropism via Utilization of a Coxsackievirus and Adenovirus Receptor-Independent Cell Entry Mechanism

    PubMed Central

    Dmitriev, Igor; Krasnykh, Victor; Miller, C. Ryan; Wang, Minghui; Kashentseva, Elena; Mikheeva, Galina; Belousova, Natalya; Curiel, David T.

    1998-01-01

    Recombinant adenoviruses (Ad) have become the vector system of choice for a variety of gene therapy applications. However, the utility of Ad vectors is limited due to the low efficiency of Ad-mediated gene transfer to cells expressing marginal levels of the coxsackievirus and adenovirus receptor (CAR). In order to achieve CAR-independent gene transfer by Ad vectors in clinically important contexts, we proposed modification of viral tropism via genetic alterations to the viral fiber protein. We have shown that incorporation of an Arg-Gly-Asp (RGD)-containing peptide in the HI loop of the fiber knob domain results in the ability of the virus to utilize an alternative receptor during the cell entry process. We have also demonstrated that due to its expanded tissue tropism, this novel vector is capable of efficient transduction of primary tumor cells. An increase in gene transfer to ovarian cancer cells of 2 to 3 orders of magnitude was demonstrated by the vector, suggesting that recombinant Ad containing fibers with an incorporated RGD peptide may be of great utility for treatment of neoplasms characterized by deficiency of the primary Ad type 5 receptor. PMID:9811704

  2. Interactions between Multiple Genetic Determinants in the 5′ UTR and VP1 Capsid Control Pathogenesis of Chronic Post-Viral Myopathy caused by Coxsackievirus B1

    PubMed Central

    Sandager, Maribeth M.; Nugent, Jaime L.; Schulz, Wade L.; Messner, Ronald P.; Tam, Patricia E.

    2008-01-01

    Mice infected with coxsackievirus B1 Tucson (CVB1T) develop chronic, post-viral myopathy (PVM) with clinical manifestations of hind limb muscle weakness and myositis. The objective of the current study was to establish the genetic basis of myopathogenicity in CVB1T. Using a reverse genetics approach, full attenuation of PVM could only be achieved by simultaneously mutating four sites located at C706U in the 5′ untranslated region (5′ UTR) and at Y87F, V136A, and T276A in the VP1 capsid. Engineering these four myopathic determinants into an amyopathic CVB1T variant restored the ability to cause PVM. Moreover, these same four determinants controlled PVM expression in a second strain of mice, indicating that the underlying mechanism is operational in mice of different genetic backgrounds. Modeling studies predict that C706U alters both local and long-range pairing in the 5′ UTR, and that VP1 determinants are located on the capsid surface. However, these differences did not affect viral titers, temperature stability, pH stability, or the antibody response to virus. These studies demonstrate that PVM develops from a complex interplay between viral determinants in the 5′ UTR and VP1 capsid and have uncovered intriguing similarities between genetic determinants that cause PVM and those involved in pathogenesis of other enteroviruses. PMID:18029287

  3. Coxsackievirus A16-like particles produced in Pichia pastoris elicit high-titer neutralizing antibodies and confer protection against lethal viral challenge in mice.

    PubMed

    Zhang, Chao; Liu, Qingwei; Ku, Zhiqiang; Hu, Yang; Ye, Xiaohua; Zhang, Yingyi; Huang, Zhong

    2016-05-01

    Coxsackievirus A16 (CA16) is a major causative agent of hand, foot and mouse disease (HFMD) which has been affecting millions of young children annually in the Asia-Pacific region over the last seven years. However, no commercial CA16 vaccines are currently available. In the present study, we investigated the expression of virus-like particles (VLPs) of CA16 in Pichia pastoris yeast and their immunogenicity and protective efficacy in mice. We found that CA16-VLPs could be produced at relatively high levels in P. pastoris yeast transformed with a construct co-expressing the P1 and 3CD proteins of CA16. Mice immunized with the yeast-derived CA16-VLPs produced high-titer serum antibodies with potent neutralization effect specifically on CA16. More importantly, passive immunization with the yeast-derived VLPs fully protected neonatal mice against CA16 lethal challenge in both antisera transfer and maternal immunization experiments. Collectively, our results demonstrate that P. pastoris-derived CA16-VLPs represent a promising CA16 vaccine candidate with proven preclinical efficacy and desirable traits for manufacturing at industrial scale. PMID:26902108

  4. 26 CFR 31.3406(b)(3)-5 - Reportable payments of payment card and third party network transactions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... party network transactions. 31.3406(b)(3)-5 Section 31.3406(b)(3)-5 Internal Revenue INTERNAL REVENUE... Reportable payments of payment card and third party network transactions. (a) Payment card and third party network transactions subject to backup withholding. The gross amount of a reportable transaction that...

  5. 26 CFR 1.367(b)-3T - Repatriation of foreign corporate assets in certain nonrecognition transactions (temporary).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 4 2014-04-01 2014-04-01 false Repatriation of foreign corporate assets in certain nonrecognition transactions (temporary). 1.367(b)-3T Section 1.367(b)-3T Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Effects on Corporation §...

  6. 26 CFR 31.3406(b)(3)-5 - Reportable payments of payment card and third party network transactions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... party network transactions. 31.3406(b)(3)-5 Section 31.3406(b)(3)-5 Internal Revenue INTERNAL REVENUE... Reportable payments of payment card and third party network transactions. (a) Payment card and third party network transactions subject to backup withholding. The gross amount of a reportable transaction that...

  7. 26 CFR 1.1311(b)-3 - Existence of relationship in case of adjustment by way of deficiency assessment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... by way of deficiency assessment. 1.1311(b)-3 Section 1.1311(b)-3 Internal Revenue INTERNAL REVENUE... of deficiency assessment. (a) Except for cases described in paragraph (b) of § 1.1312-3, no... by way of a deficiency assessment under the circumstance described in paragraph (b) of §...

  8. 26 CFR 1.1311(b)-3 - Existence of relationship in case of adjustment by way of deficiency assessment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... by way of deficiency assessment. 1.1311(b)-3 Section 1.1311(b)-3 Internal Revenue INTERNAL REVENUE... adjustment by way of deficiency assessment. (a) Except for cases described in paragraph (b) of § 1.1312-3, no... by way of a deficiency assessment under the circumstance described in paragraph (b) of §...

  9. Improving B3LYP heats of formation with three-dimensional molecular descriptors.

    PubMed

    Zhou, Yuwei; Wu, Jianming; Xu, Xin

    2016-05-15

    In the present work, we propose the X3D method that extends the B3LYP method by correcting its errors on heats of formation of hydrocarbons (HCs) with three-dimensional (3D) molecular descriptors. Inspired by the widely used Wiener index, these 3D descriptors are developed to improve over the original B3LYP method for a better description of atom-atom, atom-bond and bond-bond interactions. On top of a training set of only 45 species, the X3D method is validated against various sets of different chemistry, displaying an overall near chemical accuracy. In particular, X3D improves over B3LYP, reducing its mean absolute errors from 28.4 to 0.3 kcal/mol for (Set 1) 21 n-alkanes up to n-C32 H66 , from 19.3 to 0.6 kcal/mol for (Set 2) n-C7 H16 and its branched isomers, from 29.5 to 1.6 kcal/mol for (Set 3) 36 polycyclic saturated HCs, from 8.6 to 1.1 kcal/mol for (Set 4) 41 C6 H8 isomers of rings, alkenes, alkynes, and cumulenes, from 20.3 to 0.6 kcal/mol for (Set 5) 41 benzene-based compounds, and 8.1 to 1.3 kcal/mol for (Set 6) 66 radicals, etc. Comparisons with the G4 results are also presented. © 2016 Wiley Periodicals, Inc. PMID:26887921

  10. Lattice defects and recombination processes in non-linear crystals LiB3O5

    NASA Astrophysics Data System (ADS)

    Ogorodnikov, I. N.; Kruzhalov, A. V.; Porotnikov, A. V.; Yakovlev, Yu. V.

    The paper presents the results of a study of kinetics of the recombination processes in crystals LiB3O5 (LBO) obtained by the use of time-resolved luminescence and optical absorption spectroscopy. It was revealed that the observed peculiarities of the recombination processes in LBO are due to a participation of the trapped electron (B2+) and hole (O-) centres. In the framework of a model of the competing trapped hole centres the time dependence of both transient optical absorption and luminescence as well as their temperature dependencies was interpreted.

  11. Measles in Italy: Co-circulation of B3 variants during 2014.

    PubMed

    Magurano, Fabio; Baggieri, Melissa; Bordi, Licia; Lalle, Eleonora; Chironna, Maria; Lazzarotto, Tiziana; Amendola, Antonella; Baldanti, Fausto; Ansaldi, Filippo; Filia, Antonietta; Declich, Silvia; Iannazzo, Stefania; Pompa, Maria Grazia; Bucci, Paola; Marchi, Antonella; Nicoletti, Loredana

    2016-06-01

    In 2013, the majority of the WHO/EUR countries reported an annual incidence of >1 case per one million population indicating that the elimination target is far from being met. Thus, there is the urgent need to uncover and analyze chains of measles virus (MV) transmission with the objective to identify vulnerable groups and avoid possible routes of introduction of MV variants in the European population. The analysis of molecular epidemiology of MV B3 strains identified in 2014 has shown that four different variants co-circulated in Italy, including the strain that caused a cruise-line ship outbreak at the beginning of the year. PMID:26496509

  12. Predissociation of oxygen in the B3Sigma(u)(-) state

    NASA Technical Reports Server (NTRS)

    Chiu, S. S.-L.; Cheung, A. S.-C.; Finch, M.; Jamieson, M. J.; Yoshino, K.; Dalgarno, A.; Parkinson, W. H.

    1992-01-01

    The predissociation linewidths and level shifts of vibrational levels of three oxygen isotopic molecules (O2)-16, (O-16)(O-18), and (O2)-18 arising from the interactions of the B3Sigma(u)(-) state with the four repulsive states 5Pi(u), 3Sigma(u)(+), 3Pi(u), and 1Pi(u) have been calculated. A set of parameters characterizing these interactions has been determined. Good agreement between calculated and experimental predissociation widths and shifts has been obtained for all the three isotopic molecules.

  13. Coal bunker, B123 off starboard side of boiler room B3. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Coal bunker, B-123 off starboard side of boiler room B-3. Compartment B-19 looking fore to aft into bunker C-101; note construction details of hull framing and protective deck at top of photograph. Bunkers loaded with coal surrounded the boiler room and afforded protection in addition to the coffer dam and armored protective deck. Note watertight door at lower center right. This could be lowered to cut off the bunker in the event of hull penetration. (053) - USS Olympia, Penn's Landing, 211 South Columbus Boulevard, Philadelphia, Philadelphia County, PA

  14. Genome-wide identification and analysis of the B3 superfamily of transcription factors in Brassicaceae and major crop plants.

    PubMed

    Peng, Fred Y; Weselake, Randall J

    2013-05-01

    The plant-specific B3 superfamily of transcription factors has diverse functions in plant growth and development. Using a genome-wide domain analysis, we identified 92, 187, 58, 90, 81, 55, and 77 B3 transcription factor genes in the sequenced genome of Arabidopsis, Brassica rapa, castor bean (Ricinus communis), cocoa (Theobroma cacao), soybean (Glycine max), maize (Zea mays), and rice (Oryza sativa), respectively. The B3 superfamily has substantially expanded during the evolution in eudicots particularly in Brassicaceae, as compared to monocots in the analysis. We observed domain duplication in some of these B3 proteins, forming more complex domain architectures than currently understood. We found that the length of B3 domains exhibits a large variation, which may affect their exact number of α-helices and β-sheets in the core structure of B3 domains, and possibly have functional implications. Analysis of the public microarray data indicated that most of the B3 gene pairs encoding Arabidopsis-rice orthologs are preferentially expressed in different tissues, suggesting their different roles in these two species. Using ESTs in crops, we identified many B3 genes preferentially expressed in reproductive tissues. In a sequence-based quantitative trait loci analysis in rice and maize, we have found many B3 genes associated with traits such as grain yield, seed weight and number, and protein content. Our results provide a framework for future studies into the function of B3 genes in different phases of plant development, especially the ones related to traits in major crops. PMID:23377560

  15. CYP709B3, a cytochrome P450 monooxygenase gene involved in salt tolerance in Arabidopsis thaliana

    PubMed Central

    2013-01-01

    Background Within the Arabidopsis genome, there are 272 cytochrome P450 monooxygenase (P450) genes. However, the biological functions of the majority of these P450s remain unknown. The CYP709B family of P450s includes three gene members, CYP709B1, CYP709B2 and CYP709B3, which have high amino acid sequence similarity and lack reports elucidating biological functions. Results We identified T-DNA insertion-based null mutants of the CYP709B subfamily of genes. No obvious morphological phenotypes were exhibited under normal growth conditions. When the responses to ABA and salt stress were studied in these mutants, only the cyp709b3 mutant showed sensitivity to ABA and salt during germination. Under moderate salt treatment (150 mM NaCl), cyp709b3 showed a higher percentage of damaged seedlings, indicating a lower tolerance to salt stress. CYP709B3 was highly expressed in all analyzed tissues and especially high in seedlings and leaves. In contrast, CYP709B1 and CYP709B2 were highly expressed in siliques, but were at very low levels in other tissues. Under salt stress condition, CYP709B3 gene expression was induced after 24 hr and remained at high expression level. Expression of the wild type CYP709B3 gene in the cyp709b3 mutant fully complemented the salt intolerant phenotype. Furthermore, metabolite profiling analysis revealed some differences between wild type and cyp709b3 mutant plants, supporting the salt intolerance phenotype of the cyp709b3 mutant. Conclusions These results suggest that CYP709B3 plays a role in ABA and salt stress response and provides evidence to support the functions of cytochrome P450 enzymes in plant stress response. PMID:24164720

  16. Radiation resistance of nonlinear LiB3O5 crystals: optical properties

    NASA Astrophysics Data System (ADS)

    Ogorodnikov, I. N.; Kruzhalov, A. V.; Porotnikov, A. V.

    1997-02-01

    This paper presents the results of study of the radiation stability of LiB3O5 (LBO) crystals with regard to optical properties. LBO crystals of the high optical quality were studied under action of an electron beam with energy of 0.2 - 10 MeV, x-rays, and polarized synchrotron radiation of a high intensity. Both the trapped electron (B2) and hole (O-) centers were revealed and their optical manifestations were studied in detail. In particular, the strong radiation-induced optical absorption band at lambda equals 306 nm, extending up to the spectral region of the second harmonic (at about 532 nm), was attributed to the optical transitions inside the O- center. The accumulation of defects over the dose region between 1010 and 5 multiplied by 1016 electrons per cm2 was measured. The accumulation curve at 77 K exhibits two well-defined flux regions: 1010-1014 and 1014- 1016 electrons per cm2. The paper discusses the origin of radiation degradation of LiB3O5 optical properties.

  17. Raman spectroscopy of the borate mineral ameghinite NaB3O3(OH)4

    NASA Astrophysics Data System (ADS)

    Frost, Ray L.; Xi, Yunfei

    2012-10-01

    The molecular structure of the sodium borate mineral ameghinite NaB3O3(OH)4 has been determined by the use of vibrational spectroscopy. The crystal structure consists of isolated [B3O3(OH)4]- units formed by one tetrahedron and two triangles. H bonds and Na atoms link these polyanions to form a three-dimensional framework. The Raman spectrum is dominated by an intense band at 1027 cm-1, attributed to BO stretching vibrations of both the trigonal and tetrahedral boron. A series of Raman bands at 1213, 1245 and 1281 cm-1 are ascribed to BOH in-plane bending modes. The infrared spectra are characterized by strong overlap of broad multiple bands. An intense Raman band found at 620 cm-1 is attributed to the bending modes of trigonal and tetrahedral boron. Multiple Raman bands in the OH stretching region are observed at 3206, 3249 and 3385 cm-1. Raman spectroscopy coupled with infrared spectroscopy has enabled aspects about the molecular structure of the borate mineral ameghinite to be assessed.

  18. Roles of EphB3/Ephrin-B1 Interactions in Feather Morphogenesis

    PubMed Central

    Suksaweang, Sanong; Jiang, Ting-Xin; Roybal, Paul; Chuong, Cheng-Ming; Widelitz, Randall

    2013-01-01

    Background The Eph receptor tyrosine kinases and their ephrin ligands are involved in morphogenesis during organ formation. Methods We studied their role in feather morphogenesis, focusing on ephrin-B1 and its receptor EphB3. Results Early in feather development ephrin-B1 is expressed in the dermal condensation, not inter-bud mesenchyme. Later, in feather buds, it is in both epithelium and mesenchyme. In the feather follicle, it is enriched in the feather filament epithelium and marginal plate that sets the boundary between barb ridges. EphB3 also is expressed in epithelia. In the feather bud, its expression is restricted to the posterior bud. In the follicle, its expression forms a circle at the bud base which may set the boundary between bud and inter-bud domains. Perturbation with ephrin-B1-Fc altered feather primordia segregation and feather bud elongation. Conclusion Analyses reveal ephrin-B1-Fc caused three types of changes: blurred placode boundaries with loose dermal condensations, incomplete follicle invagination with less compact dermal papillae, and aberrant barb ridge patterning in feather filament morphogenesis. Thus, while ephrin-B1 suppression does not inhibit the initial emergence of a new epithelial domain, Eph/ephrin-B1 interaction is required for its proper completion. We propose that interaction between ephrin B1 and its receptor is involved in boundary stabilization during feather morphogenesis. PMID:23319347

  19. Ephrin-B2 and ephrin-B3 as functional henipavirus receptors.

    PubMed

    Xu, Kai; Broder, Christopher C; Nikolov, Dimitar B

    2012-02-01

    Members of the ephrin cell-surface protein family interact with the Eph receptors, the largest family of receptor tyrosine kinases, mediating bi-directional signaling during tumorogenesis and various developmental events. Surprisingly, ephrin-B2 and -B3 were recently identified as entry receptors for henipaviruses, emerging zoonotic paramyxoviruses responsible for repeated outbreaks in humans and animals in Australia, Southeast Asia, India and Bangladesh. Nipah virus (NiV) and Hendra virus (HeV) are the only two identified members in the henipavirus genus. While the initial human infection cases came from contact with infected pigs (NiV) or horses (HeV), in the more recent outbreaks of NiV both food-borne and human-to-human transmission were reported. These characteristics, together with high mortality and morbidity rates and lack of effective anti-viral therapies, make the henipaviruses a potential biological-agent threat. Viral entry is an important target for the development of anti-viral drugs. The entry of henipavirus is initiated by the attachment of the viral G envelope glycoprotein to the host cell receptors ephrin-B2 and/or -B3, followed by activation of the F fusion protein, which triggers fusion between the viral envelop and the host membrane. We review recent progress in the study of henipavirus entry, particularly the identification of ephrins as their entry receptors, and the structural characterization of the ephrin/Henipa-G interactions. PMID:22227101

  20. Mycobacterium tuberculosis WhiB3 maintains redox homeostasis by regulating virulence lipid anabolism to modulate macrophage response.

    PubMed

    Singh, Amit; Crossman, David K; Mai, Deborah; Guidry, Loni; Voskuil, Martin I; Renfrow, Matthew B; Steyn, Adrie J C

    2009-08-01

    The metabolic events associated with maintaining redox homeostasis in Mycobacterium tuberculosis (Mtb) during infection are poorly understood. Here, we discovered a novel redox switching mechanism by which Mtb WhiB3 under defined oxidizing and reducing conditions differentially modulates the assimilation of propionate into the complex virulence polyketides polyacyltrehaloses (PAT), sulfolipids (SL-1), phthiocerol dimycocerosates (PDIM), and the storage lipid triacylglycerol (TAG) that is under control of the DosR/S/T dormancy system. We developed an in vivo radio-labeling technique and demonstrated for the first time the lipid profile changes of Mtb residing in macrophages, and identified WhiB3 as a physiological regulator of virulence lipid anabolism. Importantly, MtbDeltawhiB3 shows enhanced growth on medium containing toxic levels of propionate, thereby implicating WhiB3 in detoxifying excess propionate. Strikingly, the accumulation of reducing equivalents in MtbDeltawhiB3 isolated from macrophages suggests that WhiB3 maintains intracellular redox homeostasis upon infection, and that intrabacterial lipid anabolism functions as a reductant sink. MtbDeltawhiB3 infected macrophages produce higher levels of pro- and anti-inflammatory cytokines, indicating that WhiB3-mediated regulation of lipids is required for controlling the innate immune response. Lastly, WhiB3 binds to pks2 and pks3 promoter DNA independent of the presence or redox state of its [4Fe-4S] cluster. Interestingly, reduction of the apo-WhiB3 Cys thiols abolished DNA binding, whereas oxidation stimulated DNA binding. These results confirmed that WhiB3 DNA binding is reversibly regulated by a thiol-disulfide redox switch. These results introduce a new paradigmatic mechanism that describes how WhiB3 facilitates metabolic switching to fatty acids by regulating Mtb lipid anabolism in response to oxido-reductive stress associated with infection, for maintaining redox balance. The link between the WhiB3

  1. A connection between pre-mRNA splicing and the cell cycle in fission yeast: cdc28+ is allelic with prp8+ and encodes an RNA-dependent ATPase/helicase.

    PubMed Central

    Lundgren, K; Allan, S; Urushiyama, S; Tani, T; Ohshima, Y; Frendewey, D; Beach, D

    1996-01-01

    The fission-yeast gene cdc28+ was originally identified in a screen for temperature-sensitive mutants that exhibit a cell-division cycle arrest and was found to be required for mitosis. We undertook a study of this gene to understand more fully the general requirements for entry into mitosis. Cells carrying the conditional lethal cdc28-P8 mutation divide once and arrest in G2 after being shifted to the restrictive temperature. We cloned the cdc28+ gene by complementation of the temperature-sensitive growth arrest in cdc28-P8. DNA sequence analysis indicated that cdc28+ encodes a member of the DEAH-box family of putative RNA-dependent ATPases or helicases. The Cdc28 protein is most similar to the Prp2, Prp16, and Prp22 proteins from budding yeast, which are required for the splicing of mRNA precursors. Consistent with this similarity, the cdc28-P8 mutant accumulates unspliced precursors at the restrictive temperature. Independently, we isolated a temperature-sensitive pre-mRNA splicing mutant prp8-1 that exhibits a cell-cycle phenotype identical to that of cdc28-P8. We have shown that cdc28 and prp8 are allelic. These results suggest a connection between pre-mRNA splicing and progression through the cell cycle. Images PMID:8862522

  2. Cooperative Roles of Fish Protein Kinase Containing Z-DNA Binding Domains and Double-Stranded RNA-Dependent Protein Kinase in Interferon-Mediated Antiviral Response▿†

    PubMed Central

    Liu, Ting-Kai; Zhang, Yi-Bing; Liu, Ying; Sun, Fan; Gui, Jian-Fang

    2011-01-01

    The double-stranded RNA (dsRNA)-dependent protein kinase (PKR) inhibits protein synthesis by phosphorylating eukaryotic translation initiation factor 2α (eIF2α). In fish species, in addition to PKR, there exists a PKR-like protein kinase containing Z-DNA binding domains (PKZ). However, the antiviral role of fish PKZ and the functional relationship between fish PKZ and PKR remain unknown. Here we confirmed the coexpression of fish PKZ and PKR proteins in Carassius auratus blastula embryonic (CAB) cells and identified them as two typical interferon (IFN)-inducible eIF2α kinases, both of which displayed an ability to inhibit virus replication. Strikingly, fish IFN or all kinds of IFN stimuli activated PKZ and PKR to phosphorylated eIF2α. Overexpression of both fish kinases together conferred much more significant inhibition of virus replication than overexpression of either protein, whereas morpholino knockdown of both made fish cells more vulnerable to virus infection than knockdown of either. The antiviral ability of fish PKZ was weaker than fish PKR, which correlated with its lower ability to phosphorylate eIF2α than PKR. Moreover, the independent association of fish PKZ or PKR reveals that each of them formed homodimers and that fish PKZ phosphorylated eIF2α independently on fish PKR and vice versa. These results suggest that fish PKZ and PKR play a nonredundant but cooperative role in IFN antiviral response. PMID:21937641

  3. The Dictyostelium discoideum RNA-dependent RNA polymerase RrpC silences the centromeric retrotransposon DIRS-1 post-transcriptionally and is required for the spreading of RNA silencing signals

    PubMed Central

    Wiegand, Stephan; Meier, Doreen; Seehafer, Carsten; Malicki, Marek; Hofmann, Patrick; Schmith, Anika; Winckler, Thomas; Földesi, Balint; Boesler, Benjamin; Nellen, Wolfgang; Reimegård, Johan; Käller, Max; Hällman, Jimmie; Emanuelsson, Olof; Avesson, Lotta; Söderbom, Fredrik; Hammann, Christian

    2014-01-01

    Dictyostelium intermediate repeat sequence 1 (DIRS-1) is the founding member of a poorly characterized class of retrotransposable elements that contain inverse long terminal repeats and tyrosine recombinase instead of DDE-type integrase enzymes. In Dictyostelium discoideum, DIRS-1 forms clusters that adopt the function of centromeres, rendering tight retrotransposition control critical to maintaining chromosome integrity. We report that in deletion strains of the RNA-dependent RNA polymerase RrpC, full-length and shorter DIRS-1 messenger RNAs are strongly enriched. Shorter versions of a hitherto unknown long non-coding RNA in DIRS-1 antisense orientation are also enriched in rrpC– strains. Concurrent with the accumulation of long transcripts, the vast majority of small (21 mer) DIRS-1 RNAs vanish in rrpC– strains. RNASeq reveals an asymmetric distribution of the DIRS-1 small RNAs, both along DIRS-1 and with respect to sense and antisense orientation. We show that RrpC is required for post-transcriptional DIRS-1 silencing and also for spreading of RNA silencing signals. Finally, DIRS-1 mis-regulation in the absence of RrpC leads to retrotransposon mobilization. In summary, our data reveal RrpC as a key player in the silencing of centromeric retrotransposon DIRS-1. RrpC acts at the post-transcriptional level and is involved in spreading of RNA silencing signals, both in the 5′ and 3′ directions. PMID:24369430

  4. Interaction between the RNA-dependent ATPase and poly(A) polymerase subunits of the TRAMP complex is mediated by short peptides and important for snoRNA processing

    PubMed Central

    Losh, Jillian S.; King, Alejandra Klauer; Bakelar, Jeremy; Taylor, Lacy; Loomis, John; Rosenzweig, Jason A.; Johnson, Sean J.; van Hoof, Ambro

    2015-01-01

    The RNA exosome is one of the main 3′ to 5′ exoribonucleases in eukaryotic cells. Although it is responsible for degradation or processing of a wide variety of substrate RNAs, it is very specific and distinguishes between substrate and non-substrate RNAs as well as between substrates that need to be 3′ processed and those that need to be completely degraded. This specificity does not appear to be determined by the exosome itself but rather by about a dozen other proteins. Four of these exosome cofactors have enzymatic activity, namely, the nuclear RNA-dependent ATPase Mtr4, its cytoplasmic paralog Ski2 and the nuclear non-canonical poly(A) polymerases, Trf4 and Trf5. Mtr4 and either Trf4 or Trf5 assemble into a TRAMP complex. However, how these enzymes assemble into a TRAMP complex and the functional consequences of TRAMP complex assembly remain unknown. Here, we identify an important interaction site between Mtr4 and Trf5, and show that disrupting the Mtr4/Trf interaction disrupts specific TRAMP and exosome functions, including snoRNA processing. PMID:25589546

  5. Interaction between the RNA-dependent ATPase and poly(A) polymerase subunits of the TRAMP complex is mediated by short peptides and important for snoRNA processing.

    PubMed

    Losh, Jillian S; King, Alejandra Klauer; Bakelar, Jeremy; Taylor, Lacy; Loomis, John; Rosenzweig, Jason A; Johnson, Sean J; van Hoof, Ambro

    2015-02-18

    The RNA exosome is one of the main 3′ to 5′ exoribonucleases in eukaryotic cells. Although it is responsible for degradation or processing of a wide variety of substrate RNAs, it is very specific and distinguishes between substrate and non-substrate RNAs as well as between substrates that need to be 3′ processed and those that need to be completely degraded. This specificity does not appear to be determined by the exosome itself but rather by about a dozen other proteins. Four of these exosome cofactors have enzymatic activity, namely, the nuclear RNA-dependent ATPase Mtr4, its cytoplasmic paralog Ski2 and the nuclear non-canonical poly(A) polymerases, Trf4 and Trf5. Mtr4 and either Trf4 or Trf5 assemble into a TRAMP complex. However, how these enzymes assemble into a TRAMP complex and the functional consequences of TRAMP complex assembly remain unknown. Here, we identify an important interaction site between Mtr4 and Trf5, and show that disrupting the Mtr4/Trf interaction disrupts specific TRAMP and exosome functions, including snoRNA processing. PMID:25589546

  6. A novel europium (III) nitridoborate Eu3[B3N6]: Synthesis, crystal structure, magnetic properties, and Raman spectra

    NASA Astrophysics Data System (ADS)

    Aydemir, Umut; Kokal, Ilkin; Prots, Yurii; Förster, Tobias; Sichelschmidt, Jörg; Schappacher, Falko M.; Pöttgen, Rainer; Ormeci, Alim; Somer, Mehmet

    2016-07-01

    A novel europium (III) nitridoborate, Eu3[B3N6], was successfully synthesized by oxidation of Eu3II[BN2]2 with Br2 at 1073 K. The compound crystallizes in the trigonal space group R 3 barc (No:167) with a=11.9370(4) Å, c=6.8073(4) Å, and Z=6. The crystal structure of Eu3[B3N6] consists of isolated, planar cyclic [B3N6]9- units which are charge-balanced by Eu3+ cations. The oxidation state of Eu was investigated by Mössbauer spectroscopy, electron spin resonance (ESR) spectroscopy, and quantum chemical calculations. The 151Eu Mössbauer spectroscopic measurement at 77 K reveals that the main signal at δ=0.93(7) mm/s is originating from trivalent Europium. Eu3[B3N6] showed no ESR signal in accordance with a non-magnetic (J=0) 7F0 ground state of the 4f6 configuration. Quantum chemical calculations find six electrons in the 4f subshell (4f6) of Eu indicating an oxidation state of +3. We present for the first time the vibrational spectra of a compound with cyclic trimer [B3N6]9- moieties. The Raman spectrum of Eu3[B3N6] is in good agreement with the predicted number of modes for the spectroscopically relevant cyclic [B3N6]9- group with D3h symmetry.

  7. Genetic characterization of human coxsackievirus A6 variants associated with atypical hand, foot and mouth disease: a potential role of recombination in emergence and pathogenicity.

    PubMed

    Gaunt, Eleanor; Harvala, Heli; Österback, Riikka; Sreenu, Vattipally B; Thomson, Emma; Waris, Matti; Simmonds, Peter

    2015-05-01

    Human coxsackievirus A6 (CVA6) is an enterically transmitted enterovirus. Until recently, CVA6 infections were considered as being of minor clinical significance, and only rarely aetiologically linked with hand, foot and mouth disease (HFMD) associated with other species A enteroviruses (particularly EV71 and CVA16). From 2008 onwards, however, CVA6 infections have been associated with several outbreaks worldwide of atypical HFMD (aHFMD) accompanied by a varicelliform rash. We recently reported CVA6-associated eczema herpeticum occurring predominantly in children and young adults in Edinburgh in January and February 2014. To investigate genetic determinants of novel clinical phenotypes of CVA6, we genetically characterized and analysed CVA6 variants associated with eczema herpeticum in Edinburgh in 2014 and those with aHFMD in CAV isolates collected from 2008. A total of eight recombinant forms (RFs) have circulated worldwide over the past 10 years, with the particularly recent appearance of RF-H associated with eczema herpeticum cases in Edinburgh in 2014. Comparison of phylogenies and divergence of complete genome sequences of CVA6 identified recombination breakpoints in 2A-2C, within VP3, and between 5' untranslated region and VP1. A Bayesian temporal reconstruction of CVA6 evolution since 2004 provided estimates of dates and the actual recombination events that generated more recently appearing recombination groups (RF-E, -F, -G and -H). Associations were observed between recombination groups and clinical presentations of herpangina, aHFMD and eczema herpeticum, but not with VP1 or other structural genes. These observations provided evidence that NS gene regions may potentially contribute to clinical phenotypes and outcomes of CVA6 infection. PMID:25614593

  8. Genetic characterization of human coxsackievirus A6 variants associated with atypical hand, foot and mouth disease: a potential role of recombination in emergence and pathogenicity

    PubMed Central

    Gaunt, Eleanor; Harvala, Heli; Österback, Riikka; Sreenu, Vattipally B.; Thomson, Emma; Waris, Matti

    2015-01-01

    Human coxsackievirus A6 (CVA6) is an enterically transmitted enterovirus. Until recently, CVA6 infections were considered as being of minor clinical significance, and only rarely aetiologically linked with hand, foot and mouth disease (HFMD) associated with other species A enteroviruses (particularly EV71 and CVA16). From 2008 onwards, however, CVA6 infections have been associated with several outbreaks worldwide of atypical HFMD (aHFMD) accompanied by a varicelliform rash. We recently reported CVA6-associated eczema herpeticum occurring predominantly in children and young adults in Edinburgh in January and February 2014. To investigate genetic determinants of novel clinical phenotypes of CVA6, we genetically characterized and analysed CVA6 variants associated with eczema herpeticum in Edinburgh in 2014 and those with aHFMD in CAV isolates collected from 2008. A total of eight recombinant forms (RFs) have circulated worldwide over the past 10 years, with the particularly recent appearance of RF-H associated with eczema herpeticum cases in Edinburgh in 2014. Comparison of phylogenies and divergence of complete genome sequences of CVA6 identified recombination breakpoints in 2A–2C, within VP3, and between 5′ untranslated region and VP1. A Bayesian temporal reconstruction of CVA6 evolution since 2004 provided estimates of dates and the actual recombination events that generated more recently appearing recombination groups (RF-E, -F, -G and -H). Associations were observed between recombination groups and clinical presentations of herpangina, aHFMD and eczema herpeticum, but not with VP1 or other structural genes. These observations provided evidence that NS gene regions may potentially contribute to clinical phenotypes and outcomes of CVA6 infection. PMID:25614593

  9. Single-step concentration and purification of adenoviruses by coxsackievirus-adenovirus receptor-binding capture and elastin-like polypeptide-mediated precipitation.

    PubMed

    Wu, Qian; Liu, Wenjun; Xu, Bi; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang

    2016-02-01

    A single-step method for quick concentration and purification of adenoviruses (Ads) was established by combining coxsackievirus and adenovirus receptor (CAR)-binding capture with elastin-like polypeptide (ELP)-mediated precipitation. The soluble ELP-CAR fusion protein was expressed in vector-transformed E. coli and purified to high purity by two rounds of inverse transition cycling (ITC). After demonstration of the specific binding of fusion protein, a recombinant Ad (rAd), namely rAd/GFP, was pulled down from the culture medium and extract of rAd-transduced cells using ELP-CAR protein, with recovery of 76.2 % and 73.3 %, respectively. The rAd was eluted from the ELP-CAR protein and harvested by one round of ITC, with recoveries ranging from 30.6 % to 34.5 % (virus titration assay). Both ELP-CAR-bound and eluted rAds were able to transduce CAR-positive cells, but not CAR-negative cells (fluorescent microscopy). A further viral titration assay showed that the ELP-CAR-bound rAd/GFP had significantly lower transduction efficiency than the eluted rAd, and there was less of a decrease when tested in the presence of fetal bovine serum. In addition, rAd/GFP was efficiently recovered from the "spiked" PBS and tap water with recovery of ~74 % or ~60 %. This work demonstrates the usefulness of the ELP-CAR-binding capture method for concentration and/or purification of Ads in cellular and environmental samples. PMID:26526147

  10. Novel recombinant chimeric virus-like particle is immunogenic and protective against both enterovirus 71 and coxsackievirus A16 in mice.

    PubMed

    Zhao, Hui; Li, Hao-Yang; Han, Jian-Feng; Deng, Yong-Qiang; Zhu, Shun-Ya; Li, Xiao-Feng; Yang, Hui-Qin; Li, Yue-Xiang; Zhang, Yu; Qin, E-De; Chen, Rong; Qin, Cheng-Feng

    2015-01-01

    Hand-foot-and-mouth disease (HFMD) has been recognized as an important global public health issue, which is predominantly caused by enterovirus 71 (EV-A71) and coxsackievirus A16 (CVA16). There is no available vaccine against HFMD. An ideal HFMD vaccine should be bivalent against both EV-A71 and CVA16. Here, a novel strategy to produce bivalent HFMD vaccine based on chimeric EV-A71 virus-like particles (ChiEV-A71 VLPs) was proposed and illustrated. The neutralizing epitope SP70 within the capsid protein VP1 of EV-A71 was replaced with that of CVA16 in ChiEV-A71 VLPs. Structural modeling revealed that the replaced CVA16-SP70 epitope is well exposed on the surface of ChiEV-A71 VLPs. These VLPs produced in Saccharomyces cerevisiae exhibited similarity in both protein composition and morphology as naive EV-A71 VLPs. Immunization with ChiEV-A71 VLPs in mice elicited robust Th1/Th2 dependent immune responses against EV-A71 and CVA16. Furthermore, passive immunization with anti-ChiEV-A71 VLPs sera conferred full protection against lethal challenge of both EV-A71 and CVA16 infection in neonatal mice. These results suggested that this chimeric vaccine, ChiEV-A71 might have the potential to be further developed as a bivalent HFMD vaccine in the near future. Such chimeric enterovirus VLPs provide an alternative platform for bivalent HFMD vaccine development. PMID:25597595

  11. Virus-inhibiting activity of dihydroquercetin, a flavonoid from Larix sibirica, against coxsackievirus B4 in a model of viral pancreatitis.

    PubMed

    Galochkina, Anastasia V; Anikin, Vadim B; Babkin, Vasily A; Ostrouhova, Liudmila A; Zarubaev, Vladimir V

    2016-04-01

    Members of the family Picornaviridae, in particular, enteroviruses, represent a serious threat to human health. They are responsible for numerous pathologies ranging from mild disease to fatal outcome. Due to the limited number of safe and effective antivirals against enteroviruses, there is a need for search and development of novel drugs with various mechanisms of activity against enteroviruses-induced pathologies. We studied the effect of dihydroquercetin (DHQ), a flavonoid from larch wood, on the course of pancreatitis of white mice caused by coxsackievirus B4 (CVB4). DHQ was applied intraperitoneally at doses of 75 or 150 mg/kg/day once a day for 5 days postinfection (p.i.) starting on day 1 p.i., and its effect was compared to that of the reference compound ribavirin. The application of DHQ resulted in a dose-dependent decrease in the virus titer in pancreatic tissue, reaching, at the highest dose, 2.4 logs on day 5 p.i. Also, the application of DHQ led to restoration of antioxidant activity of pancreatic tissue that was impaired in the course of pancreatitis. Morphologically, pancreatic tissue of DHQ-treated animals demonstrated less infiltration with inflammatory cells and no signs of tissue destruction compared to placebo-treated mice. Both ribavirin- and DHQ-treated animals developed fewer foci of pancreatic inflammation per mouse, and these foci contained fewer infiltrating cells than those in placebo-treated mice. The effect of DHQ was comparable to or exceeded that of ribavirin. Taken together, our results suggest high antiviral activity of DHQ and its promising potential in complex treatment of viral pancreatitis. PMID:26780775

  12. Coxsackievirus group B type 3 infection upregulates expression of monocyte chemoattractant protein 1 in cardiac myocytes, which leads to enhanced migration of mononuclear cells in viral myocarditis.

    PubMed

    Shen, Yan; Xu, Wei; Chu, Yi-Wei; Wang, Ying; Liu, Quan-Sheng; Xiong, Si-Dong

    2004-11-01

    Coxsackievirus group B type 3 (CVB3) is an important cause of viral myocarditis. The infiltration of mononuclear cells into the myocardial tissue is one of the key events in viral myocarditis. Immediately after CVB3 infects the heart, the expression of chemokine(s) by infected myocardial cells may be the first trigger for inflammatory infiltration and immune response. However, it is unknown whether CVB3 can induce the chemokine expression in cardiac myocytes. Monocyte chemoattractant protein 1 (MCP-1) is a potent chemokine that stimulates the migration of mononuclear cells. The objective of the present study was to investigate the effect of CVB3 infection on MCP-1 expression in murine cardiac myocytes and the role of MCP-1 in migration of mononuclear cells in viral myocarditis. Our results showed that the expression of MCP-1 was significantly increased in cardiac myocytes after wild-type CVB3 infection in a time- and dose-dependent manner, which resulted in enhanced migration of mononuclear cells in mice with viral myocarditis. The migration of mononuclear cells was partially abolished by antibodies specific for MCP-1 in vivo and in vitro. Administration of anti-MCP-1 antibody prevented infiltration of mononuclear cells bearing the MCP-1 receptor CCR2 in mice with viral myocarditis. Infection by UV-irradiated CVB3 induced rapid and transient expression of MCP-1 in cardiac myocytes. In conclusion, our results indicate that CVB3 infection stimulates the expression of MCP-1 in myocardial cells, which subsequently leads to migration of mononuclear cells in viral myocarditis. PMID:15507642

  13. Paeoniflorin Potentiates the Inhibitory Effects of Erlotinib in Pancreatic Cancer Cell Lines by Reducing ErbB3 Phosphorylation.

    PubMed

    Hao, Jian; Yang, Xue; Ding, Xiu-Li; Guo, Lei-Ming; Zhu, Cui-Hong; Ji, Wei; Zhou, Tong; Wu, Xiong-Zhi

    2016-01-01

    Blockade of the epidermal growth factor receptor (EGFR) by EGFR tyrosine kinase inhibitors is insufficient for effective anti-tumor activity because the reactivation of the ErbB3 signaling pathway significantly contributes to activating the consequent phosphoinositide 3-kinase (PI3K)/Akt signaling pathway. Combinatorial therapies including ErbB3 targeting may ameliorate tumor responses to anti-EGFR therapies. In the present study, we found that in BxPC-3 and L3.6pl cells, which highly expressed the ErbB3 receptor, significant reduction in cell viability, induction of apoptosis were observed when treated with a combination of erlotinib and PF compared to either agent alone. Moreover, in ErbB3-expressing BxPC-3, L3.6pl and S2VP10 cell lines, the inhibition of ErbB3/PI3K/Akt phosphorylation were observed when treated with PF. Most strikingly, both EGFR/MAPK/Erk and ErbB3/PI3K/Akt activitions were substantially suppressed when treated with the combination of PF and erlotinib. However, in the ErbB3-deficient cell line MIAPaCa-2, no such effects were observed with similar treatments. Most importantly, these in vitro results were replicated in nude mouse transplanted tumor models. Taken together, our findings show that PF enhances the effect of erlotinib in ErbB3-expressing pancreatic cancer cells by directly suppressing ErbB3 activation, and PF in combination with erlotinib is much more effective as an antitumor agent compared with either agent alone. PMID:27609096

  14. Paeoniflorin Potentiates the Inhibitory Effects of Erlotinib in Pancreatic Cancer Cell Lines by Reducing ErbB3 Phosphorylation

    PubMed Central

    Hao, Jian; Yang, Xue; Ding, Xiu-li; Guo, Lei-ming; Zhu, Cui-hong; Ji, Wei; Zhou, Tong; Wu, Xiong-zhi

    2016-01-01

    Blockade of the epidermal growth factor receptor (EGFR) by EGFR tyrosine kinase inhibitors is insufficient for effective anti-tumor activity because the reactivation of the ErbB3 signaling pathway significantly contributes to activating the consequent phosphoinositide 3-kinase (PI3K)/Akt signaling pathway. Combinatorial therapies including ErbB3 targeting may ameliorate tumor responses to anti-EGFR therapies. In the present study, we found that in BxPC-3 and L3.6pl cells, which highly expressed the ErbB3 receptor, significant reduction in cell viability, induction of apoptosis were observed when treated with a combination of erlotinib and PF compared to either agent alone. Moreover, in ErbB3-expressing BxPC-3, L3.6pl and S2VP10 cell lines, the inhibition of ErbB3/PI3K/Akt phosphorylation were observed when treated with PF. Most strikingly, both EGFR/MAPK/Erk and ErbB3/PI3K/Akt activitions were substantially suppressed when treated with the combination of PF and erlotinib. However, in the ErbB3-deficient cell line MIAPaCa-2, no such effects were observed with similar treatments. Most importantly, these in vitro results were replicated in nude mouse transplanted tumor models. Taken together, our findings show that PF enhances the effect of erlotinib in ErbB3-expressing pancreatic cancer cells by directly suppressing ErbB3 activation, and PF in combination with erlotinib is much more effective as an antitumor agent compared with either agent alone. PMID:27609096

  15. High-frequency variations of hydrogen spectral lines in the B3V star η UMa

    NASA Astrophysics Data System (ADS)

    Pokhvala, S. M.

    2015-09-01

    We reported the detection of high-frequency variations in the hydrogen Balmer lines in the hot star η UMa of spectral class B3V. Spectral observations of η UMa were carried out with slitless spectrograph (R˜100) installed on the 60 cm Carl Zeiss telescope in the Andrushivka Observatory. Spectra were obtained with a time resolution in the sub-second range. It has been found that the η UMa shows rapid variations in the hydrogen lines Hα, Hβ, Hγ, as well as variations in the atmospheric oxygen lines. The intensity variations in the hydrogen lines varies from 0.2% to 0.5% , and that of the oxygen lines is approximately 2%.

  16. A promising birefringent crystal Ba2Na3(B3O6)2F

    NASA Astrophysics Data System (ADS)

    Wang, Xing; Xia, Mingjun; Li, R. K.

    2014-12-01

    Bulk crystals of Ba2Na3(B3O6)2F (BNBF) have been successfully grown by top-seeded solution growth (TSSG) technique. Its transmittance spectra show a wide transparency range from 186 nm to 3000 nm. The refractive indices in 13 wavelengths were measured with high accuracy and the Sellmeier equations were obtained, which demonstrated that the title crystal displayed a birefringence (Δn = 0.1030 at 588 nm) comparable to that of the commercial birefringent crystal α-BBO (the high temperature form of BaB2O4). A prototype Glan-Taylor polarizer made of BNBF prisms was fabricated, which showed high transparency and large optical extinction ratio similar to the commercial polarizer made of α-BBO. In addition, BNBF crystal is less moisture sensitive than that of α-BBO, thus BNBF can be a potential new birefringent crystal.

  17. Growth and morphology of large LiB 3 O 5 single crystals

    NASA Astrophysics Data System (ADS)

    Nikolov, I.; Perlov, D.; Livneh, S.; Sanchez, E.; Czechowicz, P.; Kondilenko, V.; Loiacono, D.

    2011-09-01

    LiB 3O 5 (LBO) is one of the most widely used nonlinear optical crystals, therefore the growth of large high quality boules is of major significance to the photonics industry. In the past, LBO single crystals were limited in both size and quality, the latter of which was primarily due to the presence of bubbles, flux inclusions and striations. Furthermore, commercially available material exhibited variable optical absorption. In this research we have perfected the Top-Seeded Solution Growth (TSSG) technique for the growth of LBO single crystals from MoO 3-based fluxes. This particular growth process was developed through a thorough study of melt dynamics. Based on the results observed in our modeling experiments, the major growth parameters were optimized. The crystal morphology was modified in order to increase the material yield and eliminate inclusions. As a result we have achieved LBO single crystals of both size and quality, which we believe to be market leading.

  18. Nucleation, growth and characterization of LiB 3O 5 single crystals

    NASA Astrophysics Data System (ADS)

    Kannan, C. V.; Kimura, H.; Miyazaki, A.; Ramasamy, P.

    2005-02-01

    Nucleation parameters of LiB 3O 5 (LBO) that crystallized from high-temperature solution using two different solvents, namely boron oxide (B 2O 3) and molybdate (MoO 3), have been studied for better understanding of the growth process. Our results showed that B 2O 3 solvent yielded a larger value of metastable zone width than that of molybdate flux, thus giving more stability to the solution. Based on our theoretical considerations, inclusion-free LBO crystals have been grown by spontaneous nucleation and TSSG techniques using B 2O 3 solvent. Variation of optical absorption coefficient and refractive indices with wavelength has been studied. Results of optical and mechanical properties showed that the grown crystals are highly transparent and possesses hardness higher than that of KTP crystal.

  19. Collisional processes in the O2 B 3Σu- state

    NASA Astrophysics Data System (ADS)

    Sick, Volker; Decker, Michael; Heinze, Johannes; Stricker, Winfried

    1996-02-01

    Collisional processes, which influence quantitative laser-induced fluorescence (LIF) measurements involving the B3Σ u- state of molecular oxygen, were investigated. Since the B state is strongly predissociating, these processes are though to be important only at higher pressure. However, we found that in LIF experiments in methane/air flames in the pressure range between atmospheric pressure and 40 bar collisional quenching and rotational energy transfer (RET) are important even at moderate pressures. Total quenching cross sections of 30(± 10) Å2for ν' = 2 and 100(± 30) Å2for ν = 0 and total RET cross sections of 40(± 16) Å2 were found. An upper limit of 0.7 Å 2 for the cross section for vibrational energy transfer (VET) out of ν' = 2 could be determined.

  20. Negative linear compressibility in a crystal of α-BiB3O6.

    PubMed

    Kang, Lei; Jiang, Xingxing; Luo, Siyang; Gong, Pifu; Li, Wei; Wu, Xiang; Li, Yanchun; Li, Xiaodong; Chen, Chuangtian; Lin, Zheshuai

    2015-01-01

    Negative linear compressibility (NLC), a rare and important mechanical effect with many application potentials, in a crystal of α-BiB3O6 (BIBO) is comprehensively investigated using first-principles calculations and high-pressure synchrotron X-ray diffraction experiments. The results indicate that the BIBO crystal exhibits the second largest NLC among all known inorganic materials over a broad pressure range. This unusual NLC behaviour is due to the rotation and displacement of the rigid [BO3] and [BO4] building units that result in hinge motion in an umbrella-like topology. More importantly, the parallel-polar lone-pair electrons on the Bi(3+) cations act as "umbrella stands" to withstand the B-O hinges, thus significantly enhancing the NLC effect. BIBO presents a unique example of a "collapsible umbrella" mechanism for achieving NLC, which could be applied to other framework materials with lone-pair electrons. PMID:26305262