Sample records for cronbach alpha coefficient

  1. The Impact of Outliers on Cronbach's Coefficient Alpha Estimate of Reliability: Visual Analogue Scales

    ERIC Educational Resources Information Center

    Liu, Yan; Zumbo, Bruno D.

    2007-01-01

    The impact of outliers on Cronbach's coefficient [alpha] has not been documented in the psychometric or statistical literature. This is an important gap because coefficient [alpha] is the most widely used measurement statistic in all of the social, educational, and health sciences. The impact of outliers on coefficient [alpha] is investigated for…

  2. The Impact of Outliers on Cronbach's Coefficient Alpha Estimate of Reliability: Ordinal/Rating Scale Item Responses

    ERIC Educational Resources Information Center

    Liu, Yan; Wu, Amery D.; Zumbo, Bruno D.

    2010-01-01

    In a recent Monte Carlo simulation study, Liu and Zumbo showed that outliers can severely inflate the estimates of Cronbach's coefficient alpha for continuous item response data--visual analogue response format. Little, however, is known about the effect of outliers for ordinal item response data--also commonly referred to as Likert, Likert-type,…

  3. Minimum Sample Size for Cronbach's Coefficient Alpha: A Monte-Carlo Study

    ERIC Educational Resources Information Center

    Yurdugul, Halil

    2008-01-01

    The coefficient alpha is the most widely used measure of internal consistency for composite scores in the educational and psychological studies. However, due to the difficulties of data gathering in psychometric studies, the minimum sample size for the sample coefficient alpha has been frequently debated. There are various suggested minimum sample…

  4. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  5. Exact Distributions of Intraclass Correlation and Cronbach's Alpha with Gaussian Data and General Covariance

    ERIC Educational Resources Information Center

    Kistner, Emily O.; Muller, Keith E.

    2004-01-01

    Intraclass correlation and Cronbach's alpha are widely used to describe reliability of tests and measurements. Even with Gaussian data, exact distributions are known only for compound symmetric covariance (equal variances and equal correlations). Recently, large sample Gaussian approximations were derived for the distribution functions. New exact…

  6. Treating Cronbach's Alpha Reliability Coefficients as Data in Counseling Research

    ERIC Educational Resources Information Center

    Helms, Janet E.; Henze, Kevin T.; Sass, Terry L.; Mifsud, Venus A.

    2006-01-01

    Scientific associations and measurement experts in psychology and education have voiced various standards and best-practice recommendations concerning reliability data over the years. Yet in the counseling psychology literature, there is virtually no single-source compilation and articulation of good practices for reporting, analyzing, and…

  7. My Current Thoughts on Coefficient Alpha and Successor Procedures

    ERIC Educational Resources Information Center

    Cronbach, Lee J.; Shavelson, Richard J.

    2004-01-01

    In 1997, noting that the 50th anniversary of the publication of "Coefficient Alpha and the Internal Structure of Tests" was fast approaching, Lee Cronbach planned what have become the notes published here. His aim was to point out the ways in which his views on coefficient alpha had evolved, doubting now that the coefficient was the best way of…

  8. Testing the Difference between Two Alpha Coefficients with Small Samples of Subjects and Raters

    ERIC Educational Resources Information Center

    Feldt, Leonard S.; Kim, Seonghoon

    2006-01-01

    Researchers sometimes need a statistical test of the hypothesis that two values of Cronbach's alpha reliability coefficient are equal. The situation may involve scores from two different measures administered to independent random samples or from the same measure administered to random samples from two different populations. Feldt derived a test…

  9. A Direct Latent Variable Modeling Based Method for Point and Interval Estimation of Coefficient Alpha

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A direct approach to point and interval estimation of Cronbach's coefficient alpha for multiple component measuring instruments is outlined. The procedure is based on a latent variable modeling application with widely circulated software. As a by-product, using sample data the method permits ascertaining whether the population discrepancy…

  10. Coefficient Alpha: A Reliability Coefficient for the 21st Century?

    ERIC Educational Resources Information Center

    Yang, Yanyun; Green, Samuel B.

    2011-01-01

    Coefficient alpha is almost universally applied to assess reliability of scales in psychology. We argue that researchers should consider alternatives to coefficient alpha. Our preference is for structural equation modeling (SEM) estimates of reliability because they are informative and allow for an empirical evaluation of the assumptions…

  11. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  12. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  13. Meta-Analysis of Coefficient Alpha

    ERIC Educational Resources Information Center

    Rodriguez, Michael C.; Maeda, Yukiko

    2006-01-01

    The meta-analysis of coefficient alpha across many studies is becoming more common in psychology by a methodology labeled reliability generalization. Existing reliability generalization studies have not used the sampling distribution of coefficient alpha for precision weighting and other common meta-analytic procedures. A framework is provided for…

  14. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  15. Bayesian Statistical Inference for Coefficient Alpha. ACT Research Report Series.

    ERIC Educational Resources Information Center

    Li, Jun Corser; Woodruff, David J.

    Coefficient alpha is a simple and very useful index of test reliability that is widely used in educational and psychological measurement. Classical statistical inference for coefficient alpha is well developed. This paper presents two methods for Bayesian statistical inference for a single sample alpha coefficient. An approximate analytic method…

  16. Sample Size Requirements for Testing and Estimating Coefficient Alpha.

    ERIC Educational Resources Information Center

    Bonett, Douglas G.

    2002-01-01

    Derived an approximate test and confidence interval for coefficient alpha and used the approximate test and confidence interval to derive closed-form sample size formulas that can be used to determine the sample size needed to test coefficient alpha with desired power or to test coefficient alpha with desired precision. (SLD)

  17. A Clarification of the Effects of Rapid Guessing on Coefficient [Alpha]: A Note on Attali's "Reliability of Speeded Number-Right Multiple-Choice Tests"

    ERIC Educational Resources Information Center

    Wise, Steven L.; DeMars, Christine E.

    2009-01-01

    Attali (2005) recently demonstrated that Cronbach's coefficient [alpha] estimate of reliability for number-right multiple-choice tests will tend to be deflated by speededness, rather than inflated as is commonly believed and taught. Although the methods, findings, and conclusions of Attali (2005) are correct, his article may inadvertently invite a…

  18. Asymptotically Distribution-Free (ADF) Interval Estimation of Coefficient Alpha

    ERIC Educational Resources Information Center

    Maydeu-Olivares, Alberto; Coffman, Donna L.; Hartmann, Wolfgang M.

    2007-01-01

    The point estimate of sample coefficient alpha may provide a misleading impression of the reliability of the test score. Because sample coefficient alpha is consistently biased downward, it is more likely to yield a misleading impression of poor reliability. The magnitude of the bias is greatest precisely when the variability of sample alpha is…

  19. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  20. Correlated Errors in True Score Models and Their Effect on Coefficient Alpha.

    ERIC Educational Resources Information Center

    Green, Samuel B.; Hershberger, Scott L.

    2000-01-01

    Proposes true score models that can account for correlated errors and their effect on coefficient alpha. These models allow random measurement errors on earlier items to affect directly or indirectly the scores on later items. Conditions under which coefficient alpha may yield spuriously high estimates or reliability are discussed. (SLD)

  1. A Review of Coefficient Alpha and Some Basic Tenets of Classical Measurement Theory.

    ERIC Educational Resources Information Center

    Guthrie, Abbie C.

    Too many researchers speak of "the reliability of the test," thus indicating their basic misunderstanding of reliability. This paper explains classical reliability and the score features that influence coefficient alpha. It explains when coefficient alpha can be negative, even though it is conceptually a variance-accounted-for statistic. The…

  2. A Note on the Estimator of the Alpha Coefficient for Standardized Variables Under Normality

    ERIC Educational Resources Information Center

    Hayashi, Kentaro; Kamata, Akihito

    2005-01-01

    The asymptotic standard deviation (SD) of the alpha coefficient with standardized variables is derived under normality. The research shows that the SD of the standardized alpha coefficient becomes smaller as the number of examinees and/or items increase. Furthermore, this research shows that the degree of the dependence of the SD on the number of…

  3. Hardy-Littlewood theorem for trigonometric series with {alpha}-monotone coefficients

    SciTech Connect

    Dyachenko, Mikhail I [M. V. Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Moscow (Russian Federation); Nursultanov, Erlan D [Kazakhstan Branch of Lomonosov Moscow State University, Astana (Kazakhstan)

    2009-12-31

    The Hardy-Littlewood theorem is established for trigonometric series with {alpha}-monotone coefficients. Inequalities of Hardy-Littlewood kind are proved. Examples of series demonstrating that the results obtained are sharp are constructed. Bibliography: 15 titles.

  4. ScoreRel CI: An Excel Program for Computing Confidence Intervals for Commonly Used Score Reliability Coefficients

    Microsoft Academic Search

    J. Jackson Barnette

    2005-01-01

    An Excel program developed to assist researchers in the determination and presentation of confidence intervals around commonly used score reliability coefficients is described. The software includes programs to determine confidence intervals for Cronbach’s alpha, Pearson r-based coefficients such as those used in test-retest and alternate forms situations, split-half, and Cohen’s 2 × 2 unweighted Kappa. The general basis for the

  5. The estimation of the IRT reliability coefficient and its lower and upper bounds, with comparisons to CTT reliability statistics

    Microsoft Academic Search

    Seonghoon KimLeonard; Leonard S. Feldt

    2010-01-01

    The primary purpose of this study is to investigate the mathematical characteristics of the test reliability coefficient ?\\u000a XX? as a function of item response theory (IRT) parameters and present the lower and upper bounds of the coefficient. Another\\u000a purpose is to examine relative performances of the IRT reliability statistics and two classical test theory (CTT) reliability\\u000a statistics (Cronbach’s alpha

  6. Bias of Coefficient Alpha for Fixed Congeneric Measures with Correlated Errors.

    ERIC Educational Resources Information Center

    Raykov, Tenko

    2001-01-01

    Studied the population discrepancy of coefficient alpha from the composite reliability coefficient for fixed congeneric measures with correlated errors and expressed it in terms of parameters of the measures. Recommends structural equation modeling for identifying cases in which the discrepancy can be large. (SLD)

  7. Understanding Internal Consistency Reliability Estimates: A Conceptual Primer on Coefficient Alpha.

    ERIC Educational Resources Information Center

    Henson, Robin K.

    2001-01-01

    Although often ignored, reliability is critical when interpreting study effects and test results. Accordingly, this article focuses on the most commonly used estimate of reliability, internal consistency coefficients, with emphasis on coefficient alpha. An interpretive framework is provided for applied researchers and others seeking a conceptual…

  8. SIMREL: Software for Coefficient Alpha and Its Confidence Intervals with Monte Carlo Studies

    ERIC Educational Resources Information Center

    Yurdugul, Halil

    2009-01-01

    This article describes SIMREL, a software program designed for the simulation of alpha coefficients and the estimation of its confidence intervals. SIMREL runs on two alternatives. In the first one, if SIMREL is run for a single data file, it performs descriptive statistics, principal components analysis, and variance analysis of the item scores…

  9. A Study of the Distribution of Sample Coefficient Alpha with the Hopkins Symptom Checklist: Bootstrap versus Asymptotics.

    ERIC Educational Resources Information Center

    Yuan, Ke-Hai; Guarnaccia, Charles A.; Hayslip, Bert, Jr.

    2003-01-01

    Studied the sample coefficient alpha for each of the five subscales of the Hopkins Symptom Checklist (HSL; L. Derogaitis and others, 1974) in a sample of 419 adults. Findings show that the normal-theory-based distribution has a systematic bias in describing the behavior of the sample coefficient alpha. (SLD)

  10. Confidence Intervals For Maximized Alpha Coefficients: An Evaluation of Joe and Woodward's Procedures and an Alternative Method.

    ERIC Educational Resources Information Center

    Hakstian, A. Ralph; And Others

    1980-01-01

    The procedures yielding confidence intervals for maximized alpha coefficients of Joe and Woodward are reviewed. Confidence interval procedures of Whalen and Masson are next reviewed. Results are then presented of a Monte Carlo investigation of the procedures. (Author/CTM)

  11. [Estimators of internal consistency in health research: the use of the alpha coefficient].

    PubMed

    Cascaes da Silva, Franciele; Gonçalves, Elizandra; Valdivia Arancibia, Beatriz Angélica; Bento, Gisele Graziele; Silva Castro, Thiago Luis da; Soleman Hernandez, Salma Stephany; Silva, Rudney da

    2015-03-01

    Academic production has increased in the area of health, increasingly demanding high quality in publications of great impact. One of the ways to consider quality is through methods that increase the consistency of data analysis, such as reliability which, depending on the type of data, can be evaluated by different coefficients, especially the alpha coefficient. Based on this, the present review systematically gathers scientific articles produced in the last five years, which in a methodological manner gave the ? coefficient psychometric use as an estimator of internal consistency and reliability in the processes of construction, adaptation and validation of instruments. The identification of the studies was conducted systematically in the databases BioMed Central Journals, Web of Science, Wiley Online Library, Medline, SciELO, Scopus, Journals@Ovid, BMJ and Springer, using inclusion and exclusion criteria. Data analyses were performed by means of triangulation, content analysis and descriptive analysis. It was found that most studies were conducted in Iran (f=3), Spain (f=2) and Brazil (f=2). These studies aimed to test the psychometric properties of instruments, with eight studies using the ? coefficient to assess reliability and nine for assessing internal consistency. All studies were classified as methodological research when their objectives were analyzed. In addition, four studies were also classified as correlational and one as descriptive-correlational. It can be concluded that though the ? coefficient is widely used as one of the main parameters for assessing internal consistency of questionnaires in health sciences, its use as an estimator of trust of the methodology used and internal consistency has some critiques that should be considered. PMID:26102116

  12. Conformational changes of PYP monitored by diffusion coefficient: effect of N-terminal alpha-helices.

    PubMed

    Khan, Javaid Shahbaz; Imamoto, Yasushi; Harigai, Miki; Kataoka, Mikio; Terazima, Masahide

    2006-05-15

    Conformational changes in the light illuminated intermediate (pB) of photoactive yellow protein (PYP) were studied from a viewpoint of the diffusion coefficient (D) change of several N-truncated PYPs, which lacked the N-terminal 6, 15, or 23 amino acid residues (T6, T15, and T23, respectively). For intact PYP (i-PYP), D of pB (D(pB)) was approximately 11% lower than that (D(pG)) of the ground state (pG) species. The difference in D (D(pG) - D(pB)) decreased upon cleavage of the N-terminal region in the order of i-PYP>T6>T15>T23. This trend clearly showed that conformational change in the N-terminal group is the main reason for the slower diffusion of pB. This slower diffusion was interpreted in terms of the unfolding of the two alpha-helices in the N-terminal region, increasing the intermolecular interactions due to hydrogen bonding with water molecules. The increase in friction per one residue by the unfolding of the alpha-helix was estimated to be 0.3 x 10(-12) kg/s. The conformational change in the N-terminal group upon photoillumination is discussed. PMID:16500975

  13. Study of the absorption coefficient of alpha particles to lower hybrid waves in tokamak

    NASA Astrophysics Data System (ADS)

    Wang, Jianbing; Zhang, Xianmei; Yu, Limin; Zhao, Xiang

    2014-02-01

    Part of the energy of the Lower Hybrid (LH) waves may be absorbed by the ? particles via the so-called perpendicular landau damping mechanism, which depends on various parameters of fusion reactors and the LH waves. In this article, we calculate the absorption coefficient ?? of LH waves due to ? particles. Results show that, the ?? increases with the parallel refraction index n? while deceases with increasing the frequency of LH waves ?LH over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption, and there is a peak value of ?? when ne?8×1019m-3 for ITER-like scenario. The thermal corrections to the cold plasma dispersion relation will change the damping rate to a certain extent under some specific conditions. We have also evaluated the fraction of LH power absorbed by the alpha particles, ? ? 0.47% and 4.1% for an LH frequency of 5 GHz and 3.7 GHz respectively for ITER-like scenario. This work gives the effective reference for the choice of parameters of future fusion reactors.

  14. Study of the absorption coefficient of alpha particles to lower hybrid waves in tokamak

    SciTech Connect

    Wang, Jianbing, E-mail: zhangxm@ecust.edu.cn; Zhang, Xianmei, E-mail: zhangxm@ecust.edu.cn; Yu, Limin, E-mail: zhangxm@ecust.edu.cn; Zhao, Xiang, E-mail: zhangxm@ecust.edu.cn [Department of Physics, East China University of Science and Technology, P.O. Box 385, Shanghai 200237 (China)

    2014-02-12

    Part of the energy of the Lower Hybrid (LH) waves may be absorbed by the ? particles via the so-called perpendicular landau damping mechanism, which depends on various parameters of fusion reactors and the LH waves. In this article, we calculate the absorption coefficient ?{sub ?} of LH waves due to ? particles. Results show that, the ?{sub ?} increases with the parallel refraction index n{sub ?} while deceases with increasing the frequency of LH waves ?{sub LH} over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption, and there is a peak value of ?{sub ?} when n{sub e}?8×10{sup 19}m{sup ?3} for ITER-like scenario. The thermal corrections to the cold plasma dispersion relation will change the damping rate to a certain extent under some specific conditions. We have also evaluated the fraction of LH power absorbed by the alpha particles, ? ? 0.47% and 4.1% for an LH frequency of 5 GHz and 3.7 GHz respectively for ITER-like scenario. This work gives the effective reference for the choice of parameters of future fusion reactors.

  15. A Monte Carlo Study of Eight Confidence Interval Methods for Coefficient Alpha

    ERIC Educational Resources Information Center

    Romano, Jeanine L.; Kromrey, Jeffrey D.; Hibbard, Susan T.

    2010-01-01

    The purpose of this research is to examine eight of the different methods for computing confidence intervals around alpha that have been proposed to determine which of these, if any, is the most accurate and precise. Monte Carlo methods were used to simulate samples under known and controlled population conditions. In general, the differences in…

  16. Comparison of aerodynamic coefficients obtained from theoretical calculations wind tunnel tests and flight tests data reduction for the alpha jet aircraft

    NASA Technical Reports Server (NTRS)

    Guiot, R.; Wunnenberg, H.

    1980-01-01

    The methods by which aerodynamic coefficients are determined and discussed. These include: calculations, wind tunnel experiments and experiments in flight for various prototypes of the Alpha Jet. A comparison of obtained results shows good correlation between expectations and in-flight test results.

  17. Classification of shallow-water acoustic signals via alpha-Stable modeling of the one-dimensional wavelet coefficients

    E-print Network

    Tsakalides, Panagiotis

    Classification of shallow-water acoustic signals via alpha-Stable modeling of the one is presented for the classification of shallow water acoustic signals according to the environmental parameters for inverse procedures in underwater acoustics aiming at the recovery of the geoacoustic parameters

  18. Methodological problems in the retrospective computation of responsiveness to change: The lesson of Cronbach

    Microsoft Academic Search

    Geoffrey R. Norman; Paul Stratford; Glenn Regehr

    1997-01-01

    Objective: To examine the relation between responsiveness coefficients derived directly from a calculation of average change resulting from a treatment intervention (Responsiveness-Treatment or RT) and those derived from retrospective analysis of changed and unchanged groups (Responsiveness Retrospective or RR) based on a global measure of change. Method: Two approaches were used. First, we used simulation methods to examine the analytical

  19. Confidence Interval Methods for Coefficient Alpha on the Basis of Discrete, Ordinal Response Items: Which One, If Any, Is the Best?

    ERIC Educational Resources Information Center

    Romano, Jeanine L.; Kromrey, Jeffrey D.; Owens, Corina M.; Scott, Heather M.

    2011-01-01

    In this study, the authors aimed to examine 8 of the different methods for computing confidence intervals around alpha that have been proposed to determine which of these, if any, is the most accurate and precise. Monte Carlo methods were used to simulate samples under known and controlled population conditions wherein the underlying item…

  20. Infrared spectra and molar absorption coefficients of the 20 alpha amino acids in aqueous solutions in the spectral range from 1800 to 500 cm -1

    NASA Astrophysics Data System (ADS)

    Wolpert, Martina; Hellwig, Petra

    2006-07-01

    In this work, we present the absorption spectra and molar coefficients of all 20 amino acids in aqueous solutions down to 500 cm -1. The spectral region between 1200 and 500 cm -1 was yet disregarded for protein infrared spectroscopy, mainly due to the strong H 2O absorption. Absorption spectra were obtained mainly for physiological relevant pH region. Intense bands for aromatic amino acids, histidine and such with OH group could clearly be identified throughout the given spectral region. For sulfur-containing amino acids cysteine and methionine some strong bands besides the weak carbon-sulfur stretching vibration was shown. Effects of aqueous solution environment, pH, protonation states were discussed, together with previously reported data from theoretical approaches. With this complete set of spectral information application to proteins in the whole mid infrared region could be described precise and the potential of the lower spectral region to study typical cofactor ligands like histidine, shown.

  1. Constraining the 6.05 MeV 0$^+$ and 6.13 MeV 3$^-$ cascade transitions in the $^{12}$C($\\alpha$,$\\gamma$)$^{16}$O reaction using the Asymptotic Normalization Coefficients

    E-print Network

    Avila, M L; Koshchiy, E; Baby, L T; Belarge, J; Kemper, K W; Kuchera, A N; Mukhamedzhanov, A M; Santiago-Gonzalez, D; Uberseder, E

    2014-01-01

    Background. The $^{12}$C($\\alpha,\\gamma$)$^{16}$O reaction plays a fundamental role in astrophysics because its cross section near 300 keV in c.m. determines the $^{12}$C/$^{16}$O ratio at the end of the helium burning stage of stellar evolution. The astrophysically desired accuracy of better than 10\\% has not been achieved. Cascade $\\gamma$ transitions through the excited states of $^{16}$O are contributing to the uncertainty. Purpose. To measure the Asymptotic Normalization Coefficients (ANCs) for the 0$^+$ (6.05 MeV) and 3$^-$ (6.13 MeV) excited states in $^{16}$O and provide constraints on the cross section for the corresponding cascade transitions. Method. The ANCs were measured using the $\\alpha$-transfer reaction $^{12}$C($^6$Li,$d$)$^{16}$O performed at sub-Coulomb energies for both the entrance and exit channels. Results. The ANCs for the 0$^+$(6.05 MeV), 3$^-$(6.13 MeV), 2$^+$(6.92 MeV) and 1$^-$(7.12 MeV) states in $^{16}$O have been measured. The contribution of the 0$^+$ and 3$^-$ cascade transit...

  2. Modeling Biot's Coefficient for High Porosity Sediments From P Wave Velocity and Density Data

    Microsoft Academic Search

    I. L. Fabricius

    2006-01-01

    The effective stress coefficient predicts to which extent the fluid pressure in a given sediment counteracts the load of overlying sediments. When monitoring changes in fluid pressure and fluid composition from seismic data, the effective stress coefficient may be approximated by Biot's coefficient, alpha. alpha is under assumption of hydrostatic stress and linear elasticity defined as: alpha = 1 -

  3. Transport coefficients of gluonic fluid

    SciTech Connect

    Das, Santosh K.; Alam, Jan-e [Variable Energy Cyclotron Centre, 1/AF, Bidhan Nagar, Kolkata-700064 (India)

    2011-06-01

    The shear ({eta}) and bulk ({zeta}) viscous coefficients have been evaluated for a gluonic fluid. The elastic, gg{yields}gg and the inelastic, number nonconserving, gg{yields}ggg processes have been considered as the dominant perturbative processes in evaluating the viscous coefficients to entropy density (s) ratios. Recently the processes: gg{yields}ggg has been revisited and a correction to the widely used Gunion-Bertsch (GB) formula has been obtained. The {eta} and {zeta} have been evaluated for gluonic fluid with the formula recently derived. At large {alpha}{sub s} the value of {eta}/s approaches its lower bound, {approx}1/4{pi}.

  4. Eddy mixing coefficient on Saturn

    NASA Technical Reports Server (NTRS)

    Atreya, S. K.

    1982-01-01

    Data on the composition, thermal structure, and Lyman-alpha dayglow of Saturn, when analyzed in conjunction with photochemical models of the hydrocarbons and the atomic hydrogen production, yield the homopause value of the eddy diffusion coefficient to be approximately 100 million/sq cm per sec. The equatorial value of the eddy diffusion coefficient at the homopause of Saturn is thus found to be approximately 100 times greater than on Jupiter. The mesosphere (and presumably, troposphere) of Saturn appears to be considerably more turbulent than the upper atmosphere of Jupiter.

  5. Alpha Thalassemia

    MedlinePLUS

    ... the anemia. Normal alpha globin genes found on chromosome 16 People who do not produce enough alpha ... by four genes, two on each strand of chromosome 16. Individuals who have one or two abnormal ...

  6. A parametric study of planform and aeroelastic effects on aerodynamic center, alpha- and q- stability derivatives. Appendix C: Method for computing the aerodynamic influence coefficient matrix of nonplanar wing-body-tail configurations

    NASA Technical Reports Server (NTRS)

    Roskam, J.

    1972-01-01

    Expressions are derived for computing the aerodynamic influence coefficient matrix for nonplanar wing-body-tail configurations. An aerodynamic influence coefficient is defined as the load in lbs. induced on a panel as a result of a unit angle of attack on another panel. Fuselage, wing and tail thickness are assumed to be small with the result that the thickness effect on the flow-field is negligible. The method for determining the aerodynamic influence coefficient matrix is based on the lifting solution to the small perturbation, steady potential flow equation.

  7. Transport coefficients of gluonic fluid

    E-print Network

    Santosh K Das; Jan-e Alam

    2011-06-14

    The shear ($\\eta$) and bulk ($\\zeta$) viscous coefficients have been evaluated for a gluonic fluid. The elastic, $gg \\rightarrow gg$ and the inelastic, number non-conserving, $gg\\rightarrow ggg$ processes have been considered as the dominant perturbative processes in evaluating the viscous co-efficients to entropy density ($s$) ratios. Recently the processes: $gg \\rightarrow ggg$ has been revisited and a correction to the widely used Gunion-Bertsch (GB) formula has been obtained. The $\\eta$ and $\\zeta$ have been evaluated for gluonic fluid with the formula derived recently. The sensitivity of the quantity, $\\eta/s$ on the running coupling constant is also discussed. At $\\alpha_s=0.3$ we get $\\eta/s=0.24$ which is close to the value obtained from the analysis of the elliptic flow at RHIC experiments.

  8. Alpha Particle

    Microsoft Academic Search

    P. Murdin

    2000-01-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  9. A parametric study of planform and aeroelastic effects on aerodynamic center, alpha- and q- stability derivatures. Appendix B: Method for computing the strucutral influence coefficient matrix of nonplanar wing body tail configurations

    NASA Technical Reports Server (NTRS)

    Roskam, J.; Smith, H.; Gibson, G.

    1972-01-01

    The method used in computing the structural influence coefficient matrix of the computer program of Reference 1 (appendix A of the Summary Report) is reported. This matrix is computed for complete wing-body-tail configurations by assuming that all major airplane components can be structurally represented by a slender beam called the elastic axis. A structural influence coefficient is defined as the rotation about the Y-stability axis at panel j induced by a unit load on panel k. A description of how a structural breakdown is performed in detail is included.

  10. Statistical modeling of DCT coefficients for audio

    Microsoft Academic Search

    Cuiping Wang; Li Guo; Yifang Wei; Yujie Wang

    2010-01-01

    Based on the sharp-peak and heavy-tail of statistical distribution of discrete cosine transform (DCT) coefficients for audio, generalized Gaussian distribution (GGD) and alpha-stable distribution are usually employed as modeling tools. In this paper, the Kullback-Leibler Divergence is applied to measure the difference between modeling result and the true distribution, and the experiment results show that compared with alpha-stable distribution, the

  11. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/7/2011 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership William Root The Alpha Omega Alpha honor medical society was initially organized in 1902/community service. AA and Medical Professionalism "Be Worthy to Serve the Suffering" #12;Alpha Omega Alpha Honor

  12. Prediction of coefficients of thermal expansion for unidirectional composites

    NASA Technical Reports Server (NTRS)

    Bowles, David E.; Tompkins, Stephen S.

    1989-01-01

    Several analyses for predicting the longitudinal, alpha(1), and transverse, alpha(2), coefficients of thermal expansion of unidirectional composites were compared with each other, and with experimental data on different graphite fiber reinforced resin, metal, and ceramic matrix composites. Analytical and numerical analyses that accurately accounted for Poisson restraining effects in the transverse direction were in consistently better agreement with experimental data for alpha(2), than the less rigorous analyses. All of the analyses predicted similar values of alpha(1), and were in good agreement with the experimental data. A sensitivity analysis was conducted to determine the relative influence of constituent properties on the predicted values of alpha(1), and alpha(2). As would be expected, the prediction of alpha(1) was most sensitive to longitudinal fiber properties and the prediction of alpha(2) was most sensitive to matrix properties.

  13. Coefficient Estimates for Inverses of Starlike Functions of Positive Order

    Microsoft Academic Search

    G. P. Kapoor; A. K. Mishra

    2005-01-01

    In the present paper, the coefficient estimates are found for the class $\\\\mathcal S^{*-1}(\\\\alpha)$ consisting of inverses of functions in the class of univalent starlike functions of order $\\\\alpha$ in $\\\\mathcal D=\\\\{z\\\\in\\\\mathbb C:|z|<1\\\\}$. These estimates extend the work of {\\\\it Krzyz, Libera and Zlotkiewicz [Ann. Univ. Marie Curie-Sklodowska, 33(1979), 103-109]} who found sharp estimates on only first two coefficients for

  14. The generalized liquid drop model alpha-decay formula: Predictability analysis and superheavy element alpha half-lives

    Microsoft Academic Search

    N. Dasgupta-Schubert; Michael A. Reyes

    2007-01-01

    The predictive accuracy of the generalized liquid drop model (GLDM) formula for alpha-decay half-lives has been investigated in a detailed manner and a variant of the formula with improved coefficients is proposed. The method employs the experimental alpha half-lives of the well-known alpha standards to obtain the coefficients of the analytical formula using the experimental Q? values (the DSR-E formula),

  15. ALPHA OMEGA ALPHA National Honor Medical Society

    E-print Network

    12/6/2012 1 ALPHA OMEGA ALPHA National Honor Medical Society www.alphaomegaalpha.org AA and Leadership The Alpha Omega Alpha honor medical society was organized in 1902 to "recognize and perpetuate Omega Alpha Honor Medical Society Wisconsin beta Chapter All upcoming MCW seniors who are interested

  16. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  17. The $\\alpha-\\alpha$ fishbone potential revisited

    E-print Network

    Day, J P; Elhanafy, M; Smith, E; Woodhouse, R; Papp, Z

    2011-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $\\alpha-\\alpha$ fishbone potential by simultaneously fitting to two-$\\alpha$ resonance energies, experimental phase shifts and three-$\\alpha$ binding energies. We found that essentially a simple gaussian can provide a good description of two-$\\alpha$ and three-$\\alpha$ experimental data without invoking three-body potentials.

  18. Alpha One Foundation

    MedlinePLUS

    ... Support Find Doctor 20th Anniversary What Is Alpha-1? Alpha-1 Antitrypsin Deficiency (Alpha-1) is a ... daily treatment for COPD More News Our Number One Goal: Find a cure for Alpha-1. Website ...

  19. Sample Size Requirements for Comparing Two Alpha Coefficients.

    ERIC Educational Resources Information Center

    Bonnett, Douglas G.

    2003-01-01

    Derived general formulas to determine the sample size requirements for hypothesis testing with desired power and interval estimation with desired precision. Illustrated the approach with the example of a screening test for adolescent attention deficit disorder. (SLD)

  20. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  1. Ab initio alpha-alpha scattering

    E-print Network

    Serdar Elhatisari; Dean Lee; Gautam Rupak; Evgeny Epelbaum; Hermann Krebs; Timo A. Lähde; Thomas Luu; Ulf-G. Meißner

    2015-06-11

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  2. Ab initio alpha-alpha scattering

    E-print Network

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-01-01

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  3. Phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates

    SciTech Connect

    Mironova, A.A.; Soloshonok, I.V.; Maletina, I.I.; Orda, V.V.; Yagupol'skii, L.M.

    1988-08-20

    The reaction of difluoroiodo-/alpha/,/alpha/,/omega/-trihydrofluoroalkanes (I) with boron trifluoride and benzene gave phenyl-/alpha/,/alpha/,/omega/-trihydropolyfluoroalkyliodonium fluoroborates (II). It was established that the polyfluoroalkyl radical adds at the sulfur atom in reaction with p-chlorothiophenol, the N-polyfluoroalkylation product is formed with aniline, pyridine is polyfluoroalkylated at the nitrogen atom with the formation of a quaternary salt, and a mixture of products from polyfluoroalkylation at the nitrogen atom of the dimethylamino group and at the para position of the benzene ring is formed with dimethylaniline.

  4. Coefficients of univalent functions

    Microsoft Academic Search

    Peter L. Duren

    1977-01-01

    analytic and univalent in the unit disk \\\\z\\\\ < 1. This is the class of all univalent functions normalized by the conditions \\/(O) = 0 and \\/'(O) = 1. We shall concentrate on coefficient problems for the class S and for related classes, with emphasis on recent results and open problems. Most of the methods we shall describe have wide

  5. Turbulent MHD transport coefficients - An attempt at self-consistency

    NASA Technical Reports Server (NTRS)

    Chen, H.; Montgomery, D.

    1987-01-01

    In this paper, some multiple scale perturbation calculations of turbulent MHD transport coefficients begun in earlier papers are first completed. These generalize 'alpha effect' calculations by treating the velocity field and magnetic field on the same footing. Then the problem of rendering such calculations self-consistent is addressed, generalizing an eddy-viscosity hypothesis similar to that of Heisenberg for the Navier-Stokes case. The method also borrows from Kraichnan's direct interaction approximation. The output is a set of integral equations relating the spectra and the turbulent transport coefficients. Previous 'alpha effect' and 'beta effect' coefficients emerge as limiting cases. A treatment of the inertial range can also be given, consistent with a -5/3 energy spectrum power law. In the Navier-Stokes limit, a value of 1.72 is extracted for the Kolmogorov constant. Further applications to MHD are possible.

  6. Unequal electron and hole impact ionization coefficients in GaAs

    Microsoft Academic Search

    G. E. Stillman; C. M. Wolfe; J. A. Rossi; A. G. Foyt

    1974-01-01

    GaAs Schottky barrier avalanche photodiodes have been fabricated in which it is possible to achieve nearly pure hole and pure electron injection in the same device. Measurements of the multiplication characteristics of these devices show that the ionization coefficients of electrons (alpha) and holes (beta) are not equal and that beta>alpha. This result is in agreement with the variation of

  7. Statistical Considerations in Choosing a Test Reliability Coefficient. ACT Research Report Series, 2012 (10)

    ERIC Educational Resources Information Center

    Woodruff, David; Wu, Yi-Fang

    2012-01-01

    The purpose of this paper is to illustrate alpha's robustness and usefulness, using actual and simulated educational test data. The sampling properties of alpha are compared with the sampling properties of several other reliability coefficients: Guttman's lambda[subscript 2], lambda[subscript 4], and lambda[subscript 6]; test-retest reliability;…

  8. The Experimental Determination of Impact Ionization Coefficients in Gallium-Arsenide and Indium Phosphide

    Microsoft Academic Search

    Gary Eugene Bulman

    1983-01-01

    Impact ionization coefficients are important parameters for the understanding of high field transport in semiconductors. Previous determinations of the electron and hole impact ionization coefficients, (alpha) and (beta) respectively, in both GaAs and InP have been limited to narrow ranges of electric fields and are not in agreement. The results of extensive photocurrent multiplication measurements on both materials over a

  9. Alpha ash transport and ash control

    SciTech Connect

    Miley, G.H.; Hu, S.C.; Varadarajan, V.

    1990-01-01

    This paper discusses: thermal {alpha}-particle transport is a crucial issue in ash buildup. The transport will determine if buildup prevents ignition and if external control is necessary. Due to uncertainties in the transport coefficients, 1-1/2-D sensitivity study of the influence on the fusion power density is done using the BALDUR code. The Baldur simulations with varying diffusion coefficients for ash plasma are performed. The results of ash transport in the presence of sawteeth and varying edge conditions are discussed. Also, the nature of the fishbone oscillation in the presence of two hot species consisting of hot alphas and beam injected ions is discussed. The sawteeth and fishbones can be potential mechanisms for enhanced ash transport; the latter will indirectly influence the ash transport.

  10. Coefficients of associated Legendre functions

    NASA Technical Reports Server (NTRS)

    Peasley, Q. D.

    1976-01-01

    The exact coefficients for the explicit forms of the associated Legendre functions Pm for integer values of m,n=0,1,2,...25 are presented in tabular form together with two cross-referenced listings of the zeroes for these functions rounded to five decimal places. The unfactored coefficients and the interger coefficients are presented in adjacent columns for each function. The greatest common factor and divisor have been removed and listed separately for the integer coefficients.

  11. Similarity coefficients for binary data: properties of coefficients, coefficient matrices, multi-way metrics and multivariate coefficients

    Microsoft Academic Search

    Matthijs Joost Warrens

    2008-01-01

    In data analysis, an important role is played by similarity coefficients. A similarity coefficient is a measure of resemblance or association of two entities or variables. Similarity coefficients for binary data are used, for example, in biological ecology for measuring the degree of coexistence between two species type over different locations, or in psychology for a 2×2 reliability study where

  12. Drag Coefficient of Hexadecane Particles

    NASA Astrophysics Data System (ADS)

    Nakao, Yoshinobu; Hishida, Makoto; Kajimoto, Sadaaki; Tanaka, Gaku

    This paper deals with the drag coefficient of solidified hexadecane particles and their free rising velocity in liquid. The drag coefficient was experimentally investigated in Reynolds number range of about 40-300. The present experimental results are summarized in the following; (1) the drag coefficient of solidified hexadecane particles formed in liquid coolant by direct contact cooling is higher than that of a smooth surface sphere, this high drag coefficient seems to be attributed to the non-smooth surface of the solidified hexadecane particles, (2) experimental correlation for the drag coefficient of the solidified hexadecane particles was proposed, (3 ) the measured rising velocity of the solidified hexadecane particle agrees well with the calculated one, (4) the drag coefficients of hexadecane particles that were made by pouring hexadecane liquid into a solid hollow sphere agreed well with the drag coefficient of smooth surface sphere.

  13. Approximate formulation of redistribution in the Ly-alpha, Ly-beta, H-alpha system

    NASA Technical Reports Server (NTRS)

    Cooper, J.; Ballagh, R. J.; Hubeny, I.

    1989-01-01

    Simple approximate formulas are given for the coupled redistribution of Ly-alpha, Ly-beta, and H-alpha, by using well-defined approximations to an essentially exact formulation. These formulas incorporate all the essential physics including Raman scattering, lower state radiative decay, and correlated terms representing emission during a collision which must be retained in order that the emission coefficients are properly behaved in the line wings. Approximate expressions for the appropriate line broadening parameters are collected. Finally, practical expressions for the source functions are given. These are formulated through newly introduced nonimpact redistribution functions, which are shown to be reasonably approximated by existing (ordinary and generalized) redistribution functions.

  14. Ionization coefficients of electrons and holes in InP

    Microsoft Academic Search

    C. A. Armiento; S. H. Groves; C. E. Hurwitz

    1979-01-01

    Ionization coefficients of electrons and holes in InP have been determined experimentally from photomultiplication measurements with the 6328-A line of a He-Ne laser on abrupt-junction low-leakage np(+) InP avalanche photodiodes of inverted-mesa geometry. It is found that the ionization rate of holes (beta) is greater than that of electrons (alpha) and that the ionization-rate ratio varies with peak electric field

  15. The generalized liquid drop model alpha-decay formula: Predictability analysis and superheavy element alpha half-lives

    SciTech Connect

    Dasgupta-Schubert, N. [Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana de San Nicolas de Hidalgo, Cd. Universitaria, Morelia, Michoacan C.P. 58060 (Mexico)], E-mail: nita@ifm.umich.mx; Reyes, M.A. [Department of Electrical Engineering, University of Texas Pan American, Edinburg, TX 78539 (United States)

    2007-11-15

    The predictive accuracy of the generalized liquid drop model (GLDM) formula for alpha-decay half-lives has been investigated in a detailed manner and a variant of the formula with improved coefficients is proposed. The method employs the experimental alpha half-lives of the well-known alpha standards to obtain the coefficients of the analytical formula using the experimental Q{sub {alpha}} values (the DSR-E formula), as well as the finite range droplet model (FRDM) derived Q{sub {alpha}} values (the FRDM-FRDM formula). The predictive accuracy of these formulae was checked against the experimental alpha half-lives of an independent set of nuclei (TEST) that span approximately the same Z, A region as the standards and possess reliable alpha spectroscopic data, and were found to yield good results for the DSR-E formula but not for the FRDM-FRDM formula. The two formulae were used to obtain the alpha half-lives of superheavy elements (SHE) and heavy nuclides where the relative accuracy was found to be markedly improved for the FRDM-FRDM formula, which corroborates the appropriateness of the FRDM masses and the GLDM prescription for high Z, A nuclides. Further improvement resulted, especially for the FRDM-FRDM formula, after a simple linear optimization over the calculated and experimental half-lives of TEST was used to re-calculate the half-lives of the SHE and heavy nuclides. The advantage of this optimization was that it required no re-calculation of the coefficients of the basic DSR-E or FRDM-FRDM formulae. The half-lives for 324 medium-mass to superheavy alpha decaying nuclides, calculated using these formulae and the comparison with experimental half-lives, are presented.

  16. The SASS scattering coefficient algorithm

    NASA Astrophysics Data System (ADS)

    Bracalente, E. M.; Grantham, W. L.; Boggs, D. H.; Sweet, J. L.

    1980-04-01

    This paper describes the algorithms used to convert engineering unit data obtained from the Seasat-A satellite scatterometer (SASS) to radar scattering coefficients and associated supporting parameters. A description is given of the instrument receiver and related processing used by the scatterometer to measure signal power backscattered from the earth's surface. The applicable radar equation used for determining scattering coefficient is derived. Sample results of SASS data processed through current algorithm development facility (ADF) scattering coefficient algorithms are presented which include scattering coefficient values for both water and land surfaces. Scattering coefficient signatures for these two surface types are seen to have distinctly different characteristics. Scattering coefficient measurements of the Amazon rain forest indicate the usefulness of this type of data as a stable calibration reference target.

  17. Event counting alpha detector

    DOEpatents

    Bolton, Richard D. (Los Alamos, NM); MacArthur, Duncan W. (Los Alamos, NM)

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  18. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  19. Reexamination of the {alpha}-{alpha}''fishbone'' potential

    SciTech Connect

    Day, J. P.; McEwen, J. E.; Elhanafy, M.; Smith, E.; Woodhouse, R.; Papp, Z. [Department of Physics and Astronomy, California State University Long Beach, Long Beach, California (United States)

    2011-09-15

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the {alpha}-{alpha} fishbone potential by simultaneously fitting to two-{alpha} resonance energies, experimental phase shifts, and three-{alpha} binding energies. We found that, essentially, a simple Gaussian can provide a good description of two-{alpha} and three-{alpha} experimental data without invoking three-body potentials.

  20. Transformation of spherical harmonic coefficients to ellipsoidal harmonic coefficients

    Microsoft Academic Search

    D. Dechambre; D. J. Scheeres

    2002-01-01

    Analytical expressions linking spherical harmonics gravity field expansions with ellipsoidal harmonics gravity field expansions are developed. Certain symmetries and simplifications for the transformation between the two are noted. Using the expressions, a numerical approach is developed and applied for the computation of ellipsoidal harmonic gravity coefficients using spherical harmonics coefficients as inputs. This method can be used to transform a

  1. Prediction in random coefficient regression

    Microsoft Academic Search

    Rudolf Beran

    1995-01-01

    Random coefficient regression and autoregressive models are important in diverse applications such as the classical statistical analysis of random and mixed effects models, the modelling of certain econometric and biological time series, and as a means for image compression. This paper develops nonparametric prediction intervals for a random coefficient regression model. The construction of these intervals requires a consistent estimate

  2. The Percentage Bend Correlation Coefficient.

    ERIC Educational Resources Information Center

    Wilcox, Rand R.

    1994-01-01

    The percentage bend correlation coefficient is introduced as one way to address the problem that the usual correlation coefficient is highly nonrobust. While this method is not a replacement for the usual test, it can offer advantages in terms of power and Type I errors. (SLD)

  3. Heavy quark coefficient functions at asymptotic values $Q^2 \\gg m^2$

    E-print Network

    M. Buza; Y. Matiounine; J. Smith; R. Migneron; W. L. van Neerven

    1996-01-19

    In this paper we present the analytic form of the heavy-quark coefficient functions for deep-inelastic lepton-hadron scattering in the kinematical regime $Q^2 \\gg m^2$ . Here $Q^2$ and $m^2$ stand for the masses squared of the virtual photon and heavy quark respectively. The calculations have been performed up to next-to-leading order in the strong coupling constant $\\alpha_s$ using operator product expansion techniques. Apart from a check on earlier calculations, which however are only accessible via large computer programs, the asymptotic forms of the coefficient functions are useful for charm production at HERA when the condition $Q^2 \\gg m_c^2$ is satisfied. Furthermore the analytical expressions can also be used when one applies the variable heavy flavour scheme up to next-to-leading order in $\\alpha_s$.

  4. Negative coefficient of normal restitution.

    PubMed

    Müller, Patric; Krengel, Dominik; Pöschel, Thorsten

    2012-04-01

    This paper shows that negative coefficients of normal restitution occur inevitably when the interaction force between colliding particles is finite. We derive an explicit criterion showing that for any set of material properties there is always a collision geometry leading to negative restitution coefficients. While from a phenomenological point of view, negative coefficients of normal restitution appear rather artificial, this phenomenon is generic and implies an important overlooked limitation of the widely used hard sphere model. The criterion is explicitly applied to two paradigmatic situations: for the linear dashpot model and for viscoelastic particles. In addition, we show that for frictional particles the phenomenon is less pronounced than for smooth spheres. PMID:22680468

  5. Negative coefficient of normal restitution

    NASA Astrophysics Data System (ADS)

    Müller, Patric; Krengel, Dominik; Pöschel, Thorsten

    2012-04-01

    This paper shows that negative coefficients of normal restitution occur inevitably when the interaction force between colliding particles is finite. We derive an explicit criterion showing that for any set of material properties there is always a collision geometry leading to negative restitution coefficients. While from a phenomenological point of view, negative coefficients of normal restitution appear rather artificial, this phenomenon is generic and implies an important overlooked limitation of the widely used hard sphere model. The criterion is explicitly applied to two paradigmatic situations: for the linear dashpot model and for viscoelastic particles. In addition, we show that for frictional particles the phenomenon is less pronounced than for smooth spheres.

  6. Generalized exclusion processes: Transport coefficients.

    PubMed

    Arita, Chikashi; Krapivsky, P L; Mallick, Kirone

    2014-11-01

    A class of generalized exclusion processes with symmetric nearest-neighbor hopping which are parametrized by the maximal occupancy, k?1, is investigated. For these processes on hypercubic lattices we compute the diffusion coefficient in all spatial dimensions. In the extreme cases of k=1 (symmetric simple exclusion process) and k=? (noninteracting symmetric random walks) the diffusion coefficient is constant, while for 2?kcoefficient of self-diffusion. PMID:25493741

  7. Generalized exclusion processes: Transport coefficients

    NASA Astrophysics Data System (ADS)

    Arita, Chikashi; Krapivsky, P. L.; Mallick, Kirone

    2014-11-01

    A class of generalized exclusion processes with symmetric nearest-neighbor hopping which are parametrized by the maximal occupancy, k ?1 , is investigated. For these processes on hypercubic lattices we compute the diffusion coefficient in all spatial dimensions. In the extreme cases of k =1 (symmetric simple exclusion process) and k =? (noninteracting symmetric random walks) the diffusion coefficient is constant, while for 2 ?k coefficient of self-diffusion.

  8. Dynamic model with scale-dependent coefficients in the viscous range

    NASA Technical Reports Server (NTRS)

    Meneveau, C.; Lund, T. S.

    1996-01-01

    The standard dynamic procedure is based on the scale-invariance assumption that the model coefficient C is the same at the grid and test-filter levels. In many applications this condition is not met, e.g. when the filter-length, delta, approaches the Kolmogorov scale, and C(delta approaches eta) approaches O. Using a priori tests, we show that the standard dynamic model yields the coefficient corresponding to the test-filter scale (alpha delta) instead of the grid-scale (delta). Several approaches to account for scale dependence are examined and/or tested in large eddy simulation of isotropic turbulence: (a) take the limit alpha approaches 1; (b) solve for two unknown coefficients C(Delta) and C(alpha delta) in the least-square-error formulation; (c) the 'bi-dynamic model', in which two test-filters (e.g. at scales 2(delta) and 4(delta) are employed to gain additional information on possible scale-dependence of the coefficient, and an improved estimate for the grid-level coefficient is obtained by extrapolation, (d) use theoretical predictions for the ratio C(alpha delta)/C(delta) and dynamically solve for C(delta). None of these options is found to be entirely satisfactory, although the last approach appears applicable to the viscous range.

  9. Learning about Alpha-1 Antitrypsin Deficiency (AATD)

    MedlinePLUS

    ... terms used on this page Learning About Alpha-1 Antitrypsin Deficiency (AATD) What is alpha-1 antitrypsin ... for Alpha-1 Anttrypsin Deficiency What is alpha-1 antitrypsin defciency? Alpha-1 antitrypsin deficiency (AATD) is ...

  10. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  11. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  12. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. (a) Chemical substance...acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  13. Diffusion Coefficients in White Dwarfs

    NASA Astrophysics Data System (ADS)

    Saumon, D.; Starrett, C. E.; Daligault, J.

    2015-06-01

    Models of diffusion in white dwarfs universally rely on the coefficients calculated by Paquette et al. (1986). We present new calculations of diffusion coefficients based on an advanced microscopic theory of dense plasmas and a numerical simulation approach that intrinsically accounts for multiple collisions. Our method is validated against a state-of-the-art method and we present results for the diffusion of carbon ions in a helium plasma.

  14. Wrong Signs in Regression Coefficients

    NASA Technical Reports Server (NTRS)

    McGee, Holly

    1999-01-01

    When using parametric cost estimation, it is important to note the possibility of the regression coefficients having the wrong sign. A wrong sign is defined as a sign on the regression coefficient opposite to the researcher's intuition and experience. Some possible causes for the wrong sign discussed in this paper are a small range of x's, leverage points, missing variables, multicollinearity, and computational error. Additionally, techniques for determining the cause of the wrong sign are given.

  15. The Seebeck coefficient of iodine

    E-print Network

    Perez-Fernandez, Domingo Miguel

    1968-01-01

    THE SEEBECK COEFFICIENT OF IODINE A Thesis By DOMINGO M. PEREZ-F~EZ Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE January 1968 Major Subject...; Physics THE SEEBECK COEFFICIENT OF IODINE A Thesis By DOMINGO M. PEREZ-FERNANDEZ Approved as to style and content by: ( airman of Co ittee) (Member) (Head of Depa ment) (Member) ( ember) (Member) (Member) January 1968 ACKNONLEDGEMENTS...

  16. Theoretical Studies on Impact Ionization Coefficients of Electrons and Holes in SiGe Alloy

    Microsoft Academic Search

    K. Yeom; J. M. Hinckley; J. Singh

    1996-01-01

    Impact ionization coefficients for electrons (alpha) and holes (beta) in the SiGe alloy system are important for understanding the breakdown of electronic devices as well as for the design of avalanche photo-detectors. We have studied the impact ionization coefficients of electrons and holes in SiGe alloys using Monte Carlo simulation. Both strained and unstrained alloys are studied. For a description

  17. Dependence of the elastic strain coefficient of copper on the pre-treatment

    NASA Technical Reports Server (NTRS)

    Kuntze, Wilhelm

    1950-01-01

    The effect of various pre-treatments on the elastic strain coefficient (alpha) (defined as the reciprocal of the modulus of elasticity E) (Epsilon) and on the mechanical hysteresis of copper has been investigated. Variables comprising the pre-treatments were pre-straining by stretching in a tensile testing machine and by drawing through a die, aging at room and elevated temperatures and annealing. The variation of the elastic strain coefficient with test stress was also investigated.

  18. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  19. Varying-{alpha} monopoles

    SciTech Connect

    Menezes, J.; Avelino, P.P.; Santos, C. [Centro de Fisica do Porto e Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007, Porto (Portugal)

    2005-11-15

    We study static magnetic monopoles in the context of varying-{alpha} theories and show that there is a group of models for which the 't Hooft-Polyakov solution is still valid. Nevertheless, in general static magnetic monopole solutions in varying-{alpha} theories depart from the classical 't Hooft-Polyakov solution with the electromagnetic energy concentrated inside the core seeding spatial variations of the fine-structure constant. We show that Equivalence Principle constraints impose tight limits on the allowed variations of {alpha} induced by magnetic monopoles which confirms the difficulty to generate significant spatial variation of the fine-structure constant found in previous works. This is true even in the most favorable case where magnetic monopoles are the source for these variations.

  20. Doubled \\alpha'-Geometry

    E-print Network

    Hohm, Olaf; Zwiebach, Barton

    2014-01-01

    We develop doubled-coordinate field theory to determine the \\alpha' corrections to the massless sector of oriented bosonic closed string theory. Our key tool is a string current algebra of free left-handed bosons that makes O(D,D) T-duality manifest. While T-dualities are unchanged, diffeomorphisms and b-field gauge transformations receive corrections, with a gauge algebra given by an \\alpha'-deformation of the duality-covariantized Courant bracket. The action is cubic in a double metric field, an unconstrained extension of the generalized metric that encodes the gravitational fields. Our approach provides a consistent truncation of string theory to massless fields with corrections that close at finite order in \\alpha'.

  1. Measurement of Impact Ionization Coefficients in Gallium Nitride

    NASA Astrophysics Data System (ADS)

    Ozbek, Ayse Merve

    2011-12-01

    GaN has been recognized as a potential semiconductor for high temperature, high frequency and high power applications. Due to its wide bandgap, GaN exhibits high critical electric fields, which are suitable to sustain high breakdown voltages in power electronic devices. In order to obtain a good understanding of the breakdown characteristics of a power device, it is important to know the impact ionization coefficients of electrons and holes as a function of the electric field in the semiconductor. In this work, electron and hole impact ionization coefficients have been accurately measured in both GaN epitaxial layers grown on bulk GaN substrates and GaN epitaxial layers grown on Sapphire substrates using the pulsed electron beam induced current technique. Using Chynoweth's equation (alpha = a e-b/E), measurements for GaN epitaxial layer grown on bulk GaN substrates gave an aN value of 1.5x105 cm-1 and a bN value of 1.413x107 V/cm for the impact ionization coefficient of electrons in GaN at room temperature. For the impact ionization coefficients of holes in GaN, the values of aP and bP were found to be 6.4x105 cm-1 and 1.454x107 V/cm, respectively. An analytical solution of the form alpha = mEn for the variation of the impact ionization coefficients as a function of the electric field was derived, which is useful for analytical calculation of the breakdown voltages in GaN. For Chynoweth's equation (alpha = a e-b/E), measurements for GaN epitaxial layers grown on Sapphire substrates gave an aN value of 9.17x105 cm-1 and a bN value of 1.722x107 V/cm for the impact ionization coefficient for electrons at room temperature. For the impact ionization coefficients for holes at room temperature, the values of aP and bP were found to be 8.7x105 cm-1 and 1.464x107 V/cm, respectively. The values for both coefficients are larger than those measured for GaN grown on GaN substrates. The temperature dependence of the electron and hole impact ionization coefficients as a function of the electric field has been accurately measured for both GaN epitaxial layers grown on bulk GaN substrates and GaN epitaxial layers grown on Sapphire substrates. The impact ionization coefficients for both electrons and holes are observed to decrease with increasing temperature. This is consistent with the measured increase in the breakdown voltage with temperature for high voltage Schottky barrier diodes. This is an important observation demonstrating that stable power devices can be fabricated from Gallium Nitride. Electron Beam Induced Current (EBIC) technique was employed in order to understand the role of defects on the breakdown characteristics of GaN. The impact ionization coefficients for electrons and holes measured at the defective site were found to be higher than those measured at a non-defective site. These results indicate that the breakdown voltage of GaN devices can be reduced due to the presence of defects.

  2. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  3. Conversion coefficients for superheavy elements

    E-print Network

    T. Kibédi; M. B. Trzhaskovskaya; M. Gupta; A. E. Stuchbery

    2011-03-10

    In this paper we report on internal conversion coefficients for Z = 111 to Z = 126 superheavy elements obtained from relativistic Dirac-Fock (DF) calculations. The effect of the atomic vacancy created during the conversion process has been taken into account using the so called "Frozen Orbital" approximation. The selection of this atomic model is supported by our recent comparison of experimental and theoretical conversion coefficients across a wide range of nuclei. The atomic masses, valence shell electron configurations, and theoretical atomic binding energies required for the calculations were adopted from a critical evaluation of the published data. The new conversion coefficient data tables presented here cover all atomic shells, transition energies from 1 keV up to 6000 keV, and multipole orders of 1 to 5. A similar approach was used in our previous calculations [1] for Z = 5 - 110.

  4. Conversion coefficients for superheavy elements

    E-print Network

    Kibédi, T; Gupta, M; Stuchbery, A E

    2011-01-01

    In this paper we report on internal conversion coefficients for Z = 111 to Z = 126 superheavy elements obtained from relativistic Dirac-Fock (DF) calculations. The effect of the atomic vacancy created during the conversion process has been taken into account using the so called "Frozen Orbital" approximation. The selection of this atomic model is supported by our recent comparison of experimental and theoretical conversion coefficients across a wide range of nuclei. The atomic masses, valence shell electron configurations, and theoretical atomic binding energies required for the calculations were adopted from a critical evaluation of the published data. The new conversion coefficient data tables presented here cover all atomic shells, transition energies from 1 keV up to 6000 keV, and multipole orders of 1 to 5. A similar approach was used in our previous calculations [1] for Z = 5 - 110.

  5. Asymptotics of LQG fusion coefficients

    E-print Network

    Emanuele Alesci; Eugenio Bianchi; Elena Magliaro; Claudio Perini

    2008-10-05

    The fusion coefficients from SO(3) to SO(4) play a key role in the definition of spin foam models for the dynamics in Loop Quantum Gravity. In this paper we give a simple analytic formula of the EPRL fusion coefficients. We study the large spin asymptotics and show that they map SO(3) semiclassical intertwiners into $SU(2)_L\\times SU(2)_R$ semiclassical intertwiners. This non-trivial property opens the possibility for an analysis of the semiclassical behavior of the model.

  6. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  7. Alpha Antihydrogen Experiment

    NASA Astrophysics Data System (ADS)

    Fujiwara, M. C.; Andresen, G. B.; Ashkezari, M. D.; Baquero-Ruiz, M.; Bertsche, W.; Bray, C. C.; Butler, E.; Cesar, C. L.; Chapman, S.; Charlton, M.; Cesar, C. L.; Fajans, J.; Friesen, T.; Gill, D. R.; Hangst, J. S.; Hardy, W. N.; Hayano, R. S.; Hayden, M. E.; Humphries, A. J.; Hydomako, R.; Jonsell, S.; Kurchaninov, L.; Lambo, R.; Madsen, N.; Menary, S.; Nolan, P.; Olchanski, K.; Olin, A.; Povilus, A.; Pusa, P.; Robicheaux, F.; Sarid, E.; Silveira, D. M.; So, C.; Storey, J. W.; Thompson, R. I.; van der Werf, D. P.; Wilding, D.; Wurtele, J. S.; Yamazaki, Y.

    2011-12-01

    ALPHA is an experiment at CERN, whose ultimate goal is to perform a precise test of CPT symmetry with trapped antihydrogen atoms. After reviewing the motivations, we discuss our recent progress toward the initial goal of stable trapping of antihydrogen, with some emphasis on particle detection techniques.

  8. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  9. [alpha-Neurotoxins and alpha-conotoxins--nicotinic cholinoreceptor blockers].

    PubMed

    Utkin, Iu N; Kasheverov, I E; Tsetlin, V I

    1999-11-01

    The review is devoted to the competitive blockers of different nicotinic acetylcholine receptors, alpha-neurotoxins from snake venoms, and alpha-conotoxins from marine snails of the Conidae family. The relationship between the structure and function of these toxins is discussed. Recent data on the mechanism of alpha-neurotoxin and alpha-conotoxin interaction with the nicotinic acetylcholine receptor are presented. PMID:10645484

  10. Internal conversion coefficients in (134)Cs, (137)Ba, and (139)La: A precise test of theory

    E-print Network

    Nica, N.; Hardy, John C.; Iacob, V. E.; Balonek, C.; Trzhaskovskaya, M. B.

    2008-01-01

    Recently we measured the ratio of K-shell internal conversion coefficients, alpha(K), for the 127.5-keV E3 transition in (134)Cs and the 661.7-keV M4 transition in (137)Ba. We here report a measurement of the 165.9-keV M1 transition in (139)La...

  11. ChemTeacher: Alpha Decay

    NSDL National Science Digital Library

    2011-01-01

    ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.

  12. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  13. Sublimation Coefficient of Water Ice

    NASA Astrophysics Data System (ADS)

    Kossacki, K. J.; Markiewicz, W. J.; Skorov, Y.; Koemle, N. I.

    1999-09-01

    In simulations of evolution of cometary nuclei it is commonly assumed that the coefficients of sublimation and condensation of the volatiles are both equal to one. However, the laboratory investigation of water ice samples under cometary-like conditions (Kossacki et al., 1997) suggests, that the sublimation flux calculated with the Hertz-Knudsen formula and the above assumption is nearly an order of magnitude too high. A similar conclusion can be drawn from the results of various experiments on growth from vapour phase and sublimation of ice crystals (Lamb and Scott, 1972; Beckmann and Lacmann, 1982; Sei and Gonda, 1989). These results imply that the sublimation coefficient can be as low as 0.1. The above coefficients depend on various parameters such as temperature, concentration of surface impurities as well as deviation of the vapour pressure from that of the phase equilibrium. In this work we discuss the temperature dependence of both of these coefficients. We also propose an empirical formula to fit the temperature dependence. This new formulation is also used to analyse the implications for the thermal conductivity of a porous cometary-like ice.

  14. Prediction of stream volatilization coefficients

    USGS Publications Warehouse

    Rathbun, Ronald E.

    1990-01-01

    Equations are developed for predicting the liquid-film and gas-film reference-substance parameters for quantifying volatilization of organic solutes from streams. Molecular weight and molecular-diffusion coefficients of the solute are used as correlating parameters. Equations for predicting molecular-diffusion coefficients of organic solutes in water and air are developed, with molecular weight and molal volume as parameters. Mean absolute errors of prediction for diffusion coefficients in water are 9.97% for the molecular-weight equation, 6.45% for the molal-volume equation. The mean absolute error for the diffusion coefficient in air is 5.79% for the molal-volume equation. Molecular weight is not a satisfactory correlating parameter for diffusion in air because two equations are necessary to describe the values in the data set. The best predictive equation for the liquid-film reference-substance parameter has a mean absolute error of 5.74%, with molal volume as the correlating parameter. The best equation for the gas-film parameter has a mean absolute error of 7.80%, with molecular weight as the correlating parameter.

  15. PGC-1alpha: turbocharging mitochondria.

    PubMed

    Houten, Sander M; Auwerx, Johan

    2004-10-01

    PGC-1alpha plays essential and diverse functions in the control of metabolism ranging from mitochondrial biogenesis and respiration to hepatic gluconeogenesis and muscle fiber-type switching. In a paper in this issue of Cell, the characterization of PGC-1alpha(-/-) mice illustrates these pleiotropic functions and reveals an unexpected role for PGC-1alpha in the brain. PMID:15454076

  16. A Note on Using Stratified Alpha to Estimate the Composite Reliability of a Test Composed of Interrelated Nonhomogeneous Items

    ERIC Educational Resources Information Center

    Rae, Gordon

    2007-01-01

    The relationship between stratified alpha (alpha-sub(s)) and the reliability of a test composed of interrelated nonhomogeneous items is examined. It is mathematically demonstrated that when there is congeneric equivalence within the strata or subtests, the difference between the coefficients is a function of the variances of the loadings within…

  17. Sorption of humic acids and alpha-endosulfan by clayminerals

    SciTech Connect

    Hengpraprom, S.; Lee, C.M.; Coates, R.T.

    2005-02-18

    Sorption of alpha-endosulfan by kaolinite andmontmorillonite alone and in the presence of sorbed and dissolved humicacid (HA) was investigated (pH 8 and 25oC). Three types of HA, Elliotsoil HA (EHA), Peat HA (PHA), and Summit Hill HA (SHHA), were used torepresent typical humic substances found in soils. For sorption of HA byeither mineral, Freundlich sorption coefficient (Kf) values appeared todecrease in the order of EHA>PHA>SHHA, which followedincreasing polarity (expressed as the O/C atomic ratio) and decreasingpercent-carbon content. For both clays, sorption of alpha-endosulfan bythe HA mineral complex was greater than for sorption by the clay alone.Sorption of alpha-endosulfan by the HA mineral complexes followed thesame order as the Kf of the HAs (EHA>PHA>SHHA). Based on theamount of HA adsorbed by each mineral, organic carbon partitioncoefficients (KOC) were determined for sorption of alpha-endosulfan bytwo of the HA mineral complexes. The value of KOC for alpha-endosulfansorption was greater for kaolinite EHA than kaolinite SHHA. However, theopposite trend was found with the montmorillonite HA complexes.Montmorillonite appeared to sorb alpha-endosulfan and/or HA with higheraffinity than kaolinite, which likely is due to its 2:1 layer structureand higher surface area. Sorption of endosulfan diol, a hydrolysisproduct, by the minerals was much less than the parentpesticide.

  18. Pressure-Viscosity Coefficients of Liquid Lubricants

    Microsoft Academic Search

    Lowrie B. Sargent Jr

    1983-01-01

    The Barus equation relating viscosity to pressure includes a pressure-viscosity coefficient used widely by investigators even though that coefficient is grossly inaccurate at elevated pressures. A new empirical equation was developed relating viscosity to pressure. The equation is mathematically simple and provides two coefficients that are satisfactory over a wide pressure range. These coefficients are temperature dependent and produce a

  19. Nature of optical remote sensing coefficient

    Microsoft Academic Search

    Vladimir I. Haltrin

    2004-01-01

    The remote sensing coefficient or radiance reflection coefficient is a principal product of atmospheric correction algorithms applied to the remotely measured optical images of the ocean. This coefficient contains information about angular structure of light radiance, roughness of the ocean surface, and optical properties of the water. This presentation analyses remote sensing coefficient and presents it as a product of

  20. Portable vapor diffusion coefficient meter

    DOEpatents

    Ho, Clifford K. (Albuquerque, NM)

    2007-06-12

    An apparatus for measuring the effective vapor diffusion coefficient of a test vapor diffusing through a sample of porous media contained within a test chamber. A chemical sensor measures the time-varying concentration of vapor that has diffused a known distance through the porous media. A data processor contained within the apparatus compares the measured sensor data with analytical predictions of the response curve based on the transient diffusion equation using Fick's Law, iterating on the choice of an effective vapor diffusion coefficient until the difference between the predicted and measured curves is minimized. Optionally, a purge fluid can forced through the porous media, permitting the apparatus to also measure a gas-phase permeability. The apparatus can be made lightweight, self-powered, and portable for use in the field.

  1. High temperature Seebeck coefficient metrology

    SciTech Connect

    Martin, J. [Materials Science and Engineering Laboratory, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Tritt, T. [Department of Physics and Astronomy, Clemson University, Clemson, South Carolina 29634 (United States); Uher, C. [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2010-12-15

    We present an overview of the challenges and practices of thermoelectric metrology on bulk materials at high temperature (300 to 1300 K). The Seebeck coefficient, when combined with thermal and electrical conductivity, is an essential property measurement for evaluating the potential performance of novel thermoelectric materials. However, there is some question as to which measurement technique(s) provides the most accurate determination of the Seebeck coefficient at high temperature. This has led to the implementation of nonideal practices that have further complicated the confirmation of reported high ZT materials. To ensure meaningful interlaboratory comparison of data, thermoelectric measurements must be reliable, accurate, and consistent. This article will summarize and compare the relevant measurement techniques and apparatus designs required to effectively manage uncertainty, while also providing a reference resource of previous advances in high temperature thermoelectric metrology.

  2. High temperature Seebeck coefficient metrology

    SciTech Connect

    Martin, J.; Tritt, T.; Uher, Ctirad

    2010-01-01

    We present an overview of the challenges and practices of thermoelectric metrology on bulk materials at high temperature (300 to 1300 K). The Seebeck coefficient, when combined with thermal and electrical conductivity, is an essential propertymeasurement for evaluating the potential performance of novel thermoelectricmaterials. However, there is some question as to which measurement technique(s) provides the most accurate determination of the Seebeck coefficient at high temperature. This has led to the implementation of nonideal practices that have further complicated the confirmation of reported high ZT materials. To ensure meaningful interlaboratory comparison of data, thermoelectricmeasurements must be reliable, accurate, and consistent. This article will summarize and compare the relevant measurement techniques and apparatus designs required to effectively manage uncertainty, while also providing a reference resource of previous advances in high temperature thermoelectric metrology.

  3. The Production Coefficients of Feeds

    E-print Network

    Fraps, G. S. (George Stronach)

    1916-01-01

    STATION pp - -- - - BULLETIN NO. 185 FEBRUARY, 1916 DIVISION OF CHEMISTRY The Production Coefficients of Feeds G. S. FRAPS, Ph. D. CHEMIST IN CHARGE; STATE CHEMIST POSTOFFICE: COLLEGE STATION, BRAZOS COUNTY, TEXAS AUSTIN, TEXAS VON BOECKMANN... OF VETERINARY SCIENCE w. M WICKGS ~nspector M. FRANCIS, D. V. S., Veterinarian in T. B. REESE, &spector Charge H. SCHMIDT, D. V. M., Veterinarian SUBSTATION NO. 1: Beeville Bee County DIVISION OF CHEMISTRY E. E. BINFORD, B. S., ~rlperhtendenl G. S FRAPS...

  4. Super-b4 coefficients

    NASA Astrophysics Data System (ADS)

    McArthur, I. N.

    1983-08-01

    For a class of supersymmetric theories coupled to background Yang-Mills superfields and on a curved superspace background, the superfield analogue of the heat kernel is defined and the corresponding b4 superfields are computed. In specific cases, these super-b4 coefficients are shown to determine the one loop trace supermultiplet and the logarithmically divergent part of the effective action. Supported in part by a Hackett Studentship from the University of Western Australia.

  5. The interpretation of selection coefficients.

    PubMed

    Barton, N H; Servedio, M R

    2015-05-01

    Evolutionary biologists have an array of powerful theoretical techniques that can accurately predict changes in the genetic composition of populations. Changes in gene frequencies and genetic associations between loci can be tracked as they respond to a wide variety of evolutionary forces. However, it is often less clear how to decompose these various forces into components that accurately reflect the underlying biology. Here, we present several issues that arise in the definition and interpretation of selection and selection coefficients, focusing on insights gained through the examination of selection coefficients in multilocus notation. Using this notation, we discuss how its flexibility-which allows different biological units to be identified as targets of selection-is reflected in the interpretation of the coefficients that the notation generates. In many situations, it can be difficult to agree on whether loci can be considered to be under "direct" versus "indirect" selection, or to quantify this selection. We present arguments for what the terms direct and indirect selection might best encompass, considering a range of issues, from viability and sexual selection to kin selection. We show how multilocus notation can discriminate between direct and indirect selection, and describe when it can do so. PMID:25790030

  6. Transport Coefficients of Hadronic Matter

    NASA Astrophysics Data System (ADS)

    Demir, Nasser; Bass, Steffen A.

    2007-10-01

    Ultra-relativistic heavy-ion collisions at RHIC are thought to have created a Quark-Gluon-Plasma (QGP) with a very low shear viscosity in the deconfined phase. However, as the QGP hadronizes it will evolve through a hadronic phase with rapidly increasing viscosity. In order to fully characterize the QGP state, one has to separately determine the viscosity of the hadronic phase. We present a calculation of transport coefficients such as the shear viscosity, the shear viscosity to entropy density ratio ?s, and the diffusion coefficient as a function of T and ?B for nuclear densities in the range (?0- 2 ?0). The hadronic medium is simulated using the Ultrarelativistic Quantum Molecular Dynamics (UrQMD) model in a box with periodic boundary conditions. Green-Kubo theory enables us to compute linear transport coefficients of such a medium by examining near-equilibrium fluctuations. We outline a scheme combining the Green-Kubo formalism and our microscopic transport model to extract the time-dependence of the shear viscosity of the matter created in an ultrarelativistic heavy ion collision.

  7. Substitutional and Interstitial Diffusion in alpha2-Ti3Al(O)

    NASA Technical Reports Server (NTRS)

    Copland, Evan; Young, David J.; Gleeson, Brian; Jacobson, Nathan

    2007-01-01

    The reaction between Al2O3 and alpha2-Ti3Al was studied with a series of Al2O3/alpha2-Ti3Al multiphase diffusion couples annealed at 900, 1000 and 1100 C. The diffusion-paths were found to strongly depend on alpha2- Ti3Al(O) composition. For alloys with low oxygen concentrations the reaction involved the reduction of Al2O3, the formation of a gamma-TiAl reaction-layer and diffusion of Al and O into the alpha2-Ti3Al substrate. Measured concentration profiles across the interaction-zone showed "up-hill" diffusion of O in alpha2-Ti3Al(O) indicating a significant thermodynamic interaction between O and Al, Ti or both. Diffusion coefficients for the interstitial O in alpha2-Ti3Al(O) were determined independently from the interdiffusion of Ti and Al on the substitutional lattice. Diffusion coefficients are reported for alpha2-Ti3Al(O) as well as gamma-TiAl. Interpretation of the results were aided with the subsequent measurement of the activities of Al, Ti and O in alpha 2-Ti3Al(O) by Knudsen effusion-cell mass spectrometry.

  8. Water transport by the bacterial channel alpha-hemolysin

    NASA Technical Reports Server (NTRS)

    Paula, S.; Akeson, M.; Deamer, D.

    1999-01-01

    This study is an investigation of the ability of the bacterial channel alpha-hemolysin to facilitate water permeation across biological membranes. alpha-Hemolysin channels were incorporated into rabbit erythrocyte ghosts at varying concentrations, and water permeation was induced by mixing the ghosts with hypertonic sucrose solutions. The resulting volume decrease of the ghosts was followed by time-resolved optical absorption at pH 5, 6, and 7. The average single-channel permeability coefficient of alpha-hemolysin for water ranged between 1.3x10-12 cm/s and 1.5x10-12 cm/s, depending on pH. The slightly increased single-channel permeability coefficient at lower pH-values was attributed to an increase in the effective pore size. The activation energy of water transport through the channel was low (Ea=5.4 kcal/mol), suggesting that the properties of water inside the alpha-hemolysin channel resemble those of bulk water. This conclusion was supported by calculations based on macroscopic hydrodynamic laws of laminar water flow. Using the known three-dimensional structure of the channel, the calculations accurately predicted the rate of water flow through the channel. The latter finding also indicated that water permeation data can provide a good estimate of the pore size for large channels.

  9. Impact ionization coefficients for electrons and holes in In0.14Ga0.86As

    Microsoft Academic Search

    T. P. Pearsall; R. E. Nahory; M. A. Pollack

    1975-01-01

    We report the measurement of impact ionization rates for electrons and holes in the direct band-gap semiconductor alloy In0.14Ga0.86As. Our results show clearly that the ionization rate for holes is greater than that for electrons. The measurments were made for electric fields between 2.6×105 and 3.4×105 V cm-1. In this range, the ionization coefficients can be expressed as alpha=alpha? exp(-A\\/E)

  10. Thermal expansion coefficients of a 30% glass fiber filled PEEK pyrotechnic charge holder

    SciTech Connect

    Donnelly, M.W.; Walters, R.R.; Miller, G.D.

    1985-01-01

    Pyrotechnic actuators use hollow cylindrical ceramic or plastic charge holders to electrically isolate the pyrotechnic charge from the actuator case. In a newly developed actuator, 30% glass fiber filled polyetheretherketone (PEEK) was selected as the charge holder material both for its strength and its forming properties. Because the actuators are exposed to significant temperature variations during storage and flight, a determination of the coefficient of thermal expansion, ..cap alpha.., of the charge holders was required to assure success in this, the first electroexplosive device application of PEEK. Of special interest in this project were the questions of whether ..cap alpha.. depends on the direction (with respect to flow in the mold) or on injection pressure. From the test results, the conclusions are: (1) ..cap alpha.. does depend on direction. Its value in the thickness direction is approximately twice that in either the height or circumferential direction. This is probably because the wall thickness, 0.015'', is less than the average fiber length, 0.100'', and the PEEK is, therefore, not acting as a composite in the t direction. (2) Varying the injection pressure over the range of this study has no detectable effect on ..cap alpha... This charge holder is molded into an Inconel actuator case with ..cap alpha.. = 11.4 ..mu..m/m.C. This relatively close match of ..cap alpha..'s between adjacent materials has resulted in no dimensional problems during manufacturing and environmental testing. 1 fig., 1 tab.

  11. Influence of rotation-induced nuclear deformation on. alpha. -particle evaporation spectra

    SciTech Connect

    Huizenga, J.R.; Behkami, A.N.; Govil, I.M.; Schroder, W.U.; Toke, J. (Department of Chemistry and Nuclear Structure Research Laboratory, University of Rochester, Rochester, New York 14627 (US))

    1989-08-01

    The shapes of {alpha}-particle spectra from hot, high-spin compound nuclei produced in energetic heavy-ion fusion reactions are analyzed within the framework of a statistical model. Contrary to claims made in the literature, good agreement is obtained between calculated and experimental spectra when the evaporation barrier of each nuclide in the complex cascade is assumed equal to its respective absorption channel barrier. The dependence of the shape of {alpha}-particle spectra on nuclear deformation is discussed both in terms of the transmission coefficients and the spin-dependent level density of deformed nuclei. For deformations of the magnitude given by the rotating liquid drop model, {alpha}-particle spectra and effective barriers are insensitive to whether deformed or spherical nucleus transmission coefficients are used. It is important, however, to include the deformation dependence in the nuclear level density. Model calculations indicate that the shape of {alpha}-particle spectra may be quite insensitive to large deformations.

  12. The effect of N2/+/ recombination on the aeronomic determination of the charge exchange rate coefficient of O/+//2D/ with N2

    NASA Technical Reports Server (NTRS)

    Torr, D. G.; Orsini, N.

    1978-01-01

    The Atmosphere Explorer (AE) data are reexamined in the light of new laboratory measurements of the N2(+) recombination rate coefficient alpha. The new measurements support earlier measurements which yielded values of alpha significantly lower than the AE values. It is found that the values for alpha determined from the satellite data can be reconciled with the laboratory measurements, if the charge exchange rate coefficient for O(+)(2D) with N2 is less than one-quarter of that derived in the laboratory by Rutherford and Vroom (1971).

  13. An alpha scintillation spectrometer

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  14. An alpha scintillation spectrometer 

    E-print Network

    Yates, Ralph Aaron

    1952-01-01

    . Uranium 1'hick Uranium sources were tested to determine if any differences would exist between the oulse height distribution oi' thick Uranium and Thorium sources. Sources were prepared by placing small pieces of Uranium nitrate, UO2 (NO3)2 6H20, on a... phosphor covered light-piper. The ten different energy alpha particles that were emitted from the Uranium were blended into a continuous distribution, there being no apparent difference between this and the thick Thorium distribution. The same was true...

  15. Analysis of the evaporation coefficient and the condensation coefficient of water

    Microsoft Academic Search

    R. Marek; J. Straub

    2001-01-01

    The evaporation and condensation coefficients of water are extensively analyzed considering also data hitherto not taken into account. From the performed evaluation, a decline of both coefficients with increasing temperature and pressure is derived. For water, the condensation coefficients is generally higher than the evaporation coefficient. Evaporation and condensation coefficients exceed 0.1 for dynamically renewing water surfaces, while the analysis

  16. Inference of the aerosol Angstrom coefficient from SAGE short-wavelength data. [Stratospheric Aerosol and Gas Experiment

    NASA Technical Reports Server (NTRS)

    Lenoble, J.; Pruvost, P.

    1983-01-01

    SAGE four-channel transmission profiles are inverted to retrieve the extinction profiles from which the aerosol Angstrom coefficient alpha is obtained. The procedure allows one to check the influence of the NO2 absorption profile, which is small below 25 km. The results compare well with those obtained by a completely different procedure at NASA Langley Research Center, and the main features of the alpha profiles seem to be significant, even considering the rather large error bars. The relation between the retrieved Angstrom coefficient, the particle effective radius and the asymmetry factor is considered.

  17. Lidar calibration and extinction coefficients

    NASA Astrophysics Data System (ADS)

    Klett, J. D.

    1983-02-01

    Klett (1981) has presented an optical radar inversion scheme which utilizes only relative changes in the backscattered signal to produce estimates of atmospheric extinction as a function of range. It was also pointed out that better results could be obtained if use could be made of calibration information and/or other independent measurements to determine reference or boundary values of extinction sigma(m) more accurately. The present investigation is concerned with some characteristic features of a particular boundary value model for estimating sigma(m) based on knowledge of optical radar system constants, relative signal strength, and the relationship between the backscatter and extinction coefficients.

  18. Electron excitation coefficients in xenon

    Microsoft Academic Search

    A. Strinic; G. Malovic; J. Bozin; Z. Lj. Petrovic

    1999-01-01

    We have performed measurements of excitation coefficients for electron swarms in xenon for the range of E\\/N from 90 Td to 10 kTd. The measurements were performed for 2p_1, 2p_2, 2p_3, 2p_4, 2p_5, 2p_6, 3p_5, 3p_6, 3p_7, 3p_8, and 3p_10 levels of neutral xenon and for 6p^4D^0 and 6p^4P^0 of xenon ion. The results were obtained in self-sustained low current

  19. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  20. Generation of K{sub {alpha}} radiation by high-efficiency laser targets

    SciTech Connect

    Andreev, A A; Platonov, Konstantin Yu [Federal State Unitary Enterprise All-Russian Scientific Center 'S.I.Vavilov State Optical Institute' (FSUE GOI), St.Petersburg (Russian Federation)

    2011-06-30

    The intensity of K{sub {alpha}} radiation emanating from transversely limited thin laser targets with a periodic relief superposed onto its front side was calculated. The relief parameters and the geometrical target dimensions were optimised with the help of an analytic model. The optimal target was shown to possess a nearly 100% absorption coefficient for laser radiation and a high (up to 10{sup -3}) coefficient of laser radiation conversion to the X-ray K{sub {alpha}} radiation. (interaction of laser radiation with matter. laser plasma)

  1. COEFFICIENTS FOR THE FARRELL-JONES CONJECTURE

    E-print Network

    Bartels, Arthur

    COEFFICIENTS FOR THE FARRELL-JONES CONJECTURE ARTHUR BARTELS AND HOLGER REICH Abstract.We introduce the Farrell-Jones Conjecture with coefficients in * *an additive category with G-action. This is a variant of the Farrell-Jones

  2. Validating modeling assumptions of alpha particles in electrostatic turbulence

    NASA Astrophysics Data System (ADS)

    Wilkie, G. J.; Abel, I. G.; Highcock, E. G.; Dorland, W.

    2015-06-01

    To rigorously model fast ions in fusion plasmas, a non-Maxwellian equilibrium distribution must be used. In this work, the response of high-energy alpha particles to electrostatic turbulence has been analyzed for several different tokamak parameters. Our results are consistent with known scalings and experimental evidence that alpha particles are generally well confined: on the order of several seconds. It is also confirmed that the effect of alphas on the turbulence is negligible at realistically low concentrations, consistent with linear theory. It is demonstrated that the usual practice of using a high-temperature Maxwellian, while previously shown to give an adequate order-of-magnitude estimate of the diffusion coefficient, gives incorrect estimates for the radial alpha particle flux, and a method of correcting it in general is provided. Furthermore, we see that the timescales associated with collisions and transport compete at moderate energies, calling into question the assumption that alpha particles remain confined to a flux surface that is used in the derivation of the slowing-down distribution.

  3. Statistical Estimation of the Atmospheric Aerosol Absorption Coefficient Based on the Data of Optical Measurements

    SciTech Connect

    Uzhegov, V.N.; Kozlov, V.S.; Panchenko, M.V.; Pkhalagov, Yu.A.; Pol'kin, V.V.; Terpugova, S.A.; Shmargunov, V.P.; Yausheva, E.P.

    2005-03-18

    The problem of the choice of the aerosol optical constants and, in particular, imaginary part of the refractive index of particles in visible and infrared (IR) wavelength ranges is very important for calculation of the global albedo of the atmosphere in climatic models. The available models of the aerosol optical constants obtained for the prescribed chemical composition of particles (see, for example, Ivlev et al. 1973; Ivlev 1982; Volz 1972), often are far from real aerosol. It is shown in (Krekov et al. 1982) that model estimates of the optical characteristics of the atmosphere depending on the correctness of real and imaginary parts of the aerosol complex refractive index can differ by some hundreds percent. It is known that the aerosol extinction coefficient {alpha}({lambda}) obtained from measurements on a long horizontal path can be represented as {alpha}({lambda})={sigma}({lambda})+{beta}({lambda}), where {sigma} is the directed light scattering coefficient, and {beta} is the aerosol absorption coefficient. The coefficient {sigma}({lambda}) is measured by means of a nephelometer. Seemingly, if measure the values {alpha}({lambda}) and {sigma}({lambda}), it is easy to determine the value {beta}({lambda}). However, in practice it is almost impossible for a number of reasons. Firstly, the real values {alpha}({lambda}) and {sigma}({lambda}) are very close to each other, and the estimate of the parameter {beta}({lambda}) is concealed by the errors of measurements. Secondly, the aerosol optical characteristics on the long path and in the local volume of nephelometer can be different, that also leads to the errors in estimating {beta}({lambda}). Besides, there are serious difficulties in performing spectral measurements of {sigma}({lambda}) in infrared wavelength range. Taking into account these circumstances, in this paper we consider the statistical technique, which makes it possible to estimate the absorption coefficient of real aerosol on the basis of analysis of simultaneous measurements of the spectral aerosol extinction coefficients {alpha}({lambda}), the directed scattering coefficient of dry aerosol {sigma}{sub 0}(0.55) and the mass concentration of aerosol containing BC (black carbon) Ms.

  4. Alpha:2n:alpha molecular band in 10Be.

    PubMed

    Freer, M; Casarejos, E; Achouri, L; Angulo, C; Ashwood, N I; Curtis, N; Demaret, P; Harlin, C; Laurent, B; Milin, M; Orr, N A; Price, D; Raabe, R; Soi?, N; Ziman, V A

    2006-02-01

    The 10.15 MeV resonance in 10Be has been probed via resonant 6He+4He elastic scattering. It is demonstrated that it is the Jpi=4+ member of a rotational band built on the 6.18 MeV 0+ state. A Gammaalpha of 0.10-0.13 MeV and Gammaalpha/Gamma=0.35-0.46 were deduced. The corresponding reduced alpha width, gamma2alpha, indicates one of the largest alpha-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2+ member, is large (h2/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed alpha:2n:alpha molecular structure. PMID:16486811

  5. alpha_S and Power Corrections from JADE

    E-print Network

    Fernández, P A M

    2002-01-01

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  6. alpha_S and Power Corrections from JADE

    E-print Network

    P. A. Movilla Fernandez

    2002-09-13

    Re-analysed JADE data were used to determine alpha_S at sqrt{s} = 14-44 GeV on the basis of resummed calculations for event shapes and hadronisation models tuned to LEP data. The combined result is alpha_S(M_Z) = 0.1194 +/- 0.0082/0.0068 which is consistent with the world average. Event shapes have also been used to test power corrections based on an analytical model and to verify the gauge structure of QCD. The only non-perturbative parameter alpha_0 of the model was measured to alpha_0(2GeV) = 0.503 +/- 0.066/0.045 and is found to be universal within the total errors.

  7. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  8. Metric and Euclidean properties of dissimilarity coefficients

    Microsoft Academic Search

    J. C. Gower; P. Legendre

    1986-01-01

    We assemble here properties of certain dissimilarity coefficients and are specially concerned with their metric and Euclidean status. No attempt is made to be exhaustive as far as coefficients are concerned, but certain mathematical results that we have found useful are presented and should help establish similar properties for other coefficients. The response to different types of data is investigated,

  9. Standards for Standardized Logistic Regression Coefficients

    ERIC Educational Resources Information Center

    Menard, Scott

    2011-01-01

    Standardized coefficients in logistic regression analysis have the same utility as standardized coefficients in linear regression analysis. Although there has been no consensus on the best way to construct standardized logistic regression coefficients, there is now sufficient evidence to suggest a single best approach to the construction of a…

  10. Compression of Surface Registration using Beltrami Coefficients

    E-print Network

    Soatto, Stefano

    1 Compression of Surface Registration using Beltrami Coefficients L.M. Lui, T.W. Wong, P diffeomorphisms using Beltrami coefficients, which are complex-valued functions defined on surfaces with supreme the set of surface diffeomorphisms between them and the set of Beltrami coefficients on the source domain

  11. The Subthreshold Autism Trait Questionnaire (SATQ): Development of a Brief Self-Report Measure of Subthreshold Autism Traits

    Microsoft Academic Search

    Stephen M. Kanne; Jennifer Wang; Shawn E. Christ

    The current study was motivated by a need for a self-report questionnaire that assesses a broad range of subthreshold autism\\u000a traits, is brief and easily administered, and is relevant to the general population. An initial item pool was administered\\u000a to 1,709 students. Structural validity analysis resulted in a 24-item questionnaire termed the Subthreshold Autism Trait Questionnaire\\u000a (SATQ; Cronbach’s alpha coefficient = .73,

  12. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  13. Live! From 2-Alpha

    NSDL National Science Digital Library

    This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.

  14. Estimating Ordinal Reliability for Likert-Type and Ordinal Item Response Data: A Conceptual, Empirical, and Practical Guide

    ERIC Educational Resources Information Center

    Gadermann, Anne M.; Guhn, Martin; Zumbo, Bruno D.

    2012-01-01

    This paper provides a conceptual, empirical, and practical guide for estimating ordinal reliability coefficients for ordinal item response data (also referred to as Likert, Likert-type, ordered categorical, or rating scale item responses). Conventionally, reliability coefficients, such as Cronbach's alpha, are calculated using a Pearson…

  15. Quantum electrodynamics $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ corrections to the fine splitting in Li and Be$^+$

    E-print Network

    Puchalski, Mariusz

    2015-01-01

    We derive quantum electrodynamics corrections to the fine structure in three-electron atomic systems at $m \\alpha^6$ and $m \\alpha^7 \\ln \\alpha$ orders and present their numerical evaluations for the Li atom and Be$^+$ ion.

  16. THE COMPLEX FATE OF ALPHA-KETOACIDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610...Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes...

  19. How Is Alpha-1 Antitrypsin Deficiency Diagnosed?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Diagnosed? Alpha-1 antitrypsin (AAT) deficiency usually is diagnosed after you ... Rate This Content: NEXT >> October 11, 2011 Alpha-1 Antitrypsin Deficiency Clinical Trials Clinical trials are research ...

  20. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency Chronic obstructive pulmonary disease or COPD for short is a lung disease that affects millions ... The inherited form of emphysema is called Alpha-1 Antitrypsin Deficiency or " Alpha-1 " for short. People ...

  1. The vascular smooth muscle alpha-actin gene is reactivated during cardiac hypertrophy provoked by load.

    PubMed Central

    Black, F M; Packer, S E; Parker, T G; Michael, L H; Roberts, R; Schwartz, R J; Schneider, M D

    1991-01-01

    Cardiac hypertrophy triggered by mechanical load possesses features in common with growth factor signal transduction. A hemodynamic load provokes rapid expression of the growth factor-inducible nuclear oncogene, c-fos, and certain peptide growth factors specifically stimulate the "fetal" cardiac genes associated with hypertrophy, even in the absence of load. These include the gene encoding vascular smooth muscle alpha-actin, the earliest alpha-actin expressed during cardiac myogenesis; however, it is not known whether reactivation of the smooth muscle alpha-actin gene occurs in ventricular hypertrophy. We therefore investigated myocardial expression of the smooth muscle alpha-actin gene after hemodynamic overload. Smooth muscle alpha-actin mRNA was discernible 24 h after coarctation and was persistently expressed for up to 30 d. In hypertrophied hearts, the prevalence of smooth muscle alpha-actin gene induction was 0.909, versus 0.545 for skeletal muscle alpha-actin (P less than 0.05). Ventricular mass after 2 d or more of aortic constriction was more highly correlated with smooth muscle alpha-actin gene activation (r = 0.852; P = 0.0001) than with skeletal muscle alpha-actin (r = 0.532; P = 0.009); P less than 0.0005 for the difference in the correlation coefficients. Thus, smooth muscle alpha-actin is a molecular marker of the presence and extent of pressure-overload hypertrophy, whose correlation with cardiac growth at least equals that of skeletal alpha-actin. Induction of smooth muscle alpha-actin was delayed and sustained after aortic constriction, whereas the nuclear oncogenes c-jun and junB were expressed rapidly and transiently, providing potential dimerization partners for transcriptional control by c-fos. Images PMID:1834699

  2. Calculation of the lateral coefficient corrections for an aircraft model with rear sting support in subsonic windtunnel flow

    Microsoft Academic Search

    D. Steinbach

    1997-01-01

    For a fighter type aircraft like the TST Alpha-Jet model the aerodynamic coefficient corrections for unsymmetric windtunnel flows are calculated. The model is attached to a rear sting support system and placed in the test-section of a subsonic windtunnel (KKK at DLR Köln) at incidence and yaw. For the numerical simulation of the windtunnel flow a subsonic panel method is

  3. Reliability of Summed Item Scores Using Structural Equation Modeling: An Alternative to Coefficient Alpha

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    A method is presented for estimating reliability using structural equation modeling (SEM) that allows for nonlinearity between factors and item scores. Assuming the focus is on consistency of summed item scores, this method for estimating reliability is preferred to those based on linear SEM models and to the most commonly reported estimate of…

  4. Gas-film coefficients for streams

    USGS Publications Warehouse

    Rathbun, R.E.; Tai, D.Y.

    1983-01-01

    Equations for predicting the gas-film coefficient for the volatilization of organic solutes from streams are developed. The film coefficient is a function of windspeed and water temperature. The dependence of the coefficient on windspeed is determined from published information on the evaporation of water from a canal. The dependence of the coefficient on temperature is determined from laboratory studies on the evaporation of water. Procedures for adjusting the coefficients for different organic solutes are based on the molecular diffusion coefficient and the molecular weight. The molecular weight procedure is easiest to use because of the availability of molecular weights. However, the theoretical basis of the procedure is questionable. The diffusion coefficient procedure is supported by considerable data. Questions, however, remain regarding the exact dependence of the film coefficint on the diffusion coefficient. It is suggested that the diffusion coefficient procedure with a 0.68-power dependence be used when precise estimate of the gas-film coefficient are needed and that the molecular weight procedure be used when only approximate estimates are needed.

  5. Alpha detection on moving surfaces

    SciTech Connect

    MacArthur, D. [Los Alamos National Lab., NM (United States); Orr, C.; Luff, C. [BNFL Instruments Ltd., Sellafield (United Kingdom)

    1998-12-01

    Both environmental restoration (ER) and decontamination and decommissioning (D and D) require characterization of large surface areas (walls, floors, in situ soil, soil and rubble on a conveyor belt, etc.) for radioactive contamination. Many facilities which have processed alpha active material such as plutonium or uranium require effective and efficient characterization for alpha contamination. Traditional methods for alpha surface characterization are limited by the short range and poor penetration of alpha particles. These probes are only sensitive to contamination located directly under the probe. Furthermore, the probe must be held close to the surface to be monitored in order to avoid excessive losses in the ambient air. The combination of proximity and thin detector windows can easily cause instrument damage unless extreme care is taken. The long-range alpha detection (LRAD) system addresses these problems by detecting the ions generated by alpha particles interacting with ambient air rather than the alpha particle directly. Thus, detectors based on LRAD overcome the limitations due to alpha particle range (the ions can travel many meters as opposed to the several-centimeter alpha particle range) and penetrating ability (an LRAD-based detector has no window). Unfortunately, all LRAD-based detectors described previously are static devices, i.e., these detectors cannot be used over surfaces which are continuously moving. In this paper, the authors report on the first tests of two techniques (the electrostatic ion seal and the gridded electrostatic LRAD detector) which extend the capabilities of LRAD surface monitors to use over moving surfaces. This dynamic surface monitoring system was developed jointly by Los Alamos National Laboratory and at BNFL Instruments. All testing was performed at the BNFL Instruments facility in the UK.

  6. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  7. Electron and hole impact ionization coefficients in GaAs-Al(x)Ga(1-x)As superlattices

    NASA Technical Reports Server (NTRS)

    Juang, F.-Y.; Das, U.; Nashimoto, Y.; Bhattacharya, P. K.

    1985-01-01

    Electron and hole multiplication and impact ionization coefficients have been measured with pure carrier injection in p(+)-n(-)-n(+) diodes grown by molecular beam epitaxy. Values of the electron and hole ionization coefficient ratio alpha/beta = 2-5 are measured for superlattices with well width Lz greater than or equal to 100 A and alpha/beta greater than 10 is measured in a graded band-gap superlattice with a total well and barrier width LB + LZ = 120 A. The ratio decreases and becomes less than unity for smaller well sizes. This is caused by an increase in beta (E) while alpha (E) remains fairly constant. The results have been interpreted by considering varying hole confinement and scattering in the coupled quantum wells.

  8. Hidden messages in heavy-tails: DCT-domain watermark detection using alpha-stable models

    Microsoft Academic Search

    Alexia Briassouli; Panagiotis Tsakalides; Athanasios Stouraitis

    2005-01-01

    This paper addresses issues that arise in copyright protection systems of digital images, which employ blind watermark verification structures in the discrete cosine transform (DCT) domain. First, we observe that statistical distributions with heavy algebraic tails, such as the alpha-stable family, are in many cases more accurate modeling tools for the DCT coefficients of JPEG-analyzed images than families with exponential

  9. Nano \\/spl alpha\\/Fe\\/epoxy resin composite absorber coatings fabricated by thermal spraying technique

    Microsoft Academic Search

    Xiaojing Yuan; Hangong Wang; Genliang Hou; Li Jiang; Chunjiang Yao

    2006-01-01

    In this paper, the low temperature high velocity air fuel (LTHVAF) spraying technique was applied to prepare the alpha-Fe\\/epoxy resin nanocomposite coatings. The composite powders were mixed with different mass fractions, and the microstructure and reflectivity coefficient of coatings were tested. The results show that the microstructure of coatings is dense and low porosity; nano metal particles are dispersed in

  10. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    J. Schieck

    2006-10-06

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  11. Measurement of alpha_S in e+e- collisions at LEP and JADE

    E-print Network

    Schieck, J

    2007-01-01

    Data from e+e- annihilation into hadrons collected by the JADE, the L3 and the OPAL experiment at centre-of-mass energies between 14 GeV and 209 GeV are used to determine the strong coupling alpha_S. Observables in leading order sensitive to alpha_S as well as alpha_S**2 are used. The evolution of alpha_S with respect to the centre-of-mass energy as predicted by QCD is studied and confirmed with high precision. All measurements of alpha_S are consistent with the current world average.

  12. Equations for Annular-Heat-Transfer Coefficients

    NASA Technical Reports Server (NTRS)

    Yao, B.

    1986-01-01

    Tables of coefficients converted to algebraic expressions. Plot of Equation for Nusselt number agrees closely with points from tabulated data. Equation for Nusselt number and those for coefficients A and B obtained by regression analysis of data. Other plots also show close agreement for radius of 0.1 and 0.2. In equation form, coefficients incorporated into mathematical models more readily than as tabular data. Equations simplify design and analysis of heat exchangers.

  13. Universal relations of transport coefficients from holography

    E-print Network

    Aleksey Cherman; Abhinav Nellore

    2009-06-05

    We show that there are universal high-temperature relations for transport coefficients of plasmas described by a wide class of field theories with gravity duals. These theories can be viewed as strongly coupled large-Nc conformal field theories deformed by one or more relevant operators. The transport coefficients we study are the speed of sound and bulk viscosity, as well as the conductivity, diffusion coefficient, and charge susceptibility of probe U(1) charges. We show that the sound bound v_s^2 <= 1/3 is satisfied at high temperatures in these theories and also discuss bounds on the diffusion coefficient, the conductivity and the bulk viscosity.

  14. Data analysis for Seebeck coefficient measurements.

    PubMed

    de Boor, J; Müller, E

    2013-06-01

    The Seebeck coefficient is one of the key quantities of thermoelectric materials and routinely measured in various laboratories. There are, however, several ways to calculate the Seebeck coefficient from the raw measurement data. We compare these different ways to extract the Seebeck coefficient, evaluate the accuracy of the results, and show methods to increase this accuracy. We furthermore point out experimental and data analysis parameters that can be used to evaluate the trustworthiness of the obtained result. The shown analysis can be used to find and minimize errors in the Seebeck coefficient measurement and therefore increase the reliability of the measured material properties. PMID:23822373

  15. [Estimation of the heritability coefficient of stud fertility].

    PubMed

    Dusek, J; Munk, Z

    1980-05-01

    The breeding documentation of the English Thoroughbred horse breeding farm at Napajedla was analyzed to study some effects acting upon the fertility of studs and mares and the length of gravidity. The heritability of fertility is the subject of this report. The normality of the distribution of fertility was tested by processing 300 data on fertility at the given significance level sup / Fn(xi) - F(xi) / less than or equal to Dn(a). The value of the supreme D(300) = 0.108 is lower than the critical level for alpha 0.05. The estimation of fertility heritability coefficient indicates that h2 = 0.31; the heritability coefficient is at the boundary of low and medium heritability. The method of half-sib correlation was used for the calculation; 25% genetic similarity is involved in this case. The calculated value is an estimate characterizing the evaluated population. In view of the number of the observed studs, this value is regarded as informative. The problems under study are part of a wider range of problems concerning the evaluation of reproduction in the breeding of the English Thoroughbred Horse. PMID:6773216

  16. NEW SCALING FOR THE ALPHA EFFECT IN SLOWLY ROTATING TURBULENCE

    SciTech Connect

    Brandenburg, A.; Gressel, O.; Kaepylae, P. J.; Kleeorin, N.; Rogachevskii, I. [Nordita, KTH Royal Institute of Technology and Stockholm University, Roslagstullsbacken 23, SE-10691 Stockholm (Sweden)] [Nordita, KTH Royal Institute of Technology and Stockholm University, Roslagstullsbacken 23, SE-10691 Stockholm (Sweden); Mantere, M. J. [Department of Physics, University of Helsinki, Gustaf Haellstroemin katu 2a, P.O. Box 64, FI-00064 Helsinki (Finland)] [Department of Physics, University of Helsinki, Gustaf Haellstroemin katu 2a, P.O. Box 64, FI-00064 Helsinki (Finland)

    2013-01-10

    Using simulations of slowly rotating stratified turbulence, we show that the {alpha} effect responsible for the generation of astrophysical magnetic fields is proportional to the logarithmic gradient of kinetic energy density rather than that of momentum, as was previously thought. This result is in agreement with a new analytic theory developed in this paper for large Reynolds numbers and slow rotation. Thus, the contribution of density stratification is less important than that of turbulent velocity. The {alpha} effect and other turbulent transport coefficients are determined by means of the test-field method. In addition to forced turbulence, we also investigate supernova-driven turbulence and stellar convection. In some cases (intermediate rotation rate for forced turbulence, convection with intermediate temperature stratification, and supernova-driven turbulence), we find that the contribution of density stratification might be even less important than suggested by the analytic theory.

  17. Alpha-muon sticking and chaos in muon-catalysed "in flight" d-t fusion

    E-print Network

    Sachie Kimura; Aldo Bonasera

    2006-07-31

    We discuss the alpha-muon sticking coefficient in the muon-catalysed ``in flight" d-t fusion in the framework of the Constrained Molecular Dynamics model. Especially the influence of muonic chaotic dynamics on the sticking coefficient is brought into focus. The chaotic motion of the muon affects not only the fusion cross section but also the $\\mu-\\alpha$ sticking coefficient. Chaotic systems lead to larger enhancements with respect to regular systems because of the reduction of the tunneling region. Moreover they give smaller sticking probabilities than those of regular events. By utilizing a characteristic of the chaotic dynamics one can avoid losing the muon in the $\\mu$CF cycle. We propose the application of the so-called ``microwave ionization of a Rydberg atom" to the present case which could lead to the enhancement of the reactivation process by using X-rays.

  18. Inflaton decay in an alpha vacuum

    Microsoft Academic Search

    Siddartha Naidu; Richard Holman

    2005-01-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show

  19. alphaCertified Jonathan D. Hauenstein

    E-print Network

    Sottile, Frank

    Certified The program alphaCertified by Jonathan D. Hauenstein and Frank Sottile implements algorithms based on Smale's -theory to certify solutions to polynomial systems. This manual provides de- tailed instructions on how alphaCertified. 2 Compiling alphaCertified The program alphaCertified is written in C and uses the GMP[3

  20. Photothermal techniques applied to the determination of the water vapor diffusion coefficient and thermal diffusivity of edible films.

    PubMed

    Aguilar-Mendez, M A; Martin-Martinez, E San; Morales, J E; Cruz-Orea, A; Jaime-Fonseca, M R

    2007-04-01

    Water vapor diffusion coefficient (WVDC) and thermal diffusivity (alpha) were determined in gelatin-starch films through photothermal techniques. The effect of different variables in the elaboration of these films, such as starch and glycerol concentrations and pH, were evaluated through the response surface methodology. The results indicated that an increase in the glycerol concentration and pH favored the WVDC of the films. On the other hand, alpha was influenced principally by the starch content and pH of the film-forming solution. The minimum alpha value was 4.5 x 10(-4) cm2/s, which is compared with alpha values reported for commercial synthetic polymers. PMID:17420552

  1. A study of multiplicative watermark detection in the contourlet domain using alpha-stable distributions.

    PubMed

    Sadreazami, Hamidreza; Ahmad, M Omair; Swamy, M N S

    2014-10-01

    In the past decade, several schemes for digital image watermarking have been proposed to protect the copyright of an image document or to provide proof of ownership in some identifiable fashion. This paper proposes a novel multiplicative watermarking scheme in the contourlet domain. The effectiveness of a watermark detector depends highly on the modeling of the transform-domain coefficients. In view of this, we first investigate the modeling of the contourlet coefficients by the alpha-stable distributions. It is shown that the univariate alpha-stable distribution fits the empirical data more accurately than the formerly used distributions, such as the generalized Gaussian and Laplacian, do. We also show that the bivariate alpha-stable distribution can capture the across scale dependencies of the contourlet coefficients. Motivated by the modeling results, a blind watermark detector in the contourlet domain is designed by using the univariate and bivariate alpha-stable distributions. It is shown that the detectors based on both of these distributions provide higher detection rates than that based on the generalized Gaussian distribution does. However, a watermark detector designed based on the alpha-stable distribution with a value of its parameter ? other than 1 or 2 is computationally expensive because of the lack of a closed-form expression for the distribution in this case. Therefore, a watermark detector is designed based on the bivariate Cauchy member of the alpha-stable family for which ? = 1 . The resulting design yields a significantly reduced-complexity detector and provides a performance that is much superior to that of the GG detector and very close to that of the detector corresponding to the best-fit alpha-stable distribution. The robustness of the proposed bivariate Cauchy detector against various kinds of attacks, such as noise, filtering, and compression, is studied and shown to be superior to that of the generalized Gaussian detector. PMID:25051554

  2. Wavelet Coefficients of Levy Process R. Suyundykov

    E-print Network

    Paris-Sud XI, Université de

    Wavelet Coefficients of Levy Process R. Suyundykov ENAC Dept. MI LMA 7, Avenue Edouard Belin 31055. Abstract--The main object of the paper is to study the wavelet decomposition of Levy processes by wavelets by Haar wavelets. Keywords : Ondelettes, Processus I. INTRODUCTION Estimation of wavelet coefficients

  3. COEFFICIENTS FOR THE FARRELL-JONES CONJECTURE

    E-print Network

    Bartels, Arthur

    COEFFICIENTS FOR THE FARRELL-JONES CONJECTURE ARTHUR BARTELS AND HOLGER REICH Abstract. We introduce the Farrell-Jones Conjecture with coefficients in an additive category with G-action. This is a variant of the Farrell-Jones Conjec- ture about the algebraic K- or L-Theory of a group ring RG. It allows

  4. APPENDIX F Partition Coefficients For Lead

    E-print Network

    APPENDIX F Partition Coefficients For Lead #12;Appendix F Partition Coefficients For Lead F.1.0 Background The review of lead Kd data reported in the literature for a number of soils led to the following important conclusions regarding the factors which influence lead adsorption on minerals, soils

  5. Wear transitions in a wear coefficient model

    Microsoft Academic Search

    T. T. Vuong; P. A. Meehan

    2009-01-01

    The value chosen for the empirical wear coefficient in the frictional-work wear model greatly affects wear simulation results such as those for predicting rail corrugation growth. Furthermore, experimental results have widely shown that this wear coefficient is strongly dependent on the type of wear process involved, however these wear regimes are only defined empirically at present. This paper suggests a

  6. APPENDIX H Partition Coefficients For Strontium

    E-print Network

    APPENDIX H Partition Coefficients For Strontium #12;Appendix H Partition Coefficients For Strontium H.1.0 Background Two simplifying assumptions underlying the selection of strontium Kd values included in the look-up table were made. These assumptions are that the adsorption of strontium adsorption

  7. Analytic capacity and quasiconformal mappings Beltrami coefficient

    E-print Network

    Tolsa, Xavier

    Analytic capacity and quasiconformal mappings with W1,2 Beltrami coefficient Albert Clop Xavier Tolsa Abstract We show that if is a quasiconformal mapping with compactly sup- ported Beltrami quasiregular mappings with compactly supported Beltrami coefficient in W1,2 . 1 Introduction A Beltrami

  8. The Multidimensional Random Coefficients Multinomial Logit Model

    Microsoft Academic Search

    Raymond J. Adams; Mark Wilson; Wen-chung Wang

    1997-01-01

    A multidimensional Rasch-type item response model, the multidimensional random coefficients multinomial logit model, is presented as an extension to the Adams & Wilson (1996) random coefficients multinomial logit model. The model is developed in a form that permits generalization to the multidimensional case of a wide class of Rasch models, including the simple logistic model, Masters' partial credit model, Wilson's

  9. APPENDIX G Partition Coefficients For Plutonium

    E-print Network

    APPENDIX G Partition Coefficients For Plutonium #12;Appendix G Partition Coefficients For Plutonium G.1.0 Background A number of studies have focussed on the adsorption behavior of plutonium that Kd values for plutonium typically range over 4 orders of magnitude (Thibault et al., 1990). Also

  10. APPENDIX J Partition Coefficients For Uranium

    E-print Network

    APPENDIX J Partition Coefficients For Uranium #12;Appendix J Partition Coefficients For Uranium J.1.0 Background The review of uranium Kd values obtained for a number of soils, crushed rock and their effects on uranium adsorption on soils are discussed below. The solution pH was also used as the basis

  11. The Effects of Alpha Particle Confinement on Burning Plasma Tokamak Performance

    NASA Astrophysics Data System (ADS)

    Gormley, Robert P.

    In this thesis, three effects of alpha particle plasma interactions on the global performance of a fusion reactor are studied, namely, (i) the energy coupling efficiency of the fast alpha particles with the bulk plasma, (ii) the relationship between imperfect alpha energy coupling to the bulk plasma and the resultant alpha particle/helium ash fuel dilution; and (iii) the neoclassical bootstrap current induced by fusion born alpha particles calculated self-consistently with the plasma equilibrium. First, the ion drift kinetic equation for the high energy alpha particles is reduced from the exact five dimensional form to a two dimensional form in radius r and energy E (plus time t). The resulting slowing-down diffusion equation is solved by a multiple energy group method. A theoretically based anomalous diffusion coefficient D_sp{alpha}{an} is then introduced from a self-consistent alpha particle Alfven wave turbulence solution (by F. Gang), in which D_sp{alpha}{an } itself depends on the gradient in alpha density. The temporal and spatial behavior of eta_ alpha is analyzed for an ITER-CDA physics phase fusion reactor. We find that eta_ alpha can be as low as 0.95 depending on the plasma operating temperature. Next, the relationship between the alpha-particle power coupling efficiency and the actual alpha-particle power that is coupled with the bulk plasma is investigated, this time taking into account the concomitant helium ash accumulation. It is found that the coupled power varies less than linearly with eta_alpha and is, in fact, significantly depressed for eta_alpha near unity. Combining these effects with a thermal power balance shows that the high temperature "thermally stable" side of the ignition boundary is pushed toward lower temperatures if either D_alpha increases (which results in a lower eta_alpha) or the helium-ash confinement time lengthens. This is a consequence of strengthened fuel dilution and imperfect alpha power coupling. Implications on the thermal stability of a fusion reactor are also discussed. Lastly, we calculate the alpha particle induced bootstrap current produced, while retaining the effects of slowing-down drag, pitch-angle scattering, and arbitrary aspect ratio. The alpha drift kinetic equation is solved for the alpha bootstrap current density; and the resulting expression inserted into a simple cylindrical Ampere's Law. In addition, the alpha bootstrap current is more rigorously solved, self-consistently, with the full 2-D Grad-Shafranov equilibrium equations for three currently conceived tokamaks: TPX, ITER-CDA and ITER-EDA. In particular, the effect of varying plasma Zeff on the alpha bootstrap current is investigated. (Copies available exclusively from MIT Libraries, Rm. 14-0551, Cambridge, MA 02139-4307. Ph. 617 -253-5668; Fax 617-253-1690.).

  12. An agreement coefficient for image comparison

    USGS Publications Warehouse

    Ji, L.; Gallo, K.

    2006-01-01

    Combination of datasets acquired from different sensor systems is necessary to construct a long time-series dataset for remotely sensed land-surface variables. Assessment of the agreement of the data derived from various sources is an important issue in understanding the data continuity through the time-series. Some traditional measures, including correlation coefficient, coefficient of determination, mean absolute error, and root mean square error, are not always optimal for evaluating the data agreement. For this reason, we developed a new agreement coefficient for comparing two different images. The agreement coefficient has the following properties: non-dimensional, bounded, symmetric, and distinguishable between systematic and unsystematic differences. The paper provides examples of agreement analyses for hypothetical data and actual remotely sensed data. The results demonstrate that the agreement coefficient does include the above properties, and therefore is a useful tool for image comparison. ?? 2006 American Society for Photogrammetry and Remote Sensing.

  13. The Experimental Determination of Impact Ionization Coefficients in Gallium-Arsenide and Indium Phosphide.

    NASA Astrophysics Data System (ADS)

    Bulman, Gary Eugene

    Impact ionization coefficients are important parameters for the understanding of high field transport in semiconductors. Previous determinations of the electron and hole impact ionization coefficients, (alpha) and (beta) respectively, in both GaAs and InP have been limited to narrow ranges of electric fields and are not in agreement. The results of extensive photocurrent multiplication measurements on both materials over a very wide electric field range are reported. The electroabsorption in the depletion region of recombination radiation generated in thick heavily doped contacts has been shown to produce a mixed photocurrent injection condition in InP devices. This process was observed in a device structure conventionally used for ionization measurements and will be important for measurements on any direct band gap material. A special device structure eliminating this process has been developed which permits simultaneous injection of pure electron and hole primary photocurrents needed for accurate impact ionization coefficient measurements. The impact ionization coefficients in (100) InP have been determined from photomultiplication measurements performed on specially fabricated p('+)n and n('+)p devices permitting both electron and hole injection. The ratio of (beta)/(alpha) is found to vary from 4.0 to 1.3 as the electric field increases from 2.5 to 7.7 x 10('5) V/cm. Avalanche noise measurements performed at 30 MHz are in general agreement with the experimental ionization coefficient data. Similar (100) GaAs p('+)n device structures have been fabricated, and the impact ionization coefficients determined from devices having heavy p('+) doping indicate the effects of a finite electron threshold energy. A method is devised to include this effect in the calculation of (alpha) and (beta), and agreement is obtained among these same devices by assuming a 1.7 eV electron threshold energy. The corrected ionization data is found to also be in agreement with data derived from devices not requiring this correction. The measured ratio of (alpha)/(beta) in GaAs is found to vary from 2.5 at 2.2 x 10('5) V/cm to 1.3 at 6.25 x 10('5) V/cm. Avalanche noise measurements performed on the same devices confirm these results. Devices fabricated on (111) GaAs exhibit a periodic variation in multiplication across the active region that is associated with terracing produced during the LPE growth process.

  14. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  15. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent in reducing cell proliferation and the expression of the CD36 scavenger receptor than the un-phosphorylated alpha-tocopherol (alpha T). We have now assessed the effects of alpha T an...

  16. Alpha Chain Structures of ^{12}C

    E-print Network

    Suk-Ho Hong; Suk-Joon Lee

    1999-03-01

    N-\\alpha structures of light nuclei with axial symmetry are studied using relativistic Hartree approximation. Metastable excited states are searched in a configuration space which allows linear alpha chain structures. As a result, it is shown that ^{12}C has ^8Be + \\alpha resonance state at about 1 MeV above ^8Be-\\alpha threshold as an asymmetric 3-\\alpha linear-chain structure, which plays an important role in stellar nucleosynthesis.

  17. On the diffusion of alpha-helical proteins in solvents

    NASA Astrophysics Data System (ADS)

    Barredo, Wilson I.; Bornales, Jinky B.; Bernido, Christopher C.; Aringa, Henry P.

    2015-01-01

    The winding probability function for a biopolymer diffusing in a crowded cell is obtained with the drift coefficient f(s) involving Bessel functions of general form f(s) = kJ2p+1 (?s). The variable s is the length along the chain and ? is a constant which can be used to simulate the frequency of appearance of a certain type of amino acid. Application of a particular case p = 3 to protein chains is carried out for different alpha helical proteins found in the Protein Data Bank (PDB). Analysis of our results leads us to an empirical formula that can be used to conveniently predict k/D and ?, where D is the diffusion coefficient of various ?-helical proteins in solvents.

  18. Characterization of alpha-cordierite glass-ceramics from fly ash.

    PubMed

    He, Yong; Cheng, Weimin; Cai, Hesheng

    2005-04-11

    Batches of alpha-cordierite glass-ceramics, designated as GC-I and GC-II, containing 68 and 64 wt.% fly ash, respectively, were crystallized in the temperature range of 1125-1320 degrees C. The XRD (X-ray powder diffractometer) of the glass-ceramics show that alpha-cordierite became the dominant phase in GC-I and GC-II at 1200 degrees C. GC-I and GC-II, whose solid parts contain 74 and 78 vol.% alpha-cordierite and whose compressive strengths are 35 and 50 MPa, respectively, have the respective linear thermal expansion coefficients of 1.51x10(-6) and 1.43x10(-6)/ degrees C. The fly ash alpha-cordierite glass-ceramics can be employed as kiln furniture, honeycomb substrates for catalysts, and heat exchangers. PMID:15811690

  19. Alpha-factor structural gene mutations in Saccharomyces cerevisiae: effects on alpha-factor production and mating.

    PubMed Central

    Kurjan, J

    1985-01-01

    The role of alpha-factor structural genes MF alpha 1 and MF alpha 2 in alpha-factor production and mating has been investigated by the construction of mf alpha 1 and mf alpha 2 mutations that totally eliminate gene function. An mf alpha 1 mutant in which the entire coding region is deleted shows a considerable decrease in alpha-factor production and a 75% decrease in mating. Mutations in mf alpha 2 have little or no effect on alpha-factor production or mating. The mf alpha 1 mf alpha 2 double mutants are completely defective in mating and alpha-factor production. These results indicate that at least one alpha-factor structural gene product is required for mating in MAT alpha cells, that MF alpha 1 is responsible for the majority of alpha-factor production, and that MF alpha 1 and MF alpha 2 are the only active alpha-factor genes. Images PMID:3887136

  20. Path-Counting Formulas for Generalized Kinship Coefficients and Condensed Identity Coefficients

    PubMed Central

    Cheng, En; Ozsoyoglu, Z. Meral

    2014-01-01

    An important computation on pedigree data is the calculation of condensed identity coefficients, which provide a complete description of the degree of relatedness of two individuals. The applications of condensed identity coefficients range from genetic counseling to disease tracking. Condensed identity coefficients can be computed using linear combinations of generalized kinship coefficients for two, three, four individuals, and two pairs of individuals and there are recursive formulas for computing those generalized kinship coefficients (Karigl, 1981). Path-counting formulas have been proposed for the (generalized) kinship coefficients for two (three) individuals but there have been no path-counting formulas for the other generalized kinship coefficients. It has also been shown that the computation of the (generalized) kinship coefficients for two (three) individuals using path-counting formulas is efficient for large pedigrees, together with path encoding schemes tailored for pedigree graphs. In this paper, we propose a framework for deriving path-counting formulas for generalized kinship coefficients. Then, we present the path-counting formulas for all generalized kinship coefficients for which there are recursive formulas and which are sufficient for computing condensed identity coefficients. We also perform experiments to compare the efficiency of our method with the recursive method for computing condensed identity coefficients on large pedigrees. PMID:25165486

  1. Path-counting formulas for generalized kinship coefficients and condensed identity coefficients.

    PubMed

    Cheng, En; Ozsoyoglu, Z Meral

    2014-01-01

    An important computation on pedigree data is the calculation of condensed identity coefficients, which provide a complete description of the degree of relatedness of two individuals. The applications of condensed identity coefficients range from genetic counseling to disease tracking. Condensed identity coefficients can be computed using linear combinations of generalized kinship coefficients for two, three, four individuals, and two pairs of individuals and there are recursive formulas for computing those generalized kinship coefficients (Karigl, 1981). Path-counting formulas have been proposed for the (generalized) kinship coefficients for two (three) individuals but there have been no path-counting formulas for the other generalized kinship coefficients. It has also been shown that the computation of the (generalized) kinship coefficients for two (three) individuals using path-counting formulas is efficient for large pedigrees, together with path encoding schemes tailored for pedigree graphs. In this paper, we propose a framework for deriving path-counting formulas for generalized kinship coefficients. Then, we present the path-counting formulas for all generalized kinship coefficients for which there are recursive formulas and which are sufficient for computing condensed identity coefficients. We also perform experiments to compare the efficiency of our method with the recursive method for computing condensed identity coefficients on large pedigrees. PMID:25165486

  2. S. Subramaniam Minimum error Fickian diffusion coefficients Minimum Error Fickian Diffusion Coefficients for Mass

    E-print Network

    Subramaniam, Shankar

    which are usually ex­ pressed as functions of the binary diffusion coefficients of each species pair of components with identical binary diffusivities. While these minimum error effective diffusion coefficients binary diffusion coefficients, thereby reducing computational expense. The necessary background for mass

  3. [The application of variable theoretical alpha influence coefficent to the matrix correction in Cr-Fe-Ni stainless steel].

    PubMed

    Ying, Xiao-hu; Wang, Qian; Cao, Guo-zhou; Yu, Ming-fang

    2004-12-01

    X-ray fluorescence analysis software Spectra Plus was used to calculate theoretical alpha influence coefficents of other elements to Cr in seven stainless steel standard samples, theoretical alpha influence coefficients of elements, by which Cr signal was enhanced, varied largely with the change of elements content. Variable theoretical alpha influence coefficients, which varied with elements content, were used to correct the matrix effects in stainless steel, the secondary excitation of Cr by other elements were corrected, and Cr (0.3%-20.8%) in stainless steel and low alloy steel could be analysed in accordance with one calibration curve. The matrix effects in samples can be corrected by variable theoretical alpha influence coefficients, so the measurable content range of calibration curve was enlarged. The contents of fifteen elements Al, Si, P, S, Ti, Cr, Mn, Co, Ni, Cu, As, Mo, Sn, W and Pb in stainless steel were measured by X-ray fluorescence spectrometer, variable theoretical alpha influence coefficients were used to correct the matrix effects, and the analysis results are comparable to those obtained by wet chemical method. PMID:15828360

  4. Medical image compression by sampling DCT coefficients.

    PubMed

    Wu, Yung-Gi

    2002-03-01

    Advanced medical imaging requires storage of large quantities of digitized clinical data. Due to the constrained bandwidth and storage capacity, however, a medical image must be compressed before transmission and storage. Among the existing compression schemes, transform coding is one of the most effective strategies. Image data in spatial domain will be transformed into spectral domain after the transformation to attain more compression gains. Based on the quantization strategy, coefficients of low amplitude in the transformed domain are discarded and significant coefficients are preserved to increase the compression ratio without inducing salient distortion. In this paper, we use an adaptive sampling algorithm by calculating the difference area between correct points and predicted points to decide the significant coefficients. Recording or transmitting the significant coefficients instead of the whole coefficients achieves the goal of compression. On the decoder side, a linear equation is employed to reconstruct the coefficients between two sequent significant coefficients. Simulations are carried out to different medical images, which include sonogram, angiogram, computed tomography, and X-ray images. Consequent images demonstrate the performance at compression ratios of 20-45 without perceptible alterations. In addition, two doctors are invited to verify that the decoded quality is acceptable for practical diagnosis. Therefore, our proposed method is found to preserve information fidelity while reducing the amount of data. PMID:11936601

  5. SLE?: correlation functions in the coefficient problem

    NASA Astrophysics Data System (ADS)

    Loutsenko, Igor

    2012-07-01

    We apply the method of correlation functions to the coefficient problem in stochastic geometry. In particular, we give a proof for some universal patterns conjectured by M Zinsmeister for the second moments of the Taylor coefficients for special values of ? in the whole-plane Schramm-Loewner evolution (SLE?). We propose to use multi-point correlation functions for the study of higher moments in the coefficient problem. Generalizations related to the Levy-type processes are also considered. The exact integral means ?-spectrum of this version of the whole-plane SLE? is discussed.

  6. Transport coefficients of a unitarized pion gas

    E-print Network

    Juan M. Torres-Rincon

    2011-11-16

    The latest experimental results in relativistic heavy-ion collisions show that the matter there produced requires transport coefficients because of the important collective properties found. We review the theoretical calculation of these transport coefficients in the hadron side at low temperatures by computing them in a gas composed of low energy pions. The interaction of these pions is taken from an effective chiral theory and further requiring scattering unitarity. The propagation of D and D* mesons in the thermalized pion gas is also studied in order to extract the heavy quark diffusion coefficients in the system.

  7. Soccer ball lift coefficients via trajectory analysis

    NASA Astrophysics Data System (ADS)

    Goff, John Eric; Carré, Matt J.

    2010-07-01

    We performed experiments in which a soccer ball was launched from a machine while two high-speed cameras recorded portions of the trajectory. Using the trajectory data and published drag coefficients, we extracted lift coefficients for a soccer ball. We determined lift coefficients for a wide range of spin parameters, including several spin parameters that have not been obtained by today's wind tunnels. Our trajectory analysis technique is not only a valuable tool for professional sports scientists, it is also accessible to students with a background in undergraduate-level classical mechanics.

  8. On the emission coefficient of uranium plasmas.

    NASA Technical Reports Server (NTRS)

    Schneider, R. T.; Campbell, H. D.; Mack, J. M.

    1973-01-01

    The emission coefficient for uranium plasmas (temperature: 8000 K) was measured for the wavelength range from 1200 to 6000 A. The results were compared to theoretical calculations and other measurements. Reasonable agreement between theoretical predictions and our measurements was found in the region from 1200 to 2000 A. Although it was difficult to make absolute comparisons among the different reported measurements, considerable disagreement was found for the higher wavelength region. A short discussion regarding the overall comparisons is given, and final suggestions are made as to the most appropriate emission coefficient values to be used in future design calculations. The absorption coefficient for the same wavelength interval is also reported.

  9. Alpha effects on TAE modes and alpha transport

    Microsoft Academic Search

    C. Z. Cheng; G. Y. Fu; H. E. Mynick; R. Budny; R. B. White; S. J. Zweben; C. T. Hsu; D. J. Sigmar; D. A. Spong; B. A. Carreras; C. L. Hedrick

    1992-01-01

    In a fusion reactor, any unanticipated loss of alpha power could result in serious wall damage, impurity influx, major operational control problems, and even a failure to sustain ignition. Neutral beam injection (NBI) experiments in large tokamaks have indicated that toroidicity-induced Alfven eigenmode (TAE) can be strongly unstable and cause the loss of about half of the fast beam ions.

  10. Assignments of Jpi in 58Ni via (alpha, alpha') and (6Li, d) reactions

    Microsoft Academic Search

    G. Guillaume; F. C. Jundt; H. W. Fulbright; J. C. D. Milton; C. L. Bennett

    1977-01-01

    Measurements of 58Ni(alpha, alpha')58Ni angular distributions have been extended to small angles and disagreements between Jpi assignments based on earlier (alpha, alpha'), and (6Li, d) measurements have been explained and resolved. NUCLEAR REACTIONS 58Ni(alpha, alpha'), Ealpha=30 MeV; measured dsigmadOmega, deduced Jpi for 5.59 and 6.02 MeV levels.

  11. Melanoma and IFN alpha: potential adjuvant therapy.

    PubMed

    Bottoni, U; Clerico, R; Paolino, G; Corsetti, P; Ambrifi, M; Brachini, A; Richetta, A; Nisticò, S; Pranteda, G; Calvieri, S

    2014-01-01

    Interferon alpha (IFNalpha) is the most used adjuvant treatment in clinical practice for melanoma (MEL) high-medium risk patients; however, the use of IFNalpha has yielded conflicting data on Overall Survival (OS) and disease free survival (DFS) rates. Starting from these considerations, we carried out an analysis on our MEL patients who received adjuvant IFNalpha therapy, in order to identify possible predictors for their outcome. A total of 140 patients were included in our analysis. Patients with Breslow thickness ?2.00 mm presented a significantly longer mean DFS than patients with Breslow ?2.01 mm (p = 0.01). Using non- parametric Spearman?s Coefficient test we found association between DFS and Breslow thickness (p < 0.001) and between DFS and ulceration (p = 0.03). Performing Multiple Regression test, Breslow thickness (p < 0.001) remained the only statistically significant predictor. From the OS analysis we found that patients with lower Breslow values ? 2.00 mm (p < 0.0001), and absence of ulceration (p <0.004) showed a significantly better long-term survival. From the current analysis we found that the use of low dose IFNalpha is justified only for cutaneous melanoma ? 4.01 mm that was not ulcerated; patients with Breslow ? 4.01 mm, in our opinion, should not carry out adjuvant treatment with low dose IFNalpha, because its side effects could be higher than the its benefits. PMID:25001659

  12. Determination of diffusion coefficient for unsaturated soils 

    E-print Network

    Sood, Eeshani

    2005-08-29

    resulting in failure of slopes of embankments constructed with these soils. Therefore, it is very important to study the diffusion properties of unsaturated soils. Study of the diffusion properties requires the determination of the diffusion coefficient...

  13. MITOSIS RECURSION FOR COEFFICIENTS OF SCHUBERT POLYNOMIALS

    E-print Network

    Miller, Ezra N.

    MITOSIS RECURSION FOR COEFFICIENTS OF SCHUBERT POLYNOMIALS EZRA MILLER Abstract.Mitosis is a rule introduced in [KM02a] for manipulating subsets proof of these properties of mitosis. 1. Introduction It has been

  14. Calculation of the Tetrachoric Correlation Coefficient.

    ERIC Educational Resources Information Center

    Divgi, D. R.

    1979-01-01

    A new computer subroutine has been developed for calculating the tetrachoric correlation coefficient. Recent advances in computing inverse normal and bivariate normal distributions have been utilized. The procedure is useful for item analysis. (Author/JKS)

  15. Inflaton decay in an alpha vacuum

    SciTech Connect

    Naidu, S.; Holman, R. [Department of Physics, Carnegie Mellon University, Pittsburgh Pennsylvania 15213 (United States)

    2005-03-15

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  16. Inflaton decay in an alpha vacuum

    NASA Astrophysics Data System (ADS)

    Naidu, S.; Holman, R.

    2005-03-01

    We study the alpha vacua of de Sitter space by considering the decay rate of the inflaton field coupled to a scalar field placed in an alpha vacuum. We find an alpha dependent Bose enhancement relative to the Bunch-Davies vacuum and, surprisingly, no nonrenormalizable divergences. We also consider a modified alpha dependent time-ordering prescription for the Feynman propagator and show that it leads to an alpha independent result. This result suggests that it may be possible to calculate in any alpha vacuum if we employ the appropriate causality preserving prescription.

  17. Absorption coefficient instrument for turbid natural waters.

    PubMed

    Friedman, E; Poole, L; Cherdak, A; Houghton, W

    1980-05-15

    An instrument has been developed that directly measures the multispectral absorption coefficient of turbid natural water. The design incorporates methods for compensation of variation in the internal light source intensity, correction of the spectrally dependent nature of the optical elements, and correction for variation in background light level. When used in conjunction with a spectrally matched total attenuation instrument, the spectrally dependent scattering coefficient can also be derived. Systematic errors associated with multiple scattering have been estimated using Monte Carlo techniques. PMID:20221099

  18. An energy-dependent electron backscattering coefficient

    NASA Astrophysics Data System (ADS)

    Williamson, W., Jr.; Antolak, A. J.; Meredith, R. J.

    1987-05-01

    An energy-dependent electron backscattering coefficient is derived based on the continuous slowing down approximation and the Bethe stopping power. Backscattering coefficients are given for 10-50-keV electrons incident on bulk and thin-film aluminum, silver, and gold targets. The results are compared with the Everhart theory and empirical fits to experimental data. The energy-dependent theory agrees better with experimental work.

  19. Asymptotic test statistics for coefficients of variation

    Microsoft Academic Search

    G. Edward Miller

    1991-01-01

    A one-sample asymptotically normal test statistic Is derived for testing the hypothesis that the coefficient of variation of a normal population is equal to a specified value. Based on this derivation, an asymptotically noraml two-sample test statistic and an asymptotically chi-square k-sample test statistic are derived for testing the hypothesis that the coefficients of variation of k ?2 normal populations

  20. Experience with alpha track detectors

    Microsoft Academic Search

    R. A. Oswald; R. V. Wheeler; C. Yoder

    1988-01-01

    The heightened awareness of radon hazards have resulted in an increase in the use of alpha track detectors. Field and laboratory tests have been conducted over sufficiently long periods of time by enough different laboratories so that characteristics of these detectors are better understood. The paper compares common experiences of Terradex Radtrak and Type SF detectors. Both detectors employ the

  1. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  2. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  3. LAMBDA ALPHA GRADUATE RESEARCH GRANTS

    E-print Network

    Tennessee, University of

    ) for the National Executive Council of the following materials printed front-to-back and stapled, with NO covers to the National Office before the postmarked March 1st deadline 4 copies (one original and 3 copies). Please mail materials to: Lambda Alpha National Office c/o Mrs. Barbara Di Fabio Department

  4. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  5. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate in thp-1 monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent than the un-phosphorylated alpha alpha-tocopherol (alphaT). We have now measured plasma levels of alphaTP and compared the cellular effects of alphaTP and gamma-tocopheryl phosphate ...

  6. Dependence of Seebeck coefficient on a load resistance and energy conversion efficiency in a thermoelectric composite

    SciTech Connect

    Yamashita, Osamu [Materials Science Co. Ltd., 5-5-44 Minamikasugaoka, Ibaraki, Osaka 567-0046 (Japan)], E-mail: yamashio567@yahoo.co.jp; Odahara, Hirotaka [Advanced Materials Co. Ltd., 4-6-10 Kizuri, Higashiosaka, Osaka 577-0827 (Japan); Ochi, Takahiro; Satou, Kouji [Faculty of Engineering, Ehime University, Bunkyocho, Matsuyama 790-8577 (Japan)

    2007-10-02

    The thermo-emf {delta}V and current {delta}I generated by imposing the alternating temperature gradients (ATG) at a period of T and the steady temperature gradient (STG) on a thermoelectric (TE) composite were measured as a function of t, where t is the lapsed time and T was varied from 60 to or {infinity} s. The STG and ATG were produced by imposing steadily and alternatively a source voltage V in the range from 1.0 to 4.0 V on two Peltier modules sandwiching a composite. {delta}T, {delta}V, {delta}I and V{sub P} oscillate at a period T and their waveforms vary significantly with a change of T, where {delta}V and V{sub P} are the voltage drops in a load resistance R{sub L} and in resistance R{sub P} of two modules. The resultant Seebeck coefficient |{alpha}| = |{delta}V|/{delta}T of a composite under the STG was found to be expressed as |{alpha}| = |{alpha}{sub 0}|(1 - R{sub comp}/R{sub T}), where R{sub T} is the total resistance of a circuit for measuring the output signals and R{sub comp} is the resistance of a composite. The effective generating power {delta}W{sub eff} has a local maximum at T = 960 s for the p-type composite and at T = 480 s for the n-type one. The maximum energy conversion efficiency {eta} of the p- and n-type composites under the ATG produced by imposing a voltage of 4.0 V at an optimum period were 0.22 and 0.23% at {delta}T{sub eff} = 50 K, respectively, which are 42 and 43% higher than those at {delta}T = 42 K under the STG. These maximum {eta} for a TE composite sandwiched between two Peltier modules, were found to be expressed theoretically in terms of R{sub P}, R{sub T}, R{sub L}, {alpha}{sub P} and {alpha}, where {alpha}{sub P} and {alpha} are the resultant Seebeck coefficients of Peltier modules and a TE composite.

  7. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  8. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  9. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  10. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of the electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance...

  11. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  12. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePLUS

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  13. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  14. Genetics Home Reference: Alpha-1 antitrypsin deficiency

    MedlinePLUS

    ... Where can I find information about diagnosis or management of alpha-1 antitrypsin deficiency? These resources address the diagnosis or management of alpha-1 antitrypsin deficiency and may include ...

  15. Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

    NASA Technical Reports Server (NTRS)

    Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

    1989-01-01

    The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

  16. Equation predicts non-Darcy flow coefficient

    SciTech Connect

    Kutasov, I.M.

    1993-03-15

    An equation has been derived for obtaining a non-Darcy flow coefficient that facilitates gas well remedial treatment calculations and production performance evaluations. For high-capacity gas wells, pressure drop near the well bore cannot be estimated from the Darcy equation in which the pressure gradient is proportional to the flow velocity (laminar flow). To describe the additional pressure drop in the transition of the laminar-turbulent flow regime, Forchheimer proposed an equation in which the non-Darcy term is proportional to the flow velocity squared. To determine the coefficient of proportionality, the non-Darcy flow coefficient, [beta], empirical data or semitheoretical equations are used. As a result of non-Darcy flow, estimates of the coefficient from build-up pressure test values of the apparent skin become rate dependent. For this reason, the nature of the skin, formation (true) skin or rate dependent skin, is important for designing remedial treatments or for evaluating the productivity of a perforated gas well. A semitheoretical equation is proposed in this article for relating the non-Darcy flow coefficient, [beta] (cm[sup [minus]1]), to effective gas permeability, k[sub g] (Darcies), porosity, [phi], and irreducible water saturation, S[sub w].

  17. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha

  18. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  19. cap alpha. Particle confinement in compact tori

    Microsoft Academic Search

    Bozhokin

    1986-01-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its

  20. Phi Alpha Theta Beta Iota Chapter

    E-print Network

    Martinez, Tony R.

    Phi Alpha Theta Beta Iota Chapter Membership Application If everyone can help in some capacity, Phi Alpha Theta will be a success! Check if you would like to help with the following: _____Activities:_________________ Attach a check for $45 made payable to Phi Alpha Theta and give to the History Department receptionist

  1. Nonsingular $\\alpha$-rigid maps: Short proof

    E-print Network

    Ageev, Oleg N

    2009-01-01

    It is shown that for every $\\alpha$, where $\\alpha\\in [0, 1/2]$, there exists an $\\alpha$-rigid transformation whose spectrum has Lebesgue component. This answers the question posed by Klemes and Reinhold in [7]. We apply a certain correspondence between weak limits of powers of a transformation and its skew products.

  2. Refinement of the $n-\\alpha$ and $p-\\alpha$ fish-bone potential

    E-print Network

    Smith, E; Papp, Z

    2012-01-01

    The fishbone potential of composite particles simulates the Pauli effect by nonlocal terms. We determine the $n-\\alpha$ and $p-\\alpha$ fish-bone potential by simultaneously fitting to the experimental phase shifts. We found that with a double Gaussian parametrization of the local potential can describe the $n-\\alpha$ and $p-\\alpha$ phase shifts for all partial waves.

  3. 17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary

    E-print Network

    17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six

  4. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha

  5. Effects of pre-equilibrium nucleon emission on excitation functions of various reactions in vanadium induced by alpha particles

    Microsoft Academic Search

    N L Singh; S Mukherjee; A V Mohan Rao; L Chaturvedi; P P Singh

    1995-01-01

    Excitation functions for the 51V(( alpha ,n), ( alpha ,3n), ( alpha ,p3n), ( alpha ,p6n), ( alpha , alpha 3n), ( alpha , alpha 2pn), ( alpha ,2 alpha ), ( alpha ,2 alpha n) and ( alpha ,2 alpha 3n)) reactions have been measured up to 120 MeV using the stacked foil technique with a view to improving

  6. Farmers' Attitudes and Skills of Farm Business Management in Jordan

    ERIC Educational Resources Information Center

    Al-Rimawi, Ahmad Sh.; Karablieh, Emad K.; Al-Qadi, Abdulfatah S.; Al-Qudah, Hussein F.

    2006-01-01

    This study aimed to investigate farmers' attitudes and skills of farm management. Two scales were constructed as an instrument for data collection, based on a sample of 100 farm units. Cronbach's alpha coefficients were 0.84 or higher, which indicated that the instrument scales were internally consistent. Non-parametric tests were used to analyze…

  7. The Effects of Methods of Imputation for Missing Values on the Validity and Reliability of Scales

    ERIC Educational Resources Information Center

    Cokluk, Omay; Kayri, Murat

    2011-01-01

    The main aim of this study is the comparative examination of the factor structures, corrected item-total correlations, and Cronbach-alpha internal consistency coefficients obtained by different methods used in imputation for missing values in conditions of not having missing values, and having missing values of different rates in terms of testing…

  8. (De)Motivation in Preparatory EFL Classrooms

    ERIC Educational Resources Information Center

    Vefali, Gülsen Musayeva; Ayan, Hatice Ç.

    2015-01-01

    This survey study aimed to explore EFL learners' (de)motivation in the preparatory classes at a tertiary institution in Northern Cyprus. It administered questionnaires to 105 preparatory learners and 30 language teachers. The statistical analysis revealed the Cronbach's alpha reliability coefficient of 0.88 for the Learners' version, and 0.89 for…

  9. Confirmatory Factor Analysis of Persian Adaptation of Multidimensional Students' Life Satisfaction Scale (MSLSS)

    ERIC Educational Resources Information Center

    Hatami, Gissou; Motamed, Niloofar; Ashrafzadeh, Mahshid

    2010-01-01

    Validity and reliability of Persian adaptation of MSLSS in the 12-18 years, middle and high school students (430 students in grades 6-12 in Bushehr port, Iran) using confirmatory factor analysis by means of LISREL statistical package were checked. Internal consistency reliability estimates (Cronbach's coefficient [alpha]) were all above the…

  10. Incoming Engineering Students' Self-Assessment of Their Mathematical Background

    ERIC Educational Resources Information Center

    Guner, Necdet

    2013-01-01

    The aim of this study was to develop a tool to measure levels of mathematical knowledge gained in high school, as perceived by incoming engineering students. The study included 657 engineering students in the 2011-2012 academic year. Factor analysis was used to obtain a scale consisting of 47 items (Cronbach Alpha coefficient, 0.975). The…

  11. Understanding correlation coefficients in treaty verification

    SciTech Connect

    DeVolpi, A.

    1991-11-01

    When a pair of images are compared on a point-by-point basis, the linear-correlation coefficient is usually used as a measure of similarity or dissimilarity. This paper evaluates the theoretical underpinnings and limitation of the linear-correlation coefficient, as well as other related statistics, particularly for cases where inherent white noise is present. As a result of the limitations in linear-correlation, an additional step has been derived -- local-sum clustering -- in order to improve recognition of small dissimilarities in a pair images. Results show that three-stage procedure, consisting of first establishing congruence of the two images, than using the linear-correlation coefficient as a test of true negatives, and finally qualifying a true positive by using the cluster (local-sum) method. These algorithmic stages would be especially useful in arms control treaty verification.

  12. {alpha}-particle spectrum in the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha}

    SciTech Connect

    Dmitriev, V. F., E-mail: dmitriev@inp.nsk.s [Budker Institute of Nuclear Physics (Russian Federation)

    2009-07-15

    Using a simple phenomenological parametrization of the reaction amplitude we calculated {alpha}-particle spectrumin the reaction p + {sup 11}B {yields} {alpha} + {sup 8}Be* {yields} 3{alpha} at the resonance proton energy of 675 keV. The parametrization includes Breit-Wigner factor with an energy-dependent width for intermediate {sup 8}Be* state and the Coulomb and the centrifugal factors in {alpha}-particle-emission vertices. The shape of the spectrum consists of a well-defined peak corresponding to emission of the primary {alpha} and a flat shoulder going down to very low energy. We found that below 1.5MeV there are 17.5% of {alpha}'s and below 1MeV there are 11% of them.

  13. Alpha-plutonium's Grüneisen parameter.

    PubMed

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-28

    Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals. PMID:21386421

  14. Adult chicken alpha-globin genes alpha A and alpha D: no anemic shock alpha-globin exists in domestic chickens.

    PubMed

    Dodgson, J B; McCune, K C; Rusling, D J; Krust, A; Engel, J D

    1981-10-01

    Three alpha-type globin genes have been identified in the alpha-globin linkage group of chickens. No other alpha-type genes hae been directly shown to be within 10 kilobase pairs of any of these three closely linked genes. These three genes have been conclusively identified by DNA sequence analysis. The gene at the 5' end of the linkage group is an embryonic alpha-type globin gene, pi or pi', and the central gene corresponds to the minor adult alpha- globin, alpha D. The 3'-terminal gene sequence corresponds to the sequence of cDNA clones previously described as "alpha S", presumed anemic shock-induced alpha-globin gene [Salser, W. A., Cummings, I., Liu, A., Strommer, J., Padayatty, J. & Clarke, P. (1979) in Cellular and Molecular Regulation of Hemoglobin Switching, eds. Stamatoyannopoulos, G. & Nienheis, A. (Grune and Stratton, New York), pp. 621-643; Richards, R. I. & Wells, J. R. E. (1980) J. Biol. Chem. 255, 9306-9311]. Several groups of workers have isolated alpha S-type cDNA clones but no one has identified a cDNA clone corresponding to the published amino acid sequence of the major chicken alpha-globin, alpha A. We have identified the alpha S-type sequence as the only abundant alpha-like globin sequence in cDNA clones made from reticulocyte mRNA isolated from nonanemic chickens. Therefore, we suggest that the alpha S-type sequence corresponds to the true alpha A-globin species. PMID:6273837

  15. Introduction to Network Science 13 Clustering Coefficient and Transitivity

    E-print Network

    Safro, Ilya

    Introduction to Network Science 13 Clustering Coefficient and Transitivity #12;Introduction to Network Science 14 [BE] "Network Analysis" Clustering Coefficient and Transitivity #12;Introduction to Network Science 15 Clustering Coefficient and Transitivity #12;Introduction to Network Science 16 Homework

  16. Copernicus measurement of the Jovian Lyman-alpha emission and its aeronomical significance

    NASA Technical Reports Server (NTRS)

    Atreya, S. K.; Kerr, R. B.; Upson, W. L., II; Festou, M. C.; Donahue, T. M.; Barker, E. S.; Cochran, W. D.; Bertaux, J. L.

    1982-01-01

    It is pointed out that the intensity of the Lyman-alpha emission is a good indicator of the principal aeronomical processes on the major planets. The high-resolution ultraviolet spectrometer aboard the Orbiting Astronomical Observatory Copernicus was used in 1980 April and May to detect the Jovian Lyman-alpha emission by spectroscopically discriminating it from other Doppler shifted Lyman-alpha emissions such as those of the geocorona, and the interplanetary medium. Taking into consideration the reported emission data, it appears that an unusually large energy input due to the particle precipitation in the auroral region must have been responsible for the large observed Lyman-alpha intensity during the Voyager encounter. At most other times, the observed Jovian Lyman-alpha intensity can be explained, within the range of statistical uncertainty, by a model that takes into consideration the solar EUV flux, the solar Lyman-alpha flux, the high exospheric temperature, and the eddy diffusion coefficient without energy input from the auroral sources.

  17. Absorption coefficient instrument for turbid natural waters

    NASA Astrophysics Data System (ADS)

    Friedman, E.; Cherdak, A.; Poole, L.; Houghton, W.

    1980-05-01

    The paper presents an instrument that directly measures multispectral absorption coefficient of turbid natural water. Attention is given to the design, which is shown to incorporate methods for the compensation of variation in the internal light source intensity, correction of the spectrally dependent nature of the optical elements, and correction for variation in the background light level. In addition, when used in conjunction with a spectrally matched total attenuation instrument, the spectrally dependent scattering coefficient can also be derived. Finally, it is reported that systematic errors associated with multiple scattering have been estimated using Monte Carlo techniques.

  18. Absorption coefficient instrument for turbid natural waters

    NASA Technical Reports Server (NTRS)

    Friedman, E.; Cherdak, A.; Poole, L.; Houghton, W.

    1980-01-01

    The paper presents an instrument that directly measures multispectral absorption coefficient of turbid natural water. Attention is given to the design, which is shown to incorporate methods for the compensation of variation in the internal light source intensity, correction of the spectrally dependent nature of the optical elements, and correction for variation in the background light level. In addition, when used in conjunction with a spectrally matched total attenuation instrument, the spectrally dependent scattering coefficient can also be derived. Finally, it is reported that systematic errors associated with multiple scattering have been estimated using Monte Carlo techniques.

  19. Fractal diffusion coefficient from dynamical zeta functions

    E-print Network

    G. Cristadoro

    2005-09-28

    Dynamical zeta functions provide a powerful method to analyze low dimensional dynamical systems when the underlying symbolic dynamics is under control. On the other hand even simple one dimensional maps can show an intricate structure of the grammar rules that may lead to a non smooth dependence of global observable on parameters changes. A paradigmatic example is the fractal diffusion coefficient arising in a simple piecewise linear one dimensional map of the real line. Using the Baladi-Ruelle generalization of the Milnor-Thurnston kneading determinant we provide the exact dynamical zeta function for such a map and compute the diffusion coefficient from its smallest zero.

  20. Transport coefficients in Chiral Perturbation Theory

    E-print Network

    D. Fernandez-Fraile; A. Gomez Nicola

    2006-10-16

    We present recent results on the calculation of transport coefficients for a pion gas at zero chemical potential in Chiral Perturbation Theory using Linear Response Theory. More precisely, we show the behavior of DC conductivity and shear viscosity at low temperatures. To compute transport coefficients, the standard power counting of ChPT has to be modified. The effects derived from imposing unitarity are also analyzed. As physical applications in Relativistic Heavy Ion Collisions, we show the relation of the DC conductivity to soft-photon production and phenomenological effects related to a nonzero shear viscosity. In addition, our values for the shear viscosity to entropy ratio satisfy the KSS bound.

  1. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: matthew@astro.su.se [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  2. Perceptual Encryption of JPEG Compressed Images Using DCT Coefficients and Splitting of DC Coefficients into Bitplanes

    Microsoft Academic Search

    Muhammad Imran Khan; Varun Jeoti; Muhammad Asif Khan

    2010-01-01

    Perceptual Encryption is required in many of the multimedia content preview application. There is always a need of an efficient technique that reduces the overhead of encryption in real-time. In this paper we take advantage of the energy present in DCT block and have studied the effects of encrypting the selected DCT coefficient. Also the DC coefficient is further divided

  3. Separation of Cf, Es, and Fm by eluative chromatography using ammonium. cap alpha. -hydroxyisobutyrate

    SciTech Connect

    Mikheev, N.B.; Kamenskaya, A.N.; Auerman, L.N.; Kulyukhin, S.A.; Rumer, I.A.; Novichenko, V.L.

    1987-11-01

    The method of separation of californium, einsteinium, fermium, and certain lanthanides, based on the use of ammonium ..cap alpha..-hydroxyisobutyrate as the eluent, has been improved. The use of a 0.10-0.14 M solution of this reagent and columns (9 x 0.5 cm) filled with the resin Aminex SB with particle size 20-25 ..mu.., permitted the production of about 0.5 ..mu..g of einsteinium-253 from irradiated californium-252 with coefficient of purification of einsteinium from californium in two cycles of adsorption and elution of approx. 10/sup 10/. The coefficient of separation of californium and einsteinium is equal to 1.6 and that of einsteinium and fermium 1.9. The behavior of certain lanthanides in the separation of californium, einsteinium, and fermium using a 0.010 M solution of ammonium ..cap alpha..-hydroxyisobutyrate is discussed.

  4. Gain compression coefficient and above-threshold linewidth enhancement factor in InAs/GaAs quantum DFB lasers

    NASA Astrophysics Data System (ADS)

    Su, H.; Zhang, L.; Gray, A. L.; Wang, R.; Varangis, P. M.; Lester, L. F.

    2005-04-01

    We measure, for the first time, the gain compression coefficient and above-threshold linewidth enhancement factor (alpha parameter) in quantum dot (QD) distributed feedback lasers (DFB) by time-resolved-chirp (TRC) characterization. The alpha parameter is measured to be 2.6 at threshold and increases to 8 when the output power of the QD DFB is increased to 3 mW. The dependence of the above-threshold alpha parameter on the optical power is found to be stronger than the optical gain compression effect alone can predict. The inhomogeneous gain broadening, gain saturation at the ground states and carrier filling in the excited states in QDs are proposed to explain the results.

  5. Electroabsorption produced mixed injection and its effect on the determination of ionization coefficients

    NASA Astrophysics Data System (ADS)

    Bulman, G. E.; Cook, L. W.; Stillman, G. E.

    1982-12-01

    The electroabsorption of sub-bandgap radiation generated by the recombination of diffusing minority carriers has been shown to produce a mixed photocurrent injection condition when using standard carrier injection methods in p-n junction devices with thick contact regions. This mechanism, which may occur in any direct bandgap semiconductor, has important consequences in devices with thick contact regions where the resulting mixed injection produces results indicating a smaller difference in the calculated ionization coefficients. A structure eliminating this problem has been fabricated and the ratio of the ionization coefficients, beta/alpha, in InP is found to decrease from 4.0 to 1.3 as the field increases from 2.4 to 7.7 x 10 to the 5th V/cm.

  6. Electron-Ion Recombination Rate Coefficient Measurements in a Flowing Afterglow Plasma

    NASA Technical Reports Server (NTRS)

    Gougousi, Theodosia; Golde, Michael F.; Johnsen, Rainer

    1996-01-01

    The flowing-afterglow technique in conjunction with computer modeling of the flowing plasma has been used to determine accurate dissociative-recombination rate coefficients alpha for the ions O2(+), HCO(+), CH5(+), C2H5(+), H3O(+), CO2(+), HCO2(+), HN2O(+), and N2O(+) at 295 K. We find that the simple form of data analysis that was employed in earlier experiments was adequate and we largely confirm earlier results. In the case of HCO(+) ions, published coefficients range from 1.1 X 10(exp -7) to 2.8 x 10(exp -7) cu cm/S, while our measurements give a value of 1.9 x 10(exp -7) cu cm/S.

  7. alpha-Tocopheryl phosphate – an active lipid mediator?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The vitamin E (alpha-tocopherol, alphaT) derivative, alpha-tocopheryl phosphate (alphaTP), is detectable in small amounts in plasma, tissues, and cultured cells. Studies done in vitro and in vivo suggest that alphaT can become phosphorylated and alphaTP dephosphorylated, suggesting the existence of ...

  8. Coefficient Omega Bootstrap Confidence Intervals: Nonnormal Distributions

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin

    2013-01-01

    The performance of the normal theory bootstrap (NTB), the percentile bootstrap (PB), and the bias-corrected and accelerated (BCa) bootstrap confidence intervals (CIs) for coefficient omega was assessed through a Monte Carlo simulation under conditions not previously investigated. Of particular interests were nonnormal Likert-type and binary items.…

  9. Roughness coefficient for unsubmerged and submerged reed

    Microsoft Academic Search

    Feng-feng GU; Han-gen NI; Ding-man QI

    2007-01-01

    The characteristics of the roughness coefficient are very important for practical application. Some experiments are conducted to study the variation of Manning's n with flow depth, mean velocity, and density of vegetation,. An assumed velocity distribution to describe the vegetative flow of submerged vegetation is confirmed by experimental results. The measured velocities in this study seem to have little effect

  10. Rate coefficient for the reaction N + NO

    Microsoft Academic Search

    J. L. Fox

    1994-01-01

    Evidence has been advanced that the rate coefficient for the reaction N + NO â Nâ + O has a small positive temperature dependence at the high temperatures (900-1500 K) that prevail in the terrestrial middle and upper thermosphere by Siskind and Rusch, and at the low temperatures (100-200 K) of the Martian lower thermosphere by Fox. Assuming that the

  11. Rate coefficient for the reaction N + NO

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1994-01-01

    Evidence has been advanced that the rate coefficient for the reaction N + NO right arrow N2 + O has a small positive temperature dependence at the high temperatures (900 to 1500 K) that prevail in the terrestrial middle and upper thermosphere by Siskind and Rusch (1992), and at the low temperatures (100 to 200 K) of the Martian lower thermosphere by Fox (1993). Assuming that the rate coefficient recommended by the Jet Propulsion Laboratory evaluation (DeMore et al., 1992) is accurate at 300 K, we derive here the low temperature value of the activation energy for this reaction and thus the rate coefficient that best fits the Viking 1 measured NO densities. We find that the fit is acceptable for a rate coefficient of about 1.3 x 10(exp -10)(T/300)(exp 0.5)exp(-400/T) and better for a value of about 2.5 x 10(exp -10)(T/300)(exp 0.5)exp(-600/T)cu cm/s.

  12. Rational Roots of Polynomials with Integer Coefficients

    ERIC Educational Resources Information Center

    Combs, Randel; Walls, Gary L.

    2004-01-01

    In this note the authors investigate ways to shorten the amount of work involved in using the Rational Roots Theorem to find the rational roots of a polynomial with integral coefficients. The first result is a proof of a fact that we had long suspected, but were never able to find the statement of in any of the college algebra textbooks we had…

  13. Recursive Construction of Operator Product Expansion Coefficients

    NASA Astrophysics Data System (ADS)

    Holland, Jan; Hollands, Stefan

    2015-06-01

    We derive a novel formula for the derivative of operator product expansion (OPE) coefficients with respect to a coupling constant. The formula involves just the OPE coefficients themselves but no further input, and is in this sense self-consistent. Furthermore, unlike other formal identities of this general nature in quantum field theory (such as the formal expression for the Lagrangian perturbation of a correlation function), our formula requires no further UV-renormalization, i.e., it is completely well-defined from the start. This feature is a result of a cancelation of UV- and IR-divergences between various terms in our identity. Our proof, and an analysis of the features of the identity, is given for the example of massive, Euclidean theory in 4 dimensional Euclidean space. It relies on the renormalization group flow equation method and is valid to arbitrary, but finite orders in perturbation theory. The final formula, however, makes neither explicit reference to the renormalization group flow, nor to perturbation theory, and we conjecture that it also holds non-perturbatively. Our identity can be applied constructively because it gives a novel recursive algorithm for the computation of OPE coefficients to arbitrary (finite) perturbation order in terms of the zeroth order coefficients corresponding to the underlying free field theory, which in turn are trivial to obtain. We briefly illustrate the relation of this method to more standard methods for computing the OPE in some simple examples.

  14. The Seebeck coefficient of superionic conductors

    NASA Astrophysics Data System (ADS)

    Mahan, G. D.

    2015-01-01

    We present a theory of the anomalous Seebeck coefficient found in the superionic conductor Cu2Se. It has a phase transition at T = 400 K where the cations disorder but the anions do not. This disorder gives a temperature-dependent width to the electronic states in the conduction band. This width provides the anomalous Seebeck contribution.

  15. Apparatus Measures Seebeck Coefficient And Resistivity

    NASA Technical Reports Server (NTRS)

    Zoltan, Leslie D.; Wood, Charles; Fleurial, Jean-Pierre; Liu, Yixin

    1993-01-01

    Electrical measurements made by four point probes, two of which double as temperature probes. Laboratory apparatus measures both Seebeck coefficients and electrical resistivities of candidate thermoelectric materials at temperatures from ambient to 1,300 K. Apparatus makes possible to take both measurements alternately and in rapid succession during same heating cycle, thereby reducing distortion.

  16. Phosphorus Availability Coefficients from Various Organic Sources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives of this study were to determine Phosphorus Availability Coefficients (PACs) for a variety of organic phosphorus (P) sources, and to examine the relationship between PACs measured in simulated rainfall runoff and alternative soil incubations. PAC is an important parameter in the P-Ind...

  17. Anisotropic fluid with time dependent viscosity coefficients

    Microsoft Academic Search

    Hristu Culetu

    2007-01-01

    A spacetime endowed with an anisotropic fluid is proposed for the interior of a Schwarzschild black hole. The geometry has an instantaneous Minkowski form and is a solution of Einstein's equations with a stress tensor on the r.h.s. obeying all the energy conditions. The interior fluid is compressible, with time dependent shear and bulk viscosity coefficients. The energy density $\\\\rho$

  18. Modeling of the DCT coefficients of images

    Microsoft Academic Search

    M. Omair Ahmad; M. N. S. Swamy

    2008-01-01

    In this paper, the symmetric normal inverse Gaussian (SNIG) probability density function (PDF) is proposed as a highly suitable prior for modelling the DCT coefficients of natural images. A new method, based on minimizing the Kullback-Leibler divergence between the proposed prior and the empirical PDF extracted from image data, is proposed to estimate the SNIG parameters. The efficacy of the

  19. ESTIMATING CROP COEFFICIENTS WITH CROP CANOPY SIZE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Planting time, plant density, variety, and cultural practices vary widely for horticultural crops. It is difficult to estimate a basal crop coefficient that can incorporate these variations. Canopy cover, as an indicator of intercepted sunlight, is related to crop water use. We used a weighing ly...

  20. The Multidimensional Random Coefficients Multinomial Logit Model.

    ERIC Educational Resources Information Center

    Adams, Raymond J.; Wilson, Mark; Wang, Wen-chung

    1997-01-01

    Presents a multidimensional Rasch-type item response model, the multidimensional random coefficients multinomial logit model, which is developed in a form that permits generalization to the multidimensional case of a wide class of Rasch models. Derives marginal maximum likelihood estimators for the model. (SLD)

  1. When Should Epidemiologic Regressions Use Random Coefficients?

    Microsoft Academic Search

    Sander Greenland

    2000-01-01

    SUMMARY. Regression models with random coefficients arise naturally in both frequentist and Bayesian approaches to estimation problems. They are becoming widely available in standard computer packages under the headings of generalized linear mixed models, hierarchical models, and multilevel models. I here argue that such models offer a more scientifically defensible framework for epidemiologic analysis than the fixed-effects models now prevalent

  2. Bootstrap power of the generalized correlation coefficient

    Microsoft Academic Search

    Reza Modarres

    1996-01-01

    We present a bootstrap Monte Carlo algorithm for computing the power function of the generalized correlation coefficient. The proposed method makes no assumptions about the form of the underlying probability distribution and may be used with observed data to approximate the power function and pilot data for sample size determination. In particular, the bootstrap power functions of the Pearson product

  3. A Graphical Interpretation of Probit Coefficients.

    ERIC Educational Resources Information Center

    Becker, William E.; Waldman, Donald M.

    1989-01-01

    Contends that, when discrete choice models are taught, particularly the probit model, it is the method rather than the interpretation of the results that is emphasized. This article provides a graphical technique for interpretation of an estimated probit coefficient that will be useful in statistics and econometrics courses. (GG)

  4. Molecular Diffusion Coefficients: Experimental Determination and Demonstration.

    ERIC Educational Resources Information Center

    Fate, Gwendolyn; Lynn, David G.

    1990-01-01

    Presented are laboratory methods which allow the demonstration and determination of the diffusion coefficients of compounds ranging in size from water to small proteins. Included are the procedures involving the use of a spectrometer, UV cell, triterated agar, and oxygen diffusion. Results including quantification are described. (CW)

  5. On Reshaping of Clustering Coefficients in Degree-

    E-print Network

    Loguinov, Dmitri

    On Reshaping of Clustering Coefficients in Degree- based Topology Generators Presented by Derek al. found that the average shortest path between pairs of nodes is small. ­ High clustering al. in 1999. #12;Properties of Internet Graph II · The clustering of node v is where dv is the degree

  6. ESTIMATING SOURCE COEFFICIENTS FOR PHOSPHORUS SITE INDICES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphorus (P) release to runoff varies widely for different land-applied organic-P sources even when applied at equivalent total P rates. To address this variability, some P site indices include tabulated P source coefficients (PSCs) for differential weighting of applied P materials based on their ...

  7. Concentration and microheterogeneity glycophorms of alpha-1-acid glycoprotein in major depressive disorder

    Microsoft Academic Search

    A. Sluzewska; J. K. Rybakowski; M. Sobieska; K. Wiktorowicz

    1996-01-01

    Serum alpha-1-acid glycoprotein (AGP) concentration and its microheterogeneity were measured in 46 patients with major depressive disorder and in 20 age- and sex-matched controls. The changes in major microheterogeneity of AGP were expressed as reactivity coefficient (AGP-RC). Also measured were the levels of C-reactive protein as well as leukocyte, neutrophil and monocyte counts. The results obtained showed that two thirds

  8. Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.

    PubMed

    Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L

    2015-03-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

  9. Analysis of Raman scattered Ly-alpha emissions from the atmosphere of Uranus

    NASA Technical Reports Server (NTRS)

    Yelle, R. V.; Doose, L. R.; Tomasko, M. G.; Strobel, D. F.

    1987-01-01

    A line at 1280 A, due to Raman scattering of solar Lyman alpha (Ly-alpha) in the atmosphere of Uranus, has been detected by the Voyager Ultraviolet Spectrometer. The measured intensity of 40 + or - 20 R implies that 200 R to 500 R of the measured 1500 R Ly-alpha intensity at the subsolar point is due to Rayleigh scattering of the solar line. The presence of Rayleigh and Raman scattering at 1216 A suggests that the Uranian atmosphere is largely devoid of absorbing hydrocarbons above the 0.5 mbar level. The most natural explanation of this depletion is very weak vertical mixing equivalent to an eddy coefficient on the order of 200 sq cm/sec between 0.5 mbar and 100 mbar.

  10. Layer coefficients for NHDOT pavement materials

    NASA Astrophysics Data System (ADS)

    Janoo, Vincent C.

    1994-09-01

    In 1992, the New Hampshire Department of Transportation (NHDOT) experimented with the use of reclaimed asphalt concrete as a base course material, identified by NHDOT as reclaimed stabilized base (RSB). The RSB and a control test section were placed on Interstate 93 between exits 18 and 19. The RSB test section was designed to the same structural number (SN) as the control. To evaluate the structural capacity of these test sections, the U.S. Army Cold Regions Research and Engineering Laboratory (CRREL) conducted deflection tests using a Dynatest 8000 falling weight deflectometer (FWD). Preliminary analysis of the results by NHDOT personnel showed higher deflection in the reclaimed asphalt concrete test sections. The explanation was that the layer coefficient used for the RSB layer in the design was probably incorrect. A total of 10 test sections constituting the base course materials used by NHDOT were built near Bow, New Hampshire. CRREL evaluated and estimated the layer coefficients of the base course materials. The test program was developed to characterize the material in more than one way. Tests were conducted with the heavy weight deflectometer (HWD), dynamic cone penetrometer (DCP) and the Clegg hammer. In situ California bearing ratio (CBR) tests were also conducted. The deflection from the HWD were used with the WESDEF back calculation program to determine the layer moduli. The moduli were than used with the AASHTO Design Guide to calculate the layer coefficients. The layer coefficients were also determined with the method proposed by Rohde. The CBR values from the Clegg hammer, in situ CBR and DCP tests were also used in the relationships in the HDM model to determine the layer coefficients.

  11. The Ly-alpha/H-alpha ratio in high-redshift radio galaxies

    NASA Technical Reports Server (NTRS)

    Mccarthy, Patrick J.; Elston, Richard; Eisenhardt, Peter

    1992-01-01

    The first spectroscopic detection of H-alpha emission from radio galaxies at z greater than 2 are presented. Strong H-alpha emission is detected at z = 2.429 in B3 0731 + 438, and H-alpha is directed at z = 2.428 in 0406 - 244 at a significant level of greater than 6 sigma. The resulting Ly-alpha/H-alpha ratios for 0731 + 438 and 0406 - 244 are 3.9 and 3.2 with 3 sigma uncertainties of 1.5 for each. A range of possible extinctions is derived depending on the reddening-free Ly-alpha/H-alpha ratio assumed and the extinction curve employed. The most important result of this study is the demonstration that the Ly-alpha/H-alpha ratio in distant galaxies can now be measured with relative ease.

  12. CR-SA hysteresis phenomenon on the basis of alpha-particle satellite data

    NASA Astrophysics Data System (ADS)

    Dorman, L. I.; Iucci, N.; Parisi, M.; Villoresi, G.

    We analyzed satellite 5-min data on alpha-particle fluxes in energy intervals 60-160 MeV, 160-260 MeV and 330-500 MeV during January 1986 -- May 2000. In the first we excluded periods with great CR increases caused by particle acceleration in solar flare events. Then we determined monthly averaged fluxes as well as 5 months and 11 months smooth averaged data. We corrected these data on drift effects according to the procedure described in Dorman (2004) in dependence of alpha-particle energies. Corrected on drifts alpha-particles fluxes we compare with expected according to convection-diffusion modulation for different values of supposed dimension of the modulation region (measured by time of solar wind propagation from the Sun to the boundary of this region Xo from 1 to 60 av. months; described in Dorman, 2004). By this way we can determine Xomax, at what the correlation coefficient reaches the maximum value. Then it can be determined the dimension of modulation region (with taking into account the influence of nonlinear processes on the solar wind speed in the outer Heliosphere according to Le Roux and Fichtner, 1997), the radial diffusion coefficient and transport path as well as expected alpha-particle intensity out of the modulation region and absolute alpha-particle modulation (relative to the alpha-particle intensity level in the interstellar space). References: Dorman L.I. ``Expected relative role of drift and convection-diffusion mechanisms in global small energy cosmic ray modulation''. Paper, submitted on the Session D1.2 of COSPAR 2004. Le Roux J.A. and H. Fichtner ``The influence of pickup, anomalous, and galactic cosmic ray protons on the structure of the heliospheric shock: a self consistent approach'', Astrophys. J, 477, L115-L118, 1997.

  13. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl

    2015-02-10

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  14. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2015-01-01

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  15. alpha,alpha-Difluoro-beta-aminodeoxystatine-containing renin inhibitory peptides.

    PubMed

    Thaisrivongs, S; Schostarez, H J; Pals, D T; Turner, S R

    1987-10-01

    The preparations of sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(S)- and -3(R)-[(4-methoxyphenyl)amino]-6-methylheptanoates (7a and 7b) from sodium 4(S)-[(tert-butyloxycarbonyl)amino]-2,2-difluoro-3(R)- and -3(S)-hydroxy-6-methylheptanoates (1a and 1b) are described. The key step involves the stereospecific intramolecular displacement via a Mitsunobu reaction for the conversion of a beta-hydroxy hydroxamate to a beta-lactam ring. Compounds 7a and 7b are useful as synthetic intermediates for the preparation of enzyme inhibitors that contain 3(S),4(S)- and 3(R),4(S)-diamino-2,2-difluoro-6-methylheptanoic acid inserts. Angiotensinogen analogues VII and VIII that contain these novel amino analogues of difluorostatine were shown to be inhibitors of the enzyme renin. The alpha,alpha-difluoro-beta-aminodeoxystatine-containing compounds were shown to be weaker inhibitors than the corresponding difluorostatine-containing congeners. PMID:3309315

  16. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  17. Targeted alpha therapy for cancer

    NASA Astrophysics Data System (ADS)

    Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John

    2004-08-01

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

  18. [Cardiovascular complications of alpha interferon].

    PubMed

    Le Corguillé, Monika; Pochmalicki, Gilbert; Eugène, Claude

    2007-12-01

    Interferon-alpha is a biological response modifier with antiviral and tumoral effect that is used in the treatment of chronic viral hepatitis. Cardiovascular complications occurred in clinical trials of interferon. The most common presentations of cardio toxicity were cardiac arrhythmia, dilated cardiomyopathy, atrial extrasystole and symptoms of ischemic heart disease, including myocardial infarction and other effects less common and dangerous: low-level conduction impairment or reversible hypertension. The physiopathology of this cardiotoxicity remains unknown, but rigorous cardiological monitoring of all patients receiving this treatment seems necessary. PMID:18176361

  19. Preferred conformation of peptides from C alpha,alpha- symmetrically disubstituted glycines: aromatic residues.

    PubMed

    Crisma, M; Valle, G; Bonora, G M; Toniolo, C; Lelj, F; Barone, V; Fraternali, F; Hardy, P M; Maia, H L

    1991-05-01

    The conformational preference of C(alpha,alpha-diphenylglycine (D-phi-g) and C(alpha,alpha)-dibenzylglycine (Dbz) residues was assessed in selected derivatives and small peptides by conformational energy computations, ir absorption, 1H-nmr, and x-ray diffraction. Conformational energy computations on the two monopeptides strongly support the view that these C(alpha,alpha)-symmetrically disubstituted glycines are conformationally restricted and that their minimum energy conformation falls in the fully extended (C5) region. The results of the theoretical analyses appear to be in agreement with the solution and crystal-state structural propensities of three derivatives and seven di- and tripeptides. PMID:1932563

  20. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  1. Notes on Updated Diffusion Coefficients* University of Delaware

    E-print Network

    Wang, Hai

    these diffusion coefficients in flame modeling, the temperature dependence of binary diffusion coefficients at 1 9, pp. 353-363 (2005). #12;Table 1 Summary of polynomial coefficients for updated binary diffusionNotes on Updated Diffusion Coefficients* Hai Wang University of Delaware December 10, 2003 The need

  2. Fracture-Injection-Test Interpretation: Leakoff Coefficient vs. Permeability

    Microsoft Academic Search

    M. J. Mayerhofer; M. J. Economides

    1997-01-01

    Determining the leakoff coefficient from a minifracture pressure decline has become a relatively common industrial procedure. A main assumption of the method, which is often referred to as the Nolte analysis, is a constant leakoff coefficient. Frequently there is no constant leakoff coefficient. The definition of the coefficient is based on a constant pressure differential and a prescribed mode of

  3. Manning's roughness coefficient for Illinois streams

    USGS Publications Warehouse

    Soong, David T.; Prater, Crystal D.; Halfar, Teresa M.; Wobig, Loren A.

    2012-01-01

    Manning's roughness coefficients for 43 natural and constructed streams in Illinois are reported and displayed on a U.S. Geological Survey Web site. At a majority of the sites, discharge and stage were measured, and corresponding Manning's coefficients—the n-values—were determined at more than one river discharge. The n-values discussed in this report are computed from data representing the stream reach studied and, therefore, are reachwise values. Presentation of the resulting n-values takes a visual-comparison approach similar to the previously published Barnes report (1967), in which photographs of channel conditions, description of the site, and the resulting n-values are organized for each site. The Web site where the data can be accessed and are displayed is at URL http://il.water.usgs.gov/proj/nvalues/.

  4. Solute concentration effect on osmotic reflection coefficient.

    PubMed Central

    Adamski, R P; Anderson, J L

    1983-01-01

    A theory for the effect of concentration on osmotic reflection coefficient, correct to first order, was developed at the molecular level by considering the effect of solute-solute interactions on solute concentration and the fluid stress tensor within a solvent-filled pore. The solvent was modeled as a continuous fluid and potential energies between solute molecules and the pore wall were assumed to be pairwise additive. Although the theory is more general, calculations are presented only for excluded volume effects (hard-sphere for solute, hard-wall for pore). The relationship between the first-order concentration effect and the infinite dilution value of reflection coefficient appears to be geometry independent. The theory is discussed in light of experimental studies of osmotic flow that have recently appeared in the literature. PMID:6626681

  5. Transport Coefficients and nPI Methods

    E-print Network

    M. E. Carrington

    2011-10-06

    Transport coefficients can be obtained from 2-point correlators using the Kubo formulae. It has been shown that the full leading order result for electrical conductivity and (QCD) shear viscosity is contained in the re-summed 2-point function that is obtained from the 3-loop 3PI effective action. The theory produces all leading order contributions without the necessity for power counting, and in this sense it provides a natural framework for the calculation and suggests that one can calculate the next-to-leading contribution to transport coefficients from the 4-loop 4PI effective action. The integral equations have been derived for shear viscosity for a scalar theory with cubic and quartic interactions, with a non-vanishing field expectation value. We review these results, and explain how the calculation could be done at higher orders.

  6. Thermoelectric and Seebeck coefficients of granular metals.

    SciTech Connect

    Glatz, A.; Beloborodov, I. S.; Materials Science Division; California State Univ.

    2009-01-01

    In this work we present a detailed study and derivation of the thermopower and thermoelectric coefficient of nanogranular metals at large tunneling conductance between the grains, g{sub T} >> 1. An important criterion for the performance of a thermoelectric device is the thermodynamic figure of merit which is derived using the kinetic coefficients of granular metals. All results are valid at intermediate temperatures, E{sub c} >> T/g{sub T} > {delta}, where {delta} is the mean energy-level spacing for a single grain and E{sub c} is its charging energy. We show that the electron-electron interaction leads to an increase in the thermopower with decreasing grain size and discuss our results in light of future generation thermoelectric materials for low-temperature applications. The behavior of the figure of merit depending on system parameters such as grain size, tunneling conductance, and temperature is presented.

  7. Internal conversion coefficients for superheavy elements

    E-print Network

    O. Dragoun; M. Rysavy; A. Spalek

    2000-04-07

    The internal conversion coefficients (ICC) were calculated for all atomic subshells of the elements with 104<=Z<=126, the E1...E4, M1...M4 multipolarities and the transition energies between 10 and 1000 keV. The atomic screening was treated in the relativistic Hartree-Fock-Slater model. The Tables comprising almost 90000 subshell and total ICC were recently deposited at LANL preprint server.

  8. Quenching of spontaneous emission coefficients in plasmas

    SciTech Connect

    Chung, Y.; Lemaire, P.; Suckewer, S.

    1987-09-01

    We have observed changing Einstein coefficients of spontaneous emission as a function of electron density in CO/sub 2/ laser-produced plasmas. These measurements are based on the intensity branching ratio of CIV lines 5801 to 5812 A and 312.41 to 312.46 A which share a common upper level. Similar observations for CIII lines are also discussed. 12 refs., 3 figs.

  9. Dirac–Fock Internal Conversion Coefficients

    Microsoft Academic Search

    I. M. BAND; M. B. TRZHASKOVSKAYA; C. W. NESTOR JR.; P. O. TIKKANEN; S. RAMAN

    2002-01-01

    Internal conversion coefficients (ICCs) obtained from relativistic self-consistent-field Dirac-Fock (DF) calculations are presented. The exchange terms of DF equations are included exactly, both for the interaction between bound electrons and for the interaction between bound and free electrons. Static and dynamic effects resulting from finite nuclear size are taken into account, the latter using the surface current model. Experimental electron-binding

  10. Shear viscosity coefficient from microscopic models

    Microsoft Academic Search

    Azwinndini Muronga

    2004-01-01

    The transport coefficient of shear viscosity is studied for a hadron matter through microscopic transport model, the ultrarelativistic quantum molecular dynamics (UrQMD), using the Green-Kubo formulas. Molecular-dynamical simulations are performed for a system of light mesons in a box with periodic boundary conditions. Starting from an initial state composed of pi,eta,omega,rho,varphi with a uniform phase-space distribution, the evolution takes place

  11. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network. PMID:9030876

  12. Specific Storage as a Poroelastic Coefficient

    NASA Astrophysics Data System (ADS)

    Green, D. H.; Wang, H. F.

    1990-07-01

    A definition for the specific storage coefficient Ss is given which is unambiguous for general isotropic three-dimensional aquifer elasticity. In every representative elementary volume, Ss is the fluid volume released from storage per unit decline in hydraulic head, per unit bulk volume, under conditions such that there is no strain in two orthogonal directions, and the total normal stress in the third orthogonal direction is constant. The specific storage coefficient is a point property of the aquifer and is defined independently of problem domain stress and head boundary conditions. The expression for Ss in terms of aquifer and fluid compressibilities is identical to the familiar forms obtained assuming zero horizontal strain and constant overburden in an aquifer, although it is not restricted to these conditions. As a point property of the fluid-saturated material, the specific storage coefficient is one of four constants in the general constitutive poroelastic equations relating three-dimensional aquifer stress and strain to fluid pressure and dilatation. Written in terms of Ss, these equations show that pore fluid mass diffusion is governed by a diffusivity equal to the ratio of hydraulic conductivity to specific storage under arbitrary boundary conditions. It is shown that Ss controls slow compressional body wave velocity in the low frequency limit and that the uniaxial aquifer compressibility ? is not necessarily related to the vertical direction.

  13. MULTIVARIATE VARYING COEFFICIENT MODEL FOR FUNCTIONAL RESPONSES

    PubMed Central

    Zhu, Hongtu; Li, Runze; Kong, Linglong

    2012-01-01

    Motivated by recent work studying massive imaging data in the neuroimaging literature, we propose multivariate varying coefficient models (MVCM) for modeling the relation between multiple functional responses and a set of covariates. We develop several statistical inference procedures for MVCM and systematically study their theoretical properties. We first establish the weak convergence of the local linear estimate of coefficient functions, as well as its asymptotic bias and variance, and then we derive asymptotic bias and mean integrated squared error of smoothed individual functions and their uniform convergence rate. We establish the uniform convergence rate of the estimated covariance function of the individual functions and its associated eigenvalue and eigenfunctions. We propose a global test for linear hypotheses of varying coefficient functions, and derive its asymptotic distribution under the null hypothesis. We also propose a simultaneous confidence band for each individual effect curve. We conduct Monte Carlo simulation to examine the finite-sample performance of the proposed procedures. We apply MVCM to investigate the development of white matter diffusivities along the genu tract of the corpus callosum in a clinical study of neurodevelopment. PMID:23645942

  14. Local varying-alpha theories

    NASA Astrophysics Data System (ADS)

    2015-06-01

    In a recent paper, we demonstrated how the simplest model for varying-alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic (EM) field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

  15. Alpha decay properties of light einsteinium isotopes

    Microsoft Academic Search

    Hatsukawa Yuichi; Ohtsuki Tsutomu; Sueki Keisuke; Nakahara Hiromichi; Kohno Isao; Magara Masaaki; Shinohara Nobuo; Howard L. Hall; Roger A. Henderson; Carolyn M. Gannet; John A. Leyba; Robert B. Chadwick; Kenneth E. Gregorich; Diana Lee; Matti J. Nurmia; Darleane C. Hoffman

    1989-01-01

    The light einsteinium isotopes, with mass numbers 249, 248, 247, 246, 245 and 243, were produced by irradiating 249Cf with protons, 238U with 14N, 237Np with 12C and 233U with 14N, and have been studied by means of alpha-ray spectroscopy. An analysis of the complex alpha-peaks of the einsteinium isotopes gave new alpha-branchings. The tentative assignments of 7\\/2+ --> 7\\/2+,

  16. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  17. On alpha heating in toroidal devices

    Microsoft Academic Search

    G. H. Miley

    1979-01-01

    Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

  18. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  19. A new numerical method for conversion of sonic second virial coefficients to density second virial coefficients 

    E-print Network

    Mossaad, Ehab

    1999-01-01

    . n-Butane, " J. Chem. Thermodynamics. , 20, 243 (1988). 44 Gupta, D. , and P. T. Eubank, "Density and Virial Coefficients of Gaseous Butane from 265 to 450 K at Pressures to 3. 3 Mpa, " J. Chem. Eng. Data, 42, 961 (1997). Hirschfelder, J. O. , C...-JONES MOLECULAR MODEL SECOND DENSITY VIRIAL COEFFICIENTS. . REDUCTION OF EWING'S SONIC VELOCITY DATA FOR . . . . 2 I n-BUTANE . . . . . . . . 27 VI SUMMARY AND CONCLUSIONS. . . . . 39 REFERENCES. . . . . 43 Page APPENDIX A . APPENDIX B . . . . . 45...

  20. A model for the disc Lyman alpha emission of Uranus

    NASA Technical Reports Server (NTRS)

    Ben Jaffel, L.; Prange, R.; Emerich, C.; Vidal-Madjar, A.; Mcconnell, J. C.

    1991-01-01

    A new efficient radiative transfer algorithm for nonhomogeneous model atmospheres has been applied to the Uranian atmosphere. The contribution of the scatter solar Lyman-alpha to the Uranain emission is of the order of 300 R, and the Rayleigh contribution may reach 450 R for small values of the eddy diffusion coefficient (EDC). The total solar contribution may then reach about 750 R for a solar flux of 2.5 x 10 to the 11th photons/sq cm/s/A. A level of up to 400 R is confirmed in some directions for the interstellar wind contribution. The values of the atmospheric EDC necessary to mimic the observations are 50-100 sq cm/s. A small additional source located on the dayside Uranian atmosphere seems necessary correctly to fit the shape of the limb to limb intensity variation, especially near the limbs. Its contribution to the emergent intensity would range from 100 to 500 R.

  1. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  2. cap alpha. -Particle confinement in compact tori

    SciTech Connect

    Bozhokin, S.V.

    1986-11-01

    The motion of high-energy ..cap alpha.. particles in compact tori is studied. The classically accessible regions of motion of charged particles are found. The conditions are formulated under which the ..cap alpha.. particles produced in fusion reactions are absolutely confined. An ..cap alpha.. particle starting in a region enclosed by a ''critical'' surface will never, in the course of its motion, intersect the separatrix of a compact torus. These critical surfaces are constructed. The ratio of the volume of absolute ..cap alpha.. confinement to the total volume of a compact torus is calculated as a function of the magnetic field strength and the dimensions of the compact torus.

  3. EEG alpha power and alpha power asymmetry in sleep and wakefulness.

    PubMed

    Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J

    1999-07-01

    Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

  4. Blackness coefficients, effective diffusion parameters, and control rod worths for thermal reactors

    SciTech Connect

    Bretscher, M.M.

    1984-09-01

    Simple diffusion theory cannot be used to evaluate control rod worths in thermal reactors because of the strongly absorbing character of the control material. However, good results can be obtained from a diffusion calculation by representing the absorber slab by means of a suitable pair of internal boundary conditions, ..cap alpha.. and ..beta.., which are ratios of neutron flux to neutron current. Methods for calculating ..cap alpha.. and ..beta.. in the P/sub 1/, P/sub 3/, and P/sub 5/ approximations, with and without scattering, are presented. By appropriately weighting the fine-group blackness coefficients, broad group values, <..cap alpha..> and <..beta..>, are obtained. The technique is applied to the calculation of control rod worths of Cd, Ag-In-Cd, and Hf control elements. Results are found to compare very favorably with detailed Monte Carlo calculations. For control elements whose geometry does not permit a thin slab treatment, other methods are needed for determining the effective diffusion parameters. One such method is briefly discussed and applied to the calculation of control rod worths in the Ford Nuclear Reactor at the University of Michigan. Calculated and measured worths are found to be in good agreement.

  5. Pure E2 transitions: A test for BRICC Internal Conversion Coefficients

    SciTech Connect

    Gerl, J. [Gesellschaft fur Schwerionenforschung, GSI, 64291 Darmstadt (Germany); Sai, K. Vijay; Sainath, M.; Gowrishankar, R.; Venkataramaniah, K. [Department of Physics, Sri Sathya Sai University, Prasanthinilayam 515134, AP (India)

    2009-01-28

    The most widely used theoretical internal conversion coefficient (ICC) tables are of Hager and Seltzer (HS), Rosel et al. and BRICC (Band et al. tables using BRICC interpolation code). A rigorous comparison of experimental ICCs with various theoretical tabulations is possible only when a large data on experimental ICCs is available at one place. For this reason, a compilation of all the available experimental ICCs, {alpha}{sub T}, {alpha}{sub K}, {alpha}{sub L} of E2 transitions for a number of elements in the range of 24{<=}Z{<=}94 is presented. Listing of experimental data includes 595 datasets corresponding to 505 E2 transitions in 165 nuclei across the nuclear chart. Data with less than 10% experimental uncertainty have been selected for comparison with the theoretical values of Hager and Seltzer, Rosel et al. and BRICC. The relative percentage deviation (%{delta}) have been calculated for each of the above theories and the average (%{delta}) are estimated. The Band et al. tables, using the BRICC interpolation code are seen to give theoretical ICCs closest to experimental values.

  6. A simple application of the Bailey-Orowan creep model to Fe-39.8 at. pct Al and gamma/gamma prime - alpha

    NASA Technical Reports Server (NTRS)

    Whittenberger, J. D.; Krishnan, R. V.

    1984-01-01

    The results of a study to determine the recovery rates and work-hardening coefficients for creep from constant cross-head speed compressive tests are presented. Stressing and straining rates are computed from measured time-load curves obtained from compression testing between 1200 and 1400 K of several B2 crystal structure Fe-39.8 Al intermetallic materials and the directionally solidified eutectic alloy gamma/gamma prime alpha. These quantities are then fitted to the universal form of the Bailey-Orowan equation for creep. The recovery rates were found to be functions of nominal strain rate, stress, and temperature, while the hardening coefficients were dependent only on temperature. While the work-hardening coefficient for gamma/gamma prime - alpha was about 0.05 of the elastic modulus, the work-hardening coefficients for Fe-39.8 at. pct Al were less than 0.002 of the modulus.

  7. Production of fungal alpha-amylase by Saccharomyces kluyveri in glucose-limited cultivations.

    PubMed

    Møller, Kasper; Sharif, Mostafa Z; Olsson, Lisbeth

    2004-08-01

    Heterologous protein production by the yeast Saccharomyces kluyveri was investigated under aerobic glucose-limited conditions. Alpha-amylase from Aspergillus oryzae was used as model protein and the gene was expressed from a S. cerevisiae 2 micro plasmid. For comparison, strains of both S. kluyveri and S. cerevisiae were transformed with the same plasmid, which led to secretion of active alpha-amylase in both cases. The S. cerevisiae 2 micro plasmid was found to be stable in S. kluyveri as evaluated by a constant alpha-amylase productivity in a continuous cultivation for more than 40 generations. S. kluyveri and S. cerevisiae secreted alpha-amylase with similar yields during continuous cultivations at dilution rates of 0.1 and 0.2 h(-1) (4.8-5.7 mg (g dry weight)(-1)). At a dilution rate of 0.3 h(-1) the metabolism of S. kluyveri was fully respiratory, whereas S. cerevisiae produced significant amounts of ethanol. A fed-batch cultivation was carried out with S. kluyveri where the biomass concentration reached 85 g l(-1) and the alpha-amylase concentration reached 320 mg l(-1). Even though S. kluyveri could be grown to high cell density, it was also observed that it has a high maintenance coefficient, which resulted in low biomass yields at the low specific growth rates prevailing towards the end of the fed-batch cultivation. PMID:15246667

  8. /sup 20/Ne(. cap alpha. ,2. cap alpha. )/sup 16/O reaction

    SciTech Connect

    Sharma, N.R.; Jain, B.K.; Shyam, R.

    1988-02-01

    The /sup 20/Ne(..cap alpha..,2..cap alpha..)/sup 16/O reaction at 140 MeV incident energy is analyzed in the framework of the distorted-wave impulse approximation. The bound state ..cap alpha.. wave functions in /sup 20/Ne are generated using the orthogonal condition model. The predicted results agree with the experimental data. They are also in rough accord with the results obtained with the Woods-Saxon ..cap alpha.. wave function.

  9. Preparation of 9-alpha,11-xi-tritiated 17-alpha-ethynylestradiol, mestranol, estradiol-alpha-17-beta, and norethindrone.

    PubMed

    Rao, P N

    1971-08-01

    The preparation of 9alpha, 11xi-tritiated 17alpha-ethinyl estradiol, mestranol, estradiol-17beta, and norethindrone are described. Estrone-3-methyl ether was employed as starting material, and ethinylation with lithium acetylide-ethylene diamine resulted in 95% mestranol. Demethylation of mestranol with boron tribromide at 0 degrees resulted in 92% 17alpha-ethinyl estradiol. Dimethylsulfoxide was the choice of reagent for the condensation reaction which was complete at room temperature in about 4 hours. The usually less than 3% of unreacted 17-oxo product was removed by Girard separation. Demethylation of methyl ether with boran tribromide in methylene chloride resulted in an excellent yield of 17alpha-ethinyl estradiol-9alpha, 11xi-tritium. 3-methoxyestra-1,3,5-trien-17-one-9alpha, 11xi-tritium was reduced with sodium bis(2-methoxyethoxy) aluminum hydride to the 17beta-hydroxy compound and subsequent demethylation resulted in estradiol-9alpha, 11xi-tritium. The general method of Ringold et al was employed for the preparation of 17beta-hydroxy-17alpha-ethinylestr-4-en-3-one. Improvements for small scale radiosynthesis are also presented. PMID:5126820

  10. Permeation study of five formulations of alpha-tocopherol acetate through human cadaver skin.

    PubMed

    Mahamongkol, Hansa; Bellantone, Robert A; Stagni, Grazia; Plakogiannis, Fotios M

    2005-01-01

    Alpha-tocopherol (AT) is the vitamin E homologue with the highest in vivo biological activity. AT protects against the carcinogenic and mutagenic activity of ionizing radiation and chemical agents, and possibly against UV-induced cutaneous damage. For stability consideration, alpha-tocopherol is usually used as its prodrug ester, alpha-tocopherol acetate (ATA), which once absorbed into the skin is hydrolyzed to alpha-tocopherol, the active form. The objective of this research was to characterize in vitro the permeation properties of ATA from various solutions and gel formulations. Permeation studies were conducted using modified Franz diffusion cells and human cadaver skin as the membrane. Specifically, 5% (w/w) alpha-tocopherol acetate was formulated in the following vehicles: ethanol, isopropyl myristate, light mineral oil, 1% Klucel gel in ethanol, and 3% Klucel gel in ethanol (w/w). The receiver temperature was 37 degrees C. Samples from the receiver were collected at 2, 4, 6, 8, 12, 24, 30, 36, and 48 hours and analyzed by HPLC for concentrations of alpha-tocopherol acetate and alpha-tocopherol. The permeabilities of ATA through human cadaver skin were 1.0x10(-4), 1.1x10(-2), 1.4x10(-4), 2.1x10(-4), and 4.7x10(-4) cm/h for the ethanol solution, isopropyl myristate solution, light mineral oil solution, 1% Klucel gel, and 3% Klucel gel, respectively. The results show that the formulation had relatively minor effects on the permeability coefficients of ATA through cadaver skin in all cases except for the isopropyl myristate solution. PMID:15868062

  11. Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells

    SciTech Connect

    Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail: roy.zent@vanderbilt.edu

    2008-11-15

    The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

  12. The analysis of predictability of alpha-decay half-life formulae and the alpha partial half-lives of some exotic nuclei

    E-print Network

    N. Dasgupta-Schubert; M. A. Reyes; V. A. Tamez

    2009-10-05

    The predictabilities of the three alpha-decay half-life formulae, the Royer GLDM, the Viola-Seaborg and the Sobiczewski-Parkhomenko formulae, have been evaluated by developing a method based on the ansatz of standard experimental benchmarking. The coefficients of each formula were re-derived using the reliable data of the alpha-standards nuclei. The modified formulae that resulted were used to evaluate the accuracies of the formulae towards the prediction of half-lives of a set of nuclides with well-studied alpha- spectroscopic data as well as a set of exotic alpha-emitters. Further, a simple linear optimization of the modified formulae allowed adjustments for the insufficient statistics of the primary data set without changing the modified formulae. While the three modified formulae showed equivalent results for all the medium heavy nuclei except the odd-odd, the modified GLDM showed relatively the best figures of merit for the odd-odd and superheavy nuclides.

  13. Stroke specific quality of life questionnaire: Test of reliability and validity of the Persian version

    PubMed Central

    Mahmoodi, Mojtaba; Safari, Anahid; Vossoughi, Mehrdad; Golbon-Haghighi, Fatemeh; Kamali-Sarvestani, Maliheh; Ghaem, Haleh; Borhani-Haghighi, Afshin

    2015-01-01

    Background: The aim was to assess the reliability and the validity of the translated version of the stroke specific quality of life (SS-QOL) questionnaire in Iranian post-stroke patients. Methods: This project was performed at the Shiraz University of Medical Sciences, Shiraz, Iran, between 12 April 2010 and 24 February 2011. The English version of the SS-QOL was translated into Persian by “forward-backward” translation, cognitive inquiring and cultural adaptation process. The reliability and internal consistency were measured by Cronbach’s alpha coefficient. Validity was assessed using convergent and divergent validity through Spearman’s correlation coefficient. Results: Our study included 117 post-stroke patients, consisting of 57 (48.7%) men and 60 (51.3%) women. The mean age of the patients was 81.60 ± 7.52 (range 60-88) years. The Persian version of the SS-QOL proved reliable (Cronbach’s ? = 0.96). Internal consistency was excellent for both demographic and patients’ clinical characteristics (Cronbach’s ? ? 0.70). The scaling success rates were 100% for convergent validity of each scale. Divergent validity for all 12 scales was considered acceptable, whereas each scale had a 100% scaling success rate for convergent validity. Conclusion: The Persian version of SS-QOL should be mentioned as a noteworthy instrument to specify different aspects of health related QOL of patients suffering stroke and hence that clinicians, researchers and epidemiologist can exploit it trustfully.

  14. Direct Measurements of the Pressure Coefficient, Partial

    NASA Astrophysics Data System (ADS)

    del Cueto, Joseph Antonio

    1984-06-01

    The pressure coefficient of liquid ('3)He-('4)He mixtures was coupled to directly, with a strain gauge capacitative cell. The cell was filled, pressurized and isolated with a mixture, of ('3)He mole fraction x between 0.50-0.80. The elastic properties of the cell effected a capacitance change in an LC tank circuit driven to oscillation by a Tunnel Diode. The frequency of the circuit, as well as the balance point of an AC Wheatstone circuit sensing a cryo-resistor mounted on the cell, were sampled by a data acquisition(DAS) system, to obtain pressure vs. temperature increments data. The DAS was enabled to perform temperature ramps and cycles with amplitudes of (TURN) (+OR-) 50-100 mK, while concurrently sampling pressure vs. temperature data. It is found that (PAR-DIFF)P/(PAR-DIFF)T)(,v,x) is a piecewise smooth function in the temperature T. For x < x(,t)(P), the data indicate a cusp discontinuity at the lambda temperature of the mixture T(,(lamda))(x,v(p(,(lamda)))), and a simple discontinuity at the onset of phase separation temperature T(,S)(x,v(p(,S))). For x > x(,t)(P), only the phase separation breaks the monotonic behaviour of the pressure coefficient. Where x(,t)(P) is the tricritical concentration at pressure P, referred to in the above. The data for the pressure coefficients are parametrized by smooth functions in appendix 5. This parametrization allows for further thermodynamic analysis, as that of appendix 6, the change in chemical potential difference upon compression. The thermodynamic implications of the measured step in (PAR -DIFF)P/(PAR-DIFF)T)(,v,x), across the onset separation temperature, are explored in appendix 4. The 'volume' minima at the pressures the isochores cross at their pressure minima in temperature, are plotted and analysed to imply that for some concentrations x, the entropy of the mixture is a double valued function of absolute pressure.

  15. Alpha-1 Antitrypsin Deficiency: It's All in the Family

    MedlinePLUS

    Alpha-1 Antitrypsin Deficiency: It’s All in the Family 1 ALPHA-1 FOUNDATION The Alpha-1 Foundation is committed to finding a cure for Alpha-1 Antitrypsin ... health choices. Be tested for Alpha-1: It’s all in the family. For more information, call the ...

  16. Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes

    SciTech Connect

    Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2006-06-23

    {alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

  17. Peltier coefficient measurement in a thermoelectric module

    NASA Astrophysics Data System (ADS)

    Garrido, Javier; Casanovas, Alejandro; María Chimeno, José

    2013-09-01

    A new method for measuring the Peltier coefficient in a thermocouple X/Y based on the energy balance at the junction has been proposed recently. This technique needs only the hot and cold temperatures of a thermoelectric module when an electric current flows through it as the operational variables. The temperature evolutions of the two module sides provide an evident and accurate idea of the Peltier effect. From these temperatures, the heat transfer between the module and the ambient is also evaluated. The thermoelectric phenomena are described in the framework of an observable theory. Based on this procedure, an experiment is presented for a university teaching laboratory at the undergraduate level.

  18. Experimental rotordynamic coefficient results for honeycomb seals

    NASA Technical Reports Server (NTRS)

    Elrod, David A.; Childs, Dara W.

    1988-01-01

    Test results (leakage and rotordynamic coefficients) are presented for seven honeycomb-stator smooth-rotor seals. Tests were carried out with air at rotor speeds up to 16,000 cpm and supply pressures up to 8.2 bars. Test results for the seven seals are compared, and the most stable configuration is identified based on the whirl frequency ratio. Results from tests of a smooth-rotor/smooth-stator seal, a teeth-on-stator labyrinth seal, and the most stable honeycomb seal are compared.

  19. Surface area coefficients for airship envelopes

    NASA Technical Reports Server (NTRS)

    Diehl, W S

    1922-01-01

    In naval architecture, it is customary to determine the wetted surface of a ship by means of some formula which involves the principal dimensions of the design and suitable constants. These formulas of naval architecture may be extended and applied to the calculation of the surface area of airship envelopes by the use of new values of the constants determined for this purpose. Surface area coefficients were calculated from the actual dimensions, surfaces, and volumes of 52 streamline bodies, which form a series covering the entire range of shapes used in the present aeronautical practice.

  20. Effective distribution coefficient in magnetic Czochralski growth

    NASA Astrophysics Data System (ADS)

    Hurle, D. T. J.; Series, R. W.

    1985-10-01

    The analysis by Burton, Prim and Slichter (1953) of the dependence of the effective distribution coefficient (keff) on the growth and crystal rotation rates in Czochralski growth is extended to include the effect of an imposed steady axial magnetic field. The theory is based on the analysis of the hydromagnetic flow at a rotating disk due to Kakutani (1962). It is shown that keff approaches unity as the field increases. The likely effects of this on the growth of silicon and gallium arsenide are discussed.

  1. Plasma alpha natriuretic peptide in cardiac impairment

    Microsoft Academic Search

    A M Richards; J G Cleland; G Tonolo; G D McIntyre; B J Leckie; H J Dargie; S G Ball; J I Robertson

    1986-01-01

    Regional plasma alpha human atrial natriuretic peptide concentrations were measured, and their relation to intracardiac pressures assessed, in an unselected series of 45 patients undergoing diagnostic cardiac catheterisation. Arteriovenous gradients in plasma concentrations of alpha human atrial natriuretic peptide were consistent with its cardiac secretion and its clearance by the liver and kidneys. Plasma concentrations of the peptide in the

  2. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  3. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco...ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at 752mm...

  4. Alpha high-power chemical laser program

    Microsoft Academic Search

    Richard Ackerman; David Callahan; Anthony J. Cordi; Henry Lurie; Matthew Thomson

    1995-01-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of

  5. Search for Trapped Antihydrogen ALPHA Collaboration

    E-print Network

    Fajans, Joel

    Search for Trapped Antihydrogen ALPHA Collaboration G.B. Andresena , M.D. Ashkezarib , M. BaqueroDepartment of Physics, Swansea University, Swansea SA2 8PP, United Kingdom eInstituto de F´isica, Universidade Federal to search for trapped antihydrogen atoms with the ALPHA antihydrogen trap at the CERN Antiproton Decelerator

  6. Orbiting mechanism in alpha-40Ca scattering

    Microsoft Academic Search

    I. Parija; R. K. Satpathy; C. S. Shastry

    1984-01-01

    The large angle oscillations in several cases of alpha-40Ca scattering are examined in terms of orbital amplitude and the background amplitude interference using the approach developed recently to analyze 16O-28Si scattering. [NUCLEAR REACTIONS alpha-40Ca scattering, anomalous large angle scattering, orbiting phenomena.

  7. TF ripple loss of fast alphas

    SciTech Connect

    Hively, L.M.

    1987-02-06

    Viewgraphs from this presentation are given. The topics covered included: (1) previous work on background plasma, fast ion transport - MeV alphas, neutral beam ions, and rf heated tail ion; (2) important results; (3) alpha loss calculations; and (4) unresolved issues. (MOW)

  8. Microbial transformations of alpha-santonin.

    PubMed

    Ata, Athar; Nachtigall, Jason A

    2004-01-01

    Fungal biotransformations of alpha-santonin (1) were conducted with Mucor plumbeus (ATCC 4740), Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245), Curvularia lunata (ATCC 12017) and Rhizopus stolonifer (ATCC 10404). Rhizopus stolonifer (ATCC 10404) metabolized compound 1 to afford 3,4-epoxy-alpha-santonin (2) and 4,5-dihydro-alpha-santonin (3) while Cunninghamella bainieri (ATCC 9244), Cunninghamella echinulata (ATCC 9245) and Mucor plumbeus (ATCC 4740) were capable of metabolizing compound 1 to give a reported metabolite, 1,2-dihydro-alpha-santonin (4). The structures of these transformed metabolites were established with the aid of extensive spectroscopic studies. These fungi regiospecifically reduced the carbon-carbon double bond in ring A of alpha-santonin. PMID:15241928

  9. Radon diffusion coefficients in soils of varying moisture content

    NASA Astrophysics Data System (ADS)

    Papachristodoulou, C.; Ioannides, K.; Pavlides, S.

    2009-04-01

    Radon is a naturally occurring radioactive gas that is generated in the Earth's crust and is free to migrate through soil and be released to the atmosphere. Due to its unique properties, soil gas radon has been established as a powerful tracer used for a variety of purposes, such as exploring uranium ores, locating geothermal resources and hydrocarbon deposits, mapping geological faults, predicting seismic activity or volcanic eruptions and testing atmospheric transport models. Much attention has also been given to the radiological health hazard posed by increased radon concentrations in the living and working environment. In order to exploit radon profiles for geophysical purposes and also to predict its entry indoors, it is necessary to study its transport through soils. Among other factors, the importance of soil moisture in such studies has been largely highlighted and it is widely accepted that any measurement of radon transport parameters should be accompanied by a measurement of the soil moisture content. In principle, validation of transport models in the field is encountered by a large number of uncontrollable and varying parameters; laboratory methods are therefore preferred, allowing for experiments to be conducted under well-specified and uniform conditions. In this work, a laboratory technique has been applied for studying the effect of soil moisture content on radon diffusion. A vertical diffusion chamber was employed, in which radon was produced from a 226Ra source, was allowed to diffuse through a soil column and was finally monitored using a silicon surface barrier detector. By solving the steady-state radon diffusion equation, diffusion coefficients (D) were determined for soil samples of varying moisture content (m), from null (m=0) to saturation (m=1). For dry soil, a D value of 4.1×10-7 m2s-1 was determined, which increased moderately by a factor of ~3 for soil with low moisture content, i.e. up to m ~0.2. At higher water fractions, a decrease in D was initiated and became particularly pronounced approaching complete saturation; at m =0.9, D was as low as 2×10-9 m2s-1. A series of field experiments has also been conducted using alpha-track CR-39 detectors to follow the moisture-dependence of radon diffusion through soil under natural conditions. Diffusion coefficients were determined as a function of surface soil moisture assuming a one-dimensional diffusive radon transport model. Comparison between results obtained by the two methods showed that laboratory studies may provide a good indication of radon diffusion coefficients to be expected in the field. However, values determined in the field were systematically lower than those assessed in the laboratory. This finding could be attributed to soil-dependent parameters, such as differences in pore space geometry between the soil used in laboratory experiments and the undisturbed soil. In the latter case, the higher degree of compaction imposes a more tortuous pathway to soil gas, while at the same time the diffusive gas flux is hindered by local-scale zones of higher bulk density or water content.

  10. Coefficient adaptive triangulation for strongly anisotropic problems

    SciTech Connect

    D`Azevedo, E.F.; Romine, C.H.; Donato, J.M.

    1996-01-01

    Second order elliptic partial differential equations arise in many important applications, including flow through porous media, heat conduction, the distribution of electrical or magnetic potential. The prototype is the Laplace problem, which in discrete form produces a coefficient matrix that is relatively easy to solve in a regular domain. However, the presence of anisotropy produces a matrix whose condition number is increased, making the resulting linear system more difficult to solve. In this work, we take the anisotropy into account in the discretization by mapping each anisotropic region into a ``stretched`` coordinate space in which the anisotropy is removed. The region is then uniformly triangulated, and the resulting triangulation mapped back to the original space. The effect is to generate long slender triangles that are oriented in the direction of ``preferred flow.`` Slender triangles are generally regarded as numerically undesirable since they tend to cause poor conditioning; however, our triangulation has the effect of producing effective isotropy, thus improving the condition number of the resulting coefficient matrix.

  11. The Convergence Coefficient across Political Systems

    PubMed Central

    Schofield, Norman

    2013-01-01

    Formal work on the electoral model often suggests that parties or candidates should locate themselves at the electoral mean. Recent research has found no evidence of such convergence. In order to explain nonconvergence, the stochastic electoral model is extended by including estimates of electoral valence. We introduce the notion of a convergence coefficient, c. It has been shown that high values of c imply that there is a significant centrifugal tendency acting on parties. We used electoral surveys to construct a stochastic valence model of the the elections in various countries. We find that the convergence coefficient varies across elections in a country, across countries with similar regimes, and across political regimes. In some countries, the centripetal tendency leads parties to converge to the electoral mean. In others the centrifugal tendency dominates and some parties locate far from the electoral mean. In particular, for countries with proportional electoral systems, namely, Israel, Turkey, and Poland, the centrifugal tendency is very high. In the majoritarian polities of the United States and Great Britain, the centrifugal tendency is very low. In anocracies, the autocrat imposes limitations on how far from the origin the opposition parties can move. PMID:24385886

  12. Development of the feedwater venturi fouling coefficient

    SciTech Connect

    Gillespie, T.P. Jr.

    1990-01-01

    Duke Power Company's Oconee Nuclear Generating Station (NGS), a three-unit plant with Babcock and Wilcox nuclear steam supply systems, experienced symptoms of feedwater venturi fouling. These symptoms included decreased reactor power output while indicated thermal power remained at 100% of licensed thermal power, resulting in decreased electrical output during the operating cycle. To recover this lost generating capacity, a methodology to quantify and account for the effects of fouling using plant instrumentation was developed and implemented. By introducing a feedwater venturi fouling coefficient into the feedwater flow calculation, reactor power can be maintained at full licensed power. The result of this effort was the recovery of > 40 MW of lost generating capabilities at the Oconee NGS. Cost savings from replacement power alone is in excess of $5 million/yr. Additional savings are realized because of increased fuel use. By showing the plant's calorimetric uncertainty can remain less than [plus minus] 2% of full power, no safety or accident analysis is invalidated. Furthermore, because of its low implementation cost, determining the fouling coefficient from plant instrumentation is an attractive alternative to standard methods currently used.

  13. Graphical comparison of calculated internal conversion coefficients

    SciTech Connect

    Ewbank, W.B.

    1980-11-01

    Calculated values of the coefficients of internal conversion of gamma rays in the K shell and L/sub 1/, L/sub 2/, L/sub 3/ subshells from published tabulations by Band and Trzhaskovskaya and by Roesel et al. at Data Nucl. Data Tables, 21, 92-514(1978) are compared with values obtained by computer interpolation among tabulated values of Hager and Seltzer Nucl. Data, A4, 1-235(1968). In some cases, agreement among the three calculations is remarkably good, and differences are generally less than 5%. In a few cases, there are differences as large as 20 to 50%, corresponding to the threshold effect described by Roesel et al. The Z-dependent resonance minimum described by Roesel et al. is also observed in the comparison of E1-E4 conversion in the L/sub 1/ subshell. In several cases (notably M1-M4 conversion in the K shell and L/sub 1/ subshell), the Band and Roesel calculations show dramatically different dependence on gamma energy and atomic number. For Z = 100, the Band calculation for E4 conversion in the L/sub 3/ subshell shows irregular behavior at energies below the K-shell binding energy. A few high-quality measurements of internal conversion coefficients (+-5%) would help greatly to establish a basis for choice among the theoretical calculations. 32 figures.

  14. Thermoelectric Transport Coefficients in Correlated Condensed Matter

    NASA Astrophysics Data System (ADS)

    Shastry, Sriram

    2008-03-01

    We present a recently developed formalism for computing thermoelectric transport coefficients for standard models of correlated matter, such as the Hubbard and the t-J model. Successful predictions of this method in the context of the Hall constant are noted. This success helps to motivate the extension to the Seebeck coefficient, the Lorentz number L, and the figure of merit Z T, in terms of novel equal time correlation functions of two new fundamental operators, the thermal operator xxcirc and the thermoelectric operator xxcirc. Along the way, we uncover a new sum rule for the dynamical thermal conductivity for many standard models, precisely analogous to the f-sum rule for the electrical conductivity. Also along the way, we throw light on Lord Kelvin's early ideas on reciprocity, worked out within the context of equilibrium thermodynamics. The precise connection between Kelvin's formulation, and the later and more rigorous formulation of Onsager is commented upon. The new formalism is tested in simple settings and recent computational results are displayed for testing the frequency dependence of these variables in certain standard models. Close agreement with existing transport experiments on sodium cobaltates Na.68Co O2 in the Curie Weiss phase is found. Finally some new predictions are made regarding triangular lattice systems, motivated by the sodium cobaltate system.

  15. Full wave-field reflection coefficient inversion.

    PubMed

    Dettmer, Jan; Dosso, Stan E; Holland, Charles W

    2007-12-01

    This paper develops a Bayesian inversion for recovering multilayer geoacoustic (velocity, density, attenuation) profiles from a full wave-field (spherical-wave) seabed reflection response. The reflection data originate from acoustic time series windowed for a single bottom interaction, which are processed to yield reflection coefficient data as a function of frequency and angle. Replica data for inversion are computed using a wave number-integration model to calculate the full complex acoustic pressure field, which is processed to produce a commensurate seabed response function. To address the high computational cost of calculating short range acoustic fields, the inversion algorithms are parallelized and frequency averaging is replaced by range averaging in the forward model. The posterior probability density is interpreted in terms of optimal parameter estimates, marginal distributions, and credibility intervals. Inversion results for the full wave-field seabed response are compared to those obtained using plane-wave reflection coefficients. A realistic synthetic study indicates that the plane-wave assumption can fail, producing erroneous results with misleading uncertainty bounds, whereas excellent results are obtained with the full-wave reflection inversion. PMID:18247743

  16. Coefficient of Restitution of Adhesively Bound Aggregates

    NASA Astrophysics Data System (ADS)

    Baibolatov, Yernur; Spahn, F.

    2012-10-01

    Dry granular gases are characterized by dissipative interactions of grains whereas usually attractive forces are neglected. Here we concern attractive-adhesive contacts between the constituents of the granular gas in order to quantify their influence on the cluster formation and the establishment of a steady aggregate size-distribution in driven systems. In this context the dynamics of dense planetary rings is our major concern. These disks are dynamically dominated by a balance between viscous (collisional) heating, driven by the Kepler-shear, counteracted by granular collisional cooling so that a stationary granular temperature may establish. In this work we concentrate on the aggregate aggregate collisions, where we try to analyze the dependence of the coefficient of restitution of the aggregate on its size and internal configuration. We show that the coefficient of restitution of a single constituent differs drastically when we combine them into an aggregate. We believe that this effect plays a crucial role on the collision dynamics of the ring material. We gratefully acknowledge financial support from the grant Sp384/22-1 (DFG).

  17. The convergence coefficient across political systems.

    PubMed

    Gallego, Maria; Schofield, Norman

    2013-01-01

    Formal work on the electoral model often suggests that parties or candidates should locate themselves at the electoral mean. Recent research has found no evidence of such convergence. In order to explain nonconvergence, the stochastic electoral model is extended by including estimates of electoral valence. We introduce the notion of a convergence coefficient, c. It has been shown that high values of c imply that there is a significant centrifugal tendency acting on parties. We used electoral surveys to construct a stochastic valence model of the the elections in various countries. We find that the convergence coefficient varies across elections in a country, across countries with similar regimes, and across political regimes. In some countries, the centripetal tendency leads parties to converge to the electoral mean. In others the centrifugal tendency dominates and some parties locate far from the electoral mean. In particular, for countries with proportional electoral systems, namely, Israel, Turkey, and Poland, the centrifugal tendency is very high. In the majoritarian polities of the United States and Great Britain, the centrifugal tendency is very low. In anocracies, the autocrat imposes limitations on how far from the origin the opposition parties can move. PMID:24385886

  18. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)] [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States); Stevens, Victoria L. [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States)] [Epidemiology and Surveillance Research, American Cancer Society, Atlanta, Georgia (United States); Owens, Timothy R. [Emory University, School of Medicine, Atlanta, Georgia (United States)] [Emory University, School of Medicine, Atlanta, Georgia (United States); Oyesiku, Nelson M., E-mail: noyesik@emory.edu [Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology, Emory University, School of Medicine, Atlanta, Georgia (United States)

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  19. Molecular modeling of the alpha9alpha10 nicotinic acetylcholine receptor subtype.

    PubMed

    Pérez, Edwin G; Cassels, Bruce K; Zapata-Torres, Gerald

    2009-01-01

    This study reports the comparative molecular modeling, docking and dynamic simulations of human alpha9alpha10 nicotinic acetylcholine receptors complexed with acetylcholine, nicotine and alpha-conotoxin RgIA, using as templates the crystal structures of Aplysia californica and Lymnaea stagnalis acetylcholine binding proteins. The molecular dynamics simulations showed that Arg112 in the complementary alpha10(-) subunit, is a determinant for recognition in the site that binds small ligands. However, Glu195 in the principal alpha9(+), and Asp114 in the complementary alpha10(-) subunit, might confer the potency and selectivity to alpha-conotoxin RgIA when interacting with Arg7 and Arg9 of this ligand. PMID:19013796

  20. Comparison of field-measured radon diffusion coefficients with laboratory-measured coefficients

    SciTech Connect

    Lepel, E.A.; Silker, W.B.; Thomas, V.W.; Kalkwarf, D.R.

    1983-04-01

    Experiments were conducted to compare radon diffusion coefficients determined for 0.1-m depths of soils by a steady-state method in the laboratory and diffusion coefficients evaluated from radon fluxes through several-fold greater depths of the same soils covering uranium-mill tailings. The coefficients referred to diffusion in the total pore volume of the soils and are equivalent to values for the quantity, D/P, in the Generic Environmental Impact Statement on Uranium Milling prepared by the US Nuclear Regulatory Commission. Two soils were tested: a well-graded sand and an inorganic clay of low plasticity. For the flux evaluations, radon was collected by adsorption on charcoal following passive diffusion from the soil surface and also from air recirculating through an aluminum tent over the soil surface. An analysis of variance in the flux evaluations showed no significant difference between these two collection methods. Radon diffusion coefficients evaluated from field data were statistically indistinguishable, at the 95% confidence level, from those measured in the laboratory; however, the low precision of the field data prevented a sensitive validation of the laboratory measurements. From the field data, the coefficients were calculated to be 0.03 +- 0.03 cm/sup 2//s for the sand cover and 0.0036 +- 0.0004 cm/sup 2//s for the clay cover. The low precision in the coefficients evaluated from field data was attributed to high variation in radon flux with time and surface location at the field site.

  1. What Does It Mean to Be an Alpha-1 Carrier?

    MedlinePLUS

    ... Alpha-1 link. RESOURCES Alpha-1 Foundation Toll Free: (877) 228-7321 • www.alpha1.org The not-for-profit Foundation provides resources, education, and information on testing and diagnosis for healthcare ...

  2. IMAGE DENOISING VIA ADJUSTMENT OF WAVELET COEFFICIENT MAGNITUDE CORRELATION

    E-print Network

    Simoncelli, Eero

    IMAGE DENOISING VIA ADJUSTMENT OF WAVELET COEFFICIENT MAGNITUDE CORRELATION Javier Portilla wavelet decomposition. Specifically, we decompose the noisy image into wavelet subbands, estimate an image from the modified wavelet coefficients. This process is ap- plied repeatedly, and can

  3. Seebeck and Peltier coefficients of hydrogen electrodes related to the

    E-print Network

    Kjelstrup, Signe

    Seebeck and Peltier coefficients of hydrogen electrodes related to the PEMFC Papy Zefaniya Chemical. Abstract The coefficient of Thermoelectric power of hydrogen electrode as function of partial pressure has

  4. Techniques for increasing throughput in HEVC transform coefficient coding

    NASA Astrophysics Data System (ADS)

    Joshi, Rajan L.; Sole, Joel; Chen, Jianle; Chien, Wei-Jung; Karczewicz, Marta

    2012-10-01

    Transform coefficient coding in HEVC encompasses the scanning patterns and the coding methods for the last significant coefficient, significance map, coefficient levels and sign data. Unlike H.264/AVC, HEVC has a single entropy coding mode based on the context adaptive binary arithmetic coding (CABAC) engine. Due to this, achieving high throughput for transform coefficient coding was an important design consideration. This paper analyzes the throughput of different components of transform coefficient coding with special emphasis on the explicit coding of the last significant coefficient position and high throughput binarization. A comparison with H.264/AVC transform coefficient coding is also presented, demonstrating that HEVC transform coefficient coding achieves higher average and worst case throughput.

  5. Gammatone Wavelet Cepstral Coefficients for Robust Speech Recognition

    E-print Network

    Gammatone Wavelet Cepstral Coefficients for Robust Speech Recognition Aniruddha Adiga Department Gammatone wavelets derived from the popular Gammatone functions. These wavelets incorporate. We refer to the new features as Gammatone Wavelet Cepstral Coefficients (GWCC). The procedure

  6. A parameterization of the ice-ocean drag coefficient

    Microsoft Academic Search

    Peng Lu; Zhijun Li; Bin Cheng; Matti Leppäranta

    2011-01-01

    The ice-ocean drag coefficient was related with sea ice geometric propertiesForm drags are important especially for the MIZ and heavily ridged ice fieldParameterization changes the drag coefficient from a constant to a variable

  7. Local structure and vibrational properties of alpha-Pu, alpha-Uand the alpha-U charge density wave

    SciTech Connect

    Nelson, E.J.; Allen, P.G.; Blobaum, K.J.M.; Wall, W.A.; Booth, C.H.

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure a-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}{prime}-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}{prime}-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  8. Single particle tracking of alpha7 nicotinic AChR in hippocampal neurons reveals regulated confinement at glutamatergic and GABAergic perisynaptic sites.

    PubMed

    Bürli, Thomas; Baer, Kristin; Ewers, Helge; Sidler, Corinne; Fuhrer, Christian; Fritschy, Jean-Marc

    2010-01-01

    Alpha7 neuronal nicotinic acetylcholine receptors (alpha7-nAChR) form Ca(2+)-permeable homopentameric channels modulating cortical network activity and cognitive processing. They are located pre- and postsynaptically and are highly abundant in hippocampal GABAergic interneurons. It is unclear how alpha7-nAChRs are positioned in specific membrane microdomains, particularly in cultured neurons which are devoid of cholinergic synapses. To address this issue, we monitored by single particle tracking the lateral mobility of individual alpha7-nAChRs labeled with alpha-bungarotoxin linked to quantum dots in live rat cultured hippocampal interneurons. Quantitative analysis revealed different modes of lateral diffusion of alpha7-nAChR dependent on their subcellular localization. Confined receptors were found in the immediate vicinity of glutamatergic and GABAergic postsynaptic densities, as well as in extrasynaptic clusters of alpha-bungarotoxin labeling on dendrites. alpha7-nAChRs avoided entering postsynaptic densities, but exhibited reduced mobility and long dwell times at perisynaptic locations, indicative of regulated confinement. Their diffusion coefficient was lower, on average, at glutamatergic than at GABAergic perisynaptic sites, suggesting differential, synapse-specific tethering mechanisms. Disruption of the cytoskeleton affected alpha7-nAChR mobility and cell surface expression, but not their ability to form clusters. Finally, using tetrodotoxin to silence network activity, as well as exposure to a selective alpha7-nAChR agonist or antagonist, we observed that alpha7-nAChRs cell surface dynamics is modulated by chronic changes in neuronal activity. Altogether, given their high Ca(2+)-permeability, our results suggest a possible role of alpha7-nAChR on interneurons for activating Ca(2+)-dependent signaling in the vicinity of GABAergic and glutamatergic synapses. PMID:20634896

  9. Oxygen binding by alpha(Fe2+)2beta(Ni2+)2 hemoglobin crystals.

    PubMed Central

    Bruno, S.; Bettati, S.; Manfredini, M.; Mozzarelli, A.; Bolognesi, M.; Deriu, D.; Rosano, C.; Tsuneshige, A.; Yonetani, T.; Henry, E. R.

    2000-01-01

    Oxygen binding by hemoglobin fixed in the T state either by crystallization or by encapsulation in silica gels is apparently noncooperative. However, cooperativity might be masked by different oxygen affinities of alpha and beta subunits. Metal hybrid hemoglobins, where the noniron metal does not bind oxygen, provide the opportunity to determine the oxygen affinities of alpha and beta hemes separately. Previous studies have characterized the oxygen binding by alpha(Ni2+)2beta(Fe2+)2 crystals. Here, we have determined the three-dimensional (3D) structure and oxygen binding of alpha(Fe2+)2beta(Ni2+)2 crystals grown from polyethylene glycol solutions. Polarized absorption spectra were recorded at different oxygen pressures with light polarized parallel either to the b or c crystal axis by single crystal microspectrophotometry. The oxygen pressures at 50% saturation (p50s) are 95 +/- 3 and 87 +/- 4 Torr along the b and c crystal axes, respectively, and the corresponding Hill coefficients are 0.96 +/- 0.06 and 0.90 +/- 0.03. Analysis of the binding curves, taking into account the different projections of the alpha hemes along the optical directions, indicates that the oxygen affinity of alpha1 hemes is 1.3-fold lower than alpha2 hemes. Inspection of the 3D structure suggests that this inequivalence may arise from packing interactions of the Hb tetramer within the monoclinic crystal lattice. A similar inequivalence was found for the beta subunits of alpha(Ni2+)2beta(Fe2+)2 crystals. The average oxygen affinity of the alpha subunits (p50 = 91 Torr) is about 1.2-fold higher than the beta subunits (p50 = 110 Torr). In the absence of cooperativity, this heterogeneity yields an oxygen binding curve of Hb A with a Hill coefficient of 0.999. Since the binding curves of Hb A crystals exhibit a Hill coefficient very close to unity, these findings indicate that oxygen binding by T-state hemoglobin is noncooperative, in keeping with the Monod, Wyman, and Changeux model. PMID:10794410

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  11. Analytical aerodynamic model of a high alpha research vehicle wind-tunnel model

    NASA Technical Reports Server (NTRS)

    Cao, Jichang; Garrett, Frederick, Jr.; Hoffman, Eric; Stalford, Harold

    1990-01-01

    A 6 DOF analytical aerodynamic model of a high alpha research vehicle is derived. The derivation is based on wind-tunnel model data valid in the altitude-Mach flight envelope centered at 15,000 ft altitude and 0.6 Mach number with Mach range between 0.3 and 0.9. The analytical models of the aerodynamics coefficients are nonlinear functions of alpha with all control variable and other states fixed. Interpolation is required between the parameterized nonlinear functions. The lift and pitching moment coefficients have unsteady flow parts due to the time range of change of angle-of-attack (alpha dot). The analytical models are plotted and compared with their corresponding wind-tunnel data. Piloted simulated maneuvers of the wind-tunnel model are used to evaluate the analytical model. The maneuvers considered are pitch-ups, 360 degree loaded and unloaded rolls, turn reversals, split S's, and level turns. The evaluation finds that (1) the analytical model is a good representation at Mach 0.6, (2) the longitudinal part is good for the Mach range 0.3 to 0.9, and (3) the lateral part is good for Mach numbers between 0.6 and 0.9. The computer simulations show that the storage requirement of the analytical model is about one tenth that of the wind-tunnel model and it runs twice as fast.

  12. Serum TNF alpha inhibitor in mouse typhoid.

    PubMed

    Mastroeni, P; Villarreal, B; Demarco de Hormaeche, R; Hormaeche, C E

    1992-05-01

    Administration of anti-TNF alpha antiserum enhanced a sublethal infection with salmonellae of moderate virulence (Salmonella typhimurium M525) in innately susceptible (Ity(s)) BALB/c mice, indicating that TNF alpha is important in the early response which suppresses bacterial growth in the reticuloendothelial system (RES). However, only transient low levels of TNF alpha were detectable on day 3 in sera from some, but not all, sublethally infected mice. Conversely, on day 4 of the same infection, clear TNF alpha inhibitory activity was detected in some sera. Neither TNF alpha or any inhibitory activity were detected in sera of lethally infected BALB/c mice undergoing an acute, overwhelming Salmonella infection. In contrast, TNF alpha inhibitory activity, but not TNF alpha, was detected in sera of mice showing a cachectic syndrome induced by persistent high bacterial numbers following intravenous inoculation of a very high dose (2 x 10(7)) of the attenuated aro- S. typhimurium SL3261 strain. PMID:1501573

  13. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  14. 46 CFR 42.20-25 - Correction for block coefficient.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...2011-10-01 2011-10-01 false Correction for block coefficient. 42.20-25 Section 42.20-25...SEA Freeboards § 42.20-25 Correction for block coefficient. If the block coefficient (Cb) exceeds 0.68, the...

  15. 46 CFR 42.20-25 - Correction for block coefficient.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...2010-10-01 2010-10-01 false Correction for block coefficient. 42.20-25 Section 42.20-25...SEA Freeboards § 42.20-25 Correction for block coefficient. If the block coefficient (Cb) exceeds 0.68, the...

  16. Constraints Coefficients in hp-FEM Andreas Schroder

    E-print Network

    Schroeder, Andreas

    Constraints Coefficients in hp-FEM Andreas Schr¨oder Abstract Continuity requirements on irregular is given by the so-called constraints coefficients. Andreas Schr¨oder Department of Mathematics, Humboldt.schroeder@mathematik.hu-berlin.de 1 #12;2 Andreas Schr¨oder In a very general manner, constraints coefficients are defined as follows

  17. Penalized spline estimation for functional coefficient regression models

    Microsoft Academic Search

    Yanrong Cao; Haiqun Lin; Tracy Z. Wu; Yan Yu

    2010-01-01

    The functional coefficient regression models assume that the regression coefficients vary with some “threshold” variable, providing appreciable flexibility in capturing the underlying dynamics in data and avoiding the so-called “curse of dimensionality” in multivariate nonparametric estimation. We first investigate the estimation, inference, and forecasting for the functional coefficient regression models with dependent observations via penalized splines. The P-spline approach, as

  18. Detection of Shape Deformities using Yamabe flow and Beltrami coefficients

    E-print Network

    Soatto, Stefano

    1 Detection of Shape Deformities using Yamabe flow and Beltrami coefficients Lok Ming Lui1,2 , Tsz are formulated as conformal deformations. We then detect abnormalities by computing the Beltrami coefficient associated uniquely with the quasi-conformal map. The Beltrami coefficient is a complex- valued function

  19. Glucosylation of alpha-butyl- and alpha-octyl-D-glucopyranosides by dextransucrase and alternansucrase from Leuconostoc mesenteroides.

    PubMed

    Richard, Gaëtan; Morel, Sandrine; Willemot, René-Marc; Monsan, Pierre; Remaud-Simeon, Magali

    2003-04-22

    For the first time, glucosylation of alpha-butyl- and alpha-octylglucopyranoside was achieved using dextransucrase (DS) of various specificities, and alternansucrase (AS) from Leuconostoc mesenteroides. All the glucansucrases (GS) tested used alpha-butylglucopyranoside as acceptor; in particular, DS produced alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside and alpha-D-glucopyranosyl-(1-->6)-alpha-D-glucopyranosyl-(1-->6)-O-butyl-alpha-D-glucopyranoside. In contrast, alpha-octylglucopyranoside was glucosylated only by AS which was shown to be the most efficient catalyst. The conversion rates, obtained with this enzyme at sucrose to acceptor molar ratio of 2:1 reached 81 and 61% for alpha-butylglucopyranoside and alpha-octylglucopyranoside, respectively. Analyses obtained from liquid chromatography coupled with mass spectrometry revealed that different series of alpha-alkylpolyglucopyranosides regioisomers of increasing polymerization degree can be formed depending on the specificity of the catalyst. PMID:12681910

  20. Stirling cycle simulation without differential coefficients

    SciTech Connect

    Organ, A.J. [University Engineering Department Cambridge (United Kingdom)

    1995-12-31

    With a simple transformation, the gas processes in the Stirling machine are described for all time and location in an algebraic equation free of differential coefficients of the unknowns. Local instantaneous heat transfer and friction are represented in function of local instantaneous Reynolds number, N{sub re}. The method avoids problems of numerical discretization, stability, convergence, artificial dispersion and diffusion. The paper presents the algebra of the transformation. Specimen solutions cover the temperature field of the gas circuit (exchangers and regenerator) over a representative cycle. When programmed for workstation the core code occupies some 2 dozen lines, and processing calls for seconds of CPU time. Availability of the solution means that intimate details of the gas processes are susceptible to examination using the most basic of computing facilities.

  1. Cepheid Masses based upon Fourier Coefficient Resonances

    NASA Astrophysics Data System (ADS)

    Morgan, S. M.

    2005-05-01

    The masses of Cepheids in the Milky Way, the LMC and the SMC are examined using the resonance of the Fourier coefficients R21 and ? 21 for both fundamental and overtone mode variables. Linear non-adiabatic models are used to define a range of possible masses and luminosities based upon the temperature, pulsation period and Fourier resonances of the observed stars. Cepheid models with fundamental periods within the observed range for the resonance of p0/p_2=2 were created as well as overtone mode pulsator models which have the resonance p1/p_4=2. The model parameters are used to define likely mass-luminosity relations for Cepheids in the three galaxies which are compared to other mass-luminosity relations such as those based upon evolutionay models, double mode Cepheids, bump Cepheids and binary Cepheids.

  2. coefficient de dilatation. En fait, le rapport de ces coefficients est peu prs constant.

    E-print Network

    Paris-Sud XI, Université de

    Reibung der Gase nach einer neuen experimentellen Méthode (Détermination du frottement interne des gaz par innere Reibung des Eises (Frottement interne de la glace). - Annalen der Physik, t. XVIII, p. 81 coefficient de frottement interne de la glace, r le rayon du cylindre, 1 sa longueur 2013~- la vitesse

  3. Sedimentation Coefficient, Frictional Coefficient, and Molecular Weight: A Preparative Ultracentrifuge Experiment for the Advanced Undergraduate Laboratory.

    ERIC Educational Resources Information Center

    Halsall, H. B.; Wermeling, J. R.

    1982-01-01

    Describes an experiment using a high-speed preparative centrifuge and calculator to demonstrate effects of the frictional coefficient of a macromolecule on its rate of transport in a force field and to estimate molecular weight of the macromolecule using an empirical relationship. Background information, procedures, and discussion of results are…

  4. Binary diffusion coefficients in supercritical fluids: Recent progress in measurements and correlations for binary diffusion coefficients

    Microsoft Academic Search

    Toshitaka Funazukuri; Chang Yi Kong; Seiichiro Kagei

    2006-01-01

    Dr. Aydin Akgerman greatly contributed to studies on diffusion in liquids and supercritical fluids, in particular, measurements by the Taylor dispersion method. Based on his work, this article describes recent progress in measurements for binary diffusion coefficients in supercritical fluids by using the chromatographic impulse response technique as well as the Taylor dispersion method, and in the predictive empirical correlations.

  5. Impact of inhomogeneous optical scattering coefficient distribution on recovery of optical absorption coefficient maps using tomographic photoacoustic data

    NASA Astrophysics Data System (ADS)

    Li, Xiaoqi; Jiang, Huabei

    2013-02-01

    We present a study through extensive simulation that considers the impact of inhomogeneous optical scattering coefficient distribution on recovery of optical absorption coefficient maps using tomographic photoacoustic data collected from media mimicking breast tissue. We found that while the impact of scattering heterogeneities/targets is modest on photoacoustic recovery of optical absorption coefficients, the impact of scattering contrast caused by adipose tissue, a layer of normal tissue along the boundary of the breast, is dramatic on reconstruction of optical absorption coefficients using photoacoustic data—up to 25.8% relative error in recovering the absorption coefficient is estimated in such cases. To overcome this problem, we propose a new method to enhance photoacoustic recovery of the optical absorption coefficient in heterogeneous media by considering inhomogeneous scattering coefficient distribution provided by diffuse optical tomography (DOT). Results from extensive simulations show that photoacoustic recovery of absorption coefficient maps can be improved considerably with a priori scattering information from DOT.

  6. High precision {sup 89}Y({alpha},{alpha}){sup 89}Y scattering at low energies

    SciTech Connect

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.; Elekes, Z.; Somorjai, E. [Institute of Nuclear Research (ATOMKI), H-4001 Debrecen (Hungary); Mohr, P. [Diakonie-Klinikum, D-74523 Schwaebisch Hall (Germany); Galaviz, D. [Instituto de Estructura de la Materia, CSIC, E-28006 Madrid (Spain); Kretschmer, A.; Sonnabend, K. [Institut fuer Kernphysik, Technische Universitaet Darmstadt, D-64289 Darmstadt (Germany); Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937 Koeln (Germany); Avrigeanu, M. [Horia Hulubei National Institute for Physics and Nuclear Engineering, RO-76900 Bucharest (Romania)

    2009-10-15

    Elastic scattering cross sections of the {sup 89}Y({alpha},{alpha}){sup 89}Y reaction have been measured at energies E{sub c.m.}=15.51 and 18.63 MeV. The high-precision data for the semimagic N=50 nucleus {sup 89}Y are used to derive a local potential and to evaluate the predictions of global and regional {alpha}-nucleus potentials. The variation of the elastic {alpha}-scattering cross sections along the N=50 isotonic chain is investigated by a study of the ratios of angular distributions for {sup 89}Y({alpha},{alpha}){sup 89}Y and {sup 92}Mo({alpha},{alpha}){sup 92}Mo at E{sub c.m.}{approx_equal}15.51 and 18.63 MeV. This ratio is a very sensitive probe at energies close to the Coulomb barrier, where scattering data alone is usually not enough to characterize the different potentials. Furthermore, {alpha}-cluster states in {sup 93}Nb={sup 89}Y x {alpha} are investigated.

  7. The alpha decay of deformed superheavy elements

    E-print Network

    M. Kowal; Z. Lojewski

    2003-04-09

    The interaction potential between the alpha particle and the deformed parent nucleus was used for description of the decay of superheavy nuclei. It consists of centrifugal, nuclear and Coulomb parts suitably modified for deformed nuclei. The significant effect of various shapes of barriers obtained for deformed parent nuclei on calculated alpha half-life times were shown. The finally calculated half-life times due to the spontaneous alpha decay for superheavy elements were compared with the results obtained from other models and the experimental data.

  8. Effect of excited states on the ionization balance in plasmas via the enhancement of ionization and recombination rate coefficients.

    PubMed

    Lee, K; Kim, D E

    1999-08-01

    The effect of excited states on the effective ionization and recombination rate coefficients for the ground states was investigated analytically and by computer simulation. The calculation was done for carbon ions. The results using carbon ions show (1) the contribution from excited states to ionization rate coefficients becomes significant even at an electron density as low as 10(15) cm(-3) and saturated from around N(e) approximately 10(20) cm(-3); (2) the lower the electron temperature, the larger the contribution; (3) in the case of recombination rate coefficients, there is still a non-negligible contribution from excited states even at a very low electron density of 10(10) cm(-3), where the contribution has been considered negligible; (4) this contribution to the recombination rate coefficients increases linearly with the electron density; (5) the enhancements of the ionization and recombination rate coefficients increase as N(e) increases and are saturated to the same value at higher densities; (6) there exists a region of temperature and density where the recombination is effectively hindered. Some of the behaviors of the ionization and recombination rate coefficients in the extreme regions of a very low and high electron density were analytically understood. The calculated ionization and recombination rate coefficients for carbon ions, including the effect of excited states, were used in a one-dimensional magnetohydrodynamic code for the calculation of the ionization balance of carbon ions in a Z-pinch carbon plasma and the gain of C VI H(alpha) (18.2 nm) line. The significant change in the evolution of the ionization balance was observed. The rapid depletion of C VII ions by the increased recombination rate reduces the gain significantly by a factor of approximately 3 compared to the case where the contribution from excited states was neglected. Such calculations can be done for other ions. The characteristics found for carbon ions are generic and applicable to other ions. PMID:11970017

  9. Flag algebras and the stable coefficients of the Jones polynomial

    E-print Network

    Stavros Garoufalidis; Sergey Norin; Thao Vuong

    2015-04-22

    We study the structure of the stable coefficients of the Jones polynomial of an alternating link. We start by identifying the first four stable coefficients with polynomial invariants of a (reduced) Tait graph of the link projection. This leads us to introduce a free polynomial algebra of invariants of graphs whose elements give invariants of alternating links which strictly refine the first four stable coefficients. We conjecture that all stable coefficients are elements of this algebra, and give experimental evidence for the fifth and sixth stable coefficient. We illustrate our results in tables of all alternating links with at most 10 crossings and all irreducible planar graphs with at most 6 vertices.

  10. Measured and predicted shock shapes and aerodynamic coefficients for blunted cones at incidence in helium at Mach 20.3

    NASA Technical Reports Server (NTRS)

    Calloway, R. L.; White, N. H.

    1979-01-01

    Experimental values of shock shapes (alpha = 0 degrees and 10 degrees) and static aerodynamic coefficients (alpha = -4 degrees to 12 degrees) for sharp and spherically blunted cones having cone half-angles of 30, 45, 60, and 70 degrees and nose bluntness ratios of 0, 0.25, and 0.50 are presented. Shock shapes were also measured at 0 degree angle of attack by using a flat-faced cylinder (90 degree cone) and a hemispherically blunted cylinder (sphere). All tests were conducted in helium (gamma = 5/3) at a free-stream Mach number of 20.3 and a unit free-stream Reynolds number of 22,400,000 per meter. Comparisons between measured values and predicted values were made by using several numerical and simple engineering methods.

  11. Efficient computation of kinship and identity coefficients on large pedigrees.

    PubMed

    Cheng, En; Elliott, Brendan; Ozsoyoglu, Z Meral

    2009-06-01

    With the rapidly expanding field of medical genetics and genetic counseling, genealogy information is becoming increasingly abundant. An important computation on pedigree data is the calculation of identity coefficients, which provide a complete description of the degree of relatedness of a pair of individuals. The areas of application of identity coefficients are numerous and diverse, from genetic counseling to disease tracking, and thus, the computation of identity coefficients merits special attention. However, the computation of identity coefficients is not done directly, but rather as the final step after computing a set of generalized kinship coefficients. In this paper, we first propose a novel Path-Counting Formula for calculating generalized kinship coefficients, which is motivated by Wright's path-counting method for computing inbreeding coefficient. We then present an efficient and scalable scheme for calculating generalized kinship coefficients on large pedigrees using NodeCodes, a special encoding scheme for expediting the evaluation of queries on pedigree graph structures. Furthermore, we propose an improved scheme using Family NodeCodes for the computation of generalized kinship coefficients, which is motivated by the significant improvement of using Family NodeCodes for inbreeding coefficient over the use of NodeCodes. We also perform experiments for evaluating the efficiency of our method, and compare it with the performance of the traditional recursive algorithm for three individuals. Experimental results demonstrate that the resulting scheme is more scalable and efficient than the traditional recursive methods for computing generalized kinship coefficients. PMID:19507284

  12. Hb Constant Spring [alpha 142, Term-->Gln (TAA>CAA in alpha2)] in the alpha-thalassemia of anemic patients in Myanmar.

    PubMed

    Ne-Win; Harano, Keiko; Harano, Teruo; Kyaw-Shwe; Aye-Aye-Myint; Khin-Thander-Aye; Okada, Shigeru

    2008-01-01

    Hb Constant Spring (Hb CS), the gene (alpha(CS)) of which arises from a point mutation in the termination codon of the alpha2-globin gene, is the most prevalent variety of nondeletional alpha-thalassemia (alpha-thal) in Asian populations. It is a major cause of Hb H disease in compound heterozygotes who have Hb CS combined with a duplicated alpha gene deletion (--/alpha(CS)alpha), and it tends to be more severe than Hb H disease which is caused by a triple alpha gene deletion (--/-alpha). Hb CS is often missed by routine electrophoresis but not by polymerase chain reaction (PCR) methods. During alpha-thal screening and genotyping of 235 patients diagnosed by laboratory tests hemoglobin (Hb), MCV, MCH and Hb H inclusion bodies] using the gap-PCR method, 175 patients were diagnosed to be carriers of an alpha-thal gene, genotypes of which were 133 alpha-thal-2, 34 alpha-thal-1 (including one only by laboratory test) and eight with Hb H disease. Detection of the alpha(CS) gene for the carriers of alpha-thal-1 and Hb H disease was done by the mismatched PCR-RFLP (restriction fragment length polymorphism) method and the alpha(CS) gene was found in the homozygous state in an alpha-thal-1 patient and a single gene form in two Hb H disease patients. These genotypes were characterized by the PCR-sequencing method. These patients clinically presented the aspects of Hb H disease and of a homozygote form of alpha-thal-1. The description of the alpha(CS) gene in Myanmar is of great value in the development of an effective procedure for prenatal diagnosis of Hb Bart's hydrops fetalis syndrome. PMID:18932070

  13. Effects of ligand-mimetic peptides Arg-Gly-Asp-X (X = Phe, Trp, Ser) on alphaIIbbeta3 integrin conformation and oligomerization.

    PubMed

    Hantgan, R R; Paumi, C; Rocco, M; Weisel, J W

    1999-11-01

    The purpose of this investigation was to determine what structural changes convert "inert" alphaIIbbeta3 integrins into "activated" high-affinity receptors for adhesive proteins. Light scattering, analytical ultracentrifugation, electron microscopy, and molecular modeling were used to probe the conformational states of the alphaIIbbeta3 integrin. Isolated from human blood platelets in octyl glucoside, the alphaIIbbeta3 complex behaved as an asymmetric 230 kDa macromolecule with a z-average translational diffusion coefficient of 2.9 F and a weight-average sedimentation coefficient of 7.7 S. Dynamic light scattering showed that ligand-mimetic peptides (RGDX, X = F, W, S) caused prompt, concentration-dependent increases in the Stokes radius (R(s)) of the alphaIIbbeta3 complex, whereas control peptides of reversed sequence (XDGR, X = F, W, S) had no significant effect. Sedimentation velocity data coupled with time-derivative analyses showed that RGDX peptides shifted the distribution of alphaIIbbeta3 sedimenting species toward smaller s values. Sedimentation equilibrium measurements indicated that a slower increase in the alphaIIbbeta3 molecular weight distribution took place in the presence of RGDX ligand-mimetics. Electron microscopy showed a split of alphaIIbbeta3's globular domain into two distinct nodules in the presence of RGDX peptides; oligomers joined through their stalk regions were seen frequently. These observations suggest that receptor occupancy by ligand-mimetic RGDX peptides is tightly coupled to relatively large changes in the structure of the alphaIIbbeta3 complex. alphaIIbbeta3 bead models were developed to describe quantitatively the ligand-induced transition from a "closed" to an "open" integrin conformation and the limited oligomerization that follows. This provides a new mechanistic framework for understanding integrin activation and the formation of signaling clusters on the surface of stimulated platelets. PMID:10545168

  14. Alpha high-power chemical laser program

    NASA Astrophysics Data System (ADS)

    Ackerman, Richard A.; Callahan, David; Cordi, Anthony J.; Lurie, Henry; Thomson, Matthew

    1995-03-01

    Alpha is a megawatt-class hydrogen fluoride, continuous wave, space based chemical laser brassboard which demonstrates and validates technology for space-based applications. It consists of a cylindrical gain generator that exhausts radially outward through circumferential nozzles forming an annular lasing media and an annular ring resonator, which extracts the laser energy. Technical innovations first demonstrated on Alpha include: (1) use of extruded aluminum components, (2) diamond turned, annular optics made of molybdenum, (3) uncooled silicon mirrors, (4) light weight optical benches, and (5) active alignment. Alpha first lased in 1989, and has repeatably demonstrated megawatt-class power and excellent beam quality. Using Alpha, TRW has demonstrated the use of low weight uncooled mirrors in very high power lasers to reduce system jitter. They have performed flawlessly and beam jitter levels were significantly reduced.

  15. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  16. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  17. Genetics Home Reference: Alpha-mannosidosis

    MedlinePLUS

    ... enzyme helps break down complexes of sugar molecules (oligosaccharides) attached to certain proteins (glycoproteins). In particular, alpha-mannosidase helps break down oligosaccharides containing a sugar molecule called mannose. Mutations in ...

  18. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  19. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  20. Three-alpha structures in 12C

    Microsoft Academic Search

    R. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12C are localized. For the first time we unambiguously show in a microscopic model that the 0+2 state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  1. Three-alpha structures in 12C

    Microsoft Academic Search

    P. Pichler; H. Oberhummer; Attila Csótó; S. A. Moszkowski

    1997-01-01

    We search for three-alpha resonances in 12C by using the complex scaling method in a microscopic cluster model. All experimentally known low-lying natural-parity states of 12 are localized. For the first time we unambiguously show in a microscopic model that the 02+ state in 12C, which plays an important role in stellar nucleosynthesis, is a genuine three-alpha resonance.

  2. Energy dependence of event shapes and of $\\\\alpha_s$ at LEP 2

    Microsoft Academic Search

    P. Abreu; W Adam; T Adye; P Adzic; Z Albrecht; T Alderweireld; G D Alekseev; R Alemany; T Allmendinger; P P Allport; S Almehed; Ugo Amaldi; N Amapane; S Amato; E G Anassontzis; P Andersson; A Andreazza; S Andringa; P Antilogus; W D Apel; Y Arnoud; B Åsman; J E Augustin; A Augustinus; Paul Baillon; P Bambade; F Barão; Guido Barbiellini; R Barbier; Dimitri Yuri Bardin; G Barker; A Baroncelli; Marco Battaglia; M Baubillier; K H Becks; M Begalli; A Behrmann; P Beillière; Yu A Belokopytov; K S Belous; N C Benekos; Alberto C Benvenuti; C Bérat; M Berggren; D Bertini; D Bertrand; M Besançon; F Bianchi; M Bigi; S M Bilenky; M A Bizouard; D Bloch; H M Blom; M Bonesini; W Bonivento; M Boonekamp; P S L Booth; A W Borgland; G Borisov; C Bosio; O Botner; E Boudinov; B Bouquet; C Bourdarios; T J V Bowcock; I Boyko; I Bozovic; M Bozzo; P Branchini; T Brenke; R A Brenner; P Brückman; J M Brunet; L Bugge; T Buran; T Burgsmüller; Brigitte Buschbeck; P Buschmann; S Cabrera; M Caccia; M Calvi; T Camporesi; V Canale; F Carena; L Carroll; Carlo Caso; M V Castillo-Gimenez; A Cattai; F R Cavallo; V Chabaud; M M Chapkin; P Charpentier; L Chaussard; P Checchia; G A Chelkov; R Chierici; P V Chliapnikov; P Chochula; V Chorowicz; J Chudoba; K Cieslik; P Collins; R Contri; E Cortina; G Cosme; F Cossutti; J H Cowell; H B Crawley; D J Crennell; S Crépé; G Crosetti; J Cuevas-Maestro; S Czellar; Martyn Davenport; W Da Silva; A Deghorain; G Della Ricca; P A Delpierre; N Demaria; A De Angelis; Wim de Boer; C De Clercq; B De Lotto; A De Min; L S De Paula; H Dijkstra; Lucia Di Ciaccio; J Dolbeau; K Doroba; M Dracos; J Drees; M Dris; A Duperrin; J D Durand; G Eigen; T J C Ekelöf; Gösta Ekspong; M Ellert; M Elsing; J P Engel; B Erzen; M C Espirito-Santo; E Falk; G K Fanourakis; D Fassouliotis; J Fayot; Michael Feindt; A Fenyuk; P Ferrari; A Ferrer; E Ferrer-Ribas; F Ferro; S Fichet; A Firestone; U Flagmeyer; H Föth; E Fokitis; F Fontanelli; B J Franek; A G Frodesen; R Frühwirth; F Fulda-Quenzer; J A Fuster; A Galloni; D Gamba; S Gamblin; M Gandelman; C García; C Gaspar; M Gaspar; U Gasparini; P Gavillet; E N Gazis; D Gelé; N Ghodbane; I Gil; F Glege; R Gokieli; B Golob; G Gómez-Ceballos; P Gonçalves; I González-Caballero; Gian P Gopal; L Gorn; M Górski; Yu Guz; Valerio Gracco; J Grahl; E Graziani; C Green; H J Grimm; P Gris; G Grosdidier; K Grzelak; M Günther; J Guy; F Hahn; S Hahn; S Haider; A Hallgren; K Hamacher; J Hansen; F J Harris; V Hedberg; S Heising; J J Hernández; P Herquet; H Herr; T L Hessing; J M Heuser; E Higón; S O Holmgren; P J Holt; S Hoorelbeke; M A Houlden; Josef Hrubec; K Huet; G J Hughes; K Hultqvist; J N Jackson; R Jacobsson; P Jalocha; R Janik; C Jarlskog; G Jarlskog; P Jarry; B Jean-Marie; E K Johansson; P E Jönsson; C Joram; P Juillot; F Kapusta; K Karafasoulis; S Katsanevas; E C Katsoufis; R Keränen; Borut P Kersevan; B A Khomenko; N N Khovanskii; A P Kiiskinen; B J King; A Kinvig; N J Kjaer; O Klapp; H Klein; P M Kluit; P Kokkinias; M Koratzinos; V Kostyukhin; C Kourkoumelis; O Kuznetsov; Manfred Krammer; E Kriznic; J Krstic; Z Krumshtein; P Kubinec; J Kurowska; K L Kurvinen; J Lamsa; P Langefeld; V Lapin; J P Laugier; R Lauhakangas; Gerhard Leder; F Ledroit; V Lefébure; L Leinonen; A Leisos; R Leitner; J Lemonne; Georg Lenzen; V Lepeltier; T Lesiak; M Lethuillier; J Libby; D Liko; A Lipniacka; I Lippi; B Lörstad; J G Loken; J H Lopes; J M López; R López-Fernandez; D Loukas; P Lutz; L Lyons; J N MacNaughton; J R Mahon; A Maio; A Malek; T G M Malmgren; S Maltezos; V Malychev; F Mandl; J Marco; R P Marco; B Maréchal; M Margoni; J C Marin; C Mariotti; A Markou; C Martínez-Rivero; F Martínez-Vidal; S Martí i García; N Mastroyiannopoulos; F Matorras; C Matteuzzi; Giorgio Matthiae; J Masik; F Mazzucato; M Mazzucato; M L McCubbin; R McKay; R McNulty; G McPherson; C Meroni; W T Meyer; E Migliore; L Mirabito; Winfried A Mitaroff; U Mjörnmark; T Moa; M Moch; R Møller; K Mönig; M R Monge; X Moreau; P Morettini; G A Morton; U Müller; K Münich; M Mulders; C Mulet-Marquis; R Muresan; W J Murray; B Muryn; Gerald Myatt; T Myklebust; F Naraghi; M Nassiakou; Francesco Luigi Navarria; S Navas; K Nawrocki; P Negri; S Némécek; N Neufeld; N Neumeister; R Nicolaidou; B S Nielsen; M Nikolenko; V P Nomokonov; Ainsley Normand; A Nygren; V F Obraztsov; A G Olshevskii; A Onofre; Risto Orava; G Orazi; K Österberg; A Ouraou; M Paganoni; S Paiano; R Pain; R Paiva; J Palacios; H Palka; T D Papadopoulou; K Papageorgiou; L Pape; C Parkes; F Parodi; U Parzefall; A Passeri; O Passon; M Pegoraro; L Peralta; Manfred Pernicka; A Perrotta; C Petridou; A Petrolini; H T Phillips; F Pierre; M Pimenta; E Piotto; T Podobnik; M E Pol; G Polok; P Poropat; V Pozdnyakov; P Privitera; N Pukhaeva; Antonio Pullia; D Radojicic; S Ragazzi; H Rahmani; P N Ratoff; A L Read; P Rebecchi; N G Redaelli; Meinhard Regler; D Reid

    1999-01-01

    Infrared and collinear safe event shape distributions and their mean values are determined using the data taken at ve di erent centre of mass energies above $M_Z$ with the DELPHI detector at LEP. From the event shapes, the strong coupling $\\\\alpha_s$ is extracted in $O(\\\\alpha^2_s)$, NLLA and a combined scheme using hadronisation corrections evaluated with fragmentation model generators as well

  3. Calculations of Alpha-Particle Trajectories for Long-Range Alpha Particles Emitted in Spontaneous Fission

    Microsoft Academic Search

    Y. Boneh; Z. Fraenkel; I. Nebenzahl

    1967-01-01

    Calculated angular and energy distributions of the alpha particles in long-range alpha-particle fission are presented. The distributions were obtained from calculated alpha-particle trajectories based on a three-point-charge model for the scissioning nucleus. The calculation is two dimensional, and spontaneous fission (no preferred direction) is assumed. This reduces the number of free variables of the system to seven (except for the

  4. Destabilization of low mode number Alfven modes in a tokamak by energetic or alpha particles

    SciTech Connect

    Tsang, K. T.; Sigmar, D. J.; Whitson, J. C.

    1980-12-01

    With the inclusion of finite Larmor radius effects in the shear Alfven eigenmode equation, the continuous Alfven spectrum, which has been extensively discussed in ideal magnetohydrodynamics, is removed. Neutrally stable, discrete radial eigenmodes appear in the absence of sources of free energy and dissipation. Alpha (or energetic) particle toroidal drifts destabilize these modes, provided the particles are faster than the Alfven speed. Although the electron Landu resonance contributes to damping, a stability study of the parametric variation of the energy and the density scale length of the energetic particles shows that modes with low radial mode numbers remain unstable in most cases. Since the alpha particles are concentrated in the center of the plasma, this drift-type instability suggests anomalous helium ash diffusion. Indeed, it is shown that stochasticity of alpha orbits due to the overlapping of radially neighboring Alfven resonances is induced at low amplitudes, e/sub i//sup approx./phi/T/sub i/ greater than or equal to 0.05, implying a diffusion coefficient D/sub r//sup ..cap alpha../ greater than or equal to 4.4 x 10/sup 3/cm/sup 2//s.

  5. Preparation and properties of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl- (R)-(+)-alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha- (4-[125I]iodophenyl)-alpha-phenyl acetate as potential radiopharmaceuticals.

    PubMed

    Cohen, V I; Rzeszotarski, W J; Gibson, R E; Fan, L H; Reba, R C

    1989-10-01

    rac-4-Nitrobenzilic acid was synthesized and resolved with quinidine and quinine to give the corresponding (R)- and (S)-salts. The resolved diastereomeric salts were converted to (R)- and (S)-4-nitrobenzilic acids and subsequent esterification gave their corresponding ethyl esters. Transesterification with (R)-(-)-3-quinuclidinol afforded (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha- (4-nitrophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-nitrophenyl)-alpha-phenyl acetate. After hydrogenation, the (R,R)- and (R,S)-amines were converted to the respective triazene derivatives. The triazene derivatives reacted with sodium [125I]iodide to give (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)- alpha-hydroxy-alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-[125I]iodophenyl)-alpha-phenyl acetate. The evaluation of their affinities to muscarinic acetylcholine receptors (MAcChR) shows that (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(S)-(-)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate exhibits an affinity for the MAcChR from corpus striatum that is approximately threefold lower than that of (R)-(-)-1-azabicyclo[2.2.2]oct-3-yl-(R)-(+)-alpha-hydroxy-alpha-(4- [125I]iodophenyl)-alpha-phenyl acetate. PMID:2600789

  6. Infinite dilution activity coefficients and Henry's law coefficients of some priority water pollutants determined by a relative gas chromatographic method

    SciTech Connect

    Tse, G.; Orbey, H.; Sandler, S.I. (Univ. of Delaware, Newark, DE (United States))

    1992-10-01

    A simple, fast relative measurement method based on gas chromatography developed recently has been used to determine the infinite dilution activity coefficients and Henry's law coefficients in water of some priority pollutants. The authors show that this simple method can be used to obtain accurate data quite rapidly, which is especially valuable for screening studies. Further, the infinite dilution activity coefficient and Henry's law coefficient data reported here can be useful for directly estimating environmentally important properties such as solubilities in water, multimedia partitioning, and octanol-water partition coefficients. 8 refs., 1 tab.

  7. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  8. Staphylococcal alpha -toxin: Oligomerization of Hydrophilic Monomers to Form Amphiphilic Hexamers Induced through Contact with Deoxycholate Detergent Micelles

    Microsoft Academic Search

    Sucharit Bhakdi; Roswitha Fussle; Jorgen Tranum-Jensen

    1981-01-01

    Native staphylococcus aureus alpha -toxin is secreted as a hydrophilic polypeptide chain of Mr 34,000. The presence of deoxycholate above the critical micellar concentration induced the toxin monomers to self-associate, forming ring or cylindrical oligomers. The oligomers were amphiphilic and bound detergent. In deoxycholate solution, the protein-detergent complexes exhibited a sedimentation coefficient of 10.4 S. A Mr of 238,700 was

  9. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  10. Jet Physics at LEP and World Summary of $\\alpha_{s}$

    E-print Network

    Bethke, Siegfried

    1999-01-01

    Recent results on jet physics and tests of QCD from hadronic final states in $e^+e^-$ annihilation at PETRA and at LEP are reviewed, with special emphasis on hadronic event shapes, charged particle production rates, properties of quark and gluon jets and determinations of $\\alpha_s$. The data in the entire energy range from PETRA to LEP-2 are in broad agreement with the QCD predictions. The world summary of measurements of $\\alpha_s$ is updated and a detailed discussion of various methods to determine the overall error of uncertainties.

  11. Physically consistent simulation of mesoscale chemical kinetics: The non-negative FIS-{alpha} method

    SciTech Connect

    Dana, Saswati, E-mail: saswatid@rishi.serc.iisc.ernet.in [Supercomputer Education and Research Centre, Indian Institute of Science, Bangalore 560012 (India); Raha, Soumyendu, E-mail: raha@serc.iisc.ernet.in [Supercomputer Education and Research Centre, Indian Institute of Science, Bangalore 560012 (India)

    2011-10-01

    Biochemical pathways involving chemical kinetics in medium concentrations (i.e., at mesoscale) of the reacting molecules can be approximated as chemical Langevin equations (CLE) systems. We address the physically consistent non-negative simulation of the CLE sample paths as well as the issue of non-Lipschitz diffusion coefficients when a species approaches depletion and any stiffness due to faster reactions. The non-negative Fully Implicit Stochastic {alpha} (FIS {alpha}) method in which stopped reaction channels due to depleted reactants are deleted until a reactant concentration rises again, for non-negativity preservation and in which a positive definite Jacobian is maintained to deal with possible stiffness, is proposed and analysed. The method is illustrated with the computation of active Protein Kinase C response in the Protein Kinase C pathway.

  12. Thermal degradation of poly({alpha}-methylstyrene) in solution. [Quarterly report, July--September 1995

    SciTech Connect

    Madras, G.; Smith, J.M.; McCoy, B.J.

    1995-11-11

    The thermal degradation of poly({alpha}-methylstyrene) in solution was investigated at various temperatures (150-225 C) and polymer concentrations (2.00-20.0 g/L) at 6.8 MPa (1000 psig). The molecular weight distributions (MWDs) of the reacted polymer at these conditions were examined at four different residence times. Experimental data indicated that the polymer degraded to its monomer, {alpha}-methylstyrene. No other degradation products were observed. Continuous-mixture kinetics was used to examine the MWDs and to obtain the rate coefficient for degradation and its activation energy. The rate was first-order in polymer concentration with a rate constant at 225 C of 0.01 min{sup {minus} 1} and an activation energy of 66.5 kJ/mol (16.0 kcal/mol). The maximum conversion observed at 275 C was 1.2%. Hydrogen-donor solvent, tetralin, had no effect on the degradation.

  13. Translational diffusion coefficient and partition coefficient of a spin-labeled solute in lecithin bilayer membranes.

    PubMed

    Dix, J A; Diamond, J M; Kivelson, D

    1974-02-01

    The translational diffusion coefficient and the partition coefficient of a spin-labeled solute, di-t-butyl nitroxide, in an aqueous suspension of dipalmitoyl lecithin vesicles have been studied by electron spin resonance spectroscopy. When the lecithin is cooled through its phase transition temperature near 41 degrees C, some solute is "frozen out" of the bilayer, and the standard partial molar enthalpy and entropy of partition go more positive by a factor of 8 and 6, respectively. However, the apparent diffusion constant in the lecithin phase is only slightly smaller than that in water, both above and below the transition temperature. The fraction of bilayer volume within which solute is distributed may increase with temperature, contributing to the positive enthalpy of partition. Comparison of time constants suggests that there is a permeability barrier to this solute in the periphery of the bilayer. PMID:4360944

  14. Temperature Dependence of Ionization Coefficients for InP and 1.3 mum InGaAsP Avalanche Photodiodes

    Microsoft Academic Search

    Yoshifumi Takanashi; Yoshiji Horikoshi

    1981-01-01

    Investigations were made on the temperature dependence of excess noise characteristics for InP and 1.3 mum InGaAsP APDs for the case where electrons are injected into the high field region. The effective ratio of the ionization coefficients Keff(beta\\/alpha) was found to decrease with decreasing temperature for both APDs. Theoretical investigations on hot carriers are combined with McIntyre's theory for the

  15. Asymmetrical slip propensity: required coefficient of friction

    PubMed Central

    2013-01-01

    Background Most studies in performing slips and falls research reported their results after the ipsilateral leg of subjects (either right foot or left foot) was guided to contact the contaminated floor surface although many studies indicated concerns for asymmetries of legs in kinematic or kinetic variables. Thus, the present study evaluated if dominant leg’s slip tendency would be different from non-dominant leg’s slip tendency by comparing the Required Coefficient of Friction (RCOF) of the two lower limbs. Findings Forty seven health adults participated in the present study. RCOF was measured when left or right foot of subjects contacted the force platforms respectively. Paired t-test was performed to test if RCOF and heel velocity (HCV) of dominant legs was different from that of non-dominant legs. It was suggested that the asymmetry in RCOFs and HCV between the two lower limbs existed. The RCOFs of non-dominant legs were higher than that of dominant legs. Conclusions The results indicated that asymmetry in slip propensity, RCOF, was existed in lower extremity. The results from the study suggested that it would be benefit to include a variable, such as asymmetry, in slips and falls research. PMID:23902896

  16. Ghost imaging based on Pearson correlation coefficients

    NASA Astrophysics Data System (ADS)

    Yu, Wen-Kai; Yao, Xu-Ri; Liu, Xue-Feng; Li, Long-Zhen; Zhai, Guang-Jie

    2015-05-01

    Correspondence imaging is a new modality of ghost imaging, which can retrieve a positive/negative image by simple conditional averaging of the reference frames that correspond to relatively large/small values of the total intensity measured at the bucket detector. Here we propose and experimentally demonstrate a more rigorous and general approach in which a ghost image is retrieved by calculating a Pearson correlation coefficient between the bucket detector intensity and the brightness at a given pixel of the reference frames, and at the next pixel, and so on. Furthermore, we theoretically provide a statistical interpretation of these two imaging phenomena, and explain how the error depends on the sample size and what kind of distribution the error obeys. According to our analysis, the image signal-to-noise ratio can be greatly improved and the sampling number reduced by means of our new method. Project supported by the National Key Scientific Instrument and Equipment Development Project of China (Grant No. 2013YQ030595) and the National High Technology Research and Development Program of China (Grant No. 2013AA122902).

  17. Attenuation coefficients for water quality trading.

    PubMed

    Keller, Arturo A; Chen, Xiaoli; Fox, Jessica; Fulda, Matt; Dorsey, Rebecca; Seapy, Briana; Glenday, Julia; Bray, Erin

    2014-06-17

    Water quality trading has been proposed as a cost-effective approach for reducing nutrient loads through credit generation from agricultural or point source reductions sold to buyers facing costly options. We present a systematic approach to determine attenuation coefficients and their uncertainty. Using a process-based model, we determine attenuation with safety margins at many watersheds for total nitrogen (TN) and total phosphorus (TP) loads as they transport from point of load reduction to the credit buyer. TN and TP in-stream attenuation generally increases with decreasing mean river flow; smaller rivers in the modeled region of the Ohio River Basin had TN attenuation factors per km, including safety margins, of 0.19-1.6%, medium rivers of 0.14-1.2%, large rivers of 0.13-1.1%, and very large rivers of 0.04-0.42%. Attenuation in ditches transporting nutrients from farms to receiving rivers is 0.4%/km for TN, while for TP attenuation in ditches can be up to 2%/km. A 95 percentile safety margin of 30-40% for TN and 6-10% for TP, applied to the attenuation per km factors, was determined from the in-stream sensitivity of load reductions to watershed model parameters. For perspective, over 50 km a 1% per km factor would result in 50% attenuation = 2:1 trading ratio. PMID:24866482

  18. Filtration coefficient and osmotic reflection coefficient to albumin in rabbit submandibular gland capillaries.

    PubMed Central

    Gamble, J; Smaje, L H; Spencer, P D

    1988-01-01

    1. The isolated perfused submandibular salivary gland of the rabbit has been used in order to make estimates of the filtration coefficient (Kf) and reflection coefficient (sigma d) of the capillary wall to albumin. 2. An isogravimetric preparation was used and in paired experiments the value for Kf obtained in glands perfused with albumin-Krebs solution, 0.96 +/- 0.086 (mean +/- S.E. of mean) ml min-1 mmHg-1 100 g-1, was not significantly different from that in blood-perfused glands, 0.90 +/- 0.15. 3. On analysing the data for reflection coefficient, it was concluded that the above values underestimated Kf by about 30%; using corrected values for Kf, osmotic reflection coefficients were determined from the weight changes following a sudden change in the oncotic pressure of the perfusate. The value for sigma d to albumin lay between 0.79 and 1.0, the lower value being obtained after the Kf correction. 4. The high hydraulic conductivity, combined with sieving properties comparable to those in continuous capillaries, is consistent with other data on fenestrated capillaries. 5. Finally, it was observed that, while the Kf value calculated from the initial flux rate was similar whether measured during fluid efflux from or influx into the microvasculature, on returning to the initial conditions after raising osmotic pressure, efflux was now more rapid than influx. This phenomenon is discussed in relation to readjustment of Starling forces and the possible existence of an asymmetric double membrane in the capillary, interstitium system and cells of the salivary gland. PMID:3392669

  19. Overview of Suborbital Human Transportation Concept ALPHA

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steelant, J.; Mack, A.

    2011-08-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched Phoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to their high cost, limited safety and toxicity, a low-cost, "green" and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was selected as baseline ALPHA propulsion. The general feasibility of hybrid propulsion for suborbital vehicle application with this propellant combination was already successfully demonstrated in the first reusable and privately-funded manned launch vehicle SpaceShipOne and consequently represents the solution with the lowest development risk for the investigated application. Due to the huge success of SpaceShipOne, the same type of hybrid propulsion is foreseen for Virgin Galactic's SpaceShipTwo. ALPHA vehicle guidance will preferably be fully autonomous during the entire mission flight profile. The required technology for autonomous vehicle guidance can be from the European RLV demonstrator Phoenix, which successfully demonstrated automated landing when it was dropped three times by a helicopter and landed precisely after a GPS-guided glide. This paper outlines the current status of the technology development work for ALPHA and has a special focus on aerodynamic and aerothermodynamic aspects of the concept.

  20. The residual mass in Lattice Heavy Quark Effective Theory to alpha^3 order

    E-print Network

    F. Di Renzo; L. Scorzato

    2000-12-19

    We determine to order alpha^3 in the quenched approximation the so-called residual mass in the lattice regularisation of the Heavy Quark Effective Theory. We follow a gauge-invariant strategy which exploits the fact that this mass term dominates the exponential decrease of perturbative Wilson loops at large perimeters. Our computational tool is Numerical Stochastic Perturbation Theory. The new coefficient we compute is crucial to improve the determination of the (MS bar) mass of the b-quark from lattice simulations of the Heavy Quark Effective Theory.

  1. Theory of photoemission from cesium antimonide using an alpha-semiconductor model

    NASA Astrophysics Data System (ADS)

    Jensen, Kevin L.; Jensen, Barbara L.; Montgomery, Eric J.; Feldman, Donald W.; O'Shea, Patrick G.; Moody, Nathan

    2008-08-01

    A model of photoemission from cesium antimonide (Cs3Sb) that does not rely on adjustable parameters is proposed and compared to the experimental data of Spicer [Phys. Rev. 112, 114 (1958)] and Taft and Philipp [Phys. Rev. 115, 1583 (1959)]. It relies on the following components for the evaluation of all relevant parameters: (i) a multidimensional evaluation of the escape probability from a step-function surface barrier, (ii) scattering rates determined using a recently developed alpha-semiconductor model, and (iii) evaluation of the complex refractive index using a harmonic oscillator model for the evaluation of reflectivity and extinction coefficient.

  2. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  3. ?-cluster asymptotic normalization coefficients for nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Avila, M. L.; Rogachev, G. V.; Koshchiy, E.; Baby, L. T.; Belarge, J.; Kemper, K. W.; Kuchera, A. N.; Santiago-Gonzalez, D.

    2014-10-01

    Background: Many important ?-particle induced reactions for nuclear astrophysics may only be measured using indirect techniques due to the small cross sections at the energy of interest. One such indirect technique is to determine the asymptotic normalization coefficients (ANCs) for near-threshold resonances extracted from sub-Coulomb ?-transfer reactions. This approach provides a very valuable tool for studies of astrophysically important reaction rates since the results are practically model independent. However, the validity of the method has not been directly verified. Purpose: The aim of this Rapid Communication is to verify the technique using the O16(Li6,d)Ne20 reaction as a benchmark. The Ne20 nucleus has a well-known 1- state at an excitation energy of 5.79 MeV with a width of 28 eV. Reproducing the known value with this technique is an ideal opportunity to verify the method. Method: The 1- state at 5.79 MeV is studied using the ?-transfer reaction O16(Li6,d)Ne20 at sub-Coulomb energies. Results: The partial ? width for the 1- state at excitation energy of 5.79 MeV is extracted and compared with the known value, allowing the accuracy of the method to be evaluated. Conclusions: This study demonstrates that extracting the ANCs using sub-Coulomb ?-transfer reactions is a powerful tool that can be used to determine the partial ? width of near-threshold states that may dominate astrophysically important nuclear reaction rates.

  4. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  5. Atypical antipsychotics as noncompetitive inhibitors of alpha4beta2 and alpha7 neuronal nicotinic receptors.

    PubMed

    Grinevich, Vladimir P; Papke, Roger L; Lippiello, Patrick M; Bencherif, Merouane

    2009-08-01

    It has been suggested that the interaction of antipsychotic medications with neuronal nicotinic receptors may increase the cognitive dysfunction associated with schizophrenia and may explain why current therapies only partially address this core feature of the illness. In the present studies we compared the effects of the atypical antipsychotics quetiapine, clozapine and N-desmethylclozapine to those of the typical antipsychotics haloperidol and chlorpromazine on the alpha4beta2 and alpha7 nicotinic receptor subtypes. The binding of [(3)H]-nicotine to rat cortical alpha4beta2 receptors and [(3)H]-methyllycaconitine to rat hippocampal alpha7 receptors was not affected by any of the compounds tested. However, Rb(+) efflux evoked either by nicotine or the selective alpha4beta2 agonist TC-1827 from alpha4beta2 receptors expressed in SH-EP1 cells and nicotine-evoked [(3)H]-dopamine release from rat striatal synaptosomes were non-competitively inhibited by all of the antipsychotics. Similarly, alpha-bungarotoxin-sensitive epibatidine-evoked [(3)H]-norepinephrine release from rat hippocampal slices and acetylcholine-activated currents of alpha7 nicotinic receptors expressed in oocytes were inhibited by haloperidol, chlorpromazine, clozapine and N-desmethylclozapine. The inhibitory effects on nicotinic receptor function produced by the antipsychotics tested occurred at concentrations similar to plasma levels achieved in schizophrenia patients, suggesting that they may lead to clinically relevant effects on cognition. PMID:19481556

  6. Image denoising algorithm based on the relevance of wavelet coefficients

    NASA Astrophysics Data System (ADS)

    Ha, Yan

    2009-11-01

    In this paper the wavelet transform and the wavelet transform theory have been elaborated. A wavelet coefficients' model in which individual shrinkage thresholds are selected for each coefficient has been established. The relationships between different wavelet coefficients are analyzed. According to this new model, a new algorithm of image denosing has been proposed. It is shown in the experiments that the new algorithm is more effective than traditional algorithms.

  7. On the Connection Coefficients of the Chebyshev-Boubaker Polynomials

    PubMed Central

    2013-01-01

    The Chebyshev-Boubaker polynomials are the orthogonal polynomials whose coefficient arrays are defined by ordinary Riordan arrays. Examples include the Chebyshev polynomials of the second kind and the Boubaker polynomials. We study the connection coefficients of this class of orthogonal polynomials, indicating how Riordan array techniques can lead to closed-form expressions for these connection coefficients as well as recurrence relations that define them. PMID:23990760

  8. Visualizing and Diagnosing Coefficients from Geographically Weighted Regression Models

    Microsoft Academic Search

    David C. Wheeler

    \\u000a Visualizing and interpreting regression coefficients from spatially varying coefficient models, such as geographically weighted\\u000a regression (GWR), can be challenging, given the amount of information the models provide the spatial analyst. Adding to the\\u000a visualization dilemma are various diagnostic tools for checking the coherence of the model. One such diagnostic tool is based\\u000a on decomposing the regression coefficient variance matrix to

  9. Friction coefficient measurement system for winter maintenance vehicles

    Microsoft Academic Search

    G. Erdogan; L. Alexander; R. Rajamani

    2008-01-01

    Real-time measurement of tire-road friction coefficient is extremely valuable for winter road maintenance operations. In winter maintenance, knowledge of tire-road friction coefficient can be used to optimize application of deicing and anti-icing chemicals to the roadway. In this paper, a wheel based tire-road friction coefficient measurement system is developed for snowplows. Unlike a traditional Norse meter, this system is based

  10. Solutal Partition Coefficients in Nickel-Based Superalloy PWA1480

    Microsoft Academic Search

    Surendra N. Tewari; M. Vijayakumar; James E. Lee; P. A. Curreri

    1991-01-01

    Solutal profiles in dendritic single-crystal specimens of PWA-1480 nickel-base superalloy, which were directionally solidified and quenched, were examined on several transverse cross-sections to obtain the partition coefficients. Similar to their nickel-base binaries, the partition coefficients of tantalum, titanium, and aluminum were found to be less than unity; those of tungsten and cobalt were greater than unity. The partition coefficients were

  11. DCFPAK: Dose coefficient data file package for Sandia National Laboratory

    SciTech Connect

    Eckerman, K.F.; Leggett, R.W.

    1996-07-31

    The FORTRAN-based computer package DCFPAK (Dose Coefficient File Package) has been developed to provide electronic access to the dose coefficient data files summarized in Federal Guidance Reports 11 and 12. DCFPAK also provides access to standard information regarding decay chains and assembles dose coefficients for all dosimetrically significant radioactive progeny of a specified radionuclide. DCFPAK was designed for application on a PC but, with minor modifications, may be implemented on a UNIX workstation.

  12. Microscopic formula for transport coefficients of causal hydrodynamics.

    PubMed

    Koide, T

    2007-06-01

    The Green-Kubo-Nakano formula should be modified in relativistic hydrodynamics because of the problem of acausality and the breaking of sum rules. In this Rapid Communication, we propose a formula to calculate the transport coefficients of causal hydrodynamics based on the projection operator method. As concrete examples, we derive the expressions for the diffusion coefficient, the shear viscosity coefficient, and corresponding relaxation times. PMID:17677204

  13. COMPARISON OF MODELS FOR THE ESTIMATION OF BIOLOGICAL PARTITION COEFFICIENTS

    Microsoft Academic Search

    Martin P. Payne; Lee C. Kenny

    2002-01-01

    Several models have been published for calculating blood-air, tissue-air, or tissue-blood partition coefficients of volatile organic chemicals in human or rat tissues, from functions of their octanol-water partition coefficients or solubilities in vegetable oil and water. In this work, the relative accuracy, strengths, and limitations of the various models are examined. Comparison of predicted human tissue-air and tissue-blood partition coefficients

  14. Asymptotic coefficients for one-interacting-level Voigt profiles

    NASA Astrophysics Data System (ADS)

    Cope, D.; Lovett, R. J.

    1988-02-01

    The asymptotic behavior of general Voigt profiles with general width and shift functions has been determined by Cope and Lovett (1987). The resulting asymptotic coefficients are functions of the perturber/radiator mass ratio; also, the coefficients for the one-interacting-level (OIL) profiles proposed by Ward et al. (1974) were studied. In this paper, the behavior of the OIL asymptotic coefficients for large mass ratio values is determined, thereby providing a complete picture of OIL asymptotics for all mass ratios.

  15. Weibull crack density coefficient for polydimensional stress states

    NASA Technical Reports Server (NTRS)

    Gross, Bernard; Gyekenyesi, John P.

    1989-01-01

    A structural ceramic analysis and reliability evaluation code has recently been developed encompassing volume and surface flaw induced fracture, modeled by the two-parameter Weibull probability density function. A segment of the software involves computing the Weibull polydimensional stress state crack density coefficient from uniaxial stress experimental fracture data. The relationship of the polydimensional stress coefficient to the uniaxial stress coefficient is derived for a shear-insensitive material with a random surface flaw population.

  16. Distribution coefficients of rare earth ions in cubic zirconium dioxide

    NASA Astrophysics Data System (ADS)

    Romer, H.; Luther, K.-D.; Assmus, W.

    1994-08-01

    Cubic zirconium dioxide crystals are grown with the skull melting technique. The effective distribution coefficients for Nd(exp 3+), Sm(exp 3+) and Er(sup 3+) as dopants are determined experimentally as a function of the crystal growth velocity. With the Burton-Prim-Slichter theory, the equilibrium distribution coefficients can be calculated. The distribution coefficients of all other trivalent rare earth ions can be estimated by applying the correlation towards the ionic radii.

  17. Image denoising with window shrink wavelet coefficients by adaptive threshold

    NASA Astrophysics Data System (ADS)

    Zhao, Yifan; Li, Jiuxian; Xia, Liangzheng

    2007-11-01

    We introduce an adaptive wavelet coefficients shrinkage method and apply it to image denoising. Donoho's denoising scheme which is based on thresholding the wavelet coefficients, eliminates too many wavelet coefficient without considering the image's local characteristics. In this paper we propose a new shrinkage method which can modify the magnitude of shrinkage by considering neighboring wavelet coefficients and variance of noise. So we can use more wavelet decomposition levels than other wavelet shrinkage methods to recover the noisy images. The proposed method outperforms the other methods given in literature, while its implementation and concept are both simple.

  18. Scalable computation of kinship and identity coefficients on large pedigrees.

    PubMed

    Cheng, En; Elliott, Brendan; Ozsoyoglu, Z Meral

    2008-01-01

    With the rapidly expanding field of medical genetics and genetic counseling, genealogy information is becoming increasingly abundant. An important computation on pedigree data is the calculation of identity coefficients, which provide a complete description of the degree of relatedness of a pair of individuals. The areas of application of identity coefficients are numerous and diverse, from genetic counseling to disease tracking, and thus, the computation of identity coefficients merits special attention. However, the computation of identity coefficients is not done directly, but rather as the final step after computing a set of generalized kinship coefficients. In this paper, we first propose a novel Path-Counting Formula for calculating generalized kinship coefficients, which is motivated by Wright's path-counting method for computing the inbreeding coefficient for an individual. We then present an efficient and scalable scheme for calculating generalized kinship coefficients on large pedigrees using NodeCodes, a special encoding scheme for expediting the evaluation of queries on pedigree graph structures. We also perform experiments for evaluating the efficiency of our method, and compare it with the performance of the traditional recursive algorithm for three individuals. Experimental results demonstrate that the resulting scheme is more scalable and efficient than the traditional recursive methods for computing generalized kinship coefficients. PMID:19642266

  19. Diffusion coefficient of three-dimensional Yukawa liquids

    SciTech Connect

    Dzhumagulova, K. N.; Ramazanov, T. S.; Masheeva, R. U. [IETP, Al Farabi Kazakh National University, 71, al Farabi ave., Almaty 050040 (Kazakhstan)] [IETP, Al Farabi Kazakh National University, 71, al Farabi ave., Almaty 050040 (Kazakhstan)

    2013-11-15

    The purpose of this work is an investigation of the diffusion coefficient of the dust component in complex plasma. The computer simulation of the Yukawa liquids was made on the basis of the Langevin equation, which takes into account the influence of buffer plasma on the dust particles dynamics. The Green–Kubo relation was used to calculate the diffusion coefficient. Calculations of the diffusion coefficient for a wide range of the system parameters were performed. Using obtained numerical data, we constructed the interpolation formula for the diffusion coefficient. We also show that the interpolation formula correctly describes experimental data obtained under microgravity conditions.

  20. Effect of kinetic boundary condition on the thermal transpiration coefficient

    NASA Astrophysics Data System (ADS)

    Sugimoto, Hiroshi; Amakawa, Kenjiro

    2014-12-01

    The effect of kinetic boundary condition on the free molecular thermal transpiration coefficient ? is analyzed numerically. The Maxwell model boundary condition is applied in its original form in the sense that its accommodation coefficient depends on the speed of incident molecules. The results show that the value of ? depends much on the velocity dependency of the accommodation coefficient. The experimental result, ? < 0.5, can be reproduced if the grazing molecules reflect diffusely. This makes a sharp contrast with the previous works that ? =0.5 for the velocity independent accommodation coefficient.

  1. Linear Thermal Expansion Coefficients of Higher Manganese Silicide Compounds

    NASA Astrophysics Data System (ADS)

    Allam, Ali; Boulet, Pascal; Record, Marie-Christine

    The linear thermal expansion coefficients ?L of the higher manganese silicide compounds are calculated using a combined approach involving Density-Functional Theory calculations, an empirical relation and experimental data. Since it has been reported that the linear thermal expansion coefficient and the cohesive energy are inversely proportional to each other, we calculated by DFT methods the cohesive energies of a set of selected disilicide compounds and using the corresponding experimental data for ?L we determined the coefficient of proportionality. From the empirical relation so obtained, the linear thermal expansion coefficients of the HMS in the ‘a’ and ‘c’ directions were calculated.

  2. Coefficients of convergent multiple Walsh-Paley series

    SciTech Connect

    Plotnikov, Mikhail G [Vologda State Academy of Milk Industry, Molochnoe, Vologda Region (Russian Federation)

    2012-09-30

    The paper is concerned with the behaviour of the coefficients of multiple Walsh-Paley series that are cube convergent to a finite sum. It is shown that even an everywhere convergent series of this kind may contain coefficients with numbers from a sufficiently large set that grow faster than any preassigned sequence. By Cohen's theorem, this sort of thing cannot happen for multiple trigonometric series that are cube convergent on a set of full measure - their coefficients cannot grow even exponentially. Null subsequences of coefficients are determined for multiple Walsh-Paley series that are cube convergent on a set of definite measure. Bibliography: 18 titles.

  3. {alpha}-nucleus potentials, {alpha}-decay half-lives, and shell closures for superheavy nuclei

    SciTech Connect

    Mohr, Peter [Diakoniekrankenhaus Schwaebisch Hall, D-74523 Schwaebisch Hall (Germany)

    2006-03-15

    Systematic {alpha}-nucleus folding potentials are used to analyze {alpha}-decay half-lives of superheavy nuclei. Preformation factors of about several percent are found for all nuclei under study. The systematic behavior of the preformation factors and the volume integrals of the potentials allows predictions of {alpha}-decay energies and half-lives for unknown nuclei. Shell closures can be determined from measured {alpha}-decay energies using the discontinuity of the volume integral at shell closures. For the first time a double shell closure is predicted for Z{sub magic}=132,N{sub magic}=194, and A{sub magic}=326 from the systematics of folding potentials. The calculated {alpha}-decay half-lives remain far below 1 ns for superheavy nuclei with double shell closure and masses A>300 independent of the precise knowledge of the magic proton and neutron numbers.

  4. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  5. Benchmarking the External Surrogate Ratio Method using the ({alpha},{alpha}{sup '}f) reaction at STARS

    SciTech Connect

    Lesher, S. R. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Bernstein, L. A.; Bleuel, D.; Burke, J. T.; Lyles, B. F.; Moody, K. J.; Norman, E. B. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Ai, H. [Yale University, New Haven, Connecticut 06520 (United States); Beausang, C. W. [Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); Clark, R. M.; Fallon, P.; Gibelin, J.; Lee, I. Y.; Macchiavelli, A. O.; McMahan, M. A.; Phair, L.; Rodriguez-Vieitez, E.; Wiedeking, M. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2008-04-17

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{sup '}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n,f) and {sup 235}U(n,f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha},{alpha}{sup '}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  6. The reliability and validity of the Questionnaire - Children with Difficulties (QCD)

    PubMed Central

    2013-01-01

    Background The aim of this study was to evaluate the reliability and validity of the Questionnaire-Children with Difficulties (QCD), which was developed for the evaluation of children’s daily life behaviors during specified periods of the day. Methods The subjects were 1,514 Japanese public elementary and junior high school students. For the examination of reliability, Cronbach’s alpha was calculated to assess the internal consistency of the questionnaire. With regard to validity, correlation coefficients were calculated to examine whether QCD scores correlated with those of the ADHD-Rating Scale (ADHD-RS) and the Oppositional Defiant Behavior Inventory (ODBI). Results Cronbach’s alpha coefficient for the total score of the QCD was .876. The correlation coefficients of the QCD score with ADHD-RS and ODBI scores were -.514 and -.577, respectively. Conclusions The internal consistency and validity of the QCD were demonstrated. The QCD is a reliable and valid instrument for evaluating daily life problems for children during different time periods of the day. PMID:23537143

  7. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Lee, Si-Hyung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Kim, Jae-Sung [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Protein Analysis and Design Laboratory, Division of Drug Discovery, Korea Research Institute of Bioscience and Biotechnology, Yusong P. O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  8. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R. (Lawrence Township, Mercer County, NJ); Post, Jr., Douglass E. (Belle Mead, NJ); Dawson, John M. (Pacific Palisades, CA)

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  9. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  10. Performance of an Alpha-IPEM.

    SciTech Connect

    Doyle, Barney Lee (University of Padova and INFN, Padova, Italy); McDaniel, Floyd Del (University of North Texas, Denton, TX); Rossi, Paolo; Auzelyte, Vaida (Lund Technical University, Lund, Sweden); Mellon, Michael (Quantar Technology Incorporation, Santa Cruz, CA)

    2005-07-01

    The ion photon emission microscope, or IPEM, is the first device that allows scientists to microscopically study the effects of single ions in air on semiconductors, microchips and even biological cells without having to focus the beam. Reported here is a prototype, the size of a conventional optical microscope, developed at Sandia. The alpha-IPEM, that employs alpha particles from a radioactive source, represents the first example of IBA imaging without an accelerator. The IPEM resolution is currently limited to 10 {micro}m, but we also report a gridded-phosphor approach that could improve this resolution to that of the optical microscope, or {approx} 1 {micro}m. Finally, we propose that a simple adaptation of the alpha-IPEM could be the only way to maintain the high utility of radiation effects microscopy into the future.

  11. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-08-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  12. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.

    1992-01-01

    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  13. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  14. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  15. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM)

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  16. Cosmological Attractors from $\\alpha$-Scale Supergravity

    E-print Network

    Roest, Diederik

    2015-01-01

    The Planck value of the spectral index can be interpreted as $n_s = 1 - 2/N$ in terms of the number of e-foldings $N$. An appealing explanation for this phenomenological observation is provided by $\\alpha$-attractors: the inflationary predictions of these supergravity models are fully determined by the curvature of the Kahler manifold. We provide a novel formulation of $\\alpha$-attractors which only involves a single chiral superfield. Our construction involves a natural deformation of no-scale models, and employs these to construct a De Sitter plateau with an exponential fall-off. Finally, we show how analogous structures with a flat Kahler geometry arise as a singular limit of such $\\alpha$-scale models.

  17. Deep H alpha images of interacting galaxies

    NASA Technical Reports Server (NTRS)

    Beck, S. C.; Kovo, O.

    1993-01-01

    Gravitational interactions between galaxies are believed to increase star formation activity dramatically, and most of the brightest starburst galaxies show clear signs of recent interactions. However, it is still not known how interaction triggers star formation, nor are there models to relate the type or strength of interaction to the location or amount of star formation. We report on a series of deep H alpha images of interacting and post-interaction galaxies which we took with the purpose of finding the young stars and ionized gas in these objects. We were motivated in part by the hope that by studying the very recently formed stars we could see how the interaction process had affected the star formation. We observed the galaxies through 50 A-wide filters, one on the redshifted H alpha line and one off, and a standard R filter. Depending on the galaxy and conditions, images in the B, V, and I filters were also obtained. The images were recorded with a 4x7 ft. or 17 ft. diameter CCD at the 1-meter telescope of the Wise Observatory in Mitzpe Ramon. The H alpha and continuum images are used, together with observations at other wavelengths, to put together as complete a picture as possible of star formation and interactions in each galaxy. The complete observation set is not yet available for all the galaxies but certain results are already clear. There do not seem to be any correlations between H 1 and H alpha structures. In some H 1 plume galaxies H alpha extensions were seen on the other side of the galaxy from the H 1; in others extensive H alpha filaments have been found but not H 1. The preliminary results agree with the simplest model that interaction-induced star formation will be concentrated in the system center, since that is where the mass ends up.

  18. Optimization of the performance of a thermophilic biotrickling filter for alpha-pinene removal from polluted air.

    PubMed

    Montes, M; Veiga, M C; Kennes, C

    2014-01-01

    Biodegradation of alpha-pinene was investigated in a biological thermophilic trickling filter, using a lava rock and polymer beads mixture as packing material. Partition coefficient (PC) between alpha-pinene and the polymeric material (Hytrel G3548 L) was measured at 50 degrees C. PCs of 57 and 846 were obtained between the polymer and either the water or the gas phase, respectively. BTF experiments were conducted under continuous load feeding. The effect of yeast extract (YE) addition in the recirculating nutrient medium was evaluated. There was a positive relationship between alpha-pinene biodegradation, CO2 production and YE addition. A maximum elimination capacity (ECmax) of 98.9 g m(-3) h(-1) was obtained for an alpha-pinene loading rate of about 121 g m(-3) h(-1) in the presence of 1 g L(-1) YE. The ECmax was reduced by half in the absence of YE. It was also found that a decrease in the liquid flow rate enhances alpha-pinene biodegradation by increasing the ECmax up to 103 gm(-3) h(-1) with a removal efficiency close to 90%. The impact of short-term shock-loads (6 h) was tested under different process conditions. Increasing the pollutant load either 10- or 20-fold resulted in a sudden drop in the BTF's removal capacity, although this effect was attenuated in the presence of YE. PMID:25145201

  19. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein-protein interactions. Deletion of the PLZF POZ domain partially abrogated the inhibitory effect of PLZF-RAR alpha on RA-induced differentiation and on RA-mediated type II TGase up-regulation, suggesting that POZ-mediated protein interactions might be responsible for the inhibitory transcriptional activities of PLZF-RAR alpha. PMID:9234742

  20. Interdiffusion in Ni-rich, Ni-Cr-Al alloys at 1100 and 1200 C. I - Diffusion paths and microstructures. II - Diffusion coefficients and predicted concentration profiles

    NASA Technical Reports Server (NTRS)

    Nesbitt, J. A.; Heckel, R. W.

    1987-01-01

    Interdiffusion in Ni-rich Ni-Cr-Al alloys is investigated experimentally after annealing at 1100 and 1200 C using gamma/gamma, gamma/gamma+beta, gamma/gamma+gamma prime, and gamma/gamma+alpha diffusion couples. The amount and location of Kirkendall porosity suggests that Al diffuses more rapidly than Cr which diffuses more rapidly than Ni in the gamma phase of Ni-Cr-Al alloys. The location and extent of maxima and minima in the concentration profiles of the diffusion couples indicate that both cross-term diffusion coefficients are positive. Measurements are also presented of the ternary interdiffusion coefficients of the gamma phase in the Ni-Cr-Al system. It is shown that the interdiffusion coefficients can be accurately predicted by using a ternary finite-difference interdiffusion model.

  1. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  2. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Bounds, John A. (Los Alamos, NM)

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  3. Monitoring airborne alpha-emitter contamination

    SciTech Connect

    Kerr, P.L.; Koster, J.E.; Conaway, J.G.; Bounds, J.A.; Whitley, C.W. [Los Alamos National Lab., NM (United States); Steadman, P.A. [National Center for Genome Resources, Santa Fe, NM (United States)

    1998-02-01

    Facilities that may produce airborne alpha emitter contamination require a continuous air monitoring (CAM) system. However, these traditional CAMs have difficulty in environments with large quantities of non-radioactive particulates such as dust and salt. Los Alamos has developed an airborne plutonium sensor (APS) for the REBOUND experiment at the Nevada Test Site which detects alpha contamination directly in the air, and so is less vulnerable to the problems associated with counting activity on a filter. In addition, radon compensation is built into the detector by the use of two measurement chambers.

  4. Radiological hazards of alpha-contaminated waste

    SciTech Connect

    Rodgers, J.C.

    1982-01-01

    The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

  5. Lyman Alpha Searches at Redshift Z>7

    NASA Astrophysics Data System (ADS)

    Willis, Jon

    2007-05-01

    The ZEN survey is a narrow J-band survey for Ly-alpha emitting galaxies at z > 7. I will briefly review the pros and cons of narrow band observations before summarising the ZEN1 and ZEN2 searches based upon deep ISAAC pointings. I will then present ZEN3, consisting of wide field, narrow band observations of two fields using the CFHT WIRCam facility. I will conclude by reviewing the current sample of candidates and what we have learned about the z > 7 Ly-alpha emitting population.

  6. Green Pea Galaxies Reveal Secrets of Ly$\\alpha$ Escape

    E-print Network

    Yang, Huan; Gronke, Max; Rhoads, James E; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark

    2015-01-01

    Star-formation in galaxies generates a lot of Ly$\\alpha$ photons. Understanding the escape of Ly$\\alpha$ photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Ly$\\alpha$. To understand Ly$\\alpha$ escape, it is valuable to study analogs of high redshift Ly$\\alpha$ emitters in nearby universe. However, most nearby analogs have too small a Ly$\\alpha$ equivalent width and escape fraction compared to high redshift Ly$\\alpha$ emitters. One different group of nearby analogs are "Green Pea" galaxies, selected by their high equivalent width optical emission lines. Here we show that Green Pea galaxies have strong Ly$\\alpha$ emission lines and high Ly$\\alpha$ escape fraction (see also Henry et al. 2015), providing an opportunity to solve Ly$\\alpha$ escape problem. Green Peas have a Ly$\\alpha$ equivalent width distribution similar to high redshift Ly$\\alpha$ emitters. The Ly$\\alpha$ escape fraction correlates with many quantities of Ly$\\alpha$ profile, especially the...

  7. Personal dose equivalent conversion coefficients for neutron fluence over the energy range of 20 to 250 MeV

    SciTech Connect

    Mclean, Thomas D [Los Alamos National Laboratory; Justus, Alan L [Los Alamos National Laboratory; Gadd, S Milan [Los Alamos National Laboratory; Olsher, Richard H [RP-2; Devine, Robert T [RP-2

    2009-01-01

    Monte Carlo simulations were performed to extend existing neutron personal dose equivalent fluence-to-dose conversion coefficients to an energy of 250 MeV. Presently, conversion coefficients, H(p,slab)(10,alpha)/Phi, are given by ICRP-74 and ICRU-57 for a range of angles of radiation incidence (alpha = 0, 15, 30, 45, 60 and 75 degrees ) in the energy range from thermal to 20 MeV. Standard practice has been to base operational dose quantity calculations <20 MeV on the kerma approximation, which assumes that charged particle secondaries are locally deposited, or at least that charged particle equilibrium exists within the tally cell volume. However, with increasing neutron energy the kerma approximation may no longer be valid for some energetic secondaries such as protons. The Los Alamos Monte Carlo radiation transport code MCNPX was used for all absorbed dose calculations. Transport models and collision-based energy deposition tallies were used for neutron energies >20 MeV. Both light and heavy ions (HIs) (carbon, nitrogen and oxygen recoil nuclei) were transported down to a lower energy limit (1 keV for light ions and 5 MeV for HIs). Track energy below the limit was assumed to be locally deposited. For neutron tracks <20 MeV, kerma factors were used to obtain absorbed dose. Results are presented for a discrete set of angles of incidence on an ICRU tissue slab phantom.

  8. Transmission coefficient for ballistic transport through quantum resonator

    E-print Network

    Transmission coefficient for ballistic transport through quantum resonator V.A.Geyler 1 , I for the description of ballistic transport in 1D­2D­1D system based on the theory of self­adjoint extensions relation between conductivity and transmission coefficient for ballistic channels forming the system

  9. Biases and Standard Errors of Standardized Regression Coefficients

    ERIC Educational Resources Information Center

    Yuan, Ke-Hai; Chan, Wai

    2011-01-01

    The paper obtains consistent standard errors (SE) and biases of order O(1/n) for the sample standardized regression coefficients with both random and given predictors. Analytical results indicate that the formulas for SEs given in popular text books are consistent only when the population value of the regression coefficient is zero. The sample…

  10. SCALABLE COMPUTATION OF KINSHIP AND IDENTITY COEFFICIENTS ON LARGE PEDIGREES

    Microsoft Academic Search

    En Cheng; Brendan Elliott; Z. Meral Ozsoyoglu

    With the rapidly expanding field of medical genetics and genetic counseling, genealogy information is becoming increasingly abundant. An important computation on pedigree data is the calculation of identity coefficients, which provide a complete description of the degree of relatedness of a pair of individuals. The areas of application of identity coefficients are numerous and diverse, from genetic counseling to disease

  11. Air-sea bulk transfer coefficients in diabatic conditions

    Microsoft Academic Search

    Junsei Kondo

    1975-01-01

    On the basis of recent data for the roughness Reynolds number of the sea surface, and using the Owen-Thomson theory on the transfers of heat and mass between a rough surface and the flow above it, the bulk transfer coefficients of the sea surface have been estimated. For a reference height of 10 m, the neutral-lapse transfer coefficient for water

  12. Texture Characterization via Joint Statistics of Wavelet Coefficient Magnitudes

    Microsoft Academic Search

    Eero P. Simoncelli; Javier Portilla

    1998-01-01

    We present a parametric statistical characterization of texture images in the context of an overcomplete complex wavelet frame. The characterization consists of the local autocorrelation of the coefficients in each subband, the lo- cal autocorrelation of the cofficent magnitudes, and the cross- correlation of coefficient magnitudes at all orientations and adjacent spatial scales. We develop an efficient algorithm for sampling

  13. Aerosol Growth and the Condensation Coefficient for Water: A Review

    Microsoft Academic Search

    Michael Mozurkewich

    1986-01-01

    The transfer of gas phase species to aerosols depends critically on the condensation (or sticking) coefficient. Reported values for water on water vary from 0.03 to 1. Theoretical arguments indicate that the condensation coefficient should be near unity for polar species on an aqueous surface. As long as heat transfer is properly accounted for, measurements on bulk water support this

  14. Crop Coefficients of Some Selected Crops of Andhra Pradesh

    NASA Astrophysics Data System (ADS)

    Reddy, K. Chandrasekhar; Arunajyothy, S.; Mallikarjuna, P.

    2015-06-01

    Precise information on crop coefficients for estimating crop evapotranspiration (ETc) for regional scale irrigation planning is a major impediment in many regions. Crop coefficients suggested based on lysimeter data by earlier investigators have to be locally calibrated to account for the differences in the crop canopy under given climatic conditions. In the present study crop coefficients were derived based on reference crop evapotranspiration (ET0) estimated from Penman-Monteith equation and lysimeter measured ETc for groundnut, paddy, tobacco, sugarcane and castor crops at Tirupati, Nellore, Rajahmundry, Anakapalli and Rajendranagar centers of Andhra Pradesh respectively. Crop coefficients derived were compared with those recommended by FAO-56. The mean crop coefficients at different stages of growth were significantly different from those of FAO-56 curve though a similar trend was observed. A third order polynomial crop coefficient model has therefore been developed as a function of time (days after sowing the crop) for deriving suitable crop coefficients. The crop coefficient models suggested may be adopted to estimate crop evapotranspiration in the study area with reasonable degree of accuracy.

  15. Upscaling matrix diffusion coefficients for heterogeneous fractured rocks

    Microsoft Academic Search

    Zhenxue Dai; Andrew Wolfsberg; Zhiming Lu; Paul Reimus

    2007-01-01

    The scale dependence of the matrix diffusion coefficient (Dm) for fractured media has been observed at variable scales from column experiments to field tracer tests. In this paper, we derive an effective Dm for multimodal heterogeneous fractured rocks using characteristic distributions of matrix properties and volume averaging of the mass transfer coefficient. The effective field-scale Dm is dependent on the

  16. REE and Strontium Partition Coefficients for Nakhla Pyroxenes

    NASA Technical Reports Server (NTRS)

    Oe, K.; McKay, G.; Le, L.

    2001-01-01

    We present new partition coefficients for REE and Sr determined using a synthetic melt that crystallizes pyroxenes very similar in composition to Nakhla pyroxene cores. We believe these are the most appropriate partition coefficients to use in studying Nakhla Additional information is contained in the original extended abstract..

  17. Effect of friction coefficient on Akers clasp retention

    Microsoft Academic Search

    Yuuji Sato; Yasuhiko Abe; Yoshitaka Yuasa; Yasumasa Akagawa

    1997-01-01

    Statement of problem. Retentive force control of clasp retainers is one of the most essential factors for the successful function of removable partial dentures. However, it is not yet known how the friction coefficients differ among restored abutments and clasp materials, and how the friction coefficients affect the retention of clasps.Purpose. The purposes of this study were to clarify the

  18. Factors That Attenuate the Correlation Coefficient and Its Analogs.

    ERIC Educational Resources Information Center

    Dolenz, Beverly

    The correlation coefficient is an integral part of many other statistical techniques (analysis of variance, t-tests, etc.), since all analytic methods are actually correlational (G. V. Glass and K. D. Hopkins, 1984). The correlation coefficient is a statistical summary that represents the degree and direction of relationship between two variables.…

  19. Soft Fault Diagnosis of Analog Circuit Using Transfer Function Coefficients

    Microsoft Academic Search

    A. Kavithamani; V. Manikandan; N. Devarajan

    2011-01-01

    A method to identify parametric faults occurring in analog circuits is proposed in this paper. This method uses transfer function coefficients to identify faults in analog circuits as these coefficients are sensitive to the parameters of the circuit. Using Monte Carlo simulation each parameter of the circuit is varied within its tolerance limit and the minimum and maximum values of

  20. Multiple Objective Linear Programming with Parametric Criteria Coefficients

    Microsoft Academic Search

    Harold P. Benson

    1985-01-01

    In this paper we study the multiple objective linear programming problem with parametric criteria coefficients. This problem is of interest since in many situations the coefficients of the objective functions of a multiple objective linear program either represent estimates of the true data or are subject to systematic variations. Properties of this problem are developed, and an algorithm for generating

  1. Loss coefficient correlation for wet-cooling tower fills

    Microsoft Academic Search

    Johannes C. Kloppers; Detlev G. Kröger

    2003-01-01

    Loss coefficient correlations given in the literature for wet-cooling tower fills are relatively simple and generally do not represent the pressure drop accurately over a wide range of operational conditions. A new form of empirical equation is proposed that correlates fill loss coefficient data more effectively when compared to other forms of empirical equations commonly found in the literature.

  2. The effective magnetoelectric coefficients of polycrystalline multiferroic composites

    E-print Network

    Li, Jiangyu

    , including BiFeO3 [6] and YMnO3 [7]. Use of these so-called multiferroic materi- als, which possess twoThe effective magnetoelectric coefficients of polycrystalline multiferroic composites Shashidhar to calculate the macroscopic magne- toelectric (ME) coefficients of polycrystalline multiferroic composites

  3. Study on vibration viscosity coefficient and rheology behavior of concrete

    Microsoft Academic Search

    Yunfeng Li; Xueliang Wang

    2011-01-01

    Developing the research of the construction rheology of cement concrete is the key technology for concrete design and construction. Vibration Viscosity Coefficiens of freshly mixed concrete in different mixing ratio are measured in this paper. The correlation curve of concrete slump and vibration structure viscosity coefficients is obtained. Reasonable values of vibration viscosity coefficients will be selected to meet the

  4. Precision of diffusion coefficients by the isotope exchange technique

    Microsoft Academic Search

    Masao Nanba; Y. Oishi; Ken Ando

    1981-01-01

    The precision of diffusion coefficients determined by the gas–solid isotope exchange technique was analyzed for planar sheet diffusion, rate controlled by the isotope exhange reaction. An objective function was employed to estimate the degree of fit of a theoretical calculation to the experimental diffusion profile as a function of the sample size (l), the diffusion coefficient (D), the surface exchange

  5. Measurement of friction coefficients with the atomic force microscope

    E-print Network

    Attard, Phil

    Measurement of friction coefficients with the atomic force microscope Phil Attard1, Johanna axial method for measuring the friction coefficient with the atomic force microscope is given measurement by measuring the difference between the constant compliance slopes of the extend and retract force

  6. VISCOSITY SOLUTIONS OF HAMILTONJACOBI EQUATIONS WITH DISCONTINUOUS COEFFICIENTS

    E-print Network

    VISCOSITY SOLUTIONS OF HAMILTON­JACOBI EQUATIONS WITH DISCONTINUOUS COEFFICIENTS GIUSEPPE MARIA of viscosity solution to the Cauchy problem, and that the front tracking algorithm yields an L contractive semigroup. We define a viscosity solution by treating the discontinuities in the coefficients analogously

  7. Diffusion coefficient measurements of transparent liquid solutions using Moiré deflectometry

    Microsoft Academic Search

    Kazem Jamshidi-Ghaleh; Mohammad Taghi Tavassoly; Nastaran Mansour

    2004-01-01

    In this study the Moiré deflectometry technique is applied to the investigation of diffusion dynamics in transparent liquid mixtures. We describe the experimental details and present theoretical analysis for obtaining the magnitude of diffusion coefficient using the Moiré fringe patterns. The theoretical aspects of the method are presented and the relationship between the Moiré fringes shift and the diffusion coefficient

  8. On the coefficients of differentiated expansions of ultraspherical polynomials

    NASA Technical Reports Server (NTRS)

    Karageorghis, Andreas; Phillips, Timothy N.

    1989-01-01

    A formula expressing the coefficients of an expression of ultraspherical polynomials which has been differentiated an arbitrary number of times in terms of the coefficients of the original expansion is proved. The particular examples of Chebyshev and Legendre polynomials are considered.

  9. Concerning the calculation of the eddy viscosity coefficient

    Microsoft Academic Search

    V. T. Movchan

    1980-01-01

    A semiempirical formula is proposed for calculating the eddy viscosity coefficient in the presence of an arbitrary pressure gradient. The computed values of the eddy viscosity coefficient for flows over flat plates and for high-pressure pipe flows are found to be in satisfactory agreement with the experiment. The applicability of the formula to wall boundary-layer flows is examined.

  10. Determination of epithelial tissue scattering coefficient using confocal microscopy

    Microsoft Academic Search

    Tom Collier; Dizem Arifler; Anais Malpica; Michele Follen; Rebecca Richards-Kortum

    2003-01-01

    Most models of light propagation through tissue assume the scattering properties of the various tissue layers are the same. The authors present evidence that the scattering coefficient of normal cervical epithelium is significantly lower than values previously reported for bulk epithelial tissue. They estimated the scattering coefficient of normal and precancerous cervical epithelium using measurements of the reflectance as a

  11. Young modulus dependence of nanoscopic friction coefficient in hard coatings

    E-print Network

    Brune, Harald

    Young modulus dependence of nanoscopic friction coefficient in hard coatings Elisa Riedoa, it is intuitive that a more compliant material, into which the AFM tip is likely to penetrate deeper, yields in industry as hard coatings.2,11 We demonstrate that the variations of the fric- tion coefficient in Cr

  12. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  13. Infinite dilution activity coefficients in chemical, environmental and biochemical engineering

    Microsoft Academic Search

    S. I. Sandler

    1996-01-01

    Here we briefly review several methods by which infinite dilution activity coefficients can be obtained, and then consider how such data can be used. In particular, we examine the accuracy of predictions of vapor-liquid equilibria over the complete concentration range, and over a range of temperatures based on infinite dilution activity coefficient data at a single temperature. Next, we review

  14. A Class of Repeated Measures Concordance Correlation Coefficients

    Microsoft Academic Search

    Tonya S. King; Vernon M. Chinchilli; Kai-Ling Wang; Josep L. Carrasco

    2007-01-01

    The repeated measures concordance correlation coefficient was proposed for measuring agreement between two raters or two methods of measuring a response in the presence of repeated measurements (King et al., 2007). This paper proposes a class of repeated measures concordance correlation coefficients that are appropriate for both continuous and categorical data. We illustrate the methodology with examples comparing (1) 1-hour

  15. On measurement of thermal diffusion coefficients in multicomponent mixtures

    E-print Network

    Firoozabadi, Abbas

    for measuring thermal diffusion coefficients analogous to the existing equations for a binary mixture for the thermal diffusion coefficient of binary liquids in a thermogravitational column is from the work of Furry parameter positive thermal diffusion ratio in a binary and one for the negative parameter. In this work

  16. Binary Diffusion Coefficients for Aqueous Solutions of Lactic Acid

    Microsoft Academic Search

    Ana C. F. Ribeiro; Victor M. M. Lobo; Derek G. Leaist; Joaquim J. S. Natividade; Luís P. Veríssimo; Marisa C. F. Barros; Ana M. T. D. P. V. Cabral

    2005-01-01

    Taylor dispersion equipment installed at the University of Coimbra for the measurement of diffusion in liquids has been tested to ensure adequate accuracy and precision by measuring mutual diffusion coefficients for binary aqueous solutions of sucrose, glycine, lithium chloride, potassium chloride, and hydrochloric acid at 298.15 K. In addition, binary mutual diffusion coefficients for aqueous solutions of lactic acid (not

  17. Low-sampling-rate Kramers-Moyal coefficients

    NASA Astrophysics Data System (ADS)

    Anteneodo, C.; Queirós, S. M. Duarte

    2010-10-01

    We analyze the impact of the sampling interval on the estimation of Kramers-Moyal coefficients. We obtain the finite-time expressions of these coefficients for several standard processes. We also analyze extreme situations such as the independence and no-fluctuation limits that constitute useful references. Our results aim at aiding the proper extraction of information in data-driven analysis.

  18. ESTIMATING DISSOLVED ORGANIC CARBON PARTITION COEFFICIENTS FOR NONIONIC ORGANIC CHEMICALS

    EPA Science Inventory

    A literature search was performed for dissolved organic carbon/water partition coefficients for nonionic chemicals (Kdoc) and Kdoc data was taken from more than sixty references. The Kdoc data were evaluated as a function of the n-octanol/water partition coefficients (Kow). A pre...

  19. Second Virial Coefficients and the Forces Between Complex Molecules

    Microsoft Academic Search

    J. O. Hirschfelder; F. T. McClure

    1942-01-01

    The second virial coefficients of ethane, propane, n-butane, n-heptane, ammonia, methyl chloride, and the freons are computed from available experimental data. The causes for sizeable errors in second virial coefficients are considered. At temperatures above the critical, the second virial agrees with the theorem of corresponding states. Below the critical temperature, molecules with dipoles have unusually large virials and the

  20. Drag Coefficient, Dynamic Roughness and Reference Wind Speed

    Microsoft Academic Search

    Paul A. Hwang

    2005-01-01

    Surface waves are the roughness element of the ocean surface. The parameterization of the drag coefficient of the ocean surface is simplified by referencing to wind speed at an elevation proportional to the characteristic wavelength. The dynamic roughness is analytically related to the drag coefficient. Under the assumption of fetch limited wave growth condition, various empirical functions of the dynamic