Sample records for cronbach alpha coefficient

  1. The Impact of Outliers on Cronbach's Coefficient Alpha Estimate of Reliability: Ordinal/Rating Scale Item Responses

    ERIC Educational Resources Information Center

    Liu, Yan; Wu, Amery D.; Zumbo, Bruno D.

    2010-01-01

    In a recent Monte Carlo simulation study, Liu and Zumbo showed that outliers can severely inflate the estimates of Cronbach's coefficient alpha for continuous item response data--visual analogue response format. Little, however, is known about the effect of outliers for ordinal item response data--also commonly referred to as Likert, Likert-type,…

  2. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  3. On the Distribution of the Maximum Likelihood Estimator of Cronbach's Alpha.

    ERIC Educational Resources Information Center

    van Zyl, J. M.; Neudecker, H.; Nel, D. G.

    2000-01-01

    Derives the asymptotic normal distribution of the maximum likelihood estimator of Cronbach's alpha (under normality) for the case when no assumptions are made about the covariances among items. Also considers the asymptotic distribution for the special case of compound symmetry and when compared to the exact distribution. (Author/SLD)

  4. Cronbach's [Alpha], Revelle's [Beta], and McDonald's [Omega][sub H]: Their Relations with Each Other and Two Alternative Conceptualizations of Reliability

    ERIC Educational Resources Information Center

    Zinbarg, Richard E.; Revelle, William; Yovel, Iftah; Li, Wen

    2005-01-01

    We make theoretical comparisons among five coefficients--Cronbach's [alpha], Revelle's [beta], McDonald's [omega][sub h], and two alternative conceptualizations of reliability. Though many end users and psychometricians alike may not distinguish among these five coefficients, we demonstrate formally their nonequivalence. Specifically, whereas…

  5. Treating Cronbach's Alpha Reliability Coefficients as Data in Counseling Research

    ERIC Educational Resources Information Center

    Helms, Janet E.; Henze, Kevin T.; Sass, Terry L.; Mifsud, Venus A.

    2006-01-01

    Scientific associations and measurement experts in psychology and education have voiced various standards and best-practice recommendations concerning reliability data over the years. Yet in the counseling psychology literature, there is virtually no single-source compilation and articulation of good practices for reporting, analyzing, and…

  6. A Direct Latent Variable Modeling Based Method for Point and Interval Estimation of Coefficient Alpha

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A direct approach to point and interval estimation of Cronbach's coefficient alpha for multiple component measuring instruments is outlined. The procedure is based on a latent variable modeling application with widely circulated software. As a by-product, using sample data the method permits ascertaining whether the population discrepancy…

  7. Coefficient Alpha: A Reliability Coefficient for the 21st Century?

    ERIC Educational Resources Information Center

    Yang, Yanyun; Green, Samuel B.

    2011-01-01

    Coefficient alpha is almost universally applied to assess reliability of scales in psychology. We argue that researchers should consider alternatives to coefficient alpha. Our preference is for structural equation modeling (SEM) estimates of reliability because they are informative and allow for an empirical evaluation of the assumptions…

  8. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  9. Bayesian Statistical Inference for Coefficient Alpha. ACT Research Report Series.

    ERIC Educational Resources Information Center

    Li, Jun Corser; Woodruff, David J.

    Coefficient alpha is a simple and very useful index of test reliability that is widely used in educational and psychological measurement. Classical statistical inference for coefficient alpha is well developed. This paper presents two methods for Bayesian statistical inference for a single sample alpha coefficient. An approximate analytic method…

  10. Varying Coefficient Meta-Analytic Methods for Alpha Reliability

    ERIC Educational Resources Information Center

    Bonett, Douglas G.

    2010-01-01

    The conventional fixed-effects (FE) and random-effects (RE) confidence intervals that are used to assess the average alpha reliability across multiple studies have serious limitations. The FE method, which is based on a constant coefficient model, assumes equal reliability coefficients across studies and breaks down under minor violations of this…

  11. The number of nonzero binomial coefficients modulo p^alpha

    E-print Network

    Rowland, Eric S

    2010-01-01

    In 1947 Fine obtained an expression for the number a_p(n) of binomial coefficients on row n of Pascal's triangle that are nonzero modulo p. One can set up a recurrence for the number of integers 0 s theorem renders this recurrence as a generalization of Fine's theorem, giving a way to compute the number a_{p^alpha}(n) of nonzero binomial coefficients modulo p^alpha. From the recurrence we obtain an expression for a_{p^alpha}(n) in terms of the number of occurrences of various words in the base-p representation of n.

  12. Matching coefficients for alpha_s and m_b to O(alpha_s^2) in the MSSM

    E-print Network

    A. Bauer; L. Mihaila; J. Salomon

    2009-02-09

    We compute the exact two-loop matching coefficients for the strong coupling constant alpha_s and the bottom-quark mass m_b within the Minimal Supersymmetric Standard Model (MSSM), taking into account O(alpha_s^2) contributions from Supersymmetric Quantum Chromodynamics (SQCD). We find that the explicit mass pattern of the supersymmetric particles has a significant impact on the predictions of alpha_s and m_b at high energies. Further on, the three-loop corrections exceed the uncertainty due to the current experimental accuracy. In case of the the running bottom-quark mass, they can reach in the large tan(beta) regime up to 30% of the tree-level value.

  13. Improving Construct Validity: Cronbach, Meehl, and Neurath's Ship--Comment

    ERIC Educational Resources Information Center

    Westen, Drew; Rosenthal, Robert

    2005-01-01

    Smith's article "On Construct Validity: Issues of Method and Measurement" is a fine tribute to L. J. Cronbach and P. E. Meehl (1955) that clarifies the current state and future directions in the understanding of construct validity. Construct validity is a dynamic process, and fit indices need to be used at the service of understanding, not in…

  14. Enthalpic homogeneous pair interaction coefficients of L-alpha-amino acids as a hydrophobicity parameter of amino acid side chains.

    PubMed

    Palecz, Bartlomiej

    2002-05-29

    Enthalpies of dilution of aqueous solutions of L-alpha-cysteine, L-alpha-histidine, L-alpha-asparagine, L-alpha-glutamine, L-alpha-arginine, L-alpha-tryptophan, and L-alpha-glutamic acid in water at a temperature of 298.15 K have been measured. The values of dilution enthaply were used to determine enthalpic homogeneous pair interaction coefficients which characterize the interactions between zwitterions of the examined L-alpha-amino acids in water. Approachable literature data of hydrophobic scales have been analyzed to obtain average values. The obtained values of enthalpic pair interaction coefficients have been put together with an average hydrophobic scale. PMID:12022833

  15. Elastic, anelastic, and piezoelectric coefficients of alpha-quartz determined by resonance ultrasound spectroscopy

    Microsoft Academic Search

    Hirotsugu Ogi; Toshinobu Ohmori; Nobutomo Nakamura; Masahiko Hirao

    2006-01-01

    All independent components of the elastic constants, internal friction, and piezoelectric coefficients of synthetic alpha-quartz have been simultaneously determined by resonance ultrasound spectroscopy coupled with laser-Doppler interferometry. Seventeen crystals obtained from Z and X regions with various infrared-absorption values were used; for each crystal, a complete set of the coefficients was determined using 72 resonance frequencies, which were measured by

  16. SIMREL: Software for Coefficient Alpha and Its Confidence Intervals with Monte Carlo Studies

    ERIC Educational Resources Information Center

    Yurdugul, Halil

    2009-01-01

    This article describes SIMREL, a software program designed for the simulation of alpha coefficients and the estimation of its confidence intervals. SIMREL runs on two alternatives. In the first one, if SIMREL is run for a single data file, it performs descriptive statistics, principal components analysis, and variance analysis of the item scores…

  17. An Empirical Comparison of Several Interval Estimation Procedures for Coefficient Alpha

    ERIC Educational Resources Information Center

    Pandey, Tej N.; Hubert, Lawrence

    1975-01-01

    Use of Tukey's Jackknife in establishing a confidence interval around the population coefficient alpha is explored and the robustness of Feldt's procedure along with ten variants of the Jackknife when the data do not conform to the necessary normality requirements are evaluated. Only two of the variants compared to Feldt's approach. (RC)

  18. ScoreRel CI: An Excel Program for Computing Confidence Intervals for Commonly Used Score Reliability Coefficients

    ERIC Educational Resources Information Center

    Barnette, J. Jackson

    2005-01-01

    An Excel program developed to assist researchers in the determination and presentation of confidence intervals around commonly used score reliability coefficients is described. The software includes programs to determine confidence intervals for Cronbachs alpha, Pearson r-based coefficients such as those used in test-retest and alternate forms…

  19. Sensitivity coefficients to $\\\\alpha$-variation for fine-structure transitions in Carbon-like ions

    Microsoft Academic Search

    M. G. Kozlov; I. I. Tupitsyn; D. Reimers

    2008-01-01

    We calculate sensitivity coefficients to $\\\\alpha$-variation for the fine-structure transitions (1,0) and (2,1) within $^3P_J[2s^2 2p^2]$ multiplet of the Carbon-like ions C I, N II, O III, Na VI, Mg VII, and Si IX. These transitions lie in the far infrared region and are in principle observable in astrophysics for high redshifts z~10. This makes them very promising candidates for

  20. Sensitivity coefficients to $\\alpha$-variation for fine-structure transitions in Carbon-like ions

    E-print Network

    Kozlov, M G; Reimers, D

    2008-01-01

    We calculate sensitivity coefficients to $\\alpha$-variation for the fine-structure transitions (1,0) and (2,1) within $^3P_J[2s^2 2p^2]$ multiplet of the Carbon-like ions C I, N II, O III, Na VI, Mg VII, and Si IX. These transitions lie in the far infrared region and are in principle observable in astrophysics for high redshifts z~10. This makes them very promising candidates for the search for possible $\\alpha$-variation on a cosmological timescale. In such studies one of the most dangerous sources of systematic errors is associated with isotope shifts. We calculate isotope shifts with the help of relativistic mass shift operator and show that it may be significant for C I, but rapidly decreases along the isoelectronic sequence and becomes very small for Mg VII and Si IX.

  1. Magnetoconvection and dynamo coefficients III: alpha-effect and magnetic pumping in the rapid rotation regime

    E-print Network

    P. J. Käpylä; M. J. Korpi; M. Ossendrijver; M. Stix

    2006-05-10

    Aims. The alpha- and gamma-effects, which are responsible for the generation and turbulent pumping of large scale magnetic fields, respectively, due to passive advection by convection are determined in the rapid rotation regime corresponding to the deep layers of the solar convection zone. Methods. A 3D rectangular local model is used for solving the full set of MHD equations in order to compute the electromotive force (emf), E = , generated by the interaction of imposed weak gradient-free magnetic fields and turbulent convection with varying rotational influence and latitude. By expanding the emf in terms of the mean magnetic field, E_i = a_ij , all nine components of a_ij are computed. The diagonal elements of a_ij describe the alpha-effect, whereas the off-diagonals represent magnetic pumping. The latter is essentially the advection of magnetic fields by means other than the underlying large-scale velocity field. Comparisons are made to analytical expressions of the coefficients derived under the first-order smoothing approximation (FOSA). Results. In the rapid rotation regime the latitudinal dependence of the alpha-components responsible for the generation of the azimuthal and radial fields does not exhibit a peak at the poles, as is the case for slow rotation, but at a latitude of about 30 degrees. The magnetic pumping is predominantly radially down- and latitudinally equatorward as in earlier studies. The numerical results compare surprisingly well with analytical expressions derived under first-order smoothing, although the present calculations are expected to lie near the limits of the validity range of FOSA.

  2. Study of the absorption coefficient of alpha particles to lower hybrid waves in tokamak

    SciTech Connect

    Wang, Jianbing, E-mail: zhangxm@ecust.edu.cn; Zhang, Xianmei, E-mail: zhangxm@ecust.edu.cn; Yu, Limin, E-mail: zhangxm@ecust.edu.cn; Zhao, Xiang, E-mail: zhangxm@ecust.edu.cn [Department of Physics, East China University of Science and Technology, P.O. Box 385, Shanghai 200237 (China)

    2014-02-12

    Part of the energy of the Lower Hybrid (LH) waves may be absorbed by the ? particles via the so-called perpendicular landau damping mechanism, which depends on various parameters of fusion reactors and the LH waves. In this article, we calculate the absorption coefficient ?{sub ?} of LH waves due to ? particles. Results show that, the ?{sub ?} increases with the parallel refraction index n{sub ?} while deceases with increasing the frequency of LH waves ?{sub LH} over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption, and there is a peak value of ?{sub ?} when n{sub e}?8×10{sup 19}m{sup ?3} for ITER-like scenario. The thermal corrections to the cold plasma dispersion relation will change the damping rate to a certain extent under some specific conditions. We have also evaluated the fraction of LH power absorbed by the alpha particles, ? ? 0.47% and 4.1% for an LH frequency of 5 GHz and 3.7 GHz respectively for ITER-like scenario. This work gives the effective reference for the choice of parameters of future fusion reactors.

  3. A Comparison of Interval Estimation of Coefficient Alpha Using the Feldt and the Jackknife Procedures.

    ERIC Educational Resources Information Center

    Pandey, Tej N.; Hubert, Lawrence J.

    This investigation had two major purposes. The first was to explore the use of an inferential technique called Tukey's Jackknife in establishing a confidence interval about cooefficient alpha reliability. The second purpose was to study the robustness of the Feldt and the jackknife procedures when the data fails to satisfy usual normality…

  4. Influence of plasma parameters on the absorption coefficient of alpha particles to lower hybrid waves in tokamaks

    SciTech Connect

    Wang, J.; Zhang, X., E-mail: zhangxm@ecust.edu.cn; Yu, L.; Zhao, X. [East China University of Science and Technology, Department of Physics (China)

    2014-12-15

    In tokamaks, fusion generated ? particles may absorb lower hybrid (LH) wave energy, thus reducing the LH current drive efficiency. The absorption coefficient ?{sub ?} of LH waves due to ? particles changing with some typical parameters is calculated in this paper. Results show that ?{sub ?} increases with the parallel refraction index n{sub ?}, while decreases with the frequency of LH waves ? over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption. The absorption coefficient ?{sub ?} increases with n{sub e} when n{sub e} ? 8 × 10{sup 19} m{sup ?3}, while decreases with n{sub e} when n{sub e} becomes larger, and there is a peak value of ?{sub ?} when n{sub e} ? 8 × 10{sup 19} m{sup ?1} for the ITER-like scenario. The influence of spectral broadening in parametric decay instabilities on the absorption coefficient is evaluated. The value of ?{sub ?} with n{sub ?} being 2.5 is almost two times larger than that with n{sub ?} being 2.0 and is even lager in the case of 2.9, which will obviously increase the absorption of the LH power by alpha particles.

  5. Influence of plasma parameters on the absorption coefficient of alpha particles to lower hybrid waves in tokamaks

    NASA Astrophysics Data System (ADS)

    Wang, J.; Zhang, X.; Yu, L.; Zhao, X.

    2014-12-01

    In tokamaks, fusion generated ? particles may absorb lower hybrid (LH) wave energy, thus reducing the LH current drive efficiency. The absorption coefficient ?? of LH waves due to ? particles changing with some typical parameters is calculated in this paper. Results show that ?? increases with the parallel refraction index n ?, while decreases with the frequency of LH waves ? over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption. The absorption coefficient ?? increases with n e when n e ? 8 × 1019 m-3, while decreases with n e when n e becomes larger, and there is a peak value of ?? when n e ? 8 × 1019 m-1 for the ITER-like scenario. The influence of spectral broadening in parametric decay instabilities on the absorption coefficient is evaluated. The value of ?? with n ? being 2.5 is almost two times larger than that with n ? being 2.0 and is even lager in the case of 2.9, which will obviously increase the absorption of the LH power by alpha particles.

  6. Determination of the 3He+alpha\\to 7Be asymp. normalization coefficients (nucl. vertex constants) and their application for extrapolation of the 3He(alpha,gamma)7Be astroph. S-factors to the solar energy region

    E-print Network

    S. B. Igamov; K. I. Tursunmakhatov; R. Yarmukhamedov

    2008-05-28

    A new analysis of the precise experimental astrophysical $S$-factors for the direct capture $^3He(\\alpha,\\gamma)^7{\\rm {Be}}$ reaction [B.S. Nara Singh et al., Phys.Rev.Lett. {\\bf 93} (2004) 262503; D. Bemmerer et al., Phys.Rev.Lett. {\\bf 97} (2006) 122502; F.Confortola et al., Phys.Rev. {\\bf C 75} (2007) 065803 and T.A.D.Brown et al., Phys.Rev. {\\bf C 76} (2007) 055801] populating to the ground and first excited states of $^7{\\rm Be}$ is carried out based on the modified two - body potential approach in which the direct astrophysical $S$-factor, $S_{34}(E)$, is expressed in terms of the asymptotic normalization constants for $^3{\\rm {He}}+\\alpha\\to ^7{\\rm {Be}}$ and two additional conditions are involved to verify the peripheral character of the reaction under consideration. The Woods--Saxon potential form is used for the bound ($\\alpha+^3{\\rm {He}}$)- state and the $^3{\\rm {He}}\\alpha$- scattering wave functions. New estimates are obtained for the "indirectly measured", values of the asymptotic normalization constants (the nuclear vertex constants) for $^3{\\rm {He}}+\\alpha\\to^7{\\rm {Be}}(g.s.)$ and $^3{\\rm {He}}+\\alpha\\to^7{\\rm {Be}}(0.429 MeV)$ as well as the astrophysical $S$-factors $S_{34}(E)$ at E$\\le$ 90 keV, including $E$=0. The values of asymptotic normalization constants have been used for getting information about the $\\alpha$-particle spectroscopic factors for the mirror ($^7Li^7{\\rm {Be}}$)-pair.

  7. Confidence Interval Methods for Coefficient Alpha on the Basis of Discrete, Ordinal Response Items: Which One, If Any, Is the Best?

    ERIC Educational Resources Information Center

    Romano, Jeanine L.; Kromrey, Jeffrey D.; Owens, Corina M.; Scott, Heather M.

    2011-01-01

    In this study, the authors aimed to examine 8 of the different methods for computing confidence intervals around alpha that have been proposed to determine which of these, if any, is the most accurate and precise. Monte Carlo methods were used to simulate samples under known and controlled population conditions wherein the underlying item…

  8. Determination of the 3He+alpha\\to 7Be asymp. normalization coefficients (nucl. vertex constants) and their application for extrapolation of the 3He(alpha,gamma)7Be astroph. S-factors to the solar energy region

    E-print Network

    S. B. Igamov; Q. I. Tursunmahatov; R. Yarmukhamedov

    2010-11-22

    A new analysis of the modern precise measured astrophysical $S$ factors for the direct capture $^3He(\\alpha,\\gamma)^7{\\rm {Be}}$ reaction [B.S. Nara Singh {\\it et al.}, Phys.Rev.Lett. {\\bf 93}, 262503 (2004); D. Bemmerer {\\it et al.}, Phys.Rev.Lett. {\\bf 97}, 122502 (2006); F.Confortola {\\it et al.}, Phys.Rev.C {\\bf 75}, 065803 (2007), T.A.D.Brown {\\it et al.}, Phys.Rev. C {\\bf 76}, 055801 (2007) and A Di Leva, {\\it et al.},Phys.Rev.Lett. {\\bf 102}, 232502 (2009)] populating to the ground and first excited states of $^7{\\rm Be}$ is carried out based on the modified two - body potential approach. New estimates are obtained for the $^{\\glqq}$indirectly determined\\grqq\\, values of the asymptotic normalization constants (the nuclear vertex constants) for $^3{\\rm {He}}+\\alpha\\to{\\rm {^7Be}}$(g.s.) and $^3{\\rm {He}}+\\alpha\\to{\\rm {^7Be}}$(0.429 MeV) as well as the astrophysical $S$ factors $S_{34}(E)$ at E$\\le$ 90 keV, including $E$=0. The values of asymptotic normalization constants have been used for getting information about the $\\alpha$-particle spectroscopic factors for the mirror (${\\rm{^7Li}}{\\rm {^7Be}}$)-pair.

  9. Simultaneous Optimization of Factor Assessibility and Representativeness: An Old Solution to a New Problem

    ERIC Educational Resources Information Center

    Greene, Vernon L.

    1978-01-01

    The relationships among Rao's canonical factor analysis, Kaiser and Coffrey's alpha factor analysis, and Cronbach's alpha coefficient are discussed. Implications for test reliability and validity are noted. (JKS)

  10. Alpha Thalassemia

    MedlinePLUS

    Alpha Thalassemia ? Physicians often mistake alpha thalassemia trait for iron deficiency anemia and incorrectly prescribe iron supplements that have no effect on the anemia. Normal alpha globin genes found on ...

  11. Scale Setting for $\\alpha_{s}$ Beyond Leading Order

    E-print Network

    Hornbostel, K; Morningstar, C J

    2001-01-01

    We present a general procedure for applying the scale-setting prescription of Brodsky, Lepage and Mackenzie to higher orders in the strong coupling constant $\\alphas$. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in $\\alphas$ are anomalously small. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We find significant corrections to the scales for $R_{e^+ e^-}$, $\\Gamma(B \\to X_u e \\bar{\

  12. A parametric study of planform and aeroelastic effects on aerodynamic center, alpha- and q- stability derivatives. Appendix C: Method for computing the aerodynamic influence coefficient matrix of nonplanar wing-body-tail configurations

    NASA Technical Reports Server (NTRS)

    Roskam, J.

    1972-01-01

    Expressions are derived for computing the aerodynamic influence coefficient matrix for nonplanar wing-body-tail configurations. An aerodynamic influence coefficient is defined as the load in lbs. induced on a panel as a result of a unit angle of attack on another panel. Fuselage, wing and tail thickness are assumed to be small with the result that the thickness effect on the flow-field is negligible. The method for determining the aerodynamic influence coefficient matrix is based on the lifting solution to the small perturbation, steady potential flow equation.

  13. Optical absorption coefficient of magneto-optic garnet films

    SciTech Connect

    Liu Gong-qiang; Yu Zhi-qiang; Liu Xianglin

    1986-02-01

    This paper analyzes various factors contributing to optical attenuation in magneto-optic garnet films and derives expressions for the optical absorption and scattering coefficients ..cap alpha.. and ..gamma... The values of ..cap alpha.. and ..gamma.. for (BiTm)/sub 3/(FeGa)/sub 5/O/sub 12/ films were measured in a magneto-optic modulation device by comparing the magneto-optic rotations. Compared with other methods, this technique has two advantages: (1) absorption in the substrate is eliminated, and the measured values ..cap alpha.. are not affected by reflection at the film/substrate interface; (2) the optical scattering coefficient ..gamma.. can be separated from the optical absorption ..cap alpha.., so that the measured value ..cap alpha.. closely approximates the true optical absorption coefficient for magneto-optic garnet film materials.

  14. Factor Scores, Structure Coefficients, and Communality Coefficients

    ERIC Educational Resources Information Center

    Goodwyn, Fara

    2012-01-01

    This paper presents heuristic explanations of factor scores, structure coefficients, and communality coefficients. Common misconceptions regarding these topics are clarified. In addition, (a) the regression (b) Bartlett, (c) Anderson-Rubin, and (d) Thompson methods for calculating factor scores are reviewed. Syntax necessary to execute all four…

  15. Coefficient Estimates for Inverses of Starlike Functions of Positive Order

    Microsoft Academic Search

    G. P. Kapoor; A. K. Mishra

    2005-01-01

    In the present paper, the coefficient estimates are found for the class $\\\\mathcal S^{*-1}(\\\\alpha)$ consisting of inverses of functions in the class of univalent starlike functions of order $\\\\alpha$ in $\\\\mathcal D=\\\\{z\\\\in\\\\mathbb C:|z|<1\\\\}$. These estimates extend the work of {\\\\it Krzyz, Libera and Zlotkiewicz [Ann. Univ. Marie Curie-Sklodowska, 33(1979), 103-109]} who found sharp estimates on only first two coefficients for

  16. Accommodation Coefficient of Hydrogen; A Sensitive Detector of Surface Films

    Microsoft Academic Search

    Katharine B. Blodgett; Irving Langmuir

    1932-01-01

    An equation is derived which gives the accommodation coefficient alpha of a gas striking a surface as the ratio of the observed heat loss from the surface to the theoretical heat loss that would be observed if all the gas molecules came to thermal equilibrium with the surface. The experiments show that at temperatures above 600°K the values of alpha

  17. Coefficients Alpha, Beta, Omega, and the glb: Comments on Sijtsma

    ERIC Educational Resources Information Center

    Revelle, William; Zinbarg, Richard E.

    2009-01-01

    There are three fundamental problems in Sijtsma ("Psychometrika," 2008): (1) contrary to the name, the glb is not the greatest lower bound of reliability but rather is systematically less than omega[subscript t] (McDonald, "Test theory: A unified treatment," Erlbaum, Hillsdale, 1999), (2) we agree with Sijtsma that when considering how well a test…

  18. Pearson's Correlation Coefficient

    NSDL National Science Digital Library

    This tutorial on Pearson's Correlation Coefficient includes the definition, assumptions, and characteristics of r as well as related statistics and hypothesis test procedures. One section instructs users to find correlation in the WINKS software, but those without the software can still use the tutorial. An exercise is given at the end that can be done with any statistical software package.

  19. Point Biserial Correlation Coefficient

    NSDL National Science Digital Library

    Lowry, Richard, 1940-

    This page calculates the point biserial correlation coefficient for the case where one variable is dichotomous and the other is non-dichotomous. This page allows the user to input the data directly or copy and paste from a spreadsheet application and provides data summary.

  20. Bounding the Bogoliubov coefficients

    SciTech Connect

    Boonserm, Petarpa [School of Mathematics, Statistics, and Computer Science, Victoria University of Wellington, P.O. Box 600, Wellington (New Zealand); Visser, Matt [School of Mathematics, Statistics, and Computer Science, Victoria University of Wellington, P.O. Box 600, Wellington (New Zealand)], E-mail: matt.visser@mcs.vuw.ac.nz

    2008-11-15

    While over the last century or more considerable effort has been put into the problem of finding approximate solutions for wave equations in general, and quantum mechanical problems in particular, it appears that as yet relatively little work seems to have been put into the complementary problem of establishing rigourous bounds on the exact solutions. We have in mind either bounds on parametric amplification and the related quantum phenomenon of particle production (as encoded in the Bogoliubov coefficients), or bounds on transmission and reflection coefficients. Modifying and streamlining an approach developed by one of the present authors [M. Visser, Phys. Rev. A 59 (1999) 427-438, (arXiv:quant-ph/9901030)], we investigate this question by developing a formal but exact solution for the appropriate second-order linear ODE in terms of a time-ordered exponential of 2x2 matrices, then relating the Bogoliubov coefficients to certain invariants of this matrix. By bounding the matrix in an appropriate manner, we can thereby bound the Bogoliubov coefficients.

  1. Alpha College Today.

    ERIC Educational Resources Information Center

    Leppert, William A.

    1979-01-01

    Presents a follow-up report on Alpha, an experimental unit of the College of DuPage in Illinois. Traces the postgraduation activities of Alpha graduates and describes new Alpha programs and projects. (CAM)

  2. Alpha-1 Antitrypsin Deficiency

    MedlinePLUS

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  3. Scale setting for alpha_s beyond leading order

    E-print Network

    Hornbostel, K; Morningstar, C J

    2003-01-01

    We present a general procedure for incorporating higher-order information into the scale-setting prescription of Brodsky, Lepage and Mackenzie. In particular, we show how to apply this prescription when the leading coefficient or coefficients in a series in the strong coupling alpha_s are anomalously small and the original prescription can give an unphysical scale. We give a general method for computing an optimum scale numerically, within dimensional regularization, and in cases when the coefficients of a series are known. We apply it to the heavy quark mass and energy renormalization in lattice NRQCD, and to a variety of known series. Among the latter, we find significant corrections to the scales for the ratio of e+e- to hadrons over muons, the ratio of the quark pole to MSbar mass, the semi-leptonic B-meson decay width, and the top decay width. Scales for the latter two decay widths, expressed in terms of MSbar masses, increase by factors of five and thirteen, respectively, substantially reducing the size...

  4. Prediction of Aerodynamic Coefficients using Neural Networks for Sparse Data

    NASA Technical Reports Server (NTRS)

    Rajkumar, T.; Bardina, Jorge; Clancy, Daniel (Technical Monitor)

    2002-01-01

    Basic aerodynamic coefficients are modeled as functions of angles of attack and sideslip with vehicle lateral symmetry and compressibility effects. Most of the aerodynamic parameters can be well-fitted using polynomial functions. In this paper a fast, reliable way of predicting aerodynamic coefficients is produced using a neural network. The training data for the neural network is derived from wind tunnel test and numerical simulations. The coefficients of lift, drag, pitching moment are expressed as a function of alpha (angle of attack) and Mach number. The results produced from preliminary neural network analysis are very good.

  5. Generalized Reflection Coefficients

    NASA Astrophysics Data System (ADS)

    Remling, Christian

    2015-02-01

    I consider general reflection coefficients for arbitrary one-dimensional whole line differential or difference operators of order 2. These reflection coefficients are semicontinuous functions of the operator: their absolute value can only go down when limits are taken. This implies a corresponding semicontinuity result for the absolutely continuous spectrum, which applies to a very large class of maps. In particular, we can consider shift maps (thus recovering and generalizing a result of Last-Simon) and flows of the Toda and KdV hierarchies (this is new). Finally, I evaluate an attempt at finding a similar general setup that gives the much stronger conclusion of reflectionless limit operators in more specialized situations.

  6. First Townsend coefficient measured in argon based mixtures at high fields

    Microsoft Academic Search

    A. Sharma; Fabio Sauli

    1993-01-01

    The first Townsend coefficient alpha is measured at high fields, in pure hydrocarbons and carbon dioxide, and in their mixtures with argon, using a parallel plate chamber at various pressures. From a fit to the Townsend relation alpha\\/p = A exp(- Bp\\/E) the gas constants A and B are derived. Space charge effects are observed at high fields.

  7. Statistical Considerations in Choosing a Test Reliability Coefficient. ACT Research Report Series, 2012 (10)

    ERIC Educational Resources Information Center

    Woodruff, David; Wu, Yi-Fang

    2012-01-01

    The purpose of this paper is to illustrate alpha's robustness and usefulness, using actual and simulated educational test data. The sampling properties of alpha are compared with the sampling properties of several other reliability coefficients: Guttman's lambda[subscript 2], lambda[subscript 4], and lambda[subscript 6]; test-retest reliability;…

  8. On Robustness of the Normal-Theory Based Asymptotic Distributions of Three Reliability Coefficient Estimates.

    ERIC Educational Resources Information Center

    Yuan, Ke-Hai; Bentler, Peter M.

    2002-01-01

    Examined the asymptotic distributions of three reliability coefficient estimates: (1) sample coefficient alpha; (2) reliability estimate of a composite score following factor analysis; and (3) maximal reliability of a linear combination of item scores after factor analysis. Findings show that normal theory based asymptotic distributions for these…

  9. Coefficients of associated Legendre functions

    NASA Technical Reports Server (NTRS)

    Peasley, Q. D.

    1976-01-01

    The exact coefficients for the explicit forms of the associated Legendre functions Pm for integer values of m,n=0,1,2,...25 are presented in tabular form together with two cross-referenced listings of the zeroes for these functions rounded to five decimal places. The unfactored coefficients and the interger coefficients are presented in adjacent columns for each function. The greatest common factor and divisor have been removed and listed separately for the integer coefficients.

  10. Alpha One Foundation

    MedlinePLUS

    ... Tested Research Donate Upcoming events Alphas of Northern Illinois Support Group Meeting (3/21/2015 11:00 ... 00 AM - 2:00 PM Alphas of Northern Illinois Support Group Meeting Saturday, March 21st from 11: ...

  11. Alpha Hydroxy Acids

    MedlinePLUS

    ... page Home Cosmetics Products & Ingredients Ingredients Alpha Hydroxy Acids See also: Guidance for Industry: Labeling for Cosmetics Containing Alpha Hydroxy Acids The following information is intended to answer questions ...

  12. Alpha Thalassemia (For Parents)

    MedlinePLUS

    Thalassemias Thalassemias are a group of blood disorders that affect the way the body makes hemoglobin, a ... results in that type of thalassemia. About Alpha Thalassemia Alpha thalassemia occurs when the gene that controls ...

  13. Globin chain synthesis in the alpha thalassemia syndromes

    PubMed Central

    Kan, Yuet Wai; Schwartz, Elias; Nathan, David G.

    1968-01-01

    Whole blood samples of patients with various forms of alpha thalassemia including hemoglobin H disease, alpha thalassemia trait, and the “silent carrier” state were incubated with leucine-14C for definition of relative rates of production of alpha and beta chains in these disorders. The chains were separated by carboxymethyl cellulose chromatography in the presence of 8 M urea and dithiothreitol. Their absorptions at 280 m? were determined and their radioactivities measured in a liquid scintillation spectrometer. After correction for differences in extinction coefficients, the specific activities of the widely separated alpha and beta peaks were determined. In 11 nonthalassemic individuals, the alpha/beta specific activity ratios were found to be 1.02±0.07; in nine patients with alpha thalassemia trait, 0.77±0.05; in six patients with hemoglobin H disease, 0.41±0.11; and in four “silent carriers,” 0.88 with a range of 0.82-0.95. The results show that in peripheral blood, alpha chain production relative to beta chain production is indeed limited in the alpha thalassemia syndromes. Hemoglobin H disease results from doubly heterozygous inheritance of a gene resulting in moderate depression of alpha chain production (alpha thalassemia trait) and a gene resulting in very mild depression of alpha chain production (the “silent carrier” syndrome.” PMID:5775343

  14. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  15. GROSS ALPHA RADIUM REGULATION

    EPA Science Inventory

    The determination of concentrations of natural radioactivity in public water supplies begins with the measurement of the gross alpha particle activity. The gross alpha activity measurement is used as a screening technique. The gross alpha particle activity measurement may be su...

  16. The anomalous distributions and Soret coefficient in nonequilibrium colloid system

    E-print Network

    Zhou Yanjun; Du Jiulin

    2014-04-29

    Density distributions in nonequilibrium magnetic colloid with nonuniform temperature are studied from the Langevin equation based on a strong friction and inhomogeneous medium. In such a nonequilibrium system, the relation between the temperature gradient and the interaction potential is introduced by the nonextensive parameter. We show that the density of the colloidal particles is a function of the temperature and anomalously follows the noted alpha-distribution, or equivalently it is also a function of the interaction potential and follows Tsallis distribution. With the nonextensive parameter we establish a new Soret coefficient and thus bridge the gap between the ideally theoretical Soret coefficient and available experiments.

  17. Antibody biodistribution coefficients

    PubMed Central

    Shah, Dhaval K.; Betts, Alison M.

    2013-01-01

    Tissue vs. plasma concentration profiles have been generated from a physiologically-based pharmacokinetic model of monoclonal antibody (mAb). Based on the profiles, we hypothesized that a linear relationship between the plasma and tissue concentrations of non-binding mAbs could exist; and that the relationship may be generally constant irrespective of the absolute mAb concentration, time, and animal species being analyzed. The hypothesis was verified for various tissues in mice, rat, monkey, and human using mAb or antibody-drug conjugate tissue distribution data collected from diverse literature. The relationship between the plasma and various tissue concentrations was mathematically characterized using the antibody biodistribution coefficient (ABC). Estimated ABC values suggest that typically the concentration of mAb in lung is 14.9%, heart 10.2%, kidney 13.7%, muscle 3.97%, skin 15.7%, small intestine 5.22%, large intestine 5.03%, spleen 12.8%, liver 12.1%, bone 7.27%, stomach 4.98%, lymph node 8.46%, adipose 4.78%, brain 0.351%, pancreas 6.4%, testes 5.88%, thyroid 67.5% and thymus is 6.62% of the plasma concentration. The validity of using the ABC to predict mAb concentrations in different tissues of mouse, rat, monkey, and human species was evaluated by generating validation data sets, which demonstrated that predicted concentrations were within 2-fold of the observed concentrations. The use of ABC to infer tissue concentrations of mAbs and related molecules provides a valuable tool for investigating preclinical or clinical disposition of these molecules. It can also help eliminate or optimize biodistribution studies, and interpret efficacy or toxicity of the drug in a particular tissue. PMID:23406896

  18. Reference Material for Seebeck Coefficients

    NASA Astrophysics Data System (ADS)

    Edler, F.; Lenz, E.; Haupt, S.

    2015-03-01

    This paper describes a measurement method and a measuring system to determine absolute Seebeck coefficients of thermoelectric bulk materials with the aim of establishing reference materials for Seebeck coefficients. Reference materials with known thermoelectric properties are essential to allow a reliable benchmarking of different thermoelectric materials for application in thermoelectric generators to convert thermal into electrical energy or vice versa. A temperature gradient (1 to 8) K is induced across the sample, and the resulting voltage is measured by using two differential Au/Pt thermocouples. On the basis of the known absolute Seebeck coefficients of Au and Pt, the unknown Seebeck coefficient of the sample is calculated. The measurements are performed in inert atmospheres and at low pressure (30 to 60) mbar in the temperature range between 300 K and 860 K. The measurement results of the Seebeck coefficients of metallic and semiconducting samples are presented. Achievable relative measurement uncertainties of the Seebeck coefficient are on the order of a few percent.

  19. Nonlinear interface dynamos with alpha -quenching

    NASA Astrophysics Data System (ADS)

    Charbonneau, P.; MacGregor, K. B.

    1996-05-01

    There exist various mechanisms capable of limiting the magnitude of the (presumably) dynamo-generated, large-scale solar magnetic field. One such mechanism is the so-called ``alpha -quenching''. The underlying idea is that the Lorentz force associated with the dynamo-generated magnetic fields impedes the small scale, turbulent fluid motions giving rise to the so-called ``alpha -effect'' (the production of poloidal from toroidal fields in the framework of mean-field dynamo theory). In mean-field models, a popular ---yet essentially ad hoc--- prescription for alpha -quenching consists in replacing the coefficient (alpha ) of the alpha -effect source term in the dynamo equations by an expression of the form alpha -> alpha (B) =alpha_0 /(1+(|B|/B_eq)(2)) , where alpha_0 is a measure of the strength of the alpha -effect in the linear regime, and B_eq is the equipartition field strength, based on the kinetic energy of the turbulent, convective fluid motions (B_eq ~ 10(4) G at the base of the solar convection zone). In principle, such ``Weak Quenching'' allows the production of magnetic fields of roughly equipartition strength, as demonstrated by the numerous conventional mean-field dynamo models making use of eq. (1), or some close variant, published to date. Vainshtein & Cattaneo (1992, ApJ 393, 165) and Gruzinov & Diamond (1995, Phys. Plasmas 2, 1941) have argued, however, that alpha -quenching should be described by alpha -> alpha (B) =alpha_0 /(R_m(|B|/B_eq)(2)) where R_m is a magnetic Reynolds number based on the microscopic properties of the flow (R_m>> 1 for solar interior conditions). This now describes a much stronger form of alpha -quenching, and, with R_m>> 1, could be fatal to large-scale dynamo action, in the sense that the dynamo could only produce magnetic fields of strength << B_eq. This is in marked contradiction with the demands set by recent models of bipolar magnetic region emergence, which require field strengths of order 10x B_eq ~ 10(5) G for the observed latitudes and tilt of emergence to be adequately reproduced. In this contribution, we investigate the circumstances under which interface dynamos can avoid alpha -quenching, either in the ``Weak'' or ``Strong'' forms defined above. In interface dynamos the alpha -effect is assumed to operate within the solar convective envelope, while the strongest magnetic fields are generated by shearing below the core-envelope interface (Parker 1993, ApJ 408, 707; Charbonneau & MacGregor, submitted to ApJ). This spatial segregation of the alpha -effect source region is the key to avoiding alpha -quenching. This is illustrated using a few nonlinear, kinematic interface dynamo solutions applicable to the Sun.

  20. Study of DCT coefficient distributions

    Microsoft Academic Search

    Stephen Smoot

    1996-01-01

    Many image and video compression schemes perform the discrete cosine transform (DCT) to represent image data in frequency space. An analysis of a broad suite of images confirms previous finding that a Laplacian distribution can be used to model the luminance AC coefficients. This model is expanded and applied to color space (Cr\\/Cb) coefficients. In MPEG, the DCT is used

  1. Modelling radiative mean absorption coefficients

    Microsoft Academic Search

    J.-F. Ripoll; B. Dubroca; G. Duffa

    2001-01-01

    We define and compute mean absorption coefficients for the macroscopic models of radiative transfer. These coefficients take into account the anisotropic form of the photon emission and lead to a better computation of a photonic flow far from the radiative equilibrium. They are deduced by averaging a specific radiative intensity on the space of frequency and are generalized versions of

  2. The determination of 5alpha-androstane-3alpha, 17beta-diol in human plasma by radioimmunoassay.

    PubMed

    Laband, P; Tresguerres, J A; Lisboa, B P; Volkwein, U; Tamm, J

    1978-08-01

    Antibodies have been raised in rabbits against 3alpha, 17beta-dihydroxy-5alpha-androstane-6-0-carboxymethyloxime coupled with Cohn's fraction IV-4. The antiserum exhibited significant cross reactions with 5beta-androstane-3alph1, 17beta-diol, 5alpha-dihydrotestosterone, and testosterone. No cross reactions were observed with 5alpha-androstane-3beta,17beta-diol and 5-androstene-3beta,17beta-diol. The methodological criteria for the measurement of 5alpha-androstane-3alpha, 17beta-diol in human plasma were as follows: The specificity was ensured by separating the cross reacting steroids by thin layer chromatography. The intraassay and interassay coefficients of variation were found to be 6.2 and 10.2%, respectively. The sensitivity was 30 pg. The recovery of different amounts of 5alpha-androstane-3alpha,17beta-diol added to human plasma (80, 120, and 200 pg) yielded 91.3, 92.5, and 93.5%, respectively. The following concentrations of 5alpha-androstane-3alpha,17beta-diol have been determined in human plasma (mean +/- SD, ng/dl): Normal males: 18.98 +/- 5.9; normal females: 2.65 +/- 0.27; females with idiopathic hirsutism: 11.9 +/- 6.4; prepubertal children: not detectable. PMID:581118

  3. Rossi Alpha Method

    SciTech Connect

    Hansen, G.E.

    1985-01-01

    The Rossi Alpha Method has proved to be valuable for the determination of prompt neutron lifetimes in fissile assemblies having known reproduction numbers at or near delayed critical. This workshop report emphasizes the pioneering applications of the method by Dr. John D. Orndoff to fast-neutron critical assemblies at Los Alamos. The value of the method appears to disappear for subcritical systems where the Rossi-..alpha.. is no longer an ..alpha..-eigenvalue.

  4. The Seebeck coefficient of iodine

    E-print Network

    Perez-Fernandez, Domingo Miguel

    1968-01-01

    THE SEEBECK COEFFICIENT OF IODINE A Thesis By DOMINGO M. PEREZ-F~EZ Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE January 1968 Major Subject...; Physics THE SEEBECK COEFFICIENT OF IODINE A Thesis By DOMINGO M. PEREZ-FERNANDEZ Approved as to style and content by: ( airman of Co ittee) (Member) (Head of Depa ment) (Member) ( ember) (Member) (Member) January 1968 ACKNONLEDGEMENTS...

  5. Recombination coefficients for iron ions

    NASA Technical Reports Server (NTRS)

    Woods, D. T.; Shull, J. M.; Sarazin, C. L.

    1981-01-01

    Radiative recombination coefficients for all Fe ions are calculated by use of the Milne relation of detailed balance. Analytic fits are made to the dielectronic recombination rates computed by Jacobs (1977) and the Burgess general formula (1965). Higher level rates are treated hydrogenically by a quantum defect method based on the energies of the levels. Recombination coefficients for Fe I to Fe 26 are listed.

  6. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  7. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  8. Imaging alpha particle detector

    DOEpatents

    Anderson, David F. (Los Alamos, NM)

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  9. Alpha-particle diagnostics

    SciTech Connect

    Young, K.M.

    1991-01-01

    This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

  10. Townsend ionization coefficients of some argon-based mixtures in strong nonuniform electric fields

    Microsoft Academic Search

    Ines Krajcar Bronic; Bernd Grosswendt

    2000-01-01

    The reduced Townsend ionization coefficient alpha\\/P is derived from the measurement of the mean gas amplification factor in a low-pressure (P <= 50 kPa) proportional counter filled with argon-propane and argon-(dimethyl-ether) mixtures of various concentrations. The results are compared with our previous alpha\\/P values for argon-isobutane mixtures [I. Krajcar Bronic and B. Grosswendt, Nucl. Instrum. Methods Phys. Res. B 142,

  11. Converting Sabine absorption coefficients to random incidence absorption coefficients.

    PubMed

    Jeong, Cheol-Ho

    2013-06-01

    Absorption coefficients measured by the chamber method are referred to as Sabine absorption coefficients, which sometimes exceed unity due to the finite size of a sample and non-uniform intensity in the reverberation chambers under test. In this study, conversion methods from Sabine absorption coefficients to random incidence absorption coefficients are proposed. The overestimations of the Sabine absorption coefficient are investigated theoretically based on Miki's model for porous absorbers backed by a rigid wall or an air cavity, resulting in conversion factors. Additionally, three optimizations are suggested: An optimization method for the surface impedances for locally reacting absorbers, the flow resistivity for extendedly reacting absorbers, and the flow resistance for fabrics. With four porous type absorbers, the conversion methods are validated. For absorbers backed by a rigid wall, the surface impedance optimization produces the best results, while the flow resistivity optimization also yields reasonable results. The flow resistivity and flow resistance optimization for extendedly reacting absorbers are also found to be successful. However, the theoretical conversion factors based on Miki's model do not guarantee reliable estimations, particularly at frequencies below 250 Hz and beyond 2500?Hz. PMID:23742349

  12. Genetics Home Reference: Alpha thalassemia

    MedlinePLUS

    ... Recent literature OMIM Genetic disorder catalog Conditions > Alpha thalassemia On this page: Description Genetic changes Inheritance Diagnosis ... Glossary definitions Reviewed August 2009 What is alpha thalassemia? Alpha thalassemia is a blood disorder that reduces ...

  13. Dynamic model with scale-dependent coefficients in the viscous range

    NASA Technical Reports Server (NTRS)

    Meneveau, C.; Lund, T. S.

    1996-01-01

    The standard dynamic procedure is based on the scale-invariance assumption that the model coefficient C is the same at the grid and test-filter levels. In many applications this condition is not met, e.g. when the filter-length, delta, approaches the Kolmogorov scale, and C(delta approaches eta) approaches O. Using a priori tests, we show that the standard dynamic model yields the coefficient corresponding to the test-filter scale (alpha delta) instead of the grid-scale (delta). Several approaches to account for scale dependence are examined and/or tested in large eddy simulation of isotropic turbulence: (a) take the limit alpha approaches 1; (b) solve for two unknown coefficients C(Delta) and C(alpha delta) in the least-square-error formulation; (c) the 'bi-dynamic model', in which two test-filters (e.g. at scales 2(delta) and 4(delta) are employed to gain additional information on possible scale-dependence of the coefficient, and an improved estimate for the grid-level coefficient is obtained by extrapolation, (d) use theoretical predictions for the ratio C(alpha delta)/C(delta) and dynamically solve for C(delta). None of these options is found to be entirely satisfactory, although the last approach appears applicable to the viscous range.

  14. RAPID COMMUNICATION: Ionisation and attachment coefficients measured in nitrogen and difluorodichloromethane gas mixtures

    Microsoft Academic Search

    Y. Qiu; X. Ren; Z. Y. Liu

    1990-01-01

    In view of contradiction in the dielectric strength of the CF2Cl2\\/N2 gas mixture reported by different investigators, the authors report the Townsend first ionisation coefficient alpha and the electron attachment coefficient eta measured in that gas mixture with various mixing ratios using the steady-state Townsend method over the range 40

  15. Dependence of the elastic strain coefficient of copper on the pre-treatment

    NASA Technical Reports Server (NTRS)

    Kuntze, Wilhelm

    1950-01-01

    The effect of various pre-treatments on the elastic strain coefficient (alpha) (defined as the reciprocal of the modulus of elasticity E) (Epsilon) and on the mechanical hysteresis of copper has been investigated. Variables comprising the pre-treatments were pre-straining by stretching in a tensile testing machine and by drawing through a die, aging at room and elevated temperatures and annealing. The variation of the elastic strain coefficient with test stress was also investigated.

  16. Calculations of dynamo coefficients in Parker unstable disks without shear

    NASA Astrophysics Data System (ADS)

    Otmianowska-Mazur, K.

    2003-09-01

    We investigate the influence of the Coriolis force and magnetic reconnection on the evolution of the Parker instability in galactic disks. We apply a three-dimensional (3D) model of a local gas cube, permeated by an azimuthal regular magnetic field. We numerically solve MHD equations including the contribution of the Coriolis force. At this stage of the investigation we omit the effects of rotational shear. Our previous simulations demonstrate that Parker instability leads to the formation of helically twisted magnetic flux tubes forming a significant poloidal magnetic field component on the scale of the whole cube. Such an evolution represents an example of the fast dynamo process proposed by Parker (\\cite{Parker92}). In the present work we extend our earlier computations by calculating the basic coefficients of the MHD dynamo as time-dependent functions. The well-known dynamo coefficients alpha and eta_T - both in the relevant tensorial formulations - are derived from small scale gas motions present in the Parker instability model, so in a local formulation the total turbulent electromotive force (EMF) is described as a quantity dependent on time. The EMF-coefficients alpha and eta_T are evaluated within the limit of high microscopic conductivity.

  17. Seebeck coefficient of one electron

    SciTech Connect

    Durrani, Zahid A. K., E-mail: z.durrani@imperial.ac.uk [Department of Electrical and Electronic Engineering, Imperial College London, South Kensington Campus, London SW7 2AZ (United Kingdom)

    2014-03-07

    The Seebeck coefficient of one electron, driven thermally into a semiconductor single-electron box, is investigated theoretically. With a finite temperature difference ?T between the source and charging island, a single electron can charge the island in equilibrium, directly generating a Seebeck effect. Seebeck coefficients for small and finite ?T are calculated and a thermally driven Coulomb staircase is predicted. Single-electron Seebeck oscillations occur with increasing ?T, as one electron at a time charges the box. A method is proposed for experimental verification of these effects.

  18. Semiconductor polycrystalline alpha detectors

    Microsoft Academic Search

    M. Schieber; M. Roth; A. Zuck; G. Marom; O. Khakhan; Z. B. Alfassi

    2006-01-01

    In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation

  19. Superfluid Mutual-friction Coefficients from Vortex Dynamics in the Two-dimensional Galerkin-truncated Gross-Pitaevskii Equation

    E-print Network

    Vishwanath Shukla; Marc Brachet; Rahul Pandit

    2014-11-23

    We present algorithms for the ab-initio determination of the temperature ($T$) dependence of the mutual-friction coefficients $\\alpha$ and $\\alpha'$ and the normal-fluid density $\\rho_{\\rm n}$ in the two-dimensional (2D) Galerkin-truncated Gross-Pitaevskii system. Our algorithms enable us to determine $\\alpha(T)$, even though fluctuations in 2D are considerably larger than they are in 3D. We also examine the implications of our measurements of $\\alpha'(T)$ for the Iordanskii force, whose existence is often questioned.

  20. Estimating the polyserial correlation coefficient

    Microsoft Academic Search

    Edward J. Bedrick; Frederick C. Breslin

    1996-01-01

    We develop simple noniterative estimators of the polyserial correlation coefficient. A general relationship between the polyserial correlation and the point polyserial correlation is exploited to give extensions of Pearson's, Brogden's, and Lord's biserial estimators to the multicategory setting. The small sample and asmptotic properties of these estimators are studied in some detail. A comparison with maximum likelihood estimates shows that

  1. Neural Network Prediction of New Aircraft Design Coefficients

    NASA Technical Reports Server (NTRS)

    Norgaard, Magnus; Jorgensen, Charles C.; Ross, James C.

    1997-01-01

    This paper discusses a neural network tool for more effective aircraft design evaluations during wind tunnel tests. Using a hybrid neural network optimization method, we have produced fast and reliable predictions of aerodynamical coefficients, found optimal flap settings, and flap schedules. For validation, the tool was tested on a 55% scale model of the USAF/NASA Subsonic High Alpha Research Concept aircraft (SHARC). Four different networks were trained to predict coefficients of lift, drag, moment of inertia, and lift drag ratio (C(sub L), C(sub D), C(sub M), and L/D) from angle of attack and flap settings. The latter network was then used to determine an overall optimal flap setting and for finding optimal flap schedules.

  2. On the Validity of the Geiger-Nuttall Alpha-Decay Law and its Microscopic Basis

    E-print Network

    C. Qi; A. N. Andreyev; M. Huyse; R. J. Liotta; P. Van Duppen; R. Wyss

    2014-05-22

    The Geiger-Nuttall (GN) law relates the partial $\\alpha$-decay half-life with the energy of the escaping $\\alpha$ particle and contains for every isotopic chain two experimentally determined coefficients. The expression is supported by several phenomenological approaches, however its coefficients lack a fully microscopic basis. In this paper we will show that: 1) the empirical coefficients that appear in the GN law have a deep physical meaning and 2) the GN law is successful within the restricted experimental data sets available so far, but is not valid in general. We will show that, when the dependence of logarithm values of the $\\alpha$ formation probability on the neutron number is not linear or constant, the GN law is broken. For the $\\alpha$ decay of neutron-deficient nucleus $^{186}$Po, the difference between the experimental half-life and that predicted by the GN Law is as large as one order of magnitude.

  3. Transport coefficients of quantum plasmas

    SciTech Connect

    Bennaceur, D.; Khalfaoui, A.H. (Centre de Developpement des Technologies Avancees/Secretariat d'Etat a la Recherche Scientifique et l'Environment, Laboratoire de Fusion Thermonucleaire, 2 boulevard Frantz Fanon, Boite Postale 1017 Alger-gare (Algeria))

    1993-09-01

    Transport coefficients of fully ionized plasmas with a weakly coupled, completely degenerate electron gas and classical ions with a wide range of coupling strength are expressed within the Bloch transport equation. Using the Kohler variational principle the collision integral of the quantum Boltzmann equation is derived, which accounts for quantum effects through collective plasma oscillations. The physical implications of the results are investigated through comparisons with other theories. For practical applications, electrical and thermal conductivities are derived in simple analytical formulas. The relation between these two transport coefficients is expressed in an explicit form, giving a generalized Wiedemann-Franz law, where the Lorentz ratio is a dependent function of the coupling parameter and the degree of degeneracy of the plasma.

  4. Portable vapor diffusion coefficient meter

    DOEpatents

    Ho, Clifford K. (Albuquerque, NM)

    2007-06-12

    An apparatus for measuring the effective vapor diffusion coefficient of a test vapor diffusing through a sample of porous media contained within a test chamber. A chemical sensor measures the time-varying concentration of vapor that has diffused a known distance through the porous media. A data processor contained within the apparatus compares the measured sensor data with analytical predictions of the response curve based on the transient diffusion equation using Fick's Law, iterating on the choice of an effective vapor diffusion coefficient until the difference between the predicted and measured curves is minimized. Optionally, a purge fluid can forced through the porous media, permitting the apparatus to also measure a gas-phase permeability. The apparatus can be made lightweight, self-powered, and portable for use in the field.

  5. Consistent transport coefficients in astrophysics

    NASA Technical Reports Server (NTRS)

    Fontenla, Juan M.; Rovira, M.; Ferrofontan, C.

    1986-01-01

    A consistent theory for dealing with transport phenomena in stellar atmospheres starting with the kinetic equations and introducing three cases (LTE, partial LTE, and non-LTE) was developed. The consistent hydrodynamical equations were presented for partial-LTE, the transport coefficients defined, and a method shown to calculate them. The method is based on the numerical solution of kinetic equations considering Landau, Boltzmann, and Focker-Planck collision terms. Finally a set of results for the transport coefficients derived for a partially ionized hydrogen gas with radiation was shown, considering ionization and recombination as well as elastic collisions. The results obtained imply major changes is some types of theoretical model calculations and can resolve some important current problems concerning energy and mass balance in the solar atmosphere. It is shown that energy balance in the lower solar transition region can be fully explained by means of radiation losses and conductive flux.

  6. High temperature Seebeck coefficient metrology

    SciTech Connect

    Martin, J. [Materials Science and Engineering Laboratory, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Tritt, T. [Department of Physics and Astronomy, Clemson University, Clemson, South Carolina 29634 (United States); Uher, C. [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States)

    2010-12-15

    We present an overview of the challenges and practices of thermoelectric metrology on bulk materials at high temperature (300 to 1300 K). The Seebeck coefficient, when combined with thermal and electrical conductivity, is an essential property measurement for evaluating the potential performance of novel thermoelectric materials. However, there is some question as to which measurement technique(s) provides the most accurate determination of the Seebeck coefficient at high temperature. This has led to the implementation of nonideal practices that have further complicated the confirmation of reported high ZT materials. To ensure meaningful interlaboratory comparison of data, thermoelectric measurements must be reliable, accurate, and consistent. This article will summarize and compare the relevant measurement techniques and apparatus designs required to effectively manage uncertainty, while also providing a reference resource of previous advances in high temperature thermoelectric metrology.

  7. Factoring polynomials with rational coefficients

    Microsoft Academic Search

    A. K. Lenstra; H. W. Lenstra; L. Lovfiasz

    1982-01-01

    In this paper we present a polynomial-time algorithm to solve the following problem: given a non-zero polynomial fe Q(X) in one variable with rational coefficients, find the decomposition of f into irreducible factors in Q(X). It is well known that this is equivalent to factoring primitive polynomials feZ(X) into irreducible factors in Z(X). Here we call f~ Z(X) primitive if

  8. Optimal Bounds on Texture Coefficients

    Microsoft Academic Search

    Roberto Paroni

    2000-01-01

    Let w be the orientation distribution function of a polycrystalline aggregate of crystallites with symmetry G\\u000a cr and with group of texture symmetry G\\u000a tex. In this paper we obtain a “recipe” on how to derive optimal bounds on the texture coefficients W\\u000a \\u000a lmn\\u000a associated with w. In particular, we find explicit bounds in the case in which G\\u000a tex

  9. AlphaGalileo

    NSDL National Science Digital Library

    AlphaGalileo is designed for science journalists, but anyone with an itch for breaking academic news will enjoy this research-rich site. Readers may browse by region, including Africa, Asia, Caribbean, Europe, Latin America, Middle East, North America, Oceania, and this Scout Editorâ??s favorite: Extraterrestrial. Next, try trawling the site by Science, Health, Society, Humanities, Arts, Applied Science, and Business for the latest illuminating research in each of these fields. AlphaGalileo also issues News Releases, usually five or six paragraphs long, that cover particularly interesting research findings. Best of all, since the Scout Report previously covered AlphaGalileo back in 2007, the site has dropped its membership requirements and visitors can browse more freely than ever.

  10. Nature of optical remote sensing coefficient

    Microsoft Academic Search

    Vladimir I. Haltrin

    2004-01-01

    The remote sensing coefficient or radiance reflection coefficient is a principal product of atmospheric correction algorithms applied to the remotely measured optical images of the ocean. This coefficient contains information about angular structure of light radiance, roughness of the ocean surface, and optical properties of the water. This presentation analyses remote sensing coefficient and presents it as a product of

  11. Swell and the drag coefficient

    NASA Astrophysics Data System (ADS)

    Potter, Henry

    2015-02-01

    Simultaneous measurements of waves and turbulent fluxes were collected from a moored surface buoy in the Philippine Sea. Waves were partitioned into their wind sea and swell components, and the ratio of swell to wind sea energy was used to assign a swell index. The 10-m neutral drag coefficient was calculated using the eddy correlation method. Four hundred hours of data were processed in 30 minute runs for wind speeds 8.5 to 16.5 m s-1 when the peak wave direction was within 90° of the wind direction and included observations during mixed seas, swell dominant, and wind sea dominant conditions. The data were analyzed to explore the influence of swell on the drag coefficient. It was found that when compared to periods of equal wind speed, the drag coefficient was reduced up to 37 % when swell energy was twice that of the wind sea energy. It is believed that this reduction was due to a decrease in the turbulent flux around the swell frequency, suggesting that the swell diminishes the surface aerodynamic roughness.

  12. Swell and the drag coefficient

    NASA Astrophysics Data System (ADS)

    Potter, Henry

    2015-03-01

    Simultaneous measurements of waves and turbulent fluxes were collected from a moored surface buoy in the Philippine Sea. Waves were partitioned into their wind sea and swell components, and the ratio of swell to wind sea energy was used to assign a swell index. The 10-m neutral drag coefficient was calculated using the eddy correlation method. Four hundred hours of data were processed in 30 minute runs for wind speeds 8.5 to 16.5 m s-1 when the peak wave direction was within 90° of the wind direction and included observations during mixed seas, swell dominant, and wind sea dominant conditions. The data were analyzed to explore the influence of swell on the drag coefficient. It was found that when compared to periods of equal wind speed, the drag coefficient was reduced up to 37 % when swell energy was twice that of the wind sea energy. It is believed that this reduction was due to a decrease in the turbulent flux around the swell frequency, suggesting that the swell diminishes the surface aerodynamic roughness.

  13. Semiconductor polycrystalline alpha detectors

    NASA Astrophysics Data System (ADS)

    Schieber, M.; Roth, M.; Zuck, A.; Marom, G.; Khakhan, O.; Alfassi, Z. B.

    2006-08-01

    In order to check possible novel neutron detectors based on composite semiconductor detectors containing nuclides with large cross sections for neutron, we tested their response to alpha particles. In the present paper we describe results obtained with composite samples made of hexagonal Boron Nitride particles bound with Polystyrene or Nylon-6. The samples were tested under 5.5 MeV alpha particle radiation emitted from 241Am source and 4.8MeV alpha particle of 226Ra source. Some of the responses of these composite detectors to thermal neutrons were already reported and here we shall show some newer results obtained with thermal neutrons, from a low intensity 241Am - 9Be and also from a medium intensity 252Cf source, which were thermalized using 10 cm thick paraffin. The Alpha detection experiments show that all the tested samples, regardless of the binder, show a well-defined peak around the 270 energy channel. There was very little polarization of the alpha radiation, since the amplitude of the alpha peak is reduced after ~ 2min from start of the irradiation, from 100% to 95% and it stayed stable at this level for another 10 minutes. The alpha spectrum detected from a PbI II single crystal is also shown for comparison. The neutron spectrum obtained by the composite BN samples showed an apparent peak around the 150 energy channel. The Signal to noise ratio for neutron detection from radionuclide shown here is about 2 only, whereas recent results to be published later, obtained with our composite BN detectors from a neutron beam of about 10 7 sec -1cm -2 is ~2 5. The 1.4 and 1.7 MeV alpha peaks resulting from the nuclear reaction of thermal neutrons with 10B of the boron nitride detector are not buried in the noise range. The capacitance noise requires small contact areas, therefore for large area detectors it is necessary to produce an electronic read-out device which can add up a multitude of small (less than 10sq.mm) pixilated contacts.

  14. Effective ionization coefficients and electron drift velocities in gas mixtures of SF6 with He, Xe, CO2 and N2 from Boltzmann analysis

    Microsoft Academic Search

    M. J. Pinheiro; J. Loureiro

    2002-01-01

    The effective reduced electron ionization coefficients (alpha-eta)\\/N, with alpha and eta denoting the first Townsend ionization and attachment coefficients, respectively, and the drift velocities are calculated for different mixture compositions of SF6 with He, Xe, CO2 and N2, by solving the electron Boltzmann equation, under the two-term approximation, in a steady-state Townsend discharge. It is shown that a self-contained equation

  15. Liver and Alpha-1

    MedlinePLUS

    ... harm the liver are a virus, such as hepatitis B or C, or a chemical such as alcohol. There is no scientific evidence that carriers with the MS genes are at increased risk for liver disease. What Are Some Symptoms Of Alpha-1 Liver ...

  16. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  17. Alpha-particle-induced cancer in humans.

    PubMed

    Mays, C W

    1988-10-01

    Updated information is given on alpha-particle-induced cancer in persons internally exposed to 222Rn progeny, Thorotrast, long-lived 226Ra and 228Ra, and short-lived 224Ra. The lung cancer risk to persons breathing 222Rn progeny in the indoor air of offices, schools, and homes is of increasing concern. About half of the recent deaths among the German Thorotrast patients have been from liver cancer. Animal studies indicate that the liver cancer risk from Thorotrast is mainly from its radioactivity and that the risk coefficient for the Thorotrast patients can be used provisionally for other alpha emitters in the human liver. Six skeletal cancers have occurred in persons with average skeletal doses between 0.85 and 11.8 Gy from 226Ra and 228Ra. In the low-dose German 224Ra patients, two skeletal sarcomas have occurred at about 0.7 Gy compared to about six cases predicted by results from 224Ra patients at higher doses. The minimal appearance time for radiation-induced bone sarcomas in humans is about 4 y. Following brief irradiation, the vast majority of induced bone sarcomas are expressed by about 30 y. Recent evidence against the "practical threshold" hypothesis is given. With the downward revision of neutron doses to the atomic-bomb survivors, the follow-up of persons exposed to alpha particles may be the best opportunity to evaluate directly the effects of high LET radiation on humans. PMID:2844697

  18. ChemTeacher: Alpha Decay

    NSDL National Science Digital Library

    2011-01-01

    ChemTeacher compiles background information, videos, articles, demonstrations, worksheets and activities for high school teachers to use in their classrooms. The Alpha Decay page includes resources for teaching students about the discovery and applications of alpha decay.

  19. Virial coefficients of model alkanes

    NASA Astrophysics Data System (ADS)

    Schultz, Andrew J.; Kofke, David A.

    2010-09-01

    We report the results from Mayer-sampling Monte Carlo calculations of the virial coefficients of the united-atom TraPPE-UA model of normal alkanes. For alkane chain lengths from n =2 to 20 (where n is the number of carbon atoms), results are given for the virial coefficients B2, B3, and B4; results for B5 are given for chains up to length n =12; and results for B6 are given for chains of length n =2, 3, and 4. In all cases, values are given for temperatures ranging from 200 K to 2000 K in 20-50 K increments. The values are used to calculate the equation of state for butane and the pressure-density behavior is compared to experimental data at 350 and 550 K. Critical points are calculated for all systems and compared to simulation data previously taken for the same molecular model, and to experiment. The comparison with temperature is very good (within 1.5% for all chain lengths up to n =12), while the critical density is underestimated by about 5%-15% and the critical pressure is given within about 10%. The convergence behavior of the virial equation of state as applied across the n-alkane series is well characterized by corresponding states, meaning that the accuracy at a given density relative to the critical density does not deteriorate with increasing chain length.

  20. Measurements of thermal accommodation coefficients.

    SciTech Connect

    Rader, Daniel John; Castaneda, Jaime N.; Torczynski, John Robert; Grasser, Thomas W.; Trott, Wayne Merle

    2005-10-01

    A previously-developed experimental facility has been used to determine gas-surface thermal accommodation coefficients from the pressure dependence of the heat flux between parallel plates of similar material but different surface finish. Heat flux between the plates is inferred from measurements of temperature drop between the plate surface and an adjacent temperature-controlled water bath. Thermal accommodation measurements were determined from the pressure dependence of the heat flux for a fixed plate separation. Measurements of argon and nitrogen in contact with standard machined (lathed) or polished 304 stainless steel plates are indistinguishable within experimental uncertainty. Thus, the accommodation coefficient of 304 stainless steel with nitrogen and argon is estimated to be 0.80 {+-} 0.02 and 0.87 {+-} 0.02, respectively, independent of the surface roughness within the range likely to be encountered in engineering practice. Measurements of the accommodation of helium showed a slight variation with 304 stainless steel surface roughness: 0.36 {+-} 0.02 for a standard machine finish and 0.40 {+-} 0.02 for a polished finish. Planned tests with carbon-nanotube-coated plates will be performed when 304 stainless-steel blanks have been successfully coated.

  1. A Note on Using Stratified Alpha to Estimate the Composite Reliability of a Test Composed of Interrelated Nonhomogeneous Items

    ERIC Educational Resources Information Center

    Rae, Gordon

    2007-01-01

    The relationship between stratified alpha (alpha-sub(s)) and the reliability of a test composed of interrelated nonhomogeneous items is examined. It is mathematically demonstrated that when there is congeneric equivalence within the strata or subtests, the difference between the coefficients is a function of the variances of the loadings within…

  2. Study of backscattering in alpha-particle sources with the new code AlfaMC

    NASA Astrophysics Data System (ADS)

    Vargas, M. Jurado; Timón, A. Fernández

    2015-01-01

    The activity of alpha-particle sources with negligible thickness can be absolutely determined using 2? counting geometry detectors, requiring corrections for backscattering from the source backing. The experimental determination of these corrections is subject to large uncertainties, because the contribution of the backscattered alpha particles to the total counting is generally very low. An interesting alternative is then to use Monte Carlo methods which simulate the transport of alpha-particles into the source. The programme AlfaMC, a new Monte Carlo code developed to simulate specifically the transport of alpha particles, was here applied to the study of the backscattering in alpha-particle sources. Energy and angular distributions for the backscattered alpha particles were deeply analysed based on a multiple scattering process, as a result of a large number of weak collisions with atomic electrons. Some calculated values for the backscattering coefficient were compared with experimental values, showing a good agreement.

  3. Damped Lyman alpha Systems

    E-print Network

    Arthur M. Wolfe; Eric Gawiser; Jason X. Prochaska

    2005-09-17

    Observations of damped Lyman alpha systems offer a unique window on the neutral-gas reservoirs that gave rise to galaxies at high redshifts. This review focuses on critical properties such as the H I and metal content of the gas and on independent evidence for star formation. Together, these provide an emerging picture of gravitationally bound objects in which accretion of gas from the IGM replenishes gas consumed by star formation. Other properties such as dust content, molecular content, ionized-gas content, gas kinematics, and galaxy identifications are also reviewed. These properties point to a multiphase ISM in which radiative and hydrodynamic feedback processes are present. Numerical simulations and other types of models used to describe damped Lyman alpha systems within the context of galaxy formation are also discussed.

  4. The emission coefficient of uranium plasmas

    NASA Technical Reports Server (NTRS)

    Schneider, R. T.; Campbell, H. D.; Mack, J. M.

    1973-01-01

    The emission coefficient for uranium plasmas (Temperature: 8000 K) was measured for the wavelength range (200 A - 6000 A). The results are compared to theory and other measurements. The absorption coefficient for the same wavelength interval is also given.

  5. The alpha 21264 microprocessor

    Microsoft Academic Search

    Richard E. Kessler

    1999-01-01

    The third generation Alpha microprocessor from Compaq Computer Corporation (formerly Digital Equipment) is the 21264. This microprocessor can execute 2.0-2.4 billion instructions per second with a 500-600 MHz cycle time in a 0.35 um CMOS process, resulting in the industry-leading performance of 30+ SPECint95 and 58+ SPECfp95 in early system offerings. This paper focuses on the overall 21264 architecture, as

  6. A model for the disc Lyman alpha emission of Uranus

    SciTech Connect

    Jaffel, L.B.; Vidal-Madjar, A. (Centre National de la Recherche Scientifique, Paris (France)); Prange, R.; Emerich, C. (Inst. d'Astrophysique Spatiale, Verrieres le Buisson (France)); McConnell, J.C. (York Univ., North York, Ontario (Canada))

    1991-06-01

    A new efficient radiative transfer algorithm for inhomogeneous atmospheres has been used to simulate the limb to limb Lyman {alpha} reflectivities observed with the Voyager ultraviolet spectrometer during the flyby of Uranus. It was shown that complete frequency redistribution should be adequate to describe the disc emissions. The model atmosphere used was derived using a combination of Voyager measurements and modeling. Atomic H densities calculated had sources derivable directly from solar FUV and EUV fluxes. To fit the observations, four contributions are evaluated: (1) the resonance scattering of solar Lyman {alpha} radiation, (2) Rayleigh-Raman scattering of solar Lyman {alpha} radiation, (3) the resonance scattering of interplanetary Lyman {alpha} radiation, and (4) a possible internal source of unknown origin. From comparison with the observations, and provided that the published Voyager calibrations are correct, it is shown that only atmospheres with low eddy diffusion coefficients (K{sub H}{le}100 cm{sup 2} s{sup {minus}1}) and an internal source could simulate both the shape and the strength of the measured disc emission. The main results are then that the direct solar Lyman {alpha} scattering contribution (type 1 plus type 2) is of the order of 760 R, the scattering of interplanetary Lyman {alpha} contributes about 320 R, and a small additional internal source providing about 100-500 R is needed to match the measurements. Further, the analysis of the disc intensities suggests that there is no strong variation of K with latitude.

  7. Radiation Pressure in Lyman-alpha Forest Clouds

    E-print Network

    Michael Fisher

    2007-05-01

    The effective recombination coefficient, alpha_eff, is refined for optically thin cases. Radiation pressure in Lyman-alpha and HeII Lyman-alpha is calculated in terms of the number density and the mean free path. Pressure equilibrium between Lyman-alpha clouds and an adiabatically expanding inter-galactic medium is assumed, n_i T_i = n_c T_c. Numerical models of isothermal and adiabatic expanding Lyman-alpha forest clouds are presented, including evolving UV sources (QSOs), with various turn-on times z_on = 20, 10, and 5, and with q_0 = 1/2 in a matter-dominated Friedmann-Robertson-Walker Universe. These models lead to the conclusion that the radiation pressure and QSO turn-on time are significant in determining the range of physical size, D, and neutral hydrogen column density, N(HI), permitted for stable Lyman-alpha forest clouds. This manuscript was written in 1989 and never submitted for publication.

  8. Clustering coefficients of lexical neighborhoods

    PubMed Central

    Altieri, Nicholas; Gruenenfelder, Thomas; Pisoni, David B.

    2011-01-01

    High neighborhood density reduces the speed and accuracy of spoken word recognition. The two studies reported here investigated whether Clustering Coefficient (CC) — a graph theoretic variable measuring the degree to which a word’s neighbors are neighbors of one another, has similar effects on spoken word recognition. In Experiment 1, we found that high CC words were identified less accurately when spectrally degraded than low CC words. In Experiment 2, using a word repetition procedure, we observed longer response latencies for high CC words compared to low CC words. Taken together, the results of both studies indicate that higher CC leads to slower and less accurate spoken word recognition. The results are discussed in terms of activation-plus-competition models of spoken word recognition. PMID:21423865

  9. Bare alpha-alpha Potential and Implications on alpha-MATTER Properties

    Microsoft Academic Search

    F. Carstoiu; S. Misicu; M. Rizea; M. Lassaut

    2011-01-01

    Double folding alpha - alpha potentials based on the density dependent n - n Gogny interactions are constrained to reproduce the l = 0 resonance in 8Be. Shallow potentials are obtained by successive supersymmetric transformations which eliminate the l = 0 Pauli forbidden states. Implication for the EOS of cold alpha-matter are discussed.

  10. Soccer Ball Lift Coefficients via Trajectory Analysis

    ERIC Educational Resources Information Center

    Goff, John Eric; Carre, Matt J.

    2010-01-01

    We performed experiments in which a soccer ball was launched from a machine while two high-speed cameras recorded portions of the trajectory. Using the trajectory data and published drag coefficients, we extracted lift coefficients for a soccer ball. We determined lift coefficients for a wide range of spin parameters, including several spin…

  11. M-Bonomial Coefficients and Their Identities

    ERIC Educational Resources Information Center

    Asiru, Muniru A.

    2010-01-01

    In this note, we introduce M-bonomial coefficients or (M-bonacci binomial coefficients). These are similar to the binomial and the Fibonomial (or Fibonacci-binomial) coefficients and can be displayed in a triangle similar to Pascal's triangle from which some identities become obvious.

  12. Standards for Standardized Logistic Regression Coefficients

    ERIC Educational Resources Information Center

    Menard, Scott

    2011-01-01

    Standardized coefficients in logistic regression analysis have the same utility as standardized coefficients in linear regression analysis. Although there has been no consensus on the best way to construct standardized logistic regression coefficients, there is now sufficient evidence to suggest a single best approach to the construction of a…

  13. Estimation of Internal Consistency Reliability When Test Parts Vary in Effective Length.

    ERIC Educational Resources Information Center

    Feldt, Leonard S.; Charter, Richard A.

    2003-01-01

    Evaluating a test's reliability often requires dividing it into 3 or more unequal parts, which causes violation of the tau equivalence assumption of Cronbach's alpha. This article presents a criterion for abandoning alpha and an approach for computing a more appropriate estimate of reliability, the Gilmer-Feldt coefficient. (Author)

  14. Substitutional and Interstitial Diffusion in alpha2-Ti3Al(O)

    NASA Technical Reports Server (NTRS)

    Copland, Evan; Young, David J.; Gleeson, Brian; Jacobson, Nathan

    2007-01-01

    The reaction between Al2O3 and alpha2-Ti3Al was studied with a series of Al2O3/alpha2-Ti3Al multiphase diffusion couples annealed at 900, 1000 and 1100 C. The diffusion-paths were found to strongly depend on alpha2- Ti3Al(O) composition. For alloys with low oxygen concentrations the reaction involved the reduction of Al2O3, the formation of a gamma-TiAl reaction-layer and diffusion of Al and O into the alpha2-Ti3Al substrate. Measured concentration profiles across the interaction-zone showed "up-hill" diffusion of O in alpha2-Ti3Al(O) indicating a significant thermodynamic interaction between O and Al, Ti or both. Diffusion coefficients for the interstitial O in alpha2-Ti3Al(O) were determined independently from the interdiffusion of Ti and Al on the substitutional lattice. Diffusion coefficients are reported for alpha2-Ti3Al(O) as well as gamma-TiAl. Interpretation of the results were aided with the subsequent measurement of the activities of Al, Ti and O in alpha 2-Ti3Al(O) by Knudsen effusion-cell mass spectrometry.

  15. Water transport by the bacterial channel alpha-hemolysin

    NASA Technical Reports Server (NTRS)

    Paula, S.; Akeson, M.; Deamer, D.

    1999-01-01

    This study is an investigation of the ability of the bacterial channel alpha-hemolysin to facilitate water permeation across biological membranes. alpha-Hemolysin channels were incorporated into rabbit erythrocyte ghosts at varying concentrations, and water permeation was induced by mixing the ghosts with hypertonic sucrose solutions. The resulting volume decrease of the ghosts was followed by time-resolved optical absorption at pH 5, 6, and 7. The average single-channel permeability coefficient of alpha-hemolysin for water ranged between 1.3x10-12 cm/s and 1.5x10-12 cm/s, depending on pH. The slightly increased single-channel permeability coefficient at lower pH-values was attributed to an increase in the effective pore size. The activation energy of water transport through the channel was low (Ea=5.4 kcal/mol), suggesting that the properties of water inside the alpha-hemolysin channel resemble those of bulk water. This conclusion was supported by calculations based on macroscopic hydrodynamic laws of laminar water flow. Using the known three-dimensional structure of the channel, the calculations accurately predicted the rate of water flow through the channel. The latter finding also indicated that water permeation data can provide a good estimate of the pore size for large channels.

  16. Estimating Ordinal Reliability for Likert-Type and Ordinal Item Response Data: A Conceptual, Empirical, and Practical Guide

    ERIC Educational Resources Information Center

    Gadermann, Anne M.; Guhn, Martin; Zumbo, Bruno D.

    2012-01-01

    This paper provides a conceptual, empirical, and practical guide for estimating ordinal reliability coefficients for ordinal item response data (also referred to as Likert, Likert-type, ordered categorical, or rating scale item responses). Conventionally, reliability coefficients, such as Cronbach's alpha, are calculated using a Pearson…

  17. Surface alpha clustering

    SciTech Connect

    Rotter, I.

    1983-05-01

    The problem of alpha decay is discussed on the basis of a theory which describes discrete and continuous states in a unified manner. A formula for numerical calculations is given in which configurational mixing as well as channel coupling is taken into account. The R-matrix approximation is shown to be justified if the width is spread over a small number of decay channels. Generally, renormalization of the wave function is necessary if a factorization of the width is assumed. The importance of channel coupling for the case of a small reduced width is discussed.

  18. Alpha-mannosidosis

    PubMed Central

    Malm, Dag; Nilssen, Øivind

    2008-01-01

    Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be treated frequently. Otolaryngological treatment of fluid in the middle ear is often required and use of hearing aids is invariably required. Early educational intervention for development of social skills is needed and physiotherapy is important to improve bodily function. Orthopedic surgery may be necessary. The long-term prognosis is poor. There is an insidiously slow progression of neuromuscular and skeletal deterioration over several decades, making most patients wheel-chair dependent. No patients manage to be completely socially independent. Many patients are over 50 years of age. PMID:18651971

  19. OXYGEN MOBILITY IN POLYCRYSTALLINE NiCrâOâ AND \\/cap alpha\\/- FeâOâ

    Microsoft Academic Search

    W. D. Kingery; D. C. Hill; R. P. Nelson

    1960-01-01

    Oxygen diffusion coefficients were determined for polycrystalline ; samples of NiCrâOâ and alpha -FeâOâ by exchange ; measurements with oxygen gas containing the stable isotope O¹⁸, using mass ; spectrometer analysis. Oxygen diffusion in NiCrâOâ can be ; represented by the equation D = 0.017 exp (-65,400\\/RT). Oxygen diffusion in ; alpha -FeâOâ can be represented by the equation D

  20. Gas-film coefficients for streams

    USGS Publications Warehouse

    Rathbun, R.E.; Tai, D.Y.

    1983-01-01

    Equations for predicting the gas-film coefficient for the volatilization of organic solutes from streams are developed. The film coefficient is a function of windspeed and water temperature. The dependence of the coefficient on windspeed is determined from published information on the evaporation of water from a canal. The dependence of the coefficient on temperature is determined from laboratory studies on the evaporation of water. Procedures for adjusting the coefficients for different organic solutes are based on the molecular diffusion coefficient and the molecular weight. The molecular weight procedure is easiest to use because of the availability of molecular weights. However, the theoretical basis of the procedure is questionable. The diffusion coefficient procedure is supported by considerable data. Questions, however, remain regarding the exact dependence of the film coefficint on the diffusion coefficient. It is suggested that the diffusion coefficient procedure with a 0.68-power dependence be used when precise estimate of the gas-film coefficient are needed and that the molecular weight procedure be used when only approximate estimates are needed.

  1. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  2. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  3. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  4. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W. (Los Alamos, NM); Wolf, Michael A. (Los Alamos, NM); McAtee, James L. (Los Alamos, NM); Unruh, Wesley P. (Los Alamos, NM); Cucchiara, Alfred L. (Los Alamos, NM); Huchton, Roger L. (Los Alamos, NM)

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  5. Electron Swarm Coefficients in – and – Mixtures

    Microsoft Academic Search

    Mohammed Yousfi; Jaime de Urquijo; Antonio Juárez; Eduardo Basurto; Jose Luis Hernández-Ávila

    2009-01-01

    The electron swarm coefficients (i.e., drift velocity, longitudinal diffusion coefficient, and effective ionization coefficient) have been measured using a time-resolved pulsed Townsend technique in O2, N2, and CO2 and their mixtures CO2-N2 and CO2-O2, with CO2 shares of 20%, 50%, and 80%. Simultaneously, these swarm data have been calculated from an adequate multiterm solution of the Boltzmann equation, using previously

  6. Equations for Annular-Heat-Transfer Coefficients

    NASA Technical Reports Server (NTRS)

    Yao, B.

    1986-01-01

    Tables of coefficients converted to algebraic expressions. Plot of Equation for Nusselt number agrees closely with points from tabulated data. Equation for Nusselt number and those for coefficients A and B obtained by regression analysis of data. Other plots also show close agreement for radius of 0.1 and 0.2. In equation form, coefficients incorporated into mathematical models more readily than as tabular data. Equations simplify design and analysis of heat exchangers.

  7. Townsend Ionization Coefficients in Cs-Ag-O Photo-Tubes Filled with Argon

    Microsoft Academic Search

    W. S. Huxford

    1939-01-01

    The attempt is made to account for the amplification of photo-currents at low current densities in argon-filled Cs-Ag-O tubes on the basis of Townsend's theory assuming secondary electron emission by positive ions. Special sealed-off tubes were used having parallel plates at various separations and a constant gas pressure. Values of the Townsend coefficients alpha and gamma were determined at each

  8. Measurement of Ionization and Attachment Coefficients in C3F8

    Microsoft Academic Search

    J. L. Moruzzi; J. D. Craggs

    1963-01-01

    The growth of pre-breakdown currents in uniform field conditions in C3F8 at various pressures, for values of E\\/p in the range 90-300 V cm-1 mmHg-1 indicates large electron attachment processes. Assuming that the relevant mechanism of negative ion formation is dissociative attachment, values of the ionization and attachment coefficients (alpha and eta) have been calculated from the semi-logarithmic plots of

  9. Gas phase hydrogen permeation in alpha titanium and carbon steels

    NASA Technical Reports Server (NTRS)

    Johnson, D. L.; Shah, K. K.; Reeves, B. H.; Gadgeel, V. L.

    1980-01-01

    Commercially pure titanium and heats of Armco ingot iron and steels containing from 0.008-1.23 w/oC were annealed or normalized and machined into hollow cylinders. Coefficients of diffusion for alpha-Ti and alpha-Fe were determined by the lag-time technique. Steady state permeation experiments yield first power pressure dependence for alpha-Ti and Sievert's law square root dependence for Armco iron and carbon steels. As in the case of diffusion, permeation data confirm that alpha-titanium is subject to at least partial phase boundary reaction control while the steels are purely diffusion controlled. The permeation rate in steels also decreases as the carbon content increases. As a consequence of Sievert's law, the computed hydrogen solubility decreases as the carbon content increases. This decreases in explained in terms of hydrogen trapping at carbide interfaces. Oxidizing and nitriding the surfaces of alpha-titanium membranes result in a decrease in the permeation rate for such treatment on the gas inlet surfaces but resulted in a slight increase in the rate for such treatment on the gas outlet surfaces. This is explained in terms of a discontinuous TiH2 layer.

  10. Gross alpha analytical modifications that improve wastewater treatment compliance

    SciTech Connect

    Tucker, B.J. [Shaw Environmental and Infrastructure, Salem, NH (United States); Arndt, S. [Safety and Ecology Corporation, Maywood, NJ (United States)

    2007-07-01

    This paper will propose an improvement to the gross alpha measurement that will provide more accurate gross alpha determinations and thus allow for more efficient and cost-effective treatment of site wastewaters. To evaluate the influence of salts that may be present in wastewater samples from a potentially broad range of environmental conditions, two types of efficiency curves were developed, each using a thorium-230 (Th-230) standard spike. Two different aqueous salt solutions were evaluated, one using sodium chloride, and one using salts from tap water drawn from the Bergen County, New Jersey Publicly Owned Treatment Works (POTW). For each curve, 13 to 17 solutions were prepared, each with the same concentration of Th-230 spike, but differing in the total amount of salt in the range of 0 to 100 mg. The attenuation coefficients were evaluated for the two salt types by plotting the natural log of the counted efficiencies vs. the weight of the sample's dried residue retained on the planchet. The results show that the range of the slopes for each of the attenuation curves varied by approximately a factor of 2.5. In order to better ensure the accuracy of results, and thus verify compliance with the gross alpha wastewater effluent criterion, projects depending on gross alpha measurements of environmental waters and wastewaters should employ gross alpha efficiency curves prepared with salts that mimic, as closely as possible, the salt content of the aqueous environmental matrix. (authors)

  11. Reliability of Summed Item Scores Using Structural Equation Modeling: An Alternative to Coefficient Alpha

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    A method is presented for estimating reliability using structural equation modeling (SEM) that allows for nonlinearity between factors and item scores. Assuming the focus is on consistency of summed item scores, this method for estimating reliability is preferred to those based on linear SEM models and to the most commonly reported estimate of…

  12. A Reliability Generalization Meta-Analysis of Coefficient Alpha for the Maslach Burnout Inventory

    ERIC Educational Resources Information Center

    Wheeler, Denna L.; Vassar, Matt; Worley, Jody A.; Barnes, Laura L. B.

    2011-01-01

    The purpose of this study was to synthesize internal consistency reliability for the subscale scores on the Maslach Burnout Inventory (MBI). The authors addressed three research questions: (a) What is the mean subscale score reliability for the MBI across studies? (b) What factors are associated with observed variance in MBI subscale score…

  13. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  14. [Microorganisms that produce alpha-galactosidase, alpha-mannosidase, alpha-fucosidase and beta-acetylglucosaminidase].

    PubMed

    Ulezlo, I V; Zaprometova, O M; Ozerskaia, S M; Bezborodov, A M

    1980-01-01

    The capacity to synthesize alpha-D-galactosidase (EC 3.2.1.22), alpha-D-mannosidase (EC 3.2.1.24), alpha-L-fucosidase (EC 3.2.1.51) and beta-D-acetylglucose aminidase (EC 3.2.1.30) was tested among 100 different cultures of soil microscopic fungi and actinomycetes. Two genera of micromycetes, viz. Scopulariopsis and Aposphaeria, which had not been known as producing alpha-D-galactosidase, were found, as well as several new species of the genus Penicillium: Pen. canescens, Pen. claviforme, Pen. cyclopium, Pen. daleae, Pen. frequentans, Pen. piscarum, Pen. simplicissimu, Pen. thomii. PMID:6248742

  15. [Alpha-glucosidase inhibitor].

    PubMed

    Osonoi, Takeshi

    2015-03-01

    Alpha-glucosidase inhibitors (?-GI) have abdominal signs which are generally regarded as side-reaction. The abdominal signs are caused by generation of intestinal gas which contains hydrogen gas. The hydrogen gas absorbed in the body eliminates oxidant stress and consequently the abdominal signs may have beneficial effects preventing onset and progression of arteriosclerosis. Recently, it has been reported that the combination therapy of dipeptidyl peptidase-4 inhibitors with a-GI enhances glucagon like peptide-1 (GLP- 1) secretion and increases active GLP-1 concentration. Therefore, ?-GI is not only a matured and reliable oral anti-diabtic agent (OAD) but also a promising OAD which collaborates effectively with DPP-4 inhibitors or sodium-glucose cotransporter-2 inhibitors. PMID:25812363

  16. Live! From 2-Alpha

    NSDL National Science Digital Library

    This activity is one of several in which students are required to access and analyze actual data from NASA missions, including video "interviews" with real NASA scientists, to solve a mystery. In this mystery, students learn about the force of gravity and how scientists analyze data by studying the properties of different objects in space. Live! From 2-Alpha can be used to support instruction about forces and motion, origin and evolution of the universe, and the interaction of energy and matter. This activity is one of several in "Space Mysteries," a series of inquiry-driven, interactive Web explorations. Each Mystery in "Space Mysteries" is designed to teach at least one physical science concept (e.g. interactions of energy and matter, structures and properties of matter, energy, motion, or forces), and is accompanied by materials to be used by classroom teachers.

  17. ORNL ALPHA MIS programmer's manual

    SciTech Connect

    Haese, R.L.; Smith, S.E.; Lovin, J.K.; Grubb, J.W.

    1984-08-01

    This manual is a reference tool for programmers who are responsible for the software maintenance of the ALPHA system user interface program, also called simply ALPHA. This ALPHA user program is a part of the overall ALPHA Management Information System (MIS), which is a general-purpose MIS. The ALPHA user interface program provides the ALPHA MIS with a user-friendly, interactive interface between the general user and the System 1022 (trademark of Software House) data base. Through this facility the general user is able to choose a data base, select records from the data base, sort those records, and display in a variety of ways useful information contained in those records. User friendliness is supported by an extensive HELP facility. This manual documents all source code necessary for the successful compilation of the ALPHA user program (version 3-A). Also included is documentation covering the external files and common blocks necessary for the successful compilation of this program as well as the system reference file, which drives the program after it is compiled. Data base external files and tables that may be accessed by the ALPHA user program are documented elsewhere.

  18. EEG Alpha Power and Intelligence.

    ERIC Educational Resources Information Center

    Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.

    2002-01-01

    Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

  19. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  20. Absorption Coefficients and Impedance Daniel A. Russell

    E-print Network

    Russell, Daniel A.

    1 Absorption Coefficients and Impedance Daniel A. Russell Science and Mathematics Department will measure the absorption coefficients and acoustic impedance of samples of acoustic absorbing materials material is responsible for almost 50% of sound absorption inside an automobile). The reverberation time

  1. Measurements of Gamma-Ray Attenuation Coefficients

    Microsoft Academic Search

    B. Goswami; N. Chaudhuri

    1973-01-01

    Measurements have been made to determine gamma-ray attenuation coefficients very accurately by using an extremely-narrow-collimated-beam transmission method which effectively excluded corrections due to small-angle and multiple scattering of photons. The measured mass attenuation coefficients with maximum errors less than 3% for 34 elements in the range from hydrogen to lead are given.

  2. Photoionization rate coefficients for the rare gases

    Microsoft Academic Search

    Xuexia Pang

    2005-01-01

    By introducing the converting method from electron-impact ionization cross sections to rate coefficients through using a semi-experiential formula, we try to probe a semi-experiential formula for converting the photo-ionization cross sections into photo-ionization rate coefficient. It\\

  3. APPENDIX I Partition Coefficients For Thorium

    E-print Network

    APPENDIX I Partition Coefficients For Thorium #12;Appendix I Partition Coefficients For Thorium of thorium Kd values for the look-up table. These assumptions were based on the findings of the literature review conducted on the geochemical processes affecting thorium sorption. The assumptions are as follows

  4. A gain-coefficient switched Alexandrite laser

    NASA Astrophysics Data System (ADS)

    Lee, Chris J.; van der Slot, Peter J. M.; Boller, Klaus-J.

    2013-01-01

    We report on a gain-coefficient switched Alexandrite laser. An electro-optic modulator is used to switch between high and low gain states by making use of the polarization dependent gain of Alexandrite. In gain-coefficient switched mode, the laser produces 85 ns pulses with a pulse energy of 240 mJ at a repetition rate of 5 Hz.

  5. A gain-coefficient switched Alexandrite laser

    E-print Network

    Lee, Chris J; Boller, Klaus-J

    2012-01-01

    We report on a gain-coefficient switched Alexandrite laser. An electro-optic modulator is used to switch between high and low gain states by making use of the polarization dependent gain of Alexandrite. In gain-coefficient switched mode, the laser produces 85 ns pulses with a pulse energy of 240 mJ at a repetition rate of 5 Hz.

  6. SPECTRAL MEASURE AND APPROXIMATION OF HOMOGENIZED COEFFICIENTS

    E-print Network

    Boyer, Edmond

    matrix whose entries are the conductances (z, z +ei) of the edges (z, z +ei) starting at z, where {ei}i{1-product of this homogenization result, one obtains a characterization of the homogenized coefficients Ahom: it is shown) = 0. With this corrector, the homogenized coefficients Ahom can be characterized as · Ahom

  7. Determination of Longitudinal Dispersion Coefficient and Net

    E-print Network

    Ho, David

    Determination of Longitudinal Dispersion Coefficient and Net Advection in the Tidal Hudson River dispersion coefficient to be 70.1 ( 4.3 m2 s-1. Temporal evolution of the SF6 inventory indicates an average climatically forced variables (e.g., changes in freshwater runoff) as well as spills of contaminants related

  8. APPENDIX J Partition Coefficients For Uranium

    E-print Network

    APPENDIX J Partition Coefficients For Uranium #12;Appendix J Partition Coefficients For Uranium J.1.0 Background The review of uranium Kd values obtained for a number of soils, crushed rock and their effects on uranium adsorption on soils are discussed below. The solution pH was also used as the basis

  9. APPENDIX G Partition Coefficients For Plutonium

    E-print Network

    APPENDIX G Partition Coefficients For Plutonium #12;Appendix G Partition Coefficients For Plutonium G.1.0 Background A number of studies have focussed on the adsorption behavior of plutonium that Kd values for plutonium typically range over 4 orders of magnitude (Thibault et al., 1990). Also

  10. Calculator program set up for film coefficients

    SciTech Connect

    Gracey, J.O.; Teter, D.L.

    1982-11-15

    Describes a mechanized computation scheme for the film coefficients used in heat transfer calculations designed for the Texas Instruments TI-59 programmable calculator. Presents tables showing application conditions (small diagram included) and the corresponding heat transfer equations for 10 heat flow situations; symbols used; user instructions, a complete film coefficient program; and storage assignments. Example problem and corresponding printout are given.

  11. Alternatives to Pearson's and Spearman's Correlation Coefficients

    E-print Network

    Florentin Smarandache

    2008-05-03

    This article presents several alternatives to Pearson's correlation coefficient and many examples. In the samples where the rank in a discrete variable counts more than the variable values, the mixtures that we propose of Pearson's and Spearman's correlation coefficients give better results.

  12. Rotordynamic force coefficients of pocket damper seals

    E-print Network

    Ertas, Bugra Han

    2005-11-01

    ROTORDYNAMIC FORCE COEFFICIENTS OF POCKET DAMPER SEALS A Dissertation by BUGRA H. ERTAS Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of DOCTOR OF PHILOSOPHY August 2005 Major Subject: Mechanical Engineering ROTORDYNAMIC FORCE COEFFICIENTS OF POCKET DAMPER SEALS A Dissertation by BUGRA H. ERTAS Submitted...

  13. Friction Coefficient for Quarks in Supergravity Duals

    E-print Network

    E. Antonyan

    2006-11-22

    We study quarks moving in strongly-coupled plasmas that have supergravity duals. We compute the friction coefficient of strings dual to such quarks for general static supergravity backgrounds near the horizon. Our results also show that a previous conjecture on the bound has to be modified and higher friction coefficients can be achieved.

  14. An agreement coefficient for image comparison

    USGS Publications Warehouse

    Ji, L.; Gallo, K.

    2006-01-01

    Combination of datasets acquired from different sensor systems is necessary to construct a long time-series dataset for remotely sensed land-surface variables. Assessment of the agreement of the data derived from various sources is an important issue in understanding the data continuity through the time-series. Some traditional measures, including correlation coefficient, coefficient of determination, mean absolute error, and root mean square error, are not always optimal for evaluating the data agreement. For this reason, we developed a new agreement coefficient for comparing two different images. The agreement coefficient has the following properties: non-dimensional, bounded, symmetric, and distinguishable between systematic and unsystematic differences. The paper provides examples of agreement analyses for hypothetical data and actual remotely sensed data. The results demonstrate that the agreement coefficient does include the above properties, and therefore is a useful tool for image comparison. ?? 2006 American Society for Photogrammetry and Remote Sensing.

  15. 3 Properties of Binomial Coefficients 3.1 Properties of Binomial Coefficients

    E-print Network

    Goddard, Wayne

    coefficients are also found in Pascal's triangle. Pascal's triangle has the rule that each entry is the sum. Here is the start of Pascal's triangle with the odd binomial coefficients shaded. c Wayne Goddard

  16. THE COMPLEX FATE OF ALPHA-KETOACIDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant cells are unique in that they contain four species of alpha-ketoacid dehydrogenase complex: plastidial pyruvate dehydrogenase, mitochondrial pyruvate dehydrogenase, alpha-ketoglutarate (2-oxoglutarate) dehydrogenase, and branched-chain alpha-ketoacid dehydrogenase. All complexes include multi...

  17. A new numerical method for conversion of sonic second virial coefficients to density second virial coefficients

    E-print Network

    Mossaad, Ehab

    1999-01-01

    of the requirements for the degree of MASTER OF SCIENCE May 1999 Major Subject: Chemical Engineering A NEW NUMERICAL METHOD FOR CONVERSION OF SONIC SECOND VIRIAL COEFFICIENTS TO DENSITY SECOND VIRIAL COEFFICIENTS A thesis by EHAB MOSSAAD Submitted to Texas Ak... of Department) May 1999 Major Subject: Chemical Engineering ABSTRACT A New Numerical Method For Conversion of Sonic Second Virial Coefficients to Density Second Virial Coefficients. (May 1999) Ehab Mossaad, B. S. , The University of Texas at Austin; Chair...

  18. Carcinogenic risk coefficients at environmental levels of radon exposures: A microdosimetric approach

    SciTech Connect

    Zaider, M. [Columbia Univ., New York, NY (United States); Varma, N. [Department of Energy, Washington, DC (United States)

    1996-06-01

    We report a microdosimetric-based evaluation of the effects of domestic exposure to radon. The risk coefficients obtained here are based on the microdosimetry of radon progeny alpha particles, on a function q(y) for in vivo radiogenic neoplasia, and on scaling A-bomb results (epidemiology + microdosimetry) to radon exposure. We do not use miner data, nor do we invoke such notions as quality factors, dose equivalent or equivalent dose. With basal cells as targets our estimated risk coefficients are in good agreement with the miner data, and thus a quality factor of about 20 (as suggested by ICRP 60) is not unreasonable. However, if we take as targets the secretory cells our risk coefficients are twice as large as those reported by BEIR-IV. The main uncertainty in these estimates remains the dosimetric model. 35 refs., 4 figs., 2 tabs.

  19. Internal consistency and factor structure of 12-item general health questionnaire in visually impaired students

    PubMed Central

    Bakhla, Ajay Kumar; Verma, Vijay; Hembram, Mahesh; Praharaj, Samir Kumar; Sinha, Vinod Kumar

    2013-01-01

    Background: As there are no instruments to measure psychological wellness or distress in visually impaired students, we studied internal consistency and factor structure of GHQ-12 in visually impaired children. Materials and Methods: Internal consistency analysis (Cronbach's alpha and item total correlation) and exploratory factor analysis (principal component analysis) were carried out to identify factor structure of 12-item general health questionnaire (GHQ-12). Results: All items of GHQ-12 were significantly associated with each other and the Cronbach's alpha coefficient for the scale was 0.7. On analysis of principal component, three-factor solution was found that accounted for 47.92% of the total variance. The factors included, ‘general well-being’, ‘depression’ and ‘cognitive’, with Cronbach's alpha coefficients being 0.70, 0.59, and 0.34, respectively. Conclusion: Our study findings suggest GHQ-12 is a reliable with adequate internal consistency scale and multidimensional factor structure in visually impaired students. PMID:25013310

  20. On the emission coefficient of uranium plasmas.

    NASA Technical Reports Server (NTRS)

    Schneider, R. T.; Campbell, H. D.; Mack, J. M.

    1973-01-01

    The emission coefficient for uranium plasmas (temperature: 8000 K) was measured for the wavelength range from 1200 to 6000 A. The results were compared to theoretical calculations and other measurements. Reasonable agreement between theoretical predictions and our measurements was found in the region from 1200 to 2000 A. Although it was difficult to make absolute comparisons among the different reported measurements, considerable disagreement was found for the higher wavelength region. A short discussion regarding the overall comparisons is given, and final suggestions are made as to the most appropriate emission coefficient values to be used in future design calculations. The absorption coefficient for the same wavelength interval is also reported.

  1. Determination of absorption coefficients of thin films

    SciTech Connect

    Lodenquai, J.F. (Univ. of the West Indies, Kingston (Jamaica))

    1994-08-01

    The equations that are usually presented as those used to determine the absorption coefficients of materials in film form based on measurements of transmission and reflection coefficients are fundamentally incorrect. These equations omit a multiplicative factor arising from the complex nature of the refractive indices of the materials. This factor enters explicitly into the relationship between the transmission and reflection coefficients for such materials and is not necessarily close to unity, although in practice this factor can be approximated by unity at least in the infrared through the optical range of wavelengths.

  2. Transport coefficients of a unitarized pion gas

    E-print Network

    Juan M. Torres-Rincon

    2011-11-16

    The latest experimental results in relativistic heavy-ion collisions show that the matter there produced requires transport coefficients because of the important collective properties found. We review the theoretical calculation of these transport coefficients in the hadron side at low temperatures by computing them in a gas composed of low energy pions. The interaction of these pions is taken from an effective chiral theory and further requiring scattering unitarity. The propagation of D and D* mesons in the thermalized pion gas is also studied in order to extract the heavy quark diffusion coefficients in the system.

  3. Radon diffusion coefficients for residential concretes

    SciTech Connect

    Rogers, V.C.; Nielson, K.K.; Holt, R.B. [Rogers and Associates Engineering Corp., Salt Lake City, UT (United States); Snoddy, R. [Acurex Environmental Corp., Research Triangle Park, NC (United States)

    1994-09-01

    Radon gas diffusion through concrete can be a significant mechanism for radon entry into dwellings. Measurements of radon diffusion coefficients in the pores of residential concretes ranged from 2.1 x 10{sup {minus}8} m{sup 2} s{sup {minus}1} to 5.2 x 10{sup {minus}7} m{sup 2} s{sup {minus}1}. The pore diffusion coefficients generally increased with the water-cement ratio of the concrete and decreased with its density. A least-squares regression of the diffusion coefficients on concrete density gave an r value of -0.73. 16 refs., 2 figs., 3 tabs.

  4. Coefficient of restitution of aspherical particles

    NASA Astrophysics Data System (ADS)

    Glielmo, Aldo; Gunkelmann, Nina; Pöschel, Thorsten

    2014-11-01

    We consider the motion of an aspherical inelastic particle of dumbbell type bouncing repeatedly on a horizontal flat surface. The coefficient of restitution of such a particle depends not only on material properties and impact velocity but also on the angular orientation at the instant of the collision whose variance is considerable, even for small eccentricity. Assuming random angular orientation of the particle at the instant of contact we characterize the measured coefficient of restitution as a fluctuating quantity and obtain a wide probability density function including a finite probability for negative values of the coefficient of restitution. This may be understood from the partial exchange of translational and rotational kinetic energy.

  5. Local control versus dose or overall time: from coefficients to percentages.

    PubMed

    Fowler, J F; Chappell, R

    1994-11-01

    When clinical results are analysed to find the treatment variables which affect the outcome, two types of multivariate analysis are done. Firstly, a determination of which variables are important is made: from age, gender, stage, histology, total dose, overall time, etc. Secondly, a quasi-biological model may be set up which includes those variables, e.g. Function (p) = Variable 1 + Variable 2 + ... + alpha x dose + beta x dose x (dose per fraction) - gamma x (overall time) where p is the probability of local control and "Function" is a logit or double-log function. The coefficients thus determined are often presented simply in raw form, or as ratios such as alpha/beta or gamma/alpha where any conversion factors from "Function (p)" to percentages are assumed conveniently to cancel out. However, it is mathematically possible to convert each coefficient directly into "percent change in local control per unit dose" (for alpha), or "percent per unit time" (for gamma), without recourse to the obvious convenience of the ratios. These converted values are more understandable than the coefficients themselves. They mean the rate of change of local control with (for example) total dose if overall time and dose per fraction were held constant; or rate of loss of local control with prolongation if total dose and dose per fraction were held constant. Even though heterogeneity may alter these slopes considerably from the theoretically maximum Poisson slopes, they still tell us what is happening averaged over the group of patients being studied, with often interesting insights. PMID:7820404

  6. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  7. Determination of diffusion coefficient for unsaturated soils

    E-print Network

    Sood, Eeshani

    2005-08-29

    . The laboratory procedure followed involves measuring the soil suction along the length of the sample and at different times using thermocouple psychrometers. The evaluation of the evaporation coefficient (he) has been made an integral part of the procedure...

  8. MITOSIS RECURSION FOR COEFFICIENTS OF SCHUBERT POLYNOMIALS

    E-print Network

    Miller, Ezra N.

    MITOSIS RECURSION FOR COEFFICIENTS OF SCHUBERT POLYNOMIALS EZRA MILLER Abstract.Mitosis is a rule introduced in [KM02a] for manipulating subsets proof of these properties of mitosis. 1. Introduction It has been

  9. Creating materials with a desired refraction coefficient

    E-print Network

    A. G. Ramm

    2009-09-02

    A method is given for creating material with a desired refraction coefficient. The method consists of embedding into a material with known refraction coefficient many small particles of size $a$. The number of particles per unit volume around any point is prescribed, the distance between neighboring particles is $O(a^{\\frac{2-\\kappa}{3}})$ as $a\\to 0$, $0<\\kappa<1$ is a fixed parameter. The total number of the embedded particle is $O(a^{\\kappa-2})$. The physical properties of the particles are described by the boundary impedance $\\zeta_m$ of the $m-th$ particle, $\\zeta_m=O(a^{-\\kappa})$ as $a\\to 0$. The refraction coefficient is the coefficient $n^2(x)$ in the wave equation $[\

  10. Heat transfer coefficient of cryotop during freezing.

    PubMed

    Li, W J; Zhou, X L; Wang, H S; Liu, B L; Dai, J J

    2013-01-01

    Cryotop is an efficient vitrification method for cryopreservation of oocytes. It has been widely used owing to its simple operation and high freezing rate. Recently, the heat transfer performance of cryotop was studied by numerical simulation in several studies. However, the range of heat transfer coefficient in the simulation is uncertain. In this study, the heat transfer coefficient for cryotop during freezing process was analyzed. The cooling rates of 40 percent ethylene glycol (EG) droplet in cryotop during freezing were measured by ultra-fast measurement system and calculated by numerical simulation at different value of heat transfer coefficient. Compared with the results obtained by two methods, the range of the heat transfer coefficient necessary for the numerical simulation of cryotop was determined, which is between 9000 W/(m(2)·K) and 10000 W/(m (2)·K). PMID:23812315

  11. Digestibility and Production Coefficients of Poultry Feeds.

    E-print Network

    Fraps, G. S. (George Stronach)

    1928-01-01

    from the undigested residues. This method was used by Paraschtschuk, Lehmann, Voltz, and partly by Katayama, and the results are designated by the letter 0 in the table of digestion coefficients (Table 8). The third method was proposed by Katayama...

  12. Friction coefficient dependence on electrostatic tribocharging

    PubMed Central

    Burgo, Thiago A. L.; Silva, Cristiane A.; Balestrin, Lia B. S.; Galembeck, Fernando

    2013-01-01

    Friction between dielectric surfaces produces patterns of fixed, stable electric charges that in turn contribute electrostatic components to surface interactions between the contacting solids. The literature presents a wealth of information on the electronic contributions to friction in metals and semiconductors but the effect of triboelectricity on friction coefficients of dielectrics is as yet poorly defined and understood. In this work, friction coefficients were measured on tribocharged polytetrafluoroethylene (PTFE), using three different techniques. As a result, friction coefficients at the macro- and nanoscales increase many-fold when PTFE surfaces are tribocharged, but this effect is eliminated by silanization of glass spheres rolling on PTFE. In conclusion, tribocharging may supersede all other contributions to macro- and nanoscale friction coefficients in PTFE and probably in other insulating polymers. PMID:23934227

  13. Graphing correlation coefficients: II. An alternative procedure.

    PubMed

    Silverstein, A B

    1988-12-01

    A procedure based on the Pythagorean theorem is described for accurately portraying the relationships among the coefficients of correlation (r), determination (r2), nondetermination (1 - r2), and alienation (square root of 1 - r2). PMID:3226839

  14. Random Coefficient Models for Multilevel Analysis.

    ERIC Educational Resources Information Center

    de Leeuw, Jan; Kreft, Ita

    1986-01-01

    A statistical model is proposed for both contextual analysis and slopes as outcomes analysis. A random coefficient model is investigated in detail. Various estimation models are reviewed and applied to a Dutch school-career example. (Author/LMO)

  15. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu. [All-Russia Research Institute of Automatics (FSUE VNIIA) (Russian Federation); Tchuvil’sky, Yu. M. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation)

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  16. Long-range alpha detection

    SciTech Connect

    Kasper, K.

    1998-12-01

    The detection and measurement of alpha contamination is not an easy task. An alpha particle`s characteristic high charge and large mass make it highly interactive with surrounding matter. The particle is often absorbed before its presence can be sensed with a detector. Los Alamos National Laboratory has studied this problem and has developed an improved process to detect alpha-emitting contaminants. The process is called long-range alpha detection (LRAD). The LRAD process focuses on the collection and measurement of ions created as a result of an alpha particle`s interaction with air. With only about 35 eV necessary to create an ion pair, a typical 5-MeV alpha particle, upon emission from its maternal nucleus, creates about 150,000 pairs of charged particles. In air these charged particles take several seconds to locate a mate and become electrically neutral. During this time, ions can be pulled away from the source, collected, and measured. Ions can be motivated to a collection device by using an electric field or by moving the air mass in which the ions are located. The collected charges create a small but discrete current that can give some useful information about the alpha-emitting source. In this article, two commercially available applications of the LRADS technology will be discussed. One of these, a device used primarily for pipe monitoring, is from BNFL Instruments, Inc. The other is a monitoring box of sorts from Eberline that will produce an alpha measurement on anything that is placed in the box.

  17. On computing Laplace's coefficients and their derivatives.

    NASA Astrophysics Data System (ADS)

    Gerasimov, I. A.; Vinnikov, E. L.

    The algorithm of computing Laplace's coefficients and their derivatives is proposed with application of recurrent relations. The A.G.M.-method is used for the calculation of values L0(0), L0(1). The FORTRAN-program corresponding to the algorithm is given. The precision control was provided with numerical integrating by Simpsons method. The behavior of Laplace's coefficients and their third derivatives whith varying indices K, n for fixed values of the ?-parameter is presented graphically.

  18. Attenuation coefficients of Rayleigh and Lg waves

    Microsoft Academic Search

    Igor B. Morozov

    2010-01-01

    Analysis of the frequency dependence of the attenuation coefficient leads to significant changes in interpretation of seismic\\u000a attenuation data. Here, several published surface-wave attenuation studies are revisited from a uniform viewpoint of the temporal\\u000a attenuation coefficient, denoted by ?. Theoretically, ?( f) is expected to be linear in frequency, with a generally non-zero intercept ??=??(0) related to the variations of

  19. Gamma-Ray Attenuation Coefficient Measurements

    Microsoft Academic Search

    S. Gopal; B. Sanjeevaiah

    1973-01-01

    In an earlier paper, published by the authors elsewhere, it was shown that for 661.6-keV gamma rays the measurements of gamma-ray attenuation coefficients would greatly improve if one uses the counting sequence of Conner et al. together with a new criterion mut<1, where mu is the gamma-ray attenuation coefficient and t is the thickness of the sample. In this paper

  20. The coefficient of friction, particularly of ice

    Microsoft Academic Search

    Allan Mills

    2008-01-01

    The static and dynamic coefficients of friction are defined, and values from 0.3 to 0.6 are quoted for common materials. These drop to about 0.15 when oil is added as a lubricant. Water ice at temperatures not far below 0 °C is remarkable for low coefficients of around 0.05 for static friction and 0.04-0.02 for dynamic friction, but these figures

  1. Asymptotic Normalization Coefficients in nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Kroha, V.; Azhari, A.; Bém, P.; Burjan, V.; Gagliardi, C. A.; Mukhamedzhanov, A. M.; Novák, J.; Pisko?, Š.; Šime?ková, E.; Tang, X.; Trache, L.; Tribble, R. E.; Vincour, J.

    2003-05-01

    The technique of Asymptotic Normalization Coefficients (ANC) provides an effective method of indirect determination of S-factors for the synthesis in astrophysically important reactions. These coefficients can be extracted from the differential cross sections of the peripheral particle transfer reactions. Recent applications include measurements of ANC's for determining of stellar reaction rates of 9Be(p, ?)10B, 13C(p, ?)14N, 11C(p, ?)12N and 14N(p, ?)15O.

  2. {sup 222}Rn alpha dose to organs other than lung

    SciTech Connect

    Harley, N.H.; Robbins, E.S.

    1991-12-31

    The alpha dose to cells in tissues or organs other theft the lung has been calculated using the solubility coefficients for {sup 222} Rn measured in human tissue. The annual alpha dose equivalent f rom {sup 222} Rn and decay products in most tissues is a maximum of 30% of the annual average natural background dose equivalent (1 mSv) for external and internally deposited nuclides. The dose to the small population of lymphocytes located in or under the bronchial epithelium is a special case and their annual dose equivalent is essentially the same as that to basal cells in bronchial epithelium (200 mSv) for continuous exposure to 200 Bq M{sup {minus}3}. The significance of this dose is uncertain because the only excess cancer observed in follow up studies of underground miners with high {sup 222} Rn exposure is bronchogenic carcinoma.

  3. [sup 222]Rn alpha dose to organs other than lung

    SciTech Connect

    Harley, N.H.; Robbins, E.S.

    1991-01-01

    The alpha dose to cells in tissues or organs other theft the lung has been calculated using the solubility coefficients for [sup 222] Rn measured in human tissue. The annual alpha dose equivalent f rom [sup 222] Rn and decay products in most tissues is a maximum of 30% of the annual average natural background dose equivalent (1 mSv) for external and internally deposited nuclides. The dose to the small population of lymphocytes located in or under the bronchial epithelium is a special case and their annual dose equivalent is essentially the same as that to basal cells in bronchial epithelium (200 mSv) for continuous exposure to 200 Bq M[sup [minus]3]. The significance of this dose is uncertain because the only excess cancer observed in follow up studies of underground miners with high [sup 222] Rn exposure is bronchogenic carcinoma.

  4. Linkage of alpha G-Philadelphia to alpha-thalassemia in African-Americans .

    PubMed Central

    Surrey, S; Ohene-Frempong, K; Rappaport, E; Atwater, J; Schwartz, E

    1980-01-01

    We have studied the inheritance of the alpha-chain hemoglobin variant Hb G-Philadelphia (alpha 2(68 Asn leads to Lys)Beta 2) in two African-American families. Expression of the alpha-globin loci was monitored by the percentage of Hb G in these individuals. The variant represented approximately 33% of the total adult hemoglobin in some and 50% in others. alpha-Globin gene fragments were analyzed by using restricton endonucleases that cleave outside (EcoRI), within (HindIII), and between (Bgl II) the normal duplicated alpha-globin loci (alpha alpha/alpha alpha). Individuals having 33% variant lack one functioning alpha gene (alpha G/alpha alpha); those with 50% variant lack two genes, one missing on each chromosome (alpha G/alpha). Inheritance of alpha G was therefore linked to that of a chromosome with only one functional alpha-globin gene locus. This locus is probably the result of a nonhomologous crossover. Our results also suggest equal expression of the alpha-globin loci in humans because the percentages of the variant could be explained solely on the basis of the total number of alpha genes present. The percentages of Hb G as well as other hematologic data all were consistent with the number of alpha-globin genes identified by restriction endonuclease mapping. Gene mapping yields a more precise determination of the number of alpha-globin genes than does study of globin synthesis. Images PMID:6933536

  5. DPL ALPHA System and Codd's Cellular Space

    Microsoft Academic Search

    G. Fay

    1974-01-01

    DPL ALPHA differs from Codd's original DSL ALPHA only in one essential aspect, namely, that in Data Processing Language ALPHA primitive notions are mostly from predicate calculus (i.e., relation calculus without quantifiers). Boolean algebra and edge-notched card system rather than from relation calculus and relational algebra. ALPHA concepts then can be synthetized from these. [6

  6. Circulating integrins: alpha 5 beta 1, alpha 6 beta 4 and Mac-1, but not alpha 3 beta 1, alpha 4 beta 1 or LFA-1.

    PubMed Central

    Bretscher, M S

    1992-01-01

    The alpha 5 beta 1, alpha 6 beta 4 and Mac-1 integrins all participate in the endocytotic cycle. By contrast, alpha 3 beta 1, alpha 4 beta 1 and LFA-1 do so much more slowly, or not at all, in the cell lines examined. This indicates that the alpha-chains appear to determine whether an integrin cycles or not, and that alpha 5 beta 1, alpha 6 beta 4 and Mac-1 can be brought to the leading edge of a moving cell by endocytosis and recycling. Images PMID:1531629

  7. Theoretical basis for an anomalous temperature coefficient in swelling pressure of rabbit corneal stroma.

    PubMed Central

    Kwok, L S; Klyce, S D

    1990-01-01

    In the rabbit corneal stroma, the swelling pressure, P, has been reported to have an anomalous (negative) temperature coefficient, alpha P, contradicting traditional Donnan swelling theory. A parallel-plate, diffuse double layer Gouy-Chapman model was used to resolve this discrepancy. The present model incorporates the possibility that surface charge, sigma, is temperature dependent. It is shown that negative, zero, or positive coefficients of swelling pressure change with temperature are not mutually exclusive conditions, but can be attributed to the same underlying mechanism. For likely values of alpha P(range -7 x 10(-3) K-1 to +3.2 x 10(-3)K-1), the effective stromal charge has a negative temperature dependency, or dln sigma/dT less than 0. The present formalism is robust against variation in assumed alpha P, and is able to simultaneously satisfy the known values of swelling pressure, its thermal dependency, and stromal charge. These results implicate significant coulombic forces behind P. Predicted stromal surface charge is approximately 0.01 Cm-2. The predictions were confirmed with macrocontinuum Donnan swelling theory, suggesting that Donnan osmotic swelling is the principal macroscopic component of P. PMID:2306510

  8. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  9. An activity coefficient model for proteins.

    PubMed

    Agena, S M; Bogle, I D; Pessoa, F L

    1997-07-01

    Modeling of the properties of biochemical components is gaining increasing interest due to its potential for further application within the area of biochemical process development. Generally protein solution properties such as protein solubility are expressed through component activity coefficients which are studied here. The original UNIQUAC model is chosen for the representation of protein activity coefficients and, to the best of our knowledge, this is the first time it has been directly applied to protein solutions. Ten different protein-salt-water systems with four different proteins, serum albumin, alphacymotrypsin, beta-lactoglobulin and ovalbumin, are investigated. A root-mean-squared deviation of 0.54% is obtained for the model by comparing calculated protein activity coefficients and protein activity coefficients deduced from osmotic measurements through virial expansion. Model predictions are used to analyze the effect of salt concentrations, pH, salt types, and temperature on protein activity coefficients and also on protein solubility and demonstrate consistency with results from other references. PMID:18636445

  10. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  11. Quantization, Holography and the Universal Coefficient Theorem

    E-print Network

    Andrei T. Patrascu

    2014-07-31

    I present a method of quantization using cohomology groups extended via coefficient groups of different types. This is possible according to the Universal Coefficient Theorem (UCT). I also show that by using this method new features of quantum field theory not visible in the previous treatments emerge. The main argument is that several constructions considered as absolute until now may appear as relative, depending on individual choices of group structures needed to probe a topology. The universal coefficient theorem also gives information about how these structures as measured by different choices of groups, relate to each other. This may result in the formulation of new dualities and a deeper understanding of the relation between quantum field theories and gravity.

  12. Temperature coefficients of multijunction solar cells

    NASA Technical Reports Server (NTRS)

    Virshup, G. F.; Chung, B.-C.; Ladle Ristow, M.; Kuryla, M. S.; Brinker, D.

    1990-01-01

    Temperature coefficients measured in solar simulators with those measured under AM0 solar illumination are compared to illustrate the challenges in making these measurements. It is shown that simulator measurements of the short-circuit current (delta Jsc/delta T) are inaccurate due to the mismatch between the solar spectrum and the simulators at the bandgaps of the solar cells. Especially susceptible to error is the delta Jsc/delta T of cells which are components in monolithic multijunction solar cells, such as GaAs filtered by 1.93-eV AlGaAs, which has an AM0 coefficient of 6.82 micro-A/sq cm/deg C, compared to a Xenon simulator coefficient of 22.2 micro-A/sq cm/deg C.

  13. The effective diffusion coefficient for porous rubble

    SciTech Connect

    Sadeghi, M.M.; Lee, W.W.-L.; Pigford, T.H.; Chambre, P.L.

    1990-01-01

    Each waste package in the proposed Yucca Mountain repository is to be separated from surrounded unsaturated rock by a 2-cm air gap annulus. However, if the annulus becomes filled with rock and rubble, there can exist pathways for diffusive release of radionuclides through pore liquid, even if the repository remains unsaturated. The effective diffusion coefficient for radionuclide release through pore liquid in a rubble bed depends on the porosity and moisture content of rubble material and on the geometry and contact area of individual pieces of rubble. Here we present a theoretical analysis of the effective diffusion coefficient for a bed of rubble spheres. The results give a rough indication of the magnitude of the effective diffusion coefficient, and the analysis identifies the parameters that will affect experimental measurements of mass transfer through unsaturated rubble. 3 refs., 1 fig.

  14. Ly-alpha polarimeter design for CLASP rocket experiment

    NASA Astrophysics Data System (ADS)

    Kubo, M.; Watanabe, H.; Narukage, N.; Ishikawa, R.; Bando, T.; Kano, R.; Tsuneta, S.; Kobayashi, K.; Ichimoto, K.; Trujillo Bueno, J.; Song, D.

    2011-12-01

    A sounding-rocket program called the Chromospheric Lyman-Alpha Spectro-Polarimeter (CLASP) is proposed to be launched in the Summer of 2014. CLASP will observe the upper solar chromosphere in Ly-alpha (121.567 nm), aiming to detect the linear polarization signal produced by scattering processes and the Hanle effect for the first time. The CLASP needs a rotating half-waveplate and a polarization analyzer working at the Ly-alpha wavelength to measure the linear polarization signal. We select Magnesium Fluoride (MgF2) as a material of the optical components because of its birefringent property and high transparency at UV wavelength. We have confirmed that the reflection at the Brewster's Angle of MgF2 plate is a good polarization analyzer for the Ly-alpha line by deriving its ordinary refractive index and extinction coefficient along the ordinary and extraordinary axes. These optical parameters are calculated with a least-square fitting in such a way that the reflectance and transmittance satisfy the Kramers-Kronig relation. The reflectance and transmittance against oblique incident angles for the s-polarized and the p-polarized light are measured using the synchrotron beamline at the Ultraviolet Synchrotron Orbital Radiation Facility (UVSOR). We have also measured a retardation of a zeroth-order waveplate made of MgF2. The thickness difference of the waveplate is 14.57 um.This waveplate works as a half-waveplate at 121.74 nm. From this measurement, we estimate that a waveplate with the thickness difference of 15.71 um will work as a half-waveplate at the Ly-alpha wavelength. We have developed a rotating waveplate - polarization analyzer system called a prototype of CLASP polarimeter, and input the perfect Stokes Q and U signals. The modulation patterns that are consistent with the theoretical prediction are successfully obtained in both cases.

  15. Internal heat transfer coefficients of porous metals

    NASA Technical Reports Server (NTRS)

    Kar, K. K.; Dybbs, A.

    1982-01-01

    The internal heat transfer coefficients of porous metals have been experimentally determined in order to develop correlations between approximately defined Nusselt and Reynolds numbers. Scaled-up models of porous materials, and actual porous metal specimens, were subjected to countercurrent heat and mass transfer boundary conditions. Solid and gas phase temperatures were measured for both the scaled-up models and the actual porous metal specimens. On the basis of these measurements, the average internal heat transfer coefficient was evaluated, and a correlation between the Nusselt and Reynolds numbers was derived.

  16. Fractal diffusion coefficient from dynamical zeta functions

    E-print Network

    G. Cristadoro

    2005-09-28

    Dynamical zeta functions provide a powerful method to analyze low dimensional dynamical systems when the underlying symbolic dynamics is under control. On the other hand even simple one dimensional maps can show an intricate structure of the grammar rules that may lead to a non smooth dependence of global observable on parameters changes. A paradigmatic example is the fractal diffusion coefficient arising in a simple piecewise linear one dimensional map of the real line. Using the Baladi-Ruelle generalization of the Milnor-Thurnston kneading determinant we provide the exact dynamical zeta function for such a map and compute the diffusion coefficient from its smallest zero.

  17. Seebeck Coefficient Measured With Differential Heat Pulses

    NASA Technical Reports Server (NTRS)

    Zoltan, L.; Wood, C.; Stapfer, G.

    1986-01-01

    Common experimental errors reduced because pulse technique suppresses drifts in thermoelectric measurements. Differential-heat-pulse apparatus measures Seebeck coefficient in semiconductors at temperatures up to 1,900 K. Sample heated to measuring temperature in furnace. Ends of sample then differentially heated a few degrees more by lamps. Differential temperature rise and consequent Seebeck voltage measured via thermocouple leads. Because pulse technique used, errors that often arise from long-term drifts in thermoelectric measurements suppressed. Apparatus works with temperature differences of only few degrees, further increasing accuracy of coefficients obtained.

  18. Radon diffusion coefficients for aged residential concretes

    SciTech Connect

    Rogers, V.C.; Nielson, K.K.; Holt, R.B. [Rogers & Associates Engineering Corp., Salt Lake City, UT (United States)

    1995-06-01

    This note reports radon gas pore diffusion coefficient measurements for residential concretes from Florida, ranging in age from 12 y to 45 y. The coefficients ranged from 1.5 x 10{sup -7} m{sup 2} s{sup -1} to 5.5 x 10{sup -7} m{sup 2} s{sup -1}. On the average, these values are about a factor of 1.6 higher than average values previously reported for new residential concretes in Florida. 5 refs., 2 figs., 1 tab.

  19. The effect of thermal cycling to 1100 C on the alpha /Mo/ phase in directionally solidified gamma/gamma-prime-alpha alloys

    NASA Technical Reports Server (NTRS)

    Harf, F. H.

    1981-01-01

    Specimens of gamma/gamma-prime-alpha (Mo) eutectic alloy were thermally cycled or isothermally exposed at temperatures of 1075 to 1100 C. Transmission electron microscopy examination of cycled specimens indicated that even an exposure of 10 minutes effected noticeable changes in the shape of the alpha phase, and that the changes were cumulative as more cycles were added. The cross sections of fine, smooth fibers changed from rectangles to octagons, while lamellae and irregular shapes spheroidized. These effects are attributed to the differences in thermal expansion coefficients between the alpha phase and the gamma/gamma-prime matrix, and to the higher diffusion rates prevailing at elevated temperatures. Where the configuration of the alpha phase is a simple shape, such as a fiber, increasing the temperature eventually brings about a stress free interface between the alpha phase and the matrix by differential thermal expansion. Where the shape of the alpha phase is more complex, a stressed interface persists to higher temperatures where diffusion produces the more drastic morphological changes.

  20. LETTER TO THE EDITOR: Measurement of ionisation and attachment coefficients in gas mixtures of difluorodichloromethane and carbon dioxide

    Microsoft Academic Search

    Y. Qiu; X. Ren; Z. Y. Liu; M. C. Zhang

    1989-01-01

    The Townsend first ionisation coefficient alpha and the electron attachment coefficient eta were measured in CF2Cl2\\/CO2 gas mixtures using the steady-state Townsend method over the range 35

  1. Measuring correlations between non-stationary series with DCCA coefficient

    NASA Astrophysics Data System (ADS)

    Kristoufek, Ladislav

    2014-05-01

    In this short report, we investigate the ability of the DCCA coefficient to measure correlation level between non-stationary series. Based on a wide Monte Carlo simulation study, we show that the DCCA coefficient can estimate the correlation coefficient accurately regardless the strength of non-stationarity (measured by the fractional differencing parameter d). For a comparison, we also report the results for the standard Pearson correlation coefficient. The DCCA coefficient dominates the Pearson coefficient for non-stationary series.

  2. External Validity of a Geriatric Food Behavior Instrument

    Microsoft Academic Search

    NL Fey-Yensan; CM Capacchione; J Backstrand

    1997-01-01

    LEARNING OUTCOME: To demonstrate the external validity of a self-administered food behavior instrument for older personsThe Geriatric Food Behavior Instrument (GFBI) has been demonstrated to measure eight valid and reliable constructs of food behavior that reflect nutritional risk for an older population. Construct validity was determined using principal components analysis with reliability coefficients (Cronbach's Alpha) of seven extracted components exceeding

  3. Sample Size Requirements for the Internal Validation of Psychiatric Scales

    E-print Network

    Boyer, Edmond

    of parameters are of interest: Cronbachs alpha coefficient () which assesses reliability, and factor analysis1 Sample Size Requirements for the Internal Validation of Psychiatric Scales Alexandra ROUQUETTE1: The ratio of subjects to variables (N/p), as a rule to calculate the sample size required in internal

  4. The Effect of Music on the Test Scores of the Students in Limits and Derivatives Subject in the Mathematics Exams Done with Music

    ERIC Educational Resources Information Center

    Kesan, Cenk; Ozkalkan, Zuhal; Iric, Hamdullah; Kaya, Deniz

    2012-01-01

    In the exams based on limits and derivatives, in this study, it was tried to determine that if there was any difference in students' test scores according to the type of music listened to and environment without music. For this purpose, the achievement test including limits and derivatives and whose reliability coefficient of Cronbach Alpha is…

  5. The Validation of a Food Label Literacy Questionnaire for Elementary School Children

    ERIC Educational Resources Information Center

    Reynolds, Jesse S.; Treu, Judith A.; Njike, Valentine; Walker, Jennifer; Smith, Erica; Katz, Catherine S.; Katz, David L.

    2012-01-01

    Objective: To determine the reliability and validity of a 10-item questionnaire, the Food Label Literacy for Applied Nutrition Knowledge questionnaire. Methods: Participants were elementary school children exposed to a 90-minute school-based nutrition program. Reliability was assessed via Cronbach alpha and intraclass correlation coefficient…

  6. ESTIMATING CROP COEFFICIENTS WITH CROP CANOPY SIZE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Planting time, plant density, variety, and cultural practices vary widely for horticultural crops. It is difficult to estimate a basal crop coefficient that can incorporate these variations. Canopy cover, as an indicator of intercepted sunlight, is related to crop water use. We used a weighing ly...

  7. Measurement of $gamma$-ray attenuation coefficients

    Microsoft Academic Search

    Christmas

    1974-01-01

    Gamma-ray attenuation coefficients have been determined for aluminum, ; copper, tin, platinum and lead (elements with Z between 13 and 82) using gamma -; rays with energies between 295 and 2440 keV from a sealed Ra-226 source. A ; lithium-drifted germanium detector was employed without collimation or shielding. ; The average standard error of the experimental results was 1%. (auth)

  8. Problems on Divisibility of Binomial Coefficients

    ERIC Educational Resources Information Center

    Osler, Thomas J.; Smoak, James

    2004-01-01

    Twelve unusual problems involving divisibility of the binomial coefficients are represented in this article. The problems are listed in "The Problems" section. All twelve problems have short solutions which are listed in "The Solutions" section. These problems could be assigned to students in any course in which the binomial theorem and Pascal's…

  9. Static coefficient test method and apparatus

    NASA Technical Reports Server (NTRS)

    Haehner, C. L.; Tarpley, J. L. (inventors)

    1976-01-01

    The static coefficient of friction between contacting surfaces of a plurality of bodies is determined by applying a load to the bodies in a direction normal to the contacting surfaces. Opposite ends of a flexible filament are connected to a load cell and the first of the bodies. A motor continuously moves the second of the bodies away from the load cell at constant velocity at right angles to the force of the normal load so that the first body moves intermittently relative to the second body across a contact surface between them. The load on the surfaces, the nature of the surfaces, and the speed of the first body relative to the load cell are such that the filament is alternately and cyclically tensioned and relaxed as the movement occurs. The maximum tension occurs at the incipient stages of movement of the first body relative to the second body. The load cell derives a series of measurements which are coupled to an x-y recorder, from which the maximum forces of the filament are determined to enable the static coefficient of friction to be determined. From the maximum forces and the normal force, the coefficient is determined. For determining coefficients of friction where there are large compression loads, the normal load is applied with a calibrated compression spring that is deflected by a predetermined amount determined by a spring load vs. deflection calibration curve.

  10. Negative Temperature Coefficient in Chemical Reactions

    Microsoft Academic Search

    I A Leenson; Gleb B Sergeev

    1984-01-01

    A systematic analysis of reactions whose rate decreases with increase of temperature is presented. The possibility of a negative temperature coefficient in the elementary reactions is examined from the standpoint of the transition state theory and of collision theory. The mechanisms of complex reactions in which the temperature dependence of the rate is anomalous are discussed, and possible reasons for

  11. ALGORITHM 579 CPSC: Complex Power Series Coefficients

    E-print Network

    Fornberg, Bengt

    ALGORITHM 579 CPSC: Complex Power Series Coefficients [D4] BENGT FORNBERG California Institute Categories: 5.16 Language: FORTRAN DESCRIPTION An alg0rithm CPSC is presented here. It evaluates numerically is available from the ACM Algorithms Distribution Service (see page 555 for order form).] C CPSC - COMPLEX

  12. Experimental Influence Coefficients and Vibration Modes

    NASA Technical Reports Server (NTRS)

    Weidman, Deene J.; Kordes, Eldon E.

    1959-01-01

    Test results are presented for both symmetrical and antisymmetrical static loading of a wing model mounted on a three-point support system. The first six free-free vibration modes were determined experimentally. A comparison is made of the symmetrical nodal patterns and frequencies with the symmetrical nodal patterns and frequencies calculated from the experimental influence coefficients.

  13. Transpiration coefficients for three Great Basin shrubs

    Microsoft Academic Search

    Aaron L. Steinwand; Robert F. Harrington; David P. Groeneveld

    2001-01-01

    Transpiration by desert phreatophytes is poorly understood, and the few existing data are difficult to extrapolate spatially. This study developed transpiration coefficients (Kc) for Atriplex lentiformis ssp.torreyi , Chrysothamnus nauseosus and Sarcobatus vermiculatus to estimate transpiration using vegetation cover measurements. The Kc were developed from stomatal conductance, reference evapotranspiration (ETr), and modeled leaf area index (LAI). Transpiration estimates using the

  14. Phosphorus Availability Coefficients from Various Organic Sources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives of this study were to determine Phosphorus Availability Coefficients (PACs) for a variety of organic phosphorus (P) sources, and to examine the relationship between PACs measured in simulated rainfall runoff and alternative soil incubations. PAC is an important parameter in the P-Ind...

  15. Pressure viscosity coefficient of vegetable oils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elastohydrodynamic (EHD) pressure viscosity coefficient (PVC) of ten vegetable oils from commodity and new crops, and two petroleum-based oils, polyalphaolefin (PAO) and hexadecane, were investigated. PVC was measured using three different methods: the So and Klaus (S-K) procedure from oil visco...

  16. Autoregressive coefficient estimation in nonparametric analysis

    E-print Network

    functions. In such a scenario, the classic approach in stationary time series analysis is that the trendAutoregressive coefficient estimation in nonparametric analysis Q. Shaoa, *, and L. J. Yangb series that contains an unknown trend function and an autoregressive error term. The trend function

  17. Mixing MIR Inequalities with Two Divisible Coefficients

    E-print Network

    Paris-Sud XI, Université de

    Mixing MIR Inequalities with Two Divisible Coefficients Miguel Constantino CIO-DEIO University sets can be obtained based on the so-called Mixed Integer Rounding inequalities (MIR) and ex- tensions (Gomory [1960], Nemhauser and Wolsey [1988]). The basic MIR inequality is derived from the set PMIR = {(s

  18. Recursive Construction of Operator Product Expansion Coefficients

    NASA Astrophysics Data System (ADS)

    Holland, Jan; Hollands, Stefan

    2015-02-01

    We derive a novel formula for the derivative of operator product expansion (OPE) coefficients with respect to a coupling constant. The formula involves just the OPE coefficients themselves but no further input, and is in this sense self-consistent. Furthermore, unlike other formal identities of this general nature in quantum field theory (such as the formal expression for the Lagrangian perturbation of a correlation function), our formula requires no further UV-renormalization, i.e., it is completely well-defined from the start. This feature is a result of a cancelation of UV- and IR-divergences between various terms in our identity. Our proof, and an analysis of the features of the identity, is given for the example of massive, Euclidean {\\varphi^4} theory in 4 dimensional Euclidean space. It relies on the renormalization group flow equation method and is valid to arbitrary, but finite orders in perturbation theory. The final formula, however, makes neither explicit reference to the renormalization group flow, nor to perturbation theory, and we conjecture that it also holds non-perturbatively. Our identity can be applied constructively because it gives a novel recursive algorithm for the computation of OPE coefficients to arbitrary (finite) perturbation order in terms of the zeroth order coefficients corresponding to the underlying free field theory, which in turn are trivial to obtain. We briefly illustrate the relation of this method to more standard methods for computing the OPE in some simple examples.

  19. On Not Interpreting Coefficients: Comment on Holt.

    ERIC Educational Resources Information Center

    Wilson, Thomas P.

    1979-01-01

    A recent recommendation by Holt (EJ 200 576) that coefficients resulting from estimating log-linear and similar models should not be interpreted is argued to be based on lack of clarity about the substantive and theoretical importance of the choice between dummy and effect coding for categorical variables. (Author/GDC)

  20. THE PARTIAL REGRESSION COEFFICIENTS IN PEDIGREE EVALUATION

    E-print Network

    Paris-Sud XI, Université de

    of the same size were first discussed. In sex- limited characters where the number of partial regression regression coefficients for traits expressed on both sexes and for sex-limited characters. The regular cases arithmetic. A solution for the irregular cases in which the ancestors provide information of different

  1. ESTIMATING SOURCE COEFFICIENTS FOR PHOSPHORUS SITE INDICES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phosphorus (P) release to runoff varies widely for different land-applied organic-P sources even when applied at equivalent total P rates. To address this variability, some P site indices include tabulated P source coefficients (PSCs) for differential weighting of applied P materials based on their ...

  2. Net emission coefficient of air thermal plasmas

    Microsoft Academic Search

    Y Naghizadeh-Kashani; Y Cressault; A Gleizes

    2002-01-01

    We have calculated the net emission coefficient of air plasmas at atmospheric pressure in the temperature range between 300 and 40 000 K, in the assumption of local thermodynamic equilibrium and isothermal plasmas. This calculation takes into account the radiation due to the atomic continuum, the molecular continuum, the molecular bands (several systems for O2, N2, NO and N2+) and

  3. Mel Frequency Cepstral Coefficients for Music Modeling

    Microsoft Academic Search

    Beth Logan

    2000-01-01

    We examine in some detail Mel Frequency Cepstral Coefficients (MFCCs) - the dominant features used for speech recognition - and investigate their applicability to modeling music. In particular, we examine two of the main assumptions of the process of forming MFCCs: the use of the Mel frequency scale to model the spectra; and the use of the Discrete Cosine Transform

  4. Transport coefficients of multicomponent gas mixtures

    Microsoft Academic Search

    Kuldip Singh; A. K. Dham; S. C. Gupta

    1989-01-01

    General expressions for the transport coefficients of multicomponent gas mixture have been written in a form where the computations for a given N-component gas mixture and for any order can be done on the computer without feeding the explicit expressions for the matrix elements. (General expressions, available in literature earlier, require seperate computer programs for each order of calculation.) These

  5. Rotordynamic coefficients in stepped labyrinth seals

    Microsoft Academic Search

    Dursun Eser

    2002-01-01

    The continuity and circumferential momentum equations are given for compressible flow in a stepped labyrinth seal. Periodic and analytic solutions of these equations are obtained for the case of time dependent flow generated by a non-axisymmetric rotation of the rotor. Since it is necessary for the lateral stability analysis of the rotor, rotordynamic coefficients are then calculated.

  6. Rate coefficient for the reaction N + NO

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1994-01-01

    Evidence has been advanced that the rate coefficient for the reaction N + NO right arrow N2 + O has a small positive temperature dependence at the high temperatures (900 to 1500 K) that prevail in the terrestrial middle and upper thermosphere by Siskind and Rusch (1992), and at the low temperatures (100 to 200 K) of the Martian lower thermosphere by Fox (1993). Assuming that the rate coefficient recommended by the Jet Propulsion Laboratory evaluation (DeMore et al., 1992) is accurate at 300 K, we derive here the low temperature value of the activation energy for this reaction and thus the rate coefficient that best fits the Viking 1 measured NO densities. We find that the fit is acceptable for a rate coefficient of about 1.3 x 10(exp -10)(T/300)(exp 0.5)exp(-400/T) and better for a value of about 2.5 x 10(exp -10)(T/300)(exp 0.5)exp(-600/T)cu cm/s.

  7. The Evolution of Pearson's Correlation Coefficient

    ERIC Educational Resources Information Center

    Kader, Gary D.; Franklin, Christine A.

    2008-01-01

    This article describes an activity for developing the notion of association between two quantitative variables. By exploring a collection of scatter plots, the authors propose a nonstandard "intuitive" measure of association; and by examining properties of this measure, they develop the more standard measure, Pearson's Correlation Coefficient. The…

  8. EEG alpha power and alpha power asymmetry in sleep and wakefulness

    E-print Network

    Wisconsin at Madison, University of

    --Madison, USA Abstract Asymmetry of waking electroencephalography ~EEG! alpha power in frontal regions has been and sleeping are considered. Descriptors: Electroencephalography, Alpha, Sleep, REM sleep, Human Individual

  9. Layer coefficients for NHDOT pavement materials

    NASA Astrophysics Data System (ADS)

    Janoo, Vincent C.

    1994-09-01

    In 1992, the New Hampshire Department of Transportation (NHDOT) experimented with the use of reclaimed asphalt concrete as a base course material, identified by NHDOT as reclaimed stabilized base (RSB). The RSB and a control test section were placed on Interstate 93 between exits 18 and 19. The RSB test section was designed to the same structural number (SN) as the control. To evaluate the structural capacity of these test sections, the U.S. Army Cold Regions Research and Engineering Laboratory (CRREL) conducted deflection tests using a Dynatest 8000 falling weight deflectometer (FWD). Preliminary analysis of the results by NHDOT personnel showed higher deflection in the reclaimed asphalt concrete test sections. The explanation was that the layer coefficient used for the RSB layer in the design was probably incorrect. A total of 10 test sections constituting the base course materials used by NHDOT were built near Bow, New Hampshire. CRREL evaluated and estimated the layer coefficients of the base course materials. The test program was developed to characterize the material in more than one way. Tests were conducted with the heavy weight deflectometer (HWD), dynamic cone penetrometer (DCP) and the Clegg hammer. In situ California bearing ratio (CBR) tests were also conducted. The deflection from the HWD were used with the WESDEF back calculation program to determine the layer moduli. The moduli were than used with the AASHTO Design Guide to calculate the layer coefficients. The layer coefficients were also determined with the method proposed by Rohde. The CBR values from the Clegg hammer, in situ CBR and DCP tests were also used in the relationships in the HDM model to determine the layer coefficients.

  10. Asymptotics for the ratio of the leading coefficients of orthogonal polynomials associated with a jump modification

    Microsoft Academic Search

    M. A. Cachafeiro

    In this paper we study the behaviour of the quotient en(?)\\/en(?), where (en(?))?1\\/2 and (en(?))?1\\/2 are the leading coefficients of the orthonormal polynomials \\u000a [^(P)]n ( z,da<\\/font\\u000a> )\\\\hat P_n \\\\left( {z,d\\\\alpha } \\\\right)\\u000a and \\u000a [^(P)]n ( z,db<\\/font\\u000a> )\\\\hat P_n \\\\left( {z,d\\\\beta } \\\\right)\\u000a on the unit circle U with respect to the measures ? and ?=? + ??(t) (t?U,

  11. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  12. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  13. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  14. Alpha 1-adrenergic receptor structure

    SciTech Connect

    Venter, J.C.; Horne, P.; Eddy, B.; Greguski, R.; Fraser, C.M.

    1984-09-01

    The structure of the alpha 1-adrenergic receptor was investigated by comparing polypeptides identified by sodium dodecyl sulfate (NaDodSO4)-polyacrylamide gel electrophoresis with the size of the intact receptor in cell membranes as determined by target size analysis. The alpha 1-adrenergic receptor from rat liver membranes affinity-labeled with (/sup 3/H)phenoxybenzamine, a covalent affinity reagent, appeared as a single polypeptide with a molecular mass of 85,000 daltons (Da) on NaDodSO4-polyacrylamide gels. In the absence of protease inhibitors, smaller peptides of 58-62 kDa and 40-45 kDa, specifically labeled with (/sup 3/H)phenoxybenzamine, were also apparent on NaDodSO4 gels. In order to determine whether the 85-kDa protein represented all or only a portion of the alpha 1-receptor, radiation inactivation (target size analysis) was undertaken. Radiation-induced receptor inactivation was measured by the loss of specific (/sup 3/H)phenoxybenzamine and (/sup 3/H)prazosin binding and by the loss of affinity-labeled alpha 1-adrenergic receptors on NaDodSO4 gels. Target size analysis of rat liver alpha 1-receptors indicated that the intact membrane-bound receptor has an average molecular mass of 160,000 Da. These data suggest that the intact alpha-receptor may exist in the membrane as a dimer of two 85,000-Da subunits. The structure of the alpha 1-receptor was further studied by limited proteolysis of the 85-kDa protein isolated from NaDodSO4 gels. Trypsin, chymotrypsin, and papain produce smaller peptides similar to those produced during membrane isolation in the absence of protease inhibition. Limited proteolysis of the membrane-bound receptor produces water-soluble peptides, the largest of which is 45,000 Da. This peptide contains the ligand-binding domain and protrudes from the membrane into the extracellular space.

  15. Electron-Ion Recombination Rate Coefficient Measurements in a Flowing Afterglow Plasma

    NASA Technical Reports Server (NTRS)

    Gougousi, Theodosia; Golde, Michael F.; Johnsen, Rainer

    1996-01-01

    The flowing-afterglow technique in conjunction with computer modeling of the flowing plasma has been used to determine accurate dissociative-recombination rate coefficients alpha for the ions O2(+), HCO(+), CH5(+), C2H5(+), H3O(+), CO2(+), HCO2(+), HN2O(+), and N2O(+) at 295 K. We find that the simple form of data analysis that was employed in earlier experiments was adequate and we largely confirm earlier results. In the case of HCO(+) ions, published coefficients range from 1.1 X 10(exp -7) to 2.8 x 10(exp -7) cu cm/S, while our measurements give a value of 1.9 x 10(exp -7) cu cm/S.

  16. Effects of land cover on runoff coefficient

    NASA Astrophysics Data System (ADS)

    Sriwongsitanon, Nutchanart; Taesombat, Wisuwat

    2011-11-01

    SummaryLand cover is considered to have significant influence on the hydrologic response of a river basin. In this study, we assessed how changes in land cover over time affected flood behaviour from 1988 to 2005, in the Upper Ping River Basin, northern Thailand. We correlated the types of land cover with rainfall-runoff behaviour for smaller and larger flood events taking place during this period. To quantify land cover, nine Landsat 5 TM images taken during the dry season (January or February) were obtained and processed to examine inter-annual land cover changes. From the networks of daily read rainfall data and stream gaugings available across the basin, 68 rainfall and 11 runoff stations were selected to evaluate peak flow rate and runoff coefficient for flood events. For individual sub-catchments, strong non-linear correlations were found between the overall runoff coefficient and peak flow rates for flood events. These runoff coefficients to peak flow relationships varied from year to year with different land cover for each sub-catchment. From these relationships within a particular sub-catchment, we determined relationships between different types of land cover and runoff coefficient for the 2, 5, 10 and 15 year Annual Recurrence Interval (ARI) peak flood events. We found that runoff coefficient increased with increasing forest proportion for these specified peak flood conditions, on nine out of eleven sub-catchments. On the other hand, the runoff coefficient associated with these peak flood events decreased as agricultural and disturbed forest areas increased. The influence of land cover on runoff coefficient was, however, found to be very different between smaller (lower than ˜2 year ARI) and larger flood events (larger than ˜2 year ARI). Runoff coefficient is higher for high forest cover during larger flood events; but for smaller flood events, runoff coefficient is lower when forest cover is high. This is due to the fact that for smaller flood events, rainfall loss rate for the forest area is normally higher than that of the non-forest area according to higher evapotranspiration and soil moisture capacity. Forests have proved to potentially offer flood mitigation benefits for smaller flood events. However, for larger flood events the situation of the basin can be different, especially on a basin with higher antecedent soil moisture or even under saturation stage. Antecedent soil moisture from the previous storms could be better retained within the forest area than the non-forest area due to deeper rote zone and higher soil moisture holding capacity of the forest area compared to non-forest area. For the larger flood events, forest area tends to produce more runoff than non-forest area as found in this study. These findings gave us a more thorough understanding of the effect of land cover types on flood behaviour at different stages of soil moisture conditions, and the severity of storm events. It can be useful for land use and flood management of the river basin.

  17. The Impact of Genital Self-Image on Gynecological Exam Behaviors of College-Aged Women

    E-print Network

    DeMaria, Andrea Laine

    2012-07-16

    .6%), and in a relationship but 18 not living together (n = 203, 45.4%), or single and not dating (n = 136, 30.4%). Most participants were not currently sexually active (n = 235, 52.6%) or in an exclusive/monogamous sexual relationship (n = 184; 41... coefficient of 0.80. Subjective norm scores ranged from 3 to 21, with a mean of 17.01 (SD = 4.35; n = 450) and a Cronbach?s alpha coefficient of 0.76. Perceived behavioral control scores ranged from 2 to 14, with a mean result of 12.70 (SD = 2.35; n = 450...

  18. Orthopositronium Lifetime: Analytic Results in O({alpha}) and O({alpha}{sup 3}ln{alpha})

    SciTech Connect

    Kniehl, Bernd A.; Kotikov, Anatoly V.; Veretin, Oleg L. [II. Institut fuer Theoretische Physik, Universitaet Hamburg, Luruper Chaussee 149, 22761 Hamburg (Germany)

    2008-11-07

    We present the O({alpha}) and O({alpha}{sup 3}ln{alpha}) corrections to the total decay width of orthopositronium in closed analytic form, in terms of basic irrational numbers, which can be evaluated numerically to arbitrary precision.

  19. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N. [Department of Physics, University of Tokyo, Hongo, 113-0033 Tokyo (Japan); Ito, M. [RIKEN Nishina Center, Wako, 351-0198 Saitama (Japan); Milin, M. [Department of Physics, University of Zagreb, HR-10000 Zagreb (Croatia); Hashimoto, T.; Ishiyama, H.; Miyatake, H. [Tokai Radioactive Ion Accelerator Complex, High Energy Accelerator Research Organization (KEK), Tokai, 319-1105 Ibaraki (Japan)

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  20. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePLUS

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  1. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePLUS

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  2. Slow alpha variant during REM sleep.

    PubMed

    Gelisse, P; Crespel, A

    2008-02-01

    REM sleep resembles wakefulness or drowsiness. The pattern can be low-voltage, or else alpha-like. Alpha frequencies are present only during the tonic phases of REM sleep and, compared to wakefulness tracings, alpha activities are slightly slower by 1-2 Hz and are more monomorphic. The slow alpha-variant rhythm or subharmonic alpha pattern consists of rhythmic notched theta waves. It shares the same topography and reactivity with the alpha rhythm. We report its presence during the tonic phases of REM sleep without any modification in its morphology in the first case. In the second case, its morphology was similar to awakening but with slower amplitude. No alpha frequencies were found in REM sleep but only its slow alpha variant. This study provides evidence that REM sleep is a stage of sleep that contains rhythms similar to those seen during wakefulness and drowsiness. PMID:18329545

  3. Evolution and seismology of alpha Centauri

    E-print Network

    Josefina Montalban; Andrea Miglio

    2005-09-15

    Solar-like oscillations detected in both components of the binary system alpha Centauri provide strong constraints on the fundamental parameters of the stellar system. We model alpha Centauri by means of a Levenberg-Marquardt minimization algorithm including seismic and classical constraints. Computations, that were perfomed decreasing significanly the weight of alpha Cen B seismic data in the calibration procedure, predict small separations in good agreement with new observations of solar-like oscillations in alpha Cen B by Bedding (these proceedings).

  4. AlphaSort: a RISC machine sort

    Microsoft Academic Search

    Chris Nyberg; Tom Barclay; Zarka Cvetanovic; Jim Gray; Dave Lomet

    1994-01-01

    A new sort algorithm, called AlphaSort, demonstrates that commodity processors and disks can handle commercial batch workloads. Using Alpha AXP processors, commodity memory, and arrays of SCSI disks, AlphaSort runs the industry-standard sort benchmark in seven seconds. This beats the best published record on a 32-cpu 32-disk Hypercube by 8:1. On another benchmark, AlphaSort sorted more than a gigabyte in

  5. Manning's roughness coefficient for Illinois streams

    USGS Publications Warehouse

    Soong, David T.; Prater, Crystal D.; Halfar, Teresa M.; Wobig, Loren A.

    2012-01-01

    Manning's roughness coefficients for 43 natural and constructed streams in Illinois are reported and displayed on a U.S. Geological Survey Web site. At a majority of the sites, discharge and stage were measured, and corresponding Manning's coefficients—the n-values—were determined at more than one river discharge. The n-values discussed in this report are computed from data representing the stream reach studied and, therefore, are reachwise values. Presentation of the resulting n-values takes a visual-comparison approach similar to the previously published Barnes report (1967), in which photographs of channel conditions, description of the site, and the resulting n-values are organized for each site. The Web site where the data can be accessed and are displayed is at URL http://il.water.usgs.gov/proj/nvalues/.

  6. Thermodiffusion Coefficient for Binary Liquid Hydrocarbon Mixtures

    NASA Astrophysics Data System (ADS)

    Blanco, P.; Bou-Ali, M. M.; Platten, J. K.; Madariaga, J. A.; Urteaga, P.; Santamaría, C.

    2007-09-01

    In this work, the thermogravitational technique has been used to determine the thermodiffusion coefficient of 18 binary mixtures of normal alkanes formed with the n-octadecane as the densest component and mixed with normal alkanes from n-pentane to n-tridecane in two series of experimental tests (nine binary mixtures with mass fraction c = 0.5 and nine binary mixtures with molar fraction x = 0.5 in each component for each mixture). The measurement of the steady separation of these mixtures in the thermogravitational column, as well as their corresponding thermophysical properties, has been determined at the average temperature of 25°C. The main result shows a linear dependency of the thermodiffusion coefficient on the relative density difference, and this in both series of experimental tests (mass and molar fraction equal to 0.5).

  7. Heat transfer coefficients during quenching of steels

    NASA Astrophysics Data System (ADS)

    Hasan, H. S.; Peet, M. J.; Jalil, J. M.; Bhadeshia, H. K. D. H.

    2011-03-01

    Heat transfer coefficients for quenching in water have been measured as a function of temperature using steel probes for a variety of iron alloys. The coefficients were derived from measured cooling curves combined with calculated heat-capacities. The resulting data were then used to calculate cooling curves using the finite volume method for a large steel sample and these curves have been demonstrated to be consistent with measured values for the large sample. Furthermore, by combining the estimated cooling curves with time-temperature-transformation (TTT) diagrams it has been possible to predict the variation of hardness as a function of distance via the quench factor analysis. The work should prove useful in the heat treatment of the steels studied, some of which are in the development stage.

  8. Minior Actinide Doppler Coefficient Measurement Assessment

    SciTech Connect

    Nolan E. Hertel; Dwayne Blaylock

    2008-04-10

    The "Minor Actinide Doppler Coefficient Measurement Assessment" was a Department of Energy (DOE) U-NERI funded project intended to assess the viability of using either the FLATTOP or the COMET critical assembly to measure high temperature Doppler coefficients. The goal of the project was to calculate using the MCNP5 code the gram amounts of Np-237, Pu-238, Pu-239, Pu-241, AM-241, AM-242m, Am-243, and CM-244 needed to produce a 1E-5 in reactivity for a change in operating temperature 800C to 1000C. After determining the viability of using the assemblies and calculating the amounts of each actinide an experiment will be designed to verify the calculated results. The calculations and any doncuted experiments are designed to support the Advanced Fuel Cycle Initiative in conducting safety analysis of advanced fast reactor or acceoerator-driven transmutation systems with fuel containing high minor actinide content.

  9. Differences between charged-current coefficient functions

    E-print Network

    Moch, S; Vogt, A

    2007-01-01

    Second- and third-order results are presented for the structure functions of charged-current deep-inelastic scattering in the framework of massless perturbative QCD. We write down the two-loop differences between the corresponding crossing-even and -odd coefficient functions, including those for the longitudinal structure function not covered in the literature so far. At three loops we compute the lowest five moments of these differences for all three structure functions and provide approximate expressions in Bjorken-$x$ space. Also calculated is the related third-order coefficient-function correction to the Gottfried sum rule. We confirm the conjectured suppression of these quantities if the number of colours is large. Finally we derive the second- and third-order QCD contributions to the Paschos-Wolfenstein ratio used for the determination of the weak mixing angle from neutrino-nucleon deep-inelastic scattering. These contributions are found to be small.

  10. Differences between charged-current coefficient functions

    NASA Astrophysics Data System (ADS)

    Moch, S.; Rogal, M.; Vogt, A.

    2008-02-01

    Second- and third-order results are presented for the structure functions of charged-current deep-inelastic scattering in the framework of massless perturbative QCD. We write down the two-loop differences between the corresponding crossing-even and -odd coefficient functions, including those for the longitudinal structure function not covered in the literature so far. At three loops we compute the lowest five moments of these differences for all three structure functions and provide approximate expressions in Bjorken- x space. Also calculated is the related third-order coefficient-function correction to the Gottfried sum rule. We confirm the conjectured suppression of these quantities if the number of colours is large. Finally we derive the second- and third-order QCD contributions to the Paschos-Wolfenstein ratio used for the determination of the weak mixing angle from neutrino-nucleon deep-inelastic scattering. These contributions are found to be small.

  11. Supersymmetric contributions to weak decay correlation coefficients

    SciTech Connect

    Profumo, S.; Ramsey-Musolf, M. J.; Tulin, S. [California Institute of Technology, Pasadena, California 91125 (United States)

    2007-04-01

    We study supersymmetric contributions to correlation coefficients that characterize the spectral shape and angular distribution for polarized {mu}- and {beta}-decays. In the minimal supersymmetric standard model (MSSM), one-loop box graphs containing superpartners can give rise to non-(V-Ax(V-A) four-fermion operators in the presence of left-right or flavor mixing between sfermions. We analyze the present phenomenological constraints on such mixing and determine the range of allowed contributions to the weak decay correlation coefficients. We discuss the prospective implications for future {mu}- and {beta}-decay experiments, and argue that they may provide unique probes of left-right mixing in the first generation scalar fermion sector.

  12. Supersymmetric Contributions to Weak Decay Correlation Coefficients

    E-print Network

    Stefano Profumo; Michael J. Ramsey-Musolf; Sean Tulin

    2007-04-05

    We study supersymmetric contributions to correlation coefficients that characterize the spectral shape and angular distribution for polarized muon- and beta-decays. In the minimal supersymmetric Standard Model (MSSM), one-loop box graphs containing superpartners can give rise to non-(V-A)x(V-A) four fermion operators in the presence of left-right or flavor mixing between sfermions. We analyze the present phenomenological constraints on such mixing and determine the range of allowed contributions to the weak decay correlation coefficients. We discuss the prospective implications for future muon- and beta-decay experiments, and argue that they may provide unique probes of left-right mixing in the first generation scalar fermion sector.

  13. Gate Control Coefficient Effect on CNFET Characteristic

    SciTech Connect

    Sanudin, Rahmat; Ma'Radzi, Ahmad Alabqari; Nayan, Nafarizal [Faculty of Electrical and Electronic Engineering, Universiti Tun Hussein Onn Malaysia, Johor (Malaysia)

    2009-06-01

    The development of carbon nanotube field-effect transistor (CNFET) as alternative to existing transistor technology has long been published and discussed. The emergence of this device offers new material and structure in building a transistor. This paper intends to do an analysis of gate control coefficient effect on CNFET performance. The analysis is based on simulation study of current-voltage (I-V) characteristic of ballistic CNFET. The simulation study used the MOSFET-like CNFET mathematical model to establish the device output characteristic. Based on the analysis of simulation result, it is found that the gate control coefficient contributes to a significant effect on the performance of CNFET. The result also shown the parameter could help to improve the device performance in terms of its output and response as well. Nevertheless, the characteristic of the carbon nanotube that acts as the channel is totally important in determining the performance of the transistor as a whole.

  14. Solute concentration effect on osmotic reflection coefficient.

    PubMed Central

    Adamski, R P; Anderson, J L

    1983-01-01

    A theory for the effect of concentration on osmotic reflection coefficient, correct to first order, was developed at the molecular level by considering the effect of solute-solute interactions on solute concentration and the fluid stress tensor within a solvent-filled pore. The solvent was modeled as a continuous fluid and potential energies between solute molecules and the pore wall were assumed to be pairwise additive. Although the theory is more general, calculations are presented only for excluded volume effects (hard-sphere for solute, hard-wall for pore). The relationship between the first-order concentration effect and the infinite dilution value of reflection coefficient appears to be geometry independent. The theory is discussed in light of experimental studies of osmotic flow that have recently appeared in the literature. PMID:6626681

  15. Digestibility and Production Coefficients of Hog Feeds.

    E-print Network

    Fraps, G. S. (George Stronach)

    1932-01-01

    LIDEARY, A t% !*I COLLEGE, CA%!PUS. TEXAS AGRICULTURAL EXPERIMENT STATiON A. B. CONNER, DIRECTOR COLLEGE STATION, BRAZOS COUNTY, TEXAS 7 BULLETIN NO. 454 SEPTEMBER, 1932 Digestibility and Production Coefficients of Hog Feeds AGRICULTURAI..., 1932. **In cooveration with U. S. Department of Agriculture, The value of a pig feed depends chiefly upon its content of digestible protein and productive energy. The average compos- ition, productive energy and digestible pro- tein are given...

  16. Unbiased Estimation of Atmosphere Attenuation Coefficient

    Microsoft Academic Search

    G. D. Dikic; Z. M. Djurovic

    2007-01-01

    According to the passive sensors’ nature, only the azimuth and elevation angles are used for the target state estimation.\\u000a In some scenarios, additional information like the irradiances generated by the passive sensors must be introduced to improve\\u000a the estimation process. On the other hand, irradiances are strongly dependent on the atmosphere properties that may be described\\u000a by attenuation coefficient. An

  17. Linear attenuation coefficients for compensator based imrt

    Microsoft Academic Search

    T. Bartrum; M. Bailey; V. Nelson; M. Grace

    2007-01-01

    With rapid technological improvements in computer driven 3-D radiotherapy treatment planning systems (RTPS) the use of compensating\\u000a filters for intensity modulated radiation therapy (IMRT) will dramatically increase the ease of treatment. The procedure for\\u000a commissioning .decimal™ (Sanford, Florida) compensators involved the measurement of the effective linear attenuation coefficients\\u000a for aluminium and brass. Field sizes to be measured vary from small

  18. Gamma-Ray Attenuation-Coefficient Measurements

    Microsoft Academic Search

    A. L. Conner; H. F. Atwater; Elizabeth H. Plassmann; J. H. McCrary

    1970-01-01

    Total gamma-ray attenuation coefficients have been measured at nine energies in the range of 88 keV to 2.75 MeV for the following elements: Be, C, Mg, Al, S, Ti, Fe, Ni, Cu, Zn, Zr, Nb, Mo, Ag, Sn, La, Gd, Hf, W, Au, Pb, Th, U, and Pu. Radioactive isotopes were used as sources of monoenergetic gamma radiation in a

  19. Spearman's Rank-Difference Coefficient of Correlation

    NSDL National Science Digital Library

    MacFarland, Thomas W.

    This tutorial, created by Thomas W. MacFarland of Nova Southeastern University, explains the theory and use of the Spearman's Rank-Difference Correlation Coefficient and demonstrates it with an example on exam scores, homework scores, and project scores. Data sets are provided in both SPSS and Minitab code. This is a great resource for anyone interested in a more in-depth study of statistics.

  20. Octanol\\/Water Partition Coefficients of Chloronaphthalenes

    Microsoft Academic Search

    T. PUZYN; J. FALANDYSZ

    2005-01-01

    Computational n-octanol\\/water partition coefficients data for 75 chloronaphthalene congeners based on the Ghose, Pritchet, and Crippen algorithm; the Moriguchi method; and two QSPR models with principal component regression and partial least-squares (PLS) regression calculations are presented. Chloronaphthalenes log KOW data obtained after PLS are characterized by the lowest root mean square error (RMSEP = 0.0190), whereas results from the Ghose,

  1. Temperature coefficients of multijunction solar cells

    Microsoft Academic Search

    G. F. Virshup; B.-C. Chung; M. L. Ristow; M. S. Kuryla; D. Brinker

    1990-01-01

    Temperatures coefficients measured in solar simulators with those measured under AM0 solar illumination are compared to illustrate the challenges in making these measurements. It is shown that simulator measurements of the short-circuit current (?JSC\\/?T) are inaccurate due to the mismatch between the solar spectrum and the simulators at the bandgaps of the solar cells. Especially susceptible to error is the

  2. On the coefficients of Hilbert quasipolynomials

    Microsoft Academic Search

    Winfried Bruns; Bogdan Ichim

    2007-01-01

    The Hilbert function of a module over a positively graded algebra is of\\u000aquasi-polynomial type (Hilbert--Serre). We derive an upper bound for its grade,\\u000ai.e. the index from which on its coefficients are constant. As an application,\\u000awe give a purely algebraic proof of an old combinatorial result (due to\\u000aEhrhart, McMullen and Stanley).

  3. The discharge coefficient of effervescent atomizers

    Microsoft Academic Search

    M. Ochowiak; J. Rozanski

    2010-01-01

    The paper contains the results of experimental investigation of air–water atomization process in effervescent nozzles with internal mixing. The aim of study was analysis of pressure drop and discharge coefficient. The study was carried out at liquid flow rates changed from 0.0014to0.011[kg\\/s] and gas flow rates from 0.00015to0.0065[kg\\/s]. It corresponded to gas to liquid mass ratio (GLR) values from 0.014

  4. Partitioning coefficients between olivine and silicate melts

    Microsoft Academic Search

    J. H. Bédard

    2005-01-01

    Variation of Nernst partition coefficients (D) between olivine and silicate melts cannot be neglected when modeling partial melting and fractional crystallization. Published natural and experimental olivine\\/liquidD data were examined for covariation with pressure, temperature, olivine forsterite content, and melt SiO2, H2O, MgO and MgO\\/MgO+FeOtotal. Values of olivine\\/liquidD generally increase with decreasing temperature and melt MgO content, and with increasing melt

  5. Partitioning coefficients between olivine and silicate melts

    Microsoft Academic Search

    J. H. Bédard

    2005-01-01

    Variation of Nernst partition coefficients (D) between olivine and silicate melts cannot be neglected when modeling partial melting and fractional crystallization. Published natural and experimental olivine\\/liquidD data were examined for covariation with pressure, temperature, olivine forsterite content, and melt SiO2, H2O, MgO and MgO\\/MgO + FeOtotal. Values of olivine\\/liquidD generally increase with decreasing temperature and melt MgO content, and with

  6. Quenching of spontaneous emission coefficients in plasmas

    SciTech Connect

    Chung, Y.; Lemaire, P.; Suckewer, S.

    1987-09-01

    We have observed changing Einstein coefficients of spontaneous emission as a function of electron density in CO/sub 2/ laser-produced plasmas. These measurements are based on the intensity branching ratio of CIV lines 5801 to 5812 A and 312.41 to 312.46 A which share a common upper level. Similar observations for CIII lines are also discussed. 12 refs., 3 figs.

  7. Pearson's Product-Moment Coefficient of Correlation

    NSDL National Science Digital Library

    MacFarland, Thomas W.

    This tutorial, created by Thomas W. MacFarland of Nova Southeastern University, explains the theory and use of Pearson's Product Moment Coefficient of Correlation and demonstrates it with an example on GPA and test scores. Data sets are provided in both SPSS and Minitab code. This is a great resource for anyone looking for a more in-depth study of statistics. This could be used as either a teaching guide for educators or simply further practice for students.

  8. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  9. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  10. Alpha 1 antitrypsin phenotypes and alcoholic pancreatitis

    Microsoft Academic Search

    P S Haber; J S Wilson; B H McGarity; W Hall; M C Thomas; R C Pirola

    1991-01-01

    Altered frequencies of alpha 1 antitrypsin phenotypes have been reported in patients with chronic pancreatitis, suggesting a possible genetic basis for individual susceptibility to this disease. Alpha 1 antitrypsin phenotypes, with particular regard to alcoholic pancreatitis, were studied. Patients with alcoholic pancreatitis were compared with alcoholic control subjects with no history of pancreatic disease. Serum alpha 1 antitrypsin concentrations were

  11. Alpha 1-antitrypsin in acute myocardial infarction

    Microsoft Academic Search

    H Gilutz; Y Siegel; E Paran; N Cristal; M R Quastel

    1983-01-01

    Alpha 1-antitrypsin serum levels were measured in 48 patients with acute myocardial infarction and in 19 control patients either with coronary heart disease without necrosis, or with neither coronary disease nor inflammation. Alpha 1-antitrypsin was significantly raised in the group of patients with acute myocardial infarction. As some patients individually showed no change in alpha 1-antitrypsin levels, however, they were

  12. Physiological determinants of the pulmonary filtration coefficient.

    PubMed

    Parker, James C; Townsley, Mary I

    2008-08-01

    Current emphasis on translational application of genetic models of lung disease has renewed interest in the measurement of the gravimetric filtration coefficient (K(f)) as a means to assess vascular permeability changes in isolated perfused lungs. The K(f) is the product of the hydraulic conductivity and the filtration surface area, and is a sensitive measure of vascular fluid permeability when the pulmonary vessels are fully recruited and perfused. We have observed a remarkable consistency of the normalized baseline K(f) values between species with widely varying body weights from mice to sheep. Uniformity of K(f) values can be attributed to the thin alveolar capillary barrier required for gas exchange and the conserved matching of lung vascular surface area to the oxygen requirements of the body mass. An allometric correlation between the total lung filtration coefficient (K(f,t)) and body weight in several species (r(2)=1.00) had a slope that was similar to those reported for alveolar and pulmonary capillary surface areas and pulmonary diffusion coefficients determined by morphometric methods in these species. A consistent K(f) is dependent on accurately separating the filtration and vascular volume components of lung weight gain, then K(f) is a consistent and repeatable index of lung vascular permeability. PMID:18502816

  13. Edge Diffraction Coefficients around Critical Rays

    NASA Astrophysics Data System (ADS)

    Fradkin, L.; Harmer, M.; Darmon, M.

    2014-04-01

    The classical GTD (Geometrical Theory of Diffraction) gives a recipe, based on high-frequency asymptotics, for calculating edge diffraction coefficients in the geometrical regions where only diffracted waves propagate. The Uniform GTD extends this recipe to transition zones between irradiated and silent regions, known as penumbra. For many industrial materials, e.g. steels, and frequencies utlized in industrial ultrasonic transducers, that is, around 5 MHz, asymptotics suggested for description of geometrical regions supporting the head waves or transition regions surrounding their boundaries, known as critical rays, prove unsatisfactory. We present a numerical extension of GTD, which is based on a regularized, variable step Simpson's method for evaluating the edge diffraction coefficients in the regions of interference between head waves, diffracted waves and/or reflected waves. In mathematical terms, these are the regions of coalescence of three critical points - a branch point, stationary point and/or pole, respectively. We show that away from the shadow boundaries, near the critical rays the GTD still produces correct values of the edge diffraction coefficients.

  14. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  15. 17Alpha Centauri Bb -a nearby extrasolar planet? Alpha Centauri is a binary

    E-print Network

    17Alpha Centauri Bb - a nearby extrasolar planet? Alpha Centauri is a binary star system located 4 at La Silla in Chile to detect the tell-tail motion of Alpha Centauri B caused by an earth-sized planet in close orbit around this star. The planet, called Alpha Centauri Bb, orbits at a distance of only six

  16. Simultaneous estimation of ultrasonic wave speed, sample thickness, attenuation coefficient, and reflection coefficient

    NASA Astrophysics Data System (ADS)

    Kinzie, Aaron Wagner

    Acoustic wave speed, sample thickness, acoustic attenuation coefficient, and acoustic reflection coefficient are routinely estimated for materials characterization and flaw detection. Previous work at MU yielded a new technique to estimate the wave speed and sample thickness simultaneously. Prior work at MU has also lead to a new approach for simultaneous estimation of attenuation and reflection coefficients given prior knowledge of the sample wave speed and thickness. The research reported in this thesis shows that the simultaneous wave speed and sample thickness estimation technique can be combined with the simultaneous attenuation and reflection coefficient estimation approach. Once the wave speed and Reflection coefficient are estimated the material density can also be estimated. This study shows that without prior knowledge of a sample's properties, it is possible to estimate thickness, acoustic wave speed, acoustic attenuation coefficient, and acoustic reflection coefficient. This is shown theoretically and demonstrated experimentally. The models used are for an isotropic material with a sample of plate type geometry. This is a single sided approach using pulse-echo ultrasonic techniques. The technique utilizes axial scans to find equal diffraction points of interface reflections. The knowledge of the location in the water path length of the equal diffraction points of the interface reflections allows for the estimation of the wave speed and thickness of the sample. Data at the equal diffraction points is then used to calculate the attenuation and reflection coefficients simultaneously. Validity of the combined approach is demonstrated experimentally. Measurement procedures and data processing methods are detailed. Results are given for plastic, copper, and quartz samples. These results are shown with different broadband focused transducers with nominal center frequencies of 5, 10, and 15MHz.

  17. [Anti alpha-herpesvirus drugs].

    PubMed

    Koshizuka, Tetsuo; Suzutani, Tatsuo

    2012-04-01

    Therapy for infectious diseases resulting from alpha-herpesvirus infections has been dramatically improved by the development of acyclovir (ACV). ACV is highly specific against herpes simplex virus type 1(HSV-1), herpes simplex virus type 2 (HSV-2) and varicella-zoster virus (VZV) as ACV is specifically phosphorylated by the thymidine kinases (TKs) of these viruses. These viral TKs are important enzymes for viral replication in vivo; therefore, the growth of TK-deficient mutants is impaired. ACV-resistant viruses are rarely isolated from immunocompetent patients but are frequently obtained from immunocompromised patients. Recently, other anti alpha-herpesvirus drugs, such as valacyclovir and famciclovir, have become available for use in Japan, but the need to develop new antiherpetic compounds with different mechanisms of action remains. PMID:22568134

  18. Spectroscopic analysis of alpha Andromedae

    NASA Astrophysics Data System (ADS)

    Derman, I. E.

    1982-11-01

    Coude-spectrographic data for the visible and UV are employed to determine the atmospheric chemical composition of alpha And. Nothing that five previous observations of the star by other researchers failed to produce a consensus for the spectra, the present study considered only lines which were present in all the spectra obtained. The detected energy distribution indicated an effective temperature within 350 of 13850 K, a surface gravity around 3.85, and a microturbulence velocity of 2.5-3.5 km/sec. Normal C and Si abundances were present, along with overabundances of Mg, S, and Fe. Significant overabundances of P, Mn, Ga, Sr, Y, Zr, Eu, and Hg were detected. It is suggested that alpha And has a circumstellar envelope, indicating an unstable atmosphere and mass loss.

  19. Alpha-plutonium's Grüneisen parameter

    NASA Astrophysics Data System (ADS)

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-01

    Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals.

  20. Alpha-plutonium's Grüneisen parameter.

    PubMed

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-28

    Reported Grüneisen parameters ? of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ?V/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby ? is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend ? = 3.7 ± 0.4, slightly high compared with values for all elemental metals. PMID:21386421

  1. The Assessment of Reliability Under Range Restriction: A Comparison of [Alpha], [Omega], and Test-Retest Reliability for Dichotomous Data

    ERIC Educational Resources Information Center

    Fife, Dustin A.; Mendoza, Jorge L.; Terry, Robert

    2012-01-01

    Though much research and attention has been directed at assessing the correlation coefficient under range restriction, the assessment of reliability under range restriction has been largely ignored. This article uses item response theory to simulate dichotomous item-level data to assess the robustness of KR-20 ([alpha]), [omega], and test-retest…

  2. Voglibose: An Alpha Glucosidase Inhibitor

    PubMed Central

    Dabhi, Ajay S.; Bhatt, Nikita R.; Shah, Mohit J.

    2013-01-01

    Diabetes Mellitus (DM) is a morbid disease worldwide, with increasing incidence as time passes. It has macro-vascular and micro-vascular complications. The main cause of these complications is poorly controlled postprandial hyperglycaemia. Alpha glucosidase inhibitors, namely acarbose, voglibose and miglitol, are available for therapy. Voglibose is well tolerated and effective in comparable doses among these drugs. This article highlights the important features of voglibose. PMID:24551718

  3. The Alpha 21264 microprocessor architecture

    Microsoft Academic Search

    R. E. Kessler; E. J. McLellan; D. A. Webb

    1998-01-01

    The 21264 is the third generation Alpha microprocessor from Compaq Computer (formerly Digital Equipment) Corporation. This microprocessor achieves the industry-leading performance levels of 30+ Specint95 and 50+ Specfp95. In addition to the aggressive 600 MHz cycle time in a 0.35 ?m CMOS process, there are also many architectural features that enable the outstanding performance level of the 21264. This paper

  4. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew [Universite de Toulouse, UPS-OMP, IRAP, Toulouse (France); Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, SE-106 91 Stockholm (Sweden); Schaerer, Daniel [CNRS, IRAP, 14, avenue Edouard Belin, F-31400 Toulouse (France); Verhamme, Anne; Orlitova, Ivana [Geneva Observatory, University of Geneva, 51 Chemin des Maillettes, CH-1290 Versoix (Switzerland); Mas-Hesse, J. Miguel; Oti-Floranes, Hector [Centro de Astrobiologia (CSIC-INTA), Departamento de Astrofisica, POB 78, 28691 Villanueva de la Canada (Spain); Adamo, Angela [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Atek, Hakim [Laboratoire d'Astrophysique, Ecole Polytechnique Federale de Lausanne (EPFL), Observatoire, CH-1290 Sauverny (Switzerland); Cannon, John M. [Department of Physics and Astronomy, Macalester College, 1600 Grand Avenue, Saint Paul, MN 55105 (United States); Herenz, E. Christian [Leibniz-Institut fuer Astrophysik (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Kunth, Daniel [Institut d'Astrophysique de Paris, UMR 7095 CNRS and UPMC, 98 bis Bd Arago, F-75014 Paris (France); Laursen, Peter, E-mail: matthew@astro.su.se [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark)

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  5. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  6. SDSS-II: Determination of shape and color parameter coefficients for SALT-II fit model

    SciTech Connect

    Dojcsak, L.; Marriner, J.; /Fermilab

    2010-08-01

    In this study we look at the SALT-II model of Type IA supernova analysis, which determines the distance moduli based on the known absolute standard candle magnitude of the Type IA supernovae. We take a look at the determination of the shape and color parameter coefficients, {alpha} and {beta} respectively, in the SALT-II model with the intrinsic error that is determined from the data. Using the SNANA software package provided for the analysis of Type IA supernovae, we use a standard Monte Carlo simulation to generate data with known parameters to use as a tool for analyzing the trends in the model based on certain assumptions about the intrinsic error. In order to find the best standard candle model, we try to minimize the residuals on the Hubble diagram by calculating the correct shape and color parameter coefficients. We can estimate the magnitude of the intrinsic errors required to obtain results with {chi}{sup 2}/degree of freedom = 1. We can use the simulation to estimate the amount of color smearing as indicated by the data for our model. We find that the color smearing model works as a general estimate of the color smearing, and that we are able to use the RMS distribution in the variables as one method of estimating the correct intrinsic errors needed by the data to obtain the correct results for {alpha} and {beta}. We then apply the resultant intrinsic error matrix to the real data and show our results.

  7. Electron distribution function and recombination coefficient in ultracold plasma in a magnetic field

    SciTech Connect

    Bobrov, A. A.; Bronin, S. Ya.; Zelener, B. B.; Zelener, B. V. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)] [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation); Manykin, E. A. ['Kurchatov Institute' Russian Research Center (Russian Federation)] ['Kurchatov Institute' Russian Research Center (Russian Federation); Khikhlukha, D. R., E-mail: DKhikhlukha@ihed.ras.ru [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

    2013-07-15

    The electron distribution function and diffusion coefficient in energy space have been calculated for the first time for a weakly coupled ultracold plasma in a magnetic field in the range of magnetic fields B = 100-50000 G for various temperatures. The dependence of these characteristics on the magnetic field is analyzed and the distribution function is shown to depend on the electron energy shift in a magnetic field. The position of the 'bottleneck' of the distribution function has been found to be shifted toward negative energies with increasing magnetic field. The electron velocity autocorrelators as a function of the magnetic field have been calculated; their behavior suggests that the frequency of collisions between charged particles decreases significantly with increasing magnetic field. The collisional recombination coefficient {alpha}{sub B} has been calculated in the diffusion approximation for a weakly coupled ultracold plasma in a magnetic field. An increase in magnetic field is shown to lead to a decrease in {alpha}{sub B} and this decrease can be several orders of magnitude.

  8. Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.

    PubMed

    Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L

    2015-03-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha abnormalities in ASD. PMID:25231288

  9. Surface area coefficients for airship envelopes

    NASA Technical Reports Server (NTRS)

    Diehl, W S

    1922-01-01

    In naval architecture, it is customary to determine the wetted surface of a ship by means of some formula which involves the principal dimensions of the design and suitable constants. These formulas of naval architecture may be extended and applied to the calculation of the surface area of airship envelopes by the use of new values of the constants determined for this purpose. Surface area coefficients were calculated from the actual dimensions, surfaces, and volumes of 52 streamline bodies, which form a series covering the entire range of shapes used in the present aeronautical practice.

  10. Micro-Fluidic Diffusion Coefficient Measurement

    SciTech Connect

    Forster, F.K.; Galambos, P.

    1998-10-06

    A new method for diffusion coefficient measurement applicable to micro-fluidics is pre- sented. The method Iltilizes an analytical model describing laminar dispersion in rect- anglllar ~llicro_channe]s. The Illethod ~vas verified throllgh measllremen~ of fllloresceill diffusivity in water and aqueolls polymer solutions of differing concentration. The diffll- sivity of flllorescein was measlmed as 0.64 x 10-gm2/s in water, 0.49 x 10-gm2/s in the 4 gm/dl dextran solution and 0.38 x 10-9n12/s in the 8 gnl/dl dextran solution.

  11. Experimental rotordynamic coefficient results for honeycomb seals

    NASA Technical Reports Server (NTRS)

    Elrod, David A.; Childs, Dara W.

    1988-01-01

    Test results (leakage and rotordynamic coefficients) are presented for seven honeycomb-stator smooth-rotor seals. Tests were carried out with air at rotor speeds up to 16,000 cpm and supply pressures up to 8.2 bars. Test results for the seven seals are compared, and the most stable configuration is identified based on the whirl frequency ratio. Results from tests of a smooth-rotor/smooth-stator seal, a teeth-on-stator labyrinth seal, and the most stable honeycomb seal are compared.

  12. Studies of Gaseous Multiplication Coefficient in Isobutane

    SciTech Connect

    Lima, Iara B.; Vivaldini, Tulio C. [Instituto de Pesquisas Energeticas e Nucleares, 05508-000, Cidade Universitaria, Sao Paulo (Brazil); Goncalves, Josemary A. C.; Botelho, Suzana; Bueno Tobias, Carmen C. [Instituto de Pesquisas Energeticas e Nucleares, 05508-000, Cidade Universitaria, Sao Paulo (Brazil); Departamento de Fisica, Pontificia Universidade Catolica de Sao Paulo, 01303-050, Sao Paulo (Brazil); Ridenti, Marco A.; Pascholati, Paulo R. [Instituto de Fisica, Universidade de Sao Paulo, 05508-090, Cidade Universitaria, Sao Paulo (Brazil); Fonte, Paulo; Mangiarotti, Alessio [Laboratorio de Instrumentacao e Fisica Experimental de Particulas, Departamento de Fisica da Universidade de Coimbra, 3004-516, Coimbra (Portugal)

    2010-05-21

    This work presents the studies of gaseous multiplication coefficient behavior for isobutane, as function of the reduced electric field, by means of signal amplitude analysis. The experimental method used is based on the Pulsed Townsend technique, which follows from Townsend equation solution for a uniform electric field. In our configuration, the anode is made of a high resistivity (2.10{sup 12} OMEGA.cm) glass, while the cathode is of aluminium. In order to validate the technique and to analyze effects of non-uniformity, results for nitrogen, which has well-established data available in literature, are also presented.

  13. Transport coefficients of a massive pion gas

    E-print Network

    D. Fernandez-Fraile; A. Gomez Nicola

    2009-12-20

    We review or main results concerning the transport coefficients of a light meson gas, in particular we focus on the case of a massive pion gas. Leading order results according to the chiral power-counting are presented for the DC electrical conductivity, thermal conductivity, shear viscosity, and bulk viscosity. We also comment on the possible correlation between the bulk viscosity and the trace anomaly in QCD, as well as the relation between unitarity and a minimum of the quotient $\\eta/s$ near the phase transition.

  14. Further Precise Determinations of $\\alpha_s$ from Lattice QCD

    E-print Network

    Davies, C T H; Lepage, G P; McCallum, P; Shigemitsu, J; Sloan, J

    1997-01-01

    We present a new determination of the strong coupling constant from lattice QCD simulations. We use four different short-distance quantities to obtain the coupling, three different (infrared) meson splittings to tune the simulation parameters, and a wide range of lattice spacings, quark masses, and lattice volumes to test for systematic errors. Our final result consists of ten different determinations of $\\alpha^{(3)}_{P}(8.2 GeV)$, which agree well with each other and with our previous results. The most accurate of these, when evolved perturbatively to the $Z^0$ mass, gives obtained from other recent lattice simulations.

  15. Blackness coefficients, effective diffusion parameters, and control rod worths for thermal reactors

    SciTech Connect

    Bretscher, M.M.

    1984-09-01

    Simple diffusion theory cannot be used to evaluate control rod worths in thermal reactors because of the strongly absorbing character of the control material. However, good results can be obtained from a diffusion calculation by representing the absorber slab by means of a suitable pair of internal boundary conditions, ..cap alpha.. and ..beta.., which are ratios of neutron flux to neutron current. Methods for calculating ..cap alpha.. and ..beta.. in the P/sub 1/, P/sub 3/, and P/sub 5/ approximations, with and without scattering, are presented. By appropriately weighting the fine-group blackness coefficients, broad group values, <..cap alpha..> and <..beta..>, are obtained. The technique is applied to the calculation of control rod worths of Cd, Ag-In-Cd, and Hf control elements. Results are found to compare very favorably with detailed Monte Carlo calculations. For control elements whose geometry does not permit a thin slab treatment, other methods are needed for determining the effective diffusion parameters. One such method is briefly discussed and applied to the calculation of control rod worths in the Ford Nuclear Reactor at the University of Michigan. Calculated and measured worths are found to be in good agreement.

  16. X-ray analysis of alpha mercuric iodide crystal structure and processing effects

    SciTech Connect

    Keller, L. [CAMET Research, Inc., Goleta, CA (United States); Wang, E.X.; Cheng, A.Y. [EG and G Energy Measurements, Inc., Goleta, CA (United States). Santa Barbara Operations

    1993-07-01

    X-ray topography and rocking curve experiments were performed on {alpha}-mercuric iodide samples. As-grown crystals were examined for Intrinsic defects and crystallinity. Orientation of certain defects depends on the direction of crystal growth. The propagation of as-grown crystalline features was documented. The extent of crystal damage Introduced during various steps of device fabrication such as sawing, polishing, etching and contact deposition was explored. Coefficients of linear thermal expansion of {alpha}{sub 33} = 54 {plus_minus} 5{center_dot}10{sup {minus}6}/{degrees}C along the tetragonal c-axis, [001] direction and {alpha}{sub 11} = 11 {plus_minus} 4{center_dot}10{sup {minus}6}/{degrees}C in the [100] direction were measured.

  17. Analysis of Raman scattered Ly-alpha emissions from the atmosphere of Uranus

    NASA Technical Reports Server (NTRS)

    Yelle, R. V.; Doose, L. R.; Tomasko, M. G.; Strobel, D. F.

    1987-01-01

    A line at 1280 A, due to Raman scattering of solar Lyman alpha (Ly-alpha) in the atmosphere of Uranus, has been detected by the Voyager Ultraviolet Spectrometer. The measured intensity of 40 + or - 20 R implies that 200 R to 500 R of the measured 1500 R Ly-alpha intensity at the subsolar point is due to Rayleigh scattering of the solar line. The presence of Rayleigh and Raman scattering at 1216 A suggests that the Uranian atmosphere is largely devoid of absorbing hydrocarbons above the 0.5 mbar level. The most natural explanation of this depletion is very weak vertical mixing equivalent to an eddy coefficient on the order of 200 sq cm/sec between 0.5 mbar and 100 mbar.

  18. On the analysis of the H Lyman-alpha dayglow of Jupiter, Saturn and Uranus

    NASA Astrophysics Data System (ADS)

    Emerich, C.; Ben Jaffel, L.; Prange, R.

    1993-05-01

    A new radiative transfer model, particularly well adapted to calculations in inhomogeneous atmospheres, has been applied, during the last four years, to analyze new and older Lyman-alpha airglow data from three giant planets. We review all the results obtained so far. Several features which were not accounted for by using the previous transfer codes were satisfactorily simulated, using essentially the scattering of the solar and the interplanetary Lyman-alpha lines by hydrogen in the upper atmospheres. The search for a good fit both in intensity and in shape of the limb to limb data, and/or of the line profiles, provided constraints on the dynamics of the atmospheres, through the estimate of either the eddy diffusion coefficient, the total H column density, or of the possibility of some nonthermal turbulence processes at high altitude. Consequently, the need for an 'electroglow' process for the Lyman-alpha emission was considerably reduced and may be dismissed in the majority of cases.

  19. Relative biological effectiveness for induction of cancer by protracted alpha versus beta internal irradiation

    SciTech Connect

    Raabe, O.G. [Univ. of California, Davis, CA (United States)

    1996-06-01

    Three-dimensional dose-rate/time/ response mathematical surfaces describe radiation effects in lifetime studies of beagles after Intake by injection or inhalation of selected radionuclides (including {alpha}-emitters {sup 226}Ra, {sup 239}Pu, {sup 238}Pu, and {sup 241}Am and {Beta}-emitters {sup 90}Sr, {sup 91}Y, and {sup 144}Ce) and in people after intake of {sup 226}Ra. For each effect t{sub m}=K{sub m}d{sup -s}, where t{sub m} is the median elapsed time to death with the specified effect after intake, d is the time-weighted average absorbed radiation dose-rate to the target organ, K{sub m} is the median distribution coefficient, and s is the negative slope parameter. Using maximum likelihood survival regression methods, for fatal cancer induction s was found to be one-third for {alpha} radiation and two-thirds for {beta} radiation. Because the slopes of the response curves for high LET {alpha} emitters differ from those for the low LET {Beta} emitters, the observed relative biological effectiveness, RBE({alpha}/{beta}), varies as a function of time-weighted average dose rate. At high dose rates, this radiation-induced cancer RBE({alpha}/{beta}) is small, but as dose rate goes down, the radiation-induced cancer RBE({alpha}/{beta}) rises without limit; actually the RBE({beta}/{alpha}) for producing radiation-induced cancer approaches zero. For example, for {sup 239}Pu dioxide in lung at 0.1 Gy d{sup -1} vs. {sup 90}Sr, the RBE({alpha}/{beta})=5, while at 1 mGy d{sup -1}, RBE({alpha}/{Beta})=50. The bone cancer RBE({alpha}/{beta})=l at 0.16 Gy d{sup -1} but RBE({alpha}/{beta})=30 at 1 mGy d{sup -1} for {sup 226}Ra/{sup 90}Sr in bone. Since {sup 238}Pu and {sup 239}Pu are about 10 times more effective than {sup 226}Ra in producing bone cancer, the apparent RBE({alpha}/{beta})=300 for plutonium in bone at 1 mG d{sup -1}.

  20. On Varying-coefficient Independence Screening for High-dimensional Varying-coefficient Models

    PubMed Central

    Song, Rui; Yi, Feng; Zou, Hui

    2014-01-01

    Varying coefficient models have been widely used in longitudinal data analysis, nonlinear time series, survival analysis, and so on. They are natural non-parametric extensions of the classical linear models in many contexts, keeping good interpretability and allowing us to explore the dynamic nature of the model. Recently, penalized estimators have been used for fitting varying-coefficient models for high-dimensional data. In this paper, we propose a new computationally attractive algorithm called IVIS for fitting varying-coefficient models in ultra-high dimensions. The algorithm first fits a gSCAD penalized varying-coefficient model using a subset of covariates selected by a new varying-coefficient independence screening (VIS) technique. The sure screening property is established for VIS. The proposed algorithm then iterates between a greedy conditional VIS step and a gSCAD penalized fitting step. Simulation and a real data analysis demonstrate that IVIS has very competitive performance for moderate sample size and high dimension. PMID:25484548

  1. Interferon Alpha-Induced Depression in Chronic Hepatitis C Patients: Comparison between Different Types of Interferon Alpha

    Microsoft Academic Search

    M. Malaguarnera; I. Di Fazio; S. Restuccia; G. Pistone; L. Ferlito; L. Rampello

    1998-01-01

    IFN alpha treatment is able to produce dose-related side effects, such as depression, in the central nervous system. We assessed the effects on depression of four different types of IFN alpha (recombinant IFN alpha 2a, recombinant IFN alpha 2b, lymphoblastoid IFN alpha, leukocyte IFN alpha), administered at the same doses in four homogeneous groups of chronic hepatitis C patients (96

  2. On the Eddy Break-Up coefficient

    SciTech Connect

    Brizuela, E.A. [DSTO Aeronautical and Maritime Research Lab., Fishermens Bend, Victoria (Australia)] [DSTO Aeronautical and Maritime Research Lab., Fishermens Bend, Victoria (Australia); Bilger, R.W. [Univ. of Sydney, New South Wales (Australia). Dept. of Mechanical and Mechatronic Engineering] [Univ. of Sydney, New South Wales (Australia). Dept. of Mechanical and Mechatronic Engineering

    1996-01-01

    Advanced combustion models for turbulent reactive flow are still not at a stage where they are useful for engineering calculations of practical systems such as gas turbine combustors. State-of-the-art methods still use the Eddy Break-Up (EBU) model to give the fast chemistry limit to the reaction rate with a global kinetics formula being used to estimate the kinetically limited rates. While there must continue to be basic reservations about the general correctness of the EBU approach, it has recently been shown that the EBU limit does have a basis in theory for the nonpremixed case. The theoretical result of Bilger for the mixing-limited reaction rate shows that it is proportional to the probability density of the mixture being at stoichiometric. The EBU model, however, takes it as being proportional to the mass fraction of the deficient reactant, but this is in turn a property of the mixture fraction pdf (probability density function) under fast chemistry conditions. The theoretical result can be used to evaluate the correct value of the EBU coefficient, which is usually taken as a constant but with quite widely varying values. In this paper the authors evaluate this theoretical value for the EBU coefficient using two commonly adopted forms of the pdf. Recommendations are made with regard to the best values to use in practice.

  3. A variable rate coefficient chlorine decay model.

    PubMed

    Jonkergouw, Philip M R; Khu, Soon-Thiam; Savic, Dragan A; Zhong, Dan; Hou, Xiu Q; Zhao, Hong-Bin

    2009-01-15

    Chlorine is the most widely used water disinfectant in the world. As a result, optimal chlorine usage is essential for both human and environmental health. Chlorine decay models can be used to predict residual concentrations in water distribution networks and optimize chlorine dosing. However, the coefficients of current chlorine decay models are often dependent on the loading conditions and are therefore impractical for day-to-day water distribution network modeling purposes and chlorine dosing optimization studies. This study proposes and assesses a novel numerical chlorine decay model with four parameters that are independent of the loading conditions for a given water sample. The model is based on kinetic equations derived from the rate law for concurrent bimolecular second order reactions with chlorine and will be referred to as the variable rate coefficient (VRC) chlorine decay model. The performance of the proposed model is compared with another model reported in the literature, and the VRC model is also assessed for reliability with data sets that are omitted during model calibration. The VRC model is consistently found to be in agreement with the experimental data. PMID:19238972

  4. Hierarchical coefficient of a multifractal based network

    NASA Astrophysics Data System (ADS)

    Moreira, Darlan A.; Lucena, Liacir dos Santos; Corso, Gilberto

    2014-02-01

    The hierarchical property for a general class of networks stands for a power-law relation between clustering coefficient, CC and connectivity k: CC?k?. This relation is empirically verified in several biologic and social networks, as well as in random and deterministic network models, in special for hierarchical networks. In this work we show that the hierarchical property is also present in a Lucena network. To create a Lucena network we use the dual of a multifractal lattice ML, the vertices are the sites of the ML and links are established between neighbouring lattices, therefore this network is space filling and planar. Besides a Lucena network shows a scale-free distribution of connectivity. We deduce a relation for the maximal local clustering coefficient CCimax of a vertex i in a planar graph. This condition expresses that the number of links among neighbour, N?, of a vertex i is equal to its connectivity ki, that means: N?=ki. The Lucena network fulfils the condition N??ki independent of ki and the anisotropy of ML. In addition, CCmax implies the threshold ?=1 for the hierarchical property for any scale-free planar network.

  5. On Learning Cluster Coefficient of Private Networks

    PubMed Central

    Wang, Yue; Wu, Xintao; Zhu, Jun; Xiang, Yang

    2013-01-01

    Enabling accurate analysis of social network data while preserving differential privacy has been challenging since graph features such as clustering coefficient or modularity often have high sensitivity, which is different from traditional aggregate functions (e.g., count and sum) on tabular data. In this paper, we treat a graph statistics as a function f and develop a divide and conquer approach to enforce differential privacy. The basic procedure of this approach is to first decompose the target computation f into several less complex unit computations f1, …, fm connected by basic mathematical operations (e.g., addition, subtraction, multiplication, division), then perturb the output of each fi with Laplace noise derived from its own sensitivity value and the distributed privacy threshold ?i, and finally combine those perturbed fi as the perturbed output of computation f. We examine how various operations affect the accuracy of complex computations. When unit computations have large global sensitivity values, we enforce the differential privacy by calibrating noise based on the smooth sensitivity, rather than the global sensitivity. By doing this, we achieve the strict differential privacy guarantee with smaller magnitude noise. We illustrate our approach by using clustering coefficient, which is a popular statistics used in social network analysis. Empirical evaluations on five real social networks and various synthetic graphs generated from three random graph models show the developed divide and conquer approach outperforms the direct approach. PMID:24429843

  6. Astrophysical S Factors from Asymptotic Normalization Coefficients

    NASA Astrophysics Data System (ADS)

    Tribble, R. E.; Azhari, A.; Bem, P.; Burjan, V.; Carstoiu, F.; Cejpek, J.; Clark, H. L.; Gagliardi, C. A.; Kroha, V.; Lui, Y.-W.; Mukhamedzhanov, A. M.; Novak, J.; Piskor, S.; Sattarov, A.; Simeckova, E.; Tang, X.; Trache, L.; Vincour, J.

    2002-01-01

    Peripheral transfer reactions can be used to determine asymptotic normalization coefficients (ANC). These coefficients, which provide the normalization of the tail of the overlap function, determine S factors for direct capture reactions at astro-physical energies. A variety of proton transfer reactions have been used to measure ANC's. As tests of the technique, ANC's for 10B ? 9Be + p and 17F ? 16O + p have been measured and their values were used to predict the S factors for 9Be(p,?)10B and 16O(p,?)17F. In both cases the predictions are in excellent agreement with measured S factors. Following the same technique, the 10B(7Be,8B)9Be and 14N(7Be,8B)13C reactions have been used to measure the ANC appropriate for determining 7Be(p,?)8B. The results from the two transfer reactions provide an indirect determination of S17(0). Recent measurements have been completed on the 14N(11C,12N)13C reaction which will allow us to define the astrophysical S factor for the 11C(p,?)12N reaction.

  7. The Convergence Coefficient across Political Systems

    PubMed Central

    Schofield, Norman

    2013-01-01

    Formal work on the electoral model often suggests that parties or candidates should locate themselves at the electoral mean. Recent research has found no evidence of such convergence. In order to explain nonconvergence, the stochastic electoral model is extended by including estimates of electoral valence. We introduce the notion of a convergence coefficient, c. It has been shown that high values of c imply that there is a significant centrifugal tendency acting on parties. We used electoral surveys to construct a stochastic valence model of the the elections in various countries. We find that the convergence coefficient varies across elections in a country, across countries with similar regimes, and across political regimes. In some countries, the centripetal tendency leads parties to converge to the electoral mean. In others the centrifugal tendency dominates and some parties locate far from the electoral mean. In particular, for countries with proportional electoral systems, namely, Israel, Turkey, and Poland, the centrifugal tendency is very high. In the majoritarian polities of the United States and Great Britain, the centrifugal tendency is very low. In anocracies, the autocrat imposes limitations on how far from the origin the opposition parties can move. PMID:24385886

  8. Coefficient adaptive triangulation for strongly anisotropic problems

    SciTech Connect

    D`Azevedo, E.F.; Romine, C.H.; Donato, J.M.

    1996-01-01

    Second order elliptic partial differential equations arise in many important applications, including flow through porous media, heat conduction, the distribution of electrical or magnetic potential. The prototype is the Laplace problem, which in discrete form produces a coefficient matrix that is relatively easy to solve in a regular domain. However, the presence of anisotropy produces a matrix whose condition number is increased, making the resulting linear system more difficult to solve. In this work, we take the anisotropy into account in the discretization by mapping each anisotropic region into a ``stretched`` coordinate space in which the anisotropy is removed. The region is then uniformly triangulated, and the resulting triangulation mapped back to the original space. The effect is to generate long slender triangles that are oriented in the direction of ``preferred flow.`` Slender triangles are generally regarded as numerically undesirable since they tend to cause poor conditioning; however, our triangulation has the effect of producing effective isotropy, thus improving the condition number of the resulting coefficient matrix.

  9. Rotordynamic coefficients for stepped labyrinth gas seals

    NASA Technical Reports Server (NTRS)

    Scharrer, Joseph K.

    1989-01-01

    The basic equations are derived for compressible flow in a stepped labyrinth gas seal. The flow is assumed to be completely turbulent in the circumferential direction where the friction factor is determined by the Blasius relation. Linearized zeroth and first-order perturbation equations are developed for small motion about a centered position by an expansion in the eccentricity ratio. The zeroth-order pressure distribution is found by satisfying the leakage equation while the circumferential velocity distribution is determined by satisfying the momentum equations. The first order equations are solved by a separation of variables solution. Integration of the resultant pressure distribution along and around the seal defines the reaction force developed by the seal and the corresponding dynamic coefficients. The results of this analysis are presented in the form of a parametric study, since there are no known experimental data for the rotordynamic coefficients of stepped labyrinth gas seals. The parametric study investigates the relative rotordynamic stability of convergent, straight and divergent stepped labyrinth gas seals. The results show that, generally, the divergent seal is more stable, rotordynamically, than the straight or convergent seals. The results also show that the teeth-on-stator seals are not always more stable, rotordynamically, then the teeth-on-rotor seals as was shown by experiment by Childs and Scharrer (1986b) for a 15 tooth seal.

  10. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

    2015-01-01

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  11. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    E-print Network

    U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Düllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schädel; A. Yakushev; S. Åberg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jäger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thörle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Türler; A. Ward; D. E. Ward; N. Wiehl

    2015-02-10

    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  12. Atypical alpha asymmetry in adults with ADHD*

    PubMed Central

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8– 12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha asymmetry has been associated with ADHD-like traits such as reduced reward responsiveness, a lack of inhibition toward aversive experience, and increased approach behaviors, and previous work has indicated increased rightward alpha asymmetry in children with ADHD. The current study explores whether increased rightward alpha asymmetry is also evident in adults with ADHD. Method We assessed low (8– 10 Hz) and high (10– 12 Hz) alpha asymmetry in adults with ADHD (n = 29) versus controls (n = 62) during baseline and cognitive activation conditions for nine homologous electrode pairs along the anterior–posterior axis. Result Seven results emerged (p < .05) showing increased rightward alpha asymmetry in adults with ADHD. This occurred in three specific electrode pairs across two testing conditions, and five of six results occurred in the lower alpha band. Finally, post hoc analysis indicated that increased rightward alpha asymmetry was generally associated with greater numbers of ADHD symptoms—with a possible parietal association for inattentive and a fronto-temporal association for hyperactivity symptoms. Conclusions Increased rightward alpha asymmetry previously observed in children with ADHD appears to be a developmentally persistent feature of ADHD. PMID:19467358

  13. Inference of Electron-Ion Recombination Coefficients from Microwave Afterglow Measurements Employing Microwave Heating of Electrons

    NASA Astrophysics Data System (ADS)

    Dulaney, Jeff L.

    The rates of recombination of NO('+) and O(,2)('+)(.)O(,2) dimer ions with electrons as a function of electron temperature have been deter- mined using a microwave-afterglow/mass -spectrometer apparatus employing microwave heating of electrons. The recombination rates for these ions are of importance for modeling the upper atmosphere. The electron temperature T(,e) was found to vary spatially throughout the plasma and an improved data analysis method had to be developed. This data analysis method was used in the present studies to determine the recombination rate coefficient (alpha). The results of the recombination studies of NO('+) ions with. electrons as a function of electron temperature can be represented by the simple power law dependence. (DIAGRAM, TABLE OR GRAPHIC OMITTED...PLEASE SEE DAI). over the electron temperature range 295 K (LESSTHEQ) T(,e) (LESSTHEQ) 4500 K. This measurement is in agreement with other experimental determinations of (alpha)(NO('+)). The results of the recombination studies of O(,2)('+)(.)O(,2) dimer ions with electrons can be expressed by the power law. (DIAGRAM, TABLE OR GRAPHIC OMITTED...PLEASE SEE DAI). over the range 143 K (LESSTHEQ) T(,e) (LESSTHEQ) 5500 K. This is the first measurement of the O(,2)('+)(.)O(,2) dimer ion recombination rate coefficient at elevated electron temperatures. The room temperature value of the recombination coefficient is consistent with room temperature values for other dimer ions, i.e. (TURN)10('-6) cm('3)/sec. Also, a comprehensive review of previous microwave afterflow studies was made to determine the possible effect of the non-uniformity of the electron temperature on the data analysis of those experiments. It is found that the essential conclusions of most (but not all) of the previous afterglow studies are still valid, but that the interpretation of the data should be modified.

  14. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  15. Targeted alpha therapy for cancer

    NASA Astrophysics Data System (ADS)

    Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John

    2004-08-01

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

  16. The Cycles of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2010-02-01

    The main AB pair of the nearby Alpha Centauri triple system has one of the most extensive X-ray records of any cosmic object, stretching over three decades. The primary, ? Cen A (G2V), is a near twin of the Sun, with a similarly soft (1-2 MK) corona. The secondary, ? Cen B (K1V), is more active than the Sun, with a generally harder coronal spectrum. Here, spatially resolved measurements of the pair by Chandra's High Resolution Camera are compared, on a common basis, with previous pointings from ROSAT and XMM-Newton.

  17. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  18. Measuring the quality of family-professional partnerships in special education services

    E-print Network

    Summers, Jean Ann; Hoffman, Lesa; Marquis, Janet; Turnbull, Ann P.; Poston, Denise J.; Lord Nelson, Louise

    2005-01-01

    . They developed a 57-item measure of parents' satisfaction with dif- ferent aspects of early intervention services, which yielded a Cronbach's alpha for the scale at .95 and a Guttman split-half reliability coefficient of .89. Measures of Family-Centered Practice... sample including these children might result in too few children with more complex needs. Second, the contact person in each school district was asked to alpha- betize the names of the remaining children with disabilities who met the inclusion criteria...

  19. ESTIMATING COTTON EVAPOTRANSPIRATION CROP COEFFICIENTS WITH A MULTISPECTRAL VEGETATION INDEX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Crop coefficients are a widely used and universally accepted method for estimating the crop evapotranspiration (ETc) component in irrigation scheduling programs. However, uncertainties of generalized basal crop coefficient (Kcb) curves can contribute to ETc estimates that are substantially different...

  20. Rat pineal alpha 1-adrenoceptor subtypes: studies using radioligand binding and reverse transcription-polymerase chain reaction analysis.

    PubMed Central

    Sugden, D.; Anwar, N.; Klein, D. C.

    1996-01-01

    1. The pharmacological characteristics of alpha 1-adrenoceptor binding sites in rat pineal gland membranes, detected by use of a selective alpha 1-adrenoceptor antagonist ([125I]-iodo-2-[beta-(4-hydroxyphenyl) ethylaminomethyl]tetralone, [125I]-HEAT), were investigated with the alkylating agent, chloroethylclonidine (CEC), and in competition experiments with a number of adrenoceptor agonists and antagonists. 2. Chloroethylclonidine (CEC) treatment (10 microM, 10 min) of rat pineal membranes inactivated approximately 70% of specific [125I]-HEAT binding sites. Higher concentrations of CEC (up to 100 microM) or longer treatment periods (up to 40 min) were no more effective. 3. Adrenoceptor agonists and antagonists competitively inhibited [125I]-HEAT binding with Hill coefficients close to unity indicating a single alpha 1-adrenoceptor subtype is present. The affinity (Ki) of subtype selective agonists (oxymetazoline, SDZ NVI-085) and antagonists (5-methylurapidil, WB4101, benoxathian, phentolamine) was consistent with binding to an alpha 1B-adrenoceptor subtype. 4. The (-)- and (+)-enantiomers of niguldipine had an equal and low affinity for alpha 1-adrenoceptor binding sites both in untreated (log Ki-6.66 and -6.90 respectively) and CEC-treated membranes in which approximately 70% of sites had been inactivated (log Ki-6.41 and -6.86 respectively). This indicates that the small proportion of alpha 1-adrenoceptors insensitive to CEC are not alpha 1A-adrenoceptors. 5. mRNA was isolated from rat pinealocytes, cDNA was synthesized and then amplified by the polymerase chain reaction with alpha 1-adrenoceptor subtype specific primers. These experiments identified both alpha 1A- and alpha 1B-adrenoceptor mRNA, but not alpha 1D-mRNA in rat pinealocytes, although all three adrenoceptor subtypes were readily identified in rat brain cortex. 6. These data indicate that although both alpha 1A- and alpha 1B-adrenoceptor mRNAs are present in the pineal the major subtype of alpha 1-adrenoceptor expressed is the alpha 1B. Images Figure 2 PMID:8818350

  1. A model for the disc Lyman alpha emission of Uranus

    NASA Technical Reports Server (NTRS)

    Ben Jaffel, L.; Prange, R.; Emerich, C.; Vidal-Madjar, A.; Mcconnell, J. C.

    1991-01-01

    A new efficient radiative transfer algorithm for nonhomogeneous model atmospheres has been applied to the Uranian atmosphere. The contribution of the scatter solar Lyman-alpha to the Uranain emission is of the order of 300 R, and the Rayleigh contribution may reach 450 R for small values of the eddy diffusion coefficient (EDC). The total solar contribution may then reach about 750 R for a solar flux of 2.5 x 10 to the 11th photons/sq cm/s/A. A level of up to 400 R is confirmed in some directions for the interstellar wind contribution. The values of the atmospheric EDC necessary to mimic the observations are 50-100 sq cm/s. A small additional source located on the dayside Uranian atmosphere seems necessary correctly to fit the shape of the limb to limb intensity variation, especially near the limbs. Its contribution to the emergent intensity would range from 100 to 500 R.

  2. Mathematical model of an air-filled alpha stirling refrigerator

    NASA Astrophysics Data System (ADS)

    McFarlane, Patrick; Semperlotti, Fabio; Sen, Mihir

    2013-10-01

    This work develops a mathematical model for an alpha Stirling refrigerator with air as the working fluid and will be useful in optimizing the mechanical design of these machines. Two pistons cyclically compress and expand air while moving sinusoidally in separate chambers connected by a regenerator, thus creating a temperature difference across the system. A complete non-linear mathematical model of the machine, including air thermodynamics, and heat transfer from the walls, as well as heat transfer and fluid resistance in the regenerator, is developed. Non-dimensional groups are derived, and the mathematical model is numerically solved. The heat transfer and work are found for both chambers, and the coefficient of performance of each chamber is calculated. Important design parameters are varied and their effect on refrigerator performance determined. This sensitivity analysis, which shows what the significant parameters are, is a useful tool for the design of practical Stirling refrigeration systems.

  3. Transport Coefficients in weakly compressible turbulence

    NASA Technical Reports Server (NTRS)

    Rubinstein, Robert; Erlebacher, Gordon

    1996-01-01

    A theory of transport coefficients in weakly compressible turbulence is derived by applying Yoshizawa's two-scale direct interaction approximation to the compressible equations of motion linearized about a state of incompressible turbulence. The result is a generalization of the eddy viscosity representation of incompressible turbulence. In addition to the usual incompressible eddy viscosity, the calculation generates eddy diffusivities for entropy and pressure, and an effective bulk viscosity acting on the mean flow. The compressible fluctuations also generate an effective turbulent mean pressure and corrections to the speed of sound. Finally, a prediction unique to Yoshizawa's two-scale approximation is that terms containing gradients of incompressible turbulence quantities also appear in the mean flow equations. The form these terms take is described.

  4. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.

    2002-10-01

    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  5. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  6. Cluster Expansion of Cold Alpha Matter Energy

    Microsoft Academic Search

    F. Carstoiu; S Misicu; V. Balanica; M. Lassaut

    2010-01-01

    In the cluster expansion framework of Bose liquids we calculate analytical expressions of the two-body, three-body and four-body diagrams contributing to the g.s. energy of an infinite system of neutral alpha-particles at zero-temperature, interacting via the strong nuclear forces exclusively. This is analytically tractable by assuming a density dependent two-body correlation function of Gaussian type. For the alpha-alpha potential we

  7. On alpha heating in toroidal devices

    Microsoft Academic Search

    G. H. Miley

    1979-01-01

    Studies of the alpha particle losses and heating profiles for an alpha-heated TFTR-sized tokamak and a small field-reversed mirror reactor (FRM) are presented. The slowing-down and drift of high-energy alpha particles, including detailed orbital effects, is approximated for tokamak geometry using the SYMALF multi-energy-angle code. Results of the calculation for a beam-driven TFTR-type plasma indicate that, except for the center

  8. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K. (Idaho Falls, ID); Martz, Dowell E. (Grand Junction, CO)

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  9. Alpha-Fetoprotein-Producing Renal Cell Carcinoma

    Microsoft Academic Search

    Chang-Min Lin; En Meng; Shang-Sen Lee; Sheng-Tang Wu; Ching-Jiunn Wu; Ann Chen; Dah-Shyong Yu; Sun-Yran Chang; Guang-Huan Sun

    Renal cell carcinoma with increased serum alpha-fetoprotein is rare; only 13 such cases have been reported. Our patient, a 51-year-old man, had an increased serum alpha-fetoprotein level and a tumor in the lower pole of the right kidney; which was discovered incidentally with sonography. Two weeks after a partial nephrectomy, his serum alpha-fetoprotein level declined to within the normal range.

  10. COMPARISON OF TELEPHOTOMETER MEASUREMENTS OF EXTINCTION COEFFICIENTS WITH SCATTERING AND ABSORPTION COEFFICIENTS

    EPA Science Inventory

    During the summer of 1979, coefficients for light extinction in the atmosphere were calculated from measurements made with a telephotometer placed 251 m from a black target in Research Triangle Park, North Carolina. The results are well correlated (r = 0.92 to 0.96) with integrat...

  11. Very fast computation of polynomial remainder sequence coefficient signs

    Microsoft Academic Search

    James R. Pinkert

    1976-01-01

    Polynomial remainder sequences are the basis of many important algorithms in symbolic and algebraic manipulation. In a number of these algorithms, the actual coefficients of the sequence are not required; rather, the method uses the signs of the coefficients. Present techniques, however, compute the exact coefficients (or a mixed radix representation of them), and then obtain the signs. This paper

  12. Osmotic coefficients of aqueous sodium carbonate solutions at 25°C

    Microsoft Academic Search

    R. A. Robinson; J. B. Macaskill

    1979-01-01

    Isopiestic vapor pressure measurements are reported for aqueous sodium carbonate solutions at 25°C using sodium chloride as reference electrolyte. Osmotic and activity coefficients are calculated from the concentrations of the solutions in isopiestic equilibrium. The results are used to calculate the trace activity coefficients of carbonate ion in sodium chloride solutions; these should approximate the trace activity coefficient of carbonate

  13. Measurements of molecular and thermal diffusion coefficients in ternary mixtures

    E-print Network

    Firoozabadi, Abbas

    coefficients in ternary nonelec- trolytes and higher mixtures; Leaist and Hui1 have measured the Soret technique, Gans et al.2 have measured the Soret coefficients of a polymer and a colloid in ternary mixtures al.3 and Kita et al.4 have measured the polymer Soret coefficient in ternary mixtures of the same

  14. Process controls on event runoff coefficients in Austria

    Microsoft Academic Search

    R. Merz; G. Blöschl

    2009-01-01

    In this paper we analyze the controls on the spatiotemporal variability of event runoff coefficients. A total of about 64,000 events in 459 Austrian catchments ranging from 5 to 10000 km2 are analyzed. Event runoff coefficients vary in space, depending on the longterm controls such as climate and catchment formation. Event runoff coefficients also vary in time, depending on event

  15. The inverse bremsstrahlung absorption coefficient in collisional plasmas

    Microsoft Academic Search

    R. Cauble; W. Rozmus

    1985-01-01

    A prescription for the inverse bremsstrahlung (IB) absorption coefficient is presented. The coefficient is derived in terms of a collision frequency that is found from a memory function kinetic formalism. The formalism admits limits that allow a rigorous definition of the coefficient when the plasma is weakly coupled and approximations that provide a reliable calculation when the plasma is strongly

  16. A new airmass independent formulation for the Linke turbidity coefficient.

    E-print Network

    Perez, Richard R.

    A new airmass independent formulation for the Linke turbidity coefficient. Pierre Ineichen CUEPE@asrc.cestm.albany.edu Abstract We propose a new formulation for the Linke turbidity coefficient with the objective of removing turbidity coefficient. Introduction In a cloudless atmosphere, solar radiation is diffused by the permanent

  17. Coefficients of Association Analogous to Pearson's r for Nonparametric Statistics.

    ERIC Educational Resources Information Center

    Stavig, Gordon; Acock, Alan C.

    1980-01-01

    Two r coefficients of association are discussed. One of the coefficients can be applied to any nonparametric test statistic (NTS) in which a normal approximation equation is appropriate. The other coefficient is applicable to any NTS in which exact probabilities are known. (Author/RL)

  18. Measuring the Dispersion Coefficient with Acoustic Doppler Current Profilers

    Microsoft Academic Search

    Meredith L. Carr; Chris R. Rehmann

    2007-01-01

    A method is evaluated for estimating the longitudinal dispersion coefficient K from velocities and bathymetry measured with an acoustic Doppler current profiler ADCP. If shear dispersion controls the mixing, the dispersion coefficient can be estimated from measurements of velocity and depth in a cross section. The dispersion coefficient has typically been measured by costly and time- consuming tracer studies because

  19. [Alpha-linolenic acid and cardiovascular diseases].

    PubMed

    Risti?-Medi?, Danijela; Risti?, Gordana; Tepsi?, Vesna

    2003-01-01

    IMPORTANCE AND METABOLISM OF ALPHA-LINOLENIC ACID: Alpha-linolenic acid is an essential fatty acid which cannot be produced in the body and must be taken by food. Both in animals and humans, alpha-linolenic acid is desaturated and elongated into eicosapentaenoic and docosahexaenoic acid. It is also incorporated into plasma and tissue lipids and its conversion is affected by levels of linoleic acid. POTENTIAL ROLE IN PATHOGENESIS OF CARDIOVASCULAR DISEASES: Diet enriched in n-3 fatty acids, especially alpha-linolenic acid, reduces the incidence of cardiac death. Studies have shown that alpha linolenic acid prevents ventricular fibrillation which is the main cause of cardiac death. Studies in rats suggest that alpha-linolenic acid may be more effective in preventing ventricular fibrillations than eicosapentaenoic and docosahexaenoic acid. Furthermore, alpha-linolenic acid is the main fatty acid decreasing platalet aggregation which is an important step in thrombosis i.e. non-fatal myocardial infarction and stroke. DIETARY SOURCES AND NUTRITION RECOMMENDATIONS: Dietary sources include flaxseed and flaxseed oil, canola oil, soybean and soybean oil, pumpkin seed and pumpkin oil, walnuts and walnut oil. Strong evidence supports beneficial effects of alpha-linolenic acid and its dietary sources should be incorporated into balanced diet for prevention of cardiovascular diseases. The recommended daily intake is 2 g with a ratio of 5/1 for linoleic/alpha-linolenic acid. PMID:15510909

  20. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  1. A simple application of the Bailey-Orowan creep model to Fe-39.8 at. pct Al and gamma/gamma prime - alpha

    NASA Technical Reports Server (NTRS)

    Whittenberger, J. D.; Krishnan, R. V.

    1984-01-01

    The results of a study to determine the recovery rates and work-hardening coefficients for creep from constant cross-head speed compressive tests are presented. Stressing and straining rates are computed from measured time-load curves obtained from compression testing between 1200 and 1400 K of several B2 crystal structure Fe-39.8 Al intermetallic materials and the directionally solidified eutectic alloy gamma/gamma prime alpha. These quantities are then fitted to the universal form of the Bailey-Orowan equation for creep. The recovery rates were found to be functions of nominal strain rate, stress, and temperature, while the hardening coefficients were dependent only on temperature. While the work-hardening coefficient for gamma/gamma prime - alpha was about 0.05 of the elastic modulus, the work-hardening coefficients for Fe-39.8 at. pct Al were less than 0.002 of the modulus.

  2. EEG alpha power and alpha power asymmetry in sleep and wakefulness.

    PubMed

    Benca, R M; Obermeyer, W H; Larson, C L; Yun, B; Dolski, I; Kleist, K D; Weber, S M; Davidson, R J

    1999-07-01

    Asymmetry of waking electroencephalography (EEG) alpha power in frontal regions has been correlated with waking emotional reactivity and the emotional content of dream reports. Little is known regarding alpha asymmetry during sleep. The present study was performed to compare alpha power and alpha power asymmetry in various brain regions across states of sleep and wakefulness. Waking and sleep EEG were recorded in a group of patients undergoing polysomnographic evaluation for possible sleep disorders. Alpha EEG asymmetry in frontal and temporal regions was significantly correlated in waking versus sleep, particularly during rapid eye movement (REM) sleep. These results suggest that patterns of frontal alpha asymmetry are stable across sleep and waking and may be related to emotional reactivity during dreaming. During sleep, alpha power was highest during slow-wave sleep and lowest during REM sleep. Implications of these data for understanding the functional significance of alpha power during waking and sleeping are considered. PMID:10432792

  3. Molecular basis of alpha-thalassemia in Portugal.

    PubMed

    Peres, M J; Romão, L; Carreiro, H; Picanço, I; Batalha, L; Magalhães, H A; Martins, M C; Lavinha, J

    1995-01-01

    We have estimated the incidence and molecular basis of alpha-thalassemia in a Portuguese population, mostly from the Greater Lisbon area. In a group of 100 consecutive cord blood samples, the gene frequency of the rightward deletion (-alpha 3.7) was 0.035, and the leftward deletion (-alpha 4.2) was 0.015. In this group, we have also found four heterozygotes for the triple alpha-globin gene rearrangement (alpha alpha alpha anti 3.7. gene frequency 0.020). We have characterized the subtypes of -alpha 3.7 and alpha alpha alpha anti 3.7 rearrangements. On the whole, these results give an incidence of 10% for deletional alpha-thalassemia carriers in the studied Portuguese population. In a group of 342 subjects presenting beta-thalassemia, or Hb S trait, beta-thalassemia major sickle cell disease or low red blood cell indices, the -alpha 3.7, -alpha 4.2, -SEA, -MED, (alpha alpha)MM, and alpha alpha alpha anti 3.7 haplotypes were found in different combinations. Only one nondeletional alpha-thalassemia determinant (a 5 nucleotide deletion in the alpha 2-globin gene in the second intervening sequence donor site) was detected, which might suggest a low incidence of these defects in the Portuguese population. PMID:8718693

  4. Image fusion driven by the analysis of sparse coefficients

    NASA Astrophysics Data System (ADS)

    Yu, Xiujuan; Zhao, Hanwen; Luo, Xiaoyan; Yuan, Ding

    2014-11-01

    This paper proposes an efficient fusion method for multiple remote sensing images based on sparse representation, in which we mainly solve the fusion rules of the sparse coefficients. In the proposed fusion method, first is to obtain the sparse coefficients of different source images based on three dictionaries. Considering the sparsity, the source coefficients can be divided into large, middle, and small correlation classer. According to the analysis and comparison of permutations, the final coefficients are fused in the term of different fusion rules according to the correlation. Finally, the fused image can be reconstructed via combining the fused coefficients and trained dictionaries.

  5. Synthesis of regioisomeric methyl alpha-L-arabinofuranobiosides.

    PubMed

    Kawabata, Y; Kaneko, S; Kusakabe, I; Gama, Y

    1995-02-01

    The three regioisomers of methyl alpha-L-arabinofuranobioside, namely methyl O-alpha-L-arabinofuranosyl-(1-->2)-alpha-L-arabinofuranoside, methyl O-alpha-L-arabinofuranosyl-(1-->3)-alpha-L-arabinofuranoside, and methyl O-alpha-L-arabinofuranosyl-(1-->5)-alpha-L-arabinofuranoside, were synthesized for use as substrates in studies of the specificity of alpha-L-arabinofuranosidase. The regiospecifically protected precursors, namely methyl 3,5-di-O-benzoyl-alpha-L-arabinofuranoside, methyl 2,5-di-O-benzyl-alpha-L-arabinofuranoside, and methyl 2,3-di-O-benzoyl-alpha-L-arabinofuranoside, were prepared from 2,3,5-tri-O-benzoyl-alpha-L-arabinofuranosyl chloride (4) and methyl 5-O-trityl-alpha-L-arabinofuranoside, respectively, and glycosylated with 4 in the presence of silver trifluoromethanesulfonate and s-collidine. 1H and 13C NMR data for all compounds are presented. PMID:7697668

  6. Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells

    SciTech Connect

    Abair, Tristin D. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Sundaramoorthy, Munirathinam; Chen, Dong [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Heino, Jyrki [Department of Biochemistry and Food Chemistry, University of Turku, Turku (Finland); Ivaska, Johanna [VTT Technical Research Centre of Finland, Medical Biotechnology, Turku (Finland); Hudson, Billy G. [Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Sanders, Charles R. [Department of Biochemistry, Vanderbilt University, Nashville, TN 37232 (United States); Pozzi, Ambra [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Zent, Roy [Department of Medicine, Veterans Affairs Hospital, Nashville, TN 37232 (United States); Department of Medicine, Division of Nephrology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37232 (United States)], E-mail: roy.zent@vanderbilt.edu

    2008-11-15

    The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

  7. A generalized concordance correlation coefficient for continuous and categorical data.

    PubMed

    King, T S; Chinchilli, V M

    2001-07-30

    This paper discusses a generalized version of the concordance correlation coefficient for agreement data. The concordance correlation coefficient evaluates the accuracy and precision between two measures, and is based on the expected value of the squared function of distance. We have generalized this coefficient by applying alternative functions of distance to produce more robust versions of the concordance correlation coefficient. In this paper we extend the application of this class of estimators to categorical data as well, and demonstrate similarities to the kappa and weighted kappa statistics. We also introduce a stratified concordance correlation coefficient which adjusts for explanatory factors, and an extended concordance correlation coefficient which measures agreement among more than two responses. With these extensions, the generalized concordance correlation coefficient provides a unifying approach to assessing agreement among two or more measures that are either continuous or categorical in scale. PMID:11439426

  8. Methods for Accurate Free Flight Measurement of Drag Coefficients

    E-print Network

    Courtney, Elya; Courtney, Michael

    2015-01-01

    This paper describes experimental methods for free flight measurement of drag coefficients to an accuracy of approximately 1%. There are two main methods of determining free flight drag coefficients, or equivalent ballistic coefficients: 1) measuring near and far velocities over a known distance and 2) measuring a near velocity and time of flight over a known distance. Atmospheric conditions must also be known and nearly constant over the flight path. A number of tradeoffs are important when designing experiments to accurately determine drag coefficients. The flight distance must be large enough so that the projectile's loss of velocity is significant compared with its initial velocity and much larger than the uncertainty in the near and/or far velocity measurements. On the other hand, since drag coefficients and ballistic coefficients both depend on velocity, the change in velocity over the flight path should be small enough that the average drag coefficient over the path (which is what is really determined)...

  9. Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes

    SciTech Connect

    Chi, Seung-Wook [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Kim, Do-Hyoung [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of); Olivera, Baldomero M. [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); McIntosh, J. Michael [Department of Biology, University of Utah, Salt Lake City, UT 84112 (United States); Department of Psychiatry, University of Utah, Salt Lake City, UT 84112 (United States); Han, Kyou-Hoon [Molecular Anti-Cancer Research Center, Division of Molecular Therapeutics, Korea Research Institute of Bioscience and Biotechnology, Yusong P.O. Box 115, Daejon (Korea, Republic of)]. E-mail: khhan600@kribb.re.kr

    2006-06-23

    {alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

  10. The trypsin-inhibitory efficiency of human alpha 2-macroglobulin in the presence of alpha 1-proteinase inhibitor: evidence for the formation of an alpha 2-macroglobulin--alpha 1-proteinase inhibitor complex.

    PubMed

    Dejgaard, S; Ortapamuk, O; Ozer, I

    1999-01-01

    The inhibition of bovine pancreatic trypsin was studied at pH 7, 25 degrees C, using mixtures of purified human alpha 2-macroglobulin (alpha 2M) and alpha 1-proteinase inhibitor (alpha 1 PI). The partitioning of the enzyme between the two inhibitors was determined by comparing control esterase activity, assayed with N-benzoyl-L-arginine ethyl ester as substrate, with that remaining after incubation with inhibitory mixtures. (At [I]0 > [E]0, remaining esteratic activity reflects the concentration of alpha 2M-associated enzyme (alpha 2M-E*) and the concentration of alpha 1PI-associated, inactive enzyme (alpha 1PI-E*) is given by the difference, [E]0-[alpha 2M-E*].) The pattern of product distribution was found to be incompatible with an inhibitory model involving parallel, second-order reactions of E with alpha 2M and alpha 1PI. The data pointed to complex formation between the two inhibitors, limiting the level of alpha 2M readily available for reaction with E. Analysis based on the binding equilibrium, alpha 2M (dimeric unit) + alpha 1PI reversible alpha 2M-alpha 1PI, yielded Kd = 2.1 +/- 0.3 microM. Complex formation between alpha 2M and alpha 1PI was verified by gel permeation experiments. alpha 2M was found to restrict the volume of distribution of alpha 1PI in Sephadex G200 beds. Kd, deduced from gel permeation behaviour, was 0.8 +/- 0.32 microM. Preliminary kinetic experiments with dialyzed plasma suggested that the alpha 2M-alpha 1PI interaction is effective also in vivo. Given Kd and the mean plasma levels of the two inhibitors ([alpha 2M] = 2 microM; [alpha 1PI] = 36 microM), it was estimated that > 90% of alpha 2M in human circulation must be complexed to alpha 1PI and lack immediate antiproteinase activity. PMID:10488249

  11. Differential cardiovascular regulatory activities of the alpha 1B- and alpha 1D-adrenoceptor subtypes.

    PubMed

    Chalothorn, Dan; McCune, Dan F; Edelmann, Stephanie E; Tobita, Kimimasa; Keller, Bradley B; Lasley, Robert D; Perez, Dianne M; Tanoue, Akito; Tsujimoto, Gozoh; Post, Ginell R; Piascik, Michael T

    2003-06-01

    The regulation of cardiac and vascular function by the alpha 1B- and alpha 1D-adrenoceptors (ARs) has been assessed in two lines of transgenic mice, one over-expressing a constitutively active alpha 1B-AR mutation (alpha 1B-ARC128F) and the other an alpha 1D-AR knockout line. The advantage of using mice expressing a constitutively active alpha 1B-AR is that the receptor is tonically active, thus avoiding the use of nonselective agonists that can activate all subtypes. In hearts from animals expressing alpha 1B-ARC128F, the activities of the mitogen-activated protein kinases, extracellular signal-regulated kinase, and c-Jun N-terminal kinase were significantly elevated compared with nontransgenic control animals. Mice over-expressing the alpha 1B-ARC128F had echocardiographic evidence of contractile dysfunction and increases in chamber dimensions. In isolated-perfused hearts or left ventricular slices from alpha 1B-ARC128F-expressing animals, the ability of isoproterenol to increase contractile force or increase cAMP levels was significantly decreased. In contrast to the prominent effects on the heart, constitutive activation of the alpha 1B-AR had little effect on the ability of phenylephrine to induce vascular smooth muscle contraction in the isolated aorta. The ability of phenylephrine to stimulate coronary vasoconstriction was diminished in alpha 1D-AR knockout mice. In alpha 1D-AR knockout animals, no negative effects on cardiac contractile function were noted. These results show that the alpha1-ARs regulate distinctly different physiologic processes. The alpha 1B-AR appears to be involved in the regulation of cardiac growth and contractile function, whereas the alpha 1D-AR is coupled to smooth muscle contraction and the regulation of systemic arterial blood pressure. PMID:12649302

  12. Alpha labelings of straight simple polyominal caterpillars

    E-print Network

    Froncek, Dalibor

    Alpha labelings of straight simple polyominal caterpillars Dalibor Froncek, O'Neill Kingston, Kyle. We introduce a related family of graphs called straight simple polyominal caterpillars and prove that they also admit an alpha labeling. This implies that every straight simple polyominal caterpillar with n

  13. Personal alpha contamination simulator and detector

    Microsoft Academic Search

    R. H. Insinger; A. H. Rodemann

    1983-01-01

    A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

  14. Personal alpha contamination simulator and detector

    Microsoft Academic Search

    R. H. Insinger; A. H. Rodemann

    1985-01-01

    A simulated radiation source and a compatible detector system are disclosed. The combination is useful in training for detecting alpha radiation contamination. A flexible, soft iron plate or first permanent magnet in the detector system responds to a second magnet that is employed to represent an alpha radiation source. Where the first permanent magnet is used, an iron member may

  15. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  16. A nuclear diagnostic for fast alpha particles

    Microsoft Academic Search

    L. R. Grisham; J. M. Dawson; D. E. Post

    1983-01-01

    The authors investigate the possibility of seeding a fusion plasma with nuclei that can undergo nuclear reactions with energetic alpha particles to produce product nuclei that are radioactive. If a fraction of these product nuclei can be collected and measured, one can obtain information about the presence of fast alpha particles. It appears that a feasible diagnostic could be based

  17. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  18. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  19. A Liquid Sodium alpha omega Dynamo Experiment

    Microsoft Academic Search

    Stirling Colgate; Howard Beckley; Hui Li; Richard Sonnenfield; Dave Westpfahl; Ian Bentley; Rocky Ginanni; Travis McKinnly; Valadimir Pariev

    2004-01-01

    A Liquid Sodium alpha omega Dynamo Experiment; Stirling Colgate, Howard Beckley, Hui Li, Richard Sonnenfeld, Dave Westpfahl, Ian Bentley, Rocky Ginanni, Travis Mckinnly, and Valadimir Pariev, LANL, NMIMT, & Univ. of Rochester. A liquid sodium alpha omega dynamo experiment has been constructed at NMIMT to simulate MRI, dynamo gain, and feed back in liquid sodium (r1 = 15 cm,; r2

  20. Measurement of alpha particles on PLT

    SciTech Connect

    Murphy, T.J.; Strachan, J.D.

    1984-12-01

    The radial emission profile of the d(/sup 3/He,p)..cap alpha.. fusion reaction was measured on PLT by pitch angle resolution of the escaping 3.7-MeV alphas. The d-/sup 3/He reactions were produced by /sup 3/He minority ICRF and the emission was strongly peaked at the ICRF resonance layer.

  1. Absorbed dose rate conversion coefficients for reference terrestrial biota for external photon and internal exposures.

    PubMed

    Taranenko, V; Pröhl, G; Gómez-Ros, J M

    2004-12-01

    The paper describes dosimetric models that allow the estimation of average radiation exposures to terrestrial biota due to environmental sources in the soil as well as internal uniform distributions of radionuclides. Simple three-dimensional phantoms for 13 faunal reference organisms are specified. The calculation of absorbed dose per unit source strength for these targets is based on photon and electron transport simulations using the Monte Carlo method. The presented absorbed dose rate conversion coefficients are derived for terrestrial reference species. This allows the assessment of internal exposure as well as external photon exposure depending on the nuclide, habitat, target size and environmental contamination. To enable the application of specific radiation weighting factors for alpha-, low energy beta- (E0 < 10 keV), beta- and gamma-radiations, their partial contributions to the total absorbed dose are provided separately. The coefficients for external exposure are listed for organisms living above the ground for an infinite plane source 3 mm deep in soil, as well as for a horizontally infinite volume source uniformly distributed to a depth of 10 cm. Furthermore, the coefficients are also presented for organisms living in a contaminated 50 cm thick soil layer. A multi-layer canopy model for plants is also described. The conversion coefficients are given for 3H, 14C, 40K, 36Cl, 59,63Ni, 89,90Sr, 94Nb, 99Tc, 106Ru, 129,131I, 134,135,137Cs, 210Po, 210Pb, 226Ra, 227,228,230,231,232,234Th, 234,235,238U, 238,239,240,241Pu, 241Am, 237Np and 242,243,244Cm, together with their PMID:15700697

  2. The anisotropic scattering coefficient of sea ice

    NASA Astrophysics Data System (ADS)

    Katlein, Christian; Nicolaus, Marcel; Petrich, Chris

    2014-02-01

    Radiative transfer in sea ice is subject to anisotropic, multiple scattering. The impact of anisotropy on the light field under sea ice was found to be substantial and has been quantified. In this study, a large data set of irradiance and radiance measurements under sea ice has been acquired with a Remotely Operated Vehicle (ROV) in the central Arctic. Measurements are interpreted in the context of numerical radiative transfer calculations, laboratory experiments, and microstructure analysis. The ratio of synchronous measurements of transmitted irradiance to radiance shows a clear deviation from an isotropic under-ice light field. We find that the angular radiance distribution under sea ice is more downward directed than expected for an isotropic light field. This effect can be attributed to the anisotropic scattering coefficient within sea ice. Assuming an isotropic radiance distribution under sea ice leads to significant errors in light-field modeling and the interpretation of radiation measurements. Quantification of the light field geometry is crucial for correct conversion of radiance data acquired by Autonomous Underwater Vehicles (AUVs) and ROVs.

  3. ORNL ALPHA MIS data base manual

    SciTech Connect

    Grubb, J.W.; Lovin, J.K.; Haese, R.L.

    1984-01-01

    ALPHA is a general-purpose Management Information System (MIS) sponsored and developed by the Finance and Materials Division of the Oak Ridge National Laboratory (ORNL). It allows users to access any System 1022 data base on ORNL's DECsystem-10 computer to obtain information for use in the process of management. As its name implies, ALPHA is the foundation of most of the business information systems sponsored by the Finance and Materials Division. The purpose of this manual is to aid the experienced ALPHA user in setting up a data base and the associated tables and files to use fully the capabilities of the ALPHA System in solving the routine and the more complex MIS problems. This manual is one of a series of reports documenting the ALPHA System. When completed, these manuals will provide complete systems documentation on ORNL's most versatile and useful MIS.

  4. Long-range alpha detector (LRAD)

    SciTech Connect

    MacArthur, D.W.; McAtee, J.L.

    1991-01-01

    Historically, alpha detectors have been limited by the very short range of alpha particles in air and by relatively poor sensitivity, even if the particles are intercepted. Of necessity, these detectors are operated in a vacuum or in close proximity to the source if reasonable efficiency is desired. In our new long-range alpha detector (LRAD), alpha particles interact with the ambient air, producing ionization in the air at the rate of about 30,000 ion pairs per MeV of alpha energy. These charges can be transported over significant distances (several meters) in a moving current of air generated by a small fan. An ion chamber located in front of the fan measures the current carried by the moving ions. The LRAD-based monitor is more sensitive and more thorough than conventional monitors. We present current LRAD sensitivity limits and results, practical monitor designs, and proposed uses for LRAD monitors. 4 refs., 7 figs.

  5. Comparison of apparent diffusion coefficients (ADC) and distributed diffusion coefficients (DDC) in high-grade gliomas

    PubMed Central

    Kwee, Thomas C.; Galbán, Craig J.; Tsien, Christina; Junck, Larry; Sundgren, Pia C.; Ivancevic, Marko K.; Johnson, Timothy D.; Meyer, Charles R.; Rehemtulla, Alnawaz; Ross, Brian D.; Chenevert, Thomas L.

    2010-01-01

    Purpose To compare apparent diffusion coefficients (ADCs) with distributed diffusion coefficients (DDCs) in high-grade gliomas. Materials and Methods Twenty patients with high-grade gliomas prospectively underwent diffusion-weighted magnetic resonance imaging. Traditional ADC maps were created using b-values of 0 and 1000 s/mm2. In addition, DDC maps were created by applying the stretched-exponential model using b-values of 0, 1000, 2000, and 4000 s/mm2. Whole-tumor ADCs and DDCs (in 10-3 mm2/s) were measured and analyzed with a paired t test, Pearson's correlation coefficient, and the Bland-Altman method. Results Tumor ADCs (1.14 ± 0.26) were significantly lower (P = 0.0001) than DDCs (1.64 ± 0.71). Tumor ADCs and DDCs were strongly correlated (R = 0.9716; P < 0.0001), but mean bias ± limits of agreement between tumor ADCs and DDCs was -0.50 ± 0.90. There was a clear trend toward greater discordance between ADC and DDC at high ADC values. Conclusion Under the assumption that the stretched-exponential model provides a more accurate estimate of the average diffusion rate than the mono-exponential model, our results suggest that for a little diffusion attenuation the mono-exponential fit works rather well for quantifying diffusion in high-grade gliomas, whereas it works less well for a greater degree of diffusion attenuation. PMID:20187193

  6. Measured and predicted shock shapes and aerodynamic coefficients for blunted cones at incidence in helium at Mach 20.3

    NASA Technical Reports Server (NTRS)

    Calloway, R. L.; White, N. H.

    1979-01-01

    Experimental values of shock shapes (alpha = 0 degrees and 10 degrees) and static aerodynamic coefficients (alpha = -4 degrees to 12 degrees) for sharp and spherically blunted cones having cone half-angles of 30, 45, 60, and 70 degrees and nose bluntness ratios of 0, 0.25, and 0.50 are presented. Shock shapes were also measured at 0 degree angle of attack by using a flat-faced cylinder (90 degree cone) and a hemispherically blunted cylinder (sphere). All tests were conducted in helium (gamma = 5/3) at a free-stream Mach number of 20.3 and a unit free-stream Reynolds number of 22,400,000 per meter. Comparisons between measured values and predicted values were made by using several numerical and simple engineering methods.

  7. Determining the validity and reliability of the cultural awareness and beliefs inventory

    E-print Network

    Roberts-Walter, Patricia Fay

    2007-09-17

    that states that theoretically similar constructs should be highly correlated (Trochim, M.K., 2002). Cronbach’s Coefficient Alpha – “A measure of the internal consistency of a test, based on the extent to which test-takers, who answer a test item one way... of theoretically different constructs should fail to highly correlate with each other (Trochim, M.K., 2002). Eigenvalue - “the amount of variance in all of the items that can be explained by a given principal component or factor” (Pett, Lacket, & Sullivan...

  8. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  9. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  10. Organization of the alpha-globin genes in the Chinese alpha-thalassemia syndromes.

    PubMed Central

    Embury, S H; Lebo, R V; Dozy, A M; Kan, Y W

    1979-01-01

    The alpha-thalassemia syndromes are a group of inherited anemias, the clinical severity of which has been shown to increase with the number of alpha-globin structural genes deleted. Employing restriction endonuclease gene mapping, we defined the organization of the alpha-globin genes in cellular DNA from Chinese subjects with various alpha-thalassemia syndromes. The four alpha-globin genes of normals are at two loci located on a 23.0-kilobase pair (kb) Eco RI fragment. In deletion type hemoglobin-H disease the 5' alpha-globin locus is deleted and the single 3' alpha-globin locus is found on a 19.0-kb Eco RI fragment. In alpha-thalassemia-2 there are two alpha-globin genes on a 23.0-kb Eco RI fragment and one on a 19.0-kb fragment. In alpha-thalassemia-1 and the nondeletion type of hemoglobin-H disease the two alpha-globin genes are at two loci on one chromosome and none reside on the other chromosome. Images PMID:447845

  11. The fratricide of alpha-Omega dynamos by their alpha-squared siblings

    E-print Network

    Hubbard, Alexander; Brandenburg, Axel

    2011-01-01

    Context. Helically forced magneto-hydrodynamic shearing-sheet turbulence can support different large-scale dynamo modes, although the {\\alpha} - {\\Omega} mode is generally expected to dominate because it is the fastest growing. In an {\\alpha} - {\\Omega} dynamo, most of the field amplification is produced by the shear. As differential rotation is an ubiquitous source of shear in astrophysics, such dynamos are believed to be the source of most astrophysical large-scale magnetic fields. Aims. We study the stability of oscillatory migratory {\\alpha} - {\\Omega} type dynamos in turbulence simulations. Methods. We use shearing-sheet simulations of hydromagnetic turbulence that is helically forced at a wavenumber that is about three times larger than the lowest wavenumber in the domain so that both {\\alpha} - {\\Omega} and {\\alpha}2 dynamo action is possible. Results. After initial dominance and saturation, the {\\alpha} - {\\Omega} mode is found to be destroyed by an orthogonal {\\alpha}2 mode sustained by the helical t...

  12. {alpha} ratio 2n ratio {alpha} Molecular Band in {sup 10}Be

    SciTech Connect

    Freer, M.; Ashwood, N.I.; Curtis, N.; Price, D.; Ziman, V.A. [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham, B15 2TT (United Kingdom); Casarejos, E.; Angulo, C.; Demaret, P. [CRC/LLN Centre de Recherches du Cyclotron, Universite catholique de Louvain, B-1348 Louvain-la-Neuve (Belgium); Achouri, L.; Laurent, B.; Orr, N.A. [Laboratoire de Physique Corpusculaire, ISMRA and Universite de Caen, IN2P3-CNRS, 14050 Caen Cedex (France); Harlin, C. [School of Electronics and Physical Sciences, University of Surrey, Guildford, Surrey, GU2 7XH (United Kingdom); Milin, M.; Soic, N. [Department of Experimental Physics, Rudjer Boskovic Institute, Bijenicka 54, HR-10000 Zagreb (Croatia); Raabe, R. [Instituut voor Kern- en Stralingsfysica, University of Leuven, B-3001 Leuven (Belgium)

    2006-02-03

    The 10.15 MeV resonance in {sup 10}Be has been probed via resonant {sup 6}He+{sup 4}He elastic scattering. It is demonstrated that it is the J{sup {pi}}=4{sup +} member of a rotational band built on the 6.18 MeV 0{sup +} state. A {gamma}{sub {alpha}} of 0.10-0.13 MeV and {gamma}{sub {alpha}}/{gamma}=0.35-0.46 were deduced. The corresponding reduced {alpha} width, {gamma}{sub {alpha}}{sup 2}, indicates one of the largest {alpha}-cluster spectroscopic factors known. The deformation of the band, including the 7.54 MeV, 2{sup +} member, is large (({Dirac_h}/2{pi}){sup 2}/2I=200 keV). Such a deformation and the significant degree of clusterization signals a well-developed {alpha} ratio 2n ratio {alpha} molecular structure.

  13. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  14. ?-cluster asymptotic normalization coefficients for nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Avila, M. L.; Rogachev, G. V.; Koshchiy, E.; Baby, L. T.; Belarge, J.; Kemper, K. W.; Kuchera, A. N.; Santiago-Gonzalez, D.

    2014-10-01

    Background: Many important ?-particle induced reactions for nuclear astrophysics may only be measured using indirect techniques due to the small cross sections at the energy of interest. One such indirect technique is to determine the asymptotic normalization coefficients (ANCs) for near-threshold resonances extracted from sub-Coulomb ?-transfer reactions. This approach provides a very valuable tool for studies of astrophysically important reaction rates since the results are practically model independent. However, the validity of the method has not been directly verified. Purpose: The aim of this Rapid Communication is to verify the technique using the O16(Li6,d)Ne20 reaction as a benchmark. The Ne20 nucleus has a well-known 1- state at an excitation energy of 5.79 MeV with a width of 28 eV. Reproducing the known value with this technique is an ideal opportunity to verify the method. Method: The 1- state at 5.79 MeV is studied using the ?-transfer reaction O16(Li6,d)Ne20 at sub-Coulomb energies. Results: The partial ? width for the 1- state at excitation energy of 5.79 MeV is extracted and compared with the known value, allowing the accuracy of the method to be evaluated. Conclusions: This study demonstrates that extracting the ANCs using sub-Coulomb ?-transfer reactions is a powerful tool that can be used to determine the partial ? width of near-threshold states that may dominate astrophysically important nuclear reaction rates.

  15. Oxygen binding by alpha(Fe2+)2beta(Ni2+)2 hemoglobin crystals.

    PubMed Central

    Bruno, S.; Bettati, S.; Manfredini, M.; Mozzarelli, A.; Bolognesi, M.; Deriu, D.; Rosano, C.; Tsuneshige, A.; Yonetani, T.; Henry, E. R.

    2000-01-01

    Oxygen binding by hemoglobin fixed in the T state either by crystallization or by encapsulation in silica gels is apparently noncooperative. However, cooperativity might be masked by different oxygen affinities of alpha and beta subunits. Metal hybrid hemoglobins, where the noniron metal does not bind oxygen, provide the opportunity to determine the oxygen affinities of alpha and beta hemes separately. Previous studies have characterized the oxygen binding by alpha(Ni2+)2beta(Fe2+)2 crystals. Here, we have determined the three-dimensional (3D) structure and oxygen binding of alpha(Fe2+)2beta(Ni2+)2 crystals grown from polyethylene glycol solutions. Polarized absorption spectra were recorded at different oxygen pressures with light polarized parallel either to the b or c crystal axis by single crystal microspectrophotometry. The oxygen pressures at 50% saturation (p50s) are 95 +/- 3 and 87 +/- 4 Torr along the b and c crystal axes, respectively, and the corresponding Hill coefficients are 0.96 +/- 0.06 and 0.90 +/- 0.03. Analysis of the binding curves, taking into account the different projections of the alpha hemes along the optical directions, indicates that the oxygen affinity of alpha1 hemes is 1.3-fold lower than alpha2 hemes. Inspection of the 3D structure suggests that this inequivalence may arise from packing interactions of the Hb tetramer within the monoclinic crystal lattice. A similar inequivalence was found for the beta subunits of alpha(Ni2+)2beta(Fe2+)2 crystals. The average oxygen affinity of the alpha subunits (p50 = 91 Torr) is about 1.2-fold higher than the beta subunits (p50 = 110 Torr). In the absence of cooperativity, this heterogeneity yields an oxygen binding curve of Hb A with a Hill coefficient of 0.999. Since the binding curves of Hb A crystals exhibit a Hill coefficient very close to unity, these findings indicate that oxygen binding by T-state hemoglobin is noncooperative, in keeping with the Monod, Wyman, and Changeux model. PMID:10794410

  16. Ly-alpha polarimeter design for CLASP rocket experiment

    NASA Astrophysics Data System (ADS)

    Watanabe, H.; Narukage, N.; Kubo, M.; Ishikawa, R.; Bando, T.; Kano, R.; Tsuneta, S.; Kobayashi, K.; Ichimoto, K.; Trujillo-Bueno, J.

    2011-10-01

    A sounding-rocket program called the Chromospheric Lyman-Alpha Spectro-Polarimeter (CLASP) is proposed to be launched in the summer of 2014. CLASP will observe the solar chromosphere in Ly-alpha (121.567 nm), aiming to detect the linear polarization signal produced by scattering processes and the Hanle effect for the first time. The polarimeter of CLASP consists of a rotating half-waveplate, a beam splitter, and a polarization analyzer. Magnesium Fluoride (MgF2) is used for these optical components, because MgF2 exhibits birefringent property and high transparency at ultraviolet wavelength. The development and comprehensive testing program of the optical components of the polarimeter is underway using the synchrotron beamline at the Ultraviolet Synchrotron Orbital Radiation Facility (UVSOR). The first objective is deriving the optical constants of MgF2 by the measurement of the reflectance and transmittance against oblique incident angles for the s-polarized and the p-polarized light. The ordinary refractive index and extinction coefficient along the ordinary and extraordinary axes are derived with a least-square fitting in such a way that the reflectance and transmittance satisfy the Kramers-Krönig relation. The reflection at the Brewster's Angle of MgF2 plate is confirmed to become a good polarization analyzer at Ly-alpha. The second objective is the retardation measurement of a zeroth-order waveplate made of MgF2. The retardation of a waveplate is determined by observing the modulation amplitude that comes out of a waveplate and a polarization analyzer. We tested a waveplate with the thickness difference of 14.57 um. The 14.57 um waveplate worked as a half-waveplate at 121.74 nm. We derived that a waveplate with the thickness difference of 15.71 um will work as a half-waveplate at Ly-alpha wavelength. We developed a prototype of CLASP polarimeter using the MgF2 half-waveplate and polarization analyzers, and succeeded in obtaining the modulation patterns that are consistent with the theoretical prediction. We confirm that the performance of the prototype is optimized for measuring linear polarization signal with the least effect of the crosstalk from the circular polarization.

  17. alpha-Crystallin can Function as a Molecular Chaperone

    Microsoft Academic Search

    Joseph Horwitz

    1992-01-01

    The alpha-crystallins (alphaA and alphaB) are major lens structural proteins of the vertebrate eye that are related to the small heat shock protein family. In addition, crystallins (especially alphaB) are found in many cells and organs outside the lens, and alphaB is overexpressed in several neurological disorders and in cell lines under stress conditions. Here I show that alpha-crystallin can

  18. Analytical aerodynamic model of a high alpha research vehicle wind-tunnel model

    NASA Technical Reports Server (NTRS)

    Cao, Jichang; Garrett, Frederick, Jr.; Hoffman, Eric; Stalford, Harold

    1990-01-01

    A 6 DOF analytical aerodynamic model of a high alpha research vehicle is derived. The derivation is based on wind-tunnel model data valid in the altitude-Mach flight envelope centered at 15,000 ft altitude and 0.6 Mach number with Mach range between 0.3 and 0.9. The analytical models of the aerodynamics coefficients are nonlinear functions of alpha with all control variable and other states fixed. Interpolation is required between the parameterized nonlinear functions. The lift and pitching moment coefficients have unsteady flow parts due to the time range of change of angle-of-attack (alpha dot). The analytical models are plotted and compared with their corresponding wind-tunnel data. Piloted simulated maneuvers of the wind-tunnel model are used to evaluate the analytical model. The maneuvers considered are pitch-ups, 360 degree loaded and unloaded rolls, turn reversals, split S's, and level turns. The evaluation finds that (1) the analytical model is a good representation at Mach 0.6, (2) the longitudinal part is good for the Mach range 0.3 to 0.9, and (3) the lateral part is good for Mach numbers between 0.6 and 0.9. The computer simulations show that the storage requirement of the analytical model is about one tenth that of the wind-tunnel model and it runs twice as fast.

  19. Calculation and application of combined diffusion coefficients in thermal plasmas

    PubMed Central

    Murphy, Anthony B.

    2014-01-01

    The combined diffusion coefficient method is widely used to treat the mixing and demixing of different plasma gases and vapours in thermal plasmas, such as welding arcs and plasma jets. It greatly simplifies the treatment of diffusion for many gas mixtures without sacrificing accuracy. Here, three subjects that are important in the implementation of the combined diffusion coefficient method are considered. First, it is shown that different expressions for the combined diffusion coefficients, arising from different definitions for the stoichiometric coefficients that assign the electrons to the two gases, are equivalent. Second, an approach is presented for calculating certain partial differential terms in the combined temperature and pressure diffusion coefficients that can cause difficulties. Finally, a method for applying the combined diffusion coefficients in computational models, which typically require diffusion to be expressed in terms of mass fraction gradients, is given. PMID:24603457

  20. Anomalies of piezoelectric coefficients in barium titanate thin films

    NASA Astrophysics Data System (ADS)

    Shirokov, Vladimir; Kalinchuk, Valery; Shakhovoy, Roman; Yuzyuk, Yury

    2014-11-01

    Modeling of electromechanical devices involves the use of different material coefficients, whose measurement is a difficult task, especially when the problem concerns thin films. Required coefficients of thin films could be found theoretically, using known values of the bulk constants. Electromechanical coefficients of barium titanate thin films are still unknown; therefore, it is expedient to carry out their calculations. We give here the full set of electromechanical coefficients of barium titanate thin films for the whole range of technologically available misfit strains. In the present paper, piezoelectric coefficients as functions of a misfit strain were calculated. It was revealed that piezoelectric coefficients exhibit anomalies at phase boundaries and inside the monoclinic r-phase as well. The obtained results allow finding the required values of the thin-film parameters, varying the misfit strain.

  1. Fusion of Daubechies Wavelet Coefficients for Human Face Recognition

    E-print Network

    Bhowmik, Mrinal Kanti; Nasipuri, Mita; Basu, Dipak Kumar; Kundu, Mahantapas

    2010-01-01

    In this paper fusion of visual and thermal images in wavelet transformed domain has been presented. Here, Daubechies wavelet transform, called as D2, coefficients from visual and corresponding coefficients computed in the same manner from thermal images are combined to get fused coefficients. After decomposition up to fifth level (Level 5) fusion of coefficients is done. Inverse Daubechies wavelet transform of those coefficients gives us fused face images. The main advantage of using wavelet transform is that it is well-suited to manage different image resolution and allows the image decomposition in different kinds of coefficients, while preserving the image information. Fused images thus found are passed through Principal Component Analysis (PCA) for reduction of dimensions and then those reduced fused images are classified using a multi-layer perceptron. For experiments IRIS Thermal/Visual Face Database was used. Experimental results show that the performance of the approach presented here achieves maximum...

  2. Analytic Forms of the Perpendicular Diffusion Coefficient in NRMHD Turbulence

    NASA Astrophysics Data System (ADS)

    Shalchi, A.

    2015-02-01

    In the past different analytic limits for the perpendicular diffusion coefficient of energetic particles interacting with magnetic turbulence were discussed. These different limits or cases correspond to different transport modes describing how the particles are diffusing across the large-scale magnetic field. In the current paper we describe a new transport regime by considering the model of noisy reduced magnetohydrodynamic turbulence. We derive different analytic forms of the perpendicular diffusion coefficient, and while we do this, we focus on the aforementioned new transport mode. We show that for this turbulence model a small perpendicular diffusion coefficient can be obtained so that the latter diffusion coefficient is more than hundred times smaller than the parallel diffusion coefficient. This result is relevant to explain observations in the solar system where such small perpendicular diffusion coefficients have been reported.

  3. Alpha 1-blocker combination therapy for hypertension.

    PubMed

    Houston, M C

    1998-09-01

    Combination therapy is a cost-effective and rational approach to treatment of severe hypertension and of mild to moderate hypertension that is refractory to monotherapy. The method has several advantages, most notably improved tolerability and enhanced antihypertensive efficacy. Long-term prospective studies are needed to confirm that such agents as calcium channel blockers, ACE inhibitors, and alpha 1 blockers reduce end-organ damage more effectively than do older antihypertensive drugs. However, scientific evidence strongly suggests that reducing risk factors for end-organ damage reduces heart, brain, kidney, and large-artery injury. Alpha 1 blockers appear to be a particularly suitable choice for use in combination regimens. The only class of agents that should be avoided in combination with alpha 1 blockers is central alpha agonists; all other agents act in an additive or synergistic fashion. Unlike diuretics and beta blockers, alpha 1 blockers do not adversely affect serum lipid, glucose, or insulin levels. In fact, alpha 1 blockers may improve these measurements and also counteract the adverse effects of other antihypertensive agents on them. Alpha1-blocker therapy may bring about regression of LVH, and it does not have deleterious effects on disorders that often coexist with hypertension (e.g., gout, chronic obstructive lung disease, peripheral ischemia). PMID:9742910

  4. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  5. Fifth Order Runge-Kutta-Nyström Methods with Complex Coefficients

    E-print Network

    M. Atakan Gürkan

    2012-03-15

    We present fifth order Runge-Kutta-Nystr\\"om methods, where we allow the timestep coefficients to assume complex values. Among the methods with complex timesteps, we focus on the ones with the coefficients that have positive real parts. This property makes them suitable for problems where a negative coefficient is not acceptable. In addition, the leading order terms in the error expansion of these methods are purely imaginary, effectively increasing the order of the methods by one for real variables.

  6. DCFPAK: Dose coefficient data file package for Sandia National Laboratory

    SciTech Connect

    Eckerman, K.F.; Leggett, R.W.

    1996-07-31

    The FORTRAN-based computer package DCFPAK (Dose Coefficient File Package) has been developed to provide electronic access to the dose coefficient data files summarized in Federal Guidance Reports 11 and 12. DCFPAK also provides access to standard information regarding decay chains and assembles dose coefficients for all dosimetrically significant radioactive progeny of a specified radionuclide. DCFPAK was designed for application on a PC but, with minor modifications, may be implemented on a UNIX workstation.

  7. Evaluation of sedimentation coefficients in self-associating systems

    E-print Network

    Weirich, Charlotte Elaine

    1972-01-01

    ) (Menber) (Masher) AUGUST 1972 ABSTRACT Evaluation of Sedimentation Coefficients in Self-Associating Systems (Aug. 1972) Charlotte Elaine Weirich, B. S. , Texas Lutheran College; Directed by: Dr. E. T. Adams, Jr. Sedimentation coefficients obtained...EVALUATION OF SEDIMENTATION COEFFICIENTS IN SELF-ASSOCIATING SYSTEMS A Thesis by CHARLOTTE ELAINE WEIRICH Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE...

  8. Asymptotic coefficients for one-interacting-level Voigt profiles

    NASA Astrophysics Data System (ADS)

    Cope, D.; Lovett, R. J.

    1988-02-01

    The asymptotic behavior of general Voigt profiles with general width and shift functions has been determined by Cope and Lovett (1987). The resulting asymptotic coefficients are functions of the perturber/radiator mass ratio; also, the coefficients for the one-interacting-level (OIL) profiles proposed by Ward et al. (1974) were studied. In this paper, the behavior of the OIL asymptotic coefficients for large mass ratio values is determined, thereby providing a complete picture of OIL asymptotics for all mass ratios.

  9. Measuring Furnace/Sample Heat-Transfer Coefficients

    NASA Technical Reports Server (NTRS)

    Rosch, William R.; Fripp, Archibald L., Jr.; Debnam, William J., Jr.; Woodell, Glenn A.

    1993-01-01

    Complicated, inexact calculations now unnecessary. Device called HTX used to simulate and measure transfer of heat between directional-solidification crystal-growth furnace and ampoule containing sample of crystalline to be grown. Yields measurement data used to calculate heat-transfer coefficients directly, without need for assumptions or prior knowledge of physical properties of furnace, furnace gas, or specimen. Determines not only total heat-transfer coefficients but also coefficients of transfer of heat in different modes.

  10. On the Connection Coefficients of the Chebyshev-Boubaker Polynomials

    PubMed Central

    2013-01-01

    The Chebyshev-Boubaker polynomials are the orthogonal polynomials whose coefficient arrays are defined by ordinary Riordan arrays. Examples include the Chebyshev polynomials of the second kind and the Boubaker polynomials. We study the connection coefficients of this class of orthogonal polynomials, indicating how Riordan array techniques can lead to closed-form expressions for these connection coefficients as well as recurrence relations that define them. PMID:23990760

  11. An investigation of the eddy heat-diffusion coefficient

    E-print Network

    Gilchrist, Larry Kenneth

    1973-01-01

    Major Subjects Meteorology AN INVESTIGATION OF THE EDDY HEAT-DIFFUSION COEFFICIENT A Thesis by LARRY KENNETH GILCHRIST Approved as to style and content by& / Chairman of Cossaittee) Head of Doper 't Ilmsber Member 2" August 1973 ABSTRACT... An Investigation of the Eddy Heat-Diffusion Coefficient. (August 1973) Larry Kenneth Gilchrist, B. A. , Knox College Directed by& Dr. Kenneth C. Brundidge An investigation of the eddy heat-diffusion coefficient, Kh, was conducted that included the effects...

  12. The piezoresistance coefficients of copper and copper-nickel alloys

    Microsoft Academic Search

    Changyi Hu; Yiqun Gao; Zhongyi Sheng

    2000-01-01

    This paper attempts to further a better understanding of the piezoresistance coefficients by studying the piezoresistive effects in copper and copper-nickel alloys. The experimental evidence of isotropic piezoresistance coefficients (p11?=?p12) has been obtained for the annealed copper and copper-nickel alloys. The piezoresistance coefficients of the cold-worked copper and Cu60Ni40 alloy are of the tensor character (p11???p12). A physical explanation has

  13. Friction coefficient measurement system for winter maintenance vehicles

    Microsoft Academic Search

    G. Erdogan; L. Alexander; R. Rajamani

    2008-01-01

    Real-time measurement of tire-road friction coefficient is extremely valuable for winter road maintenance operations. In winter maintenance, knowledge of tire-road friction coefficient can be used to optimize application of deicing and anti-icing chemicals to the roadway. In this paper, a wheel based tire-road friction coefficient measurement system is developed for snowplows. Unlike a traditional Norse meter, this system is based

  14. Numerical calculation of the transport coefficients in thermal plasmas

    E-print Network

    Mahfouf, Ali; Faure, Géraldine

    2015-01-01

    -We have performed a new efficient method to calculate numerically the transport coefficients at high temperature. The collision theory was treated to study singularities that occur when evaluating the collision cross section. The transport coefficients (viscosity, diffusion coefficient, thermal and electrical conductivity) depend strongly on nature of the interaction between the particles that form the plasma and that is why it is necessary to determine the interaction potential accurately.

  15. Prevalence of alpha-thalassemias in northern Thailand.

    PubMed

    Lemmens-Zygulska, M; Eigel, A; Helbig, B; Sanguansermsri, T; Horst, J; Flatz, G

    1996-09-01

    The population of northern Thailand has one of the highest frequencies of alpha-thalassemia in the world. However, the available distributional data are controversial. In addition to deletional types of alpha-thalassemia Hb, type Constant Spring should also be taken into consideration in alpha-thalassemia population studies, because it causes clinical alpha-thalassemia in the homozygous state or when present with both alpha-globin genes deleted in trans. We have examined a sample of 215 healthy subjects from four rural districts of Chiang Mai province. Out of these, 77 exhibited anomalies of the alpha-globin genes (alpha alpha/-alpha 3.7 in 36; -alpha 3.7/-alpha 3.7 in 3; -SEA in 30; alpha alpha/alpha CS alpha in 5; alpha alpha alpha anti 3.7 in 3). Therefore, no fewer than 2% of the children in northern Thailand are expected to be born with HbH disease or thalassemic hydrops fetalis. The considerable public health problem of hemoglobinopaties and the increasing acceptance of family planning necessitates facilities for the pre- and postnatal diagnosis of these disorders at the DNA level. PMID:8707307

  16. SUMOylation of ROR{alpha} potentiates transcriptional activation function

    SciTech Connect

    Hwang, Eun Ju [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of); Lee, Ji Min [Department of Biological Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Jeong, Jiyeong; Park, Joo Hyeon; Yang, Young; Lim, Jong-Seok [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of); Kim, Jung Hwa [Department of Medical Sciences, Inha University, Incheon 402-751 (Korea, Republic of); Baek, Sung Hee [Department of Biological Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Keun Il [Department of Biological Sciences, Research Center for Women's Disease, Sookmyung Women's University, 52 Hyochangwon-gil, Yongsan-gu, Seoul 140-742 (Korea, Republic of)], E-mail: kikim@sookmyung.ac.kr

    2009-01-16

    SUMOylation regulates a variety of cellular processes, including control of transcriptional activities of nuclear receptors. Here, we present SUMOylation of orphan nuclear receptor, ROR{alpha} by both SUMO-1 and SUMO-2. SUMOylation of ROR{alpha} occurred on the 240th lysine residue at the hinge region of human protein. PIAS family members, PIASx{alpha}, PIAS3, and PIASy, increased SUMOylation of ROR{alpha}, whereas SENP2 specifically removed SUMO from ROR{alpha}. SUMOylation-defective mutant form of ROR{alpha} exhibited decreased transcriptional activity on ROR{alpha}-responsive promoters indicating that SUMOylation may positively regulate transcriptional function of ROR{alpha}.

  17. Radiation dose estimation and mass attenuation coefficients of cement samples used in Turkey.

    PubMed

    Damla, N; Cevik, U; Kobya, A I; Celik, A; Celik, N; Van Grieken, R

    2010-04-15

    Different cement samples commonly used in building construction in Turkey have been analyzed for natural radioactivity using gamma-ray spectrometry. The mean activity concentrations observed in the cement samples were 52, 40 and 324 Bq kg(-1) for (226)Ra, (232)Th and (40)K, respectively. The measured activity concentrations for these radionuclides were compared with the reported data of other countries and world average limits. The radiological hazard parameters such as radium equivalent activities (Ra(eq)), gamma index (I(gamma)) and alpha index (I(alpha)) indices as well as terrestrial absorbed dose and annual effective dose rate were calculated and compared with the international data. The Ra(eq) values of cement are lower than the limit of 370 Bq kg(-1), equivalent to a gamma dose of 1.5 mSv y(-1). Moreover, the mass attenuation coefficients were determined experimentally and calculated theoretically using XCOM in some cement samples. Also, chemical compositions analyses of the cement samples were investigated. PMID:20018450

  18. Epistasis of transcriptomes reveals synergism between transcriptional activators Hnf1alpha and Hnf4alpha.

    PubMed

    Boj, Sylvia F; Petrov, Dimitri; Ferrer, Jorge

    2010-05-01

    The transcription of individual genes is determined by combinatorial interactions between DNA-binding transcription factors. The current challenge is to understand how such combinatorial interactions regulate broad genetic programs that underlie cellular functions and disease. The transcription factors Hnf1alpha and Hnf4alpha control pancreatic islet beta-cell function and growth, and mutations in their genes cause closely related forms of diabetes. We have now exploited genetic epistasis to examine how Hnf1alpha and Hnf4alpha functionally interact in pancreatic islets. Expression profiling in islets from either Hnf1a(+/-) or pancreas-specific Hnf4a mutant mice showed that the two transcription factors regulate a strikingly similar set of genes. We integrated expression and genomic binding studies and show that the shared transcriptional phenotype of these two mutant models is linked to common direct targets, rather than to known effects of Hnf1alpha on Hnf4a gene transcription. Epistasis analysis with transcriptomes of single- and double-mutant islets revealed that Hnf1alpha and Hnf4alpha regulate common targets synergistically. Hnf1alpha binding in Hnf4a-deficient islets was decreased in selected targets, but remained unaltered in others, thus suggesting that the mechanisms for synergistic regulation are gene-specific. These findings provide an in vivo strategy to study combinatorial gene regulation and reveal how Hnf1alpha and Hnf4alpha control a common islet-cell regulatory program that is defective in human monogenic diabetes. PMID:20523905

  19. Heat transfer coefficients for drying in pulsating flows

    SciTech Connect

    Fraenkel, S.L. [DEM/UFRJ, Rio de Janeiro (Brazil)] [DEM/UFRJ, Rio de Janeiro (Brazil); Nogueira, L.A.H. [IEM/EFEI, Itajuba, Minas Gerais (Brazil)] [IEM/EFEI, Itajuba, Minas Gerais (Brazil); Carvalho, J.A. Jr.; Costa, F.S. [LCP/INPE, Cachoeira Paulista, Sao Paulo (Brazil)] [LCP/INPE, Cachoeira Paulista, Sao Paulo (Brazil)

    1998-05-01

    Pulsating flows generated by a Rijke type combustor are studied for drying of grains and food particles. It is assumed that the velocity fluctuations are the main factor in the enhancement of the drying process. The heat transfer coefficients for drying in vibrating beds are utilized to estimate the heat transfer coefficients of fixed beds in pulsating and permeating flows and are compared to the steady flow heat transfer coefficients obtained for solid porous bodies, after perturbing the main flow. The cases considered are compared to the convective heat transfer coefficients employed in non-pulsating drying.

  20. Coefficients of convergent multiple Walsh-Paley series

    SciTech Connect

    Plotnikov, Mikhail G [Vologda State Academy of Milk Industry, Molochnoe, Vologda Region (Russian Federation)

    2012-09-30

    The paper is concerned with the behaviour of the coefficients of multiple Walsh-Paley series that are cube convergent to a finite sum. It is shown that even an everywhere convergent series of this kind may contain coefficients with numbers from a sufficiently large set that grow faster than any preassigned sequence. By Cohen's theorem, this sort of thing cannot happen for multiple trigonometric series that are cube convergent on a set of full measure - their coefficients cannot grow even exponentially. Null subsequences of coefficients are determined for multiple Walsh-Paley series that are cube convergent on a set of definite measure. Bibliography: 18 titles.

  1. Effect of kinetic boundary condition on the thermal transpiration coefficient

    NASA Astrophysics Data System (ADS)

    Sugimoto, Hiroshi; Amakawa, Kenjiro

    2014-12-01

    The effect of kinetic boundary condition on the free molecular thermal transpiration coefficient ? is analyzed numerically. The Maxwell model boundary condition is applied in its original form in the sense that its accommodation coefficient depends on the speed of incident molecules. The results show that the value of ? depends much on the velocity dependency of the accommodation coefficient. The experimental result, ? < 0.5, can be reproduced if the grazing molecules reflect diffusely. This makes a sharp contrast with the previous works that ? =0.5 for the velocity independent accommodation coefficient.

  2. Chaotic Scattering Theory of Transport and Reaction-Rate Coefficients

    E-print Network

    J. R. Dorfman; P. Gaspard

    1994-05-16

    The chaotic scattering theory is here extended to obtain escape-rate expressions for the transport coefficients appropriate for a simple classical fluid, or for a chemically reacting system. This theory allows various transport coefficients such as the coefficients of viscosity, thermal conductivity, etc., to be expressed in terms of the positive Lyapunov exponents and Kolmogorov-Sinai entropy of a set of phase space trajectories that take place on an appropriate fractal repeller. This work generalizes the previous results of Gaspard and Nicolis for the coefficient of diffusion of a particle moving in a fixed array of scatterers.

  3. The Low-Temperature Seebeck Coefficient in Insulators

    NASA Astrophysics Data System (ADS)

    Mahan, G. D.

    2015-01-01

    We show the existence of a space-charge effect in the measurement of the low-temperature Seebeck coefficient in insulators. The Seebeck coefficient is obtained by measurement of the voltage due to a temperature gradient . The space-charge effect makes the voltage go to zero in insulators, even if the Seebeck coefficient does not vanish. We propose that the Seebeck coefficient does not actually vanish in insulators, contrary to common belief. We also propose that variable-range hopping is not observed in conductivity measurements.

  4. Giant Seebeck coefficient of the graphene/h-BN superlattices

    NASA Astrophysics Data System (ADS)

    Yokomizo, Yushi; Nakamura, Jun

    2013-09-01

    The electronic structures and Seebeck coefficients of the graphene/h-BN superlattices which consist of zigzag graphene nanoribbons (ZGNRs) and zigzag BN nanoribbons (ZBNNRs) have been investigated using ab initio calculations based on the density functional theory. It has been shown that a ZGNR/ZBNNR marks up to 20 times larger in the Seebeck coefficient than graphene. The Seebeck coefficients of the superlattices increase with decreasing width of the constituent ZGNR. It has been revealed that the giant Seebeck coefficients of the superlattices stem from the so-called pudding mold band with a finite energy gap.

  5. Diffusion coefficient of three-dimensional Yukawa liquids

    SciTech Connect

    Dzhumagulova, K. N.; Ramazanov, T. S.; Masheeva, R. U. [IETP, Al Farabi Kazakh National University, 71, al Farabi ave., Almaty 050040 (Kazakhstan)] [IETP, Al Farabi Kazakh National University, 71, al Farabi ave., Almaty 050040 (Kazakhstan)

    2013-11-15

    The purpose of this work is an investigation of the diffusion coefficient of the dust component in complex plasma. The computer simulation of the Yukawa liquids was made on the basis of the Langevin equation, which takes into account the influence of buffer plasma on the dust particles dynamics. The Green–Kubo relation was used to calculate the diffusion coefficient. Calculations of the diffusion coefficient for a wide range of the system parameters were performed. Using obtained numerical data, we constructed the interpolation formula for the diffusion coefficient. We also show that the interpolation formula correctly describes experimental data obtained under microgravity conditions.

  6. Abscisic Acid Transport Coefficients of Phaseolus Root Systems 1

    PubMed Central

    Fiscus, Edwin L.; Stermitz, Frank R.; Amoros, Luis G.

    1982-01-01

    Diffusive and convective transport coefficients of Phaseolus vulgaris L. cv. Ouray root systems for abscisic acid for (ABA) were measured. The convective coefficient (reflection coefficient or osmotic efficiency factor) ? was determined to be 0.96 for ABA while the diffusive coefficient, ?, was found to be 1.44 × 10?11 mole per square centimeter per second per bar. Steady-state concentrations of ABA in the root system exudates were not achieved until at least three hours after the applications suggesting either a slow saturation of binding sites or equilibration with tissues surrounding the xylem. PMID:16662402

  7. Abscisic Acid transport coefficients of phaseolus root systems.

    PubMed

    Fiscus, E L; Stermitz, F R; Amoros, L G

    1982-06-01

    Diffusive and convective transport coefficients of Phaseolus vulgaris L. cv. Ouray root systems for abscisic acid for (ABA) were measured. The convective coefficient (reflection coefficient or osmotic efficiency factor) sigma was determined to be 0.96 for ABA while the diffusive coefficient, omega, was found to be 1.44 x 10(-11) mole per square centimeter per second per bar. Steady-state concentrations of ABA in the root system exudates were not achieved until at least three hours after the applications suggesting either a slow saturation of binding sites or equilibration with tissues surrounding the xylem. PMID:16662402

  8. Interferon-alpha-associated presumed ocular sarcoidosis

    Microsoft Academic Search

    Deshka Doycheva; Christoph Deuter; Nicole Stuebiger; Manfred Zierhut

    2009-01-01

    Background  Interferon alpha, used in the treatment of different viral, autoimmune and malignant diseases, is known to induce a variety\\u000a of side effects. Recently, induction of sarcoidosis during interferon therapy has been reported. We analyzed patients for\\u000a uveitis, possibly induced by interferon alpha.\\u000a \\u000a \\u000a \\u000a Methods  We report on three patients who had developed typical signs of ocular sarcoidosis under treatment with interferon alpha

  9. Production of alpha 1-proteinase inhibitor (human).

    PubMed

    Hein, R H; Van Beveren, S M; Shearer, M A; Coan, M H; Brockway, W J

    1990-03-01

    A method for large scale isolation of alpha 1-proteinase inhibitor (alpha 1-PI) is described. This method employs waste Cohn Fraction IV-1 as the starting material and involves fractional precipitation with polyethylene glycol followed by ion exchange chromatography on diethylaminoethanol (DEAE)-Sepharose. The process also incorporates a ten hour, at 60 degrees C, heat-treatment step to reduce or eliminate the risk of transmission of viral disease. The final product, having a purity of approximately 60%, is freeze-dried. This preparation behaves almost identically to the alpha 1-PI in plasma and is suitable for replacement therapy in hereditary emphysema. PMID:2340046

  10. Alpha cluster structure in 56Ni

    NASA Astrophysics Data System (ADS)

    Akimune, H.; Fujiwara, M.; Gibelin, J.; Harakeh, M. N.; Achouri, L.; Bagchi, S.; Bastin, B.; Boretzky, K.; Bouzomita, H.; Caceres, L.; Damoy, S.; Delaunay, F.; Fernández-Domínguez, B.; Caamano, M.; Garg, U.; Grinyer, G. F.; Kalantar-Nayestanaki, N.; Kamalou, O.; Khan, E.; Krasznahorkay, A.; Lhoutellier, G.; Lukyanov, S.; Mazurek, K.; Najafi, M.; Pancin, J.; Penionzkhevich, Y.; Perrot, L.; Raabe, R.; Rigollet, C. E.; Roger, T.; Sambi, S.; Savajols, H.; Senoville, M.; Stodel, C.; Suen, L.; Thomas, J. C.; van de Walle, J.; Vandebrouck, M.

    2013-04-01

    The inelastic ?-scattering experiment on 56Ni in inverse kinematics was performed at an incident energy of 50 MeV/u at GANIL. A very high multiplicity for ?-particle emission was observed with our phase-space limited experimental set-up. The maximum observed multiplicity, which cannot be explained by means of the statistical decay model, amounted to seven. The ideal classical gas model at kT = 3 MeV fairly well reproduced the experimental momentum distribution and multiplicity of alpha particles. This result strongly suggests that an alpha-gas state in 56Ni may be excited via inelastic alpha scattering.

  11. Elevated Alpha Fetoprotein, No Hepatocellular Carcinoma

    PubMed Central

    Patil, Mallikarjun; Sheth, Keyur A.; Adarsh, Channagiri K.

    2013-01-01

    Alpha fetoprotein is a fetal specific glycoprotein which falls rapidly after birth. High level of alpha fetoprotein is suspicious of hepatocellular carcinoma but may be elevated in chronic viral hepatitis. A 35-year-old presented to us with jaundice for 7 days. He had chronic hepatitis B infection for last 12 months and was taking medicines irregularly for same. He had high alpha fetoprotein levels (740.9 ng/ml) without evidence of hepatocellular carcinoma which reduced with antiviral therapy. Such elevation can be explained due to hepatic inflammation and viral replication.

  12. Transport of alpha- and beta-D-glucose by the intact human red cell

    SciTech Connect

    Carruthers, A.; Melchior, D.L.

    1985-07-16

    The kinetics of alpha- and beta-D-glucose mutarotation and the transport of these anomers by intact human red cells were determined at 0.6 and 36.6 degrees C. The mutarotation coefficients for alpha- and beta-D-glucose in cell-free tris(hydroxymethyl)aminomethane medium (pH 7.4) at 0.6 degrees C are (2.25 +/- 0.2) and (1.73 +/- 0.42) X 10(-3) min-1, respectively, and at 36.6 degrees C are (69 +/- 12) and (75 +/- 5) X 10(-3) min-1, respectively. These values are in good agreement with previous estimates. At 0.6 degrees C, the red cell contains no detectable mutarotase activity. Initial rates of sugar uptake were measured by using radiolabeled D-glucose and time courses of uptake by turbidimetry. The time courses of alpha- and beta-D-glucose and an equilibrium mixture of alpha- and beta-D-glucose infinite-cis entry are identical at 0.66 degrees C (n = 41) where negligible mutarotation is observed. The apparent Ki values for inhibition of radiolabeled D-glucose initial uptake by unlabeled alpha- or beta-D-glucose at 0.6 degrees C are identical (1.6 mM). The calculated Vmax parameters for uptake of the radiolabeled anomers at this temperature are also indistinguishable. The time courses of infinite-cis alpha- and beta-D-glucose uptake at 36.66 degrees C are identical (n = 40). While D-glucose mutarotation is more rapid at this temperature, the anomers of D-glucose are not transported differently by the red cell hexose transfer system.

  13. High strength oxidation resistant alpha titanium alloy

    SciTech Connect

    Gigliotti, F.X. Jr.; Rowe, R.G.; Wasielewski, G.E.

    1990-03-06

    This patent describes alpha titanium alloys containing aluminum, hafnium and/or tantalum has been found to have improved creep and tensile strengths as well as oxidtion resistance at temperature up to about 700{degrees}C without embrittlement.

  14. Genetics Home Reference: Alpha-mannosidosis

    MedlinePLUS

    ... of sugar molecules (oligosaccharides) attached to certain proteins (glycoproteins). In particular, alpha-mannosidase helps break down oligosaccharides ... cataract ; cell ; deficiency ; depression ; disability ; enzyme ; fetus ; gene ; glycoproteins ; ... hepatosplenomegaly ; hydrocephalus ; inherited ; mannose ; molecule ; motor ; ...

  15. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  16. NEW APPROACHES TO CONFINED ALPHA DIAGNOSTICS

    SciTech Connect

    FISHER,R.K

    2004-04-01

    Three new approaches to obtain information on the confined fast alphas in International Thermonuclear Experimental Reactor (ITER) are proposed. The first technique measures the energetic charge exchange (CX) neutrals that result from the alpha collision-induced knock-on fuel ion tails undergoing electron capture on the MeV D neutral beams planned for heating and current drive. The second technique measures the energetic knock-on neutron tail due to alphas using the lengths of the proton recoil tracks produced by neutron collisions in nuclear emulsions. The range of the 14 to 20 MeV recoil protons increases by {approx}140 microns per MeV. The third approach would measure the CX helium neutrals resulting from confined alphas capturing two electrons in the ablation cloud surrounding a dense gas jet that has been proposed for disruption mitigation in ITER.

  17. Approaches to confined alpha diagnostics on ITER

    SciTech Connect

    Fisher, R.K. [General Atomics, PO Box 85608, San Diego, California 92186-5608 (United States)

    2004-10-01

    Three approaches to obtain information on the confined fast alphas in the International Thermonuclear Experimental Reactor (ITER) are proposed. The first technique measures the energetic charge exchange (CX) neutrals that result from the alpha collision-induced knock-on fuel ion tails undergoing electron capture on the MeV D neutral beams planned for heating and current drive. The second technique measures the energetic knock-on neutron tail due to alphas using the lengths of the proton recoil tracks produced by neutron collisions in nuclear emulsions. The range of the 14 to 20 MeV recoil protons increases by {approx}140 {mu}m per MeV. The third approach would measure the CX helium neutrals resulting from confined alphas capturing two electrons in the ablation cloud surrounding a dense gas jet that has been proposed for disruption mitigation in ITER.

  18. High Frequency Electrochemical Nanopolishing of Alpha Titanium

    E-print Network

    Kanchwala, Abbas M

    2013-08-07

    conducting material while holding close dimensional tolerances. This research develops a high frequency electrochemical nanopolishing technique for commercially pure alpha titanium. An alcohol and salt based electrolyte was used with direct current as well...

  19. Alpha-Driven Currents in Tokamak Reactors.

    NASA Astrophysics Data System (ADS)

    Gouge, Michael Joseph

    The generation of a net toroidal plasma current in tokamak reactors by interaction of an input magnetosonic wave with the fusion product alpha particles is examined. The wave transfers momentum to the alpha particles by Landau damping and transit time damping and thereby modifies the alpha particle velocity distribution function in an anisotropic manner. The change in the alpha particle distribution function and the resulting toroidal current density and wave energy absorption is calculated for several assumed alpha particle velocity distribution functions. A Gaussian velocity distribution function to model a spread in the alpha particle birth energy due to kinematic effects as well as speed diffusion from collisions with the background plasma is evaluated and found to give identical results as a monoenergetic delta function velocity distribution in the proper limits. The physical processes producing the Gaussian distribution are shown to be small. A more realistic calculation with an alpha particle velocity distribution functions based on a Fokker-Planck model of slowing down against the background electrons is performed and numerical estimates obtained for a reference tokamak reactor design. It is shown, for the assumed parallel wave vector spectrum, that the transit time damping is the dominant process and that interaction of the wave with background electrons can be neglected. The efficiency of the process is found to be comparable to that of lower hybrid current drive and approaches values of 0.15 A/W at high electron temperatures. The magnitude of the induced current is found to be significantly less than that required for plasma confinement and equilibrium, although anomalously large values of the parallel wave magnetic field could produce the design current. Issues such as wave accessibility, absorption, and mode conversion are also examined and found to be favorable for the assumed wave frequency of about four times the cyclotron frequency of deuterium and parallel wave vectors constrained for resonance with the 3.52-MeV alpha particles.

  20. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  1. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  2. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  3. Energy dependence of event shapes and of $\\\\alpha_s$ at LEP 2

    Microsoft Academic Search

    P. Abreu; W Adam; T Adye; P Adzic; Z Albrecht; T Alderweireld; G D Alekseev; R Alemany; T Allmendinger; P P Allport; S Almehed; Ugo Amaldi; N Amapane; S Amato; E G Anassontzis; P Andersson; A Andreazza; S Andringa; P Antilogus; W D Apel; Y Arnoud; B Åsman; J E Augustin; A Augustinus; Paul Baillon; P Bambade; F Barão; Guido Barbiellini; R Barbier; Dimitri Yuri Bardin; G Barker; A Baroncelli; Marco Battaglia; M Baubillier; K H Becks; M Begalli; A Behrmann; P Beillière; Yu A Belokopytov; K S Belous; N C Benekos; Alberto C Benvenuti; C Bérat; M Berggren; D Bertini; D Bertrand; M Besançon; F Bianchi; M Bigi; S M Bilenky; M A Bizouard; D Bloch; H M Blom; M Bonesini; W Bonivento; M Boonekamp; P S L Booth; A W Borgland; G Borisov; C Bosio; O Botner; E Boudinov; B Bouquet; C Bourdarios; T J V Bowcock; I Boyko; I Bozovic; M Bozzo; P Branchini; T Brenke; R A Brenner; P Brückman; J M Brunet; L Bugge; T Buran; T Burgsmüller; Brigitte Buschbeck; P Buschmann; S Cabrera; M Caccia; M Calvi; T Camporesi; V Canale; F Carena; L Carroll; Carlo Caso; M V Castillo-Gimenez; A Cattai; F R Cavallo; V Chabaud; M M Chapkin; P Charpentier; L Chaussard; P Checchia; G A Chelkov; R Chierici; P V Chliapnikov; P Chochula; V Chorowicz; J Chudoba; K Cieslik; P Collins; R Contri; E Cortina; G Cosme; F Cossutti; J H Cowell; H B Crawley; D J Crennell; S Crépé; G Crosetti; J Cuevas-Maestro; S Czellar; Martyn Davenport; W Da Silva; A Deghorain; G Della Ricca; P A Delpierre; N Demaria; A De Angelis; Wim de Boer; C De Clercq; B De Lotto; A De Min; L S De Paula; H Dijkstra; Lucia Di Ciaccio; J Dolbeau; K Doroba; M Dracos; J Drees; M Dris; A Duperrin; J D Durand; G Eigen; T J C Ekelöf; Gösta Ekspong; M Ellert; M Elsing; J P Engel; B Erzen; M C Espirito-Santo; E Falk; G K Fanourakis; D Fassouliotis; J Fayot; Michael Feindt; A Fenyuk; P Ferrari; A Ferrer; E Ferrer-Ribas; F Ferro; S Fichet; A Firestone; U Flagmeyer; H Föth; E Fokitis; F Fontanelli; B J Franek; A G Frodesen; R Frühwirth; F Fulda-Quenzer; J A Fuster; A Galloni; D Gamba; S Gamblin; M Gandelman; C García; C Gaspar; M Gaspar; U Gasparini; P Gavillet; E N Gazis; D Gelé; N Ghodbane; I Gil; F Glege; R Gokieli; B Golob; G Gómez-Ceballos; P Gonçalves; I González-Caballero; Gian P Gopal; L Gorn; M Górski; Yu Guz; Valerio Gracco; J Grahl; E Graziani; C Green; H J Grimm; P Gris; G Grosdidier; K Grzelak; M Günther; J Guy; F Hahn; S Hahn; S Haider; A Hallgren; K Hamacher; J Hansen; F J Harris; V Hedberg; S Heising; J J Hernández; P Herquet; H Herr; T L Hessing; J M Heuser; E Higón; S O Holmgren; P J Holt; S Hoorelbeke; M A Houlden; Josef Hrubec; K Huet; G J Hughes; K Hultqvist; J N Jackson; R Jacobsson; P Jalocha; R Janik; C Jarlskog; G Jarlskog; P Jarry; B Jean-Marie; E K Johansson; P E Jönsson; C Joram; P Juillot; F Kapusta; K Karafasoulis; S Katsanevas; E C Katsoufis; R Keränen; Borut P Kersevan; B A Khomenko; N N Khovanskii; A P Kiiskinen; B J King; A Kinvig; N J Kjaer; O Klapp; H Klein; P M Kluit; P Kokkinias; M Koratzinos; V Kostyukhin; C Kourkoumelis; O Kuznetsov; Manfred Krammer; E Kriznic; J Krstic; Z Krumshtein; P Kubinec; J Kurowska; K L Kurvinen; J Lamsa; P Langefeld; V Lapin; J P Laugier; R Lauhakangas; Gerhard Leder; F Ledroit; V Lefébure; L Leinonen; A Leisos; R Leitner; J Lemonne; Georg Lenzen; V Lepeltier; T Lesiak; M Lethuillier; J Libby; D Liko; A Lipniacka; I Lippi; B Lörstad; J G Loken; J H Lopes; J M López; R López-Fernandez; D Loukas; P Lutz; L Lyons; J N MacNaughton; J R Mahon; A Maio; A Malek; T G M Malmgren; S Maltezos; V Malychev; F Mandl; J Marco; R P Marco; B Maréchal; M Margoni; J C Marin; C Mariotti; A Markou; C Martínez-Rivero; F Martínez-Vidal; S Martí i García; N Mastroyiannopoulos; F Matorras; C Matteuzzi; Giorgio Matthiae; J Masik; F Mazzucato; M Mazzucato; M L McCubbin; R McKay; R McNulty; G McPherson; C Meroni; W T Meyer; E Migliore; L Mirabito; Winfried A Mitaroff; U Mjörnmark; T Moa; M Moch; R Møller; K Mönig; M R Monge; X Moreau; P Morettini; G A Morton; U Müller; K Münich; M Mulders; C Mulet-Marquis; R Muresan; W J Murray; B Muryn; Gerald Myatt; T Myklebust; F Naraghi; M Nassiakou; Francesco Luigi Navarria; S Navas; K Nawrocki; P Negri; S Némécek; N Neufeld; N Neumeister; R Nicolaidou; B S Nielsen; M Nikolenko; V P Nomokonov; Ainsley Normand; A Nygren; V F Obraztsov; A G Olshevskii; A Onofre; Risto Orava; G Orazi; K Österberg; A Ouraou; M Paganoni; S Paiano; R Pain; R Paiva; J Palacios; H Palka; T D Papadopoulou; K Papageorgiou; L Pape; C Parkes; F Parodi; U Parzefall; A Passeri; O Passon; M Pegoraro; L Peralta; Manfred Pernicka; A Perrotta; C Petridou; A Petrolini; H T Phillips; F Pierre; M Pimenta; E Piotto; T Podobnik; M E Pol; G Polok; P Poropat; V Pozdnyakov; P Privitera; N Pukhaeva; Antonio Pullia; D Radojicic; S Ragazzi; H Rahmani; P N Ratoff; A L Read; P Rebecchi; N G Redaelli; Meinhard Regler; D Reid

    1999-01-01

    Infrared and collinear safe event shape distributions and their mean values are determined using the data taken at ve di erent centre of mass energies above $M_Z$ with the DELPHI detector at LEP. From the event shapes, the strong coupling $\\\\alpha_s$ is extracted in $O(\\\\alpha^2_s)$, NLLA and a combined scheme using hadronisation corrections evaluated with fragmentation model generators as well

  4. Is the Quality of Judging in Women Artistic Gymnastics Equivalent at Major Competitions of Different Levels?

    PubMed Central

    Pajek, Maja Bu?ar; ?uk, Ivan; Pajek, Jernej; Kova?, Marjeta; Leskošek, Bojan

    In the present study, the reliability and validity of judging at the European championship in Berlin 2011 were analysed and the results were compared to a different level gymnastic competition – Universiade 2009 in Belgrade. For reliability and consistency assessment, mean absolute judge deviation from final execution score, Cronbach’s alpha coefficient, intra-class correlations (ICC) and Armor’s theta coefficient were calculated. For validity assessment mean deviations of judges’ scores, Kendall’s coefficient of concordance W and ANOVA eta-squared values were used. For Berlin 2011 in general Cronbach’s alpha was above 0.95, minima of item-total correlations were above 0.8, and the ICC of average scores and Armor’s theta were above 0.94. Comparison with Universiade 2009 identified vault and floor scores at both competitions to have inferior reliability indices. At both competitions average deviations of judges from the final E score were close to zero (p=0.84) but Berlin 2011 competition showed a higher number of apparatuses with significant Kendall’s W (5 vs. 2 for Universiade 2009) and higher eta-squared values indicating higher judge panel bias in all-round and apparatus finals. In conclusion, the quality of judging was comparable at examined gymnastics competitions of different levels. Further work must be done to analyse the inferior results at vault and floor apparatuses. PMID:24146718

  5. Staphylococcal alpha -toxin: Oligomerization of Hydrophilic Monomers to Form Amphiphilic Hexamers Induced through Contact with Deoxycholate Detergent Micelles

    Microsoft Academic Search

    Sucharit Bhakdi; Roswitha Fussle; Jorgen Tranum-Jensen

    1981-01-01

    Native staphylococcus aureus alpha -toxin is secreted as a hydrophilic polypeptide chain of Mr 34,000. The presence of deoxycholate above the critical micellar concentration induced the toxin monomers to self-associate, forming ring or cylindrical oligomers. The oligomers were amphiphilic and bound detergent. In deoxycholate solution, the protein-detergent complexes exhibited a sedimentation coefficient of 10.4 S. A Mr of 238,700 was

  6. Determination of epithelial tissue scattering coefficient using confocal microscopy

    Microsoft Academic Search

    Tom Collier; Dizem Arifler; Anais Malpica; Michele Follen; Rebecca Richards-Kortum

    2003-01-01

    Most models of light propagation through tissue assume the scattering properties of the various tissue layers are the same. The authors present evidence that the scattering coefficient of normal cervical epithelium is significantly lower than values previously reported for bulk epithelial tissue. They estimated the scattering coefficient of normal and precancerous cervical epithelium using measurements of the reflectance as a

  7. Multiple Objective Linear Programming with Parametric Criteria Coefficients

    Microsoft Academic Search

    Harold P. Benson

    1985-01-01

    In this paper we study the multiple objective linear programming problem with parametric criteria coefficients. This problem is of interest since in many situations the coefficients of the objective functions of a multiple objective linear program either represent estimates of the true data or are subject to systematic variations. Properties of this problem are developed, and an algorithm for generating

  8. Confidence interval estimation of a common correlation coefficient

    Microsoft Academic Search

    Lili Tian; Gregory E. Wilding

    2008-01-01

    This paper presents a generalized variable approach for confidence interval estimation of a common correlation coefficient from several independent samples drawn from bivariate normal populations. This approach can provide one-sided bounds and two-sided confidence intervals with satisfying coverage probabilities regardless of the number of samples, sample sizes and magnitude of the common correlation coefficient while the large sample approach can

  9. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  10. IMAGE INPAINTING BASED ON GEOMETRICAL MODELING OF COMPLEX WAVELET COEFFICIENTS

    Microsoft Academic Search

    Gang Hua; Michael T. Orchard

    The restoration of missing regions in images (inpainting) is math- ematically an interpolation problem and has many important ap- plications. This paper proposes a novel iterative inpainting algo- rithm based on the interpolation of the Complex Wavelet Transform (CWT) coefficients with simple geometrical models on the magni- tude and phase of the coefficients. The geometrical models describe the directionality and

  11. Reliability Coefficients from Two Administrations of the Willoughby Personality Schedule

    ERIC Educational Resources Information Center

    Hay, Nancy M.; Stewart, Norman R.

    1974-01-01

    This study determined internal consistency and test-retest reliability coefficients for the Willoughby Personality Schedule, currently used as an outcome measure in research and in clinical practice. The Hoyt analysis of variance yielded an internal consistency reliability coefficient of .90 on the first testing. The test-retest reliability…

  12. ATTENUATION COEFFICIENTS FOR GAMMA RAYS FROM Co⁶°

    Microsoft Academic Search

    S. S. R. Sastry; S. Jnanananda

    1958-01-01

    Attention coefficients in seven different alloys and in Perspex for the ; 1.1715 and 1.3316 Mev gamma radiations from a 17 mc Co⁶° source have been ; estimated by the method of least squares, employing the narrow beam geometry of ; Davisson and Evans with provision for accurate collimation. The experimental ; values for the coefficients and the theoretical values,

  13. The dyadic diffraction coefficient for a curved edge

    NASA Technical Reports Server (NTRS)

    Kouyoumjian, R. G.; Pathak, P. H.

    1974-01-01

    A compact dyadic diffraction coefficient for electromagnetic waves obliquely incident on a curved edge formed by perfectly conducting curved or plane surfaces is obtained. This diffraction coefficent remains valid in the transition regions adjacent to shadow and reflection boundaries, where the diffraction coefficients of Keller's original theory fail. The method is on Keller's method of the canonical problem, which in this case is the perfectly conducting wedge illuminated by plane, cylindrical, conical, and spherical waves. When the proper ray fixed coordinate system is introduced, the dyadic diffraction coefficient for the wedge is found to be the sum of only two dyads, and it is shown that this is also true for the dyadic diffraction coefficients of higher order edges. One dyad contains the acoustic soft diffraction coefficient; the other dyad contains the acoustic hard diffraction coefficient. The expressions for the acoustic wedge diffraction coefficients contain Fresnel integrals, which ensure that the total field is continuous at shadow and reflection boundaries. The diffraction coefficients have the same form for the different types of edge illumination; only the arguments of the Fresnel integrals are different. Since diffraction is a local phenomenon, and locally the curved edge structure is wedge shaped, this result is readily extended to the curved edge.

  14. Crop coefficient development and application to an evapotranspiration network

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Crop coefficients derived from properly designed, operated, and maintained lysimeters provide the most accurate values throughout the growing season and are critical in the computation of hourly and daily,regionally based, crop evapotranspiration (ET) values. Multi-stage crop coefficients can be der...

  15. Texture Characterization via Joint Statistics of Wavelet Coefficient Magnitudes

    Microsoft Academic Search

    Eero P. Simoncelli; Javier Portilla

    1998-01-01

    We present a parametric statistical characterization of texture images in the context of an overcomplete complex wavelet frame. The characterization consists of the local autocorrelation of the coefficients in each subband, the lo- cal autocorrelation of the cofficent magnitudes, and the cross- correlation of coefficient magnitudes at all orientations and adjacent spatial scales. We develop an efficient algorithm for sampling

  16. Diffusion coefficient in hydrogel under high-frequency ultrasound

    Microsoft Academic Search

    Akira Tsukamoto; Kei Tanaka; Tatsuya Kumata; Yoshiaki Watanabe; Shogo Miyata; Katsuko Furukawa; Takashi Ushida

    2007-01-01

    Modulating hydrogel properties by external stimuli can be applied for drug delivery system. For example, ultrasound can enhance drug release from hydrogel by the mechanism which is not fully understood. We measured diffusion coefficient in hydrogel under high-frequency ultrasound to understand mass transport property. To estimate diffusion coefficient, FRAP (fluorescence recovery after photobleaching) technique was applied with time-lapse fluorescence microscopy

  17. Coefficient identification of trajectory correction fuze based on sensitivity function

    Microsoft Academic Search

    Jian Zhang; Xin Wang; Jun Yao

    2010-01-01

    Trajectory correction fuze is the integrated guidance and control and the new fuze technology which can correct trajectory through the fuze. In order to improve solution precision for trajectory correction fuze, a resistance coefficient identification method based on the sensitivity theory of control system is put forward. Combined with test data of the ballistic parameters, resistance coefficient is identified in

  18. Dependence of barometric correction coefficient on geomagnetic conditions

    Microsoft Academic Search

    S. P. Kavlakov; G. Benko; A. Szentgali; A. Varga

    1982-01-01

    The results of studies of the barometric coefficient for the muon component of cosmic ray showers are discussed. Data were gathered with a multidirectional telescope, an underground telescope for measuring the very hard component, and from balloon soundings for the barometric pressure. Linear and logarithmic regressions and simultaneous correlation and daily harmonics were performed to obtain the correlation coefficients for

  19. Analysis of a heat transfer device for measuring film coefficients

    NASA Technical Reports Server (NTRS)

    Medrow, R. A.; Johnson, R. L.; Loomis, W. R.; Wedeven, L. D.

    1975-01-01

    A heat transfer device consisting of a heated rotating cylinder in a bath was analyzed for its effectiveness to determine heat transfer coefficient of fluids. A time dependent analysis shows that the performance is insensitive to the value of heat transfer coefficient with the given rig configuration.

  20. Using the gini coefficient for bug prediction in eclipse

    Microsoft Academic Search

    Emanuel Giger; Martin Pinzger; Harald Gall

    2011-01-01

    The Gini coefficient is a prominent measure to quantify the inequality of a distribution. It is often used in the field of economy to describe how goods, e.g., wealth or farmland, are distributed among people. We use the Gini coefficient to measure code ownership by investigating how changes made to source code are distributed among the developer population. The results

  1. Micro- and macroscale coefficients of friction of cementitious materials

    SciTech Connect

    Lomboy, Gilson [Department of Civil, Construction, and Environmental Engineering, Iowa State University, Ames, IA 50011 (United States)] [Department of Civil, Construction, and Environmental Engineering, Iowa State University, Ames, IA 50011 (United States); Sundararajan, Sriram, E-mail: srirams@iastate.edu [Department of Mechanical Engineering, Iowa State University, Ames, IA 50011 (United States)] [Department of Mechanical Engineering, Iowa State University, Ames, IA 50011 (United States); Wang, Kejin [Department of Civil, Construction, and Environmental Engineering, Iowa State University, Ames, IA 50011 (United States)] [Department of Civil, Construction, and Environmental Engineering, Iowa State University, Ames, IA 50011 (United States)

    2013-12-15

    Millions of metric tons of cementitious materials are produced, transported and used in construction each year. The ease or difficulty of handling cementitious materials is greatly influenced by the material friction properties. In the present study, the coefficients of friction of cementitious materials were measured at the microscale and macroscale. The materials tested were commercially-available Portland cement, Class C fly ash, and ground granulated blast furnace slag. At the microscale, the coefficient of friction was determined from the interaction forces between cementitious particles using an Atomic Force Microscope. At the macroscale, the coefficient of friction was determined from stresses on bulk cementitious materials under direct shear. The study indicated that the microscale coefficient of friction ranged from 0.020 to 0.059, and the macroscale coefficient of friction ranged from 0.56 to 0.75. The fly ash studied had the highest microscale coefficient of friction and the lowest macroscale coefficient of friction. -- Highlights: •Microscale (interparticle) coefficient of friction (COF) was determined with AFM. •Macroscale (bulk) COF was measured under direct shear. •Fly ash had the highest microscale COF and the lowest macroscale COF. •Portland cement against GGBFS had the lowest microscale COF. •Portland cement against Portland cement had the highest macroscale COF.

  2. Brief Communication Determination of vascular permeability coefficients under slow

    E-print Network

    Tien, Joe

    Brief Communication Determination of vascular permeability coefficients under slow luminal filling, Boston, MA 02215, USA a b s t r a c ta r t i c l e i n f o Article history: Accepted 12 July 2013 (permeability coefficient normalized by vascular dimensions) from time-lapse intensity data for which

  3. Spatio-temporal variability of event runoff coefficients

    Microsoft Academic Search

    R. Merz; G. Blöschl; J. Parajka

    2006-01-01

    Runoff coefficients are widely used as a diagnostic variable of runoff generation in process studies and as an important input parameter in hydrologic design. In the present study runoff coefficients have been back calculated from hourly runoff data, hourly precipitation data and estimates of snowmelt. A total of about 50,000 events in 337 Austrian catchments with catchment areas ranging from

  4. A Simple Geometric Approach to Approximating the Gini Coefficient

    ERIC Educational Resources Information Center

    Kasper, Hirschel; Golden, John

    2008-01-01

    The author shows how a quick approximation of the Lorenz curve's Gini coefficient can be calculated empirically using numerical data presented in cumulative income quintiles. When the technique here was used to estimate 621 income quintile/Gini coefficient observations from the Deninger and Squire/World Bank data set, this approach performed…

  5. APPENDIX E Partition Coefficients For Chromium(VI)

    E-print Network

    APPENDIX E Partition Coefficients For Chromium(VI) #12;Appendix E Partition Coefficients For Chromium(VI) E.1.0 Background The review of chromium Kd data obtained for a number of soils (summarized in Table E.1) indicated that a number of factors influence the adsorption behavior of chromium

  6. A program to compute aquifer-response coefficients

    USGS Publications Warehouse

    Maddock, Thomas

    1974-01-01

    An alternating direction technique is used to solve finite difference equations approximating the flow of water in an aquifer. The solutions produce response coefficients relating pumping from wells to drawdowns within those wells. The product of the response coefficient with the pumping values produces a linear algebraic technological function that can be used for integrating hydrologic phenomena into planning and management models.

  7. VISCOSITY SOLUTIONS OF HAMILTONJACOBI EQUATIONS WITH DISCONTINUOUS COEFFICIENTS

    E-print Network

    VISCOSITY SOLUTIONS OF HAMILTON­JACOBI EQUATIONS WITH DISCONTINUOUS COEFFICIENTS GIUSEPPE MARIA of viscosity solution to the Cauchy problem, and that the front tracking algorithm yields an L contractive semigroup. We define a viscosity solution by treating the discontinuities in the coefficients analogously

  8. Coefficients of Correlation and Concordance for Sets of Triads Judgments

    Microsoft Academic Search

    Richard Degerman

    1982-01-01

    Coefficients of correlation and concordance are defined for profiles consisting of ensembles of partially ordered sets by extending Kendall's rank order correlation (tau) and Kendall's coefficient of concordance (W) to cases where Ss are asked to rank order, or to choose among, the given alternatives in multiple sets (ensembles) of items. Computational versions of each formula are given for the

  9. Cavity acoustics analysis — An extensive comparison of turbulence model coefficients

    Microsoft Academic Search

    Salman Sadiq; Muhammad Iqbal Sabir

    2011-01-01

    An extensive research has been conducted to determine the effect of changing turbulence model coefficients in order to effectively predict the acoustic signature of a cavity subjected to flow field. The turbulence coefficients of a variety of turbulence models like: k-?0 , k-?&, Reynolds Stress, Shear Stress Transport (SST) and Large Eddy Simulations (LES); were analyzed and compared in terms

  10. REE and Strontium Partition Coefficients for Nakhla Pyroxenes

    NASA Technical Reports Server (NTRS)

    Oe, K.; McKay, G.; Le, L.

    2001-01-01

    We present new partition coefficients for REE and Sr determined using a synthetic melt that crystallizes pyroxenes very similar in composition to Nakhla pyroxene cores. We believe these are the most appropriate partition coefficients to use in studying Nakhla Additional information is contained in the original extended abstract..

  11. Oil UV extinction coefficient measurement using a standard spectrophotometer

    NASA Astrophysics Data System (ADS)

    Barbaro, Antongiulio; Mazzinghi, Piero; Cecchi, Giovanna

    1991-03-01

    This paper investigates the possible techniques for measurement of the extinction coefficient of oils in the near UV. Results show that the best technique, in precision and ease of use, is the unknown thickness method. This method allows the use of a standard spectrophotometer. Beer's law is also validated for oils, and a simple function is proposed for fitting the extinction coefficient spectra.

  12. Calculation of fusion product angular correlation coefficients for fusion plasmas

    SciTech Connect

    Murphy, T.J.

    1987-08-01

    The angular correlation coefficients for fusion products are calculated in the cases of Maxwellian and beam-target plasmas. Measurement of these coefficients as a localized ion temperature or fast-ion diagnostic is discussed. 8 refs., 7 figs., 1 tab.

  13. Estimating cotton evapotranspiration crop coefficients with a multispectral vegetation index

    Microsoft Academic Search

    Douglas J. Hunsaker; Paul J. Pinter Jr; Edward M. Barnes; Bruce A. Kimball

    2003-01-01

    Crop coefficients are a widely used and universally accepted method for estimating the crop evapotranspiration (ET c) component in irrigation scheduling programs. However, uncertainties of generalized basal crop coefficient ( K cb) curves can contribute to ET c estimates that are substantially different from actual ET c. Limited research with corn has shown improvements to irrigation scheduling due to better

  14. Wheat basal crop coefficients determined by normalized difference vegetation index

    Microsoft Academic Search

    Douglas J. Hunsaker; Paul J. Pinter Jr; Bruce A. Kimball

    2005-01-01

    Crop coefficient methodologies are widely used to estimate actual crop evapotranspiration (ETc) for determining irrigation scheduling. Generalized crop coefficient curves presented in the literature are limited to providing estimates of ETc for “optimum” crop condition within a field, which often need to be modified for local conditions and cultural practices, as well as adjusted for the variations from normal crop

  15. Image Restoration Approach Based on Wavelet Coefficients Modeling

    Microsoft Academic Search

    Besma Miladi; M. Jérôme; N. Ellouze

    2008-01-01

    This paper presents the restoration approach based on the modeling of the wavelet coefficients of the natural images. Two algorithms are developed: the first algorithm developed concerns the modeling of the natural images using the wavelet coefficients; the second algorithm uses the modeling results for the image restoration. Simulations are operated on some standard test images degraded by an additive

  16. Alpha-Lipoic Acid and Diabetic Neuropathy

    PubMed Central

    Vallianou, Natalia; Evangelopoulos, Angelos; Koutalas, Pavlos

    2009-01-01

    Diabetic neuropathy presents a major public health problem. It is defined by the symptoms and signs of peripheral nerve dysfunction in diabetic patients, in whom other causes of neuropathy have been excluded. Pathogenetic mechanisms that have been implicated in diabetic neuropathy are: a) increased flux through the polyol pathway, leading to accumulation of sorbitol, a reduction in myo-inositol, and an associated reduced Na+-K+-ATPase activity, and b) endoneurial microvascular damage and hypoxia due to nitric oxide inactivation by increased oxygen free radical activity. Alpha-lipoic acid seems to delay or reverse peripheral diabetic neuropathy through its multiple antioxidant properties. Treatment with alpha-lipoic acid increases reduced glutathione, an important endogenous antioxidant. In clinical trials, 600 mg alpha-lipoic acid has been shown to improve neuropathic deficits. This review focuses on the relationship of alpha-lipoic acid and auto-oxidative glycosylation. It discusses the impact of alpha-lipoic acid on hyperglycemia-induced oxidative stress, and examines the role of alpha-lipoic acid in preventing glycation process and nerve hypoxia. PMID:20043035

  17. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  18. {alpha}-states in de Sitter space

    SciTech Connect

    Boer, Jan de [Instituut voor Theoretische Fysica, Valckenierstraat 65, 1018XE Amsterdam (Netherlands); Jejjala, Vishnu; Minic, Djordje [Institute for Particle Physics and Astrophysics, Physics Department, Robeson Hall, Virginia Tech, Blacksburg, Virginia 24061 (United States)

    2005-02-15

    Field theory in de Sitter space admits a one-parameter family of vacua determined by a superselection parameter {alpha}. Of these vacua, the Euclidean vacuum uniquely extrapolates to the vacuum of flat Minkowski space. States which resemble the {alpha}-vacua can be constructed as excitations above the Euclidean vacuum. Such states have modes {alpha}(k) which decay faster that k{sup (1-d)/2}. Fields in such states exhibit nonlocal correlations when examined from the perspective of fields in the Euclidean vacuum. The dynamics of such entangled states are fully consistent. If an {alpha}-state with properties that interpolate between an {alpha}-vacuum and the Euclidean vacuum were the initial condition for inflation, a signature for this may be found in a momentum dependent correction to the inflationary power spectrum. The functional formalism, which provides the tool for examining physics in an {alpha}-state, extends to fields of other spin. In particular, the extension to spin-2 may proffer a new class of infrared modifications to gravitational interactions. The implications of superselection sectors for the landscape of string vacua are briefly discussed.

  19. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  20. Folding model analysis of alpha radioactivity

    E-print Network

    D. N. Basu

    2003-07-29

    Radioactive decay of nuclei via emission of $\\alpha$ particles has been studied theoretically in the framework of a superasymmetric fission model using the double folding (DF) procedure for obtaining the $\\alpha$-nucleus interaction potential. The DF nuclear potential has been obtained by folding in the density distribution functions of the $\\alpha$ nucleus and the daughter nucleus with a realistic effective interaction. The M3Y effective interaction has been used for calculating the nuclear interaction potential which has been supplemented by a zero-range pseudo-potential for exchange along with the density dependence. The nuclear microscopic $\\alpha$-nucleus potential thus obtained has been used along with the Coulomb interaction potential to calculate the action integral within the WKB approximation. This subsequently yields microscopic calculations for the half lives of $\\alpha$ decays of nuclei. The density dependence and the exchange effects have not been found to be very significant. These calculations provide reasonable estimates for the lifetimes of $\\alpha$ radioactivity of nuclei.

  1. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P. (Coppell, TX); Neef, Charles J. (Garland, TX)

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  2. MCNPX alpha particle dose estimate to the skin tissue from a low-enriched uranium fuel fragment.

    PubMed

    Atanackovic, J

    2012-06-01

    Three alpha volume sources (low-enriched uranium-U(3)Si) were analysed using Monte Carlo modelling in order to calculate the dose delivered to the dermis from a small embedded fuel fragment (sliver). Three shapes were analysed using MCNPX 2.6.0 code: sphere, cylinder and parallelepiped. Essentially, two kinds of runs were performed: count rate run and dosimetry run. The two results were combined to estimate dose coefficients that can be used for alpha dose assessments in the field. The two results were obtained for the 1 and 0 cm counting geometries. These results are very stable and show that the actual dose delivered to the skin per unit count rate for the recovered particle is independent of the shape of the volume alpha source. PMID:22003183

  3. Passive athermalization: required accuracy of the thermo-optical coefficients

    NASA Astrophysics Data System (ADS)

    Rogers, John R.

    2014-12-01

    Passive athermalization requires that the materials (both optical and mechanical) and optical powers be carefully selected in order for the image to stay adequately in focus at the plane of the detector as the various materials change in physical dimension and refractive index. For a large operational temperature range, the accuracy of the thermo-optical coefficients (dn/dT coefficients and the Coefficients of Thermal Expansion) can limit the performance of the final system. Based on an example lens designed to be passively athermalized over a 200°C temperature range, and using a Monte Carlo analysis technique, we examine the accuracy to which the expansion coefficients and dn/dT coefficients of the system must be known.

  4. Feature Selection for Varying Coefficient Models With Ultrahigh Dimensional Covariates

    PubMed Central

    Li, Runze; Wu, Rongling

    2014-01-01

    This paper is concerned with feature screening and variable selection for varying coefficient models with ultrahigh dimensional covariates. We propose a new feature screening procedure for these models based on conditional correlation coefficient. We systematically study the theoretical properties of the proposed procedure, and establish their sure screening property and the ranking consistency. To enhance the finite sample performance of the proposed procedure, we further develop an iterative feature screening procedure. Monte Carlo simulation studies were conducted to examine the performance of the proposed procedures. In practice, we advocate a two-stage approach for varying coefficient models. The two stage approach consists of (a) reducing the ultrahigh dimensionality by using the proposed procedure and (b) applying regularization methods for dimension-reduced varying coefficient models to make statistical inferences on the coefficient functions. We illustrate the proposed two-stage approach by a real data example. PMID:24678135

  5. Is the Gini Coefficient a Stable Measure of Galaxy Structure?

    NASA Astrophysics Data System (ADS)

    Lisker, Thorsten

    2008-12-01

    The Gini coefficient, a nonparametric measure of galaxy morphology, has recently taken up an important role in the automated identification of galaxy mergers. I present a critical assessment of its stability, based on a comparison of HST ACS imaging data from the GOODS and UDF surveys. Below a certain signal-to-noise level, the Gini coefficient depends strongly on the signal-to-noise ratio, and thus becomes useless for distinguishing different galaxy morphologies. Moreover, at all signal-to-noise levels the Gini coefficient shows a strong dependence on the choice of aperture within which it is measured. Consequently, quantitative selection criteria involving the Gini coefficient, such as a selection of merger candidates, cannot always be straightforwardly applied to different data sets. I discuss whether these effects could have affected previous studies that were based on the Gini coefficient, and establish signal-to-noise limits above which measured Gini values can be considered reliable.

  6. The inverse bremsstrahlung absorption coefficient in collisional plasmas

    NASA Astrophysics Data System (ADS)

    Cauble, R.; Rozmus, W.

    1985-11-01

    A prescription for the inverse bremsstrahlung (IB) absorption coefficient is presented. The coefficient is derived in terms of a collision frequency that is found from a memory function kinetic formalism. The formalism admits limits that allow a rigorous definition of the coefficient when the plasma is weakly coupled and approximations that provide a reliable calculation when the plasma is strongly coupled. In the latter case, use is made of spatial distribution functions computed from the solution to the set of integral equations describing plasma correlations via the hypernetted chain approximation (HNC). A simple analytic result is compared with the HNC calculations. Results show that, as expected, the classical form for the IB absorption coefficient is of little utility when the plasma is strongly coupled. The theory presented here should provide reasonable predictions of the coefficient.

  7. Direct Extraction of One-loop Integral Coefficients

    SciTech Connect

    Forde, Darren

    2007-04-16

    We present a general procedure for obtaining the coefficients of the scalar bubble and triangle integral functions of one-loop amplitudes. Coefficients are extracted by considering two-particle and triple unitarity cuts of the corresponding bubble and triangle integral functions. After choosing a specific parameterization of the cut loop momentum we can uniquely identify the coefficients of the desired integral functions simply by examining the behavior of the cut integrand as the unconstrained parameters of the cut loop momentum approach infinity. In this way we can produce compact forms for scalar integral coefficients. Applications of this method are presented for both QCD and electroweak processes, including an alternative form for the recently computed three-mass triangle coefficient in the six-photon amplitude A{sub 6}(1{sup -}, 2{sup +}, 3{sup -}, 4{sup +}, 5{sup -}, 6{sup +}). The direct nature of this extraction procedure allows for a very straightforward automation of the procedure.

  8. A new correlation coefficient for bivariate time-series data

    NASA Astrophysics Data System (ADS)

    Erdem, Orhan; Ceyhan, Elvan; Varli, Yusuf

    2014-11-01

    The correlation in time series has received considerable attention in the literature. Its use has attained an important role in the social sciences and finance. For example, pair trading in finance is concerned with the correlation between stock prices, returns, etc. In general, Pearson’s correlation coefficient is employed in these areas although it has many underlying assumptions which restrict its use. Here, we introduce a new correlation coefficient which takes into account the lag difference of data points. We investigate the properties of this new correlation coefficient. We demonstrate that it is more appropriate for showing the direction of the covariation of the two variables over time. We also compare the performance of the new correlation coefficient with Pearson’s correlation coefficient and Detrended Cross-Correlation Analysis (DCCA) via simulated examples.

  9. Normality of Monte Carlo criticality eigenfunction decomposition coefficients

    SciTech Connect

    Toth, B. E.; Martin, W. R. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, 2355 Bonisteel Boulevard, Ann Arbor, MI 48109 (United States); Griesheimer, D. P. [Bechtel Bettis, Inc., P.O. Box 79, West Mifflin, PA 15122 (United States)

    2013-07-01

    A proof is presented, which shows that after a single Monte Carlo (MC) neutron transport power method iteration without normalization, the coefficients of an eigenfunction decomposition of the fission source density are normally distributed when using analog or implicit capture MC. Using a Pearson correlation coefficient test, the proof is corroborated by results from a uniform slab reactor problem, and those results also suggest that the coefficients are normally distributed with normalization. The proof and numerical test results support the application of earlier work on the convergence of eigenfunctions under stochastic operators. Knowledge of the Gaussian shape of decomposition coefficients allows researchers to determine an appropriate level of confidence in the distribution of fission sites taken from a MC simulation. This knowledge of the shape of the probability distributions of decomposition coefficients encourages the creation of new predictive convergence diagnostics. (authors)

  10. Zero Pearson Coefficient for Strongly Correlated Growing Trees

    E-print Network

    S. N. Dorogovtsev; A. L. Ferreira; A. V. Goltsev; J. F. F. Mendes

    2009-11-22

    We obtained Pearson's coefficient of strongly correlated recursive networks growing by preferential attachment of every new vertex by $m$ edges. We found that the Pearson coefficient is exactly zero in the infinite network limit for the recursive trees ($m=1$). If the number of connections of new vertices exceeds one ($m>1$), then the Pearson coefficient in the infinite networks equals zero only when the degree distribution exponent $\\gamma$ does not exceed 4. We calculated the Pearson coefficient for finite networks and observed a slow, power-law like approach to an infinite network limit. Our findings indicate that Pearson's coefficient strongly depends on size and details of networks, which makes this characteristic virtually useless for quantitative comparison of different networks.

  11. Binding properties of alpha-1 adrenergic receptors in rat cerebral cortex: similarity to smooth muscle

    SciTech Connect

    Minneman, K.P.

    1983-12-01

    The characteristics of alpha-1 adrenergic receptors in rat cerebral cortex were examined using the radioiodinated alpha-1 adrenergic receptor antagonist ((/sup 125/I)BE). (/sup 125/I)BE labeled a single class of high-affinity binding sites in a particulate fraction of rat cerebral cortex with mass action kinetics and a KD of 57 pM. The binding of (/sup 125/I)BE was inhibited by various alpha adrenergic receptor antagonists, partial agonists and full agonists. The potency of these compounds in competing for the (/sup 125/I)BE binding sites suggested that (/sup 125/I)BE was labeling alpha-1 adrenergic receptors in rat cerebral cortex. In the absence of a physiological concentration of NaCl in the assay medium there was a small (20%) decrease in the density of (/sup 125/I)BE binding sites with no effect on the KD value. The absence of NaCl also caused a 4-fold increase in the potency of norepinephrine in competing for (/sup 125/I)BE binding sites. All drugs competed for (/sup 125/I) BE binding sites with Hill coefficients greater than 0.86, except for oxymetazoline which had a Hill coefficient of 0.77. Scatchard analysis of specific (/sup 125/I)BE binding in the presence of various competing drugs showed that the inhibition by both agonists and antagonists was purely competitive, but the inhibition by oxymetazoline was complex. Treatment of the particulate fraction of rat cerebral cortex with 0.2 to 200 nM phenoxybenzamine for 10 min caused a dose-dependent decrease in the density of (/sup 125/I) BE binding sites which could be mostly blocked by the presence of norepinephrine during the phenoxybenzamine exposure.

  12. Hemisphere Soft Function at O(alpha_s^2) for Dijet Production in e+e- Annihilation

    E-print Network

    Andre H. Hoang; Stefan Kluth

    2008-07-09

    We determine the O(alpha_s^2) corrections to the partonic hemisphere soft function relevant for thrust and jet mass distributions in e+e- annihilation in the dijet limit. In this limit the distributions can be described by a factorization theorem that sums large logarithmic terms and separates perturbative from nonperturbative effects. Using the known O(alpha_s^2) contributions of the jet functions and the hard coefficients in the factorization theorem, constraints from renormalization group evolution and nonabelian exponentiation, and results from numerical integration of O(alpha_s^2) QCD matrix elements, the O(alpha_s^2) corrections of the soft function can be determined unambiguously. We study the impact of subtracting contributions related to the O(Lambda_QCD) renormalon in the partonic threshold using the soft function gap proposed recently by Hoang and Stewart, and we discuss the importance to account for the renormalization group evolution of the gap parameter. As a byproduct we also present the previously unknown next-to-next-to-leading logarithmic anomalous dimensions for the hard coefficient that appear in the factorization theorem for the double differential invariant mass distribution for heavy quark pair production at high energies in the resonance region proven by Fleming etal.

  13. Alpha Com eclipse observing campaign

    NASA Astrophysics Data System (ADS)

    Waagen, Elizabeth O.

    2014-12-01

    Drs. Matthew W. Muterspaugh and Gregory W. Henry (Tennessee State University) have requested AAVSO observers' ssistance in monitoring the possible Algol-like binary star alpha Com before, during, and after the eclipse they have predicted for mid-to-late January 2015. The PIs will be using the Fairborn Observatory automated photometric telescopes on Mt. Hopkins, but they are requesting additional observations not only to supplement theirs but also specifically to have good coverage in the event of bad weather at Mt. Hopkins. Alf Com has a 26-year period and is 4.32V at maximum. The expected amplitude of the eclipse is about 0.8 magnitude and the duration somewhere between 28 and 45 hours. The eclipse is predicted for January 25 ± three days (JD 2457047 ± 3). Muterspaugh at al. first calculated the possibility of a 2015 eclipse in 2010 (AJ). Muterspaugh and Henry recently published an article with updated information (arXiv 2014). V and/or R photometry (other bands welcome) is requested, with a minimal cadence of one measurement/2 hours, to make sure the eclipse is caught right as it begins and to ensure having multiple data points on any unseen objects that might eclipse as well. During eclipse, continuous observations are important. Infrared (H-band) observations could be interesting, should the CHARA array image the event. The precision photometry in the weeks before and after the eclipse is requested in order to catch possible evidence for planets or other materials around the eclipsing star. Updated astrometry from the current epoch would greatly improve the eclipse preductions. Charts with comparison star sequence for alf Com may be created using the AAVSO Variable Star Plotter (http://www.aavso.org/vsp). The PIs recommend using the comparison stars HD 113848 (39 Com, HR 4946, HIP 63948, V=5.990, B-V=0.39, F4V) and HD 114520 (HIP 64312, V=6.820, B-V=0.46,F2II). Observations should be submitted to the AAVSO International Database. See AAVSO Alert Notice 506 for full details.

  14. Extremely alpha Enriched Globular Clusters in Early-Type Galaxies

    Microsoft Academic Search

    T. H. Puzia; M. Kissler-Patig; P. Goudfrooij

    2005-01-01

    We compare [alpha \\/Fe], metallicity, and age distributions of globular clusters in elliptical, lenticular, and spiral galaxies, which we derive from Lick line index measurements. We find a large number of globular clusters in elliptical galaxies that reach significantly higher [alpha \\/Fe] values ([alpha \\/Fe] >0.5) than clusters in lenticular and spiral galaxies. Most of these highly alpha -enriched globular

  15. alpha-Adrenergic regulation of human renal function.

    PubMed

    Michel, M C; Rump, L C

    1996-01-01

    Pharmacological and molecular cloning techniques have identified six human subtypes of alpha-adrenoceptors which are designated alpha 1A, alpha 1D, alpha 2A, and alpha 2C. At the protein level human kidney expresses predominantly alpha 2A-adrenoceptors while other alpha 2-adrenoceptor subtypes or alpha 1-adrenoceptors have not been detected consistently in radioligand binding studies. However, the presynaptic receptors, which inhibit noradrenaline release in the human kidney, appear to belong to the alpha 2C-subtype. Intrarenal infusion of the nonselective alpha-adrenoceptor antagonist, phentolamine, and of the selective alpha 2-adrenoceptor antagonist, yohimbine, but not of the selective alpha 1-adrenoceptor antagonist, doxazosin, increase renal blood flow and renin release in hypertensive patients undergoing diagnostic renal angiography. Thus, alpha 2- but not alpha 1-adrenoceptors appear to mediate a tonic renal vasoconstriction and inhibition of renin release. Effects of systemically given alpha 1-adrenoceptor agonists and antagonists are difficult to interpret on a mechanistic level since direct effects in the kidney and indirect effects due to baroreflex activation and peripheral presynaptic and central sympatholytic actions may at least partially offset each other. Moreover, some of these drugs may additionally act independent of alpha-adrenoceptors, for example, via imidazoline recognition sits. The net result in a given subject may depend on the endogenous sympatho-adrenal tone. Thus, for each target population of interest, effects have to be described empirically for each drug. PMID:8985718

  16. Experimental Method Development for Estimating Solid-phase Diffusion Coefficients and Material-air Partition Coefficients of SVOCs

    EPA Science Inventory

    The solid-phase diffusion coefficient (Dm) and material-air partition coefficient (Kma) are key parameters for characterizing the sources and transport of semivolatile organic compounds (SVOCs) in the indoor environment. In this work, a new experimental method was developed to es...

  17. Personal dose equivalent conversion coefficients for neutron fluence over the energy range of 20 to 250 MeV

    SciTech Connect

    Mclean, Thomas D [Los Alamos National Laboratory; Justus, Alan L [Los Alamos National Laboratory; Gadd, S Milan [Los Alamos National Laboratory; Olsher, Richard H [RP-2; Devine, Robert T [RP-2

    2009-01-01

    Monte Carlo simulations were performed to extend existing neutron personal dose equivalent fluence-to-dose conversion coefficients to an energy of 250 MeV. Presently, conversion coefficients, H(p,slab)(10,alpha)/Phi, are given by ICRP-74 and ICRU-57 for a range of angles of radiation incidence (alpha = 0, 15, 30, 45, 60 and 75 degrees ) in the energy range from thermal to 20 MeV. Standard practice has been to base operational dose quantity calculations <20 MeV on the kerma approximation, which assumes that charged particle secondaries are locally deposited, or at least that charged particle equilibrium exists within the tally cell volume. However, with increasing neutron energy the kerma approximation may no longer be valid for some energetic secondaries such as protons. The Los Alamos Monte Carlo radiation transport code MCNPX was used for all absorbed dose calculations. Transport models and collision-based energy deposition tallies were used for neutron energies >20 MeV. Both light and heavy ions (HIs) (carbon, nitrogen and oxygen recoil nuclei) were transported down to a lower energy limit (1 keV for light ions and 5 MeV for HIs). Track energy below the limit was assumed to be locally deposited. For neutron tracks <20 MeV, kerma factors were used to obtain absorbed dose. Results are presented for a discrete set of angles of incidence on an ICRU tissue slab phantom.

  18. Overview of Suborbital Human Transportation Concept ALPHA

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steelant, J.; Mack, A.

    2011-08-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched Phoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to their high cost, limited safety and toxicity, a low-cost, "green" and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was selected as baseline ALPHA propulsion. The general feasibility of hybrid propulsion for suborbital vehicle application with this propellant combination was already successfully demonstrated in the first reusable and privately-funded manned launch vehicle SpaceShipOne and consequently represents the solution with the lowest development risk for the investigated application. Due to the huge success of SpaceShipOne, the same type of hybrid propulsion is foreseen for Virgin Galactic's SpaceShipTwo. ALPHA vehicle guidance will preferably be fully autonomous during the entire mission flight profile. The required technology for autonomous vehicle guidance can be from the European RLV demonstrator Phoenix, which successfully demonstrated automated landing when it was dropped three times by a helicopter and landed precisely after a GPS-guided glide. This paper outlines the current status of the technology development work for ALPHA and has a special focus on aerodynamic and aerothermodynamic aspects of the concept.

  19. TNF alpha-induced down-regulation of estrogen receptor alpha in MCF-7 breast cancer cells.

    PubMed

    Lee, Sang-Han; Nam, Hae-Seon

    2008-09-30

    Estrogen-induced proliferation in estrogen receptor (ER)-positive breast cancer cells is primarily mediated through two distinct intracellular receptors, ER alpha and ER beta. Although tumor necrosis factor alpha (TNF alpha) and E2/ER alpha are known to exert opposing effects on cell proliferation in MCF-7 cells, the mechanism by which TNFalpha antagonizes E2/ER alpha-mediated cell proliferation is not well understood. The present study suggests that reduced cell survival in response to TNF alpha treatment in MCF-7 cells may be associated with the down-regulation of ER alpha protein. The decrease in ER alpha protein level was accompanied by an inhibition of ER alpha gene transcription. Cell viability was decreased synergistically by the combined treatment with ER alpha-siRNA and TNF alpha. Furthermore, pretreatment of cells with the PI3-kinase (PI3K)/Akt inhibitor, LY294002, markedly enhanced TNF alpha-induced down-regulation of the ER alpha protein, suggesting that the PI3K/Akt pathway might be involved in control of the ER alpha level. Moreover, down-regulation of ER alpha by TNF alpha was not inhibited in cells that were pretreated with the proteasome inhibitors, MG132 and MG152, which suggests that proteasome-dependent proteolysis does not significantly influence TNF alpha-induced down-regulation of ER alpha protein. In contrast, the effect of the PI3K/Akt inhibitor on ER alpha was blocked in cells that were treated with LY294002 in the presence of the proteasome inhibitors. Collectively, our findings show that the TNF alpha may partly regulate the growth of MCF-7 breast cancer cells through the down-regulation of ER alpha expression, which is primarily mediated by a PI3K/Akt signaling. PMID:18483465

  20. Energy absorption coefficients and photon kerma for LiF

    SciTech Connect

    Sharada, K.S.

    1982-01-01

    Accurate knowledge of energy absorption coefficients is needed to calculate the absorbed dose in any material. The photon kerma for LiF relative to air and soft tissue is computed using energy absorption coefficient values for Li, F, air, and tissue. Values of energy absorption coefficients for air are already available in J. H. Hubbell's (Photon Cross-Sections, Attenuation Coefficients and Energy Absorption Coefficients from 10 KeV to 100 GeV. National Standard Reference Data System-National Bureau of Standards Report No. 29, Washington, D. C., 1969) tables. Those for tissue are obtained by adding the weighted average of the energy absorption coefficients to the different elements constituting the tissue. For fluorine, they are computed from the values given by F. H. Attix and W. C. Roesche (Eds, Radiation Dosimetry, Vol. I, Fundamentals. Academic Press, New York/London, 1968) for CaF/sub 2/ and Ca. The values for lithium have been computed taking into consideration the photoelectric effect, Compton process, and pair production. Corrections for radiative energy losses, fluorescence yields, screening of electrons, etc., are appropriately applied. The energy absorption coefficients due to photoeffect, Compton scattering, and pair production are added to get the total. The energy absorption cross-section data for photon energies from 0.01 to 10 MeV are tabulated for each interaction.

  1. Factors influencing the stream-aquifer flow exchange coefficient.

    PubMed

    Morel-Seytoux, Hubert J; Mehl, Steffen; Morgado, Kyle

    2014-01-01

    Knowledge of river gain from or loss to a hydraulically connected water table aquifer is crucial in issues of water rights and also when attempting to optimize conjunctive use of surface and ground waters. Typically in groundwater models this exchange flow is related to a difference in head between the river and some point in the aquifer, through a "coefficient." This coefficient has been defined differently as well as the location for the head in the aquifer. This paper proposes a new coefficient, analytically derived, and a specific location for the point where the aquifer head is used in the difference. The dimensionless part of the coefficient is referred to as the SAFE (stream-aquifer flow exchange) dimensionless conductance. The paper investigates the factors that influence the value of this new conductance. Among these factors are (1) the wetted perimeter of the cross-section, (2) the degree of penetration of the cross-section, and (3) the shape of the cross-section. The study shows that these factors just listed are indeed ordered in their respective level of importance. In addition the study verifies that the analytical correct value of the coefficient is matched by finite difference simulation only if the grid system is sufficiently fine. Thus the use of the analytical value of the coefficient is an accurate and efficient alternative to ad hoc estimates for the coefficient typically used in finite difference and finite element methods. PMID:24010703

  2. Initiation and Synergistic Fibrillization of Tau and Alpha-Synuclein

    Microsoft Academic Search

    Benoit I. Giasson; Mark S. Forman; Makoto Higuchi; Lawrence I. Golbe; Charles L. Graves; Paul T. Kotzbauer; John Q. Trojanowski; Virginia M.-Y. Lee

    2003-01-01

    Alpha-synuclein (alpha-syn) and tau polymerize into amyloid fibrils and form intraneuronal filamentous inclusions characteristic of neurodegenerative diseases. We demonstrate that alpha-syn induces fibrillization of tau and that coincubation of tau and alpha-syn synergistically promotes fibrillization of both proteins. The in vivo relevance of these findings is grounded in the co-occurrence of alpha-syn and tau filamentous amyloid inclusions in humans, in

  3. Effect of alpha-tocopherol on bovine in vitro fertilization.

    PubMed

    Marques, A; Santos, P; Antunes, G; Chaveiro, A; Moreira da Silva, F

    2010-02-01

    The objectives of this work are to determine if exogenous supplementation with alpha-tocopherol increases the in vitro fertilization (IVF) rate of bovine oocytes and improves viability of selected spermatozoa after 'swim-up'. The percentage of fertilized oocytes was significantly but negatively correlated (r = -0.941, p < 0.01) with the concentration of alpha-tocopherol. The control resulted in 95% of fertilized oocytes, which decreased as follows: 25 microM alpha-tocopherol (alpha25) 86%, 50 microM alpha-tocopherol (alpha50) 74%, 100 microM alpha-tocopherol (alpha100) 66% and 200 microM alpha-tocopherol (alpha200) 56%. Relatively to sperm viability after 'swim-up' with alpha-tocopherol supplementation, this antioxidant proved to have a beneficial effect as its concentration increased up to alpha50, decreasing for the concentrations of alpha100 and alpha200. Control resulted in 83% of live cells and 16% of dead cells; alpha25 resulted in 88% of live cells and 12% of dead cells; alpha50 resulted in 91% of live cells and 9% of dead cells; alpha100 resulted in 67% of live cells and 33% of dead cells; and finally alpha200 resulted in 57% of live cells and 42% of dead cells. In summary, the present study allows to conclude that, in our conditions, supplementation with the antioxidant alpha-tocopherol in IVF of bovine oocytes has a detrimental effect on fertilization rates. Nevertheless, exogenous supplementation with alpha-tocopherol at a concentration of 50 mM in the sperm-TALP media during the 'swim-up' technique has a significant beneficial effect on the selected spermatozoa viability. PMID:20137061

  4. Drag and energy accommodation coefficients during sunspot maximum

    NASA Astrophysics Data System (ADS)

    Pardini, C.; Anselmo, L.; Moe, K.; Moe, M. M.

    2010-03-01

    Conditions appropriate to gas-surface interactions on satellite surfaces in orbit have not been successfully duplicated in the laboratory. However, measurements by pressure gauges and mass spectrometers in orbit have revealed enough of the basic physical chemistry that realistic theoretical models of the gas-surface interaction can now be used to calculate physical drag coefficients. The dependence of these drag coefficients on conditions in space can be inferred by comparing the physical drag coefficient of a satellite with a drag coefficient fitted to its observed orbital decay. This study takes advantage of recent data on spheres and attitude stabilized satellites to compare physical drag coefficients with the histories of the orbital decay of several satellites during the recent sunspot maximum. The orbital decay was obtained by fitting, in a least squares sense, the semi-major axis decay inferred from the historical two-line elements acquired by the US Space Surveillance Network. All the principal orbital perturbations were included, namely geopotential harmonics up to the 16th degree and order, third body attraction of the Moon and the Sun, direct solar radiation pressure (with eclipses), and aerodynamic drag, using the Jacchia-Bowman 2006 (JB2006) model to describe the atmospheric density. After adjusting for density model bias, a comparison of the fitted drag coefficient with the physical drag coefficient has yielded values for the energy accommodation coefficient as well as for the physical drag coefficient as a function of altitude during solar maximum conditions. The results are consistent with the altitude and solar cycle variation of atomic oxygen, which is known to be adsorbed on satellite surfaces, affecting both the energy accommodation and angular distribution of the reemitted molecules.

  5. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  6. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of)] [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of); Lee, SangYoon, E-mail: sangyoon@ajou.ac.kr [Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon 443-749 (Korea, Republic of)] [Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon 443-749 (Korea, Republic of); Kim, T. Doohun, E-mail: doohunkim@ajou.ac.kr [Department of Molecular Science and Technology, Graduate School of Interdisciplinary Programs, Ajou University, Suwon 443-749 (Korea, Republic of)

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  7. Gamma-ray attenuation coefficients in bismuth borate glasses

    Microsoft Academic Search

    Kulwant Singh; Harvinder Singh; Vishal Sharma; Rohila Nathuram; Atul Khanna; Rajesh Kumar; Surjit Singh Bhatti; Hari Singh Sahota

    2002-01-01

    Mass attenuation coefficients of glasses in the system: xBi2O3(1?x)B2O3 (x=0.30, 0.35, 0.40, 0.45 and 0.55) were determined at 356, 662, 1173 and 1332 keV photon energies using a narrow beam transmission method. Appreciable variations were observed in these coefficients due to changes in the chemical composition of glasses. These coefficients were then used to determine effective atomic numbers of glass

  8. Maxwell boundary condition and velocity dependent accommodation coefficient

    SciTech Connect

    Struchtrup, Henning, E-mail: struchtr@uvic.ca [Department of Mechanical Engineering, University of Victoria, Victoria, British Columbia V8W 2Y2 (Canada)] [Department of Mechanical Engineering, University of Victoria, Victoria, British Columbia V8W 2Y2 (Canada)

    2013-11-15

    A modification of Maxwell's boundary condition for the Boltzmann equation is developed that allows to incorporate velocity dependent accommodation coefficients into the microscopic description. As a first example, it is suggested to consider the wall-particle interaction as a thermally activated process with three parameters. A simplified averaging procedure leads to jump and slip boundary conditions for hydrodynamics. Coefficients for velocity slip, temperature jump, and thermal transpiration flow are identified and compared with those resulting from the original Maxwell model and the Cercignani-Lampis model. An extension of the model leads to temperature dependent slip and jump coefficients.

  9. Kappa coefficient: a popular measure of rater agreement.

    PubMed

    Tang, Wan; Hu, Jun; Zhang, Hui; Wu, Pan; He, Hua

    2015-02-25

    In mental health and psychosocial studies it is often necessary to report on the between-rater agreement of measures used in the study. This paper discusses the concept of agreement, highlighting its fundamental difference from correlation. Several examples demonstrate how to compute the kappa coefficient - a popular statistic for measuring agreement - both by hand and by using statistical software packages such as SAS and SPSS. Real study data are used to illustrate how to use and interpret this coefficient in clinical research and practice. The article concludes with a discussion of the limitations of the coefficient. PMID:25852260

  10. Kappa coefficient: a popular measure of rater agreement

    PubMed Central

    TANG, Wan; HU, Jun; ZHANG, Hui; WU, Pan; HE, Hua

    2015-01-01

    Summary In mental health and psychosocial studies it is often necessary to report on the between-rater agreement of measures used in the study. This paper discusses the concept of agreement, highlighting its fundamental difference from correlation. Several examples demonstrate how to compute the kappa coefficient – a popular statistic for measuring agreement – both by hand and by using statistical software packages such as SAS and SPSS. Real study data are used to illustrate how to use and interpret this coefficient in clinical research and practice. The article concludes with a discussion of the limitations of the coefficient.

  11. Risk assessment of distribution coefficient from 137Cs measurements.

    PubMed

    Külahci, Fatih; Sen, Zekai

    2009-02-01

    Classically distribution coefficient is defined as the ratio of solid total element concentration to surface water total concentration. This coefficient is obtained from the ion measurements in the Keban Dam, Turkey, which supplies water for domestic, irrigation and hydroelectric energy generation purposes. The measurements of 137Cs are carried out in 40 different sites and the general risk formulation and application is achieved for the distribution coefficient. The models are of exponential type and the spatial independence of the data is considered. Various charts are prepared for a set of risk levels as 5%, 10%, 20%, 25%, and 50%. PMID:18274870

  12. Piezoelectric and pyroelectric coefficients for ferroelectric crystals with polarizable molecules

    NASA Technical Reports Server (NTRS)

    Purvis, C. K.; Taylor, P. L.

    1982-01-01

    Expressions for piezoelectric and pyroelectric coefficients for a crystal of polarizable point dipoles are derived. The effect of crystal structure on the local electric field acting to polarize the molecules is included via the Lorentz-factor formalism. The derived expressions for the piezo- and pyroelectric coefficients are found to contain terms dependent on derivatives of the Lorentz factors. These terms reflect the changing of molecular dipole moments in response to the changing local electric field in the strained crystal. Inclusion of this effect results in predictions of coefficients substantially different from those obtained using the Lorentz field approximation.

  13. Fractional crystallization of iron meteorites: Constant versus changing partition coefficients

    NASA Technical Reports Server (NTRS)

    Jones, J. H.

    1994-01-01

    Analyses of magmatic iron meteorites, plotted on LogC(sub i) vs LogC(sub Ni) diagrams, often form linear arrays. Traditionally, this linearity has been ascribed to fractional crystallization under the assumption of constant partition coefficients (i.e., Rayleigh fractionation). Paradoxically, however, partition coefficients in the Fe-Ni-S-P system are decidedly not constant. This contribution provides a rationale for understanding how trends on LogC(sub i) vs LogC(sub Ni) diagrams can be linear, even when partition coefficients are changing rapidly.

  14. Kubo Formulas for Second-Order Hydrodynamic Coefficients

    SciTech Connect

    Moore, Guy D.; Sohrabi, Kiyoumars A. [Department of Physics, McGill University, 3600 rue University, Montreal, Quebec H3A 2T8 (Canada)

    2011-03-25

    At second order in gradients, conformal relativistic hydrodynamics depends on the viscosity {eta} and on five additional ''second-order'' hydrodynamical coefficients {tau}{sub {Pi}}, {kappa}, {lambda}{sub 1}, {lambda}{sub 2}, and {lambda}{sub 3}. We derive Kubo relations for these coefficients, relating them to equilibrium, fully retarded three-point correlation functions of the stress tensor. We show that the coefficient {lambda}{sub 3} can be evaluated directly by Euclidean means and does not in general vanish.

  15. (Non)-renormalization of the chiral vortical effect coefficient

    NASA Astrophysics Data System (ADS)

    Golkar, Siavash; Son, Dam T.

    2015-02-01

    We show using diagramtic arguments that in some (but not all) cases, the temperature dependent part of the chiral vortical effect coefficient is independent of the coupling constant. An interpretation of this result in terms of quantization in the effective 3 dimensional Chern-Simons theory is also given. In the language of 3D, dimensionally reduced theory, the value of the chiral vortical coefficient is related to the formula ?{/n = 1 ?} n = - 1/12 . We also show that in the presence of dynamical gauge fields, the CVE coefficient is not protected from renormalization, even in the large N limit.

  16. Orientation and velocity dependence of the nonequilibrium partition coefficient

    NASA Technical Reports Server (NTRS)

    Beatty, K. M.; Jackson, K. A.

    1995-01-01

    Monte Carlo simulations based on a Spin-1 Ising Model for binary alloys have been used to investigate the non-equilibrium partition coefficient (k(sub neq)) as a function of solid-liquid interface velocity and orientation. In simulations of Si with a second component k(sub neq) is greater in the [111] direction than the [100] direction in agreement with experimental results reported by Azlz et al. The simulated partition coefficient scales with the square of the step velocity divided by the diffusion coefficient of the secondary component in the liquid.

  17. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  18. HIF-1alpha and cancer therapy.

    PubMed

    Koh, Mei Yee; Spivak-Kroizman, Taly R; Powis, Garth

    2010-01-01

    Most solid tumors develop regions of hypoxia as they grow and outstrip their blood supply. In order to survive in the stressful hypoxic environment, tumor cells have developed a coordinated set of responses orchestrating their adaptation to hypoxia. The outcomes of the cellular responses to hypoxia are aggressive disease, resistance to therapy, and decreased patient survival. A critical mediator of the hypoxic response is the transcription factor hypoxia-inducible factor 1 (HIF-1) that upregulates expression of proteins that promote angiogenesis, anaerobic metabolism, and many other survival pathways. Regulation of HIF-1alpha, a component of the HIF-1 heterodimer, occurs at multiple levels including translation, degradation, and transcriptional activation, and serves as a testimony to the central role of HIF-1. Studies demonstrating the importance of HIF-1alpha expression for tumor survival have made HIF-1alpha an attractive target for cancer therapy. The growing l.ist of pharmacological inhibitors of HIF-1 and their varied targets mirrors the complex molecular mechanisms controlling HIF-1. In this chapter, we summarize recent findings regarding the regulation of HIF-1alpha and the progress made in identifying new therapeutic agents that inhibit HIF-1alpha. PMID:20033376

  19. Validity and Cross-Cultural Adaptation of the Persian Version of the Oxford Elbow Score

    PubMed Central

    Ebrahimzadeh, Mohammad H.; Kachooei, Amir Reza; Vahedi, Ehsan; Moradi, Ali; Mashayekhi, Zeinab; Hallaj-Moghaddam, Mohammad; Azami, Mehran; Birjandinejad, Ali

    2014-01-01

    Oxford Elbow Score (OES) is a patient-reported questionnaire used to assess outcomes after elbow surgery. The aim of this study was to validate and adapt the OES into Persian language. After forward-backward translation of the OES into Persian, a total number of 92 patients after elbow surgeries completed the Persian OES along with the Persian DASH and SF-36. To assess test-retest reliability, 31 randomly selected patients (34%) completed the Persian OES again after three days while abstaining from all forms of therapeutic regimens. Reliability of the Persian OES was assessed by measuring intraclass correlation coefficient (ICC) for test-retest reliability and Cronbach's alpha for internal consistency. Spearman's correlation coefficient was used to test the construct validity. Cronbach's alpha coefficient was 0.92 showing excellent reliability. Cronbach's alpha for function, pain, and social-psychological subscales was 0.95, 0.86, and 0.85, respectively. Intraclass correlation coefficient (ICC) was 0.85 for the overall questionnaire and 0.90, 0.76, and 0.75 for function, pain, and social-psychological subscales, respectively. Construct validity was confirmed as the Spearman correlation between OES and DASH was 0.80. Persian OES is a valid and reliable patient-reported outcome measure to assess postsurgical elbow status in Persian speaking population. PMID:25214845

  20. Profiles of alpha-melanocyte-stimulating hormone in the Japanese flounder as revealed by a newly developed time-resolved fluoroimmunoassay and immunohistochemistry.

    PubMed

    Amiya, Noriko; Amano, Masafumi; Takahashi, Akiyoshi; Yamanome, Takeshi; Yamamori, Kunio

    2007-03-01

    Profiles of alpha-melanocyte-stimulating hormone (alpha-MSH) in the Japanese flounder were examined by a newly developed time-resolved fluoroimmunoassay (TR-FIA) and immunohistochemistry. A TR-FIA for alpha-MSH was newly developed, and its levels in the pituitary gland and plasma of Japanese flounder reared in a white or black tank for 5 months were compared. A competitive assay using two antibodies was performed among secondary antibodies in the solid phase, alpha-MSH antibodies, samples, and europium-labeled Des-Ac-alpha-MSH. The sensitivity of the assay, defined as twice the standard deviation at a zero dose, was 0.98 ng/ml (49 pg/well). The intra- and interassay coefficients of variation of the assay were 8.8% (n=8) and 17.3% (n=5), respectively, at about 50% binding. Cross-reactivities of Des-Ac-alpha-MSH and Di-Ac-alpha-MSH were about 100%. Cross-reactivities of adrenocorticotropic hormone, salmon gonadotropin-releasing hormone (sGnRH), and chicken GnRH-II were less than 0.2%, and that of melanin-concentrating hormone was less than 2.0% at 50% binding. Displacement curves of serially twofold-diluted hypothalamus extract, pituitary gland extract, and plasma extract of Japanese flounder with the assay buffer were parallel to the alpha-MSH standard curve. Moreover, displacement curves of serially twofold-diluted hypothalamus and/or pituitary gland extract of masu salmon, goldfish, red seabream, Japanese eel, tiger puffer, and barfin flounder with the assay buffer were also parallel to the alpha-MSH standard. In Japanese flounder, total immunoreactive (ir)-alpha-MSH levels in the pituitary gland were lower in the black tank, whereas those in the plasma tended to be higher in the black tank, suggesting that the synthesis and release of alpha-MSH are higher in the black tank. alpha-MSH-ir cells were detected in the pars intermedia and a small part of the pars distalis of the pituitary gland. alpha-MSH-ir cell bodies were located in the basal hypothalamus and alpha-MSH-ir fibers were distributed not only in the hypothalamus but also in the telencephalon, midbrain, cerebellum, and medulla oblongata, suggesting that alpha-MSH functions as a neuromodulator in the brain. PMID:17286977