These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Cryocrystallography and microspectrophotometry of a mutant (alpha D60N) tryptophan synthase alpha 2 beta 2 complex reveals allosteric roles of alpha Asp60.  

PubMed

We have investigated the role of Asp60 of the alpha-subunit in allosteric communication between the tryptophan synthase alpha- and beta-subunits. Crystallographic and microspectrophotometric studies have been carried out on a mutant (alpha D60N) tryptophan synthase alpha 2 beta 2 complex which has no observable alpha-activity, but has substantial beta-activity. Single-crystal polarized absorption spectra indicate that the external aldimine is the predominant L-serine intermediate and that the amount of the intermediate formed is independent of pH, monovalent cations, and allosteric effectors. The three-dimensional structure is reported for this mutant enzyme complexed with indole 3-propanol phosphate bound to the alpha-site and L-serine bound to the beta-site (alpha D60N-IPP-Ser), and this structure is compared with that of the unliganded mutant enzyme (alpha D60N). In the complex, L-serine forms a stable external aldimine with the pyridoxal phosphate coenzyme at the active site of the beta-subunit. The conformation of the unliganded mutant is almost identical to that of the wild type enzyme. However, the structure of the mutant complexed with IPP and serine exhibits ligand-induced conformational changes much smaller than those observed previously for another mutant enzyme in the presence of the same ligands (beta K87T-IPP-Ser) [Rhee, S., Parris, K. D., Hyde, C. C., Ahmed, S. A., Miles, E. W., and Davies, D. R. (1997) Biochemistry 36, 7664-7680]. The alpha D60N-IPP-Ser alpha 2 beta 2 complex does not undergo the following ligand-induced conformational changes: (1) the closure of the alpha-subunit loop 6 (residues 178-191), (2) the movement of the mobile subdomain (residues 93-189) of the beta-subunit, and (3) the rotation of the alpha-subunit relative to the beta-subunit. These observations show that alpha Asp60 plays important roles in the closure of loop 6 and in allosteric communication between the alpha- and beta-subunits. PMID:9692955

Rhee, S; Miles, E W; Mozzarelli, A; Davies, D R

1998-07-28

2

Operational upgrades to the DIII-D 60 GHz electron cyclotron resonant heating system  

SciTech Connect

One of the primary components of the DIII-D radio frequency (rf) program over the past seven years has been the 60 GHz electron cyclotron resonant heating (ECRH) system. The system now consists of eight units capable of operating and controlling eight Varian VGE-8006 60 GHz, 200 kW gyrotrons along with their associated waveguide components. This paper will discuss the operational upgrades and the overall system performance. Many modifications were instituted to enhance the system operation and performance. Modifications discussed in this paper include an improved gyrotron tube-fault response network, a computer controlled pulse-timing and sequencing system, and an improved high-voltage power supply control interface. The discussion on overall system performance will include operating techniques used to improve system operations and reliability. The techniques discussed apply to system start-up procedures, operating the system in a conditioning mode, and operating the system during DIII-D plasma operations.

Harris, T.E.; Cary, W.P.

1993-10-01

3

research papers 1198 DOI: 10.1107/S0907444904009035 Acta Cryst. (2004). D60, 11981204  

E-print Network

that highly speci®cally hydrolyse the phosphodiester bonds of RNA at the 3H -side of guanosine nucleotides ribonuclease is RNase Sa. The structures of the enzyme and its complexes with guanosine-3H -monophosphate (3H -GMP; Sevcik et al., 1991), guanosine-2H -monophosphate (2H -GMP; Sevcik, Hill et al., 1993

4

CYP2D60 and Clinical Response to Atomoxetine in Children and Adolescents with ADHD  

ERIC Educational Resources Information Center

Background: Atomoxetine, a selective norepinephrine reuptake inhibitor effective in the treatment of attention-deficit/hyperactivity disorder (ADHD), is metabolized through the cytochrome P-450 2D6 (CYP2D6) enzyme pathway, which is genetically polymorphic in humans. Variations in plasma atomoxetine exposures can occur because of genetic variation…

Michelson, David; Read, Holly A.; Ruff, Dustin D.; Witcher, Jennifer; Zhang, Shuyu; McCracken, James

2007-01-01

5

Acta Cryst. (2004). D60, 359361 DOI: 10.1107/S0907444903027720 359 crystallization papers  

E-print Network

(MurE) from Streptococcus pneumoniae 110K/70 Anne M. Blewett,a Adrian J. Lloyd,a,b Aude EchalierE) in the Streptococcus pneumoniae TIGR4 genome sequence, identi®ed as uridine 5H -diphospho-N- acetylmuramoyl in the crystallization of S. pneumoniae MurE 110K/70. #12;360 Blewett

Fülöp, Vilmos

6

Inertia Radial Friction Welding Joint of Large Size H90 Brass\\/D60 Steel Dissimilar Metals  

Microsoft Academic Search

CT-130 Special Inertia Friction Welding Machine is used to weld a large size (156 mm diameter) of brass\\/steel by radial friction welding. Optical microscopy (OM), scanning electron microscopy (SEM), energy dispersive spectrometer (EDS), and Vickers microhardness measurements are used to analyze the welding joint. The results show a refined grain zone near the welding interface at the brass side, which is

Jian Luo; Xiaoming Wang; Dejia Liu; Fei Li; Junfeng Xiang

2012-01-01

7

Inertia Radial Friction Welding Joint of Large Size H90 Brass\\/D60 Steel Dissimilar Metals  

Microsoft Academic Search

CT-130 Special Inertia Friction Welding Machine is used to weld a large size (156 mm diameter) of brass\\/steel by radial friction welding. OM, SEM, EDS and Vickers microhardness measurements are used to analyze the welding joint. The results show a refined grain zone near the welding interface at the brass side, which is closely related to the smaller stacking fault energy

Dejia Liu; Jian Luo; Xiaoming Wang; Fei Li; Junfeng Xiang

2011-01-01

8

Extraction and selective stripping of molybdenum(VI) and vanadium(IV) from sulfuric acid solution containing aluminum(III), cobalt( II), nickel(II) and iron(III) by LIX 63 in Exxsol D80  

Microsoft Academic Search

5,8-diethyl-7-hydroxydodecane-6-oxime (LIX 63), a commercially available reagent, has been used in this work to investigate the extraction of molybdenum(VI) and vanadium(IV) from sulfuric acid solution in the presence of various other metals, such as aluminum(III), cobalt(H), nickel(II) and iron(III). Molybdenum(VI) and vanadium(IV) were extracted preferentially and separated completely from the coexisting metals involved at low pH (e.g., around 1.5) with

Pingwei Zhang; Katsutoshi Inoue; Kazuharu Yoshizuka; Hiromi Tsuyama

1996-01-01

9

3/21/09 10:52 PMAbstract Print View Page 1 of 2http://www.abstractsonline.com/plan/AbstractPrintView.aspx?mID=19...4a13-8241-ddcb3d60e4a8&cKey=d5a58d98-ea6b-48f7-92cf-79a9fa299f1b  

E-print Network

Abstract Program#/Poster#: 319.8 Title: Evidence for smooth and inertial dynamics in the evolution-electrode array to record from populations of neurons in macaque monkeys performing a delayed-reach task. Subjects evolution of FRs, including those that describe single-trial neuronal behavior concisely (see Yu et al

Shenoy, Krishna V.

10

Documents de Travail du Centre d'Economie de la Sorbonne  

E-print Network

of the wage tax. JEL classi...cation: D60 - D62 - E62 - H23 Key words: Environmental tax - Heterogenous agents together with a decrease in the at rate component of the wage tax. JEL classi...cation: D60 - D62 - E62 - H to ...ll the existing gap. The still open question "Can an environmental tax reform be designed without neg

Paris-Sud XI, Université de

11

FOR IMMEDIATE RELEASE: USC Alumni Association to Honor Cappello Capital Corp. Chairman/CEO and USC Alumnus  

E-print Network

Products and Koo Koo Roo, Inc., and is a lifetime member of the Council on Foreign Relations. In addition, and Marine Corps Lt. Gen. Frances C. Wilson EdD '80 will receive Alumni Merit Awards. Dr. David M. Breslow

Zhou, Chongwu

12

Modeling the liquid-phase oxidation of hydrocarbons over a range of temperatures and dissolved oxygen concentrations with pseudo-detailed chemical kinetics  

Microsoft Academic Search

The ability of pseudo-detailed chemical kinetic modeling to simulate the oxidation behavior of Exxsol D-80, a paraffin blend whose oxidative characteristics are representative of severely hydrotreated jet fuels, is assessed. The effects of temperature and initial dissolved O2 concentration on oxidation are considered. A 17-step pseudo-detailed mechanism is shown to provide reasonable simulations of Exxsol D-80 oxidation over a range

Nicholas J. Kuprowicz; Jamie S. Ervin; Steven Zabarnick

2004-01-01

13

Nicholas School of the Environment spring 2012 dukenvironment  

E-print Network

Jeffrey W. Johnson, JWJ Energy LLC, Chapel Hill, NC Sandra Taylor Kaupe, Palm Beach, FL J. Thomas McMurray E'76, G'78, PhD'80, Marine Ventures Foundation, Jackson Hole, WY J. Curtis Moffatt T'73, Van Ness, Winterberry Farm, Canton, NC Fred J. Stanback Jr. T'50, Salisbury, NC Frederick Vosburgh T'72, PhD'78

Dolbow, John

14

Identifying Comparable Entities on the Web Yahoo! Labs  

E-print Network

vs. Canon Rebel XTi" and "Tylenol vs. Advil". Several requests for comparisons, however, are implicit.g., by suggesting the query "Nikon D80 vs. Canon Rebel XTi"). From an advertise- ment perspective, knowing that explicitly allow for a comparative analysis of enti- ties represent a new potential direction to improve

Yang, Junfeng

15

Limits on isotropic Lorentz violation in QED from collider physics Michael A. Hohensee,1  

E-print Network

fields [4], quantum gravity [5], random-dynamics models [6], multiverses [7], brane-world scenarios [8 therefore constrains this type of Lorentz breakdown. Within the context of the standard-model extension with terrestrial and astrophysical methods are discussed. DOI: 10.1103/PhysRevD.80.036010 PACS numbers: 11.30.Cp

Walsworth, Ronald L.

16

Volume 131, Number 12 tech.mit.edu Friday, March 11, 2011 Oldest and Largest  

E-print Network

the Institute PHOTO, p. 8­9 LupE fIASCO IS uNLAbELAbLE As is his new album, Lasers, which straddles, and Dean for Undergraduate Education Daniel E. Hastings PhD '80 as chair -- choos- es the fellows. The Mac

17

www.eprg.group.cam.ac.uk EPRGWORKINGPAPER  

E-print Network

amenities such as conservation of lakes or endangered species, while exploration of information for other to Pay, Zero Inflated Ordered Probit Model JEL Classification C35, D10, D12, D80 Contact ea304@cam list of attributes or technical speci...cations. Lack of information is most apparent in non

Aickelin, Uwe

18

dukenvironmentNicholas School of the Environment SPRING 2011 `academic TRIFECTA'  

E-print Network

ON FISHERIES ECONOMICS NETS MARTY SMITH 3 MAJOR PAPERS IN A YEAR 4 #12;dukenvironment 2 COVER STORY 4 DUKE RESEARCHER ACHIEVES `ACADEMIC TRIFECTA' An Odds-Defying Feat--Novel Research on Fisheries Economics Nets, St. Petersburg, Russia J. Thomas McMurray E'76, G'78, PhD'80, Marine Ventures Foundation, Jackson

Dolbow, John

19

Alumni Scholarship Recipients 1936 -2006 Barbara Ann Hull Harris  

E-print Network

Alumni Scholarship Recipients 1936 - 2006 1 1939 Barbara Ann Hull Harris 1940 Gail Martin* '40.A. '48, Ph.D. '51 1944 Clara Moore Akers '44 Elizabeth Martin Eaton* '44 1946 Barbara Ball Bardrick '46. Stern Berkovitz '47, J.D. '80 Virginia L. Gookins Flagg '47 Jean M. KiM.B.A.ll Hunter* '47 Helen

Williams, Gary A.

20

The CENTRE for EDUCATION in MATHEMATICS and COMPUTING  

E-print Network

graph shows the results of asking 200 students to choose pizza, Thai food, or Greek food. How many students chose Greek food? (A) 20 (B) 40 (C) 60 (D) 80 (E) 100 Greek 50% Pizza 10% Thai 40% Choice of Food. At the Lacsap Hospital, Emily is a doctor and Robert is a nurse. Not including Emily, there are five doctors

Le Roy, Robert J.

21

Effect of Rapid Product Desiccation or Hydration on Thermal Resistance of Salmonella enterica Serovar Enteritidis PT 30 in Wheat Flour.  

PubMed

Salmonella is able to survive in low-moisture environments and is known to be more heat resistant as product water activity (aw) decreases. However, it is unknown how rapidly the resistance changes if product aw is altered rapidly, as can occur in certain processes. Therefore, the objective was to determine the effect of rapid product desiccation or hydration on Salmonella thermal resistance. Two dynamic moisture treatments were compared with two static moisture treatments to determine the effect of time-at-moisture on the thermal resistance of Salmonella enterica serovar Enteritidis phage type 30 (PT 30) in wheat flour. After inoculation, two static moisture groups were equilibrated to 0.3 and 0.6 aw over 4 to 7 days, and two dynamic moisture groups then were rapidly (<4 min) desiccated from 0.6 to 0.3 aw or hydrated from 0.3 to 0.6 aw. Samples then were subjected to isothermal (80°C) heat treatments, and Salmonella thermal resistance was compared via decimal reduction times (i.e., D80°C-values). The D80°C-value in flour that was rapidly desiccated from 0.6 to 0.3 aw was statistically equivalent (P > 0.05) to the D80°C-value in flour previously equilibrated to 0.3 aw, but both were greater (P < 0.05) than the D80°C-value in flour previously equilibrated to 0.6 aw. Similarly, the D80°C-value in flour rapidly hydrated from 0.3 to 0.6 aw was statistically equivalent (P > 0.05) to the D80°C-value in flour previously equilibrated to 0.6 aw, and both were less than the D80°C-value in flour previously equilibrated to 0.3 aw. Therefore, Salmonella in the rapidly desiccated flour (0.3 aw) was as thermally resistant as that which previously had been equilibrated to 0.3 aw, and Salmonella in the rapidly hydrated flour (0.6 aw) responded similarly to that in the flour previously equilibrated to 0.6 aw. These results suggest that the response period to new aw is negligible, which is critically important in applying thermal resistance data or parameters to industrial pasteurization validations. PMID:25710142

Smith, Danielle F; Marks, Bradley P

2015-02-01

22

R&D ERL: Magnetic measurements of the ERL magnets  

SciTech Connect

The magnet system of ERL consists of G5 solenoids, 6Q12 quadrupoles with 0.58 T/m gradient, 3D60 dipoles with 0.4 T central field, 15 and 30 degree Z-bend injection line dipole/quadrupole combined function magnets, and extraction line magnets. More details about the magnets can be found in a report by G. Mahler. Field quality in all the 6Q12 quadrupoles, 3D60 dipoles and the injection line magnets has been measured with either a rotating coil, or a Hall probe mapper. This report presents the results of these magnetic measurements.

Jain, A.

2010-08-01

23

Division of Epidemiology and Biostatistics Mel and Enid Zuckerman College of Public Health  

E-print Network

: > 90% B: > 80% C: > 70% D: > 60% E: 4,5, 4.5% each. HW6, 2, MD, MPH Professor Phone: 626-8025 Email: shahar@email.arizona.edu Office: Drachman Hall, Room 236 Prerequisites: EPI major or minor, MPH major, or consent of instructor. Course Learning Objectives: Understand

Arizona, University of

24

Division of Epidemiology and Biostatistics Mel and Enid Zuckerman College of Public Health  

E-print Network

% B: > 80% C: > 70% D: > 60% E: 4,5, 4.5% each. HW6, 2: Tuesdays, 4:40-7:30 Location: Drachman Hall, A-118 Instructor: Eyal Shahar, MD, MPH Professor Phone: 626 particular interests and career in epi related fields." Course Prerequisites: EPI major or minor, MPH major

Arizona, University of

25

CHEM 106X General Chemistry II, 4 Credits Course Syllabus  

E-print Network

CHEM 106X ­ General Chemistry II, 4 Credits Course Syllabus Summer 2011 INSTRUCTOR: OFFICE HOURS%_ TOTAL 100% The "guaranteed" grading scale is as follows: A, 90% B, 80% C, 70% D, 60%. The guarantee will be executed using a computerized system called OWL: On- line Web-based Learning). OWL will post assignment

Wagner, Diane

26

Applied Plant Sciences 48 Applied Plant Sciences Courses (APSC) 226  

E-print Network

Courses (BMEN) 236 M.S. 60 Ph.D. 60 Biomedical Informatics and Computational Biology (All Science Engineering and Management 61 Bioproducts and Biosystems Engineering Courses (BBE) 237 M Science Engineering and Management Agricultural, Food, and Environmental Education Courses (AFEE) 219

Amin, S. Massoud

27

Pasture-raised Katahdin and Katahdin crossbred lambs: growth and parasite resistance  

Technology Transfer Automated Retrieval System (TEKTRAN)

Katahdin ewes were mated to Dorper, Texel, Suffolk or Katahdin rams (3 rams/breed; 8-10 ewes each) to compare growth performance and parasite resistance of the crossbred lambs. Lamb BW was measured at birth (=d0), and then every 30d to d210 (adjusted). Fecal egg counts (FEC) were determined at d60 ...

28

Expression of Candidate Genes for Horn Growth in Early Bovine Development  

E-print Network

bone at d 60 of gestation........................50 4.11 Brightfield micrographs of the localization of bidirectional transcripts of C21orf66 in cartilage..................................................................................52 4... CCTTTGGCTTTTCTTCTTCC 110 C21orf66_EXON4GGGAATTGGGAGATTTCACTGGCGTTTCTCATCATCATCT108 50 C21orf66_EXON5 TGATGATGACGCTCTGGTAA TATCTGCTCCTGTTCCCATC 6758 C21orf66_EXON6CAATGCCTTATGGTTCATCCGGGAGTTTTGAAAGGGACTG107 C21orf66_EXON7 CAGGGCCATTGAGAGATTAG ACATACCCTCGCATTTCTTG 81...

Vitanza, Sarah M.

2011-02-22

29

Fracture Toughness of Thin Plates by the Double-Torsion Test Method  

NASA Technical Reports Server (NTRS)

Double torsion testing can produce fracture toughness values without crack length measurement that are comparable to those measured via standardized techniques such as the chevron-notch, surface-crack-in-flexure and precracked beam if the appropriate geometry is employed, and the material does not exhibit increasing crack growth resistance. Results to date indicate that 8 < W/d < 80 and L/W > 2 are required if crack length is not considered in stress intensity calculations. At L/W = 2, the normalized crack length should be 0.35 < a/L < 0.65; whereas for L/W = 3, 0.2 < a/L < 0.75 is acceptable. In addition, the load-points need to roll to reduce friction. For an alumina exhibiting increasing crack growth resistance, values corresponding to the plateau of the R-curve were measured. For very thin plates (W/d > 80) nonlinear effects were encountered.

Salem, Jonathan A.; Radovic, Miladin; Lara-Curzio, Edgar; Nelson, George

2006-01-01

30

AKARI/AcuA PHYSICAL STUDIES OF THE CYBELE ASTEROID FAMILY  

SciTech Connect

We present a study of 107 Cybele asteroids based on the archival database 'Asteroid Catalog Using AKARI (AcuA)' taken by the Infrared Astronomical Satellite. The database provides diameters D > 10 km, geometric albedos, and taxonomic information (75%) of the Cybeles. We find taxonomic diversity (mainly C-, D-, and P-type) in the population of 78 small Cybeles with diameters 10 km <D < 80 km. Their cumulative power-law size distribution index shows a shallow value of 0.86 {+-} 0.03. By contrast, 29 large Cybeles with D > 80 km are mostly classified as C- or P-types (90%), with a power-law index of 2.39 {+-} 0.18. The total mass of Cybele asteroids is estimated to be {approx}10{sup -5} M{sub Earth}. We also discuss the origin and formation process of the Cybele asteroid family.

Kasuga, Toshihiro [Public Relations Center, National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan); Usui, Fumihiko; Hasegawa, Sunao [Institute of Space and Astronautical Science, Japan Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan); Kuroda, Daisuke [Okayama Astrophysical Observatory, National Astronomical Observatory of Japan, 3037-5 Honjo, Kamogata, Asakuchi, Okayama 719-0232 (Japan); Ootsubo, Takafumi [Astronomical Institute, Tohoku University, 6-3 Aoba, Aramaki, Aoba-ku, Sendai 980-8578 (Japan); Mueller, Thomas G. [Max-Planck-Institut fuer Extraterrestrische Physik, Giessenbachstrasse, 85748 Garching (Germany); Ishiguro, Masateru, E-mail: toshi.kasuga@nao.ac.jp [Department of Physics and Astronomy, Seoul National University, San 56-1, Shillim-dong Gwanak-gu, Seoul 151-742 (Korea, Republic of)

2012-06-15

31

On the study of vortex-induced vibration of a cylinder with helical strakes  

Microsoft Academic Search

While the effect of helical strakes on suppression of Vortex-Induced Vibrations (VIV) has been studied extensively, the mechanism of VIV mitigation using helical strakes is much less well documented in the literature. In the present study, a rigid circular cylinder of diameter d=80mm attached with three-strand helical strakes of dimensions of 10d in pitch and 0.12d in height was tested

T. Zhou; S. F. Mohd. Razali; Z. Hao; L. Cheng

2011-01-01

32

Reproductive Status of Onchocerca volvulus after Ivermectin Treatment in an Ivermectin-Naïve and a Frequently Treated Population from Cameroon  

PubMed Central

Background For two decades, onchocerciasis control has been based on mass treatment with ivermectin (IVM), repeated annually or six-monthly. This drug kills Onchocerca volvulus microfilariae (mf) present in the skin and the eyes (microfilaricidal effect) and prevents for 3–4 months the release of new mf by adult female worms (embryostatic effect). In some Ghanaian communities, the long-term use of IVM was associated with a more rapid than expected skin repopulation by mf after treatment. Here, we assessed whether the embryostatic effect of IVM on O. volvulus has been altered following frequent treatment in Cameroonian patients. Methodology Onchocercal nodules were surgically removed just before (D0) and 80 days (D80) after a standard dose of IVM in two cohorts with different treatment histories: a group who had received repeated doses of IVM over 13 years, and a control group with no history of large-scale treatments. Excised nodules were digested with collagenase to isolate adult worms. Embryograms were prepared with females for the evaluation of their reproductive capacities. Principal Findings Oocyte production was not affected by IVM. The mean number of intermediate embryos (morulae and coiled mf) decreased similarly in the two groups between D0 and D80. In contrast, an accumulation of stretched mf, either viable or degenerating, was observed at D80. However, it was observed that the increase in number of degenerating mf between D0 and D80 was much lower in the frequently treated group than in the control one (Incidence Rate Ratio: 0.25; 95% CI: 0.10–0.63; p?=?0.003), which may indicate a reduced sequestration of mf in the worms from the frequently treated group. Conclusion/Significance IVM still had an embryostatic effect on O. volvulus, but the effect was reduced in the frequently treated cohort compared with the control population. PMID:24762816

Bopda, Jean; Kengne-Ouafo, Jonas A.; Njiokou, Flobert; Prichard, Roger K.; Wanji, Samuel; Kamgno, Joseph; Boussinesq, Michel

2014-01-01

33

Table 1. Summary of retrap and recovery results for 2003-4 Spp Name Retraps Recovs Max Dist Max Time  

E-print Network

Heron Ardea purpurea 1 0 0 0y 0m 20d 61 Cattle Egret Bubulcus ibis 0 1 0 0y 0m 5d 73 Marabou Stork Leptoptilos crumeniferus 1 0 480 0y 8m 3d 80 White Stork Ciconia ciconia 22 1 9681 3y 7m 27d 81 Sacred Ibis Threskiornis aethiopicus 34 15 30 1y 2m 5d 84 Hadada Ibis Bostrychia hagedash 0 1 0 y m 5d 86 Greater Flamingo

de Villiers, Marienne

34

Quasiconformality and mass  

SciTech Connect

We identify universal quasiconformal (walking) behavior in non-Abelian gauge field theories based on the mass-dependent all-order {beta} function introduced in [D. D. Dietrich, Phys. Rev. D 80, 065032 (2009)]. We find different types of walking behavior in the presence of (partially) massive species. We employ our findings to the construction of candidate theories for dynamical electroweak symmetry breaking by walking technicolor.

Dietrich, Dennis D. [CP3-Origins, Centre for Particle Physics Phenomenology, University of Southern Denmark, Odense (Denmark)

2010-09-15

35

Oxygen and strontium isotopic studies of basaltic lavas from the Snake River plain, Idaho  

USGS Publications Warehouse

The Snake Creek-Williams Canyon pluton of the southern Snake Range crops out over an area of about 30 km2, about 60 km southeast of Ely, Nev. This Jurassic intrusion displays large and systematic chemical and mineralogical zonation over a horizontal distance of 5 km. Major-element variations compare closely with Dalyls average andesite-dacite-rhyolite over an SiO2 range of 63 to 76 percent. For various reasons it was originally thought that assimilation played a dominant role in development of the Snake Creek-Williams Canyon pluton. However, based on modeling of more recently obtained trace element and isotopic data, we have concluded that the zonation is the result of in-situ fractional crystallization, with little assimilation at the level of crystallization. This report summarizes data available for each of the mineral species present in the zoned intrusion. Special attention has been paid to trends We present oxygen and strontium isotopic data for olivine tholeiites, evolved (that is, differentiated and (or) contaminated) lavas, rhyolites, and crustal- derived xenoliths from the Snake River Plain. These data show that the olivine tholeiites are fairly uniform in d80 (5.1 to 6.2) and 87Sr/86Sr (0.7056 to 0.7076) and reveal no correlation between these ratios. The tholeiites are considered representative of mantle-derived magmas that have not interacted significantly with crustal material or meteoric water. The evolved lavas display a wider range in d 80 (5.6 to 7.6) and 87Sr/86Sr (0.708 to 0.717) with positive correlations between these ratios in some suites but not in others. Crustal xenoliths have high and variable 8?Sr/86Sr (0.715 to 0.830) and d80 values that vary widely (6.7 to 9.2) and are a few permil greater than d80 values of the Snake River basalts. Thus, isotopic data for the evolved lavas are permissive of small degrees of contamination by crustal rocks similar to the most d80-depleted xenoliths. The d80 enrichments in some evolved lavas also are consistent with crystal fractionation processes and do not necessarily require bulk interaction with crustal rocks. Enrichment in d80 but not in 87Sr/86Sr in one suite of evolved lavas suggests that crustal contamination may not be essential to the petrogenesis of those lavas. Other suites of evolved lavas display large variations in 87Sr/86Sr that reflect at least some selective contamination with 87St. Bulk solid/liquid oxygen-isotope fractionation factors (a's) calculated for the evolved lavas from Craters of the Moon National Monument are comparatively large. These a's are dependent upon the nature and proportions of phases removed by crystal fractionation; basaltic lava a's differ from latitic lava a?s in accordance with different phenocryst assemblages in these rocks. Snake River Plain rhyolites are isotopically distinct from both the analyzed crustal xenoliths and olivine tholeiites. Their origin remains poorly understood, but crustal or sub-crustal sources may be viable. In the first case, they must be derived by anatexis of material distinct from the analyzed crustal xenoliths. In the second case, they must be derived from material unlike the source for tholeiites. No cogenetic relation with the tholeiites seems likely on the basis of available data. that might relate to the variation in the chemical petrology of the pluton.

Leeman, William P.; Whelan, Joseph F.

1983-01-01

36

DOI: 10.1126/science.1172221 , 753 (2009);325Science  

E-print Network

117, 83 (2004). 7. X. Liu, F. Jiang, S. Kalidas, D. Smith, Q. Liu, RNA 12, 1514 (2006). 8. Y. Tomari, 621 (2005). 18. I. Sugiura et al., Acta Crystallogr. D60, 674 (2004). 19. M. Maiti, H. C. Lee, Y. Liu and Y. Liu, H. Yu, D. Corey, and Z. Paroo for discussion and reading the manuscript. N.V.G. is a Howard

Higgins, Darren

37

Evaporation and condensation heat transfer and pressure drop in horizontal, 12. 7-mm microfin tubes with refrigerant 22  

Microsoft Academic Search

Using R-22 as the working fluid, a series of tests was performed to determine the evaporation and condensation performance of three 12.7-mm o.d. tubes having many small, spiral inner fins. The tubes, referred to as microfin tubes, had a 11.7-mm maximum i.d., 60 or 70 fins with heights ranging from 0.15 to 0.30 mm, and spiral angles from 15 to

L. M. Schlager; M. B. Pate; A. E. Bergles

1990-01-01

38

Effects of omega-3 fatty acid supplementation to gestation and lactation diets on the expression of immune related genes in white blood cells of lactating sows  

Technology Transfer Automated Retrieval System (TEKTRAN)

Forty-nine first parity sows (BW of 197.7 ± 2.5 kg and BF of 14.87 ± 0.21 mm) were used in this study. On d 60 of gestation, pregnant gilts were assigned to one of two dietary treatments which consisted of either a corn-soy meal basal diet (CON) or the basal diet supplemented with 1% Fertilium™ (Uni...

39

Baroreflex impairment during rapid posture changes at rest and exercise after 120 days of bed rest  

Microsoft Academic Search

Orthostatic intolerance is common after space flight and head-down tilt (HDT) bed rest. We hypothesized that HDT-induced impairments\\u000a of arterial blood pressure (AP) control would be more marked during exercise and that recovery of baroreflex function after\\u000a very long-term HDT would be delayed. Six subjects were studied before (BDC) during (day 60, D60; D113) and after (recovery\\u000a day 0, R0;

D. Linnarsson; J. Spaak; P. Sundblad

2006-01-01

40

Effect of season of birth and sex of kid on the production of live weaned single born kids in smallholder East African goat flocks in North East Zimbabwe  

Microsoft Academic Search

An amalgamated flock of traditionally managed Mashona Small East African goats was monitored over a 6 yr period. Kids born in the hot dry season were heavier (P 0.05) on weight increase. There was a steady decline in growth rates from age 15 d (60.2 g\\/d) to weaning age of 180 d (41.7 g\\/d). Overall, 19.4% of the 294 kids

L. R. Ndlovu; L. Simela

1996-01-01

41

High Power Switching Transistor  

NASA Technical Reports Server (NTRS)

Improved switching transistors handle 400-A peak currents and up to 1,200 V. Using large diameter silicon wafers with twice effective area as D60T, form basis for D7 family of power switching transistors. Package includes npn wafer, emitter preform, and base-contact insert. Applications are: 25to 50-kilowatt high-frequency dc/dc inverters, VSCF converters, and motor controllers for electrical vehicles.

Hower, P. L.; Kao, Y. C.; Carnahan, D. C.

1983-01-01

42

High-frequency plant regeneration from seed-derived callus cultures of Kentucky bluegrass ( Poa pratensis L.)  

Microsoft Academic Search

Shoot regeneration from seed-derived callus cultures of Kentucky bluegrass (Poa pratensis L.) was tested on MS basal medium supplemented with four different growth regulators. Regeneration frequencies for medium supplemented with 10 M 2,4-dichlorophenoxyacetic acid (2,4-D), 60 M 4amino-3, 5,6-picolinic acid (picloram), or 30 M 3,6dichloro-o-anisic acid (dicamba) ranged from 0.4 to 4%. Medium supplemented with 30 M dicamba plus 10

Jeffrey D. Griffin; Margaret S. Dibble

1995-01-01

43

Supporting Information Nanofluidic Diodes based on Nanotube Heterojunctions  

E-print Network

, the core-shell nanowires were broke off from the substrate and transferred to a fused silica substrate/or a TEM grid. The substrate with the core-shell nanowires were then loaded into a Xetch® Xenon DifluorideNWs Array d~60nm BHF Etching Dissolve Mask Si - Si/Al2O3 NWs PMMA Mask Si/Al2O3 Core/Shell NWs 30nm Al2O3

Yang, Peidong

44

Attentional, emotional and hormonal data in subjects of different ages  

Microsoft Academic Search

The differences in attentional style among subjects of different ages and the influence of emotionality on the attentional components were studied for a limited experimental period. Variation in the hormonal data and its relation to behavioural parameters were also evaluated. The subjects enrolled in the study were divided into four age groups (A 18–29, B 30–45, C 46–59, D 60–77 years).

Giuliano Fontani; Leda Lodi; Andrea Felici; Fausto Corradeschi; Concetta Lupo

2004-01-01

45

Survival, growth, and thermal resistance of Listeria monocytogenes in products containing peanut and chocolate.  

PubMed

Outbreaks of listeriosis associated with the consumption of ready-to-eat foods have raised interest in determining growth, survival, and inactivation characteristics of Listeria monocytogenes in a wide range of products. A study was undertaken to determine the thermal tolerance of L. monocytogenes in a peanut-based beverage (3.1% fat), whole-fat (3.5%) milk, wholefat (4.0%) and reduced-fat (1.0%) chocolate milk, a chocolate-peanut spread (39% fat), and peanut butter (53% fat). The D60 degrees C value (decimal reduction time at 60 degrees C) in peanut beverage (3.2 min) was not significantly different (P > 0.05) than the D60 degrees C value in whole-fat milk (3.3 min) or whole-fat chocolate milk (4.5 min) but significantly lower (P < or = 0.05) than the D60 degrees C value in reduced-fat chocolate milk (5.9 min). The pathogen was significantly more resistant to heat when enmeshed in chocolate-peanut spread (water activity [aw] of 0.46; D60 degrees C = 37.5 min) and peanut butter (aw of 0.32; D60 degrees C = 26.0 min) than in liquid products. At 10 degrees C, the pathogen grew most rapidly in whole-fat chocolate milk and slowest in peanut beverage. At 22 degrees C, populations increased significantly within 12 and 16 h in whole-fat milk and reduced-fat chocolate milk, respectively, and within 8 h in whole-fat chocolate milk and peanut beverage. Initial populations (3.37 to 4.42 log CFU/g) of L. monocytogenes in chocolate-peanut spread and peanut butter adjusted to an aw of 0.33 and 0.65 declined, but the pathogen was not eliminated during a 24-week period at 20 degrees C. Survival was enhanced at reduced aw. Results indicate that a pasteurization process similar to that used for full-fat milk would be adequate to ensure the destruction of L. monocytogenes in peanut beverage. The pathogen survives for at least 24 weeks in chocolate-peanut spread and peanut butter at an aw range that encompasses that found in these products. PMID:15508631

Kenney, Stephen J; Beuchat, Larry R

2004-10-01

46

Heat resistance of dermatophyte's conidiospores from athletes kits stored in Nigerian University Sport's Center.  

PubMed

The incidence and heat resistance of conidiospores produced by dermatophytes isolated from athlete's kits (canvasses, stockings and spike shoes) stored in Nigerian University Sport's Centre were investigated. Epidermophyton floccosum, Microsporum oudouinii, Microsporum canis, Trichophyton concentricum, Trichophyton mentagrophytes and Trichophyton rubrum were isolated and their incidence on the athlete's kits varied with the species and type of kits. Among the isolates T. mentagrophytes, T. rubrum and E. floccosum with 25%, 23% and 20% prevalence rates respectively, were the most common isolates, and are often associated with tinea pedis (athletes foot). Canvasses with the highest incidence of dermatophytes (25 out of 34 fungal isolates) were the most contaminated kits and could serve as effective articles for the transmission of tinea pedis among athletes in Nigeria. The common etiological agents screened, produced asexual spores (conidiospores) that exhibited high resistance to heat treatment at 80 degrees C. Of the three isolates, E. floccosum, with a decimal reduction time (D-value) of D80 = 4.4 min was the most resistant followed by T. mentagrophytes with D80 = 4.0 min and then T. rubrum with D80 = 3.2 min. The spores elimination pattern indicates that increasing the heating duration would decrease the decimal reduction time and possibly denature the fungal propagules but may damage the skin during treatment with hot water compresses. The findings have shown that the use of hot water compresses is palliative but heat treatment especially vapour-heat treatment offers adequate preventive measures if applied for periodic treatment of contaminated kits. However, determining the correct condition for effective decontamination will require detailed understanding of the heat resistance of fungal spores. Otherwise treatment of kits with detergent and chaotropic agent such as urea and guanidinium salt is preferred to heat treatment. PMID:19388558

Essien, J P; Jonah, I; Umoh, A A; Eduok, S I; Akpan, E J; Umoiyoho, A

2009-03-01

47

Simultaneous and successive inoculations of yeasts and lactic acid bacteria on the fermentation of an unsulfited Tannat grape must  

PubMed Central

Interactions between yeasts and lactic acid bacteria are strain specific, and their outcome is expected to change in simultaneous alcoholic - malolactic fermentations from the pattern observed in successive fermentations. One Oenococcus oeni strain Lalvin VP41™ was inoculated with two Saccharomyces cerevisiae strains either simultaneously, three days after the yeast inoculation, or when alcoholic fermentation was close to finish. Early bacterial inoculations with each yeast strain allowed for the growth of the bacterial populations, and the length of malolactic fermentation was reduced to six days. Alcoholic fermentation by Lalvin ICV D80® yeast strain left the highest residual sugar, suggesting a negative effect of the bacterial growth and malolactic activity on its performance. In sequential inoculations the bacterial populations did not show actual growth with either yeast strain. In this strategy, both yeast strains finished the alcoholic fermentations, and malolactic fermentations took longer to finish. Lalvin ICV D80® allowed for higher viability and activity of the bacterial strain than Fermicru UY4® under the three inoculation strategies. This was beneficial for the sequential completion of both fermentations, but negatively affected the completion of alcoholic fermentation by Lalvin ICV D80® in the early bacteria additions. Conversely, Fermicru UY4®, which was rather inhibitory towards the bacteria, favored the timely completion of both fermentations simultaneously. As bacteria in early inoculations with low or no SO2 addition can be expected to multiply and interact with fermenting yeasts, not only are the yeast-bacterium strains combination and time point of the inoculation to be considered, but also the amount of bacteria inoculated. PMID:24948914

Muñoz, Viviana; Beccaria, Bruno; Abreo, Eduardo

2014-01-01

48

Linking the hydrodynamic and kinetic description of a dissipative relativistic conformal theory  

SciTech Connect

We use the entropy production variational method to associate a one-particle distribution function to the assumed known energy-momentum and entropy currents describing a relativistic conformal fluid. Assuming a simple form for the collision operator we find this one-particle distribution function explicitly, and show that this method of linking the hydro and kinetic descriptions is a nontrivial generalization of Grad's ansatz. The resulting constitutive relations are the same as in the conformal dissipative type theories discussed by J. Peralta-Ramos and E. Calzetta [Phys. Rev. D 80, 126002 (2009)]. Our results may prove useful in the description of freeze-out in ultrarelativistic heavy-ion collisions.

Calzetta, E.; Peralta-Ramos, J. [CONICET and Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires-Ciudad Universitaria, Pabellon I, 1428 Buenos Aires (Argentina); Instituto de Fisica Teorica, Universidade Estadual Paulista, Rua Doutor Bento Teobaldo Ferraz 271 - Bloco II, 01140-070 Sao Paulo (Brazil)

2010-11-15

49

Power-counting renormalizability of generalized Horava gravity  

E-print Network

In an earlier article [arXiv:0902.0590 [hep-th], Phys. Rev D80 (2009) 025011], I discussed the potential benefits of allowing Lorentz symmetry breaking in quantum field theories. In particular I discussed the perturbative power-counting finiteness of the normal-ordered :P(phi)^{z>=d}_{d+1}: scalar quantum field theories, and sketched the implications for Horava's model of quantum gravity. In the current rather brief addendum, I will tidy up some dangling issues and fill out some of the technical details of the argument indicating the power-counting renormalizability of a z>=d variant of Horava gravity in (d+1) dimensions.

Matt Visser

2009-12-24

50

Orbital Period of the Dwarf Nova RXS J053234.9+624755  

E-print Network

We report spectroscopy of the newly discovered SU Ursae Majoris dwarf nova identified with the x-ray source RXS J053234.9+624755. Radial velocities of the H-alpha emission line in the quiescent state give an orbital period of 0.05620(4) d (80.93 min), which is among the shortest for SU UMa stars with determined periods. We also report UBVI magnitudes of the quiescent dwarf nova and surrounding stars. Using a previous measurement of the superhump period, we find the fractional superhump excess epsilon to be 0.016(4), which is not atypical of dwarf novae in this period range.

Ann B. Kapusta; John R. Thorstensen

2006-07-05

51

3650:291-001 Exam 8 SD 05/12/05 1. What is the molar specific heat at constant pressure CP of a monoatomic ideal gas?  

E-print Network

) (b) (c) (d) V P a b c d V P c d b aa d b c V P a d b c V P (a) (b) (c) (d) 3 #12;17. A steam engine that of its environment envsyst SSS += must be: (a) (b) (c)0S (d) 0S 2 #12;13. An automobile engine of operation. How much heat is discharged from this engine per second? (a) 20 kJ (b) 40 kJ (c) 60 kJ (d) 80 k

Dordevic, Sasha V.

52

High Voltage TAL Erosion Characterization  

NASA Technical Reports Server (NTRS)

Extended operation of a D-80 anode layer thruster at high voltage was investigated. The thruster was operated for 1200 hours at 700 Volts and 4 Amperes. Laser profilometry was employed to quantify the erosion of the thruster's graphite guard rings and electrodes at 0, 300, 600, 900, and 1200 hours. Thruster performance and electrical characteristics were monitored over the duration of the investigation. The guard rings exhibited asymmetric erosion that was greatest in the region of the cathode. Erosion of the guard rings exposed the magnet poles between 600 to 900 hours of operation.

Jacobson, David T.

2003-01-01

53

Manufacture of Passive Dynamic ankle-foot orthoses using selective laser sintering.  

PubMed

Ankle-foot orthosis (AFO) designs vary in size, shape, and functional characteristics depending on the desired clinical application. Passive Dynamic (PD) Response ankle-foot orthoses (PD-AFOs) constitute a design that seeks to improve walking ability for persons with various neuromuscular disorders by passively (like a spring) providing variable levels of support during the stance phase of gait. Current PD-AFO manufacturing technology is either labor intensive or not well suited for the detailed refinement of PD-AFO bending stiffness characteristics. The primary objective of this study was to explore the feasibility of using a rapid freeform prototyping technique, selective laser sintering (SLS), as a PD-AFO manufacturing process. Feasibility was determined by replicating the shape and functional characteristics of a carbon fiber AFO (CF-AFO). The study showed that a SLS-based framework is ideally suited for this application. A second objective was to determine the optimal SLS material for PD-AFOs to store and release elastic energy; considering minimizing energy dissipation through internal friction is a desired material characteristic. This study compared the mechanical damping of the CF-AFO to PD-AFOs manufactured by SLS using three different materials. Mechanical damping evaluation ranked the materials as Rilsan D80 (best), followed by DuraForm PA and DuraForm GF. In addition, Rilsan D80 was the only SLS material able to withstand large deformations. PMID:18270017

Faustini, Mario C; Neptune, Richard R; Crawford, Richard H; Stanhope, Steven J

2008-02-01

54

Note on the scale evolution of the Efremov-Teryaev-Qiu-Sterman function TF(x,x)  

NASA Astrophysics Data System (ADS)

We reexamine the scale dependence of the Efremov-Teryaev-Qiu-Sterman twist-3 matrix element that has been studied already by the four different groups with conflicting results [Z.-B. Kang and J.-W. Qiu, Phys. Rev. DPRVDAQ1550-7998 79, 016003 (2009)10.1103/PhysRevD.79.016003; J. Zhou, F. Yuan, and Z.-T. Liang, Phys. Rev. DPRVDAQ1550-7998 79, 114022 (2009)10.1103/PhysRevD.79.114022; W. Vogelsang and F. Yuan, Phys. Rev. DPRVDAQ1550-7998 79, 094010 (2009)10.1103/PhysRevD.79.094010; and V. M. Braun, A. N. Manashov, and B. Pirnay, Phys. Rev. DPRVDAQ1550-7998 80, 114002 (2009)10.1103/PhysRevD.80.114002]. We find that we can in fact reproduce the results of V. M. Braun, A. N. Manashov, and B. Pirnay, Phys. Rev. DPRVDAQ1550-7998 80, 114002 (2009)10.1103/PhysRevD.80.114002 with the methods of J. Zhou, F. Yuan, and Z.-T. Liang, Phys. Rev. DPRVDAQ1550-7998 79, 114022 (2009)10.1103/PhysRevD.79.114022 when we treat some subtleties with greater care, thus easing the mentioned conflict.

Schäfer, Andreas; Zhou, Jian

2012-06-01

55

A practical approach to dynamic load-sharing in a LAN environment  

E-print Network

N 0 e U 2O 10 30 00 es Ia the IIUI of process gauss) of processor Iu the UU gueue I 10 2D 30 ID Sd 64 70 I 10 20 leal (I load (I 10 60 7D 60 DIU9ctlgt Slut gasps loads Ihra prose lsagtb (neat( seslsls? IDII Ssdcrrpt Slut prolree Lo...-Server (Loopback) (laitializatiaa request) Name-Server (a) Name-Server Node 2 (c) Fig. 4. Formation of the logical ring network: two nodes. 30 Name-Server frat ializatioa request) (a) Name-Server Node 3 Node 2 (b) Fig. 5. Formation of the logical...

Gudur, Jaganmohan

1993-01-01

56

Structural sequences are conserved in the genes coding for the alpha, alpha' and beta-subunits of the soybean 7S seed storage protein.  

PubMed

Cloned DNAs encoding four different proteins have been isolated from recombinant cDNA libraries constructed with Glycine max seed mRNAs. Two cloned DNAs code for the alpha and alpha'-subunits of the 7S seed storage protein (conglycinin). The other cloned cDNAs code for proteins which are synthesized in vitro as 68,000 d., 60,000 d. or 53,000 d. polypeptides. Hybrid selection experiments indicate that, under low stringency hybridization conditions, all four cDNAs hybridize with mRNAs for the alpha and alpha'-subunits and the 68,000 d., 60,000 d. and 53,000 d. in vitro translation products. Within three of the mRNA, there is a conserved sequence of 155 nucleotides which is responsible for this hybridization. The conserved nucleotides in the alpha and alpha'-subunit cDNAs and the 68,000 d. polypeptide cDNAs span both coding and noncoding sequences. The differences in the coding nucleotides outside the conserved region are extensive. This suggests that selective pressure to maintain the 155 conserved nucleotides has been influenced by the structure of the seed mRNA. RNA blot hybridizations demonstrate that mRNA encoding the other major subunit (beta) of the 7S seed storage protein also shares sequence homology with the conserved 155 nucleotide sequence of the alpha and alpha'-subunit mRNAs, but not with other coding sequences. PMID:6897678

Schuler, M A; Ladin, B F; Pollaco, J C; Freyer, G; Beachy, R N

1982-12-20

57

In vivo multiphoton imaging of human skin: assessment of topical corticosteroid-induced epidermis atrophy and depigmentation  

NASA Astrophysics Data System (ADS)

Multiphoton microscopy has emerged in the past decade as a promising tool for noninvasive skin imaging. Our aim was to evaluate the potential of multiphoton microscopy to detect topical corticosteroids side effects within the epidermis and to provide new insights into their dynamics. Healthy volunteers were topically treated with clobetasol propionate on a small region of their forearms under overnight occlusion for three weeks. The treated region of each patient was investigated at D0, D7, D15, D22 (end of the treatment), and D60. Our study shows that multiphoton microscopy allows for the detection of corticoid-induced epidermis modifications: thinning of stratum corneum compactum and epidermis, decrease of keratinocytes size, and changes in their morphology from D7 to D22. We also show that multiphoton microscopy enables in vivo three-dimensional (3-D) quantitative assessment of melanin content. We observe that melanin density decreases during treatment and almost completely disappears at D22. Moreover, these alterations are reversible as they are no longer present at D60. Our study demonstrates that multiphoton microscopy is a convenient and powerful tool for noninvasive 3-D dynamical studies of skin integrity and pigmentation.

Ait El Madani, Hassan; Tancrède-Bohin, Emmanuelle; Bensussan, Armand; Colonna, Anne; Dupuy, Alain; Bagot, Martine; Pena, Ana-Maria

2012-02-01

58

Relative Match Intensities at High Altitude in Highly-Trained Young Soccer Players (ISA3600)  

PubMed Central

To compare relative match intensities of sea-level versus high-altitude native soccer players during a 2-week camp at 3600 m, data from 7 sea-level (Australian U17 National team, AUS) and 6 high-altitude (a Bolivian U18 team, BOL) native soccer players were analysed. Two matches were played at sea-level and three at 3600 m on Days 1, 6 and 13. The Yo-Yo Intermittent recovery test (vYo-YoIR1) was performed at sea-level, and on Days 3 and 10. Match activity profiles were measured via 10-Hz GPS. Distance covered >14.4 km.h-1 (D>14.4 km·h-1) and >80% of vYo-YoIR1 (D>80%vYo-YoIR1) were examined. Upon arrival at altitude, there was a greater decrement in vYo-YoIR1 (Cohen’s d +1.0, 90%CL ± 0.8) and D>14.4 km·h-1 (+0.5 ± 0.8) in AUS. D>14.4 km.h-1 was similarly reduced relative to vYo-YoIR1 in both groups, so that D>80%vYo-YoIR1 remained similarly unchanged (-0.1 ± 0.8). Throughout the altitude sojourn, vYo-YoIR1 and D>14.4 km·h-1 increased in parallel in AUS, so that D>80%vYo-YoIR1 remained stable in AUS (+6.0%/match, 90%CL ± 6.7); conversely D>80%vYo-YoIR1 decreased largely in BOL (-12.2%/match ± 6.2). In sea-level natives competing at high-altitude, changes in match running performance likely follow those in high-intensity running performance. Bolivian data confirm that increases in ‘fitness’ do not necessarily translate into greater match running performance, but rather in reduced relative exercise intensity. Key points When playing at high-altitude, players may alter their activities during matches in relation to their transient maximal physical capacities, possibly to maintain a ‘tolerable’ relative exercise intensity. While there is no doubt that running performance per se in not the main determinant of match outcomes (Carling, 2013), fitness levels influence relative match intensity (Buchheit et al., 2012, Mendez-Villanueva et al., 2013), which in-turn may impact on decision making and skill performance (Rampinini et al., 2008). In the context of high-altitude competitions, it is therefore recommended to arrive early enough (i.e., ~2 weeks) to allow (at least partial) acclimatisation, and in turn, allow sea-level native players to regulate their running activities in relation to both actual game demands and relative match intensity. PMID:25729296

Buchheit, Martin; Hammond, Kristal; Bourdon, Pitre C.; Simpson, Ben M.; Garvican-Lewis, Laura A.; Schmidt, Walter F.; Gore, Christopher J.; Aughey, Robert J.

2015-01-01

59

CONDENSED MATTER: ELECTRONIC STRUCTURE, ELECTRICAL, MAGNETIC, AND OPTICAL PROPERTIES: Microstructure and Magnetic Domains of Iron Films on Liquid Surfaces  

NASA Astrophysics Data System (ADS)

Iron (Fe) films with a thickness ranging from 1.0 nm to 80.0 nm are deposited on silicone oil surfaces by a vapor phase deposition method. The films with a thickness of d < 2.0 nm do not exhibit planar morphology but ramified aggregates instead. Magnetic force microscopy studies for the Fe films (10.0 nm <= d <= 80.0 nm) show that the domain wall structure is widespread and irregularly shaped and the oscillation phase shift ??, which records as the magnetic force image, changes from 0.29° to 0.81°. Correspondingly, the magnetic force gradient varies from 1.4 × 10-3 to 4.0 × 10-3 N/m, respectively. In our measurement, the characteristic domain walls, such as Bloch walls, Néel walls and cross-tie walls, are not observed in the film system clearly.

Xie, Jian-Ping; Xia, A.-Gen; Zhang, Chu-Hang; Yang, Bo; Fang, Zheng-Nong; Ye, Gao-Xiang

2009-11-01

60

A Near Horizon CFT Dual for Kerr-Newman-$AdS$  

E-print Network

We show that the near horizon regime of a Kerr-Newman-$AdS$ (KN$AdS$) black hole, given by its two dimensional analogue $a la$ Robinson and Wilczek (2005 Phys. Rev. Lett. 95 011303), is asymptotically $AdS_2$ and dual to a one dimensional quantum conformal field theory (CFT). The s-wave contribution of the resulting CFT's energy-momentum-tensor together with the asymptotic symmetries, generate a centrally extended Virasoro algebra, whose central charge reproduces the Bekenstein-Hawking entropy via Cardy's Formula. Our derived central charge also agrees with the near extremal Kerr/CFT Correspondence (2009 Phys. Rev. D 80, 124008) in the appropriate limits. We also compute the Hawking temperature of the KN$AdS$ black hole by coupling its Robinson and Wilczek two dimensional analogue (RW2DA) to conformal matter.

Bradly K. Button; Leo Rodriguez; Catherine A. Whiting; Tuna Yildirim

2011-05-28

61

Transverse single spin asymmetry in hadronic ?c,b production  

NASA Astrophysics Data System (ADS)

We study the transverse single spin asymmetry in ?c,b production in polarized hadron collisions, employing the collinear twist-3 approach in combination with the color singlet model. Our main focus lies on the contribution from the twist-3 Efremov-Teryaev-Qiu-Sterman function. By extrapolating the derived spin-dependent cross section to the small transverse momentum region, consistency between the collinear twist-3 approach and the transverse-momentum-dependent factorization approach is confirmed. As a byproduct of this work, we identify a term contributing to the scale evolution of trigluon correlations in the flavor-singlet case which was originally missed, see also V. M. Braun, A. N. Manashov, and B. Pirnay [Phys. Rev. D 80, 114002 (2009); PRVDAQ1550-799886, 119902(E) (2012)].

Schäfer, Andreas; Zhou, Jian

2013-07-01

62

Water, hydrogen, deuterium, carbon, carbon-13, and oxygen-18 content of selected lunar material  

USGS Publications Warehouse

The water content of the breccia is 150 to 455 ppm, with a ??D from -580 to -870 per mil. Hydrogen gas content is 40 to 53 ppm with a ??D of -830 to -970 per mil. The CO2 is 290 to 418 ppm with S 13C = + 2.3 to + 5.1 per mil and ??18O = 14.2 to 19.1 per mil. Non-CO2 carbon is 22 to 100 ppm, ??18C = -6.4 to -23.2 per mil. Lunar dust is 810 ppm H2O (D = 80 ppm) and 188 ppm total carbon (??13C = -17.6 per mil). The 18O analyses of whole rocks range from 5.8 to 6.2 per mil. The temperature of crystallization of type B rocks is 1100?? to 1300??C, based on the oxygen isotope fractionation between coexisting plagioclase and ilmenite.

Friedman, I.; O'Neil, J.R.; Adami, L.H.; Gleason, J.D.; Hardcastle, K.

1970-01-01

63

Relative Match Intensities at High Altitude in Highly-Trained Young Soccer Players (ISA3600).  

PubMed

To compare relative match intensities of sea-level versus high-altitude native soccer players during a 2-week camp at 3600 m, data from 7 sea-level (Australian U17 National team, AUS) and 6 high-altitude (a Bolivian U18 team, BOL) native soccer players were analysed. Two matches were played at sea-level and three at 3600 m on Days 1, 6 and 13. The Yo-Yo Intermittent recovery test (vYo-YoIR1) was performed at sea-level, and on Days 3 and 10. Match activity profiles were measured via 10-Hz GPS. Distance covered >14.4 km.h(-1) (D>14.4 km·h(-1)) and >80% of vYo-YoIR1 (D>80%vYo-YoIR1) were examined. Upon arrival at altitude, there was a greater decrement in vYo-YoIR1 (Cohen's d +1.0, 90%CL ± 0.8) and D>14.4 km·h(-1) (+0.5 ± 0.8) in AUS. D>14.4 km.h(-1) was similarly reduced relative to vYo-YoIR1 in both groups, so that D>80%vYo-YoIR1 remained similarly unchanged (-0.1 ± 0.8). Throughout the altitude sojourn, vYo-YoIR1 and D>14.4 km·h(-1) increased in parallel in AUS, so that D>80%vYo-YoIR1 remained stable in AUS (+6.0%/match, 90%CL ± 6.7); conversely D>80%vYo-YoIR1 decreased largely in BOL (-12.2%/match ± 6.2). In sea-level natives competing at high-altitude, changes in match running performance likely follow those in high-intensity running performance. Bolivian data confirm that increases in 'fitness' do not necessarily translate into greater match running performance, but rather in reduced relative exercise intensity. Key pointsWhen playing at high-altitude, players may alter their activities during matches in relation to their transient maximal physical capacities, possibly to maintain a 'tolerable' relative exercise intensity.While there is no doubt that running performance per se in not the main determinant of match outcomes (Carling, 2013), fitness levels influence relative match intensity (Buchheit et al., 2012, Mendez-Villanueva et al., 2013), which in-turn may impact on decision making and skill performance (Rampinini et al., 2008).In the context of high-altitude competitions, it is therefore recommended to arrive early enough (i.e., ~2 weeks) to allow (at least partial) acclimatisation, and in turn, allow sea-level native players to regulate their running activities in relation to both actual game demands and relative match intensity. PMID:25729296

Buchheit, Martin; Hammond, Kristal; Bourdon, Pitre C; Simpson, Ben M; Garvican-Lewis, Laura A; Schmidt, Walter F; Gore, Christopher J; Aughey, Robert J

2015-03-01

64

Parity-odd and CPT-even electrodynamics of the standard model extension at finite temperature  

NASA Astrophysics Data System (ADS)

This work examines the finite temperature properties of the CPT-even and parity-odd electrodynamics of the standard model extension. The starting point is the partition function computed for an arbitrary and sufficiently small tensor (kF)???? [see R. Casana, M. M. Ferreira, Jr., J. S. Rodrigues, and M. R. O. Silva, Phys. Rev. DPRVDAQ1550-7998 80, 085026 (2009).10.1103/PhysRevD.80.085026]. After specializing the Lorentz-violating tensor (kF)???? for the leading-order-nonbirefringent and parity-odd coefficients, the partition function is explicitly carried out, showing that it is a power of the Maxwell partition function. Also, it is observed that the Lorentz invariance violation coefficients induce an anisotropy in the black-body angular energy density distribution. Planck’s radiation law retains its usual frequency dependence and the Stefan-Boltzmann law keeps the same form, except for a global proportionality constant.

Casana, Rodolfo; Ferreira, Manoel M., Jr.; Silva, Madson R. O.

2010-05-01

65

Parity-odd and CPT-even electrodynamics of the standard model extension at finite temperature  

SciTech Connect

This work examines the finite temperature properties of the CPT-even and parity-odd electrodynamics of the standard model extension. The starting point is the partition function computed for an arbitrary and sufficiently small tensor (k{sub F}){sub {alpha}{nu}{rho}{phi}} [see R. Casana, M. M. Ferreira, Jr., J. S. Rodrigues, and M. R. O. Silva, Phys. Rev. D 80, 085026 (2009).]. After specializing the Lorentz-violating tensor (k{sub F}){sub {alpha}{nu}{rho}{phi}}for the leading-order-nonbirefringent and parity-odd coefficients, the partition function is explicitly carried out, showing that it is a power of the Maxwell partition function. Also, it is observed that the Lorentz invariance violation coefficients induce an anisotropy in the black-body angular energy density distribution. Planck's radiation law retains its usual frequency dependence and the Stefan-Boltzmann law keeps the same form, except for a global proportionality constant.

Casana, Rodolfo; Ferreira, Manoel M. Jr.; Silva, Madson R. O. [Departamento de Fisica, Universidade Federal do Maranhao (UFMA), Campus Universitario do Bacanga, Sao Luis-MA, 65085-580 (Brazil)

2010-05-15

66

Protonation state of E71 in KcsA and its role for channel collapse and inactivation.  

PubMed

The prototypical prokaryotic potassium channel KcsA alters its pore depending on the ambient potassium; at high potassium, it exists in a conductive form, and at low potassium, it collapses into a nonconductive structure with reduced ion occupancy. We present solid-state NMR studies of KcsA in which we test the hypothesis that an important channel-inactivation process, known as C-type inactivation, proceeds via a state similar to this collapsed state. We test this using an inactivation-resistant mutant E71A, and show that E71A is unable to collapse its pore at both low potassium and low pH, suggesting that the collapsed state is structurally similar to the inactivated state. We also show that E71A has a disordered selectivity filter. Using site-specific K(+) titrations, we detect a local change at E71 that is coupled to channel collapse at low K(+). To gain more insight into this change, we site specifically measure the chemical shift tensors of the side-chain carboxyls of E71 and its hydrogen bond partner D80, and use the tensors to assign protonation states to E71 and D80 at high K(+) and neutral pH. Our measurements show that E71 is protonated at pH 7.5 and must have an unusually perturbed pK(a) (> 7.5) suggesting that the change at E71 is a structural rearrangement rather than a protonation event. The results offer new mechanistic insights into why the widely used mutant KcsA-E71A does not inactivate and establish the ambient K(+) level as a means to populate the inactivated state of KcsA in a controlled way. PMID:22942391

Bhate, Manasi P; McDermott, Ann E

2012-09-18

67

Staphylococcal enterotoxin type A internal deletion mutants: serological activity and induction of T-cell proliferation.  

PubMed Central

Previous findings indicate that the N-terminal region of staphylococcal enterotoxin type A (SEA) is required for its ability to induce T-cell proliferation. To better localize internal peptides of SEA that are important for induction of murine T-cell proliferation, SEA mutants that had internal deletions in their N-terminal third were constructed. A series of unique restriction enzyme sites were first engineered into sea; only one of these changes resulted in an amino acid substitution (the aspartic acid residue at position 60 of mature SEA was changed to a glycine [D60G]). Because the D60G substitution had no discernible effect on serological or biological activity, the sea allele encoding this mutant SEA was used to construct a panel of mutant SEAs lacking residues 3 to 17, 19 to 23, 24 to 28, 29 to 49, 50 to 55, 56 to 59, 61 to 73, 68 to 74, or 74 to 85. Recombinant plasmids with the desired mutations were constructed in Escherichia coli and transferred to Staphylococcus aureus. Staphylococcal culture supernatants containing the mutant SEAs were examined. Western immunoblot analysis with polyclonal anti-SEA antiserum revealed that each of the recombinant S. aureus strains produced a mutant SEA of the predicted size. All the mutant SEAs exhibited increased sensitivity to monkey stomach lavage fluid in vitro, which is consistent with these mutants having conformations unlike that of wild-type SEA or the SEA D60G mutant. In general, deletion of internal peptides had a deleterious effect on the ability to induce T-cell proliferation; only SEA mutants lacking either residues 3 to 17 or 56 to 59 consistently produced a statistically significant increase in the incorporation of [3H]thymidine. In the course of this work, two monoclonal antibodies that had different requirements for binding to SEA in Western blots were identified. The epitope for one monoclonal antibody was contained within residues 108 to 230 of mature SEA. Binding of the other monoclonal antibody to SEA appeared to be dependent on the conformation of SEA. Images PMID:8478095

Harris, T O; Hufnagle, W O; Betley, M J

1993-01-01

68

The production of craters on the mid-sized Saturnian satellites by Centaur objects  

NASA Astrophysics Data System (ADS)

Context. The Saturnian satellite system has been observed in detail by the Cassini-Huygens mission. These satellites present different surface features, including impact craters caused by small objects probably coming from the trans-Neptunian region. Aims: In this paper we calculate the production of craters on the mid-sized Saturnian satellites produced by Centaurs from the scattered disk (SD) and plutinos in order to determine this contribution, and we compare our estimations with the Cassini observations. Methods: We used a method developed in a previous paper that uses a numerical investigation of the dynamical evolution of Centaur objects to calculate the production of craters. We used a size-frequency distribution (SFD) of scattered disk objects (SDOs) as a power law with a break at diameters d = 60 km considering two cases for the differential power-law index: s2 = 2.5 and s2 = 3.5 for d < 60 km. Results: We calculated the number of craters, the greatest crater produced by Centaurs from the SD and plutinos, and the present cratering rate on each of the mid-sized satellites, for both cases of the SFD of SDOs considered. The contribution of plutinos is negligible compared to SDOs. From our calculations and the comparison with observations we note that the calculated number of craters for s2 = 3.5 is in general nearer the observed number. However, in general for smaller craters, the observed number is less than the calculated one. This trend can be explained by at least two mechanisms. On the one hand, this could be caused by an erasing process that gradually buries the craters, which does not affect large craters. On the other hand, the comparison of the calculated and observed crater size-frequency distribution for different size ranges implies that for d < 60 km, the SFD of SDOs is consistent with the assumed index s2 = 3.5, for d ? 0.2-1.4 km and for d ? 0.2-1.4 km, it is consistent with s2 = 2.5. Then in the range d ~ 0.2-1.4 km, the SFD of SDOs could have a new break. This change of slope could explain the reduction of small craters, at least for some cases. Conclusions: We found a good agreement when comparing our results with observations. However, independent determination of surface ages and geological processes are needed to determine if there is a new break on the SFD of SDOs, if there is a planetocentric source of craters in the Saturnian system, and which craters are primordial.

Di Sisto, R. P.; Zanardi, M.

2013-05-01

69

The {sup 3}He({rvec d},p){sup 4 Breve;}He reaction at low energies  

SciTech Connect

Angular distributions of cross sections and complete sets of analyzing powers for the {sup 3}He({rvec d},p){sup 4}He reaction have been measured at five energies between E{sub d}=60 and 641 keV. The energy dependence of the cross section was also measured from 245 to 685 keV, and the absolute cross section was determined at E{sub d}=426thinspkeV. The data have been included in an {ital R}-matrix analysis of the {sup 5}Li system. The bare-nuclear cross section derived from the {ital R}-matrix parametrization was used to determine the electron screening potential. {copyright} {ital 1999} {ital The American Physical Society}

Geist, W.H.; Brune, C.R.; Karwowski, H.J.; Ludwig, E.J.; Veal, K.D. [Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3255 (United States)] [Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3255 (United States); [Triangle Universities Nuclear Laboratory, Durham, North Carolina 27708-0308 (United States); Hale, G.M. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)] [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

1999-11-01

70

The [sup 3]He([rvec d],p)[sup 4 Breve; ]He reaction at low energies  

SciTech Connect

Angular distributions of cross sections and complete sets of analyzing powers for the [sup 3]He([rvec d],p)[sup 4]He reaction have been measured at five energies between E[sub d]=60 and 641 keV. The energy dependence of the cross section was also measured from 245 to 685 keV, and the absolute cross section was determined at E[sub d]=426thinspkeV. The data have been included in an [ital R]-matrix analysis of the [sup 5]Li system. The bare-nuclear cross section derived from the [ital R]-matrix parametrization was used to determine the electron screening potential. [copyright] [ital 1999] [ital The American Physical Society

Geist, W.H.; Brune, C.R.; Karwowski, H.J.; Ludwig, E.J.; Veal, K.D. (Department of Physics and Astronomy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-3255 (United States) Triangle Universities Nuclear Laboratory, Durham, North Carolina 27708-0308 (United States)); Hale, G.M. (Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States))

1999-11-01

71

A new apparatus for modelling excavations  

E-print Network

a uniform layer with a relative density above 95% and a dry unit weight of 16?0 kN/m3. The properties of the sand are shown in Table 3. The sand was saturated with water by connecting the bottom drainage hole to a standpipe. Since the objective... kaolin Properties Value Minimum void ratio 0?613 Maximum void ratio 1?014 Minimum dry unit weight 12?9 kN/m3 Maximum dry unit weight 16?1 kN/m3 Specific gravity of solids 2?65 D10 124 mm D50 218 mm D60 360 mm Table 3. Properties of fraction E sand...

Lam, Sze Yue; Elshafie, Mohammed Z. E. B.; Haigh, Stuart K.; Bolton, Malcolm D.

2012-03-01

72

Searching for seismo-ionospheric earthquakes precursors: Total Electron Content disturbances before 2005-2006 seismic events  

E-print Network

During earthquakes preparation periods significant disturbances in the ionospheric plasma density are often observed. These anomalies are caused by lithosphere-atmosphere-ionosphere interaction, particularly by the seismic electric field penetrating from the ground surface into the ionosphere. The seismic electric field produces electromagnetic EB drift changing plasma density over the epicenter region and magnetically conjugated area. The paper is devoted to analysis of regular Global Positioning System observations and revelation of seismo-ionospheric precursors of earthquakes in Total Electron Content (TEC) of the ionosphere. Global and regional relative TEC disturbances maps (%) have been plotted for 2005-2006 M6, D<60 km seismic events and analyzed in order to determine general features of precursors. The obtained results agree with the recent published case-study investigations.

Romanovskaya, Yu V; Zolotov, O V; Starikova, N A; Lopatiy, V Z

2012-01-01

73

Measurement of the top quark mass in the dilepton channel  

E-print Network

,21 L. Magan˜a-Mendoza,11 V. Manankov,14 S. Mani,18 H. S. Mao,23 R. Markeloff,25 T. Marshall,27 M. I. Martin,23 K. M. Mauritz,30 B. May,26 A. A. Mayorov,15 R. McCarthy,42 J. McDonald,21 T. McKibben,24 J. McKinley,37 T. McMahon,44 H. L. Melanson,23 M... and fiducial cuts used in se ton events. Objects ee em 2 Leptons pT l .20 GeV .15 GeV uh l u ,2.5 ,1.7 >2 Jets pT j .20 GeV .20 GeV uh j u ,2.5 ,2.5 Event p? T — .10 GeV p? Tcal .25 GeV .20 GeV HT .120 GeV .120 GeV1-5 B. ABBOTT et al. PHYSICAL REVIEW D 60...

Baringer, Philip S.; Abbott, B.; Abolins, M.; Abramov, V.; Acharya, B. S.; Adam, I.; Adams, D. L.; Adams, M.; Ahn, S.; Aihara, H.

1999-07-14

74

On the foundations of vision modeling. I. Weber’s law and Weberized TV restoration  

NASA Astrophysics Data System (ADS)

Most conventional image processors consider little the influence of human vision psychology. Weber’s law in psychology and psychophysics claims that humans’ perception and response to the intensity fluctuation ?u of visual signals are weighted by the background stimulus u, instead of being plainly uniform. This paper attempts to integrate this well known perceptual law into the classical total variation (TV) image restoration model of Rudin et al. [Physica D 60 (1992) 259]. We study the issues of existence and uniqueness for the proposed Weberized nonlinear TV restoration model, making use of the direct method in the space of functions with bounded variations. We also propose an iterative algorithm based on the linearization technique for the associated nonlinear Euler-Lagrange equation.

Shen, Jianhong

2003-02-01

75

[Effect of actinomycin D and sibiromycin on the embryonic and larval development of Nereis virens (Sars.)].  

PubMed

The morphogenetic function of nuclear apparatus has been studied by means of "chemical enucleation" using actinomycin D (60 microgram/ml, 3 hrs) and sibiromycin (10--100 microgram/ml, 3 hrs) at different developmental stages of Nereis virens (Sars.). The embryos were subjected to the effect of the inhibitors at the successive stages every 6 hrs beginning from the fertilization. The development proceeded in the normal way til the throchophore stage in spite of the inhibition of DNA-dependent RNA synthesis what agrees with the concept of P. P. Ivanov on the existence in Polychaeta of a developmental tendency to trochophore. The first period of morphogenetic activity of the genome which ensures the transition from trochophore to metatrochophore coincides with the gastrula stage and the second period which ensures the transformation of metatrochophore into nectochaete with the final phases of the trochophore stage. PMID:1053271

Dondua, A K

1975-01-01

76

Radiation effects on power transistor performance  

NASA Technical Reports Server (NTRS)

The D60T, D62T, and D75T transistors in the nuclear reactor were irradiated with bias voltage and high current I sub c vs. V sub ec curves were obtained to evaluate gain degradation at high power levels. Pre- and post-irradiation high current switching tests were performed to evaluate the response. The gamma ray damage work done at Sandia was correlated with the neutron work done at the O.S.U. reactor with the above specified transistors. Theoretical analyses of damage and electrical performance were conducted in terms of semiconductor physics. The experimental high current pulser was improved in order to measure switching time changes which are less than one microsecond at currents of 100 to 200 amperes for in-situ testing.

Frasca, Albert J.

1987-01-01

77

CCD Observations of ERS with the 60 cm Telescope at ASV  

NASA Astrophysics Data System (ADS)

We present the observations of extragalactic radio sources (ERS) which are possible in the optical domain and can be used to establish the link between the ICRF2 and the future Gaia Celestial Reference Frame (GCRF). Our telescope of small aperture size (< 1 m) is located in the south of Serbia, near the town of Prokuplje, at the Astronomical Station Vidojevica (ASV) which belongs to the Astronomical Observatory of Belgrade (AOB). It is a Cassegrain-type optical system (D=60 cm, F=600 cm) of equatorial mount. About 40 ERS, from ICRF2 list, were observed at ASV during 2011 and 2012. These observations are of importance to compare the ERS optical and radio positions (VLBI ones), and to investigate the relation between optical and radio reference frames. Also, they are useful to check the possibilities of the instrument. We observed ERS with the CCD Apogeee Alta U42. The observations, reduction and preliminary results of some ERS are presented here.

Damljanovic, G.; Milic, I. S.

2013-05-01

78

Heat resistance of Listeria monocytogenes.  

PubMed

Two methods were used to study the thermal resistance of Listeria monocytogenes. The D60 degrees C values ranged from 1.3 to 6.5 s in a open vessel. D72 degrees C varied from 0.06 to 1.5 s and z from 3.1 to 6.5 K (38 strains) in capillary tubes. Therefore a conventional pasteurization process of 15 s at 72 degrees C could assure 10 to 250 decimal reductions, depending on the strain. Six days enrichment at 4 degrees C in milk prior to incubation at 37 degrees C did not show any influence on measured heat resistance (4 strains). A significant difference of thermal resistance among strains according to their serotype was noted: strains belonging to serogroup 1 were more heat resistant than those belonging to serogroup 4. PMID:2517174

Lemaire, V; Cerf, O; Audurier, A

1989-01-01

79

Thermal resistance of Listeria monocytogenes.  

PubMed

Two methods were used to study the thermal resistance of Listeria monocytogenes. The D60 degrees C values ranged from 1.3-6.5 min in an open vessel. D72 degrees C varied from 0.06-1.5 s and z from 3.1-6.5 K (38 strains) in capillary tubes. Therefore a conventional pasteurization process of 15 s at 72 degrees C could assure 10-750 decimal reductions, depending on the strain. Six days enrichment, at 4 degrees C in milk prior to incubation at 37 degrees C, did not show any influence on measured heat resistance (4 strains). A significant difference in thermal resistance among strains according to their serotype was noted: strains belonging to serogroup 1 were more heat resistant than those belonging to serogroup 4. PMID:2515785

Lemaire, V; Cerf, O; Audurier, A

1989-01-01

80

Effects of oral intake of cetirizine HCl and desloratadine molecules on the middle ear mucosa: an experimental animal study.  

PubMed

We have planned to demonstrate histopathologic effects of mid- or long-term oral use of desloratadine and cetirizine HCl molecules on middle ear mucosa of rats. Thirty-six rats were randomized equally into six groups. Desloratadine groups received once daily doses of 1 mg/ml desloratadine for 30 (D30 Group) or 60 (D60 Group) days. The Cetirizine study groups were given once daily doses of 1 mg/ml cetirizine for 30 (S30 Group) or 60 (S60 Group) days. Control groups were given 2 cc physiologic saline using orogastric gavage method through a 12 G gavage catheter for 30 (K30 Group) or 60 (K60) days. At the end of 30 days, D30, S30 and K30 Groups were sacrificed. Tissue samples harvested from groups were evaluated between 1 and 4 Grades for histological characteristics of middle ear canal, eardrum, middle ear epithelium and connective tissue, edema, vascular congestion and inflammatory cells. In the control group no pathological finding was encountered in rats sacrificed on 30 and 60 days. No statistical difference was observed when groups were compared on external ear epithelial tissue, external ear sebaceous gland, middle ear inflammation, and middle ear capillary dilatation both on 30 and 60 days. Tympanic membrane collagen was more evident in D30 and D60 groups when compared with C30 and C60 groups. Comparison of histopathological grading results between 30 and 60 days revealed no significant changes. In conclusion, oral intake of cetirizine and desloratadine preparations has effects of tympanic membrane collagen, degrees of edema and vascular congestion being more prominent with desloratadine molecule. PMID:24526000

Songu, Murat; Ozkul, Yilmaz; Kirtay, Seyithan; Arslanoglu, Secil; Ozkut, Mahmut; Inan, Sevinc; Onal, Kazim

2014-04-01

81

Effect of vitamin e and zinc supplementation on energy metabolites, lipid peroxidation, and milk production in peripartum sahiwal cows.  

PubMed

The study was conducted to evaluate the effect of vitamin E and zinc supplementation on energy metabolites, lipid peroxidation, and milk production in peripartum Sahiwal cows. For this, thirty-two pregnant dry Sahiwal cows were selected at sixty days prepartum and divided into four groups viz control, T1, T2, and T3 of eight each. Group T1 were supplemented with zinc at 60 ppm/d/cow, group T2 were supplemented with vitamin E at 1,000 IU/d/cow and group T3 were supplemented with combination of vitamin E at 1,000 IU/d/cow and zinc at 60 ppm/d/cow during d 60 prepartum to d 90 postpartum. Blood samples were collected on d -60, -45, -30, -15, -7, -3, 0, 3, 7, 15, 30, 45, 60, 90, and 120 with respect to day of parturition and analysed for glucose, non esterified fatty acid, and thiobarbituric acid reactive substance. Body condition score was maintained significantly better (p<0.05) in T3 than in the control, T1 and T2 groups. Overall glucose level was higher (p<0.05) in T3 than control, T1, and T2 groups. Levels of nonesterified fatty acid, and thiobarbituric acid reactive substance were lower (p<0.05) in T3 than control, T1, and T2 groups. Milk yield was higher (p<0.05) in T3 than control, T1, and T2 groups. In conclusion, the present study indicated that the supplementation of vitamin E and zinc in peripartum Sahiwal cows enhanced milk production by reducing negative energy balance. PMID:25049743

Chandra, G; Aggarwal, A; Singh, A K; Kumar, M; Upadhyay, R C

2013-11-01

82

Effect of Vitamin E and Zinc Supplementation on Energy Metabolites, Lipid Peroxidation, and Milk Production in Peripartum Sahiwal Cows  

PubMed Central

The study was conducted to evaluate the effect of vitamin E and zinc supplementation on energy metabolites, lipid peroxidation, and milk production in peripartum Sahiwal cows. For this, thirty-two pregnant dry Sahiwal cows were selected at sixty days prepartum and divided into four groups viz control, T1, T2, and T3 of eight each. Group T1 were supplemented with zinc at 60 ppm/d/cow, group T2 were supplemented with vitamin E at 1,000 IU/d/cow and group T3 were supplemented with combination of vitamin E at 1,000 IU/d/cow and zinc at 60 ppm/d/cow during d 60 prepartum to d 90 postpartum. Blood samples were collected on d ?60, ?45, ?30, ?15, ?7, ?3, 0, 3, 7, 15, 30, 45, 60, 90, and 120 with respect to day of parturition and analysed for glucose, non esterified fatty acid, and thiobarbituric acid reactive substance. Body condition score was maintained significantly better (p<0.05) in T3 than in the control, T1 and T2 groups. Overall glucose level was higher (p<0.05) in T3 than control, T1, and T2 groups. Levels of nonesterified fatty acid, and thiobarbituric acid reactive substance were lower (p<0.05) in T3 than control, T1, and T2 groups. Milk yield was higher (p<0.05) in T3 than control, T1, and T2 groups. In conclusion, the present study indicated that the supplementation of vitamin E and zinc in peripartum Sahiwal cows enhanced milk production by reducing negative energy balance. PMID:25049743

Chandra, G.; Aggarwal, A.; Singh, A. K.; Kumar, M.; Upadhyay, R. C.

2013-01-01

83

Engineering Development of Advanced Physical Fine Coal Cleaning for Premium Fuel Applications: Task 9 - Selective agglomeration Module Testing and Evaluation.  

SciTech Connect

The primary goal of this project was the engineering development of two advanced physical fine coal cleaning processes, column flotation and selective agglomeration, for premium fuel applications. The project scope included laboratory research and bench-scale testing of both processes on six coals to optimize the processes, followed by the design, construction, and operation of a 2 t/hr process development unit (PDU). The project began in October, 1992, and is scheduled for completion by September 1997. This report summarizes the findings of all the selective agglomeration (SA) test work performed with emphasis on the results of the PDU SA Module testing. Two light hydrocarbons, heptane and pentane, were tested as agglomerants in the laboratory research program which investigated two reactor design concepts: a conventional two-stage agglomeration circuit and a unitized reactor that combined the high- and low-shear operations in one vessel. The results were used to design and build a 25 lb/hr bench-scale unit with two-stage agglomeration. The unit also included a steam stripping and condensation circuit for recovery and recycle of heptane. It was tested on six coals to determine the optimum grind and other process conditions that resulted in the recovery of about 99% of the energy while producing low ash (1-2 lb/MBtu) products. The fineness of the grind was the most important variable with the D80 (80% passing size) varying in the 12 to 68 micron range. All the clean coals could be formulated into coal-water-slurry-fuels with acceptable properties. The bench-scale results were used for the conceptual and detailed design of the PDU SA Module which was integrated with the existing grinding and dewatering circuits. The PDU was operated for about 9 months. During the first three months, the shakedown testing was performed to fine tune the operation and control of various equipment. This was followed by parametric testing, optimization/confirmatory testing, and finally a 72-hour round the clock production run for each of the three project coals (Hiawatha, Taggart, and Indiana VII). The parametric testing results confirmed that the Taggart coal ground to a D80 of 30 microns could be cleaned to 1 lb ash/MBtu, whereas the Hiawatha and Indiana Vil coals had to be ground to D80s of 40 and 20 microns, respectively, to be cleaned to 2 lb ash/MBtu. The percent solids, residence time, shear intensity (impeller tip speed and energy input per unit volume), and heptane dosage were the main variables that affected successful operation (phase inversion or microagglomerate formation in the high-shear reactor and their growth to 2-3 mm in size during low shear). Downward inclination of the vibrating screen and adequate spray water helped produce the low ash products. Btu recoveries were consistently greater than 98%. Two-stage steam stripping achieved about 99% heptane recovery for recycle to the process. Residual hydrocarbon concentrations were in the 3000 to 5000 ppm range on a dry solids basis.

Moro, N.` Jha, M.C.

1997-09-29

84

Pre- and post-partum mild underfeeding influences gene expression in the reproductive tract of cyclic dairy cows.  

PubMed

Undernutrition before and after calving has a detrimental effect on the fertility of dairy cows. The effect of nutritional stress was previously reported to influence gene expression in key tissues for metabolic health and reproduction such as the liver and the genital tract early after calving, but not at breeding, that is, between 70 and 90 days post-partum. This study investigated the effects of pre- and post-partum mild underfeeding on global gene expression in the oviduct, endometrium and corpus luteum of eight multiparous Holstein cows during the early and middle phases of an induced cycle 80 days post-partum. Four control cows received 100% of energy and protein requirements during the dry period and after calving, while four underfed received 80% of control diet. Oestrous synchronization treatment was used to induce ovulation on D80 post-partum. Oviducts, ovaries and the anterior part of each uterine horn were recovered surgically 4, 8, 12 and 15 days after ovulation. Corpora lutea were dissected from the ovaries, and the endometrium was separated from the stroma and myometrium in each uterine horn. The oviduct segments were comprised of ampulla and isthmus. RNAs from ipsi- and contralateral samples were pooled on an equal weight basis. In each tissue, gene expression was assessed on a custom bovine 10K array. No differentially expressed gene (DEG) in the corpus luteum was identified between underfed and control, conversely to 293 DEGs in the oviduct vs 1 in the endometrium under a false discovery rate (FDR) < 0.10 and 1370 DEGs vs 3, respectively, under FDR < 0.15. Additionally, we used dedicated statistics (regularized canonical correlation analysis) to correlate the post-partum patterns of six plasma metabolites and hormones related to energy metabolism measured weekly between calving and D80 with gene expression. High correlations were observed between post-partum patterns of IGF-1, insulin, ?-hydroxybutyrate and the expression in the oviduct of genes related to reproductive system disease, connective tissue disorders and metabolic disease. Moreover, we found special interest in the literature to retinoic acid-related genes (e.g. FABP5/CRABP2) that might indicate abnormalities in post-partum tissue repair mechanisms. In conclusion, this experiment highlights relationships between underfeeding and gene expression in the oviduct and endometrium after ovulation in cyclic Holstein cows. This might help to explain the effect of mild undernutrition on fertilization failure and early embryonic mortality in post-partum dairy cows. PMID:23131127

Valour, D; Hue, I; Degrelle, S A; Déjean, S; Marot, G; Dubois, O; Germain, G; Humblot, P; Ponter, A A; Charpigny, G; Grimard, B

2013-06-01

85

Biochemical characterization of the soluble alkaline phosphatase isolated from the venomous snake W. aegyptia.  

PubMed

A soluble form of alkaline phosphatase (ALP) has been identified and purified from Walterinnesia aegyptia venom using an HPLC system Gold 126/1667 equipped with Protein PAK 125 and Protein PAK 60 columns. The enzyme was purified 3.4 fold over crude venom with a yield of 37.3%. On SDS-PAGE under non-reduced conditions the purified enzyme showed three bands of 212 kD, 80 kD, and 55 kD. However, under reducing conditions, the enzyme showed two bands of 80 kD and 55 kD. The specific activity of ALP was 24 U/mg with p-nitrophenylephosphate as the substrate. During isoelectric focusing experiments the ALP exhibited two bands focused at pH 6.2 and 6.8, which suggests that either the enzyme exists as two different isoforms or the two bands in IEF may be two subunits of 80 kD and 55 kD. The kinetic parameters (Km and Vmax) and IC50 of ALP inhibition by L-phenylalanine, L-leucine, imidazole, caffeine, orthophosphate and permanganate were also investigated in the present study. Zinc and cyanide ions at a concentration of 15 mM and 10 mM, respectively, completely inhibited the activity of W. aegyptia ALP. PMID:12503880

Al-Saleh, Saad S M

2002-12-01

86

Effect of Thermal Shock on Grindability of Oleic Adsorbed Flotation Placer Sillimanite  

NASA Astrophysics Data System (ADS)

Thermal shock is one of the most effective techniques in size reduction. The present investigation deals with the effect of thermal shock treatment on grindability and grinding characteristics of sillimanite minerals and also an attempt has been made on the overall energy saving for preparation of sillimanite flour by using ball mill. This attempt is made due to a fine dry grinding of sillimanite minerals to produce sillimanite flour, which is an energy intensive operation. It is observed from the present investigation that the particle sizes at d50 and d80 passing size in microns for thermally treated sillimanite is slightly lower than that of natural sillimanite. The study of grinding kinetics using ball mill indicate that the slope value obtained for thermally treated sillimanite is lower than the natural sillimanite, which shows that the sample responded to higher rate of grinding. The result of grindability studies reveal that the power required for thermal treatment of sillimanite is 395.36 hp and the total energy saving in the order of 8.9 % is achieved by thermal treatment of sillimanite at 900 °C for period of half an hour heating time due to development of numerous micro-cracks and fractures within the mineral grains. Hence, it is recommended to use thermally treated sillimanite for preparation of sillimanite flour (<75 µm particle size) which reduces power consumption of 8.9 %.

Laxmi, T.; Bhima Rao, R.

2015-04-01

87

Electric vehicle dynamic-stress-test cycling performance of lithium-ion cells  

SciTech Connect

Dynamic Stress tests (DST) of. small lithium-ion cells have demonstrated that the systems delivers high energy (65 Wh/kg, 4.3 hours runtime) with reasonable cycle-life (375--480 cycles) under the full USABC mid-term dynamic-stress-test conditions (150 W/kg). At lower DoD substantially higher cycle life was observed (2800 cycles at 44% DoD, 1.9 hours runtime). Both the DoD and charging voltage V{sub c} (4.1V < V{sub c} < 4.2 V) affect the delivered energy and cell life in an interacting manner. At high DoD (>80%), a lower V{sub c} is prefered because it maximize cycle life with a small penalty in energy. At intermediate DoD (40--80%) a higher V{sub c} is preferred. Long-term tests are needed to determine the DST cycle life at very low DoD (<40%). The high power pulse of the DST test limits the delivered cell energy and life. If a high energy density load leveling, technology is developed (e.g. flywheels or double layer capacitors) the delivered energy and cycle life could be substantially increased.

Mayer, S.T.

1994-05-01

88

CAPTURE OF TROJANS BY JUMPING JUPITER  

SciTech Connect

Jupiter Trojans are thought to be survivors of a much larger population of planetesimals that existed in the planetary region when planets formed. They can provide important constraints on the mass and properties of the planetesimal disk, and its dispersal during planet migration. Here, we tested a possibility that the Trojans were captured during the early dynamical instability among the outer planets (aka the Nice model), when the semimajor axis of Jupiter was changing as a result of scattering encounters with an ice giant. The capture occurs in this model when Jupiter's orbit and its Lagrange points become radially displaced in a scattering event and fall into a region populated by planetesimals (that previously evolved from their natal transplanetary disk to {approx}5 AU during the instability). Our numerical simulations of the new capture model, hereafter jump capture, satisfactorily reproduce the orbital distribution of the Trojans and their total mass. The jump capture is potentially capable of explaining the observed asymmetry in the number of leading and trailing Trojans. We find that the capture probability is (6-8) Multiplication-Sign 10{sup -7} for each particle in the original transplanetary disk, implying that the disk contained (3-4) Multiplication-Sign 10{sup 7} planetesimals with absolute magnitude H < 9 (corresponding to diameter D = 80 km for a 7% albedo). The disk mass inferred from this work, M{sub disk} {approx} 14-28 M{sub Earth}, is consistent with the mass deduced from recent dynamical simulations of the planetary instability.

Nesvorny, David [Department of Space Studies, Southwest Research Institute, 1050 Walnut St., Suite 300, Boulder, CO 80302 (United States); Vokrouhlicky, David [Institute of Astronomy, Charles University, V Holesovickach 2, 180 00 Prague 8 (Czech Republic); Morbidelli, Alessandro [Departement Cassiopee, University of Nice, CNRS, Observatoire de la Cote d'Azur, Nice, F-06304 (France)

2013-05-01

89

Emissions from a generator fueled by blends of diesel, biodiesel, acetone, and isopropyl alcohol: analyses of emitted PM, particulate carbon, and PAHs.  

PubMed

Biodiesel is one of alternative energies that have been extensively discussed and studied. This research investigates the characteristics of particulate matter (PM), particulate carbon, and polycyclic aromatic hydrocarbons (PAHs) emitted from a generator fueled by waste-edible-oil-biodiesel with acetone and isopropyl alcohol (IPA) addition. The tested biodieselhols consisted of pure diesel oil (D100) with 1-3 vol.% pure acetone (denoted as A), 1-70 vol.% waste-edible-oil-biodiesel (denoted as W), and 1 vol.% pure isopropyl alcohol (the stabilizer, denoted as P). The results show that in comparison to W1D99, W3D97, W5D95, W10D90, and W20D80, the use of biodieselhols achieved additional reduction of PM and particulate organic carbon (OC) emission, and such reduction increased as the addition percentage of pure acetone increased. Regardless of the percentages of added waste-edible-oil-biodiesel, acetone, and isopropyl alcohol, the use of biodieselhol in place of D100 could reduce the emissions of Total-PAHs (by 6.13-42.5% (average = 24.1%)) and Total-BaPeq (by 16.6-74.8% (average = 53.2%)) from the diesel engine generator. Accordingly, the W/D blended fuels (W<20 vol.%) containing acetone (1-3 vol.%) and isopropyl alcohol (1 vol.%) are a potential alternative fuel for diesel engine generators because they substantially reduce emissions of PM, particulate OC, Total-PAHs, and Total-BaPeq. PMID:23911918

Tsai, Jen-Hsiung; Chen, Shui-Jen; Huang, Kuo-Lin; Lin, Wen-Yinn; Lee, Wen-Jhy; Lin, Chih-Chung; Hsieh, Lien-Te; Chiu, Juei-Yu; Kuo, Wen-Chien

2014-01-01

90

Hyper Suprime-Cam: camera design  

NASA Astrophysics Data System (ADS)

Hyper Suprime-Cam (HSC) is the next generation wide-field imager for the prime focus of Subaru Telescope, which is scheduled to receive its first light in 2011. Combined with a newly built wide-field corrector, HSC covers 1.5 degree diameter field of view with 116 fully-depleted CCDs. In this presentation, we summarize the details of the camera design: the wide-field corrector, the prime focus unit, the CCD dewar and the peripheral devices. The wide-field corrector consists of 5 lenses with lateral shift type doublet ADC element. The novel design guarantees the excellent image quality (D80 <0".3) over the field of view. On the focal plane, 116 CCDs are tiled on the cold plate which is made of Silicon Carbide (SiC) and cooled down to -100 degrees by two pulse tube coolers. The system is supported by the prime focus unit which provides a precise motion of the system to align the wide-field corrector and the CCD dewar to the optical axis of the telescope.

Komiyama, Yutaka; Aihara, Hiroaki; Fujimori, Hiroki; Furusawa, Hisano; Kamata, Yukiko; Karoji, Hiroshi; Kawanomoto, Satoshi; Mineo, Sogo; Miyatake, Hironao; Miyazaki, Satoshi; Morokuma, Tomoki; Nakaya, Hidehiko; Nariai, Kyoji; Obuchi, Yoshiyuki; Okura, Yuki; Tanaka, Yoko; Uchida, Tomohisa; Uraguchi, Fumihiro; Utsumi, Yosuke; Endo, Makoto; Ezaki, Yutaka; Matsuda, Toru; Miwa, Yoshinori; Yokota, Hideo; Wang, Shiang-Yu; Liaw, Eric J.; Chen, Hsin-Yo; Chiu, Chyi-Fong; Jeng, Dun-Zen

2010-07-01

91

Physiological and morphological characteristics of the rhythmic contractions of the amnion in veiled chameleon (Chamaeleo calyptratus) embryogenesis.  

PubMed

A morpho-functional study of the veiled chameleon (Chamaeleo calyptratus) amnion was performed as part of a general comparative study of amnion rhythmic contractions (ARC) in reptile and bird embryogenesis. Eggs incubated at 27.5 degrees C were used at different developmental stages from day 80 (D80) to D184 for the recording of ARC using a force transducer. Slow ARC, about 1 min in duration, were revealed from D88 (stage 31) to the near-hatching stages (incubation time was 183-198 days). The frequency and amplitude of slow ARC increased significantly towards the end of incubation. This ARC enhancement correlated with the differentiation of smooth muscle elements in the amniotic membrane from single spindle-shaped cells to complex "star-like" structures and with the development of the actin fibers, revealed by phalloidin, in the amniotic muscle layer. Short-term changes in temperature influenced ARC and heart rate (HR). Cooling to 25 degrees C from the control (27.5 degrees C) resulted in a significant decrease in both ARC frequency and HR. Heating to 30 degrees C significantly increased the embryonic HR, but not ARC frequency. Within the temperature range from 25 to 30 degrees C the temperature effect on ARC frequency and HR was reversible. PMID:15664309

Nechaeva, Marina V; Makarenko, Irina G; Tsitrin, Evgenii B; Zhdanova, Nadezhda P

2005-01-01

92

Transmission Of Fast Highly Charged Ions Through A Single Glass Macrocapillary  

SciTech Connect

The transmission of 3 MeV protons and 16 MeV O{sup 5+} ions through a single cylindrically-shaped insulating macrocapillary glass has been investigated in a preliminary study. The capillary had a diameter d = 0.18 mm and length l 14.4 mm, giving an aspect ratio l/d = 80. The sample was mounted on a goniometer to permit precise positioning with respect to the incident beam direction. Results show that 3 MeV protons transmit through the capillary without energy loss at small tilt angles (near zero), and the 16 MeV O{sup 5+} ions show transmission through the sample also with little energy loss at the same small tilt angles and little change in their charge state ({approx}1%). For a larger tilt angle (= 1.5 deg.), appreciable losses in energy occurred for incident O{sup 5+} and the ions changed their charge state up to 7{sup +}.

Ayyad, A.; Dassanayake, B. S.; Kayani, A.; Tanis, J. A. [Department of Physics, Western Michigan University, Kalamazoo, MI 49008 (United States)

2011-06-01

93

Non-Gaussianity in the cosmic microwave background induced by dipolar dark matter  

SciTech Connect

In previous work [L. Blanchet and A. Le Tiec, Phys. Rev. D 80 (2009) 023524], motivated by the phenomenology of dark matter at galactic scales, a model of dipolar dark matter (DDM) was introduced. At linear order in cosmological perturbations, the dynamics of the DDM was shown to be identical to that of standard cold dark matter (CDM). In this paper, the DDM model is investigated at second order in cosmological perturbation theory. We find that the internal energy of the DDM fluid modifies the curvature perturbation generated by CDM with a term quadratic in the dipole field. This correction induces a new type of non-Gaussianity in the bispectrum of the curvature perturbation with respect to standard CDM. Leaving unspecified the primordial amplitude of the dipole field, which could in principle be determined by a more fundamental description of DDM, we find that, in contrast with usual models of primordial non-Gaussianities, the non-Gaussianity induced by DDM increases with time after the radiation-matter equality on super-Hubble scales. This distinctive feature of the DDM model, as compared with standard CDM, could thus provide a specific signature in the CMB and large-scale structure probes of non-Gaussianity.

Blanchet, Luc; Marsat, Sylvain [GRECO, Institut d'Astrophysique de Paris — UMR 7095 du CNRS, Université Pierre and Marie Curie, 98 bis boulevard Arago, 75014 Paris (France); Langlois, David [Astroparticle and Cosmologie (CNRS-Université Paris 7), 10 rue Alice Domon et Léonie Duquet, 75205 Paris Cedex 13 (France); Tiec, Alexandre Le, E-mail: blanchet@iap.fr, E-mail: langlois@iap.fr, E-mail: letiec@umd.edu, E-mail: marsat@iap.fr [Maryland Center for Fundamental Physics and Joint Space-Science Institute, Department of Physics, University of Maryland, College Park, MD 20742 (United States)

2013-02-01

94

B¯?Xs? rate and CP asymmetry within the aligned two-Higgs-doublet model  

NASA Astrophysics Data System (ADS)

In the two-Higgs-doublet model the alignment of the Yukawa matrices in flavor space guarantees the absence of flavor-changing neutral currents at tree level, while introducing new sources for CP violation parametrized in a very economical way [Antonio Pich and Paula Tuzon, Phys. Rev. DPRVDAQ1550-7998 80, 091702 (2009)10.1103/PhysRevD.80.091702]. This implies a potentially large influence in a number of processes, b?s? being a prominent example where rather high experimental and theoretical precision meet. We analyze the CP rate asymmetry in this inclusive decay and determine the resulting constraints on the model parameters. We demonstrate the compatibility with previously obtained limits [Martin Jung, Antonio Pich, and Paula Tuzon, J. High Energy Phys.JHEPFG1029-8479 11 (2010) 00310.1007/JHEP11(2010)003]. Moreover, we extend the phenomenological analysis of the branching ratio, and examine the influence of resulting correlations on the like-sign dimuon charge asymmetry in B decays.

Jung, Martin; Pich, Antonio; Tuzón, Paula

2011-04-01

95

Impact of work-life imbalance on job satisfaction and quality of life among hospital nurses in Japan.  

PubMed

This study investigated the status of work-life imbalance among hospital nurses in Japan and impact of work-life imbalance on job satisfaction and quality of life. A cross-sectional survey of 1,202 nurses (81% response rate) was conducted in three Japanese acute care hospitals. Participants were divided into four groups for actual work-life balance (Group A: 50/50, including other lower working proportion groups [e.g., 40/50]; Group B: 60/40; Group C: 70/30; and Group D: 80/20, including other higher working proportion groups [e.g., 90/10]). We also asked participants about desired work-life balance, and private and work-related perspectives. Satisfactions (job, private life, and work-life balance), quality of life, and stress-coping ability were also measured. All data were compared among the four groups. Most nurses sensed that they had a greater proportion of working life than private life, and had a work-life imbalance. Actual WLB did not fit compared to desired WLB. When the actual working proportion greatly exceeds the private life proportion, nurses' health could be in danger, and they may resign due to lower job satisfaction and QOL. Simultaneous progress by both management and individual nurses is necessary to improve work-life imbalance. PMID:25475095

Makabe, Sachiko; Takagai, Junko; Asanuma, Yoshihiro; Ohtomo, Kazuo; Kimura, Yutaka

2015-04-01

96

Boundary Conditions for NHEK through Effective Action Approach  

NASA Astrophysics Data System (ADS)

We study the asymptotic symmetry group (ASG) of the near horizon geometry of extreme Kerr black hole through the effective action approach developed by Porfyriadis and Wilczek (arXiv:1007.1031v1[gr-qc]). By requiring a finite boundary effective action, we derive a new set of asymptotic Killing vectors and boundary conditions, which are much more relaxed than the ones proposed by Matsuo Y et al. [Nucl. Phys. B 825 (2010) 231], and still allow a copy of a conformal group as its ASG. In the covariant formalism, the asymptotic charges are finite, with the corresponding central charge vanishing. By using the quasi-local charge and introducing a plausible cut-off, we find that the higher order terms of the asymptotic Killing vectors, which could not be determined through the effective action approach, contribute to the central charge as well. We also show that the boundary conditions suggested by Guica et al. [Phys. Rev. D 80 (2009) 124008] lead to a divergent first-order boundary effective action.

Chen, Bin; Ning, Bo; Zhang, Jia-Ju

2012-04-01

97

Real-time particle size analysis using focused beam reflectance measurement as a process analytical technology tool for a continuous granulation-drying-milling process.  

PubMed

Focused beam reflectance measurement (FBRM) was used as a process analytical technology tool to perform inline real-time particle size analysis of a proprietary granulation manufactured using a continuous twin-screw granulation-drying-milling process. A significant relationship between D20, D50, and D80 length-weighted chord length and sieve particle size was observed with a p value of <0.0001 and R(2) of 0.886. A central composite response surface statistical design was used to evaluate the effect of granulator screw speed and Comil® impeller speed on the length-weighted chord length distribution (CLD) and particle size distribution (PSD) determined by FBRM and nested sieve analysis, respectively. The effect of granulator speed and mill speed on bulk density, tapped density, Compressibility Index, and Flowability Index were also investigated. An inline FBRM probe placed below the Comil-generated chord lengths and CLD data at designated times. The collection of the milled samples for sieve analysis and PSD evaluation were coordinated with the timing of the FBRM determinations. Both FBRM and sieve analysis resulted in similar bimodal distributions for all ten manufactured batches studied. Within the experimental space studied, the granulator screw speed (650-850 rpm) and Comil® impeller speed (1,000-2,000 rpm) did not have a significant effect on CLD, PSD, bulk density, tapped density, Compressibility Index, and Flowability Index (p value > 0.05). PMID:23435807

Kumar, Vijay; Taylor, Michael K; Mehrotra, Amit; Stagner, William C

2013-06-01

98

Water, hydrogen, deuterium, carbon, carbon-13, and oxygen-18 content of selected lunar material.  

PubMed

The water content of the breccia is 150 to 455 ppm, with a deltaD from-580 to -870 per mil. Hydrogen gas content is 40 to 53 ppm with a deltaD of -830 to -970 per mil. The CO(2) is 290 to 418 ppm with delta (13)C = + 2.3 to + 5.1 per mil and delta(18)O = 14.2 to 19.1 per mil. Non-CO(2) carbon is 22 to 100 ppm, delta(13)C = -6.4 to -23.2 per mil. Lunar dust is 810 ppm H(2)O (D = 80 ppm) and 188 ppm total carbon(delta(13)C = -17.6 per mil). The (18)O analyses of whole rocks range from 5.8 to 6.2 per mil. The temperature of crystallization of type B rocks is 1100 degrees to 1300 degrees C, based on the oxygen isotope fractionation between coexisting plagioclase and ilmenite. PMID:17781488

Friedman, I; O'neil, J R; Adami, L H; Gleason, J D; Hardcastle, K

1970-01-30

99

Dipyrone has no effects on bone healing of tibial fractures in rats  

PubMed Central

OBJECTIVE: To evaluate the effect of dipyrone on healing of tibial fractures in rats. METHODS: Fourty-two Wistar rats were used, with mean body weight of 280g. After being anesthetized, they were submitted to closed fracture of the tibia and fibula of the right posterior paw through manual force. The rats were randomly divided into three groups: the control group that received a daily intraperitoneal injection of saline solution; group D-40, that received saline injection containing 40mg/Kg dipyrone; and group D-80, that received saline injection containing 80mg/Kg dipyrone. After 28 days the rats were sacrificed and received a new label code that was known by only one researcher. The fractured limbs were then amputated and X-rayed. The tibias were disarticulated and subjected to mechanical, radiological and histological evaluation. For statistical analysis the Kruskal-Wallis test was used at a significance level of 5%. RESULTS: There wasn't any type of dipyrone effect on healing of rats tibial fractures in relation to the control group. CONCLUSION: Dipyrone may be used safely for pain control in the treatment of fractures, without any interference on bone healing. Level of Evidence II, Controlled Laboratory Study. PMID:25246852

Gali, Julio Cesar; Sansanovicz, Dennis; Ventin, Fernando Carvalho; Paes, Rodrigo Henrique; Quevedo, Francisco Carlos; Caetano, Edie Benedito

2014-01-01

100

Scanning SQUID microscopy of local superconductivity in inhomogeneous combinatorial ceramics.  

PubMed

Although combinatorial solid-state chemistry promises to be an efficient way to search for new superconducting compounds, the problem of determining which compositions are strongly diamagnetic in a mixed-phase sample is challenging. By means of reactions in a system of randomly mixed starting components (Ca, Sr, Ba, La, Y, Pb, Bi, Tl, and Cu oxides), samples were produced that showed an onset of diamagnetic response above 115?K in bulk measurements. Imaging of this diamagnetic response in ceramic samples by scanning SQUID microscopy (SSM) revealed local superconducting areas with sizes down to as small as the spatial resolution of a few micrometers. In addition, locally formed superconducting matter was extracted from mixed-phase samples by magnetic separation. The analysis of single grains (d<80??m) by X-ray diffraction, elemental analysis, and bulk SQUID measurements allowed Tl2Ca3Ba2Cu4O12, TlCaBaSrCu2O(7-?), BaPb(0.5)Bi(0.25)Tl(0.25)O(3-?), TlBa2Ca2Cu3O9, Tl2Ba2CaCu2O8, and YBa2Cu3O7 phases to be identified. SSM, in combination with other diagnostic techniques, is therefore shown to be a useful instrument to analyze inhomogeneous reaction products in the solid-state chemistry of materials showing magnetic properties. PMID:25303177

Iranmanesh, Mitra; Stir, Manuela; Kirtley, John R; Hulliger, Jürg

2014-11-24

101

Anti-centromere antibody and CREST syndrome in patients with primary biliary cirrhosis.  

PubMed

Anti-centromere antibodies (ACA) in 41 sera from patients with primary biliary cirrhosis (PBC) were analyzed by an immunoblotting method and the correlation between the presence of ACA and the clinical features in these PBC patients was studied. In 10 of 16 ACA-positive PBC patients, one or more clinical features of CREST syndrome (PBC-CREST) were found. Statistical differences were observed in age at disease onset, serum levels of IgM and total bilirubin and titer of anti-M2 antibody, between PBC-CREST patients and the PBC patients without CREST symptoms (PBC-non CREST). By immunoblotting analysis, three major epitopes of ACA were identified at 18 kD, 80 kD and 140 kD polypeptides. The 18 kD polypeptides were detected in all 16 ACA-positive PBC patients. From these results, it is suggested that ACA-positive PBC-CREST patients can be separated from ACA-negative PBC-CREST and PBC-non CREST patients. PMID:1284406

Shoji, I; Takagi, T; Kasukawa, R

1992-12-01

102

General relativistic, nonstandard model for the dark sector of the Universe  

NASA Astrophysics Data System (ADS)

We present a general relativistic version of the self-gravitating fluid model for the dark sector of the Universe (darkon fluid) introduced in Stichel and Zakrzewski (Phys Rev D 80:083513, 2009) and extended and reviewed in Stichel and Zakrzewski (Entropy 15:559, 2013). This model contains no free parameters in its Lagrangian. The resulting energy-momentum tensor is dustlike with a nontrivial energy flow. In an approximation valid at sub-Hubble scales we find that the present-day cosmic acceleration is not attributed to any kind of negative pressure but it is due to a dynamically determined negative energy density. This property turns out to be equivalent to a time-dependent spatial curvature. The obtained cosmological equations, at sub-Hubble scales, agree with those of the nonrelativistic model but they are given a new physical interpretation. Furthermore, we have derived the self-consistent equation to be satisfied by the nonrelativistic gravitational potential produced by a galactic halo in our model from a weak-field limit of a generalized Tolman-Oppenheimer-Volkoff equation.

Stichel, P. C.; Zakrzewski, W. J.

2015-01-01

103

What do we really know about blunted vocal affect and alogia? A meta-analysis of objective assessments.  

PubMed

Deficits in nonverbal vocal expression (e.g., blunted vocal affect, alogia) are a hallmark of schizophrenia and are a focus of the Research Domain Criteria initiative from the National Institute of Mental Health. Results from studies using symptom rating scales suggest that these deficits are profound; on the order of four to six standard deviations. To complement this endeavor, we conducted a meta-analysis of studies employing objective analysis of natural speech in patients with schizophrenia and nonpsychiatric controls. Thirteen studies, collectively including 480 patients with schizophrenia and 326 nonpsychiatric controls, were identified. There was considerable variability across studies in which aspects of vocal communication were examined and in the magnitudes of deficit. Overall, speech production (reflecting alogia) was impaired at a large effects size level (d=-.80; k=13), whereas speech variability (reflecting blunted affect) was much more modest (d=-.36; k=2). Regarding the former, this was largely driven by measures of pause behavior, as opposed to other aspects of speech (e.g., number of words/utterances). On the other hand, ratings of negative symptoms across these studies suggested profound group differences (d=3.54; k=4). These data suggest that only certain aspects of vocal expression are affected in schizophrenia, and highlight major discrepancies between symptom rating and objective-based measures. The discussion centers on advancing objective analysis for understanding vocal expression in schizophrenia and for identifying and defining more homogenous patient subsets for study. PMID:25261880

Cohen, Alex S; Mitchell, Kyle R; Elvevåg, Brita

2014-11-01

104

A meta-analytic investigation of neurocognitive deficits in bipolar illness: profile and effects of clinical state.  

PubMed

A meta-analysis of neuropsychological studies of patients with bipolar disorder comprised of 42 studies of 1,197 patients in euthymia, 13 studies consisting of 314 patients in a manic/mixed phase of illness, and 5 studies of 96 patients in a depressed state. Cohen d values were calculated for each study as the mean difference between patient and control group score on each neuropsychological measure, expressed in pooled SD units. For euthymia, results revealed impairment across all neuropsychological domains, with d values in the moderate-to-large range (d = .5 - .8) for the vast majority of measures. There was evidence of large effect-size impairment on measures of verbal learning (d = .81), and delayed verbal and nonverbal memory (d = .80 - .92), while effect-size impairment on measures of visuospatial function was small-to-moderate (d

Kurtz, Matthew M; Gerraty, Raphael T

2009-09-01

105

Impact of work-life imbalance on job satisfaction and quality of life among hospital nurses in Japan  

PubMed Central

This study investigated the status of work-life imbalance among hospital nurses in Japan and impact of work-life imbalance on job satisfaction and quality of life. A cross-sectional survey of 1,202 nurses (81% response rate) was conducted in three Japanese acute care hospitals. Participants were divided into four groups for actual work-life balance (Group A: 50/50, including other lower working proportion groups [e.g., 40/50]; Group B: 60/40; Group C: 70/30; and Group D: 80/20, including other higher working proportion groups [e.g., 90/10]). We also asked participants about desired work-life balance, and private and work-related perspectives. Satisfactions (job, private life, and work-life balance), quality of life, and stress-coping ability were also measured. All data were compared among the four groups. Most nurses sensed that they had a greater proportion of working life than private life, and had a work-life imbalance. Actual WLB did not fit compared to desired WLB. When the actual working proportion greatly exceeds the private life proportion, nurses’ health could be in danger, and they may resign due to lower job satisfaction and QOL. Simultaneous progress by both management and individual nurses is necessary to improve work-life imbalance.

MAKABE, Sachiko; TAKAGAI, Junko; ASANUMA, Yoshihiro; OHTOMO, Kazuo; KIMURA, Yutaka

2014-01-01

106

Quantum Larmor radiation in a conformally flat universe  

SciTech Connect

We investigate the quantum effect on the Larmor radiation from a moving charge in an expanding universe based on the framework of the scalar quantum electrodynamics. A theoretical formula for the radiation energy is derived at the lowest order of the perturbation theory with respect to the coupling constant of the scalar quantum electrodynamics. We evaluate the radiation energy on the background universe so that the Minkowski spacetime transits to the Milne universe, in which the equation of motion for the mode function of the free complex scalar field can be exactly solved in an analytic way. Then, the result is compared with the WKB approach, in which the equation of motion of the mode function is constructed with the WKB approximation which is valid as long as the Compton wavelength is shorter than the Hubble horizon length. This demonstrates that the quantum effect on the Larmor radiation of the order e{sup 2}({h_bar}/2{pi}) is determined by a nonlocal integration in time depending on the background expansion. We also compare our result with a recent work by Higuchi and Walker [Phys. Rev. D 80, 105019 (2009)], which investigated the quantum correction to the Larmor radiation from a charged particle in a nonrelativistic motion in a homogeneous electric field.

Kimura, Rampei; Nakamura, Gen; Yamamoto, Kazuhiro [Department of Physical Science, Hiroshima University, Higashi-Hiroshima 739-8526 (Japan)

2011-02-15

107

Functional reconstitution of glycinergic synapses incorporating defined glycine receptor subunit combinations.  

PubMed

Glycine receptor (GlyR) chloride channels mediate fast inhibitory neurotransmission in the spinal cord and brainstem. Four GlyR subunits (?1-3, ?) have been identified in humans, and their differential anatomical distributions underlie a diversity of synaptic isoforms with unique physiological and pharmacological properties. To improve our understanding of these properties, we induced the formation of recombinant synapses between cultured spinal neurons and HEK293 cells expressing GlyR subunits of interest plus the synapse-promoting molecule, neuroligin-2A. In the heterosynapses thus formed, recombinant ?1? and ?3? GlyRs mediated fast decaying inhibitory postsynaptic currents (IPSCs) whereas ?2? GlyRs mediated slow decaying IPSCs. These results are consistent with the fragmentary information available from native synapses and single channel kinetic studies. As ? subunit incorporation is considered essential for localizing GlyRs at the synapse, we were surprised that ?1-3 homomers supported robust IPSCs with ? subunit incorporation accelerating IPSC rise and decay times in ?2? and ?3? heteromers only. Finally, heterosynapses incorporating ?1(D80A)? and ?1(A52S)? GlyRs exhibited accelerated IPSC decay rates closely resembling those recorded in native synapses from mutant mice homozygous for these mutations, providing an additional validation of our technique. Glycinergic heterosynapses should prove useful for evaluating the effects of drugs, hereditary disease mutations or other interventions on defined GlyR subunit combinations under realistic synaptic activation conditions. PMID:25445488

Zhang, Yan; Dixon, Christine L; Keramidas, Angelo; Lynch, Joseph W

2015-02-01

108

Effect of organic selenium in the diet on sperm quality of boars.  

PubMed

The effect of a diet supplemented with organic selenium (Se) on sperm production and quality of boars was investigated. Sixty mature boars from a commercial artificial insemination centre were randomly allocated at Day (D) 0 into Group A and B. Group A received the regular ration supplemented with inorganic Se (0.4?mg/kg feed as Na(2) SeO(3)) whereas Group B was switched to the same diet but with organic Se (0.4?mg/kg fed as Se-yeast). The sperm was investigated during 4?months (D0, D30, D60, D75, D90, D105 and D120). Sperm concentration and motility were objectively measured using a photometer and Computer Assisted Semen Analysis (CASA) respectively. Morphology of the sperm was assessed using eosin-nigrosin staining and the resistance to induction of oxidative stress (production of malonaldehyde, MDA) through thiobarbituric acid reagent species analysis. Additionally, the Se concentration in sperm and blood plasma were measured. Repeated measures analysis of variance (anova) from D60 to 120 (spermatogenesis of approximately 2?months) or anova at D120 (Se concentrations) were used for statistical analysis. The total number of ejaculated sperm was not significantly different between both groups, but boars of Group B had a significantly higher sperm concentration (434.6 vs 514.1?×?10(6) sperm/ml; p??0.05) were observed for the other parameters. Under the present study conditions, changing from inorganic Se to organic Se in the diet of boars increased sperm concentration but reduced some motility parameters and resistance to oxidative stress. PMID:20015118

López, A; Rijsselaere, T; Van Soom, A; Leroy, J L M R; De Clercq, J B P; Bols, P E J; Maes, D

2010-12-01

109

Effects of body condition score at parturition and postpartum supplemental fat on adipose tissue lipogenic activity of lactating beef cows.  

PubMed

Three-year-old Angus x Gelbvieh beef cows nutritionally managed to achieve a BCS of 4 +/- 0.07 (479.3 +/- 36.3 kg of initial BW) or 6 +/- 0.07 (579.6 +/- 53.1 kg of initial BW) at parturition were used in a 2-yr experiment (n = 36/yr) to determine the effects of BCS at parturition and postpartum lipid supplementation on cow adipose tissue lipogenesis. Beginning 3 d postpartum, cows within each BCS were randomly assigned to be fed hay and a low-fat control supplement or supplements with either cracked high-linoleate safflower seeds or cracked high-oleate safflower seeds until d 60 of lactation. Diets were formulated to be isonitrogenous and isocaloric, and safflower seed diets provided 5% DMI as fat. Adipose tissue biopsies were collected near the tail-head region of cows on d 30 and 60 of lactation. Dietary treatment did not affect (P > or = 0.43) adipose tissue lipogenesis. Body condition score at parturition did not affect acetate incorporation into lipid (P = 0.53) or activity of acetyl CoA carboxylase (P = 0.77) or fatty acid synthase (P = 0.18). Lipoprotein lipase activity and palmitate incorporation into triacyl-glycerol tended to be greater (P = 0.06), and palmitate esterification into total acylglycerols was greater (P = 0.01) in cows with a BCS of 4 at parturition. Mean activity of acetyl-CoA carboxylase (P < 0.001), lipoprotein lipase (P = 0.01), and rate of palmitate incorporation into monoacylglycerol (P = 0.02), diacylglycerol (P = 0.001), triacylglycerol (P = 0.003), and total acylglycerols (P = 0.002) were greater at d 30 than d 60, suggesting a greater proclivity for fatty acid biosynthesis and esterification by adipose tissue at d 30 of lactation. Although dietary lipid supplementation did not affect adipose tissue lipogenesis, results suggest that cows with a BCS of 4 at parturition have a greater propensity to deliver exogenously derived fatty acids to the adipocyte surface and incorporate preformed fatty acids into acylglycerols as stored adipocyte lipid. Additionally, cows in early lactation seemed to be able to synthesize and incorporate more fatty acids into stored lipid than cows during peak lactation. PMID:16424268

Lake, S L; Scholljegerdes, E J; Nayigihugu, V; Murrieta, C M; Atkinson, R L; Rule, D C; Robinson, T J; Hess, B W

2006-02-01

110

A frequency-duty cycle equation for the ACGIH hand activity level  

PubMed Central

Objective A new equation for predicting the hand activity level (HAL) used in the ACGIH threshold limit value® (TLV®), was based on exertion frequency (F) and percentage duty cycle (D). Background The TLV® includes a table for estimating HAL from F and D originating from data in Latko et al. (1997) and post-hoc adjustments that includes extrapolations outside of the data range. Methods Multimedia video task analysis determined D for two additional jobs from Latko’s study not in the original data set, and a new non-linear regression equation was developed to better fit the data and create a more accurate table. Results The equation, HAL=6.56lnD[F1.311+3.18F1.31], generally matches the TLV® HAL lookup table, and is a substantial improvement over the linear model, particularly for F > 1.25 Hz and D > 60% jobs. Conclusion The equation more closely fits the data and applies the TLV® using a continuous function. Practitioner Summary The original HAL lookup table is limited in resolution, omits values, and extrapolates values outside of the range of data. A new equation and table was developed to address these issues. PMID:25343340

Radwin, Robert G.; Azari, David P.; Lindstrom, Mary J.; Ulin, Sheryl S.; Armstrong, Thomas J.; Rempel, David

2015-01-01

111

A frequency-duty cycle equation for the ACGIH hand activity level.  

PubMed

A new equation for predicting the hand activity level (HAL) used in the American Conference for Government Industrial Hygienists threshold limit value®(TLV®) was based on exertion frequency (F) and percentage duty cycle (D). The TLV® includes a table for estimating HAL from F and D originating from data in Latko et al. (Latko WA, Armstrong TJ, Foulke JA, Herrin GD, Rabourn RA, Ulin SS, Development and evaluation of an observational method for assessing repetition in hand tasks. American Industrial Hygiene Association Journal, 58(4):278-285, 1997) and post hoc adjustments that include extrapolations outside of the data range. Multimedia video task analysis determined D for two additional jobs from Latko's study not in the original data-set, and a new nonlinear regression equation was developed to better fit the data and create a more accurate table. The equation, HAL = 6:56 ln D[F(1:31) /1+3:18 F(1:31), generally matches the TLV® HAL lookup table, and is a substantial improvement over the linear model, particularly for F>1.25 Hz and D>60% jobs. The equation more closely fits the data and applies the TLV® using a continuous function. PMID:25343340

Radwin, Robert G; Azari, David P; Lindstrom, Mary J; Ulin, Sheryl S; Armstrong, Thomas J; Rempel, David

2015-01-01

112

A rapid, sensitive and selective electrochemical biosensor with concanavalin A for the preemptive detection of norovirus.  

PubMed

Norovirus (NoV) is a foodborne pathogen that can cause sporadic and epidemic gastrointestinal diseases. Rapid screening is crucial to promptly identify the presence of NoV and prevent food poisoning. Here, we present a sensitive, selective, and rapid electrochemical biosensor for the detection of NoV. The proposed electrochemical biosensor is composed of a nanostructured gold electrode conjugated with concanavalin A (ConA). ConA functions as a recognition element that selectively captures NoV. Cyclic voltammetry revealed a linear relationship (R(2) = 0.998) between the current and concentration of NoV (in the range of 10(2) and 10(6) copies/mL), with a relatively short assay time (1h) and a good detection limit (35 copies/mL). Additionally, the signals of Hepatitis A and E in the selectively test were found to be only 2.0% and 2.8% of the NoV signal at an identical concentration of 10(3) copies/mL, proving that the electrochemical biosensor has a selectively of approximately 98%. Moreover, the concentration of NoV was measured in a realistic environment, i.e., a sample solution extracted from lettuce, to demonstrate a potential application of the proposed biosensor (LoD = 60 copies/mL). PMID:25254625

Hong, Sung A; Kwon, Joseph; Kim, Duwoon; Yang, Sung

2015-02-15

113

Examination of the new MMPI-2 Response Bias Scale (Gervais): relationship with MMPI-2 validity scales.  

PubMed

Validity scales were recently developed to improve assessment of symptom validity beyond original MMPI-2 validity scales. In an initial study, the Response Bias Scale (RBS; Gervais, 2005) was developed based upon non-head-injury claimant performances on a cognitive effort measure, the Word Memory Test (WMT). The present study examined relationships of the RBS with numerous MMPI-2 validity scales in a sample of 211 participants with secondary gain (SG) or no secondary gain (NSG). Of the validity scales observed, RBS yielded the largest effect size difference between groups (d = .65), followed closely by FBS (d = .60) and the L-scale (d = .51). Overall, RBS correlated most significantly (r = .74, p < .001) with FBS, but also showed significant correlations with most other validity scales for both groups. RBS further demonstrated significant correlations (p < .001) with all clinical scales except for Mf. Findings suggest that RBS and FBS may represent a similar construct of symptom validity, and may outperform other MMPI-2 validity scales in discriminating SG and NSG groups. Findings provide preliminary support for use of RBS within the forensic context. PMID:17162723

Nelson, Nathaniel W; Sweet, Jerry J; Heilbronner, Robert L

2007-01-01

114

Radiographic protocol and normal anatomy of the hind feet in the white rhinoceros (ceratotherium simum).  

PubMed

Foot pathology is a common and important health concern in captive rhinoceroses worldwide, but osteopathologies are rarely diagnosed, partly because of a lack of radiographic protocols. Here, we aimed to develop the first radiographic protocol for rhinoceros feet and describe the radiographic anatomy of the white rhinoceros (Ceratotherium simum) hind foot (pes). Computed tomographic images were obtained of nine cadaver pedes from seven different white rhinoceroses and assessed for pathology. A single foot deemed free of pathology was radiographed using a range of different projections and exposures to determine the best protocol. 3D models were produced from the CT images and were displayed with the real radiographs to describe the normal radiographic anatomy of the white rhinoceros pes. An optimal radiographic projection was determined for each bone in the rhinoceros pes focusing on highlighting areas where pathology has been previously described. The projections deemed to be most useful were D60Pr-PlDiO (digit III), D45Pr45M-PlDiLO (digit II), and D40Pr35L-PlDiLO (digit IV). The primary beam was centered 5-7 cm proximal to the cuticle on the digit of interest. Articular surfaces, ridges, grooves, tubercles, processes and fossae were identified. The radiographic protocol we have developed along with the normal radiographic anatomy we have described will allow for more accessible and effective diagnosis of white rhinoceros foot osteopathologies. PMID:25339254

Dudley, Robert J; Wood, Simon P; Hutchinson, John R; Weller, Renate

2015-03-01

115

Zero-reflection metal slabs: A mechanism of light tunneling in metamaterials  

NASA Astrophysics Data System (ADS)

Thick metals are nearly opaque due to high reflectance and the huge third-order nonlinear susceptibility of metals is hardly utilized. In the present paper, zero-reflection phenomena in a thick metal (M) slab covered with one-dimensional dielectric photonic crystals (PC's) (CD) n are studied in heterostructures M(DC) n and sandwiched structures (CD) n M(DC) n . Visible-light tunneling modes can be realized in M(DC) n or (CD) n M(DC) n in which the optical epsilon-negative medium (metal) is paired with the PC, which mimics a lossless optical mu-negative medium in the gap region. The transmittance as high as 33% and 38% are observed at wavelength of 589 nm for M = Ag, with thickness d=60.2 nm in a heterostructure and d=83.1 nm in a sandwiched structure, respectively. The transmittance is more than 200 times larger than that of a single Ag layer with the same thickness in the latter case. Possible applications on metal-based nonlinearity enhancement and optical absorber are also discussed.

Du, Guiqiang; Jiang, Haitao; Wang, Zhanshan; Chen, Hong

2011-06-01

116

Monte Carlo simulations and radiation dosimetry measurements of peripherally applied HDR {sup 192}Ir breast brachytherapy D-shaped applicators  

SciTech Connect

Conformal dose coverage for accelerated partial breast irradiation or radiotherapy boost can be obtained with AccuBoost registered D-shaped brachytherapy applicators using a flattened surface positioned near the patient. Three D-shaped applicators (D45/D53/D60) were dosimetrically characterized using Monte Carlo methods (MCNP5), air ionization chambers (Farmer and Markus), and radiochromic film (GafChromic EBT) in polystyrene and ICRU 44 breast tissue. HDR {sup 192}Ir source dwell times were either constant or optimized to improve skin dose uniformity. Scatter dose decreased as depth decreased. 10 mm beyond the applicator aperture, dose reductions of 90% and 51% were observed at depths of 0 and 30 mm, respectively. Similarly, planar dose uniformity improved as depth decreased and was also due to scatter and applicator geometry. Dose uniformity inside the applicator aperture was approximately 11% and 15% for all three applicators at the skin and 30 mm deep, respectively. Depth dose measurements in polystyrene using ion chamber and radiochromic film agreed with Monte Carlo results within 2%. Discrepancies between film and Monte Carlo dose profiles at 30 mm depth were within 1%.

Yang Yun; Rivard, Mark J. [Department of Biomedical Engineering and Biotechnology, University of Massachusetts Lowell, Massachusetts 01854 (United States); Department of Radiation Oncology, Tufts University School of Medicine, Boston, Massachusetts 02111 (United States)

2009-03-15

117

ZnO Nanorods Grown Electrochemically on Different Metal Oxide Underlays  

NASA Astrophysics Data System (ADS)

In this study we present results on electrochemically grown ZnO nanorods on different metal oxide underlays, such as ZnO seed layers with different morphologies, ZnS and TiO2 compact thin films produced by spray pyrolysis on transparent conductive oxide (TCO) substrates. Also in this work we present results on ZnO nanorods directly deposited on some chosen TCO substrates. The relationship between nanorod formation and substrate properties were studied. All ZnO nanorod layers were grown electrochemically using ZnCl2 aqueous solutions (c=0.2 mmol/L) at the bath temperature of 80 °C during one hour. The structural properties and morphology of metal oxide underlays and ZnO nanorods grown on them were studied by scanning electron microscopy (SEM), x-ray diffraction spectroscopy (XRD). Depending on the substrate morphology, ZnO rods with different dimension, orientation, shape and density were obtained. For instance, larger rods (d~200 nm, l~700 nm) were obtained on substrates, such as ITO/glass, FTO/glass and ZnO:In/ITO/glass. Smaller rods (d~60 nm, l~350 nm) were obtained on smooth, uniform and fine-grained underlays, such as ZnS and TiO2.

Gromyko, I.; Dedova, T.; Krunks, M.; Syritski, V.; Mere, A.; Mikli, V.; Unt, T.; Oja Acik, I.

2015-03-01

118

A randomised phase II trial of preoperative chemotherapy of cisplatin–docetaxel or docetaxel alone for clinical stage IB/II non-small-cell lung cancer: results of a Japan Clinical Oncology Group trial (JCOG 0204)  

PubMed Central

Preoperative chemotherapy is a promising strategy in patients with early-stage resectable non-small-cell lung cancer (NSCLC); optimal chemotherapy remains unclear. Clinical (c-) stage IB/II NSCLC patients were randomised to receive either two cycles of docetaxel (D)–cisplatin (P) combination chemotherapy (D 60?mg?m?2 and P 80?mg?m?2 on day 1) every 3–4 weeks or three cycles of D monotherapy (70?mg?m?2) every 3weeks. Thoracotomy was performed 4–5 weeks (DP) or 3–4 weeks (D) after chemotherapy. The primary end point was 1-year disease-free survival (DFS). From October 2002 to November 2003, 80 patients were randomised. Chemotherapy toxicities were mainly haematologic and well tolerated. There were two early postoperative deaths with DP (one intraoperative bleeding and one empyema). Pathologic complete response was observed in two DP patients. Docetaxel–cisplatin was superior to D in terms of response rate (45 vs 15%) and complete resection rate (95 vs 87%). Both DFS and overall survival were better in DP. Disease-free survival at 1, 2 and 4 years were 78, 65 and 57% with DP, and were 62, 44 and 36% with D, respectively. Preoperative DP was associated with encouraging resection rate and DFS data, and phase III trials for c-stage IB/II NSCLC are warranted. PMID:18728643

Kunitoh, H; Kato, H; Tsuboi, M; Asamura, H; Tada, H; Nagai, K; Mitsudomi, T; Koike, T; Nakagawa, K; Ichinose, Y; Okada, M; Shibata, T; Saijo, N

2008-01-01

119

3D geometry applied to atmospheric layers  

NASA Astrophysics Data System (ADS)

Epipolar geometry is an efficient method for generating 3D representations of objects. Here we present an original application of this method to the case of atmospheric layers. Two synchronized simultaneous images of the same scene are taken in two sites at a distance D. The 36*36 fields of view are oriented face to face along the same line of sight, but in opposite directions. The elevation angle of the optical axis above the horizon is 17. The observed objects are airglow emissions or cirrus clouds or aircraft trails. In the case of clouds, the shape of the objects is diffuse. To obtain a superposition of the common observed zone, it is necessary to calculate a normalized cross-correlation coefficient (NCC) to identify pairs of matching points in both images. The perspective effect in the rectangular images is inverted to produce a satellite-type view of the atmospheric layer as could be seen from an overlying satellite. We developed a triangulation algorithm to retrieve the 3D surface of the observed layer. The stereoscopic method was used to retrieve the wavy structure of the OH emissive layer at the altitude of 87 km. The distance between the observing sites was 600 km. Results obtained in Peru from the sites of Cerro Cosmos and Cerro Verde will be presented. We are currently extending the stereoscopic procedure to the study of troposphere cirruses, of natural origin or induced by aircraft engines. In this case, the distance between observation sites is D 60 km.

Nadjib Kouahla, Mohamed; Moreels, Guy; Faivre, Michael

120

Effect of Acacia karroo Supplementation on Growth, Ultimate pH, Colour and Cooking Losses of Meat from Indigenous Xhosa Lop-eared Goats  

PubMed Central

The objective of the study was to determine the effect of Acacia karroo supplementation on growth, ultimate pH, colour and cooking losses of meat from indigenous Xhosa lop-eared goats. Eighteen castrated 4-month-old kids were used in the study until slaughter. The kids were subdivided in two treatment groups A. karroo supplemented (AK) and non-supplemented (NS). The supplemented goats were given 200 g per head per d of fresh A. karroo leaves. The kids were slaughtered on d 60 and sample cuttings for meat quality assessment were taken from the Longistimus dorsi muscle. The supplemented kids had higher (p<0.05) growth rates than the non-supplemented ones. The meat from the A. karroo supplemented goats had lower (p<0.05) ultimate pH and cooking loss than the meat from the non-supplemented goats. Acacia karroo supplemented goats produced higher (p<0.05) b* (yellowness) value, but supplementation had no significant effect on L* (lightness) and a* (redness) of the meat. Therefore, A. karroo supplementation improved growth performance and the quality of meat from goats. PMID:25049715

Ngambu, S.; Muchenje, V.; Marume, U.

2013-01-01

121

Formation and decay of Einstein-Yang-Mills black holes  

NASA Astrophysics Data System (ADS)

We study various aspects of black holes and gravitational collapse in Einstein-Yang-Mills theory under the assumption of spherical symmetry. Numerical evolution on hyperboloidal surfaces extending to future null infinity is used. We begin by constructing colored and Reissner-Nordström black holes on surfaces of constant mean curvature and analyze their perturbations. These linearly perturbed black holes are then evolved into the nonlinear regime and the masses of the final Schwarzschild black holes are computed as a function of the initial horizon radius. We compare with an information-theoretic bound on the lifetime of unstable hairy black holes derived by Hod. Finally we study critical phenomena in gravitational collapse at the threshold between different Yang-Mills vacuum states of the final Schwarzschild black holes, where the n =1 colored black hole forms the critical solution. The work of Choptuik et al. [Phys. Rev. D 60, 124011 (1999)] is extended by using a family of initial data that includes another region in parameter space where the colored black hole with the opposite sign of the Yang-Mills potential forms the critical solution. We investigate the boundary between the two regions and discover that the Reissner-Nordström solution appears as a new approximate codimension-two attractor.

Rinne, Oliver

2014-12-01

122

Assessment of Natural Radioactivity Levels of Cements and Cement Composites in the Slovak Republic  

PubMed Central

The radionuclide activities of 226Ra, 232Th and 40K and radiological parameters (radium equivalent activity, gamma and alpha indices, the absorbed gamma dose rate and external and internal hazard indices) of cements and cement composites commonly used in the Slovak Republic have been studied in this paper. The cement samples of 8 types of cements from Slovak cement plants and five types of composites made from cement type CEM I were analyzed in the experiment. The radionuclide activities in the cements ranged from 8.58–19.1 Bq·kg?1, 9.78–26.3 Bq·kg?1 and 156.5–489.4 Bq·kg?1 for 226Ra, 232Th and 40K, respectively. The radiological parameters in cement samples were calculated as follows: mean radium equivalent activity Raeq = 67.87 Bq·kg?1, gamma index I? = 0.256, alpha index I? = 0.067, the absorbed gamma dose rate D = 60.76 nGy·h?1, external hazard index Hex = 0.182 and internal hazard index Hin was 0.218. The radionuclide activity in composites ranged from 6.84–10.8 Bq·kg?1 for 226Ra, 13.1–20.5 Bq·kg?1 for 232Th and 250.4–494.4 Bq·kg?1 for 40K. The calculated radiological parameters of cements were lower than calculated radiological parameters of cement composites. PMID:24351739

Eštoková, Adriana; Palaš?áková, Lenka

2013-01-01

123

Assessment of natural radioactivity levels of cements and cement composites in the Slovak Republic.  

PubMed

The radionuclide activities of 226Ra, 232Th and 40K and radiological parameters (radium equivalent activity, gamma and alpha indices, the absorbed gamma dose rate and external and internal hazard indices) of cements and cement composites commonly used in the Slovak Republic have been studied in this paper. The cement samples of 8 types of cements from Slovak cement plants and five types of composites made from cement type CEM I were analyzed in the experiment. The radionuclide activities in the cements ranged from 8.58-19.1 Bq·kg(-1), 9.78-26.3 Bq·kg(-1) and 156.5-489.4 Bq·kg(-1) for 226Ra, 232Th and 40K, respectively. The radiological parameters in cement samples were calculated as follows: mean radium equivalent activity Ra(eq) = 67.87 Bq·kg(-1), gamma index I? = 0.256, alpha index I? = 0.067, the absorbed gamma dose rate D = 60.76 nGy·h(-1), external hazard index H(ex) = 0.182 and internal hazard index H(in) was 0.218. The radionuclide activity in composites ranged from 6.84-10.8 Bq·kg(-1) for 226Ra, 13.1-20.5 Bq·kg(-1) for 232Th and 250.4-494.4 Bq·kg(-1) for 40K. The calculated radiological parameters of cements were lower than calculated radiological parameters of cement composites. PMID:24351739

Eštoková, Adriana; Palaš?áková, Lenka

2013-12-01

124

Embryoless Wheat Grain  

PubMed Central

Yorkstar wheat, grown in New York State, has a high percentage (10-11) of grains without embryos. The embryoless grains have viable aleurone layers and show no sign of injury. These grains are able to support ?-amylase synthesis only in the presence of gibberellin A3 (GA3). In the absence of GA3 some protein synthesis occurs in embryoless grains during the early hours of soaking, indicating that such activity occurs prior to and independent of GA3 induction of ?-amylase. The level of ?-amylase on a dry weight basis is the same in embryoless and normal grains and decreases with time of soaking. In the presence of GA3, ?-amylase decreases at a slower rate. Isoenzymes of ?-amylase from GA3-treated embryoless and normal grains show quantitative as well as qualitative differences. Cycloheximide (60 ?g/ml) completely inhibits the synthesis of ?-amylase by embryoless grains. Of the RNA synthesis inhibitors, actinomycin D (60 ?g/ml) was ineffective while 6-methylpurine (60 ?g/ml) gave 65% inhibition without decreasing the number of isoenzymes. Images PMID:16658386

Khan, Anwar A.; Verbeek, Rita; Waters, Earl C.; van Onckelen, Henry A.

1973-01-01

125

Opioid binding site in EL-4 thymoma cell line  

SciTech Connect

Using EL-4 thymoma cell-line we found a binding site similar to the k opioid receptor of the nervous system. The Scatchard analysis of the binding of (/sup 3/H) bremazocine indicated a single site with a K/sub D/ = 60 +/- 17 nM and Bmax = 2.7 +/- 0.8 pmols/10/sup 6/ cells. To characterize this binding site, competition studies were performed using selective compounds for the various opioid receptors. The k agonist U-50,488H was the most potent displacer of (/sup 3/H) bremazocine with an IC/sub 50/ value = 0.57..mu..M. The two steroisomers levorphanol and dextrorphan showed the same affinity for this site. While morphine, (D-Pen/sup 2/, D-Pen/sup 5/) enkephalin and ..beta..-endorphin failed to displace, except at very high concentrations, codeine demonstrated a IC/sub 50/ = 60..mu..M, that was similar to naloxone. 32 references, 3 figures, 2 tables.

Fiorica, E.; Spector, S.

1988-01-01

126

An Effectiveness Trial of a New Enhanced Dissonance Eating Disorder Prevention Program among Female College Students  

PubMed Central

Objective Efficacy trials indicate that a dissonance-based prevention program in which female high school and college students with body image concerns critique the thin-ideal reduced risk factors, eating disorder symptoms, and future eating disorder onset, but weaker effects emerged from an effectiveness trial wherein high school clinicians recruited students and delivered the program under real-world conditions. The present effectiveness trial tested whether a new enhanced dissonance version of this program produced larger effects when college clinicians recruited students and delivered the intervention using improved procedures to select, train, and supervise clinicians. Method Young women recruited from seven universities across the US (N = 408, M age = 21.6, SD = 5.64) were randomized to the dissonance intervention or an educational brochure control condition. Results Dissonance participants showed significantly greater decreases in risk factors (thin-ideal internalization, body dissatisfaction, dieting, negative affect) and eating disorder symptoms versus controls at posttest and 1-year follow-up, resulting in medium average effect size (d = .60). Dissonance participants also reported significant improvements in psychosocial functioning, but not reduced healthcare utilization or unhealthy weight gain. Conclusions This novel multisite effectiveness trial with college clinicians found that the enhanced dissonance version of this program and the improved facilitator selection/training procedures produced average effects that were 83% larger than effects observed in the high school effectiveness trial. PMID:24189570

Stice, Eric; Butryn, Meghan L.; Rohde, Paul; Shaw, Heather; Marti, C. Nathan

2014-01-01

127

Susceptibility of the Adult Japanese Beetle, Popillia japonica to Entomopathogenic Nematodes  

PubMed Central

To build upon prior research demonstrating the potential of entomopathogenic nematode dissemination by infected adult Japanese beetle, Popillia japonica, we evaluated susceptibility of the adult beetles to 20 strains of Steinernema and Heterorhabditis under laboratory conditions. The nematodes were applied at a rate of 10,000 infective juveniles per 10 adult beetles in 148 mL plastic cups containing autoclaved sand and sassafras leaves as a source of food for the beetles. All strains infected the beetles and caused 55% to 95% mortality. The most virulent strains that caused 50% beetle mortality in less than 5 days included a strain of H. georgiana (D61), three strains of Steinernema sp. (R54, R45, and FC48), and two strains of S. carpocapsae (All and D60). The ability of two strains of Steinernema sp. (R45 and R54) and two strains of Heterorhabditis bacteriophora (D98 and GPS11) to infect and reproduce in the beetle was further examined to assess the potential of infected beetles to disseminate nematodes upon their death. All four strains infected and killed the beetles, but only Steinernema strains reproduced in the cadavers. We conclude that both Heterorhabditis and Steinernema strains are able to cause mortality to adult Japanese beetle, but Steinernema strains may be effectively disseminated due to their reproduction in the beetle. PMID:23431080

Morris, E. Erin; Grewal, Parwinder S.

2011-01-01

128

Susceptibility of the Adult Japanese Beetle, Popillia japonica to Entomopathogenic Nematodes.  

PubMed

To build upon prior research demonstrating the potential of entomopathogenic nematode dissemination by infected adult Japanese beetle, Popillia japonica, we evaluated susceptibility of the adult beetles to 20 strains of Steinernema and Heterorhabditis under laboratory conditions. The nematodes were applied at a rate of 10,000 infective juveniles per 10 adult beetles in 148 mL plastic cups containing autoclaved sand and sassafras leaves as a source of food for the beetles. All strains infected the beetles and caused 55% to 95% mortality. The most virulent strains that caused 50% beetle mortality in less than 5 days included a strain of H. georgiana (D61), three strains of Steinernema sp. (R54, R45, and FC48), and two strains of S. carpocapsae (All and D60). The ability of two strains of Steinernema sp. (R45 and R54) and two strains of Heterorhabditis bacteriophora (D98 and GPS11) to infect and reproduce in the beetle was further examined to assess the potential of infected beetles to disseminate nematodes upon their death. All four strains infected and killed the beetles, but only Steinernema strains reproduced in the cadavers. We conclude that both Heterorhabditis and Steinernema strains are able to cause mortality to adult Japanese beetle, but Steinernema strains may be effectively disseminated due to their reproduction in the beetle. PMID:23431080

Morris, E Erin; Grewal, Parwinder S

2011-09-01

129

Changing the omega-6 to omega-3 fatty acid ratio in sow diets alters serum, colostrum, and milk fatty acid profiles, but has minimal impact on reproductive performance.  

PubMed

This experiment tested the hypothesis that reducing the omega-6 (n-6) to omega-3 (n-3) fatty acid (FA) ratio in sow diets will improve performance, characterized by increased litter size, decreased preweaning mortality, and improved growth performance. Second, we determined if the FA profile in sow and piglet blood, colostrum, and milk are altered when sows are fed diets with varied n-6:n-3 ratios and if the dietary FA ratio impacts circulating concentrations of IgG, IgA, eicosapentaenoic (EPA), or docosahexaenoic (DHA) acid. Sows (n=150) were assigned to 1 of 5 treatments (each divided into gestation and lactation diets) on d 80 of gestation. Period 1 (P1) is defined as d 80 of gestation to weaning and Period 2 (P2) refers to the subsequent breeding to weaning. Diets were wheat and barley based (5% crude fat) and treatments consisted of a control (tallow), 3 diets with plant oil-based n-6:n-3 ratios (9:1P, 5:1P, and 1:1P), and a 5:1 fish oil diet (5:1F). Litter size was unaffected by treatment during P1 and P2 (P>0.10). In P1, birth weight was unaffected by diet (P>0.10); however, weaning weight (P=0.019) and ADG from birth to weaning (P=0.011) were greatest for piglets born to 9:1P and 5:1P sows. During P2, 5:1F sows consumed 10% less feed during lactation (P=0.036), tended to have reduced piglet birth weights (P=0.052), and piglet weaning weight was reduced by 0.8 kg (P=0.040) relative to the other diets. Colostrum and piglet serum IgA and IgG concentrations were unaffected by diet (P>0.10). Serum n-3 FA were greatest in sows (P<0.01) consuming 1:1P and 5:1F diets and in their offspring (P=0.014). Serum ?-linolenic acid (ALA) was greatest in 1:1P sows and EPA and DHA were greatest in 5:1F sows (P<0.01). In pre-suckle piglet serum, ALA did not differ among treatment groups (P>0.10). Relative to piglets of sows consuming the control diet, EPA was 2.5-fold greater in the 1:1P group and 4-fold greater in 5:1F group (P<0.01) before suckling. In post-suckle samples, ALA was greatest in piglets from the 1:1P sows (P<0.01) and EPA and DHA were greatest in piglets from the 5:1F sows (P<0.01). Feeding diets with plant-based n-6:n-3 ratios of 5:1 or 1:1 did not impact performance relative to a control group but improved the conversion of ALA into EPA and increased the transfer of n-3 to piglets through milk. When a fish-based 5:1 ratio diet was fed, pre-weaning mortality was increased, and piglet birth and weaning weights decreased. PMID:25403193

Eastwood, L; Leterme, P; Beaulieu, A D

2014-12-01

130

pH-Responsive Artemisinin Dimer in Lipid Nanoparticles Are Effective Against Human Breast Cancer in a Xenograft Model.  

PubMed

Artemisinin (ART), a well-known antimalaria drug, also exhibits anticancer activities. We previously reported a group of novel dimeric artemisinin piperazine conjugates (ADPs) possessing pH-dependent aqueous solubility and a proof-of-concept lipid nanoparticle formulation based on natural egg phosphatidylcholine (EPC). EPC may induce allergic reactions in individuals sensitive to egg products. Therefore, the goal of this report is to develop ADP-synthetic lipid particles suitable for in vivo evaluation. We found that ADP binds to 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) with greater than 90% efficiency and forms drug-lipid particles (d ? 80 nm). Cryo-electron microscopy of the ADP drug-lipid particles revealed unilamellar vesicle-like structures. Detailed characterization studies show insertion of the ADP lead compound, ADP109, into the DPPC membrane and the presence of an aqueous core. Over 50% of the ADP109 was released in 48 hours at pH4 compared with less than 20% at neutral. ADP109-lipid particles exhibited high potency against human breast cancer, but was tolerated well by nontumorigenic cells. In MDA-MB-231 mouse xenograft model, lipid-bound ADP109 particles were more effective than paclitaxel in controlling tumor growth. Cellular uptake studies showed endocytosis of the nanoparticles and release of core-trapped marker throughout the cytosol at 37°C. These results demonstrate, for the first time, the in vivo feasibility of lipid-bound ART dimer for cancer chemotherapy. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci 104:1815-1824, 2015. PMID:25753991

Zhang, Yitong J; Zhan, Xi; Wang, Liguo; Ho, Rodney J Y; Sasaki, Tomikazu

2015-05-01

131

VizieR Online Data Catalog: Hamburg/RASS Cat. of optical identifications (HRC) (Bade+, 1998)  

NASA Astrophysics Data System (ADS)

The file rassid2.cat provides information on optical identifications to X-ray positions of the ROSAT All-Sky Survey (RASS). The file was created by correlating the Bright Source Catalogue of ROSAT (Voges et al., 1996, Cat. ) and the Hamburg/RASS Catalogue of Optical Identifications (HRC) (Bade et al., 1996, in prep.). In the current state (Version 2.0) the catalogue contains 4665 positions in the extragalactic northern sky. For each X-ray position optical information taken from HQS objective prism and direct Schmidt plates (Hagen et al., 1995A&AS..111..195H) is given and a finding chart derived from digitized direct plates as gzipped Postscript file is provided (sky.ps file). If possible, the most likely optical counterpart is marked in the catalogue and on the finding chart. For many of the newly processed HQS fields of Version 2.0 no direct Schmidt plates from the HQS exists. In these cases we put finding charts generated from the STScI Digitized Sky Survey on the ftp server, ftp.hs.uni-hamburg.de, pub/outgoing/rass-id. We remind the reader that the STScI Digitized Sky Survey and HQS prism plates have different epochs. This has to be taken into account for stellar identifications. Furthermore the spectral sensitivity of the STScI Digitized Sky Survey and the HQS prism plates is different. The finding chart for each X-ray position is stored as a gzipped Postscript file and they can be found in the directories d-10 to d+80 at ftp.hs.uni-hamburg.de, pub/outgoing/rass-id. These directories arrange the files into declination belts. Names of finding charts generated by the STScI Digitized Sky Survey begin with a 'p'. (4 data files).

Bade, N.; Engels, D.; Voges, W.; Beckmann, V.; Boller, T.; Cordis, L.; Dahlem, M.; Englhauser, J.; Molthagen, K.; Nass, P.; Studt, J.; Reimers, D.

2001-03-01

132

Long-term fate and bioavailability of sediment associated 2,3,7,8-tetrachlorodibenzofuran in littoral enclosures  

SciTech Connect

the fate and bioavailability of 2,3,7,8-tetrachlorodibenzofuran (TCDF; 4,6-tritium labeled) was examined over a 3-year period in littoral enclosures in a small oligotrophic lake in the Experimental Lakes Area. Tetrachlorodibenzofuran was added as a single dose or as five small multiple additions over a 5-d period in a sediment slurry. Tetrachlorodibenzofuran was rapidly redistributed, mainly to bottom sediments reflecting removal on settling particles. Between 0 and 120 d. 80 to 90% of TCDF in the water column was associated with particles (>1 {micro}m). The highest concentration of TCDF in suspended particles was consistently observed in the smallest size fraction (0.22--1 {micro}m) at 326 to 464 d post treatment. Mode of addition had no effect on TCDF concentrations in water or surficial sediments or pore waters throughout the experiment. Mean TCDF concentrations in surficial sediment were 1.830 {+-} 1.180 pg/g whereas they averaged 1.260 {+-} 596 pg/g OC from 318 to 851 d post treatment. Increasing concentrations of TCDE in lower sediment layers at 952 d suggests that TCDF was either diffusing into the sediment or undergoing burial. Fugacity (f) calculations indicated that the TCDF in enclosures shifted from disequilibrium favoring the water column to a disequilibrium with respect to bottom sediments from day 21 onward. Initially, TCDF was more bioavailable to filtering and deposit feeders (mussels, Chironomidae, Hexagenia sp., and zooplankton) in enclosures receiving multiple additions; however, differences were rarely statistically significant. Concentrations of TCDF in all organisms were initially high, and they decreased in later sampling periods. Biota--sediment-accumulation factors (BSAFs) in mussels and crayfish were >1 in the early sampling periods, which reflected greater bioavailability of the added particle-borne TCDF. By 851 d, BSAFs had declined to 0.02 to 0.04, reflecting removal of TCDF from the water column and from surficial sediments.

Currie, R.S.; Fairchild, W.L.; Holoka, M.H.; Muir, D.C.G.

2000-06-01

133

Self-organization of local magnetoplasma structures in the upper layers of the solar convection zone  

SciTech Connect

Self-organization and evolution of magnetoplasma structures in the upper layers of the solar convection zone are discussed as a process of diffuse aggregation of magnetic flux tubes. Equations describing the tube motion under the action of magnetic interaction forces, hydrodynamic forces, and random forces are written explicitly. The process of aggregation of magnetic flux tubes into magnetic flux clusters of different shapes and dimensions is simulated numerically. The obtained structures are compared with the observed morphological types of sunspot groups. The quantitative comparison with the observational data was performed by comparing the fractal dimensions of the photospheric magnetic structures observed in solar active regions with those of structures obtained in the numerical experiment. The model has the following free parameters: the numbers of magnetic flux tubes with opposite polarities on the considered area element (Nn and Ns), the average radius of the cross section of the magnetic flux tube (a), its effective length (l), the twist factor of the tube field (k), and the absolute value of the average velocity of chaotic tube displacements (d). Variations in these parameters in physically reasonable limits leads to the formation of structures (tube clusters of different morphological types) having different fractal dimensions. Using the NOAA 10488 active region, which appeared and developed into a complicated configuration near the central meridian, as an example, it is shown that good quantitative agreement between the fractal dimensions is achieved at the following parameters of the model: Nn = Ns = 250 ± 50; a = 150 ± 50 km; l ? 5000 km, and d = 80 ± 10 m/s. These results do not contradict the observational data and theoretical estimates obtained in the framework of the Parker “spaghetti” model and provide new information on the physical processes resulting in the origin and evolution of local magnetic plasma structures in the near-photospheric layers of the solar convection zone.

Chumak, O. V., E-mail: chuo@yandex.ru [Moscow State University, Sternberg Astronomical Institute (Russian Federation)

2013-08-15

134

Requirement of the Flagellar Protein Export Apparatus Component FliO for Optimal Expression of Flagellar Genes in Helicobacter pylori  

PubMed Central

Flagellar biogenesis in Helicobacter pylori involves the coordinated expression of flagellar genes with assembly of the flagellum. The H. pylori flagellar genes are organized into three regulons based on the sigma factor needed for their transcription (RpoD [?80], RpoN [?54], or FliA [?28]). Transcription of RpoN-dependent genes is activated by a two-component system consisting of the sensor kinase FlgS and the response regulator FlgR. While the cellular cues sensed by the FlgS/FlgR two-component system remain to be elucidated, previous studies revealed that disrupting certain components of the flagellar export apparatus inhibited transcription of the RpoN regulon. FliO is the least conserved of the membrane-bound components of the export apparatus and has not been annotated for any of the H. pylori genomes sequenced to date. A PSI-BLAST analysis identified a potential H. pylori FliO protein which membrane topology algorithms predict to possess a large N-terminal periplasmic domain that is absent from FliO of Escherichia coli and Salmonella, the paradigms for flagellar structure/function studies. FliO was necessary for flagellar biogenesis as well as wild-type levels of motility and transcription of RpoN-dependent and FliA-dependent flagellar genes in H. pylori strain B128. FliO also appears to be required for wild-type levels of the export apparatus protein FlhA in the membrane. Interestingly, the periplasmic and cytoplasmic domains were somewhat dispensable for flagellar gene regulation and assembly, suggesting that these domains have relatively minor roles in flagellar synthesis. PMID:24837287

Tsang, Jennifer

2014-01-01

135

Performance-based everyday functioning after stroke: relationship with IADL questionnaire and neurocognitive performance.  

PubMed

Neuropsychologists frequently are asked to comment on everyday functioning, but the research relies mostly on questionnaire-based assessment of daily functioning. While performance-based assessment of everyday functioning has many advantages over commonly used questionnaires, there are few empirically validated comprehensive performance-based measures. We present data here on a performance-based battery of daily living skills, the Functional Impact Assessment (FIA) in 47 unilateral stroke patients and 37 matched healthy controls. The FIA was validated by comparing it to performance on the self- and informant-report version of the Functional Activities Questionnaire (FAQ). We also examined the relationship between the FIA and cognitive functioning using the Neuropsychological Assessment Battery (NAB). The stroke group's performance on the FIA, FAQ (self and informant), and NAB (total and domain scores) was significantly (d's ? .80) lower than the control group. The NAB total score and all domain scores were highly correlated with the FIA in the stroke group (r's > .7), and only one NAB domain score (visuospatial) was a unique predictor. This may be due to the fact that most of the NAB domains have a statistical problem of multicollinearity, which may explain why only the spatial domain was a unique predictor. While the informant FAQ was significantly correlated with FIA total score (r = .48, p < .01), the NAB total score was a significantly better predictor (r = .83, p < .001) than the informant FAQ. NAB total scaled score of less than 86 predicted impairment on the FIA with 92% sensitivity and 84% specificity. Our findings argue that the FIA is sensitive to deficits associated with stroke and is highly associated with all neuropsychological domains (attention, executive functions, language and spatial skills, and memory). PMID:21880170

Sadek, Joseph R; Stricker, Nikki; Adair, John C; Haaland, Kathleen Y

2011-09-01

136

Genitourinary Toxicity After High-Dose-Rate (HDR) Brachytherapy Combined With Hypofractionated External Beam Radiotherapy for Localized Prostate Cancer: An Analysis to Determine the Correlation Between Dose-Volume Histogram Parameters in HDR Brachytherapy and Severity of Toxicity  

SciTech Connect

Purpose: To evaluate the severity of genitourinary (GU) toxicity in high-dose-rate (HDR) brachytherapy combined with hypofractionated external beam radiotherapy (EBRT) for prostate cancer and to explore factors that might affect the severity of GU toxicity. Methods and Materials: A total of 100 Japanese men with prostate cancer underwent {sup 192}Ir HDR brachytherapy combined with hypofractionated EBRT. Mean (SD) dose to 90% of the planning target volume was 6.3 (0.7) Gy per fraction of HDR. After 5 fractions of HDR treatment, EBRT with 10 fractions of 3 Gy was administrated. The urethral volume receiving 1-15 Gy per fraction in HDR brachytherapy (V1-V15) and the dose to at least 5-100% of urethral volume in HDR brachytherapy (D5-D100) were compared between patients with Grade 3 toxicity and those with Grade 0-2 toxicity. Prostate volume, patient age, and International Prostate Symptom Score were also compared between the two groups. Results: Of the 100 patients, 6 displayed Grade 3 acute GU toxicity, and 12 displayed Grade 3 late GU toxicity. Regarding acute GU toxicity, values of V1, V2, V3, and V4 were significantly higher in patients with Grade 3 toxicity than in those with Grade 0-2 toxicity. Regarding late GU toxicity, values of D70, D80, V12, and V13 were significantly higher in patients with Grade 3 toxicity than in those with Grade 0-2 toxicity. Conclusions: The severity of GU toxicity in HDR brachytherapy combined with hypofractionated EBRT for prostate cancer was relatively high. The volume of prostatic urethra was associated with grade of acute GU toxicity, and urethral dose was associated with grade of late GU toxicity.

Ishiyama, Hiromichi [Department of Radiology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan)], E-mail: hishiyam@kitasato-u.ac.jp; Kitano, Masashi [Department of Radiology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan); Satoh, Takefumi [Department of Urology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan); Kotani, Shouko [Department of Radiology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan); Uemae, Mineko [Division of Radiation Oncology, Kitasato University Hospital, Kitasato, Sagamihara, Kanagawa (Japan); Matsumoto, Kazumasa; Okusa, Hiroshi; Tabata, Ken-ichi; Baba, Shiro [Department of Urology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan); Hayakawa, Kazushige [Department of Radiology, Kitasato University School of Medicine, Kitasato, Sagamihara, Kanagawa (Japan)

2009-09-01

137

Experimental Study on the Flow Regimes and Pressure Gradients of Air-Oil-Water Three-Phase Flow in Horizontal Pipes  

PubMed Central

An experimental investigation has been carried out to study the flow regimes and pressure gradients of air-oil-water three-phase flows in 2.25 ID horizontal pipe at different flow conditions. The effects of water cuts, liquid and gas velocities on flow patterns and pressure gradients have been studied. The experiments have been conducted at 20°C using low viscosity Safrasol D80 oil, tap water and air. Superficial water and oil velocities were varied from 0.3?m/s to 3?m/s and air velocity varied from 0.29?m/s to 52.5?m/s to cover wide range of flow patterns. The experiments were performed for 10% to 90% water cuts. The flow patterns were observed and recorded using high speed video camera while the pressure drops were measured using pressure transducers and U-tube manometers. The flow patterns show strong dependence on water fraction, gas velocities, and liquid velocities. The observed flow patterns are stratified (smooth and wavy), elongated bubble, slug, dispersed bubble, and annular flow patterns. The pressure gradients have been found to increase with the increase in gas flow rates. Also, for a given superficial gas velocity, the pressure gradients increased with the increase in the superficial liquid velocity. The pressure gradient first increases and then decreases with increasing water cut. In general, phase inversion was observed with increase in the water cut. The experimental results have been compared with the existing unified Model and a good agreement has been noticed. PMID:24523645

Al-Hadhrami, Luai M.; Shaahid, S. M.; Tunde, Lukman O.; Al-Sarkhi, A.

2014-01-01

138

Binding studies and photoaffinity labeling identify two classes of phencyclidine receptors in rat brain  

SciTech Connect

Binding and photoaffinity labeling experiments were employed in order to differentiate 1-(1-phenylcyclohexyl)piperidine (PCP) receptor sites in rat brain. Two classes of PCP receptors were characterized and localized: one class binds (/sup 3/H)-N-(1-(2-thienyl)cyclohexyl)piperidine ((/sup 3/H)TCP) with high affinity (K/sub d/ = 10-15 nM) and the other binds the ligand with a relatively low affinity (K/sub d/ = 80-100 nM). The two classes of sites have different patterns of distribution. Forebrain regions are characterized by high-affinity sites, but some parts contain low-affinity sites as well. In the cerebellum only low-affinity sites were detected. Binding sites for (/sup 3/H)PCP and for its photolabile analog (/sup 3/H)azido-PCP showed a regional distribution similar to that of the (/sup 3/H)TCP sites. The neuroleptic drug haloperidol did not block binding to either the high- or the low-affinity (/sup 3/H)TCP sites, whereas Ca/sup 2 +/ inhibited binding to both. Photoaffinity labeling of the PCP receptors with (/sup 3/H)AZ-PCP indicated that five specifically labeled polypeptides of these receptors are unevenly distributed in the rat brain. Two of the stereoselectively labeled polypeptides appear to be associated with the high- and low-affinity (/sup 3/H)TCP-binding sites; the density of the M/sub r/ 90,000 polypeptide in various brain regions correlates well with the localization of the high-affinity sites, whereas the density of the M/sub r/ 33,000 polypeptide correlates best with the distribution of the low-affinity sites. The results are compatible with the existence of two classes of PCP receptors in the rat brain, each having a distinct polypeptide that carries the ligand recognition site and has a selective localization in the brain.

Haring, R.; Kloog, Y.; Kalir, A.; Sokolovsky, M.

1987-09-08

139

A Semi-Automated Technique Determining the Liver Standardized Uptake Value Reference for Tumor Delineation in FDG PET-CT  

PubMed Central

Background 18F-fluorodeoxyglucose (FDG) positron emission tomography (PET)-computed tomography (CT) has been an essential modality in oncology. We propose a semi-automated algorithm to objectively determine liver standardized uptake value (SUV), which is used as a threshold for tumor delineation. Methods A large spherical volume of interest (VOI) was placed manually to roughly enclose the right lobe (RL) of the liver. For each voxel in this VOI, a coefficient of variation of voxel values (CVv) was calculated for neighboring voxels within a radius of d/2. The voxel with the minimum CVv was then selected, where a 30-mm spherical VOI was placed at that voxel in accordance with PERCIST criteria. Two nuclear medicine physicians independently defined 30-mm VOIs manually on 124 studies in 62 patients to generate the standard values, against which the results from the new method were compared. Results The semi-automated method was successful in determining the liver SUV that was consistent between the two physicians in all the studies (d?=?80 mm). The liver SUV threshold (mean +3 SD within 30-mm VOI) determined by the new semi-automated method (3.12±0.61) was not statistically different from those determined by the manual method (Physician-1: 3.14±0.58, Physician-2: 3.15±0.58). The semi-automated method produced tumor volumes that were not statistically different from those by experts' manual operation. Furthermore, the volume change in the two sequential studies had no statistical difference between semi-automated and manual methods. Conclusions Our semi-automated method could define the liver SUV robustly as the threshold value used for tumor volume measurements according to PERCIST. The method could avoid possible subjective bias of manual liver VOI placement and is thus expected to improve clinical performance of volume-based parameters for prediction of cancer treatment response. PMID:25162396

Hirata, Kenji; Kobayashi, Kentaro; Wong, Koon-Pong; Manabe, Osamu; Surmak, Andrew; Tamaki, Nagara; Huang, Sung-Cheng

2014-01-01

140

New insight into the peroxidase-hydroxamic acid interaction revealed by the combination of spectroscopic and crystallographic studies.  

PubMed

Aromatic hydroxamic acids, such as salicylhydroxamic (SHA) and benzohydroxamic (BHA) acids, are commonly used as probes for studying the active sites of peroxidases. In this paper, we have extended the study of the complexes of Arthromyces ramosus peroxidase (ARP/CIP) with BHA and SHA by analyzing their Raman spectra in solution and in single crystals. The experiments were carried out under various conditions to identify the best experimental conditions, and hence, avoid artifacts deriving from the preparation of the samples or collection of the spectra. The analysis of the data takes also into account the characteristic of the electronic absorption spectra in solution and the crystal structures of the complexes. The results showed small differences between the solution and the crystal phases even though the coordination state can be dramatically affected by the physical or chemical conditions. The greater sensitivity of the spectroscopic technique enabled us to establish the existence of multiple species upon complexation of the protein with the hydroxamic acids that could not be detected by ordinary X-ray crystallography. Furthermore, SHA titration experiments and singular value decomposition analysis of the absorption spectra indicated the presence of two binding sites in the protein, one with a high affinity (K(d) = 1.7 mM), which should correspond to the SHA bound protein as determined by X-ray, and the other with a very low affinity (K(d) > 80 mM) probably located in a non-heme site. This suggests that the heterogeneous titration line shape involves ligand binding to a non-heme site in competition with the canonical heme site. In contrast, the titration profile obtained with the BHA ligand is monophasic, in agreement with all the peroxidases so far studied. PMID:14636075

Indiani, Chiara; Santoni, Elisa; Becucci, Maurizio; Boffi, Alberto; Fukuyama, Keiichi; Smulevich, Giulietta

2003-12-01

141

High Prevalence of Vitamin D Insufficiency in Black and White Pregnant Women Residing in the Northern United States and Their Neonates1  

PubMed Central

In utero or early-life vitamin D deficiency is associated with skeletal problems, type 1 diabetes, and schizophrenia, but the prevalence of vitamin D deficiency in U.S. pregnant women is unexplored. We sought to assess vitamin D status of pregnant women and their neonates residing in Pittsburgh by race and season. Serum 25-hydroxyvitamin D (25(OH)D) was measured at 4–21 wk gestation and predelivery in 200 white and 200 black pregnant women and in cord blood of their neonates. Over 90% of women used prenatal vitamins. Women and neonates were classified as vitamin D deficient [25(OH)D <37.5 nmol/L], insufficient [25(OH)D 37.5–80 nmol/L], or sufficient [25(OH)D >80 nmol/L]. At delivery, vitamin D deficiency and insufficiency occurred in 29.2% and 54.1% of black women and 45.6% and 46.8% black neonates, respectively. Five percent and 42.1% of white women and 9.7% and 56.4% of white neonates were vitamin D deficient and insufficient, respectively. Results were similar at <22 wk gestation. After adjustment for prepregnancy BMI and periconceptional multivitamin use, black women had a smaller mean increase in maternal 25(OH)D compared with white women from winter to summer (16.0 ± 3.3 nmol/L vs. 23.2 ± 3.7 nmol/L) and from spring to summer (13.2 ± 3.0 nmol/L vs. 27.6 ± 4.7 nmol/L) (P < 0.01). These results suggest that black and white pregnant women and neonates residing in the northern US are at high risk of vitamin D insufficiency, even when mothers are compliant with prenatal vitamins. Higher-dose supplementation is needed to improve maternal and neonatal vitamin D nutriture. PMID:17237325

Bodnar, Lisa M.; Simhan, Hyagriv N.; Powers, Robert W.; Frank, Michael P.; Cooperstein, Emily; Roberts, James M.

2015-01-01

142

25-Hydroxyvitamin D status, arterial stiffness and the renin-angiotensin system in healthy humans.  

PubMed

Vitamin D deficiency is associated with increased arterial stiffness. We sought to clarify the influence of vitamin D in modulating angiotensin II-dependent arterial stiffness. Thirty-six healthy subjects (33 ± 2 years, 67% female, mean 25-hydroxyvitamin D 69 ± 4 nmol/L) were studied in high salt balance. Arterial stiffness, expressed as brachial pulse wave velocity (bPWV) and aortic augmentation index (AIx), was measured by tonometry at baseline and in response to angiotensin II infusion (3 ng/kg/min × 30 min then 6 ng/kg/min × 30 min). The primary outcome was change in bPWV after an angiotensin II challenge. Results were analyzed according to plasma 25-hydroxyvitamin D status: deficient (<50 nmol/L) and sufficient (? 50 nmol/L). There were no differences in baseline arterial stiffness between vitamin D deficient (25-hydroxyvitamin D 40 ± 2 nmol/L) and sufficient (25-hydroxyvitamin D 80 ± 4 nmol/L) groups. Compared with sufficient vitamin D status, vitamin D deficiency was associated with a decreased arterial response to angiotensin II challenge (?brachial pulse wave velocity: 0.48 ± 0.44 m/s versus 1.95 ± 0.22 m/s, p=0.004; ?aortic augmentation index: 9.4 ± 3.4% versus 14.2 ± 2.7%, p=0.3), which persisted for brachial pulse wave velocity response after adjustment for covariates (p=0.03). Vitamin D deficiency is associated with increased arterial stiffness in healthy humans, possibly through an angiotensin II-dependent mechanism. PMID:24164282

Abdi-Ali, Ahmed; Nicholl, David D M; Hemmelgarn, Brenda R; MacRae, Jennifer M; Sola, Darlene Y; Ahmed, Sofia B

2014-01-01

143

Relic gravitational waves in light of the 7-year Wilkinson Microwave Anisotropy Probe data and improved prospects for the Planck mission  

NASA Astrophysics Data System (ADS)

The new release of data from Wilkinson Microwave Anisotropy Probe improves the observational status of relic gravitational waves. The 7-year results enhance the indications of relic gravitational waves in the existing data and change to the better the prospects of confident detection of relic gravitational waves by the currently operating Planck satellite. We apply to WMAP7 data the same methods of analysis that we used earlier [W. Zhao, D. Baskaran, and L. P. Grishchuk, Phys. Rev. DPRVDAQ1550-7998 80, 083005 (2009)10.1103/PhysRevD.80.083005] with WMAP5 data. We also revised by the same methods our previous analysis of WMAP3 data. It follows from the examination of consecutive WMAP data releases that the maximum likelihood value of the quadrupole ratio R, which characterizes the amount of relic gravitational waves, increases up to R=0.264, and the interval separating this value from the point R=0 (the hypothesis of no gravitational waves) increases up to a 2? level. The primordial spectra of density perturbations and gravitational waves remain blue in the relevant interval of wavelengths, but the spectral indices increase up to ns=1.111 and nt=0.111. Assuming that the maximum likelihood estimates of the perturbation parameters that we found from WMAP7 data are the true values of the parameters, we find that the signal-to-noise ratio S/N for the detection of relic gravitational waves by the Planck experiment increases up to S/N=4.04, even under pessimistic assumptions with regard to residual foreground contamination and instrumental noises. We comment on theoretical frameworks that, in the case of success, will be accepted or decisively rejected by the Planck observations.

Zhao, W.; Baskaran, D.; Grishchuk, L. P.

2010-08-01

144

Experimental study on the flow regimes and pressure gradients of air-oil-water three-phase flow in horizontal pipes.  

PubMed

An experimental investigation has been carried out to study the flow regimes and pressure gradients of air-oil-water three-phase flows in 2.25 ID horizontal pipe at different flow conditions. The effects of water cuts, liquid and gas velocities on flow patterns and pressure gradients have been studied. The experiments have been conducted at 20 °C using low viscosity Safrasol D80 oil, tap water and air. Superficial water and oil velocities were varied from 0.3 m/s to 3 m/s and air velocity varied from 0.29 m/s to 52.5 m/s to cover wide range of flow patterns. The experiments were performed for 10% to 90% water cuts. The flow patterns were observed and recorded using high speed video camera while the pressure drops were measured using pressure transducers and U-tube manometers. The flow patterns show strong dependence on water fraction, gas velocities, and liquid velocities. The observed flow patterns are stratified (smooth and wavy), elongated bubble, slug, dispersed bubble, and annular flow patterns. The pressure gradients have been found to increase with the increase in gas flow rates. Also, for a given superficial gas velocity, the pressure gradients increased with the increase in the superficial liquid velocity. The pressure gradient first increases and then decreases with increasing water cut. In general, phase inversion was observed with increase in the water cut. The experimental results have been compared with the existing unified Model and a good agreement has been noticed. PMID:24523645

Al-Hadhrami, Luai M; Shaahid, S M; Tunde, Lukman O; Al-Sarkhi, A

2014-01-01

145

Development of Evaluation Methods for Lower Limb Function between Aged and Young Using Principal Component Analysis  

NASA Astrophysics Data System (ADS)

There is the increasing concern of the society to prevent the fall of the aged. The improvement in aged people's the muscular strength of the lower-limb, postural control and walking ability are important for quality of life and fall prevention. The aim of this study was to develop multiple evaluation methods in order to advise for improvement and maintenance of lower limb function between aged and young. The subjects were 16 healthy young volunteers (mean ± S.D: 19.9 ± 0.6 years) and 10 healthy aged volunteers (mean ± S.D: 80.6 ± 6.1 years). Measurement items related to lower limb function were selected from the items which we have ever used. Selected measurement items of function of lower are distance of extroversion of the toe, angle of flexion of the toe, maximum width of step, knee elevation, moving distance of greater trochanter, walking balance, toe-gap force and rotation range of ankle joint. Measurement items summarized by the principal component analysis into lower ability evaluation methods including walking ability and muscle strength of lower limb and flexibility of ankle. The young group demonstrated the factor of 1.6 greater the assessment score of walking ability compared with the aged group. The young group demonstrated the factor of 1.4 greater the assessment score of muscle strength of lower limb compared with the aged group. The young group demonstrated the factor of 1.2 greater the assessment score of flexibility of ankle compared with the aged group. The results suggested that it was possible to assess the lower limb function of aged and young numerically and to advise on their foot function.

Nomoto, Yohei; Yamashita, Kazuhiko; Ohya, Tetsuya; Koyama, Hironori; Kawasumi, Masashi

146

A comprehensive statistical assessment of star-planet interaction  

NASA Astrophysics Data System (ADS)

We investigate whether magnetic interaction between close-in giant planets and their host stars produce observable statistical enhancements in stellar coronal or chromospheric activity. New Chandra observations of 12 nearby (d<60 pc) planet-hosting solar analogs are combined with archival Chandra, XMM-Newton, and ROSAT coverage of 11 similar stars to construct a sample inoculated against inherent stellar class and planet-detection biases. Survival analysis and Bayesian regression methods (incorporating both measurements errors and X-ray upper limits; 13/23 stars have secure detections) are used to test whether "hot Jupiter" hosts are systematically more X-ray luminous than comparable stars with more distant or smaller planets. No significant correlations are present between common proxies for interaction strength (Mp/a^2 or 1/a) versus coronal activity (Lx or Lx/Lbol). In contrast, a sample of 198 vetted FGK main-sequence stars does show a significant (~99% confidence) increase in X-ray luminosity with Mp/a^2. While selection biases are incontrovertibly present within the main-sequence sample, we demonstrate that the effect is primarily driven by a handful of extreme hot-Jupiter systems with Mp/a^2>450 Mjup/AU^2, which here are all X-ray luminous but to a degree commensurate with their Ca II H and K activity, in contrast to presented magnetic star-planet interaction scenarios that predict enhancements relatively larger in Lx. We discuss these results in the context of cumulative tidal spin-up of stars hosting close-in gas giants (potentially followed by planetary infall and destruction). We also test our main-sequence sample for correlations between planetary properties and UV luminosity or Ca II H and K emission, and find no significant dependence.

Miller, Brendan P.; Gallo, Elena; Wright, Jason; Pearson, Elliott

2015-01-01

147

Parenteral Administration of l-Arginine Prevents Fetal Growth Restriction in Undernourished Ewes12  

PubMed Central

Intrauterine growth restriction (IUGR) is a major health problem worldwide that currently lacks an effective therapeutic solution. This study was conducted with an ovine IUGR model to test the hypothesis that parenteral administration of l-arginine (Arg) is effective in enhancing fetal growth. Beginning on d 28 of gestation, ewes were fed a diet providing 100% (control-fed) or 50% (underfed) of NRC-recommended nutrient requirements. Between d 60 of gestation and parturition, underfed ewes received i.v. infusions of saline or 155 ?mol Arg-HCl/kg body weight 3 times daily, whereas control-fed ewes received only saline. The birth weights of lambs from saline-infused underfed ewes were 23% lower (P < 0.01) than those of lambs from control-fed dams. Administration of Arg to underfed ewes increased (P < 0.01) concentrations of Arg (69%), ornithine (55%), proline (29%), methionine (37%), leucine (36%), isoleucine (35%), cysteine (19%), and FFA (43%) in maternal serum, decreased maternal circulating levels of ammonia (18%) and triglycerides (32%), and enhanced birth weights of lambs by 21% compared with saline-infused underfed ewes. There was no difference in birth weights of lambs between the control-fed and the Arg-infused underfed ewes. These novel results indicate that parenteral administration of Arg to underfed ewes prevented fetal growth restriction and provide support for its clinical use to ameliorate IUGR in humans. The findings also lay a new framework for studying cellular and molecular mechanisms responsible for the beneficial effects of Arg in regulating conceptus growth and development. PMID:20505020

Lassala, Arantzatzu; Bazer, Fuller W.; Cudd, Timothy A.; Datta, Sujay; Keisler, Duane H.; Satterfield, M. Carey; Spencer, Thomas E.; Wu, Guoyao

2010-01-01

148

A Comprehensive Statistical Assessment of Star-Planet Interaction  

NASA Astrophysics Data System (ADS)

We investigate whether magnetic interaction between close-in giant planets and their host stars produce observable statistical enhancements in stellar coronal or chromospheric activity. New Chandra observations of 12 nearby (d < 60 pc) planet-hosting solar analogs are combined with archival Chandra, XMM-Newton, and ROSAT coverage of 11 similar stars to construct a sample inoculated against inherent stellar class and planet-detection biases. Survival analysis and Bayesian regression methods (incorporating both measurements errors and X-ray upper limits; 13/23 stars have secure detections) are used to test whether "hot Jupiter" hosts are systematically more X-ray luminous than comparable stars with more distant or smaller planets. No significant correlations are present between common proxies for interaction strength (M P/a 2 or 1/a) versus coronal activity (L X or L X/L bol). In contrast, a sample of 198 FGK main-sequence stars does show a significant (~99% confidence) increase in X-ray luminosity with M P/a 2. While selection biases are incontrovertibly present within the main-sequence sample, we demonstrate that the effect is primarily driven by a handful of extreme hot-Jupiter systems with M P/a 2 > 450 M Jup AU-2, which here are all X-ray luminous but to a degree commensurate with their Ca II H and K activity, in contrast to presented magnetic star-planet interaction scenarios that predict enhancements relatively larger in L X. We discuss these results in the context of cumulative tidal spin-up of stars hosting close-in gas giants (potentially followed by planetary infall and destruction). We also test our main-sequence sample for correlations between planetary properties and UV luminosity or Ca II H and K emission, and find no significant dependence.

Miller, Brendan P.; Gallo, Elena; Wright, Jason T.; Pearson, Elliott G.

2015-02-01

149

THE PARSEC-SCALE ENVIRONMENT AND THE EVOLUTIONARY STATUS OF MWC 349A  

SciTech Connect

We report on a study of the ?10' (?5 pc in projection) environs of the peculiar, high-luminosity emission-line star MWC 349A in the IR, radio, and visible domains. Besides the recently discovered X-shaped, arcmin-scale IR nebula centered on MWC 349A ({sup X} nebula{sup )}, with the kinematic age of ?10{sup 4} yr, we identify several young objects pointing toward an ongoing process of active star formation in this region and estimate some physical parameters of the newly discovered objects. The radiation of the X nebula is due to a geometrically and optically thin dust front heated to T{sub d} ? 60-70 K by the radiation of the central star. The bipolar dust front probably results from the interaction of a powerful stellar wind with the circumstellar disk. One of the related objects is an elongated, cold molecular cloud, ?1 pc in size, adjacent to MWC 349A in projection and having the same radial velocity (V{sub LSR} ? +9 km s{sup –1}). The proximity of the molecular cloud may indicate that MWC 349A was born locally rather than being a runaway object ejected from the core of Cyg OB2 several Myr ago. If it is still associated with its natal cloud, MWC 349A may be a rare example of the observable pre-main-sequence stage of a ?30 M{sub ?} star. If the association with the molecular cloud is an effect of projection, however, MWC 349A may already be an evolved star, even if it was born locally. We discuss future observations that may shed more light on the evolutionary status of this unique object.

Strelnitski, Vladimir; Armstrong, Peter; Lagergren, Krister; Walker, Gary [Maria Mitchell Observatory, 4 Vestal Street, Nantucket, MA 02554 (United States); Bieging, John H. [Steward Observatory, The University of Arizona, Tucson, AZ 85721 (United States); Hora, Joseph; Smith, Howard A., E-mail: vladimir@mariamitchell.org, E-mail: bailyhill14@gmail.com, E-mail: PeterArmstrong@limpiaobservatory.com, E-mail: jbieging@as.arizona.edu, E-mail: jhora@cfa.harvard.edu, E-mail: hsmith@cfa.harvard.edu, E-mail: kal7q@virginia.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

2013-11-10

150

Identification of Functional Regions in the Rhodospirillum rubrum L-Asparaginase by Site-Directed Mutagenesis.  

PubMed

Site-directed mutagenesis of Rhodospirillum rubrum L-asparaginase (RrA) was performed in order to identify sites of the protein molecule important for its therapeutic and physico-chemical properties. Ten multipoint mutant genes were obtained, and five recombinant RrA variants were expressed in E. coli BL21(DE3) cells and isolated as functionally active highly purified proteins. Protein purification was performed using Q-Sepharose and DEAE-Toyopearl chromatography. Overall yield of the active enzymes was 70-80 %, their specific activity at pH 7.4 and 37 °C varied of 140-210 U/mg. L-Glutaminase activity did not exceed 0.01 % of L-asparaginase activity. All RrA mutants showed maximum enzyme activity at pH 9.3-9.5 and 53-58 °C. Km and Vmax values for L-asparagine were evaluated for all mutants. Mutations G86P, D88H, M90K (RrAH), G121L, D123A (Rr?I) caused the loss of enzyme activity and confirmed the importance of these sites in the implementation of catalytic functions. Removal of four residues from C-terminal area of the enzyme (RrAK) resulted in the enzyme instability. Mutations D60K, F61L(Rr?D), and R118H, G120R(Rr?J) led to the improvement of kinetic parameters and enzyme stabilization. Substitutions E149R, V150P (Rr?B) improved antineoplastic and cytotoxic activity of the RrA. A64V, E67K substitutions, especially in combination with E149R, V150P (Rr?E), considerably destabilized recombinant enzyme. PMID:25370827

Pokrovskaya, M V; Aleksandrova, S S; Pokrovsky, V S; Veselovsky, A V; Grishin, D V; Abakumova, O Yu; Podobed, O V; Mishin, A A; Zhdanov, D D; Sokolov, N N

2015-03-01

151

Crystal Structures of Aspergillus japonicus Fructosyltransferase Complex with Donor/Acceptor Substrates Reveal Complete Subsites in the Active Site for Catalysis*  

PubMed Central

Fructosyltransferases catalyze the transfer of a fructose unit from one sucrose/fructan to another and are engaged in the production of fructooligosaccharide/fructan. The enzymes belong to the glycoside hydrolase family 32 (GH32) with a retaining catalytic mechanism. Here we describe the crystal structures of recombinant fructosyltransferase (AjFT) from Aspergillus japonicus CB05 and its mutant D191A complexes with various donor/acceptor substrates, including sucrose, 1-kestose, nystose, and raffinose. This is the first structure of fructosyltransferase of the GH32 with a high transfructosylation activity. The structure of AjFT comprises two domains with an N-terminal catalytic domain containing a five-blade ?-propeller fold linked to a C-terminal ?-sandwich domain. Structures of various mutant AjFT-substrate complexes reveal complete four substrate-binding subsites (?1 to +3) in the catalytic pocket with shapes and characters distinct from those of clan GH-J enzymes. Residues Asp-60, Asp-191, and Glu-292 that are proposed for nucleophile, transition-state stabilizer, and general acid/base catalyst, respectively, govern the binding of the terminal fructose at the ?1 subsite and the catalytic reaction. Mutants D60A, D191A, and E292A completely lost their activities. Residues Ile-143, Arg-190, Glu-292, Glu-318, and His-332 combine the hydrophobic Phe-118 and Tyr-369 to define the +1 subsite for its preference of fructosyl and glucosyl moieties. Ile-143 and Gln-327 define the +2 subsite for raffinose, whereas Tyr-404 and Glu-405 define the +2 and +3 subsites for inulin-type substrates with higher structural flexibilities. Structural geometries of 1-kestose, nystose and raffinose are different from previous data. All results shed light on the catalytic mechanism and substrate recognition of AjFT and other clan GH-J fructosyltransferases. PMID:20466731

Chuankhayan, Phimonphan; Hsieh, Chih-Yu; Huang, Yen-Chieh; Hsieh, Yi-You; Guan, Hong-Hsiang; Hsieh, Yin-Cheng; Tien, Yueh-Chu; Chen, Chung-De; Chiang, Chien-Min; Chen, Chun-Jung

2010-01-01

152

Growth temperature alters Salmonella Enteritidis heat/acid resistance, membrane lipid composition and stress/virulence related gene expression.  

PubMed

The influence of growth temperature (10, 25, 37, and 42 °C) on the survival of Salmonella Enteritidis in simulated gastric fluid (SGF; pH=2.0) and during heat treatment (54, 56, 58, and 60 °C), on the membrane fatty acid composition, as well as on stress-/virulence-related gene expression was studied. Cells incubated at temperatures lower or higher than 37 °C did not increase their acid resistance, with the maximum D-value of 3.07 min in cells grown at 37 °C; while those incubated at higher temperature increased their heat resistance, with the maximum D60 °C-values of 1.4 min in cells grown at 42 °C. A decrease in the ratio of unsaturated to saturated fatty acids was observed as the growth temperature increased. Compared to the control cells grown at 37 °C, the expression of rpoS was 16.5- and 14.4-fold higher in cells cultivated at 10 and 25 °C, respectively; while the expression of rpoH was 2.9-fold higher in those cultivated at 42 °C. The increased expression of stress response gene rpoH and the decreased ratio of unsaturated to saturated fatty acids correlated with the greater heat resistance of bacteria grown at 42 °C; while the decreased expression of stress response gene rpoS at 42 °C might contribute to the decrease in acid resistance. Virulence related genes-spvR, hilA, avrA-were induced in cells cultivated at 42 °C, except sefA which was induced in the control cells. This study indicates that environmental temperature may affect the virulence potential of S. Enteritidis, thus temperature should be well controlled during food storage. PMID:24368153

Yang, Yishan; Khoo, Wei Jie; Zheng, Qianwang; Chung, Hyun-Jung; Yuk, Hyun-Gyun

2014-02-17

153

Effect of protein level in prepartum diets on metabolism and performance of dairy cows.  

PubMed

Multigravid Holstein cows (n = 75) were used in a randomized block design to evaluate the effect of prepartum diets formulated to supply surplus energy and incremental concentrations of protein on the nutritional status of dairy cows at parturition. Cows were blocked according to expected calving date and assigned to one of five diets: 9.7, 11.7, 13.7, 14.7, and 16.2% crude protein (CP). Dietary treatments were initiated 28 d before expected calving date and fed until parturition. A common diet was fed postpartum. Dry matter intake and milk yield were recorded daily through 90 d postpartum. Increasing the protein concentration from 9.7 to 14.7% of dry matter during the last 28 d of gestation improved responses of cows during lactation. Increasing dietary protein up to 14.7% also increased milk yield response to recombinant bovine somatotropin (rbST) during the ninth week of lactation and yields of 305-d 2x mature equivalent milk, milk protein, and milk fat. Plasma aspartate aminotransferase tended to be highest in cows fed 13.7 and 14.7% CP prepartum, but decreased linearly postpartum in response to dietary protein levels. There were no treatment differences for plasma insulin-like growth factor-1 (IGF-1) at d 60 postpartum (before rbST provision), but IGF-1 on d 90 (after rbST provision) was higher in plasma of cows fed 14.7% CP than the other diets except 13.7% CP. Close-up diets containing 13.7% CP and surplus energy produced the most beneficial outcomes during the subsequent lactation. PMID:12201533

Park, A F; Shirley, J E; Titgemeyer, E C; Meyer, M J; VanBaale, M J; VandeHaar, M J

2002-07-01

154

Effect of climatic conditions, season and wastewater quality on contaminant removal efficiency of two experimental constructed wetlands in different regions of Spain.  

PubMed

The aim of this study was to examine the effects of climate, season and wastewater quality on contaminant removal efficiency of constructed wetlands implemented in Mediterranean and continental-Mediterranean climate region of Spain. To this end, two experimental horizontal subsurface flow constructed wetlands located in Barcelona and León (Spain) were compared. The two constructed wetland systems had the same experimental set-up. Each wetland had a surface area of 2.95 m(2), a water depth of 25 cm and a granular medium of D(60)=7.3 mm, and was planted with Phragmites australis. Both systems were designed in order to operate with a maximum organic loading rate of 6 g(DBO) m(-2) d(-1). Experimental systems operated with a hydraulic loading rate of 28.5 and 98 mm d(-1) in Barcelona and León, respectively. Total suspended solids, biochemical oxygen demand and ammonium mass removal efficiencies followed seasonal trends, with higher values in the summer (97.4% vs. 97.8%; 97.1% vs. 96.2%; 99.9% vs. 88.9%, in Barcelona and León systems, respectively) than in the winter (83.5% vs. 74.4%; 73.2% vs. 60.6%; 19% vs. no net removal for ammonium in Barcelona and León systems, respectively). During the cold season, biochemical oxygen demand and ammonium removal were significantly higher in Barcelona system than in León, as a result of higher temperature and redox potential in Barcelona. During the warm season, statistical differences were observed only for ammonium removal. Results showed that horizontal subsurface flow constructed wetland is a successful technology for both regions considered, even if winter seemed to be a critical period for ammonium removal in continental climate regions. PMID:22910037

Garfí, Marianna; Pedescoll, Anna; Bécares, Eloy; Hijosa-Valsero, María; Sidrach-Cardona, Ricardo; García, Joan

2012-10-15

155

Prophylactic effect of egualen sodium, a stable azulene derivative, on gastrointestinal damage induced by ischemia/reperfusion, double antiplatelet therapy and loxoprofen in rats.  

PubMed

We examined the effect of egualen, a stable azulene derivative, against gastric damage induced by ischemia/reperfusion (I/R), gastric bleeding induced by double antiplatelet therapy with aspirin (ASA) plus clopidogrel, and small intestinal damage generated by loxoprofen, and investigated the possible mechanisms involved in its protective action. Male C57BL/6 mice or SD rats were used under urethane anesthesia (gastric lesions) or in a conscious (intestinal lesions) state. I/R-induced gastric injury was produced in mice by clamping the celiac artery for 30 min, followed by reperfusion for 60 min. Gastric bleeding was induced in rats by luminal perfusion with 25 mM ASA+50 mM HCl for 2 hours in the presence of clopidogrel (30 mg/kg). To produce small intestinal lesions the rats were given loxoprofen (60 mg/kg) p.o. and killed 24 hours later. Egualen was given i.d. 60 min before I/R or ASA perfusion, while given p.o. twice 30 min before and 6 hours after loxoprofen. Egualen significantly prevented the I/R-induced gastric damage, and the effect was equivalent to that of seratrodast (TXA2 antagonist). This agent also significantly suppressed gastric bleeding induced by ASA plus clopidogrel, similar to PGE2. Likewise, egualen significantly prevented loxoprofen-induced damage in the small intestine, accompanied by an increase in the secretion of mucus and suppression of bacterial invasion as well as iNOS expression. These results suggest that egualen has a prophylactic effect against various lesions in the gastrointestinal mucosa, probably through its characteristic pharmacological properties, such as TXA2 antagonistic action, local mucosal protection, and stimulation of mucus secretion. PMID:23568973

Amagase, K; Yoshida, Y; Hara, D; Murakami, T; Takeuchi, K

2013-02-01

156

Short communication: Endoplasmic reticulum stress gene network expression in bovine mammary tissue during the lactation cycle.  

PubMed

The endoplasmic reticulum (ER) has a crucial role in cellular metabolism. Recent studies in nonruminants discovered that components of the ER stress pathway, induced during the unfolded protein response, play critical roles in regulating lipogenesis. The bovine mammary gland faces extreme metabolic stress at the onset of lactation due primarily to the increase in flux through pathways associated with milk fat and protein synthesis. Our objective was to study, via quantitative real-time PCR, the expression of the ER stress pathway components P58IPK, PERK, XBP1, ATF4, ATF3, ATF6, CHOP, MBTPS1, GRP94, and BiP in mammary tissue (n=7 cows × 5 time points) collected at -15, 1, 15, 60, and 240 d relative to parturition. Expression of P58IPK and ATF4 increased to a peak at d 60, followed by a decrease by d 240 postpartum. Despite the decrease in expression by 240 d, P58IPK remained higher than prepartal levels (d -15). Expression patterns of ATF3 and CHOP were similar and peaked at d 15, followed by a decrease through d 240, at which point CHOP expression was still greater than prepartal levels. The sharp increase in milk production postpartum (d 15) as well as apoptosis during late lactation (240 d) may have induced a pseudo unfolded protein response state. This is supported by the similar expression patterns of P58IPK and PERK. In the context of lactation, however, transcriptional changes in the ER stress pathway at different stages of the lactation cycle are a normal aspect of the tissue's adaptation to the changing physiological state. PMID:22541483

Invernizzi, G; Naeem, A; Loor, J J

2012-05-01

157

Phosphorus sorption capacities and physicochemical properties of nine substrate materials for constructed wetland.  

PubMed

Constructed wetland (CW) is a promising technique for removal of pollutants from wastewater and agricultural runoff. The performance of a CW to remove pollutants, however, hinges on the use of suitable substrate materials. This study examined the physicochemical properties and phosphorus (P) sorption capacities of nine different CW substrate materials using both batch experiments and the Freundlich as well as the Langmuir isotherm. The nine substrate materials used in this study were turf, topsoil, gravel, midsized sand (MSS), blast furnace slag (BFS), coal burn slag (CBS), blast furnace artificial slag (BFAS), coal burn artificial slag (CBAS), and midsized artificial sand (MSAS). Experimental data showed that sorption of P increased with initial solution P concentrations for all nine substrate materials. The maximum P sorption capacity of the substrate materials estimated by Langmuir isotherm was in the following order: turf (4243 mg/kg substrate) > BFAS (2116 mg/kg substrate) > BFS (1598 mg/kg substrate) > CBS (1449 mg/kg substrate) > top soil (1396 mg/kg substrate) > CBAS (1194 mg/kg substrate) > MSAS (519 mg/kg substrate) > gravel (494 mg/kg substrate) > MSS (403 mg/kg substrate). The specific gravity of eight substrate materials (except gravel) had very significant negative correlations with the P sorption, whereas the particle diameter of D(60) and uniformity coefficient (K(60)) had positive correlations with the P sorption. The cation exchange capacity, organic matter, available ferrous, and exchangeable aluminum of the eight substrate materials also had very significant positive correlations with the P sorption, while the pH of the substrate materials showed a very significant negative correlation with the P sorption. Our study further suggests that turf and CBAS are the two relatively ideal substrate materials suitable for removal of P from a CW system. PMID:18175159

Cui, Lihua; Zhu, Xizhen; Ma, Mei; Ouyang, Ying; Dong, Mei; Zhu, Wenling; Luo, Shiming

2008-08-01

158

Phosphorus sorption capacities and physicochemical properties of nine substrate materials for constructed wetland  

SciTech Connect

Constructed wetland (CW) is a promising technique for removal of pollutants from wastewater and agricultural runoff. The performance of a CW to remove pollutants, however, hinges on the use of suitable substrate materials. This study examined the physicochemical properties and phosphorus (P) sorption capacities of nine different CW substrate materials using both batch experiments and the Freundlich as well as the Langmuir isotherm. The nine substrate materials used in this study were turf, topsoil, gravel, midsized sand (MSS), blast furnace slag (BFS), coal burn slag (CBS), blast furnace artificial slag (BFAS), coal burn artificial slag (CBAS), and midsized artificial sand (MSAS). Experimental data showed that sorption of P increased with initial solution P concentrations for all nine substrate materials. The maximum P sorption capacity of the substrate materials estimated by Langmuir isotherm was in the following order: turf (4243 mg/kg substrate) > BFAS (2116 mg/kg substrate) > BFS (1598 mg/kg substrate) > CBS (1449 mg/kg substrate) > top soil (1396 mg/kg substrate) > CBAS (1194 mg/kg substrate) > MSAS (519 mg/kg substrate) > gravel (494 mg/kg substrate) > MSS (403 mg/kg substrate). The specific gravity of eight substrate materials (except gravel) had very significant negative correlations with the P sorption, whereas the particle diameter of D-60 and uniformity coefficient (K-60) had positive correlations with the P sorption. The cation exchange capacity, organic matter, available ferrous, and exchangeable aluminum of the eight substrate materials also had very significant positive correlations with the P sorption, while the pH of the substrate materials showed a very significant negative correlation with the P sorption. Our study further suggests that turf and CBAS are the two relatively ideal substrate materials suitable for removal of P from a CW system.

Cui, L.H.; Zhu, X.Z.; Ma, M.; Ouyang, Y.; Dong, M.; Zhu, W.L.; Luo, S.M. [South China Agricultural University, Guangdong (China)

2008-08-15

159

In utero exposure to the endocrine disruptor di-(2-ethylhexyl) phthalate induces long-term changes in gene expression in the adult male adrenal gland.  

PubMed

The plasticizer di-(2-ethylhexyl) phthalate (DEHP) is used to add flexibility to polyvinylchloride polymers and as a component of numerous consumer and medical products. DEHP and its metabolites have been detected in amniotic fluid and umbilical cord blood, suggesting fetal exposure. In the present study, we used an in utero exposure model in which pregnant rat dams were exposed to 1- to 300-mg DEHP/kg·d from gestational day 14 until birth. We previously reported that this window of exposure to environmentally relevant doses of DEHP resulted in reduced levels of serum testosterone and aldosterone in adult male offspring and that the effects on aldosterone were sustained in elderly rats and resulted in decreased blood pressure. Here, we characterized the long-term effects of in utero DEHP exposure by performing global gene expression analysis of prepubertal (postnatal d 21) and adult (postnatal d 60) adrenal glands. We found that the peroxisome proliferator-activated receptor and lipid metabolism pathways were affected by DEHP exposure. Expression of 2 other DEHP targets, hormone-sensitive lipase and phosphoenolpyruvate carboxykinase 1 (Pck1), correlated with reduced aldosterone levels and may account for the inhibitory effect of DEHP on adrenal steroid formation. The angiotensin II and potassium pathways were up-regulated in response to DEHP. In addition, the potassium intermediate/small conductance calcium-activated channel Kcnn2 and 2-pore-domain potassium channel Knck5 were identified as DEHP targets. Based on this gene expression analysis, we measured fatty acid-binding protein 4 and phosphoenolpyruvate carboxykinase 1 in sera from control and DEHP-exposed rats and identified both proteins as putative serum biomarkers of in utero DEHP exposure. These results shed light on molecular targets that mediate DEHP long-term effects and, in doing so, provide means by which to assess past DEHP exposure. PMID:24564399

Martinez-Arguelles, D B; Campioli, E; Lienhart, C; Fan, J; Culty, M; Zirkin, B R; Papadopoulos, V

2014-05-01

160

Evaluation of preferable insertion routes for esophagogastroduodenoscopy using ultrathin endoscopes  

PubMed Central

AIM: To evaluate the discomfort associated with esophagogastroduodenoscopy (EGD) using an ultrathin endoscope through different insertion routes. METHODS: This study (January 2012-March 2013) included 1971 consecutive patients [male/female (M/F), 1158/813, 57.5 ± 11.9 years] who visited a single institute for annual health checkups. Transnasal EGD was performed in 1394 patients and transoral EGD in 577. EGD-associated discomfort was assessed using a visual analog scale score (VAS score: 0-10). RESULTS: Multivariate analysis revealed gender (M vs F: 4.02 ± 2.15 vs 5.06 ± 2.43) as the only independent predictor of the VAS score in 180 patients who underwent EGD for the first time; whereas it revealed gender (M vs F 3.60 ± 2.20 vs 4.84 ± 2.37), operator, age group (A: < 39 years; B: 40-49 years; C: 50-59 years; D: 60-69 years; E: > 70 years; A/B/C/D/E: 4.99 ± 2.32/4.34 ± 2.49/4.19 ± 2.31/3.99 ± 2.27/3.63 ± 2.31), and type of insertion as independent predictors in the remaining patients. Subanalysis for gender, age group, and insertion route revealed that the VAS score decreased with age regardless of gender and insertion route, was high in female patients regardless of age and insertion route, and was low in males aged over 60 years who underwent transoral insertion. CONCLUSION: Although comprehensive analysis revealed that the insertion route may not be an independent predictor of the VAS score, transoral insertion may reduce EGD-associated discomfort in elderly patients. PMID:24803817

Ono, Satoshi; Niimi, Keiko; Fujishiro, Mitsuhiro; Takahashi, Yu; Sakaguchi, Yoshiki; Nakayama, Chiemi; Minatsuki, Chihiro; Matsuda, Rie; Hirayama-Asada, Itsuko; Tsuji, Yosuke; Mochizuki, Satoshi; Kodashima, Shinya; Yamamichi, Nobutake; Ozeki, Atsuko; Matsumoto, Lumine; Ohike, Yumiko; Yamazaki, Tsutomu; Koike, Kazuhiko

2014-01-01

161

Influence of sex and castration of females on growth performance and carcass and meat quality of heavy pigs destined for the dry-cured industry.  

PubMed

Crossbred pigs (n = 240) from Pietrain x Large White sires mated to Landrace x Large White dams, with an average age of 100 d (60.5 +/- 2.3 kg of BW), were used to investigate the effects of sex and slaughter weight (SW) on growth performance and on carcass and meat quality characteristics. There were 6 treatments arranged factorially, with 3 classes (intact females, IF; castrated females, CF; and castrated males, CM) and 2 slaughter weights (114 and 122 kg of BW). Each of the 6 combinations of treatments was replicated 4 times, and the experimental unit was a pen with 10 pigs. Castrated males and CF ate more feed, grew faster, and had more carcass backfat depth and fat thickness at the gluteus medius muscle but lower loin yield than IF (P < 0.05). In addition, CF and CM had more intramuscular fat (P < 0.05) and less linoleic acid content in the subcutaneous fat (P < 0.01) than IF. Pigs slaughtered at 122 kg of BW had lower ADG (P < 0.05), decreased G:F (P < 0.05), and more gluteus medius fat than pigs slaughtered at 114 kg of BW (P < 0.05). It was concluded that CF and CM had similar productive performance and meat quality characteristics when slaughtered at the same age, and that castration of females improved ADG and increased weight and fat content of primal cuts with respect to IF. Therefore, castration of females is recommended in pigs destined for the dry-cured industry because of the beneficial effects on quality of the primal cuts. PMID:18310495

Peinado, J; Medel, P; Fuentetaja, A; Mateos, G G

2008-06-01

162

F-18 labeled 3-fluorodiazepam  

SciTech Connect

3-Fluorodiazepam is a new and potent antianxiety agent with prolonged action. The authors found that molecular fluorine (0.5% in Ne) reacts cleanly with diazepam in freon or chloroform at room temperature to produce 3-fluorodiazepam in good yields. Successful syntheses have employed 2:1 to 5:1 molar ratios diazepam: fluorine to minimize the formation of byproducts. (/sup 18/F) 3-Fluorodiazepam, a potential candidate for PET studies, (specific activity 3-5 Ci/mmol) has been synthesized from /sup 18/F-F/sub 2/ using the same procedure, followed by column chromatographic purification (Silicagel, dichloromethane: ethyl acetate, 5:1) with a radiochemical yield of 12-20% (50% maximum) and a chemical and radiochemical purity >99% as judged by reversed-phase high pressure liquid chromatography analysis (Ultrasyl octyl column, 10 ..mu.. m, 4.6 x 250 mm i.d., 60% MeOH 40% water; flow rate, 1.0 ml/min; retention time for (/sup 18/F) fluorodiazepam, 11.4 min; for diazepam, 13.5 min; radioactivity and ultraviolet detectors). Lower radiochemical yields (5-7%), and significant formation of by-products were observed when (/sup 18/F)acetylhypofluorite, prepared in the gasphase, was used as the reagent. Readily accessible routes to /sup 18/F-labeled benzodiazepines of higher specific activity were also investigated. Approaches to the synthesis of high specific activity (>200 Ci/mmol) (/sup 18/F)3-fluorodiazepam involve nucleophilic displacement at carbon-3 (e.g. from 3-chlorodiazepam) with (/sup 18/F)fluoride ion. The results presented here demonstrate the synthetic accessibility of /sup 18/F-labeled benzodiazepines for application in neurotransmitter ligand studies with PET.

Luxen, A.; Barrio, J.R.; Bida, G.T.; Satyamurthy, N.; Phelps, M.E.

1985-05-01

163

Generalized Polynomial Chaos Based Uncertainty Quantification for Planning MRgLITT Procedures  

PubMed Central

Purpose A generalized polynomial chaos (gPC) method is used to incorporate constitutive parameter uncertainties within the Pennes representation of bioheat transfer phenomena. The stochastic temperature predictions of the mathematical model are critically evaluated against MR thermometry data for planning MR-guided Laser Induced Thermal Therapies (MRgLITT). Methods Pennes bioheat transfer model coupled with a diffusion theory approximation of laser tissue interaction was implemented as the underlying deterministic kernel. A probabilistic sensitivity study was used to identify parameters that provide the most variance in temperature output. Confidence intervals of the temperature predictions are compared to MR temperature imaging (MRTI) obtained during phantom and in vivo canine (n=4) MRgLITT experiments. The gPC predictions were quantitatively compared to MRTI data using probabilistic linear and temporal profiles as well as 2-D 60 °C isotherms. Results Within the range of physically meaningful constitutive values relevant to the ablative temperature regime of MRgLITT, the sensitivity study indicated that the optical parameters, particularly the anisotropy factor, created the most variance in the stochastic model's output temperature prediction. Further, within the statistical sense considered, a nonlinear model of the temperature and damage dependent perfusion, absorption, and scattering is captured within the confidence intervals of the linear gPC method. Multivariate stochastic model predictions using parameters with the dominant sensitivities show good agreement with experimental MRTI data. Conclusions Given parameter uncertainties and mathematical modeling approximations of the Pennes bioheat model, the statistical framework demonstrates conservative estimates of the therapeutic heating and has potential for use as a computational prediction tool for thermal therapy planning. PMID:23692295

Fahrenholtz, S.; Stafford, R. J.; Maier, F.; Hazle, J. D.; Fuentes, D.

2014-01-01

164

Combined use of a transformed red mud reactive barrier and electrokinetics for remediation of Cr/As contaminated soil.  

PubMed

A reactive barrier (RB) of transformed red mud (TRM), a by-product of the refinement of bauxite in alumina production, was placed adjacent to the anode of an electrokinetic (EK) system with the aim of enhancing removal of chromium or arsenic, added singly to a low permeability clayey soil, and favouring entrapment. The innovative study focused on evaluation of the synergic interaction between the EK system and the RB, and of the efficiency when compared to traditional EK remediation (control tests). The results obtained underlined the successful outcome of treatment of the Cr(VI)-contaminated soil. In presence of the TRM RB, 19.4% wt. of total Cr content was detected in the anolyte and 20.6% wt. trapped in the anodic RB after 6d, versus 6.6% wt. in the anolyte and 8.8% wt. in the soil adjacent to the anode following the control run without RB. On increasing duration of treatment up to 12d, 60.8% wt. of total initial Cr was found in the anolyte and 25.5% wt. trapped in the RB, versus 9.1% wt. and 5.3% wt., respectively, after a control run of the same duration. Finally, on increasing the mass of TRM in the RB, 60.6% wt. of initial Cr content was found to have accumulated in the RB, with Cr being completely absent from the anodic chamber. Conversely, combined treatment was much less effective on As contaminated soil, at least under the operative conditions applied. Low initial As concentration and interference with iron oxides in the soil were likely the reasons underlying low efficiency while attempting As decontamination. PMID:22119416

Cappai, G; De Gioannis, G; Muntoni, A; Spiga, D; Zijlstra, J J P

2012-01-01

165

Enlarging the Toolbox for Allergen Epitope Definition with an Allergen-Type Model Protein  

PubMed Central

Background Birch pollen-allergic subjects produce polyclonal cross-reactive IgE antibodies that mediate pollen-associated food allergies. The major allergen Bet v 1 and its homologs in plant foods bind IgE in their native protein conformation. Information on location, number and clinical relevance of IgE epitopes is limited. We addressed the use of an allergen-related protein model to identify amino acids critical for IgE binding of PR-10 allergens. Method Norcoclaurine synthase (NCS) from meadow rue is structurally homologous to Bet v 1 but does not bind Bet v 1-reactive IgE. NCS was used as the template for epitope grafting. NCS variants were tested with sera from 70 birch pollen allergic subjects and with monoclonal antibody BV16 reported to compete with IgE binding to Bet v 1. Results We generated an NCS variant (?29NCSN57/I58E/D60N/V63P/D68K) harboring an IgE epitope of Bet v 1. Bet v 1-type protein folding of the NCS variant was evaluated by 1H-15N-HSQC NMR spectroscopy. BV16 bound the NCS variant and 71% (50/70 sera) of our study population showed significant IgE binding. We observed IgE and BV16 cross-reactivity to the epitope presented by the NCS variant in a subgroup of Bet v 1-related allergens. Moreover BV16 blocked IgE binding to the NCS variant. Antibody cross-reactivity depended on a defined orientation of amino acids within the Bet v 1-type conformation. Conclusion Our system allows the evaluation of patient-specific epitope profiles and will facilitate both the identification of clinically relevant epitopes as biomarkers and the monitoring of therapeutic outcomes to improve diagnosis, prognosis, and therapy of allergies caused by PR-10 proteins. PMID:25356997

Hartl, Maximilian; Randow, Stefanie; Gubesch, Michaela; Vogel, Lothar; Husslik, Felix; Reuter, Andreas; Lidholm, Jonas; Ballmer-Weber, Barbara; Vieths, Stefan; Rösch, Paul; Schiller, Dirk

2014-01-01

166

Effects of acclimation to handling on performance, reproductive, and physiological responses of Brahman-crossbred heifers.  

PubMed

The objective of this study was to evaluate the effects of acclimation to handling on growth, plasma concentrations of progesterone (P4) and cortisol, temperament, and reproductive performance of Brahman-crossbred heifers. Over 2 consecutive years, 37 Braford and 43 Brahman x Angus heifers were initially evaluated, within 30 d after weaning, for BW and puberty status via transrectal ultrasonography and plasma P4 concentrations (d 0 and 10), and for temperament by measurements of chute score, pen score, and exit velocity (d 10 only). On d 11, heifers were stratified by breed, puberty status, temperament score, BW, and age and randomly assigned to receive or not (control) the acclimation treatment. Acclimated heifers were exposed to a handling process 3 times weekly (Mondays, Wednesdays, and Fridays) for 4 wk (d 11 to 39 of the experiment). The acclimation treatment was applied individually to heifers by processing them through a handling facility, whereas control heifers remained undisturbed on pasture. Heifer puberty status, evaluated via plasma P4 concentrations and transrectal ultrasonography, and BW were assessed again on d 40 and 50, d 80 and 90, and d 120 and 130. Blood samples collected before (d 10) and at the end of the acclimation period (d 40) were also analyzed for plasma concentrations of cortisol. Heifer temperament was assessed again on d 40 of the study. No interactions containing the effects of treatment, breed, and year were detected. Acclimated heifers had reduced (P < 0.01) ADG compared with control heifers (0.50 vs. 0.58 kg/d, respectively). Attainment of puberty and pregnancy, however, was hastened (P = 0.02 and 0.04, respectively) in acclimated heifers compared with control. Acclimated heifers had reduced chute score (P < 0.01) and concentrations of cortisol (P < 0.01) and P4 (P = 0.03; prepubertal heifers only) compared with control heifers after the acclimation period (1.37 vs. 1.84 for chute score; 37.8 vs. 50.5 ng/mL of cortisol; 0.52 vs. 0.78 ng/mL of P4). Results from this study indicated that, although acclimation to handling decreased ADG, it resulted in decreased chute score, reduced plasma concentrations of cortisol and prepubertal P4, and enhanced reproductive performance of Brahman-crossbred heifers. PMID:19617508

Cooke, R F; Arthington, J D; Austin, B R; Yelich, J V

2009-10-01

167

Effects of the provision of large amounts of solid feeds to veal calves on growth and slaughter performance and intravitam and postmortem welfare indicators.  

PubMed

Polish Friesian male calves (n = 78) were used to investigate the effects of innovative feeding plans based on the provision of large amounts of solid feeds on growth performance, welfare, and carcass characteristics of veal calves. Groups of calves (initial BW 71.5 ± 3.7 kg) were fed 1 of 3 treatments (26 calves/treatment): 1) milk replacer plus corn grain (CG), 2) milk replacer plus an 80:20 mixture (as-fed basis) of corn grain and wheat straw (CGS), or 3) milk replacer plus a 72:20:8 mixture (as-fed basis) of corn grain, wheat straw, and extruded soybean, respectively (CGSES). All the treatments provided at least 170 kg DM/calf from solid feed throughout the 206 d of fattening. Type and concentration of milk replacer were the same for all calves throughout fattening. Calves fed CGSES received 96% of the daily amount of milk replacer delivered to CG and CGS to balance the dietary CP content. No differences (P ? 0.063) among treatments were observed for growth performance and DMI. Health status of CG calves was less than CGSES calves, as indicated by the greatest (P < 0.001) proportion of milk replacer refusal events and the greatest (P < 0.001) incidence of treatments for respiratory disorders. Inclusion of straw and soybean in the solid feeds increased (P < 0.001) the daily intake of iron in CGS and CGSES as compared with CG; however, blood hemoglobin concentrations measured at d 5 and 31 were greater (P < 0.05) than when measured on d 80, 122, and 206 of fattening. Feeding treatment did not (P ? 0.107) affect HCW, dressing percentage, or carcass color. Calves fed CG had heavier (P < 0.001) reticulorumens and more (P < 0.001) developed rumens than CGS and CGSES calves, but 84% and 68% of CG rumens (P < 0.001) showed overt signs of hyperkeratinization and plaques, respectively. These alterations of rumen mucosa were not detected in CGSES calves, and only 8% of CGS calves had rumen plaques. Regardless of feeding treatment, postmortem inspection recorded a prevalence of more than 84% abomasal lesions. When feeding veal calves with large amounts of solids, it is advisable to avoid the provision of corn grain alone and replace part of the cereal with a roughage source to improve calf health and prevent rumen mucosa alterations. PMID:22585794

Prevedello, P; Brscic, M; Schiavon, E; Cozzi, G; Gottardo, F

2012-10-01

168

Low cost attitude and heading sensors in terrestrial photogrammetry - calibration and testing  

NASA Astrophysics Data System (ADS)

Most of the contemporary terrestrial mobile mapping systems (MMSs) use tactical or navigation grade inertial measurement units (IMU) to determine the approximated angular exterior orientation (EO) elements of images. Navigation grade IMUs, usually integrated with GNSS receivers, are also used to determine the projection center coordinates. Recent researches show that using also a low-cost attitude and heading reference system (AHRS) or a low-cost IMU, satisfies the demands of certain photogrammetric applications. Our researches aim to evaluate the accuracy of low-cost devices suitable for constructing small, low-cost photogrammetric MMS. During our research two low-cost devices, providing information about image attitude and heading, were tested. The first one is the calibrated Ricoh G700SE GPS camera with an electronic compass and a level indicator. The second device is the Xsens MTi AHRS unit, comprising 3 MEMS (micro-electromechanical systems) gyros, 3 MEMS accelerometers and 3 magnetometers. For the testing purposes the AHRS was combined with the calibrated Nikon D80 SLR camera. The 3D AHRS magnetometer calibration was carried out using the manufacturer's software to compensate for the soft and hard iron effects. The images of three test fields were taken. The images of the first test field with signalized control points were used to determine the boresight rotation matrix of the AHRS. The bundle adjustment was solved separately for each camera and each test field to determine the true (reference) angular exterior orientation parameters. The differences between measured and calculated angles allowed to evaluate the accuracy of the measured angles. The tests results for the GPS camera show high residuals of measured azimuths, however its level indicator allows camera levelling with subdegree accuracy. The results obtained for the low-cost AHRS unit were significantly better, however over 2° residuals for yaw angle were also observed. The results prove the usefulness of the AHRS for constructing a small, hand-held MMS, whereas GPS camera azimuth measurements can be treated rather as a rough approximations in the photogrammetric network adjustment.

Kolecki, J.; Kuras, P.

2011-12-01

169

Direct imaging of extra-solar planets in star forming regions. Lessons learned from a false positive around IM Lupi  

NASA Astrophysics Data System (ADS)

Context. Most exoplanet imagers consist of ground-based adaptive optics coronagraphic cameras which are currently limited in contrast, sensitivity and astrometric precision, but advantageously observe in the near-infrared window (1-5 ?m). Because of these practical limitations, our current observational aim at detecting and characterizing planets puts heavy constraints on target selection, observing strategies, data reduction, and follow-up. Most surveys so far have thus targeted young systems (1-100 Myr) to catch the putative remnant thermal radiation of giant planets, which peaks in the near-infrared. They also favor systems in the solar neighborhood (d < 80 pc), which eases angular resolution requirements but also ensures a good knowledge of the distance and proper motion, which are critical to secure the planet status, and enable subsequent characterization. Aims: Because of their youth, it is very tempting to target the nearby star forming regions, which are typically twice as far as the bulk of objects usually combed for planets by direct imaging. Probing these interesting reservoirs sets additional constraints that we review in this paper by presenting the planet search that we initiated in 2008 around the disk-bearing T Tauri star IM Lup, which is part of the Lupus star forming region (140-190 pc). Methods: We show and discuss why age determination, the choice of evolutionary model for both the central star and the planet, precise knowledge of the host star proper motion, relative or absolute (between different instruments) astrometric accuracy (including plate scale calibration), and patience are the key ingredients for exoplanet searches around more distant young stars. Results: Unfortunately, most of the time, precision and perseverance are not paying off: we discovered a candidate companion around IM Lup in 2008, which we report here to be an unbound background object. We nevertheless review in details the lessons learned from our endeavor, and additionally present the best detection limits ever calculated for IM Lup. We also accessorily report on the successful use of innovative data reduction techniques, such as the damped-LOCI and iterative roll subtraction. Based on the ESO observing programs 380.C-0910, 084.C-0444, 287.C-5040; and HST observing program 10177.

Mawet, D.; Absil, O.; Montagnier, G.; Riaud, P.; Surdej, J.; Ducourant, C.; Augereau, J.-C.; Röttinger, S.; Girard, J.; Krist, J.; Stapelfeldt, K.

2012-08-01

170

On the study of vortex-induced vibration of a cylinder with helical strakes  

NASA Astrophysics Data System (ADS)

While the effect of helical strakes on suppression of Vortex-Induced Vibrations (VIV) has been studied extensively, the mechanism of VIV mitigation using helical strakes is much less well documented in the literature. In the present study, a rigid circular cylinder of diameter d =80 mm attached with three-strand helical strakes of dimensions of 10 d in pitch and 0.12 d in height was tested in a wind tunnel. It was found that the helical strakes can reduce VIV by about 98%. Unlike the bare cylinder, which experiences lock-in over the reduced velocity in the range of 5-8.5, the straked cylinder does not show any lock-in region. In exploring the mechanism of VIV reduction by helical strakes, measurements in stationary bare and straked cylinder wakes using both a single X-probe at four different Reynolds numbers, i.e. Re=10 240, 20 430, 30 610 and 40 800, and two X-probes with variable separations in the spanwise direction at R e=20 430 were conducted. It was found that vortices shed from the straked cylinder are weakened significantly. The dominate frequency varies by about 30% over the range of x / d =10-40 in the streamwise direction while that differs by about 37.2% of the averaged peak frequency over a length of 3.125 d in the spanwise direction. The latter is supported by the phase difference between the velocity signals measured at two locations separated in the spanwise direction. The correlation length of the vortex structures in the bare cylinder wake is much larger than that obtained in the straked cylinder wake. As a result, the straked cylinder wake agrees more closely with isotropy than the bare cylinder wake. Flow visualization on the plane perpendicular to the cylinder axis at Reynolds number of about 300 reveals small-scale vortices in the shear layers of the straked cylinder wake. However, these vortices do not roll up and interact with each other to form the well-organized Karman-type vortices. Flow visualization on the plane parallel to the cylinder axis shows vortex dislocation and swirling flow, which should be responsible for the variations of the peak frequency in the streamwise as well as spanwise directions.

Zhou, T.; Razali, S. F. Mohd.; Hao, Z.; Cheng, L.

2011-10-01

171

Automatic Isolation of Blurred Images from Uav Image Sequences  

NASA Astrophysics Data System (ADS)

Unmanned aerial vehicles (UAV) have become an interesting and active research topic for photogrammetry. Current research is based on images acquired by an UAV, which have a high ground resolution and good spectral and radiometrical resolution, due to the low flight altitudes combined with a high resolution camera. UAV image flights are also cost effective and have become attractive for many applications including change detection in small scale areas. One of the main problems preventing full automation of data processing of UAV imagery is the degradation effect of blur caused by camera movement during image acquisition. This can be caused by the normal flight movement of the UAV as well as strong winds, turbulence or sudden operator inputs. This blur disturbs the visual analysis and interpretation of the data, causes errors and can degrade the accuracy in automatic photogrammetric processing algorithms. The detection and removal of these images is currently achieved manually, which is both time consuming and prone to error, particularly for large image-sets. To increase the quality of data processing an automated filtering process is necessary, which must be both reliable and quick. This paper describes the development of an automatic filtering process, which is based upon the quantification of blur in an image. A "shaking table" was used to create images with known blur during a series of laboratory tests. This platform can be moved in one direction by a mathematical function controlled by a defined frequency and amplitude. The shaking table was used to displace a Nikon D80 digital SLR camera with a user defined frequency and amplitude. The actual camera displacement was measured accurately and exposures were synchronized, which provided the opportunity to acquire images with a known blur effect. Acquired images were processed digitally to determine a quantifiable measure of image blur, which has been created by the actual shaking table function. Once determined for a sequence of images, a user defined threshold can be used to differentiate between "blurred" and "acceptable" images. A subsequent step is to establish the effect that blurred images have upon the accuracy of subsequent measurements. Both of these aspects will be discussed in this paper and future work identified.

Sieberth, T.; Wackrow, R.; Chandler, J. H.

2013-08-01

172

Plane of nutrition influences the performance, innate leukocyte responses, and resistance to an oral Salmonella enterica serotype Typhimurium challenge in Jersey calves.  

PubMed

Two experiments investigated how plane of nutrition influences performance, leukocyte responses, and resistance to an oral Salmonella enterica serotype Typhimurium challenge. In experiment 1, 46 (2±1 d of age) calves were randomly assigned to 2 diets: a low (LPN; n=23) and high plane of nutrition (HPN; n=23). The LPN calves were fed 409 g/d of dry matter (DM) of a 20% crude protein and 20% fat milk replacer, whereas HPN calves were fed 610 and 735 g/d of DM of a 28% crude protein and 25% fat milk replacer during wk 1 and 2 to 6, respectively. In experiment 2, 20 bull calves (LPN; n=11 and HPN; n=9) were orally challenged on d 80 with 1.5×10(7) cfu of Salmonella Typhimurium (ATCC #14028). The HPN calves had a greater incidence (87.5 vs. 45.5%) and duration of days with high fecal scores (5.5 vs. 3.5 d). The LPN calves had greater neutrophil surface expression of L-selectin on d 7, 21, and 42. Following the Salmonella Typhimurium challenge, calf starter DM intake was greater among the HPN calves. The percentage of neutrophils producing an oxidative burst was also greater among HPN calves on d 1 to 5 after the challenge. Similarly, the intensity of the oxidative burst tended to be greater among the HPN calves on d 2 and 3 postchallenge. The secretion of tumor necrosis factor-? from whole-blood cultures stimulated with lipopolysaccharide tended to be greater on d 1 and was greater on d 5 and 6 among HPN calves. The median ranks of haptoglobin concentrations were greater and plasma zinc concentrations tended to be decreased among LPN calves. These data indicate that feeding a HPN to Jersey calves improved average daily gain and feed efficiency, but increased the incidence of high fecal scores during the first few weeks of life; however, the HPN Jersey calves may be more resistant to Salmonella Typhimurium after weaning. PMID:25597967

Ballou, M A; Hanson, D L; Cobb, C J; Obeidat, B S; Sellers, M D; Pepper-Yowell, A R; Carroll, J A; Earleywine, T J; Lawhon, S D

2015-03-01

173

X-ray Emission from Black Holes at the Centers of Nearby Dwarf Galaxies  

NASA Astrophysics Data System (ADS)

As part of a search for intermediate-mass black hole candidates in the local universe, we have assembled a new sample of nearby (d < 80 Mpc) AGNs in dwarf galaxies with stellar masses less than 1010 M?. Collectively, these 28 objects are the least massive galaxies known to contain central black holes. Surprisingly, only two of them show clear evidence of broad emission lines in their optical spectra, indicating a much higher incidence of narrow-line (type 2) AGNs in our low-mass sample than in samples of classical Seyfert galaxies. There are two possible explanations for this. First, our objects may have the same basic structure as luminous Seyfert galaxies but a higher probability that their broad-line regions (BLRs) are obscured along the line of sight (e.g., due to a larger covering factor of the nuclear torus). Alternatively, theoretical work suggests that the BLR becomes increasingly difficult to detect (or may even cease to exist) as luminosity or black-hole mass decreases. Some of our objects, if they are in the relevant mass/luminosity range, could actually be unobscured. To investigate which scenario is more plausible, we have observed a subset of 8 galaxies from our sample with Chandra and XMM-Newton. We find that the ratios of their observed X-ray luminosities and their [O III] emission-line luminosities are very low compared to the intrinsic ratios measured for luminous AGNs, suggesting that our objects are heavily absorbed. Consistent with this conclusion, one well-detected object (NGC 4117) has a typical Seyfert 2 X-ray spectrum with an absorption column density of NH ? 4 × 1023 cm-2. However, the modest spectral evidence available for the remaining objects indicates that their observed X-ray emission is extremely soft, which is not expected in the absorption scenario. We note, though, that the weak fluxes of the soft-spectrum objects (LX ? 1038-1039 erg s-1) could easily be associated with sources in the host galaxy (e.g., diffuse hot gas), leaving open the possibility that the active nuclei are in fact heavily absorbed.

Manheim, Madeleine; Moran, E. C.; LaMassa, S. M.

2013-06-01

174

Specific VpU codon changes were significantly associated with gp120 V3 tropic signatures in HIV-1 B-subtype.  

PubMed

After infection and integration steps, HIV-1 transcriptions increase sharply and singly-spliced mRNAs are produced. These encode Env (gp120 and gp41) and auxiliary proteins Vif, Vpr and VpU. The same localization within the unique structure of the mRNAs suggests that the VpU sequence prior to the Env could affect the Env polyprotein expression.The HIV-1 infection process begins when the gp120 subunit of the envelope glycoprotein complex interacts with its receptor(s) on the target cell. The V3 domain of gp120 is the major determinant of cellular co-receptor binding. According to phenotypic information of HIV-1 isolates, sequences from the VpU to V3 regions (119 in R5- and 120 X4-tropic viruses; one per patient) were analysed. The binomial correlation phi coefficient was used to assess covariation among VpU and gp120(V3) signatures. Subsequently, average linkage hierarchical agglomerative clustering was performed. Beyond the classical V3 signatures (R5-viruses: S11, E25D; X4-viruses: S11KR, E25KRQ), other specific V3 and novel VpU signatures were found to be statistically associated with co-receptor usage. Several statistically significant associations between V3 and VpU mutations were also observed. The dendrogram showed two distinct large clusters: one associated with R5-tropic sequences (bootstrap=0.94), involving: (a) H13NP(V3), E25D(V3), S11(V3), T22A(V3) and Q61H(VpU), (b) E25A(V3) and L12F(VpU), (c) D44E(VpU), R18Q(V3) and D80N(VpU); and another associated with X4-tropic sequences (bootstrap=0.97), involving: (i) E25I(V3) and V10A(VpU), (ii) 0-1insV(VpU), H13R(V3), I46L(VpU), I30M(V3) and 60-62del(VpU), (iii) S11KR(V3) and E25KRQ(V3). Some of these pairs of mutations were encoded always by one specific codon. These data indicate the possible VpU mutational patterns contributing to regulation of HIV-1 tropism. PMID:23271577

Dimonte, Salvatore; Babakir-Mina, Muhammed; Aquaro, Stefano; Perno, Carlo-Federico

2012-12-01

175

Mutagenesis of Klebsiella aerogenes UreG to Probe Nickel Binding and Interactions with Other Urease-Related Proteins†  

PubMed Central

UreG is a GTPase required for assembly of the nickel-containing active site of urease. Herein, a Strep-tagged Klebsiella aerogenes UreG (UreGStr) and selected site-directed variants of UreGStr were constructed for studying the in vivo effects on urease activation in recombinant Escherichia coli cells, characterizing properties of the purified proteins, and analysis of in vivo and in vitro protein-protein interactions. Whereas the Strep-tag had no effect on UreG’s ability to activate urease, enzyme activity was essentially abolished in the K20A, D49A, C72A, H74A, D80A, and S111A UreGStr variants, with diminished activity also noted with E25A, C28A, and S115A proteins. Lys20 and Asp49 are likely to function in binding/hydrolysis of GTP and binding of Mg, respectively. UreGStr binds one nickel or zinc ion per monomer (Kd = ~5 ?M for each metal ion) at a binding site that includes Cys72, as shown by a 12-fold increased Kd for nickel ions using C72A UreGStr and by a thiolate-to-nickel charge-transfer band that is absent in the mutant protein. Based on UreG homology to HypB, a GTPase needed for hydrogenase assembly, along with the mutation results, His74 is likely to be an additional metal ligand. In vivo pull-down assays revealed Asp80 as critical for stabilizing UreGStr interaction with the UreABC-UreDF complex. In vitro pull-down assays demonstrated UreG binding to UreE, with the interaction enhanced by nickel or zinc ions. The metallochaperone UreE is suggested to transfer its bound nickel to UreG in the UreABC-UreDFG complex, with the metal ion subsequently transferring to UreD, and then into the nascent active site of urease in a GTP-dependent process. PMID:20533838

Boer, Jodi L.; Quiroz-Valenzuela, Soledad; Anderson, Kimberly L.; Hausinger, Robert P.

2010-01-01

176

Structural characteristics of the nonallosteric human cytosolic malic enzyme.  

PubMed

Human cytosolic NADP(+)-dependent malic enzyme (c-NADP-ME) is neither a cooperative nor an allosteric enzyme, whereas mitochondrial NAD(P)(+)-dependent malic enzyme (m-NAD(P)-ME) is allosterically activated by fumarate. This study examines the molecular basis for the different allosteric properties and quaternary structural stability of m-NAD(P)-ME and c-NADP-ME. Multiple residues corresponding to the fumarate-binding site were mutated in human c-NADP-ME to correspond to those found in human m-NAD(P)-ME. Additionally, the crystal structure of the apo (ligand-free) human c-NADP-ME conformation was determined. Kinetic studies indicated no significant difference between the wild-type and mutant enzymes in Km,NADP, Km,malate, and kcat. A chimeric enzyme, [51-105]_c-NADP-ME, was designed to include the putative fumarate-binding site of m-NAD(P)-ME at the dimer interface of c-NADP-ME; however, this chimera remained nonallosteric. In addition to fumarate activation, the quaternary structural stability of c-NADP-ME and m-NAD(P)-ME is quite different; c-NADP-ME is a stable tetramer, whereas m-NAD(P)-ME exists in equilibrium between a dimer and a tetramer. The quaternary structures for the S57K/N59E/E73K/S102D and S57K/N59E/E73K/S102D/H74K/D78P/D80E/D87G mutants of c-NADP-ME are tetrameric, whereas the K57S/E59N/K73E/D102S m-NAD(P)-ME quadruple mutant is primarily monomeric with some dimer formation. These results strongly suggest that the structural features near the fumarate-binding site and the dimer interface are highly related to the quaternary structural stability of c-NADP-ME and m-NAD(P)-ME. In this study, we attempt to delineate the structural features governing the fumarate-induced allosteric activation of malic enzyme. PMID:24998673

Hsieh, Ju-Yi; Li, Shao-Yu; Chen, Meng-Chun; Yang, Pai-Chun; Chen, Hui-Yi; Chan, Nei-Li; Liu, Jyung-Hurng; Hung, Hui-Chih

2014-10-01

177

Novel phospholipase A2 inhibitors from python serum are potent peptide antibiotics.  

PubMed

Antimicrobial peptides (AMPs) play a vital role in defense against resistant bacteria. In this study, eight different AMPs synthesized from Python reticulatus serum protein were tested for bactericidal activity against various Gram-positive and Gram-negative bacteria (Staphylococcus aureus, Burkholderia pseudomallei (KHW and TES strains), and Proteus vulgaris) using a disc-diffusion method (20 ?g/disc). Among the tested peptides, phospholipase A2 inhibitory peptide (PIP)-18[59-76], ?-Asp65-PIP[59-67], D-Ala66-PNT.II, and D60,65E-PIP[59-67] displayed the most potent bactericidal activity against all tested pathogens in a dose-dependent manner (100-6.8 ?g/ml), with a remarkable activity noted against S. aureus at 6.8 ?g/ml dose within 6 h of incubation. Determination of minimum inhibitory concentrations (MICs) by a micro-broth dilution method at 100-3.125 ?g/ml revealed that PIP-18[59-76], ?-Asp65-PIP[59-67] and D-Ala66-PNT.II peptides exerted a potent inhibitory effect against S. aureus and B. pseudomallei (KHW) (MICs 3.125 ?g/ml), while a much less inhibitory potency (MICs 12.5 ?g/ml) was noted for ?-Asp65-PIP[59-67] and D-Ala66-PNT.II peptides against B. pseudomallei (TES). Higher doses of peptides had no effect on the other two strains (i.e., Klebsiella pneumoniae and Streptococcus pneumoniae). Overall, PIP-18[59-76] possessed higher antimicrobial activity than that of chloramphenicol (CHL), ceftazidime (CF) and streptomycin (ST) (30 ?g/disc). When the two most active peptides, PIP-18[59-76] and ?-Asp65-PIP[59-67], were applied topically at a 150 mg/kg dose for testing wound healing activity in a mouse model of S. aureus infection, the former accelerates faster wound healing than the latter peptide at 14 days post-treatment. The western blot data suggest that the topical application of peptides (PIP-18[59-67] and ?-Asp65-PIP[59-67]) modulates NF-kB mediated wound repair in mice with relatively little haemolytic (100-1.56 ?g/ml) and cytotoxic (1000-3.125 ?g/ml) effects evident on human cells in vitro. PMID:25583073

Samy, Ramar Perumal; Thwin, Maung Maung; Stiles, Brad G; Satyanarayana-Jois, Seetharama; Chinnathambi, Arunachalam; Zayed, M E; Alharbi, Sulaiman Ali; Siveen, Kodappully Sivaraman; Sikka, Sakshi; Kumar, Alan Prem; Sethi, Gautam; Lim, Lina Hsiu Kim

2015-04-01

178

Fish meal supplementation increases bovine plasma and luteal tissue omega-3 fatty acid composition.  

PubMed

The objective of this experiment was to determine if dietary inclusion of fish meal would increase plasma and luteal tissue concentrations of eicosapentaenoic and docosahexaenoic acids. Seventeen nonlactating Angus cows (2 to 8 yr of age) were housed in individual pens and fed a corn silage-based diet for approximately 60 d. Diets were supplemented with fish meal at 5% DMI (a rich source of eicosapentaenoic acid and docosahexaenoic acid; n = 9 cows) or corn gluten meal at 6% DMI (n = 8 cows). Body weights and jugular blood samples were collected immediately before the initiation of supplementation and every 7 d thereafter for 56 d to monitor plasma n-3 fatty acid composition and BW. Estrous cycles were synchronized using 2 injections of PGF(2?) administered at 14-d intervals. The ovary bearing the corpus luteum was surgically removed at midcycle (between d 10 and 12) after estrus synchronization, which corresponded to approximately d 60 of supplementation. The ovary was transported to the laboratory, and approximately 1.5 g of luteal tissue was stored at -80°C until analyzed for n-3 fatty acid content. Initial and ending BW did not differ (P > 0.10) between cows supplemented with fish meal and those with corn gluten meal. Plasma eicosapentaenoic acid was greater (P < 0.05) beginning at d 7 of supplementation and docosahexaenoic was greater (P < 0.05) beginning at d 14 of supplementation for cows receiving fish meal. Luteal tissue collected from fish meal-supplemented cows had greater (P < 0.05) luteal n-3 fatty acids and reduced (P < 0.05) arachidonic acid and n-6 to n-3 ratio as compared with tissue obtained from cows supplemented with corn gluten meal. Our data show that fish meal supplementation increases luteal n-3 fatty acid content and reduces available arachidonic acid content, the precursor for PGF(2?). The increase in luteal n-3 fatty acids may reduce PGF(2?) intraluteal synthesis after breeding resulting in increased fertility in cattle. PMID:22003234

White, N R; Burns, P D; Cheatham, R D; Romero, R M; Nozykowski, J P; Bruemmer, J E; Engle, T E

2012-03-01

179

Origin of hydrous fluids at seismogenic depth: Constraints from natural and experimental fault rocks  

NASA Astrophysics Data System (ADS)

Fluids control the mechanical behavior of fault zones during the seismic cycle. We used geochemical, mineralogical, microstructural, hydrogen isotope compositions and Fourier Transform Infrared (FTIR) investigations to characterize the origin of hydrous fluids involved in ductile and brittle shear zones at the bottom of the seismogenic crust. Natural samples were collected from exhumed mylonitic shear zones and cataclasite-pseudotachylyte bearing faults in the northern Adamello (Italian Southern Alps), which were active at 9-11 km depth. Pseudotachylytes, solidified coseismic friction-induced melts, testify to ancient seismogenic behavior of the faults. Natural pseudotachylytes were compared with artificial pseudotachylytes produced in high velocity friction experiments simulating seismic slip. Mylonites have mineralogical, elemental and hydrogen isotope compositions (-80‰D<-60‰) compositions suggesting interactions with a crustal metamorphic fluid. Pseudotachylytes are composed of high temperature minerals (plagioclase, biotite, dmisteinbergite, cordierite, and scapolite) and have elemental compositions resulting from mixing of tonalite and cataclasite. Pseudotachylytes have complex microstructures, including: (i) microlitic domains, with well crystallized micrometric biotite, which have hydrogen isotope composition (-81‰50 °C and have low ?D value (-93‰). The hydrogen isotope composition of bulk samples is dominated by the composition of cryptocrystalline domains (-103‰

Mittempergher, Silvia; Dallai, Luigi; Pennacchioni, Giorgio; Renard, François; Di Toro, Giulio

2014-01-01

180

Effects of diets containing grape seed, linseed, or both on milk production traits, liver and kidney activities, and immunity of lactating dairy ewes.  

PubMed

This study aimed to evaluate the effects of the dietary inclusion of grape seed, alone or in combination with linseed, on milk production traits, immune response, and liver and kidney metabolic activity of lactating ewes. Twenty-four Sarda dairy ewes were randomly assigned to 4 dietary treatments consisting of a control diet (CON), a diet containing 300 g/d per head of grape seed (GS), a diet containing 220 g/d per head of extruded linseed (LIN), and a diet containing a mix of 300 g/d per head of grape seed and 220 g/d per head of extruded linseed (MIX). The study lasted 10 wk, with 2 wk of adaptation period and 8 wk of experimental period. Milk yield was measured and samples were collected weekly and analyzed for fat, protein, casein, lactose, pH, milk urea nitrogen, and somatic cell count. Blood samples were collected every 2 wk by jugular vein puncture and analyzed for hematological parameters, for albumin, alkaline phosphatase, bilirubin, creatinine, gamma glutamyltransferase, aspartate aminotransferase, alanine aminotransferase, protein, blood urea nitrogen, and for anti-albumin IgG, IL-6, and lymphocyte T-helper (CD4(+)) and lymphocyte T-cytotoxic (CD8(+)) cells. On d 0, 45, and 60 of the trial, lymphocyte response to phytohemagglutinin was determined in vivo on each animal by measuring skin-fold thickness (SFT) at the site of phytohemagglutinin injection. Humoral response to chicken egg albumin was stimulated by a subcutaneous injection with albumin. Dietary treatments did not affect milk yield and composition. Milk urea nitrogen and lactose were affected by diet × period. Diets did not influence hematological, kidney, and liver parameters, except for blood urea nitrogen, which decreased in LIN and increased in MIX compared with CON and GS. Dietary treatments did not alter CD4(+), CD8(+), and CD4(+)-to-CD8(+) ratio. The SFT was reduced in GS and MIX and increased in LIN compared with CON. The IgG and IL-6 were affected by diet × period. The reduction in IgG on d 60 and SFT in ewes fed GS suggests an immunomodulatory effect of this residue. The limited variation in milk and hematological and metabolic parameters suggests that GS and LIN can be included, alone or in combination, in the diet of dairy ewes without adverse effects on milk production and health status. PMID:25497793

Nudda, A; Correddu, F; Marzano, A; Battacone, G; Nicolussi, P; Bonelli, P; Pulina, G

2015-02-01

181

Effects of a combination of niacin and chromium(III)-chloride on the skin and lungs of hyperlipemic rats.  

PubMed

The aim of this study was to investigate the biochemical effects of niacin and chromium(III)-chloride on serum lipid peroxidation, uric and sialic acids, and the extent of lipid peroxidation and glutathione levels in skin and lung tissues of hyperlipidemic rats. In this study, female Swiss albino rats, 12 mo old, were used. They were randomly divided into four groups. Group I animals were fed with a standard pellet diet and water ad libitium. Group II rats were fed with a standard pellet diet and were treated with a dose of 250 microg/kg body weight CrCI(3).6H(2)O and 100 mg/kg body weight niacin, for 45 d, by the gavage technique. Group III rats were fed a lipogenic diet in which 2% cholesterol, 0.5% cholic acid, and 20% sunflower oil were added to the pellet chow. In addition, the animals in this group drank water containing 3% ethanol. This regime was maintained for 60 d. The rats in group IV were maintained in the same food and drink regime as the animals in group III. After 2 wk, the animals showed symptoms of hyperlipemia and they were treated with 250 microg/kg body weight CrCI(3).6H(2)O and 100 mg/kg body weight niacin, by gavage, for 45 d. On d 60, the blood and the skin and lungs samples were taken from animals. In the hyperlipemic groups, a reduction of the lung glutathione level and an increase in serum, lung, and skin lipid peroxidation levels and in serum sialic and uric acid were observed. In rats treated with a combination of niacin and Cr(III), the skin and serum lipid peroxidation and the sialic and uric acid levels decreased while showing an increase of lung glutathione activity. These results suggest that niacin and Cr(III), when administered in combination, have a protective effect against skin and lung tissues damage as a result of hyperlipidemia. PMID:15784957

Yanardag, Refiye; Peksel, Aysegul; Yesilyaprak, Bihter; Doger, M Mutluhan; Arisan-Atac, Inci

2005-03-01

182

Effects of implant regimens (trenbolone acetate-estradiol administered alone or in combination with zeranol) and vitamin D3 on fresh beef color and quality.  

PubMed

In the first oftwo experiments, 123 calf-fed steers were used over a 2-yr period to evaluate the effects of trenbolone acetate (TBA)-based implants administered alone or in combination with zeranol implants on fresh beef muscle quality, color, and physiological maturity of the carcass. Implant treatments decreased (P < 0.05) a* values (d 0 and d 3 of retail display) and b* values (d 0, d 1, and d 3 of retail display) after 14 d of aging. Carcasses from cattle initially implanted with Revalor-S and reimplanted with Revalor-S on d 60 of the finishing period showed increased lean and bone maturity scores and ash content of the 9th to 11th thoracic buttons and Warner-Bratzler shear force values (WBS) compared to those initially implanted with Ralgro and subsequently reimplanted with Revalor-S or control cattle. In addition, implants decreased (P < 0.05) marbling, percentage of the carcasses grading Choice, and kidney, pelvic, and heart fat (KPH). Implant treatments increased (P < 0.05) ADG, hot carcass weights, and longissimus muscle (LM) area. In the second experiment over a 2-yr period, 166 steers fed as yearlings were allotted to one of two implant treatments and one of two vitamin D3 preharvest supplementation treatments. Implanted steers had heavier (P < 0.05) final body weights and higher (P < 0.05) ADG, less (P < 0.05) KPH fat, and larger (P < 0.05) LM. Also, implanted steers had more (P < 0.05) advanced bone maturity scores, higher (P < 0.05) ash content of the 9th to 11th thoracic buttons, and higher (P < 0.05) WBS values on 5-d postmortem loin steaks. Vitamin D3 feeding decreased (P < 0.05) final live weight, ADG (P < 0.05), and LM (P < 0.05), but did not significantly improve WBS values. In Experiment 2, neither implant treatment nor vitamin D3 supplementation had significant effects on L*, a*, or b* values of muscles in steaks before or during simulated retail display. PMID:12597383

Reiling, B A; Johnson, D D

2003-01-01

183

Cytoreductive surgery plus hyperthermic intraperitoneal chemotherapy improves survival of gastric cancer with peritoneal carcinomatosis: evidence from an experimental study  

PubMed Central

Background Cytoreductive surgery (CRS) plus hyperthermic intraperitoneal chemotherapy (HIPEC) has been considered as a promising treatment modality for gastric cancer with peritoneal carcinomatosis (PC). However, there have also been many debates regarding the efficacy and safety of this new approach. Results from experimental animal model study could help provide reliable information. This study was to investigate the safety and efficacy of CRS + HIPEC to treat gastric cancer with PC in a rabbit model. Methods VX2 tumor cells were injected into the gastric submucosa of 42 male New Zealand rabbits using a laparotomic implantation technique, to construct rabbit model of gastric cancer with PC. The rabbits were randomized into control group (n = 14), CRS alone group (n = 14) and CRS + HIPEC group (n = 14). The control group was observed for natural course of disease progression. Treatments were started on day 9 after tumor cells inoculation, including maximal removal of tumor nodules in CRS alone group, and maximal CRS plus heperthermic intraperitoneal chemoperfusion with docetaxel (10 mg/rabbit) and carboplatin (40 mg/rabbit) at 42.0 ± 0.5°C for 30 min in CRS + HIPEC group. The primary endpoint was overall survival (OS). The secondary endpoints were body weight, biochemistry, major organ functions and serious adverse events (SAE). Results Rabbit model of gastric cancer with PC was successfully established in all animals. The clinicopathological features of the model were similar to human gastric PC. The median OS was 24.0 d (95% confidence interval 21.8 - 26.2 d ) in the control group, 25.0 d (95% CI 21.3 - 28.7 d ) in CRS group, and 40.0 d (95% CI 34.6 - 45.4 d ) in CRS + HIPEC group (P = 0.00, log rank test). Compared with CRS only or control group, CRS + HIPEC could extend the OS by at least 15 d (60%). At the baseline, on the day of surgery and on day 8 after surgery, the peripheral blood cells counts, liver and kidney functions, and biochemistry parameters were all comparable. SAE occurred in 0 animal in control group, 2 animals in CRS alone group including 1 animal death due to anesthesia overdose and another death due to postoperative hemorrhage, and 3 animals in CRS + HIPEC group including 1 animal death due to anesthesia overdose, and 2 animal deaths due to diarrhea 23 and 27 d after operation. Conclusions In this rabbit model of gastric cancer with PC, CRS alone could not bring benefit while CRS + HIPEC with docetaxel and carboplatin could significantly prolong the survival with acceptable safety. PMID:21548973

2011-01-01

184

Effect of heat stress during late gestation on immune function and growth performance of calves: isolation of altered colostral and calf factors.  

PubMed

Calves born to cows exposed to heat stress during the dry period and fed their dams' colostrum have compromised passive and cell-mediated immunity compared with calves born to cows cooled during heat stress. However, it is unknown if this compromised immune response is caused by calf or colostrum intrinsic factors. Two studies were designed to elucidate the effects of colostrum from those innate to the calf. The objective of the first study was to evaluate the effect of maternal heat stress during the dry period on calf-specific factors related to immune response and growth performance. Cows were dried off 46 d before expected calving and randomly assigned to 1 of 2 treatments: heat stress (HT; n=18) or cooling (CL; n=18). Cows of the CL group were housed with sprinklers, fans and shade, whereas cows of HT group had only shade. After calving, the cows were milked and their colostrum was frozen for the subsequent study. Colostrum from cows exposed to a thermoneutral environment during the dry period was pooled and stored frozen (-20 °C). Within 4h of birth, 3.8L of the pooled colostrum from thermoneutral cows was fed to calves born to both HT and CL cows. Day of birth was considered study d 0. All calves were exposed to the same management and weaned at d 49. Blood samples were collected before colostrum feeding, 24h after birth and twice weekly up to d 28. Total serum IgG concentrations were determined. Body weight was recorded at birth and at d 15, 30, 45, and 60. Relative to CL calves, HT calves were lighter at birth (38.3 vs. 43.1 kg), but no difference in weight gain was observed at d 60. Additionally, HT calves had lower apparent efficiency of IgG absorption (26.0 vs. 30.2%), but no differences were observed for total IgG concentration. The objective of the second study was to evaluate the isolated effect of the colostrum from HT cows on calf immune response and growth performance. The experimental design was identical to the first study, but all calves were born to cows under thermoneutral conditions during the dry period. At birth, calves were blocked by sex and birth weight and then randomly assigned to 1 of 2 treatments, which meant they received pooled colostrum from HT cows or CL cows. No treatment effect was observed on passive immune transfer or on postnatal growth. Thus, heat stress during the last 6 wk of gestation negatively affects the ability of the calf to acquire passive immunity, regardless of colostrum source. PMID:25108869

Monteiro, A P A; Tao, S; Thompson, I M; Dahl, G E

2014-10-01

185

Characteristics and retention of luteal structures, extended postinsemination cycle, progesterone, and pregnancy-specific protein B in serum after human chorionic gonadotropin treatment of dairy cows.  

PubMed

Our objectives were to determine characteristics (size, number, and stayability) of luteal structures formed in response to human chorionic gonadotropin (hCG) administered on d 7 after timed artificial insemination (AI) and the influence of hCG on returns to estrus and pregnancy outcome. Holstein cows (n=328), milked 3 times daily, previously inseminated at first service were assigned randomly to a completely randomized design consisting of 2 treatments when at least 1 corpus luteum (CL) was detected on d 7 after AI. Treatment consisted of 1,000 IU hCG or 1 mL of saline (control) administered i.m. Blood was collected and luteal structures were mapped and sized by transrectal ultrasonography on d 7, 14, 21, 28, and 32 after AI. Blood also was collected on d 60 in all pregnant cows. Treatment with hCG induced new luteal structures in 70% of cows, regardless of pregnancy status or number of pretreatment CL. Cows producing greater than the median 46 kg of energy-corrected milk per day were less likely to respond to hCG. The number of total luteal structures per cow, original CL volume, and total luteal volume (original CL + new luteal structures) were increased by hCG. Progesterone concentration was greater in pregnant than nonpregnant cows on d 14 unless cows responded to hCG by forming new luteal structures. Concentrations of progesterone were greatest in pregnant, hCG-treated cows. Pregnancy per AI at d 32 or 60 after first AI was less in hCG- than saline-treated cows because pregnancy outcome for hCG cows that had only 1 pretreatment CL and failed to respond to hCG was only 55 to 61% of that observed in controls. Proportions of cows returning to estrus from 18 to 25 d after AI were less in hCG than control cows but greater for cows returning >25 d. Regardless of treatment, 25% of cows in both treatments retained at least 1 original CL to d 28 after AI and were not pregnant on d 32. Progesterone concentrations in these nonpregnant cows with retained CL between d 14 and 28 after AI were intermediate between nonpregnant cows that returned to estrus by d 25 and all pregnant cows. Concentrations of pregnancy-specific protein B were elevated in some of these nonpregnant, CL-retained cows, indicating early pregnancy loss. Retention of original luteal tissue in nonpregnant cows to d 28 after AI indicated that pregnancy had been initiated but failed, as verified by concentrations of progesterone and pregnancy-specific protein B. PMID:22818453

Stevenson, J S; Pulley, S L

2012-08-01

186

Further characterization of the interaction of histidine-rich glycoprotein with heparin: evidence for the binding of two molecules of histidine-rich glycoprotein by high molecular weight heparin and for the involvement of histidine residues in heparin binding  

SciTech Connect

Rabbit histidine-rich glycoprotein (HRG, 94 kDa) binds heparin with high affinity (apparent K/sub d/ 60-110 nM). Eosin Y (1 equiv) bound to HRG was used as a reporter group to monitor associations of HRG with heparins of molecular mass 10, 17.5, and 30 kDa. The stoichiometries of the heparin- (/sup 125/I) HRG complexes were determined by fluorescence and absorbance measurements as well as by analytical ultracentrifugation. Two types of complex form: complexes of 1 heparin: 1 HRG and of 1 heparin:2 HRG. The 1:2 complex formation requires a minimum heparin chain length since 17.5-kDa but not 10-kDa heparin binds two HRG molecules. The formation of the 1:2 complexes of the larger heparin fractions is enhanced by divalent copper or zinc (1-10 equiv) bound to HRG. However, metal is not required for complex formation since all sizes of heparin examined interact tightly with HRG in the presence of ethylenediaminetetraacetic acid. Between 0.1 and 0.3 M ionic strength, both 1:1 and 1:2 complexes of heparin with HRG are progressively destabilized. No heparin-HRG complex is found at ionic strengths of 0.5 M. Between pH 8.5 and pH 6.5 both 1:2 and 1:1 complexes are found with 17.5-kDa heparin, but at pH 5.5 only 1:1 complexes are formed. The heparin-HRG interaction is progressively decreased by modification of the histidine residues of HRG, whereas modification of 22 of the 33 lysine residues of HRG has little effect. Supporting the role of histidine in heparin binding, a histidine-proline-glycine-rich peptide (molecular mass 28 kDa) derived from HRG and intact HRG binds to heparin-Sepharose at pH 6.8, but only HRG binds to the affinity medium at pH 7.4.

Burch, M.K.; Blackburn, M.N.; Morgan, W.T.

1987-11-17

187

Camelina meal and crude glycerin as feed supplements for developing replacement beef heifers.  

PubMed

Angus × Gelbvieh rotationally crossbred yearling heifers (n = 99, yr 1; n = 105, yr 2) were used in a 2-yr randomized complete block design experiment with repeated measures to determine the effect of feeding camelina biodiesel coproducts (meal and crude glycerin) on serum concentrations of triiodothyronine, thyroxine, insulin, ?-hydroxybutyrate, and glucose, as well as on growth and reproductive performance. Heifers were assigned to 1 of 15 pens, and pens were assigned initially to receive 7.03 k·•heifer(-1)·d(-1) of bromegrass hay plus 0.95 kg·heifer(-1)·d(-1) of 1 of 3 supplements for 60 d before breeding: 1) control (50% ground corn and 50% soybean meal, as-fed basis); 2) mechanically extracted camelina meal; or 3) crude glycerin (50% soybean meal, 33% ground corn, 15% crude glycerin, 2% corn gluten meal; as-fed basis). Preprandial blood samples were collected via the jugular vein on d 0, 30, and 60 of the feeding period. A 2-injection PGF(2?) protocol (d 60 and 70 of the study) was used to synchronize estrus. Heifers were artificially inseminated 12 h after estrus was first detected. Heifers not detected in estrus within 66 h received a GnRH injection and were artificially inseminated. Dietary treatment × sampling period interactions were not detected (P = 0.17 to 0.87). Dietary treatment did not affect BW (P = 0.44 to 0.59) or serum concentrations of thyroxine (P = 0.96), ?-hydroxybutyrate (P = 0.46), glucose (P = 0.59), or insulin (P = 0.44). Serum concentrations of triiodothyronine were greater (P = 0.05) in heifers fed camelina meal. Additionally, dietary treatment did not affect the percentage of heifers detected in estrus before timed AI (P = 0.83), first-service pregnancy rates of those heifers detected in estrus (P = 0.97), or overall first-service pregnancy rates (P = 0.58). Heifers fed camelina meal, however, had greater (P = 0.05) first-service pregnancy rates to timed AI than did heifers fed the control and crude glycerin supplements. The cost per pregnancy was similar for heifers fed the crude glycerin or the control supplement, whereas the cost per pregnancy was the least for heifers fed camelina meal. We conclude that camelina coproducts can replace conventional corn-soybean meal supplements in the diets of developing replacement beef heifers. PMID:21821818

Moriel, P; Nayigihugu, V; Cappellozza, B I; Gonçalves, E P; Krall, J M; Foulke, T; Cammack, K M; Hess, B W

2011-12-01

188

Genotypic Resistance Analysis of the Virological Response to Fosamprenavir-Ritonavir in Protease Inhibitor-Experienced Patients in CONTEXT and TRIAD Clinical Trials?  

PubMed Central

The aim of this study was to identify human immunodeficiency virus (HIV) protease mutations associated with virological response (VR) to fosamprenavir-ritonavir (FPV/r) in 113 protease inhibitor (PI)-experienced patients randomized in both CONTEXT and TRIAD clinical trials and receiving the same dose (700/100 mg twice daily) of FPV/r. The impact of each protease mutation on the VR to FPV/r, defined as the decrease in HIV RNA at week 12, was investigated with nonparametric analyses. A step-by-step procedure was done using a Jonckheere-Terpstra (JT) test that retains the group of mutations most strongly associated with the VR. Mutations at the following 14 codons were associated with a reduced VR to FPV/r: 10, 15, 33, 46, 54, 60, 62, 63, 72, 73, 82, 84, 89, and 90. The JT procedure led to selecting the CONTEXT/TRIAD genotypic set of mutations, I15V, M46I/L, I54L/M/V, D60E, L63P/T, and I84V, as providing the strongest association with the VR (P = 1.45 × 10?11). In the nine patients with zero mutations within this set, the median decrease in HIV RNA was ?2.63 log copies/ml, and was ?2.22 (n = 45), ?1.50 (n = 26), ?0.58 (n = 23), ?0.47 (n = 6), ?0.13 (n = 3), and 0.04 (n = 1) log copies/ml in those with one, two, three, four, five, and six mutations, respectively. This study identified six mutations associated with VR to FPV/r. Some of these mutations are shared with the current FPV/r Agence Nationale de Recherches sur le SIDA (ANRS) resistance score, which has been cross-validated in the CONTEXT/TRIAD data set, suggesting that the current ANRS FPV/r score is a useful tool for the prediction of VR to FPV/r in PI-experienced patients. PMID:18852278

Marcelin, Anne-Geneviève; Flandre, Philippe; Molina, Jean-Michel; Katlama, Christine; Yeni, Patrick; Raffi, Francois; Antoun, Zeina; Ait-Khaled, Mounir; Calvez, Vincent

2008-01-01

189

Differentiated embryonic chondrocyte-expressed gene 1 is associated with hypoxia-inducible factor 1? and Ki67 in human gastric cancer  

PubMed Central

Background Gastric cancer is a leading causes of cancer-related deaths ,but the underlying molecular mechanisms of its progression are largely unknown. Differentiated embryonic chondrocyte-expressed gene 1 (DEC1), is an important transcription factor involved in the progression of tumors and has recently been identified to be strongly inducible by hypoxia. Little is known about the contribution of DEC1 to the intracellular hypoxia and proliferation signaling events in gastric cancer. Methods Immunohistochemistry was used to detect the expression of DEC1, hypoxia-inducible factor 1(HIF-1?) and Ki67 in 173 human gastric cancer samples and adjacent non-tumor tissues samples. The relationship between DEC1, HIF-1? and Ki67 was evaluated. Results DEC1 protein was persistently expressed in the nucleus and cytoplasm of gastric cancer tissue. The protein expression of DEC1 and HIF-1? in tumour tissues was 83.8% and 54.3%, respectively, and was significantly higher than that in adjacent normal tissues (83.8% vs 23.7%, P <0.001; 54.3% vs 12.7%, P< 0.001). The expression of DEC1 and HIF-1? was associated with poor histological differentiation. (P < 0. 01). Furthermore, DEC1 level was positively correlated with HIF-1? (P < 0. 01, r=0.290) and Ki67 expression (P < 0. 01, r=0.249). Conclusion The upregulation of DEC1 may play an important role in hypoxia regulation and cell proliferation in gastric cancer. The relevant molecular mechanism requires further investigation. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1794565980889391med.motic.com/MoticGallery/Slide?id=08d180cd-5fdb-4cee-830a-0b1fef3311f2&user=2C69F0D6-A478-4A2B-ABF0-BB36763E8025med.motic.com/MoticGallery/Slide?id=4762991d-3f2f-43aa-b4bf-ecdd2c2ae3ec&user=2C69F0D6-A478-4A2B-ABF0-BB36763E8025med.motic.com/MoticGallery/Slide?id=2717f209-b3fd-4e71-b621-0d60ea507a82&user=2C69F0D6-A478-4A2B-ABF0-BB36763E8025 PMID:23445622

2013-01-01

190

MART-1 peptide vaccination plus IMP321 (LAG-3Ig fusion protein) in patients receiving autologous PBMCs after lymphodepletion: results of a Phase I trial  

PubMed Central

Background Immunotherapy offers a promising novel approach for the treatment of cancer and both adoptive T-cell transfer and immune modulation lead to regression of advanced melanoma. However, the potential synergy between these two strategies remains unclear. Methods We investigated in 12 patients with advanced stage IV melanoma the effect of multiple MART-1 analog peptide vaccinations with (n?=?6) or without (n?=?6) IMP321 (LAG-3Ig fusion protein) as an adjuvant in combination with lymphodepleting chemotherapy and adoptive transfer of autologous PBMCs at day (D) 0 (Trial registration No: NCT00324623). All patients were selected on the basis of ex vivo detectable MART-1-specific CD8 T-cell responses and immunized at D0, 8, 15, 22, 28, 52, and 74 post-reinfusion. Results After immunization, a significant expansion of MART-1-specific CD8 T cells was measured in 83% (n?=?5/6) and 17% (n?=?1/6) of patients from the IMP321 and control groups, respectively (P?2-, >4- and >6-fold higher at D15, D30 and D60 (P?

2014-01-01

191

The hemocompatibility of a nitric oxide generating polymer that catalyzes S-nitrosothiol decomposition in an extracorporeal circulation model  

PubMed Central

Nitric oxide (NO) generating (NOGen) materials have been shown previously to create localized increases in NO concentration by the catalytic decomposition of blood S-nitrosothiols (RSNO) via copper (Cu)-containing polymer coatings and may improve extracorporeal circulation (ECC) hemocompatibility. In this work, a NOGen polymeric coating composed of a Cuo-nanoparticle (80 nm)-containing hydrophilic polyurethane (SP-60D-60) combined with the intravenous infusion of an RSNO, S-nitroso-N-acetylpenicillamine (SNAP), is evaluated in a 4 h rabbit thrombogenicity model and the anti-thrombotic mechanism is investigated. Polymer films containing 10 wt.% Cuo-nanoparticles coated on the inner walls of ECC circuits are employed concomitantly with systemic SNAP administration (0.1182 ?mol/kg/min) to yield significantly reduced ECC thrombus formation compared to polymer control + systemic SNAP or 10 wt.% Cu NOGen + systemic saline after 4 h blood exposure (0.4 ± 0.2 NOGen/SNAP vs 4.9 ± 0.5 control/SNAP or 3.2 ± 0.2 pixels/cm2 NOGen/saline). Platelet count (3.9 ± 0.7 NOGen/SNAP vs 1.8 ± 0.1 control/SNAP or 3.0 ± 0.2 × 108/ml NOGen/saline) and plasma fibrinogen levels were preserved after 4 h blood exposure with the NOGen/SNAP combination vs either the control/SNAP or the NOGen/saline groups. Platelet function as measured by aggregometry (51 ± 9 NOGen/SNAP vs 49 ± 3% NOGen/saline) significantly decreased in both the NOGen/SNAP and NOGen/saline groups while platelet P-selectin mean fluorescence intensity (MFI) as measured by flow cytometry was not decreased after 4 h on ECC to ex vivo collagen stimulation (26 ± 2 NOGen/SNAP vs 29 ± 1 MFI baseline). Western blotting showed that fibrinogen activation as assessed by A? dimer expression was reduced after 4 h on ECC with NOGen/SNAP (68 ± 7 vs 83 ± 3% control/SNAP). These results suggest that the NOGen polymer coating combined with SNAP infusion preserves platelets in blood exposure to ECCs by attenuating activated fibrinogen and preventing platelet aggregation. These NO-mediated platelet changes were shown to improve thromboresistance of the NOGen polymer-coated ECCs when adequate levels of RSNOs are present. PMID:21696821

Major, Terry C.; Brant, David O.; Burney, Charles P.; Amoako, Kagya A.; Annich, Gail M.; Meyerhoff, Mark E.; Handa, Hitesh; Bartlett, Robert H.

2011-01-01

192

A randomized trial to evaluate the effect of a trace mineral premix on the incidence of active digital dermatitis lesions in cattle.  

PubMed

A balanced, parallel-group, single-blinded randomized efficacy study divided into 2 periods was conducted to evaluate the effect of a premix containing higher than typically recommended levels of organic trace minerals and iodine (HOTMI) in reducing the incidence of active digital dermatitis (DD) lesions acquired naturally and induced by an experimental infection challenge model. For the natural exposure phase of the study, 120 healthy Holstein steers 5 to 7 mo of age without signs of hoof disease were randomized into 2 groups of 60 animals. The control group was fed a standard trace mineral supplement and the treatment group was fed the HOTMI premix, both for a period of 60 d. On d 60, 15 steers free of macroscopic DD lesions were randomly selected from each group for the challenge phase and transported to an experimental facility, where they were acclimated and then challenged within a DD infection model. The same diet group allocation was maintained during the 60 d of the challenge phase. The primary outcome measured was the development of an active DD lesion greater than 20mm in diameter across its largest dimension. No lesions were identified during the natural exposure phase. During the challenge phase, 55% (11/20) and 30% (6/20) of feet were diagnosed with an active DD lesion in the control and treatment groups, respectively. Diagnosis of DD was confirmed by histopathologic demonstration of invasive Treponema spp. within eroded and hyperplastic epidermis and ulcerated papillary dermis. All DD confirmed lesions had dark-field microscopic features compatible with DD and were positive for Treponema spp. by PCR. As a secondary outcome, the average DD lesion size observed in all feet was also evaluated. Overall mean (standard deviation) lesion size was 17.1 (2.36) mm and 11.1 (3.33) mm for the control and treatment groups, respectively, with this difference being driven by acute DD lesions >20mm. A trend existed for the HOTMI premix to reduce the total DD infection rate and the average size of the experimentally induced lesions. Further research is needed to validate the effect of this intervention strategy in the field and to generate prevention and control measures aimed at optimizing claw health based on nutritional programs. PMID:25087030

Gomez, A; Bernardoni, N; Rieman, J; Dusick, A; Hartshorn, R; Read, D H; Socha, M T; Cook, N B; Döpfer, D

2014-10-01

193

Flow control of a circular cylinder with O-rings  

NASA Astrophysics Data System (ADS)

The flow around a circular cylinder is controlled by attaching O-rings to reduce drag force acting on the cylinder. Wind tunnel experiments on the flow around a circular cylinder with and without ring type surface protrusions are carried out to investigate the flow characteristics of the controlled wake. Four experimental models are tested in this study; one smooth cylinder of diameter D (60 mm) and three cylinders fitted with longitudinal O-rings of diameters d=0.0167D, 0.05D and 0.067 D with various pitches. The drag force, mean velocity and turbulence intensity profiles in the near wake behind the cylinders are measured for Reynolds numbers based on the cylinder diameter in the range of ReD=7.8×10 3˜1.2×10 5. Flow field around the cylinders is visualized using a smoke-wire technique to see the flow structure qualitatively. The results are compared with those for a smooth cylinder having the same diameter. At ReD=1.2×10 5, the cylinder fitted with O-rings of d=0.0167 D in a pitch interval of 0.165 D shows the maximum drag reduction of about 9%, compared with the smooth cylinder. The drag reduction effect of O-rings of d=0.067 D is not so high and it has nearly the same value as that of the smooth cylinder. For the O-ring circular, as the Reynolds number increases, the location of peak turbulence intensity shifts downstream and the peak magnitude is decreased. In addition, the vortex shedding frequency has nearly same value as that of the smooth cylinder up to a Reynolds number of 3.2×10 4. Thereafter, the shedding frequency increases and finally disappears as the Reynolds number increases. The visualized flow for the smooth cylinder does not show distinct spanwise variation of flow pattern. However, the size of vortices and vortex formation region formed behind the O-ring cylinder are smaller, compared with the smooth cylinder. In addition, the instantaneous topological flow image shows spanwise variation of V-shaped flow pattern. Consequently, the simple attachment of O-rings effectively controls the vortex shedding from the cylinder and elongates the vortex formation region, reducing drag force acting on the cylinder at high Reynolds numbers.

Lim, Hee-Chang; Lee, Sang-Joon

2004-08-01

194

Hepatitis B Virus Core Promoter Mutations in Patients With Chronic Hepatitis B and Hepatocellular Carcinoma in Bucharest, Romania  

PubMed Central

Background: Accurate and personalized molecular virological diagnosis of hepatitis B virus (HBV) infection is crucial for individualized selection of patients for antiviral therapy in Romania. Objectives: We aimed to investigate HBV mutations in Romanian patients with chronic HBV infection, also to match HBV genotypes with HBV mutations identified and clinical outcomes. Patients and Methods: This was a cross-sectional study. A total of 484 Romanian patients with chronic HBV infection and hepatocellular carcinoma (HCC) were investigated. This was performed in Fundeni Clinical Institute, Bucharest, Romania during January 2005 to August 2010. HBsAg positive patients with chronic HBV infection admitted to Fundeni Clinical Institute were randomly enrolled in the study. Analysis was performed in the Centre for Immunogenetics and Virology, Fundeni Clinical Institute, Bucharest, Romania. Indirect diagnosis was performed with enhanced chemiluminescence method using Architect i2000SR and HBV-DNA was quantified with COBAS TaqMan HBV PCR. Direct sequencing of the PCR-products was performed with the PCR-product sequencing kit. HBV genotyping was performed with INNO-LiPA DR Amplification and INNO-LiPA HBV precore-core. Results: We detected two HBV genotypes; A (8.1%) and D (60.5%), and a mixture of genotypes A and D (31.4%) (P < 0.001). Basal core promoter (BCP) A1762T/G1764A and precore (PC) G1896A mutations were detected in these Romanian patients with chronic HBV infection. HBV chronic carriers had mainly genotype D (54.4%) and HBV WT (64.0%). BCP A1762T, G1764A and PC G1896A were significantly associated with HCC-tissue HBV sequencing (75.3%) (P < 0.001). PC G1896A alone was detected in HCC-serum HBV sequencing group (66.7%). Conclusions: Genotype D was the main genotype detected in Romanian patients with chronic HBV infection. Genotype D presented both BCP and PC mutations more frequently. PMID:25477976

Constantinescu, Ileana; Dinu, Andrei-Antoniu; Boscaiu, Voicu; Niculescu, Marius

2014-01-01

195

Pressure drop, flow pattern and local water volume fraction measurements of oil-water flow in pipes  

NASA Astrophysics Data System (ADS)

Oil-water flow in horizontal and slightly inclined pipes was investigated. The experimental activities were performed using the multiphase flow loop at Telemark University College, Porsgrunn, Norway. The experiments were conducted in a 15 m long, 56 mm diameter, inclinable steel pipe using Exxsol D60 oil (density of 790 kg m-3 and viscosity of 1.64 mPa s) and water (density of 996 kg m-3 and viscosity of 1.00 mPa s) as test fluids. The test pipe inclination was changed in the range from 5° upward to 5° downward. Mixture velocity and inlet water cut vary up to 1.50 m s-1 and 0.975, respectively. The time-averaged cross-sectional distributions of oil and water were measured with a single-beam gamma densitometer. The pressure drop along the test section of the pipe was also measured. The characterization of flow patterns and identification of their boundaries are achieved via visual observations and by analysis of local water volume fraction measurements. The observed flow patterns were presented in terms of flow pattern maps for different pipe inclinations. In inclined flows, dispersions appear at lower mixture velocities compared to the horizontal flows. Smoothly stratified flows observed in the horizontal pipe disappeared in upwardly inclined pipes and new flow patterns, plug flow and stratified wavy flow were observed. The water-in-oil dispersed flow regime slightly shrinks as the pipe inclination increases. In inclined flows, the dispersed oil-in-water flow regime extended to lower mixture velocities and lower inlet water cuts. The present experimental data were compared with the results of a flow-pattern-dependent prediction model, which uses the area-averaged steady-state two-fluid model for stratified flow and the homogeneous model for dispersed flow. The two-fluid model was able to predict the pressure drop and water hold-up for stratified flow. The homogeneous model was not able to predict the pressure profile of dispersed oil-water flow at higher water cuts. The two-fluid model and the homogeneous model over-predict the pressure drop for dual-continuous flow.

Kumara, W. A. S.; Halvorsen, B. M.; Melaaen, M. C.

2009-11-01

196

Utilization of MatPIV program to different geotechnical models  

NASA Astrophysics Data System (ADS)

The Particle Imaging Velocimetry (PIV) technique is being used to measure soil displacements. PIV has been used for many years in fluid mechanics; but for physical modeling in geotechnical engineering, this technique is still relatively new. PIV is a worldwide growth in soil mechanics over the last decade owing to the developments in digital cameras and laser technologies. The use of PIV is feasible provided the surface contains sufficient texture. A Cambridge group has shown that natural sand contains enough texture for applying PIV. In a texture-based approach, the only requirement is for any patch, big or small to be sufficiently unique so that statistical tracking of this patch is possible. In this paper, some of the soil mechanic's models were investigated such as retaining walls, slope failures, and foundations. The photographs were taken with the help of the high resolution digital camera, the displacements of soils were evaluated with free software named as MatPIV and the displacement graphics between the two images were obtained. Nikon D60 digital camera is 10.2 MB and it has special properties which makes it possible to use in PIV applications. These special properties are Airflow Control System and Image Sensor cleaning for protection against dust, Active D-Lighting for highlighted or shadowy areas while shooting, advanced three-point AF system for fast, efficient and precise autofocus. Its fast and continuous shooting mode enables up to 100 JPEG images at three frames per second. Norm Sand (DIN 1164) was used for all the models in a glass rectangular box. For every experiment, MatPIV was used to calculate the velocities from the two images. MatPIV program was used in two ways such as easy way and difficult way: In the easy way, the two images with 64*64 pixels with 50% or 75% overlap of the interrogation windows were taken into consideration and the calculation was performed with a single iteration through the images and the result consisted of four matrices measured in pixels and pixels/second. At the end of the iteration, the results were visualized. In the application of difficult way of MatPIV, a grid of points into the research model was inserted and the first image was taken with the Nikon D60 digital camera. Afterwards, how large a pixel in the image and the orientation of the coordinate system were calculated. If there are no particles to perform PIV calculations in the investigated region, the best way is to mask out this empty region. The crucial step in PIV is the particle image analysis, which is to determine the displacements between two successive images. The first image was divided into a grid of test patches. Each test patch consisted of a sample of the image matrix of size L * L pixels. To find the displacement of the test patch between images 1 and 2, a search patch was extracted from the second image. The cross-correlation of test patch and search patch was evaluated. The resulting normalized correlation plane indicated the "degree of match" between the test and search patch. The highest peak in the normalized correlation plane indicated the displacement vector of the test patch. The procedure described above for evaluation a single displacement vector was repeated for the entire grid of test patches, producing the displacement field between the image pair. After having performed the calculations, there were so many wild vectors due to low image quality in some parts of the images to be removed with the help of the different filters. There are four different filters in MatPIV, these are: signal-to-noise ratio filter, peak height filter, global filter, and local filter. The filters were used step by step to decide which filter could give the best result for the related images. As a last step, both of the ways were compared in each geotechnical model.

Aklik, P.; Idinger, G.

2009-04-01

197

Photogrammetric survey to measure the bed topography of a laboratory large amplitude meandering channel  

NASA Astrophysics Data System (ADS)

One of the main characteristics of the rivers that exhibit a meandering planform is the continuous evolution of the planimetric shape. In order to limit flooding risks and to control the ecological equilibrium of the areas neighboring the channel, it is important to define a forecast methodology of the channel evolution. The pattern of the channel evolution strongly depends on the configuration of the "stable" bed topography along the channel in every stage of the evolution itself. Previous works [Schumm, 1963; Schumm, 1972; Jackson, 1975; Hooke, 1976; Ren and Jun, 1989; Whiting and Dietrich, 1993] show that the localization of the erosion and deposition zones along the channel is not standard but it depends on the planimetric shape of the channel itself. For example, it was shown that at the early stage of a meander wave evolution (small value of deflection angle J0) the deepest erosion of the bed is localized at the inner bank between the sections corresponding respectively to the inflection point and to the apex of the bend. In channels with "large" sinuosity (large value of deflection angle J0) the deepest erosion is localized in the outer bank near the apex of the bend [Yalin, 1992]. Recently, da Silva et al. [2006] verified that every different sinuosity (every J0) has its own convective flow pattern and, as previously observed in a large amplitude meandering channel by Termini (1996), the knowledge of the convective structure of the depth-averaged "initial" (determined at t=0 with flat bed) flow, which is associated only to changing channel curvature, can be used to predict the general features of bed topography. Thus, the knowledge of the stable bed topography is important to predict the channel planimetric evolution. In this paper the equilibrium bed topography determined in a large meandering laboratory channel has been first measured by a using a profile indicator PV09 by Delft Hydraulics (precision of 0.1 mm). The PV09 is designed to maintain a constant distance between the probe and the bed (or between the probe and the free surface) in order to maintain a constant electric capacity. Thus, the instrument is able to monitor the temporal or the spatial variation of the bed (or the free surface) sampling a value per second. Then, the analogical output is converted into digital, filtered and recorded by the help of a PC card NI-DAQ (National Instruments) and of a data acquisition algorithm expressly scheduled in Labview (ver. 7.0) environment. Then a photogrammetric survey has been carried out to produce in a fully automatic way a very dense Digital Surface Model (DSM) of the bed topography of the laboratory channel. The image acquisition has been performed using a Nikon D80 digital camera with a focal length of 28 mm and a resolution of 3872 pixel x 2592 pixel; the pixel size was 6.1 mm. The camera-to-object distance was 0.65 m and the photo scale was 1:23. The photos were taken providing the stereo coverage necessary for automatic DSM generation. The photos orientation was executed by bundle adjustment without control points using only several calibrated scale bar to scale the photogrammetric model. The very dense DSM has been produced with a step of 2 mm for the whole channel using image matching techniques without editing.

Lo Brutto, Mauro

2010-05-01

198

Zonation of Hydrothermal Alteration in the Central Uplift of the Puchezh-Katunki Astrobleme  

NASA Astrophysics Data System (ADS)

The giant (D = 80 km) Puchezh-Katunki astrobleme [1,2] is the site of widespread hydrothermal alteration. It occurs mainly in the central uplift composed of brecciated archean rocks and overlain by allogenic breccia, suevites, and coptomict gravelites (the latter is the lowest bed of crater-lake deposits). Distribution and vertical zonation of secondary minerals is controlled by the thermal gradient during cooling of authigenic breccia massif, while the degree of alteration depends on the intensity of brecciation and fracturing of basement rocks. Three types of hydrothermal mineralization are distinguished on the basis of different crystallization conditions: (1) mixed hydrothermal-diagenetic, in coptomict gravelites; (2) metasomatic, including formation of Fe-Mg hydrous phyllosilicates in shocked and thermally altered gneisses and amphibolites; and (3) veins, represented by mineral associations filling fractures and voids in basement rocks, allogenic breccia, and suevites. The second and third types occur together and each displays characteristic zonations, thus several zones may be distinguished in vertical section (zones 2-4 below). The uppermost zone corresponds to mixed hydrothermal-diagenetic conditions described in (1) above. In general, four zones are distinguished, from top downward, as follows. 1. Zone of hydrothermal-diagenetic alteration in coptomict gravelites. In this zone, replacement of impact glass fragments by assemblage of montmorillonite, calcite, and pyrite, and formation of alkali zeolites and calcite as a cement are observed establishing a temperature of alteration of less than 100 degrees C. 2. Zone of low-temperature (100 degrees-200 degrees C) mineralization comosed of suevites, allogenic breccia, and the upper part of authigenic breccia down to 2.5 km. Fe-saponite develops in shocked and recrystallized basement rocks, and various zeolites, apophylite, calcite, anhydrite, and pyrite fill vugs and fractures; in addition, calcite-nontronite veinlets occur locally. The distribution of zeolites is characterized by their own zonation [3]. 3. Zone of moderate-temperature (200 degrees-300 degrees C) mineralization in basement at a depth of 2.5-4.2 km. Chlorite (of diabantite-pictochlorite series) is a common metasomatic phase associated with pyrite, and also with albite, epidote, and calcite locally. In veinlets, Ca-Fe silicates (andradite, salite, epidote, prehnite) together with pyrite, chlorite, and, very rarely, quartz, are found in a laumontite-anhydrite matrix. 4. Zone of low-moderate-temperature (150 degrees - 250 degrees C?) mineralization at a depth below 4.2 km. Prehnite, anhydrite, calcite, and pyrite are present. Absence of Ca-Fe silicates may indicate a decrease in crystallization temperature compared with the upper zone, while disappearance of hydrous phases seems to be a result of the fall of P(sub)H2O at this depth. The decrease in degree of alteration outward from the impact center and the change in zeolite composition to lower-temperature varieties as well as crystallization of gypsum instead of anhydrite are evidence of lateral hydrothermal zonation in the crater. Thus the zones may have an ellipsoidal shape corresponding to isotherms during circulation. The generalized chronological order of hydrothermal crystallization is the following: Ca-Fe silicates, chlorite (smectites)-calcite, pyrite-anhydrite- zeolites, apophyllite-calcite, nontronite. This reflects a continually decreasing temperature during the process of hydrothermal alteration. Spatial segregation of minerals is caused by change of parameters (pH, f(sub)CO2, temperature, etc.) of solutions moving in the thermogradient field, where the source of heat is a result of the thermal history of the central uplift [4]. Nevertheless, the role of endogenic heat and mass transfer in impact-induced hydrothermal circulation processes cannot be ruled out. References: [1] Masaitis V. L. and Mashchak M. S. (1990) Meteoritics, 25, 383a. [2] Pevzner L. A. et al. (1992) LPS XXIII, 1063-1064. [3] Naumov M. V. (1992) LPS XXIII, 967-968. [4] M

Naumov, M. V.

1993-07-01

199

Quantitative Analysis of Major Factors Affecting Black Carbon Transport and Concentrations in the Unique Atmospheric Structures of Urban Environment  

NASA Astrophysics Data System (ADS)

Black carbon (BC) from vehicular emission in transportation is a principal component of particulate matters ? 2.5 mum (PM2.5). PM2.5 and other diesel emission pollutants (e.g., NOx) are regulated by the Clean Air Act (CAA) according to the National Ambient Air Quality standards (NAAQS). This doctoral dissertation details a study on transport behaviors of black carbon and PM2.5 from transportation routes, their relations with the atmospheric structure of an urban formation, and their relations with the use of biodiesel fuels. The results have implications to near-road risk assessment and to the development of sustainable transportation solutions in urban centers. The first part of study quantified near-roadside black carbon transport as a function of particulate matter (PM) size and composition, as well as microclimatic variables (temperature and wind fields) at the interstate highway I-75 in northern Cincinnati, Ohio. Among variables examined, wind speed and direction significantly affect the roadside transport of black carbon and hence its effective emission factor. Observed non-Gaussian dispersion occurred during low wind and for wind directions at acute angles or upwind to the receptors, mostly occurring in the morning hours. Meandering of air pollutant mass under thermal inversion is likely the driving force. In contrary, Gaussian distribution predominated in daytime of strong downwinds. The roles of urban atmospheric structure, wind fields, and the urban heat island (UHI) effects were further examined on pollutant dispersion and transport. Spatiotemporal variations of traffic flow, atmospheric structure, ambient temperature and PM2.5 concentration data from 14 EPA-certified NAAQS monitoring stations, were analyzed in relation to land-use in the Cincinnati metropolitan area. The results show a decade-long UHI effects with higher interior temperature than that in exurban, and a prominent nocturnal thermal inversion frequent in urban boundary layer. The combined contribution from both traffic and atmospheric circulation accounted for observed spatiotemporal variability in PM2.5 concentrations. Based on these experimental and quantitative analyses, a three-dimensional model is proposed for contaminant's transport in highly urbanized Cincinnati region. Furthermore this dissertation explored implications on roadside pollutant evaluation, and on the risk analysis of future fuel substitution using biodiesel. The Gaussian-type models are poor in determining the effective emission factor particularly under nocturnal thermal inversion for which the effective emission factor is a function of lapse rate in the morning. The Gaussian models are applicable in daytime after the breakdown of thermal inversion. Lastly, among three types of fuels examined, the proposed butanol-added biodiesel-diesel blend (D80B15Bu5) yielded a good compromise between black carbon and NOx emissions while maintaining proper combustion properties. It is also found that the emission contained less black carbon and had higher organic carbon (OC) and elemental (EC) ratio than tested petroleum diesel. As demonstrated in other parts of this study, the OC-enriched emission will likely affect the black carbon occurrence and PM concentrations in the urban environments. Overall, it is suggested that urban formation and biofuel usage define the environmental impacts of black carbon, and are the focus for climate change mitigation and adaptation.

Liang, Marissa Shuang

200

Progesterone supplementation to lactating dairy cows without a corpus luteum at initiation of the Ovsynch protocol.  

PubMed

The objectives were to determine the effect of progesterone supplementation on fertility responses in lactating dairy cows without corpora lutea (CL) at initiation of the timed artificial insemination (AI) program. Holstein cows from 5 commercial dairy farms were subjected to the Ovsynch-56 protocol (d -10 GnRH, d -3 PGF2?, d -0.7 GnRH, d 0 AI). Ovaries were scanned by ultrasonography on d -10. Within farm, cows without CL were blocked by pen and assigned randomly to remain as nonsupplemented controls (CON; n=652) or to receive 2 controlled internal drug-release (CIDR) inserts containing 1.38g of progesterone each from d -10 to -3 (2CIDR; n=642). Cows with CL were randomly selected within pen and used as positive controls as cows in diestrus at the initiation of the Ovsynch protocol (DIEST; n=640). Signs of estrus were detected beginning on d -9 based on removal of tail chalk, and cows in estrus received AI on the same day. Blood samples from subsets of cows on d -10, -9, -7, -5, -3, and 0 (n=109) and on d 6, 13, and 19 (n=156) were analyzed for progesterone concentrations. Pregnancy was diagnosed on d 32 and 60 after AI. The average progesterone concentration during the timed AI program was lowest for CON, intermediate for 2CIDR, and highest for DIEST (0.92, 2.77, and 4.93 ng/mL, respectively). The proportions of cows that ovulated in response to the first GnRH (63.6, 61.1, and 47.2%, respectively) and that had a new CL on d -3 at PGF2? injection (72.4, 67.9, and 47.4%, respectively) were greater for CON and 2CIDR compared with DIEST, respectively. The diameter of the ovulatory follicle and the proportion of cows that ovulated in response to the second GnRH did not differ among treatments. A greater proportion of CON and 2CIDR cows were detected in estrus at AI compared with DIEST cows (35.8, 39.6, and 30.6%, respectively). Pregnancy per AI was less for CON compared with 2CIDR and DIEST on d 32 (31.3, 42.2, and 38.4%, respectively) and d 60 after AI (28.9, 37.2, and 33.9%, respectively), indicating that progesterone supplementation reestablished fertility in cows lacking a CL similar to that of cows in diestrus at the initiation of the timed AI program. Treatment did not affect pregnancy loss between d 32 and 60 of gestation. Pregnancy from a subset of cows with plasma progesterone concentrations indicated that a minimum concentration of 2.0 ng/mL was needed to optimize fertility. A single ultrasound examination effectively identified a low-fertility cohort of cows based on the absence of CL at the first GnRH injection of the Ovsynch protocol. Supplementation with 2 CIDR inserts increased progesterone in plasma by an additional 1.85 ng/mL compared with CON, resulting in concentrations of 2.77 ng/mL during development of the ovulatory follicle, which restored fertility in dairy cows lacking CL to a level similar to that of cows in diestrus. PMID:25682137

Bisinotto, R S; Castro, L O; Pansani, M B; Narciso, C D; Martinez, N; Sinedino, L D P; Pinto, T L C; Van de Burgwal, N S; Bosman, H M; Surjus, R S; Thatcher, W W; Santos, J E P

2015-04-01

201

DEM generation from digital photographs using computer vision: Accuracy and application  

NASA Astrophysics Data System (ADS)

Data for detailed digital elevation models (DEMs) are usually collected by expensive laser-based techniques, or by photogrammetric methods that require expertise and specialist software. However, recent advances in computer vision research now permit 3D models to be automatically derived from unordered collections of photographs, and offer the potential for significantly cheaper and quicker DEM production. Here, we review the advantages and limitations of this approach and, using imagery of the summit craters of Piton de la Fournaise, compare the precisions obtained with those from formal close range photogrammetry. The surface reconstruction process is based on a combination of structure-from-motion and multi-view stereo algorithms (SfM-MVS). Using multiple photographs of a scene taken from different positions with a consumer-grade camera, dense point clouds (millions of points) can be derived. Processing is carried out by automated 'reconstruction pipeline' software downloadable from the internet. Unlike traditional photogrammetric approaches, the initial reconstruction process does not require the identification of any control points or initial camera calibration and is carried out with little or no operator intervention. However, such reconstructions are initially un-scaled and un-oriented so additional software has been developed to permit georeferencing. Although this step requires the presence of some control points or features within the scene, it does not have the relatively strict image acquisition and control requirements of traditional photogrammetry. For accuracy, and to allow error analysis, georeferencing observations are made within the image set, rather than requiring feature matching within the point cloud. Application of SfM-MVS is demonstrated using images taken from a microlight aircraft over the summit of Piton de la Fournaise volcano (courtesy of B. van Wyk de Vries). 133 images, collected with a Canon EOS D60 and 20 mm fixed focus lens, were used to create a ~1.6 km wide DEM covering the summit craters. When compared with a DEM constructed using close-range photogrammetry the SfM-MVS results showed an RMS error of 1.0 m. The overall precision of the project can be considered by ratioing this against the average viewing distance (1000 m). This relative precision of 1:1000 is in line with the results of other projects carried out over a range of spatial scales (down to ~0.1 m), so appears to be a characteristic expected achievable precision for the SfM-MVS approach. Consequently, over shorter viewing distances, absolute precisions increase - e.g. centimeter-level precisions for outcrop-scale studies where viewing distances may be expected to be of order 10 m. Although SfM-MVS cannot deliver the accuracy and precision of formal close-range photogrammetry, it can approach the results that are achievable from single stereo image pairs. However, the main advantages of the technique lie in the enhanced flexibility in image collection and automated processing, both of which significantly decrease the level of expertise required. When compared with terrestrial laser scanning at outcrop scales, the data collection time in the field can be reduced by ~80%. SfM-MVS data quality is sufficient for the technique to provide valuable DEMs of active flows and domes where access to (or for) modern surveying equipment is restricted.

James, M. R.; Robson, S.

2012-12-01

202

The accuracy of photo-based structure-from-motion DEMs  

NASA Astrophysics Data System (ADS)

Data for detailed digital elevation models (DEMs) are usually collected by expensive laser-based techniques, or by photogrammetric methods that require expertise and specialist software. However, recent advances in computer vision research now permit 3D models to be automatically derived from unordered collections of photographs, offering the potential for significantly cheaper and quicker DEM production. Here, we assess the accuracy of this approach for geomorphological applications using examples from a coastal cliff and a volcanic edifice. The reconstruction process is based on a combination of structure-from-motion and multi-view stereo algorithms (SfM-MVS). Using multiple photographs of a scene taken from different positions with a consumer-grade camera, dense point clouds (millions of points) can be derived. Processing is carried out by automated 'reconstruction pipeline' software downloadable from the internet, e.g. http://blog.neonascent.net/archives/bundler-photogrammetry-package/. Unlike traditional photogrammetric approaches, the initial reconstruction process does not require the identification of any control points or initial camera calibration and is carried out with little or no operator intervention. However, such reconstructions are initally un-scaled and un-oriented so additional software (http://www.lancs.ac.uk/staff/jamesm/software/sfm_georef.htm) has been developed to permit georeferencing. Although this step requires the presence of some control points or features within the scene, it does not have the relatively strict image acquisition and control requirements of traditional photogrammetry. For accuracy, and to allow error analysis, georeferencing observations are made within the image set, rather than requiring feature matching within the point cloud. In our coastal example, 133 photos taken with a Canon EOS 450D and 28 mm prime lens, from viewing distances of ~20 m, were used to reconstruct a ~60 m long section of eroding cliff. The resulting surface model was compared with data collected by a Riegl LMS-Z210ii terrestrial laser scanner. Differences between the surfaces were dominated by the varying effects of occlusions on the techniques, and systematic distortion of the SfM-MVS model along the length of the cliff could not be resolved over the ±15 mm precision of the TLS data. For a larger-scale example, a ~1.6 km wide region over the summit of Piton de la Fournaise volcano was reconstructed using 133 photos taken with a Canon EOS D60 and 20 mm prime lens, from a microlight aircraft (with a representative viewing distance of 1.0 km). In this case, the resulting DEM showed an RMS error of 1.0 m when compared with the results from traditional photogrammetry and some areas of systematic error were evident. Such errors were minimised by reprocessing the SfM-MVS results with a more sophisticated camera model than is integrated into the reconstruction pipeline. In combination, the results indicate that, with a good, convergent image set, SfM-MVS can be anticipated to deliver relative precisions of 1:1000 or better, for geomorphological applications. However, under certain conditions, the restricted camera model used can result in detectable error. We highlight the requirement for new network design tools that will help optimise image collection, facilitate error visualisation and allow a user to determine whether their image network is fit for purpose.

James, M. R.; Robson, S.

2012-04-01

203

Environmental regulation of pregnancy-specific protein B concentrations during late pregnancy in dairy cattle.  

PubMed

Environmental factors, such as photoperiod and heat stress, can be manipulated during the dry period to influence health, productivity, and reproductive performance of dairy cows in their subsequent lactation. The impacts of photoperiod and heat stress on subsequent lactation are related to alterations in prolactin (PRL) signaling and may affect the expression of pregnancy-specific protein B (PSPB). Additionally, exposure of cows to heat stress during the dry period decreases gestation length; however, the mechanism involved in this process is unknown. The objective of these experiments was to evaluate the influence of environmental factors (i.e., heat stress and photoperiod) during late gestation (i.e., dry period) on PSPB concentrations in plasma of dairy cows. In Exp. 1, cows were dried off in the summer months approximately 46 d before expected calving and assigned randomly to heat stress (HT; n=30) or cooling (CL; n=30) treatment. Cooling cows were housed with sprinklers, fans, and shade, whereas HT cows were provided only shade. In Exp. 2, cows were dried off at approximately 60 d before expected calving in summer/fall months and randomly assigned to 3 treatments: long day photoperiod (LDPP: 16L:8D; n=15), short day photoperiod (SDPP: 8L:16D; n=14) and SDPP+PRL implant (12 mg/d of PRL at 28 d or 16 mg/d of PRL at 39 d; n=11). In both experiments, plasma samples were collected at dry off and at -32, -18, -7, -3 and 0 d relative to calving. In Exp. 1, greater concentrations of PSPB were detected in plasma of CL versus HT cows (388.3±24.7 vs. 287.4±23.8 ng/mL; P<0.01). Concentrations of PSPB did not differ between -46 to -18 d before calving (66.0 ng/mL). However, PSPB concentrations were greater (P<0.01) for CL cows at d -7 (534.7>357.2 ng/mL), -3 (807.2>572.2 ng/mL) and 0 (800.8>563.5 ng/mL) relative to calving. Additionally, HT cows in Exp. 1 had increased PRL plasma concentrations compared with CL cows (21.01±1.6 vs. 13.78±1.6 ng/mL). In Exp. 2, no differences were detected in plasma concentrations of PSPB (ng/mL) among LDPP, SDPP, or SDPP+PRL groups on d -60 (41.5), -32 (51.7), -18 (58.5), -7 (532.9), -3 (838.2), and 0 (729.4) relative to parturition. Photoperiodic PRL concentrations were 10.81, 7.84, and 4.22 ng/mL for LDPP, SDPP+ PRL, and SDPP, respectively. Results indicate that HT alters PSPB concentrations in late pregnancy, suggesting that placental activity is altered in cows exposed to excessive elevated temperatures around the time of calving. However, the mechanism involved likely is not associated with changes in PRL secretion. PMID:23100573

Thompson, I M; Tao, S; Branen, J; Ealy, A D; Dahl, G E

2013-01-01

204

Measurements of the acid-binding capacity of ingredients used in pig diets  

PubMed Central

Some feed ingredients bind more acid in the stomach than others and for this reason may be best omitted from pig starter foods if gastric acidity is to be promoted. The objective of this study was to measure the acid-binding capacity (ABC) of ingredients commonly used in pig starter foods. Ingredients were categorised as follows: (i) milk products (n = 6), (ii) cereals (n = 10), (iii) root and pulp products (n = 5), (iv) vegetable proteins (n = 11), (v) meat and fish meal (n = 2), (vi) medication (n = 3), (vii) amino acids (n = 4), (viii) minerals (n = 16), (ix) acid salts (n = 4), (x) acids (n = 10). A 0.5 g sample of food was suspended in 50 ml distilled de-ionised water with continuous stirring. This suspension was titrated with 0.1 mol/L HCl or 0.1 mol/L NaOH so that approximately 10 additions of titrant was required to reach pH 3.0. The pH readings after each addition were recorded following equilibration for three minutes. ABC was calculated as the amount of acid in milliequivalents (meq) required to lower the pH of 1 kg food to (a) pH 4.0 (ABC-4) and (b) pH 3.0 (ABC-3). Categories of food had significantly different (P < 0.01) ABC values. Mean ABC-4 and ABC-3 values of the ten categories were: (i) 623 (s.d. 367.0) and 936 (s.d. 460.2), (ii) 142 (s.d. 79.2) and 324 (s.d. 146.4), (iii) 368 (s.d. 65.3) and 804 (s.d. 126.7), (iv) 381 (s.d. 186.1) and 746 (s.d. 227.0), (v) 749 (s.d. 211.6) and 1508 (s.d. 360.8), (vi) 120 (s.d. 95.6) and 261 (s.d. 163.2), (vii) 177 (s.d. 60.7) and 1078 (s.d. 359.0), (viii) 5064 (s.d. 5525.1) and 7051 (s.d. 5911.6), (ix) 5057 (s.d. 1336.6) and 8945 (s.d. 2654.1) and (x) -5883 (s.d. 4220.5) and -2591 (s.d. 2245.4) meq HCl per kg, respectively. Within category, ABC-3 and ABC- 4 values were highly correlated: R2 values of 0.80 and greater for food categories i, iv, v, vi, vii and viii. The correlation between predicted and observed ABC values of 34 mixed diets was 0.83 for ABC-4 and 0.71 for ABC-3. It was concluded that complete diets with low ABC values may be formulated through careful selection of ingredients. The final pH to which ABC is measured should matter little as ABC-3 and ABC-4 are highly correlated. PMID:21851673

2005-01-01

205

Synthesis, Crystal Structure, and Magnetic Properties of Tetraphenylarsonium Tetrachloro(oxalato)rhenate(IV) and Bis(2,2'-bipyridine)tetrachloro(&mgr;-oxalato)copper(II)rhenium(IV).  

PubMed

Two new rhenium(IV) compounds of formula (AsPh(4))(2)[ReCl(4)(ox)] (1) and [ReCl(4)(&mgr;-ox)Cu(bipy)(2)] (2) (AsPh(4) = tetraphenylarsonium cation, ox = oxalate anion, and bipy = 2,2'-bipyridine) have been synthesized and their crystal structures determined by single-crystal X-ray diffraction. 1 and 2 crystallize in the monoclinic system, space groups P2(1)/c and P2(1)/n, respectively, with a = 22.250(5) Å, b = 11.245(3) Å, c = 19.089(4) Å, beta = 96.59(2) degrees, and Z = 4 for 1 and a = 9.421(2) Å, b = 16.909(4) Å, c = 16.179(4) Å, beta = 93.97(2) degrees, and Z = 4 for 2. The structure of 1 is made up of [ReCl(4)(ox)](2)(-) anions and AsPh(4)(+) cations held united by electrostatic forces. Rhenium(IV) is hexacoordinate, with two oxygens of a chelating ox and four chlorine atoms building a distorted octahedron around the metal atom. There is no contact between the [ReCl(4)(ox)](2)(-) anions, the shortest Re.Re and Cl.Cl distances being 10.345 and 7.209 Å, respectively. This anionic complex is coordinated to a [Cu(bipy)(2)](2+) cation in 2, through one oxalate-oxygen, giving a neutral heterometallic dinuclear unit. The Cu(II) ion shows a very distorted five-coordinated geometry, four bipy-nitrogens occuping the equatorial positions and the oxygen atom the apical one. The basal plane geometry is distorted toward the tetrahedron, the dihedral angle between the mean planes of the two bipy ligands is 37.6(2) degrees. These [ReCl(4)(&mgr;-ox)Cu(bipy)(2)] units are arranged in such a way that a chlorine atom of one of them points toward the copper atom of the neighboring one, forming helicoid chains. The intrachain Re.Cu distances through chloro and oxalato bridges are 4.658 and 4.798 Å, respectively. The magnetic behavior of 1 and 2 has been investigated over the temperature range 1.8-300 K. 1 is a magnetically diluted Re(IV) complex, the great value of zero-field splitting of the ground level (D = 60 cm(-)(1)) accounting for the variation of chi(M)T with T in the low-temperature range. 2 behaves as a ferrimagnetic chain, with weak antiferromagnetic interactions between Re(IV) and Cu(II) through oxalato and single chloro bridges. PMID:11671200

Chiozzone, Raúl; González, Ricardo; Kremer, Carlos; De Munno, Giovanni; Cano, Joan; Lloret, Francesc; Julve, Miguel; Faus, Juan

1999-10-18

206

Mexican Infrared-Optical New Technology Telescope: The TIM project  

NASA Astrophysics Data System (ADS)

The scientific goals for TIM are an image quality of 0.25", consistent with the seeing at our site, optimization for the infrared as many scientific programs are going in that region of the spectrum, a M1 diameter in excess of 6.5 meters and a field of view limited to 10 arc minutes. Practical reasons, such as the limited funding available and the requirement of mexican financial agencies that the telescope should be built and installed in Mexico, lead us to decide for a segmented telescope, with a single secondary mirror, a single cassegrain focus and a light high stifness tubular structure. ALthough we are still working on the conceptual design of the telescope, there are some concepts that we are pursuing. The optical desing (M1+M2) is Ritchey-Cretien type with an hyperbolic primary 7.8 m od F/1.5 and a 0.9 m diameter f/15 secondary mirror. This will give a plate scale of 1.7 "/mm. This is 0.03 "/pix in direct mode, enough for AO goals. As for direct imaging, a factor of 5 reduction with 20 cm diam optical components would be able to produce 5' fields on a 2048, 20 microns type detector with 0.17"/pix. This implies that, with the use of auxiliary optics which is a common need for each particular instrument anyway, a wide variety of needs can be accomodated with a single secondary mirror. Choping for infrared observations would however introduce a additional cost in the secondary mirror. Alternatively the use of cold tertiary choping mirror is currently under study. The M1+M2 design currently aquires d80 of 0.17" in a 5' field without correction and 1" in a 10' field, that would require a field correcting lens. The M1 mirror will be segmented into 19 1.8 m diameter segments. There are 4 kinds of segments, the central, which we have kept to provide a reference for phasing, 6 more segments for the first ring and 12 in the outer ring, of two different kinds. The spacing between the segments is 5 mm, enough to reduce the inter-segment thermal background to half a percent of a 99\\% reflectivity primary mirror. The width of the segments was decided to be 7.5 cm, similar to keck's, noting also that the self weight deflections of this segment are sligthly inferior (more rigid) than the NTT mirror as defined by Willson et al. Due to this increased rigidity, and to a more homogeneous distribution, while the NTT mirror is supported in 78 points, the Keck segments are supported by 36. We have decreased this number of support points to 19 in our design, but using extended actuators (airbags) that distribute the support force and that together support most of the area of the segment. The current design allows also the inclusion of wind buffeting actuators, and position actuators at the edges of each segment. Position control of each segment is accomplished by electromechanical and piezo actuators, that thanks to the force actuators, only have to act on a reduced portion of the weigth of each segment. The hard points can be located at the edge of the segment and provide common reference for neighboor segments as well. The telescope structure is being designed by finite element analysis. It is an alt-az mount with cassegrain focus instruments only. The structure is being designed as a high stiffnes, low weigth tubular structure. The upper tube is a two tier design with eigen-frequencies larger than 12.9 Htz. The elevation ring is also being designed as a tubular structure obtaining so far eigen-frecuencies of 12.6. In the combined structure the first eigenfrequency goes down to 8 Hz, but it is a rigid rotation about the elevation axis, and so it is not structural. The second eigenfrequency is a bending of the secondary structure at 8.5 hz, and other designs of the secondary vanes are being sttudied to increment this frequency. The third eigenfrequency is the first real eigen-frequency of the structure and occurs at 13hz. Maximum deflections by gravity are 2.2 mm for the telescope tube at horizon while at zenith its only of 0.7mm. The total weigth of the structure, optics and a few instruments is expected

Salas, L.

1998-11-01