Science.gov

Sample records for dechets tres faiblement

  1. The Tres Ventanas Mummies of Peru.

    PubMed

    Wann, L Samuel; Lombardi, Guido; Ojeda, Bernadino; Benfer, Robert A; Rivera, Ricardo; Finch, Caleb E; Thomas, Gregory S; Thompson, Randall C

    2015-06-01

    The Tres Ventanas mummies of Peru are thought to be among the oldest mummies in existence, dating to between 8,000 and 10,000 years ago. A preliminary assessment is made of the potential of these mummies for use in future research on mummified remains. Although the Tres Ventanas cave and the four mummies were explored and then excavated by Frederic Engel in 1966-67, and the project is named in his honor as the "Engel Study Group", the importance of both the physical remains and the context in which they were found has only come to light in the last few years. Most important is the paleopathological examination of these remains, since these mummies are found in a high altitude area of Peru where adaptation to the limited partial pressure of oxygen is perhaps a key component in broadening our understanding of human diversity in past populations. PMID:25998637

  2. APOSTLE: 11 TRANSIT OBSERVATIONS OF TrES-3b

    SciTech Connect

    Kundurthy, P.; Becker, A. C.; Agol, E.; Barnes, R.; Williams, B.

    2013-02-10

    The Apache Point Survey of Transit Lightcurves of Exoplanets (APOSTLE) observed 11 transits of TrES-3b over two years in order to constrain system parameters and look for transit timing and depth variations. We describe an updated analysis protocol for APOSTLE data, including the reduction pipeline, transit model, and Markov Chain Monte Carlo analyzer. Our estimates of the system parameters for TrES-3b are consistent with previous estimates to within the 2{sigma} confidence level. We improved the errors (by 10%-30%) on system parameters such as the orbital inclination (i {sub orb}), impact parameter (b), and stellar density ({rho}{sub *}) compared to previous measurements. The near-grazing nature of the system, and incomplete sampling of some transits, limited our ability to place reliable uncertainties on individual transit depths and hence we do not report strong evidence for variability. Our analysis of the transit timing data shows no evidence for transit timing variations and our timing measurements are able to rule out super-Earth and gas giant companions in low-order mean motion resonance with TrES-3b.

  3. 78 FR 77445 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-23

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on December 6, 2013, Tres Palacios Gas Storage LLC (Tres Palacios) 700 Louisiana Street, Suite 2060,...

  4. 76 FR 41235 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on July 5, 2011, Tres Palacios Gas Storage LLC (TPGS), Two Brush Creek Blvd., Suite 200, Kansas...

  5. The University of Arizona Astronomy Club Observations of Transiting Extrasolar Planets TrES-3b and TrES-4b

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Hardegree-Ullman, K.; Smart, B.; Walker-LaFollette, A.; Cunningham, K.; Hardegree-Ullman, E. E.; Crawford, B.; Mueting, J.; Carleton, T.; Schwarz, K.; Robertson, A.; Guvenen, B.; Towner, A.; Austin, C.; Henz, T.; Keys, D.; Johnson, K.

    2011-05-01

    Using the Steward Observatory 61" Kuiper Telescope, The University of Arizona Astronomy Club observed extrasolar planets TrES-3b and TrES-4b. We observed the planets with the Harris-B, V, and R filters as they transited their parent stars during the months of May-July 2009. The main goal of this project was to get undergraduates involved with a research astronomy project and allow them to gain experience beyond what they would receive in the classroom. Many of the team members were introduced to astronomical observing techniques and data reduction using IRAF. Part of the project involved determining the optimum number of flat-field and bias frames required for image calibrations. With our results, we have been able to confirm and refine previously published values for the planets' orbital inclination, mass, radius, and density.

  6. Chemical Composition of the Planet-Harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Yong, D.; Carney, B. W.; Laird, J. B.; Latham, D. W.; Torres, G.

    2005-12-01

    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck/HIRES and HET/HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]> = -0.02± 0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets, and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way Galaxy. TrES-1 is found to be a very likely member of the thin disk population. By comparing α -element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]> 0.0) stars with planets appear to be systematically underabundant in [α /Fe] by ˜ 0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  7. Chemical Composition of the Planet-harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, Alessandro; Yong, David; Carney, Bruce W.; Laird, John B.; Latham, David W.; Torres, Guillermo

    2006-04-01

    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck HIRES and Hobby-Eberly Telescope HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]>=-0.02+/-0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way. TrES-1 is found to be very likely a member of the thin-disk population. By comparing α-element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]>~0.0) stars with planets appear to be systematically underabundant in [α/Fe] by ~0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  8. VizieR Online Data Catalog: TrES-4b RV and Ic curves (Sozzetti+, 2015)

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Bonomo, A. S.; Biazzo, K.; Mancini, L.; Damasso, M.; Desidera, S.; Gratton, R.; Lanza, A. F.; Poretti, E.; Rainer, M.; Malavolta, L.; Affer, L.; Barbieri, M.; Bedin, L. R.; Boccato, C.; Bonavita, M.; Borsa, F.; Ciceri, S.; Claudi, R. U.; Gandolfi, D.; Giacobbe, P.; Henning, T.; Knapic, C.; Latham, D. W.; Lodato, G.; Maggio, A.; Maldonado, J.; Marzari, F.; Martinez Fiorenzano, A. F.; Micela, G.; Molinari, E.; Mordasini, C.; Nascimbeni, V.; Pagano, I.; Pedani, M.; Pepe, F.; Piotto, G.; Santos, N.; Scandariato, G.; Shkolnik, E.; Southworth, J.

    2015-06-01

    The TrES-4 system was observed with HARPS-N on 17 individual epochs between March 2013 and July 2014. We carried out Ic-band precision photometric observations of two complete transit events of TrES-4 b with the CAHA 1.23-m on UT 2013 July 6 and UT 2014 June 30. (2 data files).

  9. Optical and Near-UV Observations of the Transiting Extrasolar Planet TrES-4b

    NASA Astrophysics Data System (ADS)

    Smith, Carter-Thaxton; Turner, J.; Carleton, T.; Crawford, B.; Guvenen, B.; Hardegree-Ullman, K.; Small, L.; Towner, A. P.; Walker-LaFollette, A.; Henz, T.

    2013-01-01

    Using the Steward Observatory 61” Kuiper Telescope, The University of Arizona Astronomy Club conducted photometric observations of the transiting extrasolar planet TrES-4b as part of the Exoplanet Observation Project. Observations were made in the Bessell U, Harris B, and Harris R filters. Initial observations were made in 2009, with follow up observations in 2011. Basic data reduction and photometry was done using IRAF and determination of transit parameters was done using Transit Analysis Package (TAP) and JKTEBOP transit modeling code. We present an updated planetary mass, radius, density, surface gravity, Safronov number, equilibrium temperature, orbital distance, and orbital inclination for TrES-4b. In addition, we also searched for asymmetries between the near-UV and optical light curves. This project, started in spring 2009, has introduced many undergraduate students to research and given them valuable experience with data reduction and observation techniques.

  10. DETECTION OF PLANETARY EMISSION FROM THE EXOPLANET TrES-2 USING SPITZER/IRAC

    SciTech Connect

    O'Donovan, Francis T.; Charbonneau, David; Knutson, Heather A.; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake

    2010-02-20

    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +- 0.021%, 0.230% +- 0.024%, 0.199% +- 0.054%, and 0.359% +- 0.060% at 3.6 {mu}m, 4.5 {mu}m, 5.8 {mu}m, and 8.0 {mu}m, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T{sub eff} = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four IRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet.

  11. Detection of Planetary Emission from the Exoplanet TrES-2 Using Spitzer/IRAC

    NASA Technical Reports Server (NTRS)

    Donovan, Francis T.; Charbonneau, David; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake; Knutson, Heather A.

    2010-01-01

    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +/- 0.021%, 0.230% +/- 0.024%, 0.199% +/- 0.054%, and 0.359% +/- 0.060% at 3.6 microns, 4.5 microns, 5.8 microns, and 8.0 microns, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T(sub eff) = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four lRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet. Key words: eclipses - infrared: stars - planetary systems - stars: individual (OSC 03549-02811) - techniques: photometric

  12. TRES: Identification of Discriminatory and Informative SNPs from Population Genomic Data.

    PubMed

    Kavakiotis, Ioannis; Triantafyllidis, Alexandros; Ntelidou, Despoina; Alexandri, Panoraia; Megens, Hendrik-Jan; Crooijmans, Richard P M A; Groenen, Martien A M; Tsoumakas, Grigorios; Vlahavas, Ioannis

    2015-01-01

    The advent of high-throughput genomic technologies is enabling analyses on thousands or even millions of single-nucleotide polymorphisms (SNPs). At the same time, the selection of a minimum number of SNPs with the maximum information content is becoming increasingly problematic. Available locus ranking programs have been accused of providing upwardly biased results (concerning the predicted accuracy of the chosen set of markers for population assignment), cannot handle high-dimensional datasets, and some of them are computationally intensive. The toolbox for ranking and evaluation of SNPs (TRES) is a collection of algorithms built in a user-friendly and computationally efficient software that can manipulate and analyze datasets even in the order of millions of genotypes in a matter of seconds. It offers a variety of established methods for evaluating and ranking SNPs on user defined groups of populations and produces a set of predefined number of top ranked loci. Moreover, dataset manipulation algorithms enable users to convert datasets in different file formats, split the initial datasets into train and test sets, and finally create datasets containing only selected SNPs occurring from the SNP selection analysis for later on evaluation in dedicated software such as GENECLASS. This application can aid biologists to select loci with maximum power for optimization of cost-effective panels with applications related to e.g. species identification, wildlife management, and forensic problems. TRES is available for all operating systems at http://mlkd.csd.auth.gr/bio/tres. PMID:26137847

  13. Planetary transit observations at the University Observatory Jena: TrES-2

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Mugrauer, M.; Schmidt, T. O. B.; Roell, T.; Eisenbeiss, T.; Hohle, M. M.; Koeltzsch, A.; Vaňko, M.; Ginski, Ch.; Marka, C.; Moualla, M.; Tetzlaff, N.; Seifahrt, A.; Broeg, Ch.; Koppenhoefer, J.; Raetz, M.; Neuhäuser, R.

    2009-05-01

    We report on observations of several transit events of the transiting planet TrES-2 obtained with the Cassegrain-Teleskop-Kamera at the University Observatory Jena. Between March 2007 and November 2008 ten different transits and almost a complete orbital period were observed. Overall, in 40 nights of observation 4291 exposures (in total 71.52 h of observation) of the TrES-2 parent star were taken. With the transit timings for TrES-2 from the 34 events published by the TrES-network, the Transit Light Curve project and the Exoplanet Transit Database plus our own ten transits, we find that the orbital period is P=(2.470614± 0.000001) d, a slight change by ˜ 0.6 s compared to the previously published period. We present new ephemeris for this transiting planet. Furthermore, we found a second dip after the transit which could either be due to a blended variable star or occultation of a second star or even an additional object in the system. Our observations will be useful for future investigations of timing variations caused by additional perturbing planets and/or stellar spots and/or moons. Based on observations obtained with telescopes of the University Observatory Jena, which is operated by the Astrophysical Institute of the Friedrich-Schiller-University Jena and the 80cm telescope of the Wendelstein Observatory of the Ludwig-Maximilians-University Munich.

  14. ON THE APPARENT ORBITAL INCLINATION CHANGE OF THE EXTRASOLAR TRANSITING PLANET TrES-2b

    SciTech Connect

    Scuderi, Louis J.; Dittmann, Jason A.; Males, Jared R.; Green, Elizabeth M.; Close, Laird M.

    2010-05-01

    On 2009 June 15 UT the transit of TrES-2b was detected using the University of Arizona's 1.55 m Kuiper Telescope with 2.0-2.5 millimag rms accuracy in the I band. We find a central transit time of T{sub c} = 2454997.76286 {+-} 0.00035 HJD, an orbital period of P = 2.4706127 {+-} 0.0000009 days, and an inclination angle of i = 83.{sup 0}92 {+-} 0{sup 0}.05, which is consistent with our re-fit of the original I-band light curve of O'Donovan et al. where we find i = 83.{sup 0}84 {+-} 0{sup 0}.05. We calculate an insignificant inclination change of {Delta}i = -0.{sup 0}08 {+-} 0{sup 0}.07 over the last three years, and as such, our observations rule out, at the {approx}11{sigma} level, the apparent change of orbital inclination to i{sub predicted} = 83.{sup 0}35 {+-} 0{sup 0}.1 as predicted by Mislis and Schmitt and Mislis et al. for our epoch. Moreover, our analysis of a recently published Kepler Space Telescope light curve for TrES-2b finds an inclination of i = 83.{sup 0}91 {+-} 0.{sup 0}03 for a similar epoch. These Kepler results definitively rule out change in i as a function of time. Indeed, we detect no significant changes in any of the orbital parameters of TrES-2b.

  15. A Spitzer Five-band Analysis of the Jupiter-sized Planet TrES-1

    NASA Astrophysics Data System (ADS)

    Cubillos, Patricio; Harrington, Joseph; Madhusudhan, Nikku; Foster, Andrew S. D.; Lust, Nate B.; Hardy, Ryan A.; Bowman, M. Oliver

    2014-12-01

    With an equilibrium temperature of 1200 K, TrES-1 is one of the coolest hot Jupiters observed by Spitzer. It was also the first planet discovered by any transit survey and one of the first exoplanets from which thermal emission was directly observed. We analyzed all Spitzer eclipse and transit data for TrES-1 and obtained its eclipse depths and brightness temperatures in the 3.6 μm (0.083% ± 0.024%, 1270 ± 110 K), 4.5 μm (0.094% ± 0.024%, 1126 ± 90 K), 5.8 μm (0.162% ± 0.042%, 1205 ± 130 K), 8.0 μm (0.213% ± 0.042%, 1190 ± 130 K), and 16 μm (0.33% ± 0.12%, 1270 ± 310 K) bands. The eclipse depths can be explained, within 1σ errors, by a standard atmospheric model with solar abundance composition in chemical equilibrium, with or without a thermal inversion. The combined analysis of the transit, eclipse, and radial-velocity ephemerides gives an eccentricity of e = 0.033+0.015 -0.031, consistent with a circular orbit. Since TrES-1's eclipses have low signal-to-noise ratios, we implemented optimal photometry and differential-evolution Markov Chain Monte Carlo (MCMC) algorithms in our Photometry for Orbits, Eclipses, and Transits pipeline. Benefits include higher photometric precision and ~10 times faster MCMC convergence, with better exploration of the phase space and no manual parameter tuning.

  16. A Spitzer five-band analysis of the Jupiter-sized planet TrES-1

    SciTech Connect

    Cubillos, Patricio; Harrington, Joseph; Foster, Andrew S. D.; Lust, Nate B.; Hardy, Ryan A.; Bowman, M. Oliver; Madhusudhan, Nikku

    2014-12-10

    With an equilibrium temperature of 1200 K, TrES-1 is one of the coolest hot Jupiters observed by Spitzer. It was also the first planet discovered by any transit survey and one of the first exoplanets from which thermal emission was directly observed. We analyzed all Spitzer eclipse and transit data for TrES-1 and obtained its eclipse depths and brightness temperatures in the 3.6 μm (0.083% ± 0.024%, 1270 ± 110 K), 4.5 μm (0.094% ± 0.024%, 1126 ± 90 K), 5.8 μm (0.162% ± 0.042%, 1205 ± 130 K), 8.0 μm (0.213% ± 0.042%, 1190 ± 130 K), and 16 μm (0.33% ± 0.12%, 1270 ± 310 K) bands. The eclipse depths can be explained, within 1σ errors, by a standard atmospheric model with solar abundance composition in chemical equilibrium, with or without a thermal inversion. The combined analysis of the transit, eclipse, and radial-velocity ephemerides gives an eccentricity of e=0.033{sub −0.031}{sup +0.015}, consistent with a circular orbit. Since TrES-1's eclipses have low signal-to-noise ratios, we implemented optimal photometry and differential-evolution Markov Chain Monte Carlo (MCMC) algorithms in our Photometry for Orbits, Eclipses, and Transits pipeline. Benefits include higher photometric precision and ∼10 times faster MCMC convergence, with better exploration of the phase space and no manual parameter tuning.

  17. Analysis of Kepler's Short-cadence Photometry for TrES-2b

    NASA Astrophysics Data System (ADS)

    Kipping, David; Bakos, Gáspár

    2011-05-01

    We present an analysis of 18 short-cadence (SC) transit light curves of TrES-2b using quarter 0 (Q0) and quarter 1 (Q1) from the Kepler Mission. The photometry is of unprecedented precision, 237 ppm minute-1, allowing for the most accurate determination of the transit parameters yet obtained for this system. Global fits of the transit photometry, radial velocities, and known transit times are used to obtain a self-consistent set of refined parameters for this system, including updated stellar and planetary parameters. Special attention is paid to fitting for limb darkening and eccentricity. We place an upper limit on the occultation depth to be <72.9 ppm to 3σ confidence, indicating TrES-2b has the lowest determined geometric albedo for an exoplanet, of Ag < 0.146. We also produce a transit timing analysis using Kepler's SC data and demonstrate exceptional timing precision at the level of a few seconds for each transit event. With 18 fully sampled transits at such high precision, we are able to produce stringent constraints on the presence of perturbing planets, Trojans, and extrasolar moons. We introduce the novel use of control data to identify phasing effects. We also exclude the previously proposed hypotheses of short-period transit time variation and additional transits but find that the hypothesis of long-term inclination change is neither supported nor refuted by our analysis. Based on archival data of the Kepler telescope.

  18. ANALYSIS OF KEPLER'S SHORT-CADENCE PHOTOMETRY FOR TrES-2b

    SciTech Connect

    Kipping, David; Bakos, Gaspar

    2011-05-20

    We present an analysis of 18 short-cadence (SC) transit light curves of TrES-2b using quarter 0 (Q0) and quarter 1 (Q1) from the Kepler Mission. The photometry is of unprecedented precision, 237 ppm minute{sup -1}, allowing for the most accurate determination of the transit parameters yet obtained for this system. Global fits of the transit photometry, radial velocities, and known transit times are used to obtain a self-consistent set of refined parameters for this system, including updated stellar and planetary parameters. Special attention is paid to fitting for limb darkening and eccentricity. We place an upper limit on the occultation depth to be <72.9 ppm to 3{sigma} confidence, indicating TrES-2b has the lowest determined geometric albedo for an exoplanet, of A{sub g} < 0.146. We also produce a transit timing analysis using Kepler's SC data and demonstrate exceptional timing precision at the level of a few seconds for each transit event. With 18 fully sampled transits at such high precision, we are able to produce stringent constraints on the presence of perturbing planets, Trojans, and extrasolar moons. We introduce the novel use of control data to identify phasing effects. We also exclude the previously proposed hypotheses of short-period transit time variation and additional transits but find that the hypothesis of long-term inclination change is neither supported nor refuted by our analysis.

  19. SYSTEM PARAMETERS, TRANSIT TIMES, AND SECONDARY ECLIPSE CONSTRAINTS OF THE EXOPLANET SYSTEMS HAT-P-4, TrES-2, TrES-3, and WASP-3 FROM THE NASA EPOXI MISSION OF OPPORTUNITY

    SciTech Connect

    Christiansen, Jessie L.; Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Deming, Drake; Barry, Richard K.; Livengood, Timothy A.; Hewagama, Tilak; Madhusudhan, Nikku; Seager, Sara; Wellnitz, Dennis D.; A'Hearn, Michael F.; Hampton, Don L.; Lisse, Carey M.

    2011-01-10

    As part of the NASA EPOXI Mission of Opportunity, we observed seven known transiting extrasolar planet systems in order to construct time series photometry of extremely high phase coverage and precision. Here we present the results for four 'hot-Jupiter systems' with near-solar stars-HAT-P-4, TrES-3, TrES-2, and WASP-3. We observe 10 transits of HAT-P-4, estimating the planet radius R{sub p} = 1.332 {+-} 0.052 R{sub Jup}, the stellar radius R{sub *} = 1.602 {+-} 0.061 R{sub sun}, the inclination i = 89.67 {+-} 0.30 deg, and the transit duration from first to fourth contact {tau} = 255.6 {+-} 1.9 minutes. For TrES-3, we observe seven transits and find R{sub p} = 1.320 {+-} 0.057 R{sub Jup}, R{sub *} = 0.817 {+-} 0.022 R{sub sun}, i = 81.99 {+-} 0.30 deg, and {tau} = 81.9 {+-} 1.1 minutes. We also note a long-term variability in the TrES-3 light curve, which may be due to star spots. We observe nine transits of TrES-2 and find R{sub p} = 1.169 {+-} 0.034 R{sub Jup}, R{sub *} = 0.940 {+-} 0.026 R{sub sun}, i = 84.15 {+-} 0.16 deg, and {tau} = 107.3 {+-} 1.1 minutes. Finally, we observe eight transits of WASP-3, finding R{sub p} = 1.385 {+-} 0.060 R{sub Jup}, R{sub *} = 1.354 {+-} 0.056 R{sub sun}, i = 84.22 {+-} 0.81 deg, and {tau} = 167.3 {+-} 1.3 minutes. We present refined orbital periods and times of transit for each target. We state 95% confidence upper limits on the secondary eclipse depths in our broadband visible bandpass centered on 650 nm. These limits are 0.073% for HAT-P-4, 0.062% for TrES-3, 0.16% for TrES-2, and 0.11% for WASP-3. We combine the TrES-3 secondary eclipse information with the existing published data and confirm that the atmosphere likely does not have a temperature inversion.

  20. POSSIBLE TRANSIT TIMING VARIATIONS OF THE TrES-3 PLANETARY SYSTEM

    SciTech Connect

    Jiang, Ing-Guey; Wu, Yu-Ting; Chien, Ping; Lin, Yi-Ling; Chen, Hong-Yu; Hu, Juei-Hwa; Yeh, Li-Chin; Thakur, Parijat; Sun Zhao; Ji Jianghui

    2013-03-15

    Five newly observed transit light curves of the TrES-3 planetary system are presented. Together with other light-curve data from the literature, 23 transit light curves in total, which cover an overall timescale of 911 epochs, have been analyzed through a standard procedure. From these observational data, the system's orbital parameters are determined and possible transit timing variations (TTVs) are investigated. Given that a null TTV produces a fit with reduced {chi}{sup 2} = 1.52, our results agree with previous work, that TTVs might not exist in these data. However, a one-frequency oscillating TTV model, giving a fit with a reduced {chi}{sup 2} = 0.93, does possess a statistically higher probability. It is thus concluded that future observations and dynamical simulations for this planetary system will be very important.

  1. Metazoan parasite community of blue sea catfish, Sciades guatemalensis (Ariidae), from Tres Palos Lagoon, Guerrero, Mexico.

    PubMed

    Violante-González, Juan; Aguirre-Macedo, Ma Leopoldina; Rojas-Herrera, Agustín; Guerrero, Salvador Gil

    2009-10-01

    The seasonal dynamic of the metazoan parasite community of the blue sea catfish (Sciades guatemalensis) from Tres Palos Lagoon, Guerrero, Mexico, was studied at the component community and infracommunity levels. A total of 382 fish were collected during the regional dry and rainy seasons (a total of seven seasons) between April 2000 and September 2007. Nine helminths were collected: Neotetraonchus sp., Pseudoacanthostomum panamense, Austrodiplostomum compactum, Clinostomum complanatum, Metadena sp., Pseudoleptorhynchoides lamothei, Neoechinorhynchus cf. golvani, Hysterothylacium perezi, and Contracaecum sp. The infection dynamics of some dominant helminths was influenced by environmental changes generated by the dry/rainy season cycle. Nested (non-random) species composition was observed in the infracommunities during almost all of the sample period. Variation in the intensity of nestedness was attributed to a sequential colonization process over time by the dominant helminths. PMID:19548005

  2. The GAPS programme with HARPS-N at TNG. VI. The curious case of TrES-4b

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Bonomo, A. S.; Biazzo, K.; Mancini, L.; Damasso, M.; Desidera, S.; Gratton, R.; Lanza, A. F.; Poretti, E.; Rainer, M.; Malavolta, L.; Affer, L.; Barbieri, M.; Bedin, L. R.; Boccato, C.; Bonavita, M.; Borsa, F.; Ciceri, S.; Claudi, R. U.; Gandolfi, D.; Giacobbe, P.; Henning, T.; Knapic, C.; Latham, D. W.; Lodato, G.; Maggio, A.; Maldonado, J.; Marzari, F.; Martinez Fiorenzano, A. F.; Micela, G.; Molinari, E.; Mordasini, C.; Nascimbeni, V.; Pagano, I.; Pedani, M.; Pepe, F.; Piotto, G.; Santos, N.; Scandariato, G.; Shkolnik, E.; Southworth, J.

    2015-03-01

    We update the TrES-4 system parameters using high-precision HARPS-N radial-velocity measurements and new photometric light curves. A combined spectroscopic and photometric analysis allows us to determine a spectroscopic orbit with a semi-amplitude K = 51 ± 3 m s-1. The derived mass of TrES-4b is found to be Mp = 0.49 ± 0.04 MJup, significantly lower than previously reported. Combined with the large radius () inferred from our analysis, TrES-4b becomes the transiting hot Jupiter with the second-lowest density known. We discuss several scenarios to explain the puzzling discrepancy in the mass of TrES-4b in the context of the exotic class of highly inflated transiting giant planets. Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundacion Galileo Galilei of the INAF at the Spanish Observatorio del Roque de los Muchachos of the IAC in the frame of the program Global Architecture of Planetary Systems (GAPS), and with the Zeiss 1.23-m telescope at the German-Spanish Astronomical Center at Calar Alto, Spain. Tables 1 and 3 are available in electronic form at http://www.aanda.org

  3. 77 FR 40628 - Draft Safe Harbor Agreement and Application for an Enhancement of Survival Permit for the Tres...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-10

    ...: Mike_Martinez@fws.gov . Include ``Arizona Ecological Services Field Office draft Tres Rios SHA'' in the.... FOR FURTHER INFORMATION CONTACT: Mike Martinez, at the U.S. Fish and Wildlife Service, by mail at the address under ADDRESSES, by phone at 602-242-0210 x224, or by email at...

  4. ATMOSPHERE AND SPECTRAL MODELS OF THE KEPLER-FIELD PLANETS HAT-P-7b AND TrES-2

    SciTech Connect

    Spiegel, David S.; Burrows, Adam E-mail: burrows@astro.princeton.ed

    2010-10-10

    We develop atmosphere models of two of the three Kepler-field planets that were known prior to the start of the Kepler mission (HAT-P-7b and TrES-2). We find that published Kepler and Spitzer data for HAT-P-7b appear to require an extremely hot upper atmosphere on the dayside, with a strong thermal inversion and little day-night redistribution. The Spitzer data for TrES-2 suggest a mild thermal inversion with moderate day-night redistribution. We examine the effect of nonequilibrium chemistry on TrES-2 model atmospheres and find that methane levels must be adjusted by extreme amounts in order to cause even mild changes in atmospheric structure and emergent spectra. Our best-fit models to the Spitzer data for TrES-2 lead us to predict a low secondary eclipse planet-star flux ratio ({approx}<2 x 10{sup -5}) in the Kepler bandpass, which is consistent with what very recent observations have found. Finally, we consider how the Kepler-band optical flux from a hot exoplanet depends on the strength of a possible extra optical absorber in the upper atmosphere. We find that the optical flux is not monotonic in optical opacity, and the non-monotonicity is greater for brighter, hotter stars.

  5. THE BROADBAND INFRARED EMISSION SPECTRUM OF THE EXOPLANET TrES-3

    SciTech Connect

    Fressin, Francois; Knutson, Heather A.; Charbonneau, David; O'Donovan, Francis T.; Burrows, Adam; Spiegel, David; Deming, Drake; Mandushev, Georgi

    2010-03-01

    We use the Spitzer Space Telescope to estimate the dayside thermal emission of the exoplanet TrES-3 integrated in the 3.6, 4.5, 5.8, and 8.0 {mu}m bandpasses of the Infrared Array Camera (IRAC) instrument. We observe two secondary eclipses and find relative eclipse depths of 0.00346 +- 0.00035, 0.00372 +- 0.00054, 0.00449 +- 0.00097, and 0.00475 +- 0.00046, respectively, in the four IRAC bandpasses. We combine our results with the earlier K-band measurement of De Mooij et al., and compare them with models of the planetary emission. We find that the planet does not require the presence of an inversion layer in the high atmosphere. This is the first very strongly irradiated planet that does not have a temperature inversion, which indicates that stellar or planetary characteristics other than temperature have an important impact on temperature inversion. De Mooij and Snellen also detected a possible slight offset in the timing of the secondary eclipse in the K band. However, based on our four Spitzer channels, we place a 3sigma upper limit of |ecos(omega)| < 0.0056, where e is the planet's orbital eccentricity and omega is the longitude of the periastron. This result strongly indicates that the orbit is circular, as expected from tidal circularization theory.

  6. Observations of the transiting planet TrES-2 with the AIU Jena telescope in Großschwabhausen

    NASA Astrophysics Data System (ADS)

    Raetz, S.; Mugrauer, M.; Schmidt, T. O. B.; Roell, T.; Eisenbeiss, T.; Hohle, M.; Seifahrt, A.; Koeltzsch, A.; Vaňko, M.; Broeg, Ch.; Koppenhoefer, J.; Neuhäuser, R.

    2009-02-01

    We have started high precision photometric monitoring observations at the AIU Jena observatory in Großschwabhausen near Jena in fall 2006. We used a 25.4cm Cassegrain telescope equipped with a CCD-camera mounted piggyback on a 90cm telescope. To test the attainable photometric precision, we observed stars with known transiting planets. We could recover all planetary transits observed by us. We observed the parent star of the transiting planet TrES-2 over a longer period in Großschwabhausen. Between March and November 2007 seven different transits and almost a complete orbital period were analyzed. Overall, in 31 nights of observation 3423 exposures (in total 57.05h of observation) of the TrES-2 parent star were taken. Here, we present our methods and the resulting light curves. Using our observations we could improve the orbital parameters of the system.

  7. Influence of deposit architecture on intrastratal deformation, slope deposits of the Tres Pasos Formation, Chile

    NASA Astrophysics Data System (ADS)

    Auchter, Neal C.; Romans, Brian W.; Hubbard, Stephen M.

    2016-07-01

    Slope sediments on passive and active margins deform and fail across a broad range of scales ranging from loading and sediment remobilization near the sediment-water interface to submarine landslides and mass movements that incorporate significant volumes of slope deposits. Deformational styles are characterized by updip extension and downdip compressional features that occur above a detachment surface. Conditions for failure and deformation include the presence of weak layer(s) that serve as a detachment surface, competency contrasts that allow for detachment and downslope movement, deformation above a detachment surface, and a triggering mechanism(s) that initiates failure. Slope failure processes and products are well documented at scales resolvable by seismic-reflection surveys and in instances of extensive downslope failure, but the processes and products associated with intermediate-scale slope deformation are poorly understood. Intrastratal deformation is defined as stratigraphically isolated zones of deformation bounded above and below by concordant and undeformed strata. In this study, outcrop examples of intrastratal deformation from the Upper Cretaceous Tres Pasos Formation are used to elucidate the influence of depositional architecture on slope deformation. The facies distribution associated with compensational stacking of lobe deposits is shown to have a first-order control on the location and style of deformation. Detachment planes that form in mudstone deposits associated with lobe fringe and interlobe deposits are spatially limited and deformation is restricted to interbedded sandstone and mudstone associated with off-axial lobe positions. Downslope translation was arrested by stratigraphic buttresses associated with more sandstone-prone axial deposits. Emplacement of a regionally extensive mass transport deposit is interpreted as the triggering mechanism for contemporaneous intrastratal deformation of > 60 m of underlying stratigraphy. A vertical

  8. Transit timing of TrES-2: a combined analysis of ground- and space-based photometry

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Maciejewski, G.; Ginski, Ch.; Mugrauer, M.; Berndt, A.; Eisenbeiss, T.; Adam, Ch.; Raetz, M.; Roell, T.; Seeliger, M.; Marka, C.; Vaňko, M.; Bukowiecki, Ł.; Errmann, R.; Kitze, M.; Ohlert, J.; Pribulla, T.; Schmidt, J. G.; Sebastian, D.; Puchalski, D.; Tetzlaff, N.; Hohle, M. M.; Schmidt, T. O. B.; Neuhäuser, R.

    2014-10-01

    Homogeneous observations and careful analysis of transit light curves can lead to the identification of transit timing variations (TTVs). TrES-2 is one of few exoplanets, which offer the matchless possibility to combine long-term ground-based observations with continuous satellite data. Our research aimed at the search for TTVs that would be indicative of perturbations from additional bodies in the system. We also wanted to refine the system parameters and the orbital elements. We obtained 44 ground-based light curves of 31 individual transit events of TrES-2. Eight 0.2-2.2-m telescopes located at six observatories in Germany, Poland and Spain were used. In addition, we analysed 18 quarters (Q0-Q17) of observational data from NASA's space telescope Kepler including 435 individual transit events and 11 publicly available ground-based light curves. Assuming different limb darkening (LD) laws we performed an analysis for all light curves and redetermined the parameters of the system. We also carried out a joint analysis of the ground- and space-based data. The long observation period of seven years (2007-2013) allowed a very precise redetermination of the transit ephemeris. For a total of 490 transit light curves of TrES-2, the time of transit mid-point was determined. The transit times support neither variations on long time-scale nor on short time-scales. The nearly continuous observations of Kepler show no statistically significant increase or decrease in the orbital inclination i and the transit duration D. Only the transit depth shows a slight increase which could be an indication of an increasing stellar activity. In general, system parameters obtained by us were found to be in agreement with previous studies but are the most precise values to date.

  9. PHOTOMETRICALLY DERIVED MASSES AND RADII OF THE PLANET AND STAR IN THE TrES-2 SYSTEM

    SciTech Connect

    Barclay, Thomas; Huber, Daniel; Rowe, Jason F.; Quintana, Elisa V.; Christiansen, Jessie L.; Jenkins, Jon M.; Mullally, Fergal; Seader, Shaun E.; Tenenbaum, Peter; Thompson, Susan E.; Barentsen, Geert; Bloemen, Steven; Demory, Brice-Olivier; Fulton, Benjamin J.; Shporer, Avi; Ragozzine, Darin

    2012-12-10

    We measure the mass and radius of the star and planet in the TrES-2 system using 2.7 years of observations by the Kepler spacecraft. The light curve shows evidence for ellipsoidal variations and Doppler beaming on a period consistent with the orbital period of the planet with amplitudes of 2.79{sup +0.44}{sub -0.62} and 3.44{sup +0.32}{sub -0.37} parts per million (ppm), respectively, and a difference between the dayside and the nightside planetary flux of 3.41{sup +0.55}{sub -0.82} ppm. We present an asteroseismic analysis of solar-like oscillations on TrES-2A which we use to calculate the stellar mass of 0.94 {+-} 0.05 M{sub Sun} and radius of 0.95 {+-} 0.02 R{sub Sun }. Using these stellar parameters, a transit model fit and the phase-curve variations, we determine the planetary radius of 1.162{sup +0.020}{sub -0.024} R{sub Jup} and derive a mass for TrES-2b from the photometry of 1.44 {+-} 0.21 M{sub Jup}. The ratio of the ellipsoidal variation to the Doppler beaming amplitudes agrees to better than 2{sigma} with theoretical predications, while our measured planet mass and radius agree within 2{sigma} of previously published values based on spectroscopic radial velocity measurements. We measure a geometric albedo of 0.0136{sup +0.0022}{sub -0.0033} and an occultation (secondary eclipse) depth of 6.5{sup +1.7}{sub -1.8} ppm which we combined with the day/night planetary flux ratio to model the atmosphere of TrES-2b. We find that an atmosphere model that contains a temperature inversion is strongly preferred. We hypothesize that the Kepler bandpass probes a significantly greater atmospheric depth on the night side relative to the day side.

  10. A new species of Myotis from the Islas Tres Marias, Nayarit, Mexico, with comments on variation in Myotis nigricans

    USGS Publications Warehouse

    Bogan, Michael A.

    1978-01-01

    A new Myotis is described from the Islas Tres Marias, Nayarit, Mexico. the new species is distinct from related taxa n the adjacent Mexican mainland (M. californicus, M. leibii, and M. carteri), although most closely related to M. carteri as shown by univariate and canonical variates analyses. An analysis of six groups of M. nigricans from Middle and South America supports the elevation of M. nigricans carteri to specific status, confirms the distinctness of M. nigricus extremus, but fails to substantiate subspecific status for bats from Columbia and Ecuador, recent recognized as M. n. punensis.

  11. Spin-orbit alignment for KELT-7b and HAT-P-56b via Doppler tomography with TRES

    NASA Astrophysics Data System (ADS)

    Zhou, George; Latham, David W.; Bieryla, Allyson; Beatty, Thomas G.; Buchhave, Lars A.; Esquerdo, Gilbert A.; Berlind, Perry; Calkins, Michael L.

    2016-08-01

    We present Doppler tomographic analyses for the spectroscopic transits of KELT-7b and HAT-P-56b, two hot-Jupiters orbiting rapidly rotating F-dwarf host stars. These include analyses of archival TRES observations for KELT-7b, and a new TRES transit observation of HAT-P-56b. We report spin-orbit aligned geometries for KELT-7b (2.7 +/- 0.6 deg) and HAT-P-56b (8 +/- 2 deg). The host stars KELT-7 and HAT-P-56 are among some of the most rapidly rotating planet-hosting stars known. We examine the tidal re-alignment model for the evolution of the spin-orbit angle in the context of the spin rates of these stars. We find no evidence that the rotation rates of KELT-7 and HAT-P-56 have been modified by star-planet tidal interactions, suggesting that the spin-orbit angle of systems around these hot stars may represent their primordial configuration. In fact, KELT-7 and HAT-P-56 are two of three systems in super-synchronous, spin-orbit aligned states, where the rotation periods of the host stars are faster than the orbital periods of the planets.

  12. Seasonal patterns in metazoan parasite community of the "Fat Sleeper" Dormitator latifrons (Pisces: Eleotridae) from Tres Palos Lagoon, Guerrero, Mexico.

    PubMed

    Violante-González, Juan; Rojas-Herrera, Agustín; Aguirre-Macedo, Ma Leopoldina

    2008-09-01

    Dormitator is among the most important fish genera in the Mexican Pacific coastal lagoon systems. In Tres Palos Lagoon, the Fat Sleeper Dormitator latifrons is one of the most significant species based on catch volume, although it is only consumed locally. Very little information exists on this species' parasitofauna. Composition and temporal variation in the metazoan parasite community structure of Dormitator latifrons from Tres Palos Lagoon (99 degrees 47' W, 16 degrees 48' N), Guerrero, Mexico, were determined using seasonal samples taken between April 2000 and June 2002. Ten parasite species (55 817 individuals) were recovered from 219 examined hosts. These species included eight helminths (Ascocotyle (Phagicola) longa, Echinochasmus leopoldinae, Clinostomum complanatum, Pseudoacanthostomum panamense, Saccocoelioides lamothei, Parvitaenia cochlearii, Contracaecum sp. and Neoechinorhynchus golvani) and two crustaceans (Argulus sp. and Ergasilus sp.). Five of the helminth species exhibited seasonal variation in their infection dynamics associated with environmental changes during the dry and rainy seasons. The variations in the infection dynamics generated changes in the community structure over time. PMID:19419054

  13. Spin-orbit alignment for KELT-7b and HAT-P-56b via Doppler tomography with TRES

    NASA Astrophysics Data System (ADS)

    Zhou, George; Latham, David W.; Bieryla, Allyson; Beatty, Thomas G.; Buchhave, Lars A.; Esquerdo, Gilbert A.; Berlind, Perry; Calkins, Michael L.

    2016-08-01

    We present Doppler tomographic analyses for the spectroscopic transits of KELT-7b and HAT-P-56b, two hot-Jupiters orbiting rapidly rotating F-dwarf host stars. These include analyses of archival Tillinghast Reflector Echelle Spectrograph (TRES) observations for KELT-7b, and a new TRES transit observation of HAT-P-56b. We report spin-orbit aligned geometries for KELT-7b (2.7° ± 0.6°) and HAT-P-56b (8° ± 2°). The host stars KELT-7 and HAT-P-56 are among some of the most rapidly rotating planet-hosting stars known. We examine the tidal re-alignment model for the evolution of the spin-orbit angle in the context of the spin rates of these stars. We find no evidence that the rotation rates of KELT-7 and HAT-P-56 have been modified by star-planet tidal interactions, suggesting that the spin-orbit angle of systems around these hot stars may represent their primordial configuration. In fact, KELT-7 and HAT-P-56 are two of three systems in supersynchronous, spin-orbit aligned states, where the rotation periods of the host stars are faster than the orbital periods of the planets.

  14. THE TRANSIT LIGHT-CURVE PROJECT. XIV. CONFIRMATION OF ANOMALOUS RADII FOR THE EXOPLANETS TrES-4b, HAT-P-3b, AND WASP-12b

    SciTech Connect

    Chan, Tucker; Ingemyr, Mikael; Winn, Joshua N.; Sanchis-Ojeda, Roberto; Holman, Matthew J.; Esquerdo, Gil; Everett, Mark

    2011-06-15

    We present transit photometry of three exoplanets, TrES-4b, HAT-P-3b, and WASP-12b, allowing for refined estimates of the systems' parameters. TrES-4b and WASP-12b were confirmed to be 'bloated' planets, with radii of 1.706 {+-} 0.056R{sub Jup} and 1.736 {+-} 0.092R{sub Jup}, respectively. These planets are too large to be explained with standard models of gas giant planets. In contrast, HAT-P-3b has a radius of 0.827 {+-} 0.055R{sub Jup}, smaller than a pure hydrogen-helium planet and indicative of a highly metal-enriched composition. Analyses of the transit timings revealed no significant departures from strict periodicity. For TrES-4, our relatively recent observations allow for improvement in the orbital ephemerides, which is useful for planning future observations.

  15. Dynamic study of the upper Sao Francisco River and the Tres Marias reservoir using MSS/LANDSAT images. [Brazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The use of LANDSAT multispectral ban scanner imagery to verify the relationship between the behavior of the Tres Marias reservoir and the dynamics of the Sao Francisco River supply basin is described. The dispersion of suspended sediments and their concentration in the surface layers of the water are considered. A five year survey of the region during both dry and rainy seasons was performed. The drainage network was analyzed based on the patterns of dessication, water rises and soil use in the supply basin. Surface layers of the reservoir were tabulated as a function of the levels of gray in the imagery. In situ observations of water depth and reflectance were performed. Ground truth and LANDSAT data were correlated to determine the factors affecting the dynamics of the supply basin.

  16. A TRANSIT TIMING ANALYSIS OF NINE RISE LIGHT CURVES OF THE EXOPLANET SYSTEM TrES-3

    SciTech Connect

    Gibson, N. P.; Pollacco, D.; Simpson, E. K.; Barros, S.; Joshi, Y. C.; Todd, I.; Keenan, F. P.; Skillen, I.; Benn, C.; Christian, D.; Hrudkova, M.; Steele, I. A.

    2009-08-01

    We present nine newly observed transits of TrES-3, taken as part of a transit timing program using the RISE instrument on the Liverpool Telescope. A Markov-Chain Monte Carlo analysis was used to determine the planet-star radius ratio and inclination of the system, which were found to be R{sub p} /R {sub *} = 0.1664{sup +0.0011} {sub -0.0018} and i = 81.73{sup +0.13} {sub -0.04}, respectively, consistent with previous results. The central transit times and uncertainties were also calculated, using a residual-permutation algorithm as an independent check on the errors. A re-analysis of eight previously published TrES-3 light curves was conducted to determine the transit times and uncertainties using consistent techniques. Whilst the transit times were not found to be in agreement with a linear ephemeris, giving {chi}{sup 2} = 35.07 for 15 degrees of freedom, we interpret this to be the result of systematics in the light curves rather than a real transit timing variation. This is because the light curves that show the largest deviation from a constant period either have relatively little out-of-transit coverage or have clear systematics. A new ephemeris was calculated using the transit times and was found to be T{sub c} (0) = 2454632.62610 {+-} 0.00006 HJD and P = 1.3061864 {+-} 0.0000005 days. The transit times were then used to place upper mass limits as a function of the period ratio of a potential perturbing planet, showing that our data are sufficiently sensitive to have probed sub-Earth mass planets in both interior and exterior 2:1 resonances, assuming that the additional planet is in an initially circular orbit.

  17. High-precision multiband time series photometry of exoplanets Qatar-1b and TrES-5b

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Mancini, L.; Tregloan-Reed, J.; Ciceri, S.; Southworth, J.; D'Ago, G.; Bruni, I.; Baştürk, Ö.; Alsubai, K. A.; Bachelet, E.; Bramich, D. M.; Henning, Th.; Hinse, T. C.; Iannella, A. L.; Parley, N.; Schroeder, T.

    2015-04-01

    We present an analysis of the Qatar-1 and TrES-5 transiting exoplanetary systems, which contain Jupiter-like planets on short-period orbits around K-dwarf stars. Our data comprise a total of 20 transit light curves obtained using five medium-class telescopes, operated using the defocusing technique. The average precision we reach in all our data is RMSQ = 1.1 mmag for Qatar-1 (V = 12.8) and RMST = 1.0 mmag for TrES-5 (V = 13.7). We use these data to refine the orbital ephemeris, photometric parameters, and measured physical properties of the two systems. One transit event for each object was observed simultaneously in three passbands (gri) using the BUSCA imager. The QES survey light curve of Qatar-1 has a clear sinusoidal variation on a period of P⋆ = 23.697 ± 0.123 d, implying significant star-spot activity. We searched for star-spot crossing events in our light curves, but did not find clear evidence in any of the new data sets. The planet in the Qatar-1 system did not transit the active latitudes on the surfaces of its host star. Under the assumption that P⋆ corresponds to the rotation period of Qatar-1A, the rotational velocity of this star is very close to the vsin i⋆ value found from observations of the Rossiter-McLaughlin effect. The low projected orbital obliquity found in this system thus implies a low absolute orbital obliquity, which is also a necessary condition for the transit chord of the planet to avoid active latitudes on the stellar surface.

  18. Impact de la varicocèle sur le volume testiculaire et les paramètres spermatiques

    PubMed Central

    Benazzouz, Mohamed Hicham; Essatara, Younes; El Sayegh, Hachem; Iken, Ali; Benslimane, Lounis; Nouini, Yassine

    2014-01-01

    Introduction La varicocèle est une pathologie masculine fréquente dont l'incidence est encore plus importante dans dans la population des hommes infertiles. Si ses mécanismes sont à ce jour incomplètement expliqués il semble acquis que la varicocèle peut être associée a une dysfonction testiculaire avec diminution du volume testiculaire et de la concentration en spermatozoïde de l’éjaculat. Méthodes Dans un premier temps nous exposons les résultats d'une étude rétrospective sur 5 ans (de Mars 2009 à Mars 2014), réalisée au service d'urologie A de l'hôpital Ibn Sina de Rabat et ayant comme objectif d’évaluer l'impact de la varicocèle palpable sur le volume testiculaire et les paramètres spermatiques. Tous les patients inclus dans notre étude avaient une varicocèle palpable. Dans un deuxième temps, et à travers une revue de la littérature nous discutons l'impact du traitement de la varicocèle sur la fertilité. Résultats 39 patients ont été inclus dans notre étude. L’âge moyen était de 29,71 ans et la varicocèle siégeait dans 89,74% des cas du coté gauche. Une atrophie testiculaire homolatérale à la varicocèle était retrouvée dans 7% des cas alors que des anomalies du spermogramme se voyaient dans 69,23% des cas. Conclusion L'impact de la varicocèle sur l'altération des paramètres spermatiques a été clairement établi bien que sa physio pathogénie ne soit pas bien élucidée. Le traitement chirurgical de la varicocèle semble indiqué chez les hommes infertiles présentant une varicocèle clinique et une altération significative du sperme. PMID:25918574

  19. Seismic activity and stress tensor inversion at Las Tres Vírgenes Volcanic and Geothermal Field (México)

    NASA Astrophysics Data System (ADS)

    Antayhua-Vera, Yanet; Lermo-Samaniego, Javier; Quintanar-Robles, Luis; Campos-Enríquez, Oscar

    2015-10-01

    We analyze local earthquakes occurring between 2003 and 2012 at the Las Tres Vírgenes Volcanic and Geothermal Field (TVVGF) to establish their temporal and spatial distribution, and relationships with local and regional fault systems, water injection, acid stimulation and steam production tests. We obtained focal mechanisms and inverted data for the stress tensor to understand the local and regional stress fields. We analyzed 423 local earthquakes with magnitudes between 0.1 and 2.9 Mc and hypocentral depths from 0.2 to 7.4 km b.s.l. The cutoff depth at ~ 7.4 km possibly delineates the brittle-ductile transition zone. We identified seven swarms (from 1 to 7). Swarms 1 (December 2009), 2 (May 2010), 3 (June-July 2010) and 7 (December 2012) are strongly correlated with injection processes; whereas swarms 5 (April 2012) and 6 (September 2012) are correlated with local tectonic faults. Stress inversion showed NW-SE, E-W and NE-SW extensional orientations (Shmin), in agreement with the local tectonic stress field; while NE-SW compressional orientations (SHmax) are correlated with the regional tectonic stress field.

  20. Collapse of the northern Jalisco continental slope:Subduction erosion, forearc slivering, or subduction beneath the Tres Marias escarpment?

    NASA Astrophysics Data System (ADS)

    Bandy, W. L.; Mortera-Gutierrez, C. A.; Ortiz-Zamora, G.; Ortega-Ramirez, J.; Galindo Dominguez, R. E.; Ponce-Núñez, F.; Pérez-Calderón, D.; Rufino-Contreras, I.; Valle-Hernández, S.; Pérez-González, E.

    2010-12-01

    Rivera Plate beneath the Tres Marias Escarpment.

  1. Near-Infrared Thermal Emission from the Hot Jupiter TrES-2b: Ground-based Detection of the Secondary Eclipse

    NASA Astrophysics Data System (ADS)

    Croll, Bryce; Albert, Loic; Lafreniere, David; Jayawardhana, Ray; Fortney, Jonathan J.

    2010-07-01

    We present near-infrared Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-2b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect its thermal emission with an eclipse depth of 0.062+0.013 -0.011% (5σ). Our best-fit secondary eclipse is consistent with a circular orbit (a 3σ upper limit on the eccentricity, e, and argument or periastron, ω, of |e cos ω| < 0.0090), in agreement with mid-infrared detections of the secondary eclipse of this planet. A secondary eclipse of this depth corresponds to a dayside Ks-band brightness temperature of TB = 1636+79 -88 K. Our thermal emission measurement, when combined with the thermal emission measurements using Spitzer/IRAC from O'Donovan and collaborators, suggests that this planet exhibits relatively efficient dayside to nightside redistribution of heat and a near isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. It is unclear if the atmosphere of TrES-2b requires a temperature inversion; if it does it is likely due to chemical species other than TiO/VO as the atmosphere of TrES-2b is too cool to allow TiO/VO to remain in gaseous form. Our secondary eclipse has the smallest depth of any detected from the ground, at around 2 μm, to date. Based on observations obtained with WIRCam, a joint project of Canada-France-Hawaii Telescope (CFHT), Taiwan, Korea, Canada, France, at the Canada-France-Hawaii Telescope (CFHT) which is operated by the National Research Council (NRC) of Canada, the Institute National des Sciences de l'Univers of the Centre National de la Recherche Scientifique of France, and the University of Hawaii.

  2. NEAR-INFRARED THERMAL EMISSION FROM THE HOT JUPITER TrES-2b: GROUND-BASED DETECTION OF THE SECONDARY ECLIPSE

    SciTech Connect

    Croll, Bryce; Jayawardhana, Ray; Albert, Loic; Lafreniere, David; Fortney, Jonathan J.

    2010-07-10

    We present near-infrared Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-2b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect its thermal emission with an eclipse depth of 0.062{sup +0.013}{sub -0.011}% (5{sigma}). Our best-fit secondary eclipse is consistent with a circular orbit (a 3{sigma} upper limit on the eccentricity, e, and argument or periastron, {omega}, of |e cos {omega}| < 0.0090), in agreement with mid-infrared detections of the secondary eclipse of this planet. A secondary eclipse of this depth corresponds to a dayside Ks-band brightness temperature of T{sub B} = 1636{sup +79}{sub -88} K. Our thermal emission measurement, when combined with the thermal emission measurements using Spitzer/IRAC from O'Donovan and collaborators, suggests that this planet exhibits relatively efficient dayside to nightside redistribution of heat and a near isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. It is unclear if the atmosphere of TrES-2b requires a temperature inversion; if it does it is likely due to chemical species other than TiO/VO as the atmosphere of TrES-2b is too cool to allow TiO/VO to remain in gaseous form. Our secondary eclipse has the smallest depth of any detected from the ground, at around 2 {mu}m, to date.

  3. A user`s manual for the program TRES4: Random vibration analysis of vertical-axis wind turbines in turbulent winds

    SciTech Connect

    1994-03-01

    TRES4 is a software package that works with the MSC/NASTRAN finite element analysis code to conduct random vibration analysis of vertical-axis wind turbines. The loads on the turbine are calculated in the time domain to retain the nonlinearities of stalled aerodynamic loadings. The loads are transformed into modal coordinates to reduce the number of degrees of freedom. Power spectra and cross spectra of the loads are calculated in the modal coordinate system. These loads are written in NASTRAN Bulk Data format to be read and applied in a random vibration analysis by NASTRAN. The resulting response is then transformed back to physical coordinates to facilitate user interpretation.

  4. Dynamic study of the upper Sao Francisco river and Tres Marias reservoir using MSS/LANDSAT images. M.S. Thesis; [BRazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The relationship between the dispersion and concentration of sediment in the superficial layers of the Tres Marias reservoir and the dynamics of the drainage basins of its tributaries was verified using LANDSAT MSS imagery. The drainage network, dissection patterns, and land use of each watershed were considered in an analysis of multispectral images, corresponding to bands 4,5, and 7, of dry and rainy seasons in 1973, 1975, 1977, and 1978. The superficial layer water layers of the reservoir were also divided according to the grey level pattern of each image. Two field trips were made to collect Secchi depths and in situ water reflectance. It is concluded that it is possible to determine the main factors that act in the dynamics of the drainage basins of a reservoir by simultaneous control of the physical variables and the antropic action of each basin.

  5. Multi-phase submarine channel-fill history recorded by stratigraphic architectures in outcropping slope-channel deposits, Tres Pasos Formation, southern Chile

    NASA Astrophysics Data System (ADS)

    Auchter, N.; Romans, B.; Hubbard, S. M.; Daniels, B. G.; Reimchen, A. P.; Jackson, A. A.; Stright, L.

    2014-12-01

    The relationship between sediment transport processes, deposits, and channel morphology is well established for subaerial channel systems. Linking channel-fill patterns with planform morphology in submarine systems, however, is less constrained because of the difficulty in direct observation of sediment transport processes, including deposition of coarse-grained turbidites. Ever-increasing resolution of 3-D seismic-reflection and integrated bathymetry-sonar tools have led to significant improvement, but resolution issues still hinder effective analysis. For example, are inclined reflectors observed in seismic cross sections of channels associated with sinuous planforms indicative of turbidity-current-scale morphodynamics or are they composite surfaces that record larger-scale/longer-term evolution? Documenting the nature and variability of intra-channel fill architecture in outcropping submarine channel deposits provides insight into linking depositional processes and channel morphologies. The Late Cretaceous retroarc foreland Magallanes Basin in southern Chile formed during uplift of the Andean Cordillera. Deep-water slope strata of the Tres Pasos Formation are exposed along a depositional-dip-oriented outcrop belt up to 2000 m thick and at least 100 km long. These strata provide an excellent natural laboratory for comparison of slope channel architectures from different positions on the slope and stages of basin infilling. We consider channelized architectural element dimensions and internal stratigraphic surface characteristics from multiple exposures along the outcrop belt. We also document varying stacking patterns of channel elements over time, from both laterally to vertically offset end-members. Results suggest that for both lateral and vertical channel stacking patterns, phases of accommodation generation (e.g., incision or sediment bypass) and migration of the channel are temporally distinct from phases of channel infilling (e.g., turbidity current

  6. Polymorphisme de l'apolipoprotéine E dans la population du nord du Maroc: fréquence et influence sur les paramètres lipidiques

    PubMed Central

    Benyahya, Fatiha; Barakat, Amina; Ghailani, Naima; Bennani, Mohcine

    2013-01-01

    Introduction L'objectif de ce travail est de déterminer les fréquences alléliques et génotypiques des sites polymorphes situés dans le gène de l'apolipoprotéine E (apo E) ainsi que leur impact sur les paramètres cliniques et lipidiques dans un échantillon de la population du nord du Maroc cliniquement diagnostiqué ADH. Méthodes Le génotype de l'apo E a été analysé par séquençage direct chez 46 patients cliniquement diagnostiqués ADH selon les critères standards. Résultats Les fréquences des allèles epsilon 3, epsilon 2 et epsilon 4 ont été respectivement 78.3%, 2.2% et 19.6%. La fréquence de l'allèle epsilon 4 est très élevée chez la population du nord du Maroc en comparaison avec les populations des autres régions marocaines. Elle est similaire à celle rapportée dans les pays de l'Europe du nord. Les taux du cholestérol total, du cholestérol LDL ainsi que la présence des xanthomes et les maladies cardiovasculaires ne différent pas entre les génotypes de l'apoE. En revanche, les résultats ont montré une influence de l'allèle epsilon4 sur le taux des triglycérides chez les sujets obèses. Conclusion Le génotype de l'apoE ne peut expliquer le phénotype clinique et biochimique présenté par des patients du Nord du Maroc cliniquement diagnostiqués ADH. PMID:24396563

  7. Etude théorique des paramètres principaux réglant la sensibilité des capteurs d'accélération à cristal de quartz

    NASA Astrophysics Data System (ADS)

    Delaite, R.; Aïch, Y.

    1994-10-01

    A theoretical analysis of quartz accelerometers is performed to determine their optimal mechanical and sensitivity performances. A general analytical model is used to investigate the parameters and their effects on the sensitivity of these sensors. The analysis of physical characteristics shows that feasibility and performances depend on three factors such as dimensions of the quartz plate, quantity of holders located at the crystal edge and location of these holders with respect to the crystal's crystallographic reference. This study is applied to various design sensors with different supporting quartz crystal. The conditions on parameters are given to achieve optimum performances. Une étude théorique de la sensibilité des capteurs d'accélération à cristal de quartz est présentée. Son but est d'optimiser les performances mécaniques et métrologiques de ces capteurs. Les paramètres sensibles sont mis en évidence. L'analyse des caractéristiques physiques démontre que la faisabilité et les performances des accéléromètres à quartz dépendent, pour une coupe donnée du cristal, de trois facteurs : les dimensions de la lame de quartz, le nombre de liaisons à la périphérie du cristal et la position de ces liaisons par rapport à la référence cristallographique. L'étude est appliquée aux cas des capteurs bipodes, multipodes et monopodes. Pour chaque type de capteur, les valeurs des paramètres sensibles correspondant aux performances optimales sont précisées.

  8. Study of the relation between soil use, vegetation coverage, and the discharge of sediments from artificial reservoirs using MSS/LANDSAT images. Example: The Tres Marias reservoir and its supply basin

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The land use and types of vegetation in the region of the upper Sao Francisco River, Brazil, are identified. This region comprises the supply basin of the Tres Marias reservoir. Imagery from channels 5 and 7 of the LANDSAT multispectral band scanner during wet and rainy seasons and ground truth data were employed to characterize and map the vegetation, land use, and sedimentary discharges from the reservoir. Agricultural and reforested lands, meadows, and forests are identified. Changes in land use due to human activity are demonstrated.

  9. Evaluation of SIR-A (Shuttle Imaging Radar) images from the Tres Marias region (Minas Gerais State, Brazil) using derived spatial features and registration with MSS-LANDSAT images

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Kux, H. J. H.; Dutra, L. V.

    1984-01-01

    Two image processing experiments are described using a MSS-LANDSAT scene from the Tres Marias region and a shuttle Imaging Radar SIR-A image digitized by a vidicon scanner. In the first experiment the study area is analyzed using the original and preprocessed SIR-A image data. The following thematic classes are obtained: (1) water, (2) dense savanna vegetation, (3) sparse savanna vegetation, (4) reforestation areas and (5) bare soil areas. In the second experiment, the SIR-A image was registered together with MSS-LANDSAT bands five, six, and seven. The same five classes mentioned above are obtained. These results are compared with those obtained using solely MSS-LANDSAT data. The spatial information as well as coregistered SIR-A and MSS-LANDSAT data can increase the separability between classes, as compared to the use of raw SIR-A data solely.

  10. Influence des paramètres de dépôt sur la morphologie de films minces de tétraborate de lithium obtenus par le procédé ``PYROSOL"

    NASA Astrophysics Data System (ADS)

    Bornand, V.; El Bouchikhi, A.; Papet, Ph.; Philippot, E.

    1997-04-01

    Li2B4O7 piezo-electric thin films were prepared by “PYROSOL" process which is a useful method for the elaboration of thin films. Morphological development and crystallization of thin films are very dependent on the experimental parameters like the substrate temperature, the concentration and the relative proportion of the precursors in methyl alcohol. The effect of these various parameters were studied in order to obtain homogeneous, crystallized and oriented thin films. La réalisation de couches minces de matériaux piézo-électriques de Li2B4O7 par le procédé “PYROSOL" révèle une grande diversité de conditions de dépôt. La température du substrat, la composition des solutions de précurseurs et leur concentration conditionnent la morphologie et l'état de cristallisation des films. En particulier, l'obtention de couches minces denses, homogènes et présentant une orientation préférentielle nécessite des températures de substrat supérieures à 620 ^{circ}C. L'influence de ces divers paramètres expérimentaux a été étudiée dans le but d'obtenir des dépôts homogènes, cristallisés et orientés.

  11. Mapping variations in weight percent silica measured from multispectral thermal infrared imagery - Examples from the Hiller Mountains, Nevada, USA and Tres Virgenes-La Reforma, Baja California Sur, Mexico

    USGS Publications Warehouse

    Hook, S.J.; Dmochowski, J.E.; Howard, K.A.; Rowan, L.C.; Karlstrom, K.E.; Stock, J.M.

    2005-01-01

    Remotely sensed multispectral thermal infrared (8-13 ??m) images are increasingly being used to map variations in surface silicate mineralogy. These studies utilize the shift to longer wavelengths in the main spectral feature in minerals in this wavelength region (reststrahlen band) as the mineralogy changes from felsic to mafic. An approach is described for determining the amount of this shift and then using the shift with a reference curve, derived from laboratory data, to remotely determine the weight percent SiO2 of the surface. The approach has broad applicability to many study areas and can also be fine-tuned to give greater accuracy in a particular study area if field samples are available. The approach was assessed using airborne multispectral thermal infrared images from the Hiller Mountains, Nevada, USA and the Tres Virgenes-La Reforma, Baja California Sur, Mexico. Results indicate the general approach slightly overestimates the weight percent SiO2 of low silica rocks (e.g. basalt) and underestimates the weight percent SiO2 of high silica rocks (e.g. granite). Fine tuning the general approach with measurements from field samples provided good results for both areas with errors in the recovered weight percent SiO2 of a few percent. The map units identified by these techniques and traditional mapping at the Hiller Mountains demonstrate the continuity of the crystalline rocks from the Hiller Mountains southward to the White Hills supporting the idea that these ranges represent an essentially continuous footwall block below a regional detachment. Results from the Baja California data verify the most recent volcanism to be basaltic-andesite. ?? 2005 Elsevier Inc. All rights reserved.

  12. Détermination des paramètres bioécologiques et entomologiques d’Anopheles gambiae sl dans la transmission du paludisme à Bandundu-ville, République Démocratique de Congo

    PubMed Central

    Matubi, Emery Metelo; Bukaka, Eric; Luemba, Trésor Bakambana; Situakibanza, Hyppolite; Sangaré, Ibrahim; Mesia, Gauthier; Ngoyi, Dieudonné Mumba; Maniania, Nguya Kalemba; Akikwa, Charles Ngandote; Kanza, Jean Pierre Basilua; Tamfum, Jean-Jacques Muyembe; sudi, Jonas Nagahuedi Bongo

    2015-01-01

    Introduction La présente étude a été menée à Bandundu-ville (RDC) en vue d'identifier les paramètres écologiques et entomologiques modulant la transmission du paludisme ainsi que leur tendance saisonnière dans cette agglomération. Méthodes Cette étude a été réalisée dans la période du 1er juin au 31 décembre 2011. Des prospections des gîtes larvaires d'anophèles avec récolte ont été réalisées, les paramètres physiques, physico-chimiques et environnementaux déterminés. La densité larvaire a été estimée selon une échelle de classes de densité, inspirée de la méthode de Carron pour chaque type de gîtes. Quarante-huit maisons ont été sélectionnées et prospectées pour la récolte des moustiques par pulvérisation intradomicilaire. L'identification des moustiques a été faite sur base des critères morphologiques de Gilles et Demeillon. L'Indice sporozoïtique (Is) a été déterminé par le test ELISA CSP de Plasmodium falciparum à l'Institut National de Recherche Biomédicale selon le protocole de Robert Wirtz. Les autres paramètres entomologiques comme la densité, le taux d'agressivité, le taux d'inoculation entomologique (TIE) ainsi que l'indice de stabilité ont été déterminés selon le protocole de l'OMS. La régression linéaire a été réalisée au seuil de signification de 0,05 pour identifier les déterminants de la densité larvaire. Résultats Cent-sept gîtes larvaires ont été identifiés et caractérisés en 5 types (digues et puits d'eau, collections d'eau maraîchère et concasseurs moellons, marais Régie de distribution d'eau, marais le long des rivières et ruisseaux et flaques d'eau de pluies). La densité larvaire moyenne a été de 117,4±64,1. Quatre mille cinq cents quatre-vingt-huit moustiques ont été capturés et identifiés, parmi lesquels 1.258 Anopheles gambiae sl avec une densité de 8,86, un taux d'agressivité de 1,55 piqûre par homme par nuit, l'Is de 5,6%, un TIE de 0,085 piq

  13. E Pluribus Tres: The 2009 Nobel Prize in Chemistry

    PubMed Central

    Carter, Charles W.

    2009-01-01

    Summary This year’s Nobel Prize in Chemistry celebrates a multitude of research areas, making the difficult selection of those most responsible for providing atomic details of the nanomachine that makes proteins according to genetic instructions. The Ribosome and RNA polymerase (recognized in 2006) structures highlight a puzzling asymmetry at the origins of biology. PMID:20004159

  14. Análisis detallado de tres complejos estelares en NGC 300

    NASA Astrophysics Data System (ADS)

    Rodríguez, M. J.; Baume, G. L.; Feinstein, C.

    2015-08-01

    From images obtained with the Advance Camera for Surveys (ACS) of the Hubble Space Telescope (HST) and available in the MAST/STScI database, we have conducted a detailed study of three complexes of stellar associations located in particular regions of the NGC 300 galaxy. We built their respective radial density profiles, their photometric diagrams corrected by field contamination, and their initial mass functions. All these elements together with a comparison with theoretical evolutionary models yielded preliminary results about the characteristics of the studied associations.

  15. Une mort tres douce: end-of-life decisions in France; reflections from a Dutch perspective.

    PubMed

    Haverkamp, Margje H; van Delden, Johannes J M

    2006-01-01

    This study considers the range of thinking about end-of-life decisions (ELD) in France from a Dutch point of view, taking a small number of interviews with important French opinion-leaders as a basis. Until today, end-of-life care in France has been clouded with uncertainty pending the enactment of more specific definitions and regulations. French physicians could face a dilemma in treating a dying patient, caught between an official ban on ELD and a professional obligation to treat cases individually. The practical consequence of this climate is a lack of accountability of the French physician towards colleagues and patients. Rationalistic, paternalistic, and religious traditions have been obstructive to the adoption of regulatory reforms. In November 2004, Parliament accepted a law proposal by which the practice of the withholding and withdrawal of life-saving therapies would become more transparent, which would diminish the physician's fear of legal persecution. This proposal was then converted into law by the Senate. In the Netherlands, euthanasia - the active termination of life - is legal and regulated according to specific criteria. The Dutch approach has been shaped by an Anglo-Saxon emphasis on individual autonomy, and conforms to a broad preference in Dutch society to disclose and regulate controversial activities rather than to tolerate them sub rosa. As the Dutch regulations have been enacted, reporting rates - but not euthanasia cases - have risen. Compliance with the criteria and doctor-patient communication have been high. The French vigilance of professional autonomy provides a valuable example to the Dutch. The Dutch, in return, offer the French concrete examples for ELD policy. PMID:16858623

  16. Gallia Est Omnis Divisa in Partes Tres (All Gaul Is Divided into Three Parts).

    ERIC Educational Resources Information Center

    Seligson, Gerda

    1979-01-01

    Stresses the need for Latin instruction in the school curriculum today. The history of Latin instruction in the U.S. is traced starting from the time that writing Latin and analyzing texts in terms of grammatical, logical, and compositional categories were emphasized. (NCR)

  17. Home before You Know It = De regres en casa en un dos por tres.

    ERIC Educational Resources Information Center

    Vida Health Communications, Inc., Cambridge, MA.

    The arrival of a newborn requires a great deal of adjustment. Intended for new and expectant parents, this booklet and companion video provide practical advice and hands-on demonstrations of the essentials of mother and baby care, from birth to the first visit to the pediatrician. The first part of the booklet, which comes in both English- and…

  18. Las Tres Comidas del Dia (The Three Meals of the Day).

    ERIC Educational Resources Information Center

    Olais, Niltza M.

    A sixteen line poem in Spanish provides the text of this short booklet on the three meals of the day. Designed for use as supplementary reading materials for the elementary grade Spanish speaking child, the booklet was developed by students in the Bilingual Teacher Aide Program at Mesa Community College. Content and language have been controlled…

  19. Les Maîtres de l'Orge: the proteome content of your beer mug.

    PubMed

    Fasoli, Elisa; Aldini, Giancarlo; Regazzoni, Luca; Kravchuk, Alexander V; Citterio, Attilio; Righetti, Pier Giorgio

    2010-10-01

    The beer proteome has been evaluated via prior capture with combinatorial peptide ligand libraries (ProteoMiner as well as a homemade library of reduced polydispersity) at three different pH (4.0, 7.0, and 9.3) values. Via mass spectrometry analysis of the recovered fractions, after elution of the captured populations in 4% boiling SDS, we could categorize such species in 20 different barley protein families and 2 maize proteins, the only ones that had survived the brewing process (the most abundant ones being Z-serpins and lipid transfer proteins). In addition to those, we could identify 40 unique gene products from Saccharomyces cerevisiae, one from S. bayanus and one from S. pastorianus as routinely used in the malting process for lager beer. These latter species must represent trace components, as in previous proteome investigations barely two such yeast proteins could be detected. Our protocol permits handling of very large beer volumes (liters, if needed) in a very simple and user-friendly manner and in a much reduced sample handling time. The knowledge of the residual proteome in beers might help brewers in selecting proper proteinaceous components that might enrich beer flavor and texture. PMID:20722451

  20. 78 FR 57878 - Notice of Availability of the Proposed Bureau of Land Management Tres Rios Field Office and San...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-20

    ... visual resources including air and water quality; wildlife habitat; forests and woodlands; and other... Field Office and San Juan National Forest Land and Resource Management Plan/Final Environmental Impact... Resource Management Plan/Final Environmental Impact Statement (LRMP/Final EIS) for the San Juan...

  1. Inversor Resonante de Tres Elementos L-LC con Caracteristica Cortocircuitable para Aplicaciones de Calentamiento por Induccion

    NASA Astrophysics Data System (ADS)

    Espi Huerta, Jose Miguel

    Los generadores de calentamiento por induccion son puentes inversores con carga resonante, cuya mision es basicamente crear una corriente sinusoidal de gran amplitud sobre la "bobina de caldeo", que forma parte del tanque resonante. En el interior de esta bobina se introduce la pieza que se desea calentar. EI campo magnetico creado induce corrientes superficiales (corrientes de Foucault) sobre la pieza, que producen su calentamiento. Los tanques resonantes (tambien llamados osciladores) utilizados en la actualidad son el resonante serie y el resonante paralelo. Aunque ya desde hace algun tiempo se vienen construyendo generadores de alta potencia basados en estos dos osciladores, el exito nunca ha. sido completo en ninguno de los dos casos. Tal y como se explica en la introduccion de esta memoria, los puentes inversores utilizados deben operar sobre una carga inductiva (corriente retrasada) para evitar el fenomeno de la recuperacion inversa de sus diodos y la consiguiente ruptura de los transistores. De la restriccion topologica anterior se deduce que el generador paralelo debe conmutar a frecuencias inferiores a la resonancia, y el serie a frecuencias superiores. A esta restriccion topologica hay que unir otra que es exclusiva del calentamiento por induccion: La corriente por la bobina de caldeo debe ser sinusoidal. De no ser asi, resultaria imposible disponer toda la potencia de calentamiento sobre la pieza en el espesor requerido por la aplicacion. Como consecuencia, los inversores no pueden operar por debajo de la frecuencia de resonancia del oscilador, pues en ese caso se amplifican los armonicos de orden superior de la tension/corriente de entrada situados sobre la resonancia, con la consiguiente distorsion de la corriente de salida. La conjuncion de las dos restricciones anteriores obligan al inversor paralelo a funcionar a la frecuencia de resonancia del oscilador. Esto imposibilita un control por variacion de frecuencia, regulandose la potencia desde la seccion de entrada mediante un mayor o menor aporte de corriente al puente. Como consecuencia, la seccion de entrada del paralelo, ya de por si mas voluminosa que lao del serie por el uso de grandes componentes magneticos (bobinas de filtro o de "alisamiento"), result a tambien mas complicada y costosa debido a la necesidad de ser implementada mediante rectificador controlado. Ademas, la regulacion que ofrece el rectificador es pobre, dada su baja frecuencia de conmutacion. En cambio, el circuito serie puede funcionar por encima de la resonancia manteniendo una secuencia de conmutacion sin riesgos de recuperacion inversa y con una corriente de salida practicamente sinusoidal, lo que permite un control de la potencia por variacion de frecuencia. Puesto que la tarea de regulacion se realiza desde el puente inversor, la regulacion resulta mucho mas eficaz y la seccion de entrada se puede implementar mediante un simple rectificador no controlado y un condensador de filtro. (Abstract shortened by UMI.).

  2. El curriculo creativo para ninos de cero a tres anos (The Creative Curriculum for Infants and Toddlers).

    ERIC Educational Resources Information Center

    Dombro, Amy Laura; Colker, Laura J.; Dodge, Diane Trister

    Stemming from the core idea that infant and toddler care should be based on building relationships, this curriculum in Spanish-language version provides a foundation for staff development. Section 1, "Why a Curriculum for Infants and Toddlers?" examines key quality indicators, discusses curriculum components, describes how to use the curriculum to…

  3. Comparaison de méthodes d'identification des paramètres d'une machine asynchrone

    NASA Astrophysics Data System (ADS)

    Bellaaj-Mrabet, N.; Jelassi, K.

    1998-07-01

    Interests, in Genetic Algorithms (G.A.) expands rapidly. This paper consists initially to apply G.A. for identifying induction motor parameters. Next, we compare the performances with classical methods like Maximum Likelihood and classical electrotechnical methods. These methods are applied on three induction motors of different powers to compare results following a set of criteria. Les algorithmes génétiques sont des méthodes adaptatives de plus en plus utilisée pour la résolution de certains problèmes d'optimisation. Le présent travail consiste d'une part, à mettre en œuvre un A.G sur des problèmes d'identification des machines électriques, et d'autre part à comparer ses performances avec les méthodes classiques tels que la méthode du maximum de vraisemblance et la méthode électrotechnique basée sur des essais à vides et en court-circuit. Ces méthodes sont appliquées sur des machines asynchrones de différentes puissances. Les résultats obtenus sont comparés selon certains critères, permettant de conclure sur la validité et la performance de chaque méthode.

  4. Tres Marias Reservoir, Minas Gerais State: Study of the dispersion of suspended sediments in surface waters using orbital images

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1980-01-01

    Computer compatible tapes from LANDSAT were used to compartmentalize the Ires Marias reservoir according to respective grey level spectral response. Interactive and automatic, supervised classification, was executed from the IMAGE-100 system. From the simple correlation analysis and graphic representation, it is shown that grey tone levels are inversely proportional to Secchi Depth values. It is further shown that the most favorable period to conduct an analysis of this type is during the rainy season.

  5. 77 FR 5504 - Tres Palacios Gas Storage, L.L.C.; Notice of Intent To Prepare an Environmental Assessment for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-03

    ... United States and Mexico. The general location of the Project facilities is shown in Appendix 1.\\1\\ \\1... and operation of the proposed Project, under these general headings: Geology and soils; Land use...

  6. Restauration fonctionnelle du rachis : effet du niveau initial de douleur sur les performances des sujets lombalgiques chroniques

    PubMed Central

    Caby, Isabelle; Olivier, N; Mendelek, F; Kheir, R Bou; Vanvelcenaher, J; Pelayo, P

    2014-01-01

    HISTORIQUE : La lombalgie chronique est une douleur lombaire persistante d’origine multifactorielle. Le niveau de douleur initial reste faiblement utilisé pour analyser et comparer les réponses des patients lombalgiques au programme de reconditionnement. OBJECTIFS : Apprécier et évaluer les réponses des sujets lombalgiques chroniques très douloureux à une prise en charge dynamique et intensive. MÉTHODOLOGIE : 144 sujets atteints de lombalgie chronique ont été inclus dans un programme de restauration fonctionnelle du rachis de 5 semaines. Les sujets ont été classés en deux groupes de niveau de douleur: un groupe atteint de douleur sévère (n = 28) et un groupe atteint de douleur légère à modérée (n = 106). L’ensemble des sujets ont bénéficié d’une prise en charge identique comprenant principalement de la kinésithérapie, de l’ergothérapie, du reconditionnement musculaire et cardio-vasculaire ainsi qu’un suivi psychologique. Les paramètres physiques (flexibilité, force musculaire) et psychologiques (qualité de vie) ont été mesurés avant (T0) et après le programme (T5sem). RÉSULTATS : L’ensemble des performances physiques et fonctionnelles des sujets très douloureux sont moins bonnes et le retentissement de la lombalgie sur la qualité de vie, pour ces mêmes sujets, est majoré à T0. Toutes les différences significatives constatées à T0 entre les deux groupes s’effacent à T5sem. CONCLUSIONS : Les sujets lombalgiques chroniques très douloureux répondent favorablement au programme dynamique et intensif. L’intensité douloureuse de la lombalgie n’aurait pas d’effet sur les réponses au programme. La restauration fonctionnelle du rachis apporterait aux sujets la possibilité de mieux gérer leur douleur quel que soit son niveau. PMID:25299476

  7. Conversacion sobre "Tres tristes tigres". Una entrevista de Rita Guibert (A Conversation about "Three Sad Tigers". An Interview with Rita Guibert)

    ERIC Educational Resources Information Center

    Cabrera Infante, Guillermo

    1971-01-01

    Interview took place in London, England, on October 5, 1970 between Cuban writer Guillermo Cabrera Infante and journalist Rita Guibert. Special issue dedicated to contemporary Spanish American literature. (DS)

  8. Relantionships between gold mineralization and granite - Discussion with the support of a pluridisciplinary study of the Passa Tres gold deposit (South Brazil)

    NASA Astrophysics Data System (ADS)

    Dressel, Bárbara; Chauvet, Alain; Trzaskos, Barbara; Biondi, Joao Carlos; Bruguier, Olivier; Monie, Patrick; Villanova, Sandro; Bazille, Jose

    2016-04-01

    The Passa Três Granite, located at East of the Paraná State is elongated following a NNE-SSW direction. This sienogranite is emplaced within metapelites of the meso to neoproterozoic Açungui Group, between the Morro Agudo and Lancinha transcurrent faults, comprising the N040°E trending Lancinha Transcurrent Fault System. Gold mineralization within the Passa Três Granite is constituted by huge quartz veins with sulfides, variable quantities of fluorite and carbonates, forming orebodies with different internal textures, including massive, banded, sheared and brecciated. Structural data indicate the existence of two major fault systems, one N-S and the other E-W, with dips of 15-45°W and 20-75°S, respectively. Both NS and EW systems are interpreted to be contemporaneous and conjugate. Normal motions are everywhere suspected and main mineralized veins are located at opening sites at these fault systems, such as pull-aparts. The structural model suggests that the normal motion can be initiated by shearing along a "guide" level, in which sulfides and clay minerals are concentrated. This configuration can be observed at several scales, such as field, hand samples and thin section. Mineralized veins mainly contain, in addition to the quartz of the gangue, sulphides (pyrite, chalcopyrite, galena, molybdenite), fluorite, chlorite, muscovite, sericite, and carbonate. The presence of sericite, kaolinite and chlorite indicate the occurrence of, at least, propylitic and phyllic-type alterations, both in core of the granite and best-expressed at the rim of quartz-rich orebodies. Gold occurs as native grains in core of the quartz veins, within fractures that affect pyrite and frequently exhibiting normal motions consistent with the one observed at larger scale and systematically associated with chalcopyrite and galena. Quartz veins are sometimes bordered by aplitic dike. Additionally, some of the veins can exhibit a very thin margin of adularia minerals that seems to represent the early stage of vein formation. These observations favor the link between late-magmatic fluids and veins formation. In order to constrain this assumption, a campaign of absolute dating has been undertaken. Zircons from granite and aplite for the magmatic feature and adularia, muscovite, sericite and molybdenite grains for the hydrothermal ones were selected and will be dated by, respectively U-Pb, Ar-Ar and Re-Os methods. Preliminary field results may suggest that gold-quartz veins may formed during the magmatic-hydrothermal transition and that mineralizing fluids possibly represent the late stages of magmatic fluid. Their mode of formation looks to be consistent with an extensional setting. With the help of all these new data, a discussion will be initiated about the genetic model of granite-hosted gold deposits and particularly on this specific case represented by the Passa Três deposit in which huge quartz veins, and no stockwork, are only formed inside the granite and not in surrounding rocks.

  9. Experiencias, Sentido y Significado de la Consejeria en Justicia Social a Nivel Universitario: Estudio de Caso Cualitativo Mediante Tres Narrativas De Consejeros Profesionales en Educacion Superior

    ERIC Educational Resources Information Center

    Santiago Tosado, Virginia

    2012-01-01

    The purpose of the study was to understand and profoundly describe the nature of social justice practice, as is comes up from the experience of three professional counselors whose working settings are the academic arena. Detailed descriptions are presented concerning the meanings and sense of counseling for social justice, as the interviews…

  10. Very high temperature measurements: Applications to nuclear reactor safety tests; Mesures des tres hautes temperatures: Applications a des essais de surete des reacteurs nucleaires

    SciTech Connect

    Parga, Clemente-Jose

    2013-09-27

    This PhD dissertation focuses on the improvement of very high temperature thermometry (1100 deg. C to 2480 deg. C), with special emphasis on the application to the field of nuclear reactor safety and severe accident research. Two main projects were undertaken to achieve this objective: - The development, testing and transposition of high-temperature fixed point (HTFP) metal-carbon eutectic cells, from metrology laboratory precision (±0.001 deg. C) to applied research with a reasonable degradation of uncertainties (±3-5 deg. C). - The corrosion study and metallurgical characterization of Type-C thermocouple (service temp. 2300 deg. C) prospective sheath material was undertaken to extend the survivability of TCs used for molten metallic/oxide corium thermometry (below 2000 deg. C)

  11. Catalysts for Change: Three Case Studies of Quality Education Worldwide = Catalizadores del Cambio: Tres Casos de Estudio sobre la Educacion de Calidad en el Mundo

    ERIC Educational Resources Information Center

    Puriefoy, Wendy D.

    2007-01-01

    Public education is the cornerstone of democracy and is absolutely fundamental to a democratic, civil and prosperous society. Beyond the boundaries of the United States, other countries are working to provide quality education to their children through civil society institutions. In particular, there are three extraordinary organizations in Peru,…

  12. Estimation de parametres structuraux des arbres dans une savane a partir de mesures LiDAR terrestre et d'imagerie a tres haute resolution spatiale

    NASA Astrophysics Data System (ADS)

    Beland, Martin

    This thesis takes its place in a context where information on the biophysical state of forest ecosystems at spatial scales only remote sensing can retrieve is in demand more than ever. In order to provide reliable information using validated approaches, the remote sensing research community recognises the need for new and innovative methods, especially in heterogeneous environments like savannas. The recent emergence of terrestrial LiDAR scanners (TLS) and the increase in the computational capability of computers which allow running ray tracing model simulations with a high level of realism hold great potential to improve our understanding of the processes influencing the radiance measured by satellite sensors. This thesis makes use of these two cutting edge technologies for estimating the spatial distribution of tree leaf area, a key element of modeling radiative transfer processes. The first part of the thesis concerns the development of methods for estimating tridimensional leaf area distribution in a savanna environment from TLS measurements. The methods presented address certain issues related to TLs measures affecting the application of classical theories (the probability of light transmission and the contact frequency) to the estimation of leaf area through indirect means. These issues pertain to the cross-section of laser pulses emitted by a TLS and the occlusion effects caused by the interception of laser pulses by material inside the crown. The developed methods also exploit additional information provided by the active nature of the TLS sensor that is not available to passive sensors like hemispherical photography, i.e. the intensity of a pulse return offers the possibility to distinguish between energy interception by wood and foliage. A simplified approach of this method is presented to promote its use by other research groups. This approach consists of a series of parameterisations and represents a significant gain in terms of the required resources to produce the leaf area, estimates. The second part of the thesis explores the combination of the tree representations generated in the first part with a ray tracing model to simulate the interactions of light with tree crowns. This approach is highly innovative and our study showed its potential to improve our understanding of the factors influencing the radiative environment in a savanna. The methods presented offer a solution to map leaf area at the individual tree scale over large areas from very high spatial resolution imagery. Mots-cles: Scanneur LiDAR terrestre, voxel, distribution 3D de surface foliaire, savanes, densite de surface foliaire (LAD), indice de surface foliaire (LAI), effets d'occlusion, parametrage, cartographie de la surface foliaire, lancer de rayons, modelisation du transfert radiatif.

  13. Integrated Approach To Producing High-Purity Trehalose from Maltose by the Yeast Yarrowia lipolytica Displaying Trehalose Synthase (TreS) on the Cell Surface.

    PubMed

    Li, Ning; Wang, Hengwei; Li, Lijuan; Cheng, Huiling; Liu, Dawen; Cheng, Hairong; Deng, Zixin

    2016-08-10

    An alternative strategy that integrated enzyme production, trehalose biotransformation, and bioremoval in one bioreactor was developed in this study, thus simplifying the traditional procedures used for trehalose production. The trehalose synthase gene from a thermophilic archaea, Picrophilus torridus, was first fused to the YlPir1 anchor gene and then inserted into the genome of Yarrowia lipolytica, thus yielding an engineered yeast strain. The trehalose yield reached 73% under optimal conditions. The thermal and pH stabilities of the displayed enzyme were improved compared to those of its free form purified from recombinant Escherichia coli. After biotransformation, the glucose byproduct and residual maltose were directly fermented to ethanol by a Saccharomyces cerevisiae strain. Ethanol can be separated by distillation, and high-purity trehalose can easily be obtained from the fermentation broth. The results show that this one-pot procedure is an efficient approach to the economical production of trehalose from maltose. PMID:27472444

  14. New Transit Observations for HAT-P-30 b, HAT-P-37 b, TrES-5 b, WASP-28 b, WASP-36 b and WASP-39 b

    NASA Astrophysics Data System (ADS)

    Maciejewski, G.; Dimitrov, D.; Mancini, L.; Southworth, J.; Ciceri, S.; D'Ago, G.; Bruni, I.; Raetz, St.; Nowak, G.; Ohlert, J.; Puchalski, D.; Saral, G.; Derman, E.; Petrucci, R.; Jofre, E.; Seeliger, M.; Henning, T.

    2016-01-01

    We present new transit light curves for planets in six extrasolar planetary systems. They were acquired with 0.4-2.2 m telescopes located in west Asia, Europe, and South America. When combined with literature data, they allowed us to redetermine system parameters in a homogeneous way. Our results for individual systems are in agreement with values reported in previous studies. We refined transit ephemerides and reduced uncertainties of orbital periods by a factor between 2 and 7. No sign of any variations in transit times was detected for the planets studied.

  15. Influence des conditions climatiques saisonnières sur quelques paramètres physiologiques dès boucs Créoles alimentés avec de l'ensilage de banane

    NASA Astrophysics Data System (ADS)

    Fauconneau, B.; Xande, A.

    1986-06-01

    Response of three groups of 12 male creole goats (weighing about 10 kg) to environmental variations was tested in Guadeloupe (French West Indies) respectively at three times in the year: end of humid season (October November), dry season (February March) and beginning of humid season (July August). Voluntary free intake of banana silage (silage of mixed green banana, bagassa, wheat bran and urea complemented with molasse) was not significantly affected by climatic variations. Three physiological parameters: rectal temperature, respiratory frequency and cardiac frequency were measured. These parameters were correlated with heat production dependent factors such as metabolic body weight, body weight gain and voluntary free intake. Rectal temperature increased all through the day until sunset and then decreased during the night. Both minimal rectal temperature and daily increase of rectal temperature were correlated with ambient temperature. Cardiac frequency increased during feeding. Generally cardiac frequency seemed to be correlated with activity of animals and so with behavioural response to environmental variations. Respiratory frequency was the most sensitive index of goat response to climate. The daily increase of respiratory frequency was important at the end of the humid season but was not observed in dry season. This increase was dependent on ambient temperature increase but also on air humidity characteristics and air velocity. These points are discussed according to integration of those physiological parameters in thermoregulation.

  16. La influencia de "los de abajo" en tres procesos de cambio linguistico en el espanol de Morelia, Michoacan (The Influence of "the Underclass" on Three Processes of Linguistic Change in the Spanish of Morelia, Michoacan).

    ERIC Educational Resources Information Center

    Gutierrez, Manuel J.

    1994-01-01

    Examines the role of the educational and socioeconomic levels of the speakers in advancing linguistic change. The study reviews three grammatical phenomena found at distinct stages of change. Individuals at the lower socioeconomic and educational strata of society embrace innovations in language more readily than their affluent and educated…

  17. GEDEON: A joint venture between research (CEA and CNRS) and industry (EDF and FRAMATOME)

    NASA Astrophysics Data System (ADS)

    Schapira, J. P.

    1999-07-01

    Nuclear waste partitionning and transmutation (P & T) are considered in France as an official line of research, in accordance with the Law of December 30, 1991 concerning research in the field of long lived and highly active nuclear waste. A research group called GEDEON ( GEstion des DEchets par des Options Nouvelles) has been set up between CEA, CNRS, EDF and FRAMATOME with the aim to carry out basic research related to the use of accelerator driven subcritical systems (ADS) and of thorium as an option to reduce the waste long term impacts. In the partners agreement of GEDEON, the following subjects have been identified: spallation physics, nuclear data, subcritical neutronic studies, materials, thorium, system and scenario studies. The organization as well as the scientific program and activities of GEDEON are presented.

  18. Lo que Piensan los Estudiantes y Profesores Sobre la Calidad de la Educacion Superior. Estudio Comparativo en 5 Instituciones de Educacion Superior--dos publicas y tres privadas--en Guadalajara, Jalisco, Mexico (What Students and Faculties Think about the Quality of Higher Education. Comparative Study of 5 Higher Education Institutions--Two Public and Three Private--in Guadalajara, Jalisco, Mexico).

    ERIC Educational Resources Information Center

    Yanez, Maria Lorena Hernandez

    This study, written in Spanish, compared attitudes of students (N=302) and faculty (N=28) at five institutions of higher education (two public and three private) in Guadalajara, Jalisco, Mexico. The study explored first, whether respondents believed there are significant quality differences between private and public universities and, second, what…

  19. Exploring EFL Pre-Service Teachers' Experience with Cultural Content and Intercultural Communicative Competence at Three Colombian Universities (Indagación sobre la experiencia con el contenido cultural y la competencia comunicativa intercultural de docentes de inglés en formación, en tres universidades colombianas)

    ERIC Educational Resources Information Center

    Olaya, Alba; Gómez Rodríguez, Luis Fernando

    2013-01-01

    This article reports the findings of a qualitative research project that explored pre-service English teachers' perceptions of and attitudes toward the aspects of culture and intercultural competence addressed in their English classes in the undergraduate programs at three Colombian universities. Findings reveal that pre-service teachers are…

  20. Etude du profil d'echelle des formes et de mesures d'energie de texture pour l'evaluation semi-automatique des degâts sur les bâtiments dans les images satellitaires de tres haute resolution

    NASA Astrophysics Data System (ADS)

    Dubois, David

    Dozens of natural disasters occur each year throughout the world. They cause the death of thousands of people and cost billions of dollars in losses and reconstruction. Considerable resources are invested in the various phases of the emergency cycle like response and reconstruction. To avoid mismanagement of human and material resources during the response to a disaster, decisions must be made very quickly. To make appropriate choices, decision makers need up to date information on conditions on the ground. The images acquired by satellite are a possible source for this information. The new satellites equipped with optical sensors having spatial resolution finer than a meter per pixel provide details useful for determining the status of roads and damage to buildings. Unfortunately, visual analysis of these very large images is time consuming and fatigue may increase the rate of human error. In this thesis, we propose a semi-automatic method for the extraction of buildings and damage assessment using geometric, radiometric and texture features. The work includes a review of the literature in order to identify gaps in current approaches and possible solutions, the development of a methodology to solve this difficult problem, the testing of the proposed method on a portion of images of the city of Port-au-Prince, Haiti captured before and after the earthquake of January 12, 2010, assessment of results and their comparison with the literature. The proposed method requires processing of the image in a hierarchical tree shapes through the fast level set transform. Once the image is represented in this way, an algorithm for extracting meaningful forms is used to assign a representative form for each pixel. Geometrical descriptors such as area, perimeter and others from central moments are extracted from these forms. In addition, for damage assessment, energy measurements of texture are calculated on the forms before and after the event. Buildings are extracted using a supervised classifier based on a support vector machine (SVM). The damage is classified according to three degrees: little or no damage, damaged and destroyed. After experiment, the proposed method for the evaluation of damage exceeds those proposed in the recent literature both in rapidity and accuracy. The use of the scale profile and Laws textures are considerable innovations in the field of remote sensing brought by this thesis.

  1. Étude de la variation spatio-temporelle des paramètres physico-chimiques caractérisant la qualité des eaux d'une lagune côtière et ses zonations écologiques : cas de Moulay Bousselham, Maroc

    NASA Astrophysics Data System (ADS)

    Labbardi, Hanane; Ettahiri, Omar; Lazar, Said; Massik, Zakia; El Antri, Said

    2005-04-01

    Our interest is related to the hydrological characteristics of the Moulay Bousselham lagoon. Water samples were taken monthly from July 2001 to June 2002 in 15 stations distributed along the lagoon. The various measured hydrological parameters (temperature, salinity, suspended matter, chlorophyll a) showed significant monthly variations ( p<0.001), whereas spatially among all sampled stations, only the salinity showed significant variations. The variability analysis approached by the analysis of the normalized principal components combined with discriminate analysis showed very small inter-stations variability. Its percentage is 11% and 9% of the total variance during high and low tide, respectively. To cite this article: H. Labbardi et al., C. R. Geoscience 337 (2005).

  2. La teneur en iode du sel de cuisine consommé à Lubumbashi et le statut iode des personnes vulnérables: cas de femmes enceintes de milieux défavorisés

    PubMed Central

    Banza, Bienvenue Ilunga; Lumbu, Jean Baptiste Simbi; Donnen, Philippe; Twite, Eugène Kabange; Kwete, Daniel Mikobi; Kazadi, Costa Mwadianvita; Ozoza, Jean Okolonken; Habimana, Laurence; Kalenga, Prosper Muenze Kayamba; Robert, Annie

    2016-01-01

    Introduction La consommation du sel faiblement iodé peut engendrer des troubles divers liés à la carence iodée Ce travail a pour objectif d’évaluer la teneur en iode du sel consommé à Lubumbashi et de déterminer le statut iodé des femmes enceintes, cible privilégiée de la carence iodée. Méthodes Une étude transversale descriptive a été consacrée à une analyse iodométrique d'iode dans 739 échantillons de sel collectés dans les ménages et marchés de Lubumbashi en 2014. Précédemment, l'iode urinaire a été déterminé par la technique de minéralisation au persulfate d'ammonium chez 225 femmes enceintes reçues en consultation du 15 mars 2009 au 25 avril 2011. Résultats Notre enquête a révélé 47,5% des échantillons de sels de cuisine adéquatement iodés (15 à 40 ppm), 36,9% d’échantillons faiblement iodés, 7,4% d’échantillons trop riches en iode et 8,1% des échantillons non iodés. La disponibilité en iode du sel de cuisine analysé était globalement de 54,9%, se trouvant nettement en dessous des normes OMS (90%). En mesurant l'iode urinaire chez la femme enceinte, la carence iodée (iode urinaire <150 µg/l) a été observée dans une proportion de 52%. Conclusion La faible disponibilité en iode du sel consommé à Lubumbashi pourrait être responsable d'une grande proportion de la carence iodée observée chez la femme enceinte, ce qui expose celle-ci aux risques majeurs des troubles dus à la carence en iode. PMID:27279956

  3. 75 FR 32932 - Combined Notice of Filings No. 2

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-10

    ... Commission has received the following Natural Gas Pipeline Rate and Refund Report filings: Docket Numbers: RP09-260-005. Applicants: Tres Palacios Gas Storage LLC. Description: Tres Palacios Gas Storage LLC submits Second Substitute First Revised Sheet 138 to FERC Gas Tariff, Original Volume 1. Filed Date:...

  4. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  5. In vitro comparative studies of resveratrol and triacetylresveratrol on cell proliferation, apoptosis, and STAT3 and NFκB signaling in pancreatic cancer cells.

    PubMed

    Duan, JingJing; Yue, Wen; E, JianYu; Malhotra, Jyoti; Lu, Shou-En; Gu, Jun; Xu, Feng; Tan, Xiang-Lin

    2016-01-01

    Resveratrol (RES) has been studied extensively as an anticancer agent. However, the anticancer effects of triacetylresveratrol (TRES, an acetylated analog of RES) which has higher bioavailability have not been well established. We comparatively evaluated their effects on cell proliferation, apoptosis and the molecular changes in STAT3, NFκB and apoptotic signaling pathways in pancreatic cancer cells. Apoptosis was determined by flow cytometry. The nuclear translocation and interaction of STAT3 and NFκB were detected by Western blotting and immunoprecipitation, respectively. Both TRES and RES inhibited cell viability, and induced apoptosis of pancreatic cancer cells in a concentration and incubation time-dependent manner. TRES, similarly to RES, inhibited the phosphorylation of STAT3 and NFκB, down-regulated Mcl-1, and up-regulated Bim and Puma in pancreatic cancer cells. Remarkably, we, for the first time, observed that both TRES and RES suppressed the nuclear translocation, and interrupted the interaction of STAT3 and NFκB in PANC-1 cells. Comparative anticancer effects of TRES and RES on pancreatic cancer suggested that TRES with higher bioavailability may be a potential agent for pancreatic cancer prevention and treatment. Further in vivo experiments and functional studies are warranted to investigate whether TRES exhibits better beneficial effects than RES in mice and humans. PMID:27539371

  6. In vitro comparative studies of resveratrol and triacetylresveratrol on cell proliferation, apoptosis, and STAT3 and NFκB signaling in pancreatic cancer cells

    PubMed Central

    Duan, JingJing; Yue, Wen; E, JianYu; Malhotra, Jyoti; Lu, Shou-en; Gu, Jun; Xu, Feng; Tan, Xiang-Lin

    2016-01-01

    Resveratrol (RES) has been studied extensively as an anticancer agent. However, the anticancer effects of triacetylresveratrol (TRES, an acetylated analog of RES) which has higher bioavailability have not been well established. We comparatively evaluated their effects on cell proliferation, apoptosis and the molecular changes in STAT3, NFκB and apoptotic signaling pathways in pancreatic cancer cells. Apoptosis was determined by flow cytometry. The nuclear translocation and interaction of STAT3 and NFκB were detected by Western blotting and immunoprecipitation, respectively. Both TRES and RES inhibited cell viability, and induced apoptosis of pancreatic cancer cells in a concentration and incubation time-dependent manner. TRES, similarly to RES, inhibited the phosphorylation of STAT3 and NFκB, down-regulated Mcl-1, and up-regulated Bim and Puma in pancreatic cancer cells. Remarkably, we, for the first time, observed that both TRES and RES suppressed the nuclear translocation, and interrupted the interaction of STAT3 and NFκB in PANC-1 cells. Comparative anticancer effects of TRES and RES on pancreatic cancer suggested that TRES with higher bioavailability may be a potential agent for pancreatic cancer prevention and treatment. Further in vivo experiments and functional studies are warranted to investigate whether TRES exhibits better beneficial effects than RES in mice and humans. PMID:27539371

  7. Facility design, construction, and operation

    SciTech Connect

    1995-04-01

    France has been disposing of low-level radioactive waste (LLW) at the Centre de Stockage de la Manche (CSM) since 1969 and now at the Centre de Stockage de l`Aube (CSA) since 1992. In France, several agencies and companies are involved in the development and implementation of LLW technology. The Commissariat a l`Energie Atomic (CEA), is responsible for research and development of new technologies. The Agence National pour la Gestion des Dechets Radioactifs is the agency responsible for the construction and operation of disposal facilities and for wastes acceptance for these facilities. Compagnie Generale des Matieres Nucleaires provides fuel services, including uranium enrichment, fuel fabrication, and fuel reprocessing, and is thus one generator of LLW. Societe pour les Techniques Nouvelles is an engineering company responsible for commercializing CEA waste management technology and for engineering and design support for the facilities. Numatec, Inc. is a US company representing these French companies and agencies in the US. In Task 1.1 of Numatec`s contract with Martin Marietta Energy Systems, Numatec provides details on the design, construction and operation of the LLW disposal facilities at CSM and CSA. Lessons learned from operation of CSM and incorporated into the design, construction and operating procedures at CSA are identified and discussed. The process used by the French for identification, selection, and evaluation of disposal technologies is provided. Specifically, the decisionmaking process resulting in the change in disposal facility design for the CSA versus the CSM is discussed. This report provides` all of the basic information in these areas and reflects actual experience to date.

  8. Prototype pushing robot for emplacing vitrified waste canisters into horizontal disposal drifts

    SciTech Connect

    Londe, L.; Seidler, W.K.; Bosgiraud, J.M.; Guenin, J.J.; Devaux, P.

    2007-07-01

    Within the French Underground Disposal concept, as described in ANDRA's (Agence Nationale pour la Gestion des Dechets Radioactifs) Dossier 2005, the Pushing Robot is an application envisaged for the emplacement (and the potential retrieval) of 'Vitrified waste packages', also called 'C type packages'. ANDRA has developed a Prototype Pushing Robot within the framework of the ESDRED Project (Engineering Studies and Demonstration of Repository Design) which is co-funded by the European Commission as part of the sixth EURATOM Research and Training Framework Programme (FP6) on nuclear energy (2002 - 2006). The Rationale of the Pushing Robot technology comes from various considerations, including the need for (1) a simple and robust system, capable of moving (and potentially retrieving) on up to 40 metres (m), a 2 tonne C type package (mounted on ceramic sliding runners) inside the carbon steel sleeve constituting the liner (and rock support) of a horizontal disposal cell, (2) small annular clearances between the package and the liner, (3) compactness of the device to be transferred from surface to underground, jointly with the package, inside a shielding cask, and (4) remote controlled operations for the sake of radioprotection. The initial design, based on gripping supports, has been replaced by a 'technical variant' based on inflatable toric jacks. It was then possible, using a test bench, to check that the Pushing Robot worked properly. Steps as high as 7 mm were successfully cleared by a dummy package pushed by the Prototype.. Based on the lessons learned by ANDRA's regarding the Prototype Pushing Robot, a new Scope of Work is being written for the Contract concerning an Industrial Scale Demonstrator. The Industrial Scale Demonstration should be completed by the end of the second Quarter of 2008. (authors)

  9. Epithelium

    MedlinePlus

    The term "epithelium" refers to layers of cells that line hollow organs and glands. It is also those cells that make ... Epithelium. In: Kierszenbaum AL, Tres LL. Histology and Cell Biology - An Introduction to Pathology , 3rd ed. Philadelphia, ...

  10. A SEARCH FOR ADDITIONAL PLANETS IN FIVE OF THE EXOPLANETARY SYSTEMS STUDIED BY THE NASA EPOXI MISSION

    SciTech Connect

    Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Christiansen, Jessie L.; Deming, Drake; Barry, Richard K.; Kuchner, Marc J.; Livengood, Timothy A.; Hewagama, Tilak; Hampton, Don L.; Lisse, Carey M.; Seager, Sara; Veverka, Joseph F.

    2011-05-01

    We present time series photometry and constraints on additional planets in five of the exoplanetary systems studied by the EPOCh (Extrasolar Planet Observation and Characterization) component of the NASA EPOXI mission: HAT-P-4, TrES-3, TrES-2, WASP-3, and HAT-P-7. We conduct a search of the high-precision time series for photometric transits of additional planets. We find no candidate transits with significance higher than our detection limit. From Monte Carlo tests of the time series using putative periods from 0.5 days to 7 days, we demonstrate the sensitivity to detect Neptune-sized companions around TrES-2, sub-Saturn-sized companions in the HAT-P-4, TrES-3, and WASP-3 systems, and Saturn-sized companions around HAT-P-7. We investigate in particular our sensitivity to additional transits in the dynamically favorable 3:2 and 2:1 exterior resonances with the known exoplanets: if we assume coplanar orbits with the known planets, then companions in these resonances with HAT-P-4b, WASP-3b, and HAT-P-7b would be expected to transit, and we can set lower limits on the radii of companions in these systems. In the nearly grazing exoplanetary systems TrES-3 and TrES-2, additional coplanar planets in these resonances are not expected to transit. However, we place lower limits on the radii of companions that would transit if the orbits were misaligned by 2.{sup 0}0 and 1.{sup 0}4 for TrES-3 and TrES-2, respectively.

  11. Probing the interaction of trans-resveratrol with bovine serum albumin: a fluorescence quenching study with Tachiya model.

    PubMed

    Xiao, J B; Chen, X Q; Jiang, X Y; Hilczer, M; Tachiya, M

    2008-01-01

    The interaction of trans-resveratrol (TRES) and bovine serum albumin (BSA) was investigated using fluorescence spectroscopy (FS) with Tachiya model. The binding number maximum of TRES was determined to be 8.86 at 293.15 K, 23.42 at 303.15 K and 33.94 at 313.15 K and the binding mechanism analyzed in detail. The apparent binding constants (K (a)) between TRES and BSA were 5.02 x 10(4) (293.15 K), 8.89 x 10(4) (303.15 K) and 1.60 x 10(5) L mol(-1) (313.15 K), and the binding distances (r) between TRES and BSA were 2.44, 3.01, and 3.38 nm at 293.15, 303.15, and 313.15 K, respectively. The addition of TRES to BSA solution leads to the enhancement in RLS intensity, exhibiting the formation of the aggregate in solution. The negative entropy change and enthalpy change indicated that the interaction of TRES and BSA was driven mainly by van der Waals interactions and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. PMID:18351302

  12. TN International and ITS operational feedback regarding the decommissioning of obsolete casks dedicated to the transport and/or storage of nuclear raw materials, fuel and used fuel

    SciTech Connect

    Blachet, L.; Bimet, F.; Rennesson, N.

    2008-07-01

    Within the AREVA group, TN International is a major actor regarding the design of casks and transportation for the nuclear cycle. In the early 2005, TN International has started the project of decommissioning some of its own equipment and was hence the first company ever in the AREVA Group to implement this new approach. In order to do so, TN International has based this project by taking into account the AREVA Sustainable Development Charter, the French regulatory framework, the ANDRA (Agence Nationale pour la Gestion des Dechets Radioactifs - National Agency for the radioactive waste management) requirements and has deployed a step by step methodology such as radiological characterization following a logical route. The aim was to define a standardized process with optimized solutions regarding the diversity of the cask's fleet. As a general matter, decommissioning of nuclear casks is a brand new field as the nuclear field is more familiar with the dismantling of nuclear facilities and/or nuclear power plant. Nevertheless existing workshops, maintenance facilities, measurements equipments and techniques have been exploited and adapted by TN International in order to turn an ambitious project into a permanent and cost-effective activity. The decommissioning of the nuclear casks implemented by TN International regarding its own needs and the French regulatory framework is formalized by several processes and is materialized for instance by the final disposal of casks as they are or in ISO container packed with cut-off casks and big bags filled with crushed internal cask equipments, etc. The first part of this paper aims to describe the history of the project that started with a specific environmental analysis which took into account the values of AREVA as regards the Sustainable Development principles that were at the time and are still a topic of current concern in the world. The second part will deal with the definition, the design and the implementation of the

  13. Identification of active transcriptional regulatory elements from GRO-seq data.

    PubMed

    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam

    2015-05-01

    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment (https://github.com/Danko-Lab/dREG/). This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  14. Homology modeling and function of trehalose synthase from Pseudomonas putida P06.

    PubMed

    Su, Jing; Wang, Tengfei; Ma, Chunling; Li, Zhongkui; Li, Zhenzhen; Wang, Ruiming

    2014-05-01

    Trehalose is a non-reducing disaccharide that has wide applications in the food industry and pharmaceutical manufacturing. Trehalose synthase (TreS) from Pseudomonas putida P06 catalyzes the reversible interconversion of maltose and trehalose and may have applications in the food industry. However, the catalytic mechanism of TreS is not well understood. Here, we investigated the structural characteristics of this enzyme by homology modeling. The highly conserved Asp294 residue was identified to be critical for catalytic activity. In addition, flexible docking studies of the enzyme-substrate system were performed to predict the interactions between TreS and its substrate, maltose. Amino acids that interact extensively with the substrate and stabilize the substrate in an orientation suitable for enzyme catalysis were identified. The importance of these residues for catalytic activity was confirmed by the biochemical characterization of the relevant mutants generated by site-directed mutagenesis. PMID:24563286

  15. Atmospheric characterization of five hot Jupiters with the wide field Camera 3 on the Hubble space telescope

    SciTech Connect

    Ranjan, Sukrit; Charbonneau, David; Désert, Jean-Michel; Madhusudhan, Nikku; Deming, Drake; Wilkins, Ashlee; Mandell, Avi M.

    2014-04-20

    We probe the structure and composition of the atmospheres of five hot Jupiter exoplanets using the Hubble Space Telescope Wide Field Camera 3 (WFC3) instrument. We use the G141 grism (1.1-1.7 μm) to study TrES-2b, TrES-4b, and CoRoT-1b in transit; TrES-3b in secondary eclipse; and WASP-4b in both. This wavelength region includes a predicted absorption feature from water at 1.4 μm, which we expect to be nondegenerate with the other molecules that are likely to be abundant for hydrocarbon-poor (e.g., solar composition) hot Jupiter atmospheres. We divide our wavelength regions into 10 bins. For each bin we produce a spectrophotometric light curve spanning the time of transit or eclipse. We correct these light curves for instrumental systematics without reference to an instrument model. For our transmission spectra, our mean 1σ precision per bin corresponds to variations of 2.1, 2.8, and 3.0 atmospheric scale heights for TrES-2b, TrES-4b, and CoRoT-1b, respectively. We find featureless spectra for these three planets. We are unable to extract a robust transmission spectrum for WASP-4b. For our dayside emission spectra, our mean 1σ precision per bin corresponds to a planet-to-star flux ratio of 1.5 × 10{sup –4} and 2.1 × 10{sup –4} for WASP-4b and TrES-3b, respectively. We combine these estimates with previous broadband measurements and conclude that for both planets isothermal atmospheres are disfavored. We find no signs of features due to water. We confirm that WFC3 is suitable for studies of transiting exoplanets, but in staring mode multivisit campaigns are necessary to place strong constraints on water abundance.

  16. Cryptographie quantique avec des états cohérents à longueur d'onde télécom

    NASA Astrophysics Data System (ADS)

    Lodewyck, J.; Tualle-Brouri, R.; Debuisschert, T.; Grangier, P.

    2006-10-01

    Nous proposons un système de distribution quantique de clé avec des variables continues, implémenté avec des technologies télécom à 1550 nm. Le dispositif actuel nous a permis de transmettre une clé secrète brute au taux de 1 Mb/s sur une distance de quelques mètres. Une extension en cours de réalisation nous permettra de transmettre des clés sur des distances allant jusqu'à plusieurs dizaines dekilomètres.

  17. Critical Muralism

    ERIC Educational Resources Information Center

    Rosette, Arturo

    2009-01-01

    This study focuses on the development and practices of Critical Muralists--community-educator-artist-leader-activists--and situates these specifically in relation to the Mexican mural tradition of los Tres Grandes and in relation to the history of public art more generally. The study examines how Critical Muralists address artistic and…

  18. Imagining the Mexican Immigrant Worker: (Inter)Nationalism, Identity, and Insurgency in the Chicano Movement in Los Angeles.

    ERIC Educational Resources Information Center

    Chavez, Ernesto

    2000-01-01

    Traces the history of two organizations of the 1970s Chicano Movement: the Committee to Free Los Tres and the Centro de Accion Social Autonomo (CASA). Discusses their Marxist ideology, notion of Chicano cultural nationalism, involvement of college students and other youth, campaigns supporting immigrant workers' rights and affirmative action at…

  19. Radiations cosmiques : danger dans l'Espace

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.; Dzitko, H.

    2000-06-01

    Au sol, l'atmosphere nous protege plus ou moins bien. Mais dans l'espace ou a bord des avions de ligne, l'homme est directement expose aux rayonnements cosmiques qui peuvent etre mortels. Un veritable frein a la presence humaine prolongee dans l'espace. Une menace que les agences spatiales prennent tres au serieux.

  20. VET Workers' Problem-Solving Skills in Technology-Rich Environments: European Approach

    ERIC Educational Resources Information Center

    Hämäläinen, Raija; Cincinnato, Sebastiano; Malin, Antero; De Wever, Bram

    2014-01-01

    The European workplace is challenging VET adults' problem-solving skills in technology-rich environments (TREs). So far, no international large-scale assessment data has been available for VET. The PIAAC data comprise the most comprehensive source of information on adults' skills to date. The present study (N = 50 369) focuses on gaining…

  1. 75 FR 18232 - Endangered and Threatened Wildlife and Plants; 5-Year Status Reviews of 15 Caribbean Species

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-09

    .... mirabilis (no common name), chupacallos (Pleodendron macranthum), Vahl's boxwood or diablito de tres cuernos...), palo de nigua (Cornutia obovata), palo de Ram n (Banara vanderbiltii), uvillo (Eugenia haematocarpa... mature. B. Endangered means any species that is in danger of extinction throughout all or a...

  2. Dos dosis de vacuna contra los VPH pueden proteger

    Cancer.gov

    Dos dosis de Cervarix, la vacuna contra virus del papiloma humano (VPH), fueron tan efectivas como la pauta normal actual de tres dosis después de cuatro años de seguimiento. El estudio de vacuna en Costa Rica, patrocinado por el NCI, fue diseñado para ev

  3. Preliminary Report from the 2005 Conference on Teacher Research Experiences

    NASA Astrophysics Data System (ADS)

    Scowcroft, G. A.; Knowlton, C.

    2005-12-01

    There is a clearly expressed need from the field for a coordination of efforts and a sharing of best practices among institutions and projects providing teacher research experiences for K-12 science educators. To address these needs, over 100 participants from 30 Teacher Research Experience (TRE) Projects met at the University of Rhode Island in April 2005 to participate in the Conference on Teacher Research Experiences (CTRE). Three member teams from each project included principle investigators, project directors and evaluators, teachers, scientists, and other professionals engaged in TREs. The CTRE goals were to: 1.) initiate a community of professionals that engage in TREs; 2.) build a foundation of best practices for TREs; 3.) work toward standardizing teacher mentoring activities; 4.) establish connections and collaborations between projects; 5.) provide opportunities for meeting individual project challenges. This presentation will discuss conference results as well as highlight data collected from the participating projects describing project design elements, successes, and needs. There are common experiences shared by those participating in TREs that help to build an informed and supportive professional community.

  4. Cigarrillos electrónicos | Smokefree Español

    Cancer.gov

    Seguramente ha oído a personas hablar del uso de los cigarrillos electrónicos como una manera de dejar de fumar. Si esta pensando en usar un cigarrillo electrónico, aquí hay tres cosas que debe de saber.

  5. El pronóstico del cáncer

    Cancer.gov

    Tres pacientes con cáncer y su médico, el doctor Anthony L. Back, un oncólogo quien también es experto a nivel nacional en la comunicación entre médicos y pacientes, comparten sus puntos de vista sobre sus pronósticos de cáncer.

  6. Estudios ALCHEMIST para el cáncer de pulmón en estadio inicial

    Cancer.gov

    ALCHEMIST comprende tres estudios clínicos integrados de medicina de precisión diseñados para identificar a personas con cáncer de pulmón en estadio inicial cuyos tumores tienen ciertos cambios genéticos poco comunes.

  7. Review of thermally regenerative electrochemical systems. Volume I. Synopsis and executive summary

    SciTech Connect

    Chum, H. L.; Osteryoung, R. A.

    1980-08-01

    Thermally regenerative electrochemical systems (TRES) are closed systems that convert heat into electricity in an electrochemical heat engine that is Carnot cycle limited in efficiency. Past and present work on such systems is reviewed. Two broad classes of TRES are based on the types of energy inputs required for regeneration: thermal alone and coupled thermal and electrolytic. The thermal regeneration alone encompasses electrochemical systems (galvanic or fuel cells) in which one or more products are formed. The regeneration can be performed in single or multiple steps. The compounds include metal hydrides, halides, oxides, chalcogenides, and alloys or bimetallic systems. The coupled thermal and electrolytic regeneration encompasses electrochemical systems (galvanic or fuel cells) regenerated by electrolysis at a different temperature or different pressure. Examples include metal halides and water. Thermogalvanic or nonisothermal cells are included in this category. Also included are electrochemical engines in which the working electroactive fluid is isothermally expanded through an electrolyte. TRES cover temperature ranges from about 20/sup 0/C to 1000/sup 0/C. Engines with power outputs of 0.1 mW/cm/sup 2/ to 1 W/cm/sup 2/ have been demonstrated. Recommendations are made of areas of research in science and engineering that would have long-range benefit to a TRES program.

  8. Identification of thyroid hormone receptor binding sites in developing mouse cerebellum

    PubMed Central

    2013-01-01

    Background Thyroid hormones play an essential role in early vertebrate development as well as other key processes. One of its modes of action is to bind to the thyroid hormone receptor (TR) which, in turn, binds to thyroid response elements (TREs) in promoter regions of target genes. The sequence motif for TREs remains largely undefined as does the precise chromosomal location of the TR binding sites. A chromatin immunoprecipitation on microarray (ChIP-chip) experiment was conducted using mouse cerebellum post natal day (PND) 4 and PND15 for the thyroid hormone receptor (TR) beta 1 to map its binding sites on over 5000 gene promoter regions. We have performed a detailed computational analysis of these data. Results By analysing a recent spike-in study, the optimal normalization and peak identification approaches were determined for our dataset. Application of these techniques led to the identification of 211 ChIP-chip peaks enriched for TR binding in cerebellum samples. ChIP-PCR validation of 25 peaks led to the identification of 16 true positive TREs. Following a detailed literature review to identify all known mouse TREs, a position weight matrix (PWM) was created representing the classic TRE sequence motif. Various classes of promoter regions were investigated for the presence of this PWM, including permuted sequences, randomly selected promoter sequences, and genes known to be regulated by TH. We found that while the occurrence of the TRE motif is strongly correlated with gene regulation by TH for some genes, other TH-regulated genes do not exhibit an increased density of TRE half-site motifs. Furthermore, we demonstrate that an increase in the rate of occurrence of the half-site motifs does not always indicate the specific location of the TRE within the promoter region. To account for the fact that TR often operates as a dimer, we introduce a novel dual-threshold PWM scanning approach for identifying TREs with a true positive rate of 0.73 and a false positive

  9. Analysis of hydrocarbon-bearing fluid inclusions (HCFI) using time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Przyjalgowski, Milosz A.; Ryder, Alan G.; Feely, Martin; Glynn, Thomas J.

    2005-06-01

    Hydrocarbon-bearing fluid inclusions (HCFI) are microscopic cavities within rocks that are filled with petroleum oil, the composition of which may not have changed since the trapping event. Thus, the composition of that entrapped oil can provide information about the formation and evolution of the oil reservoir. This type of information is important to the petroleum production and exploration industries. Crude oil fluorescence originates from the presence of cyclic aromatic compounds and the nature of the emission is governed by the chemical composition of the oil. Fluorescence based methods are widely used for analysis of crude oil because they offer robust, non-contact and non-destructive measurement options. The goal of our group is the development of a non-destructive analytical method for HCFI using time-resolved fluorescence methods. In broad terms, crude oil fluorescence behavior is governed by the concentration of quenching species and the distribution of fluorophores. For the intensity averaged fluorescence lifetime, the best correlations have been found between polar or alkane concentrations, but these are not suitable for robust, quantitative analysis. We have recently started to investigate another approach for characterizing oils by looking at Time-resolved Emission Spectra (TRES). TRES are constructed from intensities sampled at discrete times during the fluorescence decay of the sample. In this study, TRES, from a series of 10 crude oils from the Middle East, have been measured at discrete time gates (0.5 ns, 1 ns, 2 ns, 4 ns) over the 450-700 nm wavelength range. The spectral changes in TRES, such as time gate dependent Stokes' shift and spectral broadening, are analyzed in the context of energy transfer rates. In this work, the efficacy of using TRES for fingerprinting individual oils and HCFI is also demonstrated.

  10. Novel Resveratrol-Based Substrates for Human Hepatic, Renal, and Intestinal UDP-Glucuronosyltransferases

    PubMed Central

    2015-01-01

    Trans-Resveratrol (tRes) has been shown to have powerful antioxidant, anti-inflammatory, anticarcinogenic, and antiaging properties; however, its use as a therapeutic agent is limited by its rapid metabolism into its conjugated forms by UDP-glucuronosyltransferases (UGTs). The aim of the current study was to test the hypothesis that the limited bioavailability of tRes can be improved by modifying its structure to create analogs which would be glucuronidated at a lower rate than tRes itself. In this work, three synthetic stilbenoids, (E)-3-(3-hydroxy-4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)acrylic acid (NI-12a), (E)-2,4-dimethoxy-6-(4-methoxystyryl)benzaldehyde oxime (NI-ST-05), and (E)-4-(3,5-dimethoxystyryl)-2,6-dinitrophenol (DNR-1), have been designed based on the structure of tRes and synthesized in our laboratory. UGTs recognize and glucuronidate tRes at each of the 3 hydroxyl groups attached to its aromatic rings. Therefore, each of the above compounds was designed with the majority of the hydroxyl groups blocked by methylation and the addition of other novel functional groups as part of a drug optimization program. The activities of recombinant human UGTs from the 1A and 2B families were examined for their capacity to metabolize these compounds. Glucuronide formation was identified using HPLC and verified by β-glucuronidase hydrolysis and LC–MS/MS analysis. NI-12a was glucuronidated at both the −COOH and −OH functions, NI-ST-05 formed a novel N–O-glucuronide, and no product was observed for DNR-1. NI-12a is primarily metabolized by the hepatic and renal enzyme UGT1A9, whereas NI-ST-05 is primarily metabolized by an extrahepatic enzyme, UGT1A10, with apparent Km values of 240 and 6.2 μM, respectively. The involvement of hepatic and intestinal UGTs in the metabolism of both compounds was further confirmed using a panel of human liver and intestinal microsomes, and high individual variation in activity was demonstrated between donors. In summary

  11. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    SciTech Connect

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A. . E-mail: rhodin@partners.org

    2005-11-18

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity.

  12. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  13. Case Study of Small Molecules As Antimalarials: 2-Amino-1-phenylethanol (APE) Derivatives

    PubMed Central

    2014-01-01

    Antiparasitic oral drugs have been associated to lipophilic molecules due to their intrinsic permeability. However, these kind of molecules are associated to numerous adverse effects, which have been extensively studied. Within the Tres Cantos Antimalarial Set (TCAMS) we have identified two small, soluble and simple hits that even presenting antiplasmodial activities in the range of 0.4–0.5 μM are able to show in vivo activity. PMID:24944739

  14. Magnétométrie à hélium par pompage laser: le bilan

    NASA Astrophysics Data System (ADS)

    Gilles, H.; Hamel, J.; Monfort, Y.

    2002-06-01

    Depuis 1986, l'équipe Physique Atomique et Capteurs du CIRIL-ISMRA de Caen étudie les magnétomètres à hélium par pompage laser. On présente ici le bilan de ces travaux de recherche et les performances des deux prototypes (hélium4 et hélium3) réalisés au Laboratoire.

  15. The Meteoritical Bulletin, No. 77, 1994 November

    NASA Astrophysics Data System (ADS)

    Wlotzka, Frank

    1994-11-01

    This Meteoritical Bulletin is again dominated by meteorite finds from hot and cold deserts: 99 from the Nullarbor, 12 from the Sahara, and 35 from Antarctica. Besides 161 ordinary chondrites, it lists 5 irons (Colton, Hidden Valley, Miles, Tagounite, Tres Castillos), 2 ureilites (FRO90168, Hughes 009), 1 howardite (ALH 88135), 1 CV3 (Axtell), 1 CK4 (Sleeper Camp 006), and 2 enstatite chondrites (ALH 88070, Forrest 033). Three of the meteorites are falls.

  16. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  17. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  18. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  19. The reprint of a chapter of Nicolaus Copernicus' principal book by Heinrich Brucaeus, Rostock 1573 (German Title: Der Nachdruck eines Kapitels des Hauptwerkes von Nicolaus Copernicus durch Heinrich Brucaeus, Rostock 1573)

    NASA Astrophysics Data System (ADS)

    Hamel, Jürgen

    The book "De motu primo libri tres" of the Rostock professor Heinrich Brucaeus (1530-1593), which appeared in 1573, contains an unmodified reprint of a section of Copernicus` principal work, first book, 14th chapter, exercise 3. This reprint, hitherto unnoticed, is of interest for the reception of Copernicus' work. This article reproduces the text and presents some research on Brucaeus, who was Tycho Brahe's teacher in Rostock. His biography and his scientific achievements are outlined.

  20. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  1. Astronomía y Física: un matrimonio Sartriano

    NASA Astrophysics Data System (ADS)

    Vucetich, H.

    Desde el siglo XVII, Física y Astronomía han formado un matrimonio similar al de Sartre y Beauvoir: lleno de amores contingentes, pero firme y duradero. En la charla examino tres de los frutos más recientes de este matrimonio: - La confirmación de la Relatividad General con datos astronómicos. - Astrofísica y Física de neutrinos. - Teorías de supercuerdas y astronomía.

  2. La distribución multimodal de cúmulos globulares en la galaxia NGC 1399

    NASA Astrophysics Data System (ADS)

    Forte, J. C.; Ostrov, P. G.

    Se presenta una discusión de las características del diagrama de dos colores para un muestreo de 400 cúmulos globulares asociados con NGC 1399. Los resultados indican la presencia de, por lo menos, tres familias de cúmulos. La naturaleza de una cuarta componente, muy azul, no es clara aunque podría tratarse de cúmulos ``sueltos" asociados con el sistema de Fornax.

  3. Geoffrey Burbidge : L'art de la critique

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.

    1997-06-01

    Avec pres de cinquante ans de carriere derriere lui, Geoffrey Burbidge n'a rien perdu de son gout du débat et de la controverse. Mondialement reconnu pour ses travaux sur les quasars, il en agace aujourd'hui plus d'un en venant deranger le bel ordonnancement de la cosmologie. Il porte sur le monde scientifique un regard tres critique, condamnant notamment ces chercheurs qui acceptent trop volontiers d'emprunter les chemins tout traces.

  4. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin

    PubMed Central

    2013-01-01

    Background Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. Results By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven “bookmarked” regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Conclusion Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the

  5. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference.

    PubMed

    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin

    2016-01-01

    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice. PMID:27328657

  6. Reproductive success of three passerine species exposed to dioxin-like compounds near Midland, Michigan, USA.

    PubMed

    Fredricks, Timothy B; Zwiernik, Matthew J; Seston, Rita M; Coefield, Sarah J; Glaspie, Cassandra N; Tazelaar, Dustin L; Kay, Denise P; Newsted, John L; Giesy, John P

    2012-05-01

    Nests of three passerine birds, house wren (HOWR), tree swallow (TRES), and eastern bluebird (EABL) were monitored daily (2005-2007) at study areas (SAs) downstream of Midland, Michigan where soil and sediment concentrations of polychlorinated dibenzofurans (PCDFs) were significantly greater than the regional background concentrations and upstream reference areas (RAs). Similarly, TRES research conducted at sites contaminated with dioxin-like compounds indicated that concentrations of polychlorinated dibenzo-p-dioxins and PCDFs, expressed as ΣPCDD/DFs and 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents observed in the diet and eggs of these three species would be predicted to cause significant effects on reproduction. However, site-specific reproductive parameters including hatching success and fledging success at downstream SAs were similar to or greater than those at upstream RAs. Specifically, hatching success was not significantly different among years, species, locations, or between early and late nesting attempts. Of all initiated clutches, 66% (n = 427), 73% (n = 245), and 64% (n = 122) successfully fledged at least one nestling for HOWR, TRES, and EABL, respectively. Overall reproductive performance was similar between SAs and RAs. The reason for these unexpected results is consistent with the fact that there are species-specific and congener-specific differences in sensitivities to the effects of aryl hydrocarbon receptor agonists. PMID:22392542

  7. Identification of thyroid hormone response elements in vivo using mice expressing a tagged thyroid hormone receptor α1

    PubMed Central

    Dudazy-Gralla, Susi; Nordström, Kristina; Hofmann, Peter Josef; Meseh, Dina Abdul; Schomburg, Lutz; Vennström, Björn; Mittag, Jens

    2013-01-01

    TRα1 (thyroid hormone receptor α1) is well recognized for its importance in brain development. However, due to the difficulties in predicting TREs (thyroid hormone response elements) in silico and the lack of suitable antibodies against TRα1 for ChIP (chromatin immunoprecipitation), only a few direct TRα1 target genes have been identified in the brain. Here we demonstrate that mice expressing a TRα1–GFP (green fluorescent protein) fusion protein from the endogenous TRα locus provide a valuable animal model to identify TRα1 target genes. To this end, we analysed DNA–TRα1 interactions in vivo using ChIP with an anti-GFP antibody. We validated our system using established TREs from neurogranin and hairless, and by verifying additional TREs from known TRα1 target genes in brain and heart. Moreover, our model system enabled the identification of novel TRα1 target genes such as RNF166 (ring finger protein 166). Our results demonstrate that transgenic mice expressing a tagged nuclear receptor constitute a feasible approach to study receptor–DNA interactions in vivo, circumventing the need for specific antibodies. Models like the TRα1–GFP mice may thus pave the way for genome-wide mapping of nuclear receptor-binding sites, and advance the identification of novel target genes in vivo. PMID:23398480

  8. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference

    PubMed Central

    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin

    2016-01-01

    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice. PMID:27328657

  9. Genetic differentiation in the Mexican endemic Rufous-backed Robin, Turdus rufopalliatus (Passeriformes: Turdidae).

    PubMed

    Montaño-Rendón, Mauricio; Sánchez-González, Luis A; Hernández-Alonso, Germán; Navarro-Sigüenza, Adolfo G

    2015-01-01

    The Rufous-backed Robin (Turdus rufopalliatus) is endemic to deciduous and semideciduous tropical forests of western Mexico. Of the currently recognized subspecies, T. r. graysoni, from the Tres Marías Islands and nearby coastal Nayarit, has been considered a separate species; however, this treatment has been challenged due to an apparent contact zone on the mainland, although no hybrids have ever been recorded. Here, we use mitochondrial DNA sequences from individuals sampled across the species' range to assess their phylogeographic relationships. We found reciprocal monophyly between Tres Marías Islands and mainland populations, which share no haplotypes between them. Evolutionary divergence detected within T. rufopalliatus suggests that mainland and island populations have been isolated from each other, and divergence decreases if insular populations are excluded. Demographic parameters suggest that populations are in the process of a rapid expansion from ancestral populations with a lower population size. These results are consistent with morphometric and plumage differences that have been used to recognize the Tres Marías Islands populations from the mainland ones, thus suggesting species status of the island form. PMID:26624454

  10. Improvement of the Spatial Amplitude Isotropy of a ^4He Magnetometer Using a Modulated Pumping Beam

    NASA Astrophysics Data System (ADS)

    Chéron, B.; Gilles, H.; Hamel, J.; Moreau, O.; Noël, E.

    1997-08-01

    Optically pumped magnetometers are scalar magnetometers. Contrary to vectoriel magnetometers, they measure the total magnetic field whatever the direction of the sensor. However, for some orientations of the magnetometer with respect to the magnetic field direction, the resonant signal vanishes and the measurement is impossible. In this paper we present a simple solution to reduce the amplitude spatial anisotropy and apply it to a ^4He magnetometer developed in our Laboratory. Les magnétomètres à pompage optique sont des magnétomètres scalaires. Contrairement aux magnétomètres vectoriels, ils mesurent le module du champ magnétique quelle que soit l'orientation du capteur dans l'espace. Cependant, pour certaines orientations du magnétomètre par rapport à la direction du champ à mesurer, l'amplitude du signal de résonance s'annule et la mesure devient impossible. Dans cet article, nous présentons une solution simple pour réduire l'anisotropie spatiale d'amplitude et nous l'appliquons à un magnétomètre à hélium-4 développé dans notre Laboratoire.

  11. Parasite communities of the neotropical cormorant Phalacrocorax brasilianus (Gmelin) (Aves, Phalacrocoracidae) from two coastal lagoons in Guerrero state, Mexico.

    PubMed

    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín; Flores-Garza, Rafael; Larumbe-Morán, Edvino

    2011-11-01

    The parasite community structure of the neotropical cormorant, Phalacrocorax brasilianus, from two lagoons (Coyuca and Tres Palos) from Guerrero state, México, was examined. Fourteen species of adult helminths (6,391 individuals) from 48 cormorants were identified: 9 digeneans, 1 acanthocephalan, 1 cestode, and 3 nematodes. A total of 11 species were collected in Coyuca Lagoon and 12 in Tres Palos Lagoon. Nine species co-occurred in cormorants of both lagoons but, with the exception of Contracaecum multipapillatum and Drepanocephalus olivaceus, species were not equally common in both lagoons. The prevalence values of six species of helminth and the mean abundance of four species varied significantly between lagoons, and C. multipapillatum was numerically dominant in both lagoons. The qualitative similarity between the two communities at the component level was 64%. All cormorants examined were infected, and parasite species richness was 3-5 in Coyuca and 4-9 in Tres Palos lagoon. The results indicate that both communities presented a similar structure at the component level, probably because the cormorants of both lagoons feed on the same species of fish and thus acquire almost the same species of parasites. Differences observed at the infracommunity level were attributed to variations in the degree of dominance of the particular species. PMID:21503640

  12. Supplement to the site observational work plan for the UMTRA Project Site at Ambrosia Lake, New Mexico

    SciTech Connect

    1996-02-01

    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of (1) the average linear velocity of the ground water in the alluvium; (2) the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale; and (3) the fate and transport of contaminants from the uppermost aquifer to the Westwater Canyon Member of the Morrison Formation. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Shale unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. Figure 1 is a geologic cross section depicting the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Table 1 presents hydrogeologic information of each hydrostratigraphic unit.

  13. Supplement to the site observational work plan for the UMTRA project site at Ambrosia Lake, New Mexico

    SciTech Connect

    1995-11-01

    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) (DOE, 1995) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of the average linear velocity of the ground water in the alluvium and a discussion of the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Sahel unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. A geologic cross section depicts the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Hydrogeologic information of each hydrostratigraphic unit is presented.

  14. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B. M.; Pearson, K. A.; Biddle, L. I.; Cates, I. T.; Berube, M.; Thompson, R. M.; Smith, C. W.; Teske, J. K.; Hardegree-Ullman, K. K.; Robertson, A. N.; Crawfod, B. E.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K. L.; Hoglund, S.; Hofmann, R. A.; Jones, C.; Towner, A.; Small, L. C.; Walker-LaFollette, A. M.; Sanford, B.; Griffith, C. C.; Sagan, T.

    2013-10-01

    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  15. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B.; Pearson, K.; Biddle, L. I.; Cates, I.; Berube, M.; Thompson, R.; Smith, C.; Teske, J. K.; Hardegree-Ullman, K.; Robertson, A.; Crawfod, B.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K.; Hoglund, S.; Hofmann, R.; Jones, C.; Towner, A. P.; Small, L.; Walker-LaFollette, A.; Sanford, B.; Sagan, T.

    2014-01-01

    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  16. Phase transitions and reentrant phenomena in liquid crystals having both rigid and flexible intramolecular joints

    NASA Astrophysics Data System (ADS)

    Pyżuk, W.; Górecka, E.; Mieczkowski, J.; Przedmojski, J.

    1992-07-01

    : monocouche et partiellement bicouche. Pour des homologues plus longs dans la série des composés azoxy, on a constaté l'existence d'autres phases smectiques ce qui implique l'apparition, sur les diagrammes des phases, de nouveau points multicritiques, par exemple le point Ad Cd N^re. Sur chaque ligne séparant les phases smectiques A de la phase nématique les transitions sont faiblement du premier ordre ou du deuxième ordre ce qui mène dans certain cas à plus qu'un point tricritique. Sur la ligne A{1} N/A{1} N^re on observe à T_NI/T_AN = 0,834 un simple point tricritique N A{1} — l'apparition des autres dépend du choix des constituants du système binaire. Dans le cas de quatre composés azoxy on a constaté une transition du deuxième ordre entre les phases smectiques partiellement bicouches, Ad et Cd. La transition est accompagnée d'un brusque changement de la chaleur spécifique qui varie linéairement avec la longueur de la queue de la molécule. Pour des homologues suivants de la série des composés azoxy on observe différentes dépendances en température de la distance entre les couches de la phase Ad.

  17. Mixtures of ultracold gases: Fermi sea and Bose-Einstein condensate of lithium isotopes

    NASA Astrophysics Data System (ADS)

    Schreck, F.

    2003-03-01

    régime quantique à très basse température. Le refroidissement est obtenu par évaporation du ^7Li dans un piège magnétique très confinant. Puisque le refroidissement évaporatif d'un gaz de fermion polarisé est impossible, le ^6Li est refroidi sympathiquement par contact thermique avec le ^7Li. Dans une première série d'expériences, les propriétés des gaz quantiques dans les états hyperfins les plus élevés, piégés magnétiquement, sont étudiées. Un gaz de 10^5 fermions a une température de 0,25(5) fois la température de Fermi (T_F) est obtenu. L'instabilité du condensat pour plus de 300 atomes condensés, à cause des interactions attractives, limite la dégénérescence que l'on peut atteindre. Pour s'affranchir de cette limite, une autre série d'expérience est menée dans les états hyperfins bas, piégeable magnétiquement, où les interactions entre bosons sont faiblement répulsives. Les collisions inter-isotopiques permettent alors la thermalisation du mélange. Le mélange d'un condensat de Bose-Einstein (CBE) de ^7Li et d'un mer de Fermi de ^6Li est produit. Le condensat est quasi unidimensionnel et la fraction thermique peut être négligeable. La dégénérescence atteinte correspond à T/T_C=T/T_F=0{,}2(1). La température est mesurée à partir de la fraction thermique des bosons qui disparaît aux plus basses températures, et limite notre précision de mesure. Dans une troisième série d'expérience, les bosons sont transférés dans un piège optique, et placé dans l'état interne |F=1,m_F=1rangle, l'état fondamental pour les bosons. Une résonance de Feshbach est repérée puis exploitée pour former un condensai où les interactions sont ajustables. Quand les interactions effectives entre les atomes sont attractives, on observe la formation d'un soliton brillant de matière. La propagation de ce soliton sans dispersion sur une distance de 1{,}1 mm est observée.

  18. Fluctuations quantiques et instabilites structurales dans les conducteurs a basse dimensionalite

    NASA Astrophysics Data System (ADS)

    Dikande, Alain Moise

    Un engouement particulier s'est manifeste ces dernieres annees pour les systemes electroniques fortement correles, ce en rapport avec l'immense richesse de leurs proprietes physiques. En general, ces proprietes sont induites par la presence d'interactions entre electrons qui, combinees a la structure du reseau moleculaire, donnent parfois lieu a une tres grande variete de phases electroniques et structurales ayant des incidences directes sur les phenomenes de transport dans ces materiaux. Les systemes electroniques couples a un reseau moleculaire et designes systemes electron-phonon font partie de cette classe de materiaux qui ont recemment capte l'attention, en raison notamment de la competition entre plusieurs echelles d'energie dans un environnement caracterise par une forte anisotropie cristalline et une dynamique moleculaire assez importante. En effet, en plus des proprietes electroniques et structurales particulieres la dimensionalite de ces systemes contribue egalement a leur richesse. Ainsi, une tres forte anisotropie structurale peut rehausser de facon considerable l'importance des interactions entre electrons et entre molecules constituant le reseau au point ou la physique du systeme soit regie par de tres fortes fluctuations. Ce dernier contexte est devenu un domaine a part de la physique des systemes fortement correles, a savoir celui des les phenomenes critiques quantiques . Parmi les systemes electron-phonon, on retrouve les composes inorganique KCP et organique TTF-TCNQ decouverts durant les annees 70, et explores en profondeur a cause de leur tendance vers une instabilite du type onde de densite de charge a basse temperature. Ces composes, en general designes systemes de Peierls en reference a l'instabilite de leurs structures electroniques regie par le reseau moleculaire, ont recemment connu un regain d'interet a la lumiere des nouveaux developpements dans les techniques de caracterisation des structures electroniques ainsi que sur le plan de

  19. Validation of a hybrid Doppler ultrasound vessel-based registration algorithm for neurosurgery

    PubMed Central

    Chen, Sean Jy-Shyang; Reinertsen, Ingerid; Coupé, Pierrick; Yan, Charles X B; Mercier, Laurence; Del Maestro, D Rolando; Collins, D Louis

    2012-01-01

    Purpose We describe and validate a novel hybrid non-linear vessel registration algorithm for intraoperative updating of preoperative magnetic resonance (MR) images using Doppler ultrasound (US) images acquired on the dura for the correction of brain-shift and registration inaccuracies. We also introduce an US vessel appearance simulator that generates vessel images similar in appearance to that acquired with US from MR angiography data. Methods Our registration uses the minimum amount of preprocessing to extract vessels from the raw volumetric images. This prevents the removal of important registration information and minimizes the introduction of artifacts that may affect robustness, while reducing the amount of extraneous information in the image to be processed, thus improving the convergence speed of the algorithm. We then completed 3 rounds of validation for our vessel registration method for robustness and accuracy using (i)a large number of synthetic trials generated with our US vessel simulator, (ii)US images acquired from a real physical phantom made from polyvinyl alcohol cryogel (PVAc), and (iii)real clinical data gathered intraoperatively from 3 patients. Results Resulting target registration errors (TRE) of less than 2.5mm are achieved in more than 90% of the synthetic trials when the initial TREs are less than 20mm. TREs of less than 2mm were achieved when the technique was applied to the physical phantom, and TREs of less than 3mm were achieved on clinical data. Conclusions These test trials show that the proposed algorithm is not only accurate but also highly robust to noise and missing vessel segments when working with US images acquired in a wide range of real-world conditions. PMID:22447435

  20. Application of MODIS-ASTER (MASTER) simulator data to geological mapping of young volcanic regions in Baja California, Mexico

    NASA Astrophysics Data System (ADS)

    Dmochowski, Jane Ellen

    Visible, near infrared, short-wave infrared, and thermal infrared multi-channel remote sensing data, MODIS-ASTER (MASTER), are used to extract geologic information from two volcanic regions in Baja California, Mexico: Tres Virgenes-La Reforma Volcanic Region and the volcanic island of Isla San Luis. The visible and near infrared and short-wave infrared data were atmospherically corrected and classified. The resulting classification roughly delineates surfaces that vary in their secondary minerals. Attempts to identify these minerals using ENVI's Spectral Analyst(TM) were moderately successful. The analysis of the thermal infrared data utilizes the shift to longer wavelengths in the Reststrahlen band as the mineralogy changes from felsic to mafic to translate the data into values of weight percent SiO2. The results indicate that the general approach tends to underestimate the weight percent SiO2 in the image. This discrepancy is removed with a "site calibration," which provides good results in the calculated weight percent SiO2 with errors of a few percent. However, errors become larger with rugged topography or low solar angle at the time of image acquisition. Analysis of bathymetric data around Isla San Luis, and consideration of the island's alignment with the Ballenas transform fault zone to the south and volcanic seamounts nearby, suggest Isla San Luis is potentially volcanically active and could be the product of a "leaky" transform fault. The results from the image analysis in the Tres Virgenes-La Reforma Volcanic Region show the La Reforma and El Aguajito volcanic centers to be bimodal in composition and verify the most recent volcanism in the Tres Virgenes region to be basaltic-andesite. The results of fieldwork and image analysis indicate that the volcanic products of the central dome of La Reforma are likely a sequence of welded ash flow tuffs and lavas of varied composition, evidence of its origin as a caldera.

  1. The inflammatory and normal transcriptome of mouse bladder detrusor and mucosa

    PubMed Central

    Saban, Marcia R; Hellmich, Helen L; Turner, Mary; Nguyen, Ngoc-Bich; Vadigepalli, Rajanikanth; Dyer, David W; Hurst, Robert E; Centola, Michael; Saban, Ricardo

    2006-01-01

    Background An organ such as the bladder consists of complex, interacting set of tissues and cells. Inflammation has been implicated in every major disease of the bladder, including cancer, interstitial cystitis, and infection. However, scanty is the information about individual detrusor and urothelium transcriptomes in response to inflammation. Here, we used suppression subtractive hybridizations (SSH) to determine bladder tissue- and disease-specific genes and transcriptional regulatory elements (TRE)s. Unique TREs and genes were assembled into putative networks. Results It was found that the control bladder mucosa presented regulatory elements driving genes such as myosin light chain phosphatase and calponin 1 that influence the smooth muscle phenotype. In the control detrusor network the Pax-3 TRE was significantly over-represented. During development, the Pax-3 transcription factor (TF) maintains progenitor cells in an undifferentiated state whereas, during inflammation, Pax-3 was suppressed and genes involved in neuronal development (synapsin I) were up-regulated. Therefore, during inflammation, an increased maturation of neural progenitor cells in the muscle may underlie detrusor instability. NF-κB was specifically over-represented in the inflamed mucosa regulatory network. When the inflamed detrusor was compared to control, two major pathways were found, one encoding synapsin I, a neuron-specific phosphoprotein, and the other an important apoptotic protein, siva. In response to LPS-induced inflammation, the liver X receptor was over-represented in both mucosa and detrusor regulatory networks confirming a role for this nuclear receptor in LPS-induced gene expression. Conclusion A new approach for understanding bladder muscle-urothelium interaction was developed by assembling SSH, real time PCR, and TRE analysis results into regulatory networks. Interestingly, some of the TREs and their downstream transcripts originally involved in organogenesis and

  2. [Not Available].

    PubMed

    San Mauro Martin, Ismael; Mendive Dubourdieu, Paula; Paredes Barato, Víctor; Garicano Vilar, Elena

    2016-01-01

    Introducción: la tradición de la comida picante desempeña un papel muy importante en el gusto por este tipo de comida y su tolerancia. Las preferencias alimentarias muestran influencia genética y ambiental.Objetivos: estudiar la tolerancia y el gusto por el picante de tres poblaciones, y la influencia hereditaria y del ambiente.Métodos:se realizó una encuesta a 522 sujetos, de tres continentes (Asia, Europa y Latinoamérica) en tres idiomas (español, inglés y chino) a través de Internet. Se realizaron preguntas acerca de la tolerancia al picante, el gusto por los alimentos picantes, su uso, la edad de comienzo de consumo, el gusto del padre y de la madre y si ella lo consumía durante el embarazo y/o lactancia.Resultados: existe diferencia entre el gusto por el picante del hijo y el sexo (p < 0,001), la tolerancia (p < 0,001) y, solo en el sexo femenino, el gusto de la madre por el picante (p < 0,001), su consumo durante el embarazo (p < 0,001) y la lactancia (p = 0,005) y el gusto del padre por el picante (p = 0,003). Existe correlación entre el continente de residencia (p = 0,007) y de nacimiento (p = 0,012) y la tolerancia a los alimentos picantes.Conclusión: la influencia de los progenitores, el género y la composición corporal se relacionaron con gustos y tolerancias diferentes. PMID:27571668

  3. Controlled Vocabulary Service Application for Environmental Data Store

    NASA Astrophysics Data System (ADS)

    Ji, P.; Piasecki, M.; Lovell, R.

    2013-12-01

    In this paper we present a controlled vocabulary service application for Environmental Data Store (EDS). The purpose for such application is to help researchers and investigators to archive, manage, share, search, and retrieve data efficiently in EDS. The Simple Knowledge Organization System (SKOS) is used in the application for the representation of the controlled vocabularies coming from EDS. The controlled vocabularies of EDS are created by collecting, comparing, choosing and merging controlled vocabularies, taxonomies and ontologies widely used and recognized in geoscience/environmental informatics community, such as Environment ontology (EnvO), Semantic Web for Earth and Environmental Terminology (SWEET) ontology, CUAHSI Hydrologic Ontology and ODM Controlled Vocabulary, National Environmental Methods Index (NEMI), National Water Information System (NWIS) codes, EPSG Geodetic Parameter Data Set, WQX domain value etc. TemaTres, an open-source, web -based thesaurus management package is employed and extended to create and manage controlled vocabularies of EDS in the application. TemaTresView and VisualVocabulary that work well with TemaTres, are also integrated in the application to provide tree view and graphical view of the structure of vocabularies. The Open Source Edition of Virtuoso Universal Server is set up to provide a Web interface to make SPARQL queries against controlled vocabularies hosted on the Environmental Data Store. The replicas of some of the key vocabularies commonly used in the community, are also maintained as part of the application, such as General Multilingual Environmental Thesaurus (GEMET), NetCDF Climate and Forecast (CF) Standard Names, etc.. The application has now been deployed as an elementary and experimental prototype that provides management, search and download controlled vocabularies of EDS under SKOS framework.

  4. Les fluctuations supraconductrices dans le compose praseodyme-cerium-oxyde de cuivre

    NASA Astrophysics Data System (ADS)

    Renaud, Jacques

    Ce travail etudie les fluctuations supraconductrices dans le compose supraconducteur a haute temperature critique dope aux electrons Pr2-xCe xCuO4+delta. La technique utilisee pour sonder ces fluctuations est le transport electrique DC dans le plan ab. Il s'agit, a notre connaissance, de la premiere etude de ce type dans la classe generale des supraconducteurs a haute temperature critique dopes aux electrons et, plus particulierement, dans Pr2-xCe xCuO4+delta. De plus, l'etude est effectuee pour trois regimes de dopage, soit sous-dope x = 0.135, dopage optimal x = 0.15 et surdope x = 0.17. Les echantillons etudies sont des couches minces d'epaisseur plus grande que 100 nm crues par ablation laser. Les mesures electriques DC effectuees dans ce travail sont la resistance en reponse lineaire et les courbes IV en reponse non lineaire en fonction de la temperature. La mise en oeuvre experimentale de ces mesures a necessite une grande attention au filtrage et aux effets de chauffage a haut courant. Nous montrons que, sans cette attention, les donnees experimentales sont toujours erronees dans le regime pertinent pour nos echantillons. Les resultats pour le dopage optimal x = 0.15 sont expliques de facon tres convaincante dans le cadre de fluctuations purement 2D. D'abord, le regime des fluctuations gaussiennes est tres bien decrit par le modele d'Aslamazov-Larkin en deux dimensions. Ensuite, le regime de fluctuations critiques, se trouvant a plus basse temperature que le regime gaussien, est tres bien decrit par la physique 2D de Kosterlitz-Thouless. Dans cette analyse, les deux regimes ont des temperatures critiques coherentes entre elles, ce qui semble confirmer ce scenario 2D. Une analyse des donnees dans le cadre de fluctuations 3D est exploree mais donne des conclusions incoherentes. Les resultats pour les autres dopages sont qualitativement equivalents avec le dopage optimal et permettent donc une explication purement 2D. Par contre, contrairement au dopage optimal

  5. Les rivières et les sources de la Plaine du Cul-de-Sac: extrait du rapport sur les eaux souterraines de la Plaine du Cul-de-Sac

    USGS Publications Warehouse

    Taylor, George C., Jr.; Lemoine, Rémy C.

    1949-01-01

    Les principales rivières de la Plaine du Cul-de-Sac, la Rivière Grise ou Grande Rivière du Cul-de-Sac et la Rivière Blanche, prennent naissance sur le flanc Nord du Massif de la Selle à des altitudes de 1,300 à 1,800 mètres au dessus du niveau de la mer. Elles coulent à l’amont à travers des gorges profondes et sont éloignées de 9 Kms. dans la partie central de la bordure Sud de la plaine.

  6. Searches for extra-solar Earths with astro-combs, why and how

    NASA Astrophysics Data System (ADS)

    Li, Chih-Hao

    2011-04-01

    Searches for Earth-like extra-solar planets using the precision radial velocity (PRV) technique requires <10 cm/s accuracy on stellar RVs, which is ˜10 times smaller than the current sensitivity, over several years. Astro-combs, a combination of an octave spanning femtosecond laser and a mode-filtering cavity, provide a promising route to increased accuracy and long-term stability on the astrophysical spectrograph calibration. Here I present several techniques to achieve the required calibration accuracy and our calibration results on the TRES spectrograph for a 1.5-m telescope at the Whipple Observatory.

  7. Cellules solaires photovoltaïques plastiques enjeux et perspectives

    NASA Astrophysics Data System (ADS)

    Sicot, L.; Dumarcher, V.; Raimond, P.; Rosilio, C.; Sentein, C.; Fiorini, C.

    2002-04-01

    Après avoir détaillé le fonctionnement d'une cellule photovoltaïque plastique et les paramètres photovoltaïques permettant de caractéiser son efficacité, un état de l'art des technologies de fabrication des cellules est présenté. Des moyens d'amélioration des performances des cellules photovoltaïques organiques sont ensuite illustrés par l'étude de dispositifs développés au Laboratoire Composants Organiques (LCO) du CEA Saclay.

  8. Una visita en Sud America

    NASA Astrophysics Data System (ADS)

    1982-09-01

    Oisfrute de una estadfa en el Hotel La Silla, el mejor hotel de Sud America con su tan unica atmosfera extraterrestre! Los espera su calificado personal de experimentados hoteleros, jefes de cocina, etc., ansiosos todos de satisfacer sus deseos hasta el mas mfnimo detalle. Naturalmente nuestro espacioso restaurant de tres estrellas ofrece un completo surtido de exquisitas comidas y deliciosos tragos (conocedores usualmente eligen "Oelicia Orion" 0 "Centauro Especial"). EI servicio cempleto durante 24 horas incluye nuestra ya mundialmente famosa "Cena de medianoche para los miradores de estrellas", por eso - no olvide: No pierda la oportunidad de una estadfa en EL HOTEL LA SILLA - una experiencia maravillosa!

  9. Cooperative development of antimicrobials: looking back to look ahead.

    PubMed

    Nathan, Carl

    2015-10-01

    As foundations and governments mobilize to tackle antimicrobial resistance (AMR), several experiments in academic-industrial collaboration have emerged. Here, I examine two historical precedents, the Penicillin Project and the Malaria Project of the Second World War, and two contemporary examples, the Tuberculosis Drug Accelerator programme and the Tres Cantos Open Lab. These and related experiments suggest that different strategies can be effective in managing academic-industrial collaborations, and that such joint projects can prosper in both multisite and single-site forms, depending on the specific challenges and goals of each project. The success of these strategies and the crisis of AMR warrant additional investment in similar projects. PMID:26373373

  10. Polycomb/Trithorax response elements and epigenetic memory of cell identity.

    PubMed

    Ringrose, Leonie; Paro, Renato

    2007-01-01

    Polycomb/Trithorax group response elements (PRE/TREs) are fascinating chromosomal pieces. Just a few hundred base pairs long, these elements can remember and maintain the active or silent transcriptional state of their associated genes for many cell generations, long after the initial determining activators and repressors have disappeared. Recently, substantial progress has been made towards understanding the nuts and bolts of PRE/TRE function at the molecular level and in experimentally mapping PRE/TRE sites across whole genomes. Here we examine the insights, controversies and new questions that have been generated by this recent flood of data. PMID:17185323

  11. Ground-based near-UV observations of 15 transiting exoplanets: constraints on their atmospheres and no evidence for asymmetrical transits

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Pearson, Kyle A.; Biddle, Lauren I.; Smart, Brianna M.; Zellem, Robert T.; Teske, Johanna K.; Hardegree-Ullman, Kevin K.; Griffith, Caitlin C.; Leiter, Robin M.; Cates, Ian T.; Nieberding, Megan N.; Smith, Carter-Thaxton W.; Thompson, Robert M.; Hofmann, Ryan; Berube, Michael P.; Nguyen, Chi H.; Small, Lindsay C.; Guvenen, Blythe C.; Richardson, Logan; McGraw, Allison; Raphael, Brandon; Crawford, Benjamin E.; Robertson, Amy N.; Tombleson, Ryan; Carleton, Timothy M.; Towner, Allison P. M.; Walker-LaFollette, Amanda M.; Hume, Jeffrey R.; Watson, Zachary T.; Jones, Christen K.; Lichtenberger, Matthew J.; Hoglund, Shelby R.; Cook, Kendall L.; Crossen, Cory A.; Jorgensen, Curtis R.; Romine, James M.; Thompson, Alejandro R.; Villegas, Christian F.; Wilson, Ashley A.; Sanford, Brent; Taylor, Joanna M.; Henz, Triana N.

    2016-06-01

    Transits of exoplanets observed in the near-UV have been used to study the scattering properties of their atmospheres and possible star-planet interactions. We observed the primary transits of 15 exoplanets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-16b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-12b, WASP-33b, WASP-36b, WASP-44b, WASP-48b, and WASP-77Ab) in the near-UV and several optical photometric bands to update their planetary parameters, ephemerides, search for a wavelength dependence in their transit depths to constrain their atmospheres, and determine if asymmetries are visible in their light curves. Here, we present the first ground-based near-UV light curves for 12 of the targets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-33b, WASP-36b, WASP-48b, and WASP-77Ab). We find that none of the near-UV transits exhibit any non-spherical asymmetries, this result is consistent with recent theoretical predictions by Ben-Jaffel et al. and Turner et al. The multiwavelength photometry indicates a constant transit depth from near-UV to optical wavelengths in 10 targets (suggestive of clouds), and a varying transit depth with wavelength in 5 targets (hinting at Rayleigh or aerosol scattering in their atmospheres). We also present the first detection of a smaller near-UV transit depth than that measured in the optical in WASP-1b and a possible opacity source that can cause such radius variations is currently unknown. WASP-36b also exhibits a smaller near-UV transit depth at 2.6σ. Further observations are encouraged to confirm the transit depth variations seen in this study.

  12. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    PubMed Central

    Morabia, Alfredo

    2015-01-01

    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico? PMID:25124247

  13. Spatially explicit exposure assessment for small streams in catchments of the orchard growing region `Lake Constance

    NASA Astrophysics Data System (ADS)

    Golla, B.; Bach, M.; Krumpe, J.

    2009-04-01

    drift values in the authorization procedure for plant protection products, pp. 133-141. In Workshop on risk management and risk mitigation measures in the context of authorization of plant protection products [3] Klein, A. W., Dechet, F., and Streloke, M (2003): Probabilistic Assessment Method for Risk Analysis in the framework of Plant Protection Product Authorisation, Industrieverband Agrar (IVA, 2006), Frankfurt/Main [4] Schulz R, Stehle S, Elsaesser F, Matezki S, Müller A, Neumann M, Ohliger R, Wogram J, Zenker K. 2008. Geodata-based Probabilistic Risk Assessment and Management of Pesticides in Germany, a Conceptual Framework. IEAM_2008-032R [5] Kubiak, R., Hommen, Bach, M., Classen, G. Fent, H.-G. Frede, A. Gergs, B. Golla, M. Klein, J. Krumpe, S. Matetzki, A. Müller, M. Neumann,T. G. Preuss, H. T. Ratte, M. Roß-Nickoll, S. Reichenberger, C. Schäfers, T. Strauss, A. Toschki, M. Trapp, J. Wogram (2009): A new GIS based approach for the assessment and management of environmental risks of plant protection, SETAC EUROPE Göteborg [6] Enzian, S. ,Golla., B. (2006) A method for the identification and classification of "save distance" cropland to the potential drift exposure of pesticides towards surface waters. UBA-Texte [7] Bach, M., Träbing, K. and Frede, H.-G. (2004): Morphological Characteristics of small rivers in the context of probabilistic exposure assessment. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 56

  14. Origin of the DUPAL anomaly in mantle xenoliths of Patagonia (Argentina) and geodynamic consequences

    NASA Astrophysics Data System (ADS)

    Mazzucchelli, Maurizio; Cipriani, Anna; Hémond, Christophe; Zanetti, Alberto; Bertotto, Gustavo Walter; Cingolani, Carlos Alberto

    2016-04-01

    The sub-continental lithospheric mantle of South America has been known for some time to carry the DUPAL isotope anomaly as seen in volcanics from the Paraná volcanic province. However, this has not allowed discriminating whether the DUPAL anomaly is a primary feature of the mantle source or acquired during the upwelling and emplacement of the primary magmas. We discovered mantle xenoliths from the Tres Lagos location in Patagonia that carry evidence of percolation by metasomatic melts that imparted the DUPAL isotope anomaly signature. We discuss a model that requires four isotope components (LCC, EM2, HIMU and DM) to account for the Sr, Nd and Pb isotope variability of our samples. We propose that upwelling of hot astenosphere during the Miocene could have triggered the melting of the LCC and EM2 components carrying the DUPAL anomaly, previously entrained in the subcontinental mantle by subduction. These ascending melts would have then metasomatised the local SCLM characterised by DMM and HIMU geochemical affinity generating the hybrid DUPAL-bearing mantle sampled by the Tres Lagos xenoliths.

  15. [In Process Citation].

    PubMed

    Reyna, Nadia; Moreno Rojas, Rafael; Mendoza, Laura; Parra, Karla; Linares, Sergia; Reyna, Eduardo; Cámara Martos, Fernando

    2016-01-01

    Se ha estudiado el índice glicémico, la carga glicémica y el efecto de saciedad producido en adultos jóvenes (12 hombres y 8 mujeres) por el consumo de tres tipos de barritas nutricionales formuladas con proteínas lactoséricas (LS), caseínas (CS) o hidratos de carbono (HC) frente a un control (C). Los valores de glucemia en la sangre a los 30 min fueron significativamente mayores (p < 0,05) para la barra HC (129 ± 8 mg/dl) frente a las barras CS (103 ± 6 mg/dl) y LS (86 ± 8 mg/dl). Asimismo, también se encontraron diferencias estadísticamente significativas (p < 0,05) entre los índices glicémicos de los tres tipos de barras estudiadas (LS = 11,5 ± 3,9; CS = 40,7 ± 6,5; HC = 68,8 ± 13,0). Por otro lado, las barritas nutricionales formuladas con proteínas lácteas (LS y CS) muestran un efecto de saciedad mucho más intenso y prolongado que la formulada con hidratos de carbono (HC), lo que pone de manifiesto el potencial de estas proteínas para ser utilizadas en la formulación de productos para diabéticos y dietéticos. PMID:27238803

  16. Musical structure modulates semantic priming in vocal music.

    PubMed

    Poulin-Charronnat, Bénédicte; Bigand, Emmanuel; Madurell, François; Peereman, Ronald

    2005-01-01

    It has been shown that harmonic structure may influence the processing of phonemes whatever the extent of participants' musical expertise [Bigand, E., Tillmann, B., Poulin, B., D'Adamo, D. A., & Madurell, F. (2001). The effect of harmonic context on phoneme monitoring in vocal music. Cognition, 81, B11-B20]. The present study goes a step further by investigating how musical harmony may potentially interfere with the processing of words in vocal music. Eight-chord sung sentences were presented, their last word being either semantically related (La girafe a un tres grand cou, The giraffe has a very long neck) or unrelated to the previous linguistic context (La girafe a un tres grand pied, The giraffe has a very long foot). The target word was sung on a chord that acted either as a referential tonic chord or as a congruent but less referential subdominant chord. Participants performed a lexical decision task on the target word. A significant interaction was observed between semantic and harmonic relatedness suggesting that music modulates semantic priming in vocal music. Following Jones' dynamic attention theory, we argue that music can modulate semantic priming in vocal music, by modifying the allocation of attentional resource necessary for linguistic computation. PMID:15617668

  17. Helminth communities of two species of piscivorous birds, Ardea alba (Linnaeus) and Nyctanassa violacea (Gmelin) (Ciconiiformes: Ardeidae), in two coastal lagoons from Guerrero state, Mexico.

    PubMed

    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín A; Flores-Rodríguez, Pedro

    2012-07-01

    The composition and species richness in helminth communities of two species of heron, Ardea alba and Nyctanassa violacea, in two coastal lagoons from Guerrero, Mexico were examined. Nineteen species of helminth (7,804 individuals) were identified in 43 adult birds: 15 digeneans, 1 acanthocephalan, 1 cestode, and 2 nematodes. Eight species co-occurred in herons of both species and lagoons. The prevalence values of seven species and the mean abundance of five species varied significantly between species of birds and between lagoons. The heterophyid, Ascocotyle (Phagicola) longa, was the helminth numerically dominant in the helminth community of A. alba in both lagoons, while the cestode, Parvitaenia cochlearii, dominated the community of N. violacea. At the component community level, species richness varied significantly: 10 species in A. alba from Coyuca to 16 in N. violacea (Tres Palos). All of the birds examined were infected with helminth parasites: three to seven species per host in A. alba from Coyuca, and two to eight species in A. alba and N. violacea from Tres Palos. The results indicate that even though species composition was similar between both species of heron, the structure of their communities was not the same. Differences in the feeding behavior of the birds (day/night habits), as well as local differences in the abundance of species of fish, and infection levels of helminths in each lagoon are suggested as being responsible for the variations registered in the structure of the helminth communities. PMID:22314783

  18. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie

    2014-01-01

    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384

  19. Estudio ab initio del mecanismo de la reacción HSO + O3

    NASA Astrophysics Data System (ADS)

    Nebot Gil, I.

    La reacción entre el radical HSO y el ozono ha sido ampliamente estudiada desde el punto de vista experimental debido a la importancia que tiene el radical HSO en la oxidación de los compuestos de azufre reductores y a que puede contribuir a la producción de H2SO4 [1-4]. Se realizaron diversos estudios teóricos sobre la cinética de la reacción entre el radical HSO y el ozono. La reacción del HSO con el ozono presenta tres canales diferentes : HSO + O3 &rightarrow &HSO2 + O2 &rightarrow &HS + 2 O2 &rightarrow &SO + OH + O2 La controversia existente entre los grupos experimentales sobre cuál de las tres vías es la predominante, se ha resuelto mediante un estudio teórico de todas ellas utilizando métodos ab initio. La estructura de todos los reactivos, productos, intermedios y estados de transición ha sido optimizada a nivel ab initio utilizando los métodos UMP2 /6-31G** y QCISD/6-31G**.

  20. A CORRELATION BETWEEN STELLAR ACTIVITY AND HOT JUPITER EMISSION SPECTRA

    SciTech Connect

    Knutson, Heather A.; Howard, Andrew W.; Isaacson, Howard

    2010-09-10

    We present evidence for a correlation between the observed properties of hot Jupiter emission spectra and the activity levels of the host stars measured using Ca II H and K emission lines. We find that planets with dayside emission spectra that are well-described by standard one-dimensional atmosphere models with water in absorption (HD 189733, TrES-1, TrES-3, WASP-4) orbit chromospherically active stars, while planets with emission spectra that are consistent with the presence of a strong high-altitude temperature inversion and water in emission orbit quieter stars. We estimate that active G and K stars have Lyman {alpha} fluxes that are typically a factor of 4-7 times higher than quiet stars with analogous spectral types and propose that the increased UV flux received by planets orbiting active stars destroys the compounds responsible for the formation of the observed temperature inversions. In this paper, we also derive a model-independent method for differentiating between these two atmosphere types using the secondary eclipse depths measured in the 3.6 and 4.5 {mu}m bands on the Spitzer Space Telescope and argue that the observed correlation is independent of the inverted/non-inverted paradigm for classifying hot Jupiter atmospheres.

  1. Múltiples estados de desorden en el etanol sólido

    NASA Astrophysics Data System (ADS)

    Fernández-Perea, R.

    El diagrama de fases del etanol por debajo de los 169 K será presentado. Se mostrará que el etanol puede solidificarse en tres fases con diversos niveles de desorden,(como un vidrio(G), como un vidrio orientacional (OG) y como un cristal de fase rotora (RP)) además de en una fase totalmente cristalina. Las estructuras de estas tres fases serán presentadas tal y como se deducen a partir de diversas medidas de difracción de neutrones al igual que las proporciones de los isómeros de dicho material en las fases desordenadas y se compararán con los resultados de la fase cristalina y del líquido superenfriado. Igualmente diversas medidas sobre su dinámica serán presentadas, tanto de dispersión de neutrones, como de capacidad calorífica y de medidas dieléctricas y comparadas con modelos teóricos y simulaciones para tratar de explicar los procesos de relajación observados y las transiciones entre las diversas fases.

  2. Neogene stratigraphy, foraminifera, diatoms, and depositional history of Maria Madre Island, Mexico: Evidence of early Neogene marine conditions in the southern Gulf of California

    USGS Publications Warehouse

    McCloy, C.; Ingle, J.C.; Barron, J.A.

    1988-01-01

    Foraminifera and diatoms have been analyzed from an upper Miocene through Pleistocene(?) sequence of marine sediments exposed on Maria Madre Island, largest of the Tre??s Marias Islands off the Pacific coast of Mexico. The Neogene stratigraphic sequence exposed on Maria Madre Island includes a mid-Miocene(?) non-marine and/or shallow marine sandstone unconformably overlain by a lower upper Miocene to uppermost Miocene upper to middle bathyal laminated and massive diatomite, mudstone, and siltstone unit. This unit is unconformably overlain by lower Pliocene middle to lower bathyal sandstones and siltstones which, in turn, are unconformably overlain by upper Pliocene through Pleistocene(?) upper bathyal to upper middle bathyal foraminiferal limestones and siltstones. These beds are unconformably capped by Pleistocene terrace deposits. Basement rocks on the island include Cretaceous granite and granodiorite, and Tertiary(?) andesites and rhyolites. The upper Miocene diatomaceous unit contains a low diversity foraminiferal fauna dominated by species of Bolivina indicating low oxygen conditions in the proto-Gulf Maria Madre basin. The diatomaceous unit grades into a mudstone that contains a latest Miocene upper to middle bathyal biofacies characterized by Baggina californica and Uvigerina hootsi along with displaced neritic taxa. An angular unconformity separates the upper Miocene middle bathyal sediments from overlying lower Pliocene siltstones and mudstones that contain a middle to lower bathyal biofacies and abundant planktonic species including Neogloboquadrina acostaensis and Pulleniatina primalis indicating an early Pliocene age. Significantly, this Pliocene unit contains common occurrences of benthic species restricted to Miocene sediments in California including Bulimina uvigerinaformis. Pliocene to Pleistocene(?) foraminiferal limestones and siltstones characterize submarine bank accumulations formed during uplift of the Tre??s Marias Island area, and include

  3. Sensitized luminescence from water-soluble LaF3:Eu nanocrystals via partially-capped 1,10-phenanthroline: time-gated emission and multiple lifetimes.

    PubMed

    Irfanullah, Mir; Bhardwaj, Navneet; Chowdhury, Arindam

    2016-08-01

    Water dispersible citrate-capped LaF3:Eu(5%) nanocrystals (NCs) have been partially surface-functionalized by 1,10-phenanthroline (phen) via a ligand exchange method to produce novel water dispersed citrate/phen-capped LaF3:Eu(5%) NCs in which citrate ligands preserve the water dispersibility of the NCs and phen ligands act as sensitizers of surface Eu(3+)-dopant sites. The partial ligand exchange and the formation of water dispersed NCs have been monitored by (1)H NMR spectroscopy, as well as luminescence measurements at different time intervals during the reaction. These NCs display a distinct phen-sensitized Eu(3+)-emission profile with enhanced intensity in water as compared to the emission profile and intensity obtained upon direct excitation. Time-resolved (or time-gated) emission spectroscopy (TRES) has been used to probe PL dynamics of Eu(3+)-sites of LaF3:Eu(5%) NCs by taking advantage of selectively sensitizing surface Eu(3+)-dopant sites by phen ligands as well as by exciting all the Eu(3+)-sites in the NCs upon direct excitation. TRES upon direct excitation of the citrate-capped LaF3:Eu(5%) NCs reveals that Eu(3+)-dopants occupy at least three different sites, each with a different emission profile and lifetime, and emission from purely interior Eu(3+)-sites has been resolved due to their long lifetime as compared to the lifetime of purely surface and near surface Eu(3+)-sites. In contrast, the phen-sensitized emission from citrate/phen-capped LaF3:Eu(5%) NCs displays similar emission profiles and lifetimes in TRES measurements, which reveal that phen truly sensitizes purely surface dopant sites of the NCs in water, all of which have nearly the same local environment. The phen-sensitized Eu(3+)-emission of the NCs in water remains stable even upon addition of various buffer solutions at physiological pH, as well as upon addition of water-miscible organic solvents. Furthermore, the two-photon excitation (λex. = 720 nm) of these water-soluble phen

  4. Use of IPA to demonstrate loss of forest interior birds from isolated woodlots

    USGS Publications Warehouse

    Robbins, C.S.; Boone, D.D.

    1983-01-01

    'Empleo de indices puntuales de abundancia (IPA) para demostrar la perdida de aves forestales en bosques aislados'. En Maryland, E.U., se seleccionaron bloques boscosos de diferente superficie, divididos en seis clase de tamano (2,8-6 ha, 7-14, 20-30, 34-80, 105-1300, mayores de 4000 ha). En estas ?islas' forestales fue programado un conjunto de muestreos puntuales con estas caracteristicas: 1) Cada punto se visito tres veces. 2) En cada visita se hicieron cuatro censos consecutivos de 5 minutos de duracion, empleando diferentes simbolos para machos cantores, adultos no cantores, aves en vuelo y aves inmaduras. 3) Los conteos se hicieron en tres epocas: final de Mayo, mitad de Junio y final de Junio. 4) Se dividio el tiempo de censo en tres priodos horarios: 5,15-6,30 ; 6,30-8; 8-9,30 hrs. 5) Los puntos se agruparon en co juntos de 4 a 9, considerando que un conjunto es el nlimero que un observador puede cubrir por manana. 6) La vegetacion fue descrita exhaustivamente en cuanto composicion y fisionomla. El principal objetivo que se busca consiste en conocer los requisitos areales de ciertas especies de bosque muy sensibles a la fragmentacion del habitat. Puede observarse (Figura 1) que una serie de migrantes de largo alcance se asientan en relacion con el aumento de la superficie del rodal arbo1ado, sabre todo en macizos de 4.000 o mas hectareas. Sin embargo, las especies sedentarias (Fig. 2) tienen pauta de presencia irregular en funcion del area, forestal, con tendencia a presentarse menos en los bosques mas extensos, Dryocopus pileatus, por excepcion, reacciona negativamente al pequeno tamano de la parcela arbolado, prefiriendo bosques grandes. Parecida respuesta da tambien Sitta carolinensis. Aunque se sabe poco de las exigencias areales de las aves forestales americanas, el metodo de los IPA resulta muy adecuado para esta clase de investigacion de tanto interes en gestion ambiental, posibilitando colectar gran cantidad de datos comparables en un periodo de

  5. Revision curricular a partir de un analisis comparativo de las discrepancias en los curriculos de una escuela de optometria en Puerto Rico con las competencias requeridas para las agencias de revalida y acreditacion 2004

    NASA Astrophysics Data System (ADS)

    Rivera Pacheco, Andres

    El proposito de esta investigacion, un estudio cualitativo de caso, fue comparar y contrastar el curriculo vigente de la Escuela de Optometria de la UIAPR con las competencias y estandares requeridos por las agencias de acreditacion y de revalida. Con este proposito, decidimos realizar una revision y un analisis de documentos: el prontuario de cada uno de los cursos de los curriculos implantados en el 1993 y en el 2001; las competencias y estandares establecidos por las agencias de revalida y de acreditacion; y las estadisticas en las que se analiza el porcentaje de estudiantes que aprueban cada una de las partes de los examenes de revalida entre el 1998 al 2003. Se realizaron entrevistas dirigidas para dar apoyo y complementar la revision y el analisis de estos documentos. Los participantes de las entrevistas fueron tres estudiantes de la clase de optometria del 2004 (ultima clase del curriculo del 1993); tres estudiantes de la clase de optometria del 2005 (primera clase graduanda del curriculo vigente) y tres profesores y/o directores de los Departamentos de Ciencias Basicas, Ciencias Clinicas y Cuidado al Paciente. Esta investigacion se enmarco en el modelo de evaluacion curricular de discrepancia de Malcolm Provus y en el modelo de desarrollo basado en competencias. Uno de los hallazgos mas importantes del estudio es que los cambios que se implantaron al curriculo del 2001 no han logrado que los estudiantes mejoren su ejecucion en los examenes de revalida. Por otro lado, se encontro que el curriculo vigente atiende completamente los estandares de la practica de Optometria, pero no las competencias. Esta informacion fue validada mediante el uso de una tabla de cotejo para el analisis de los cursos y de la informacion obtenida de las entrevistas. El estudio determina y concluye que existen discrepancias entre los prontuarios de los cursos del curriculo y las competencias requeridas por la agencia de revalida. Segundo, que el Departamento de Ciencias Basicas es el

  6. Characterizing the Atmospheres of Super-Earths and Hot-Jupiters with Narrow-Band Photometry

    NASA Astrophysics Data System (ADS)

    Colon, Knicole D.; Gaidos, E.; Wilson, P. A.; Ford, E. B.; Sing, D. K.; Ballester, G. E.; Desert, J.; Ehrenreich, D.; Fortney, J. J.; Lecavelier des Etangs, A.; Lopez-Morales, M.; Morley, C.; Pettitt, A.; Pont, F.; Vidal-Madjar, A.

    2014-01-01

    Nearly one thousand extrasolar planets have been discovered, but none are considered true analogs to solar system planets. Instead, we characterize some planets as “super-Earths” or “hot-Jupiters.” It has been possible to characterize the atmospheres of some of these planets via transit observations, which is a crucial stepping stone towards future studies of true solar system analogs. We present narrow-band photometry of several transiting planets, including the super-Earth GJ 1214b and the hot-Jupiters XO-2b and TrES-2b. For GJ 1214b, most studies find that the transmission spectrum is flat, which favors either a high mean molecular weight or cloudy/hazy hydrogen (H) rich atmosphere model. We observed seven transits of GJ 1214b through a narrow K-band (2.141 micron) filter with the Wide Field Camera on the 3.8 meter United Kingdom Infrared Telescope. We observed another five transits at 800-900 nm using tunable filters with the Optical System for Imaging and low Resolution Integrated Spectroscopy (OSIRIS) on the 10.4 meter Gran Telescopio Canarias (GTC). Our observations support a flat transmission spectrum for GJ 1214b, but we also find that a hydrogen-dominated upper atmosphere cannot be excluded. For hot-Jupiters, potassium has been predicted to be one of the strongest sources of opacity at optical wavelengths and has been previously detected in the atmospheres of XO-2b and TrES-2b. Using OSIRIS on the GTC, we observed three transits of XO-2b and two transits of TrES-2b in multiple bandpasses around the potassium absorption feature at 770 nm. Our technique is somewhat different than in previous studies, and we use our observations to constrain the amount of potassium in these exoplanet atmospheres. We consider how our studies set the stage for future investigations of true Earth and Jupiter analogs that have not yet been discovered.

  7. Release of 50 new, drug-like compounds and their computational target predictions for open source anti-tubercular drug discovery

    PubMed Central

    Rebollo-Lopez, María Jose; Lelièvre, Joël; Alvarez-Gomez, Daniel; Castro-Pichel, Julia; Martínez-Jiménez, Francisco; Papadatos, George; Kumar, Vinod; Colmenarejo, Gonzalo; Mugumbate, Grace; Hurle, Mark; Barroso, Vanessa; Young, Rob J.; Martinez-Hoyos, María; González del Río, Rubén; Bates, Robert H.; Lopez-Roman, Eva Maria; Mendoza-Losana, Alfonso; Brown, James R.; Alvarez-Ruiz, Emilio; Marti-Renom, Marc A.; Overington, John P.; Cammack, Nicholas; Ballell, Lluís; Barros-Aguire, David

    2015-01-01

    As a follow up to the antimycobacterial screening exercise and the release of GSK´s first Tres Cantos Antimycobacterial Set (TCAMS-TB), this paper presents the results of a second antitubercular screening effort of two hundred and fifty thousand compounds recently added to the GSK collection. The compounds were further prioritized based on not only antitubercular potency but also on physicochemical characteristics. The 50 most attractive compounds were then progressed for evaluation in three different predictive computational biology algorithms based on structural similarity or GSK historical biological assay data in order to determine their possible mechanisms of action. This effort has resulted in the identification of novel compounds and their hypothesized targets that will hopefully fuel future TB drug discovery and target validation programs alike. PMID:26642067

  8. Field based analysis of sediment entrainment in two high gradient streams located in Alpine and Andine environments

    NASA Astrophysics Data System (ADS)

    Mao, Luca; Uyttendaele, Geertrui Paula; Iroumé, Andrés; Lenzi, Mario Aristide

    2008-01-01

    This paper presents an analysis of critical thresholds for bedload transport based on field measurements conducted in two small, high gradient streams: the Rio Cordon (Italian Alps) and the Tres Arroyos (Chilean Andes). The threshold of incipient motion was identified by using marked particles displacement and both flood and flow competence approaches. The findings are expressed in terms of Shields parameter, dimensionless discharge, and specific stream power, and are used to identify the effects of relative grain size, relative depth, and bedform resistance. Overall, particle entrainment tends to be size selective, rather than exhibiting equal mobility, and the high values of dimensionless critical shear stress observed at both study sites confirm the additional roughness effects of step-pool morphologies that are very effective in reducing the bed shear stress and causing an apparent increase in critical shear stress.

  9. Vegetation ecological restoration during geothermic exploratory perforation: A case study in Mexico

    SciTech Connect

    Ortega-Rubio, A.; Salinas, F.; Naranjo, A.

    1997-12-31

    At Las Tres Virgenes, B.C.S., Mexico developed the Geothermic exploratory drilling of the area. One of the main recommendations of our Environmental Impact Assessment Study includes transplantation of the plant individuals found in the zones of roads and drilling platforms. In this work we describe the methodologies used to transplant the vegetal individuals found in such zones. We listed the species selected and the survivorship rate obtained for every one of them. From a total of 4,266 transplanted individuals, including many endemic species, a total of 2349 survived. Members of the Agavaceae and Cactaceae families show the maximum survivorship rate, meanwhile the members of the Burseraceae, Euphorbiaceae and Fouqueriaceae families exhibited the minimum survivorship rate (between 12.7% and 20%).

  10. The quest for mammalian Polycomb response elements: are we there yet?

    PubMed

    Bauer, Moritz; Trupke, Johanna; Ringrose, Leonie

    2016-06-01

    A long-standing mystery in the field of Polycomb and Trithorax regulation is how these proteins, which are highly conserved between flies and mammals, can regulate several hundred equally highly conserved target genes, but recognise these targets via cis-regulatory elements that appear to show no conservation in their DNA sequence. These elements, termed Polycomb/Trithorax response elements (PRE/TREs or PREs), are relatively well characterised in flies, but their mammalian counterparts have proved to be extremely difficult to identify. Recent progress in this endeavour has generated a wealth of data and raised several intriguing questions. Here, we ask why and to what extent mammalian PREs are so different to those of the fly. We review recent advances, evaluate current models and identify open questions in the quest for mammalian PREs. PMID:26453572

  11. Banderas Rift Zone: A plausible NW limit of the Jalisco Block

    NASA Astrophysics Data System (ADS)

    Alvarez, Román

    2002-10-01

    Echo soundings recently made in Bahía de Banderas show that this region is a graben with steeply dipping walls and several basins; it is the offshore continuation of the Valle de Banderas graben, and of a branching rift (Río Ameca rift) originating in the Tepic-Zacoalco rift zone. The general trend of the three structures is ENE with some NE trending offsets, and they have a total length of 150 km; this Banderas Rift Zone is proposed as the NW limit of the Jalisco block. The existence of this limit suggests that there is another platelet, or block, between the Jalisco block and a portion of the Rivera plate, probably bounded by the Tres Marías escarpment, the Jalisco block and the North America plate.

  12. TeV blazars as seen by the CAT telescope

    NASA Astrophysics Data System (ADS)

    Piron, Frederic; CAT Collaboration

    2001-05-01

    Les blazars de type Lacertide sont des noyaux actifs de galaxies possedant un jet relativiste de matiere dirige vers la Terre. L'emis- sion de ce jet, amplifiee par effet Doppler, domine celle de l'objet central sur un large domaine en energie, avec des variations parfois tres courtes dans le repere de l'observateur. Les resultats d'observation par C.A.T. de Lacertides extremes seront presentes. L'etude de leur emission au TeV, et de sa corre- lation avec celle observee dans le domaine des rayons X, permet de sonder les mecanismes d'acceleration a l'oeuvre dans les jets, dans l'environnement proche du trou noir central.

  13. Novel 2-Phenoxyanilide Congeners Derived from a Hit Structure of the TCAMS: Synthesis and Evaluation of Their in Vitro Activity against Plasmodium falciparum.

    PubMed

    Weidner, Thomas; Nasereddin, Abed; Preu, Lutz; Grünefeld, Johann; Dzikowski, Ron; Kunick, Conrad

    2016-01-01

    The Tres Cantos Antimalarial Compound Set (TCAMS) is a publicly available compound library which contains 13533 hit structures with confirmed activity against Plasmodium falciparum, the infective agent responsible for malaria tropica. The TCAMS provides a variety of starting points for the investigation of new antiplasmodial drug leads. One of the promising compounds is TCMDC-137332, which seemed to be a good starting point due to its antiplasmodial potency and its predicted physicochemical properties. Several new analogues based on a 2-phenoxyanilide scaffold were synthesized by standard amide coupling reactions and were fully characterized regarding their identity and purity by spectroscopic and chromatographic methods. Furthermore, the results of the biological evaluation of all congeners against Plasmodium falciparum NF54 strains are presented. The findings of our in vitro screening could not confirm the presumed nanomolar antiplasmodial activity of TCMDC-137332 and its derivatives. PMID:26901174

  14. Formación estelar en NGC 6357: viendo a través del polvo con Gemini

    NASA Astrophysics Data System (ADS)

    Bosch, G.; Morrell, N.; Barbá, R.

    Presentamos aquí los primeros resultados de fotometría JHKs obtenidos con Flamingos I en el telescopio Gemini Sur. El mosaico comprendido por tres posiciones adyacentes tomadas a lo largo de varios semestres nos permite caracterizar la población estelar en la zona que presenta una interacción más importante entre las estrellas masivas y la nube molecular que les dió origen. Los diagramas color-magnitud nos permiten identificar numerosas fuentes con exceso infrarrojo, la mayoría de ellas imposible de detectarse en el rango óptico debido a la fuerte absorción del polvo presente en la región. Es altamente probable que la mayoría de estas fuentes con exceso sean protoestrellas, aunque es necesario realizar espectroscopía infrarroja de las mismas para confirmar su naturaleza.

  15. Astro-comb calibration of an Echelle Spectrograph

    NASA Astrophysics Data System (ADS)

    Li, C.-H.; Phillips, D. F.; Glenday, A. G.; Benedick, A. J.; Chang, G.; Chen, L.-J.; Cramer, C.; Furesz, G.; Kärtner, F. X.; Sasselov, D.; Szentgyorgyi, A.; Walsworth, R. L.

    2010-07-01

    We describe recent work calibrating a cross-dispersed spectrograph with an "astro-comb" i.e., a high repetition rate, octave spanning femtosecond laser frequency comb; and a filter cavity suppressing laser modes to match the resolution of the spectrograph. Our astro-comb provides ~1500 evenly spaced (~0.6 A) calibration lines of roughly 100 nW per line between 7800 and 8800 Angstroms. The calibration lines of the laser are stabilized to atomic clocks which can be referenced to GPS providing intrinsic stability of the source laser below 1 cm/s in stellar radial velocity sensitivity, as well as long term stability and reproducibility over years. We present calibration of the TRES spectrograph at the 1.5 m telescope at the Fred L Whipple Observatory below 1 m/s radial velocity sensitivity in six orders from 7800-8800 A.

  16. Statistique des photons d'un laser à 4 niveaux soumis à un pompage optique

    NASA Astrophysics Data System (ADS)

    Chusseau, L.; Arnaud, J.; Philippe, F.

    2002-06-01

    Les lasers conventionnels à 4 niveaux peuvent délivrer de la lumière de statistique sous-Poissonienne même lorsqu'ils sont soumis à un pompage optique. Nous retrouvons exactement ces prédictions de l'optique quantique en supposant simplement que les atomes ont des niveaux d'énergie quantifiés interagissant avec un champ électromagnétique classique, la source du bruit optique étant les sauts quantiques entre niveaux. Des formules analytiques sont obtenues pour les deux paramètres clefs de la statistique des photons du laser: le facteur de Fano et la densité spectrale des photons émis.

  17. Vers une méthode de réglage expérimentale des commandes PID floues : application aux systèmes électromécaniques

    NASA Astrophysics Data System (ADS)

    Maussion, P.; Hissel, D.

    1998-08-01

    Electrical and electromechanical systems have to satisfy to more and more constrained specifications. Therefore, non-linear control structures must be spread out. Among them, fuzzy logic control can be one interessant and performant alternative. The main handicap of this kind of stucture resides in the fact that the tuning parameters are very numerous. In this paper, we first propose an on-site tuning strategy of this set of parameters in the case of a fuzzy proportionnal-integrative controller based on the experimental designs methodology and on a limited number of pre-defined closed-loop experiments. Then, a complete set of predetermined parameters for a fuzzy proportionnal-integrative-derivative controller will be given. These parameters have been optimized on a specified benchmark according to an IAE criterion. They are calculated like the Ziegler-Nichols or Broïda methodology on conventional controllers; that is, using a single open-loop step response to obtain a model of a first-order plus delay transfert function. Validity limits for this method are provided. Les systèmes électriques ou électromécaniques doivent satisfaire à des spécifications de plus en plus contraignantes qui nécessitent la mise au point de structures de commande non linéaires. Parmi celles-ci, la commande par logique floue constitue une alternative intéressante et performante. Son principal handicap réside dans le nombre très important de paramètres à régler. Dans cet article, nous nous proposons de systématiser ces réglages dans deux cas de figure. Tout d'abord nous utiliserons la méthodologie des plans d'expérimentations pour effectuer un réglage sur site d'un contrôleur flou de type proportionnel-intégral. Ce réglage sera obtenu en ne réalisant qu'un nombre limité d'essais expérimentaux en boucle fermée avec des combinaisons prédéfinies des paramètres à régler. La combinaison optimale de ces paramètres au sens d'un critère de type IAE (Intégrale de la

  18. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica

    SciTech Connect

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, T. B. K.; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed; Baeshen, Nabih; Kyrpides, Nikos; Reeve, Wayne

    2015-06-14

    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project proposal.

  19. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica

    DOE PAGESBeta

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, T. B. K.; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed; Baeshen, Nabih; et al

    2015-06-14

    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Rootmore » Nodule Bacteria (GEBA-RNB) project proposal.« less

  20. Effet de la substitution du cuivre par du lithium sur les proprietes de l'oxyde spinelle lithium(x)cuivre(y-x)cobalt(3-y)oxygen(4) etudie pour l'electrocatalyse de la reaction de degagement de l'oxygene en milieu alcalin

    NASA Astrophysics Data System (ADS)

    Fatih, Khalid

    L'electrolyse de l'eau demeure la seule technologie industrielle de generation de l'hydrogene et de l'oxygene tres purs sans rejet de CO2 dans l'atmosphere, ce qui le rend tres attrayant par rapport a la combustion de carburants fossiles qui provoque presentement de serieux problemes environnementaux. Dans le but d'ameliorer le rendement de ce procede, nous avons developpe de nouveaux materiaux d'anode peu couteux, a base de l'oxyde mixte CuyCo3-yO 4, qui possedent une cinetique rapide pour la reaction de degagement de l'oxygene (RDO). Cette reaction suscite un interet particulier en raison de la surtension d'activation relativement elevee a l'anode qui cause la principale perte de rendement du procede. Une etude systematique a ete effectuee sur la substitution du Cu par du Li (0 a 40%), afin d'elucider les proprietes electrocatalytiques des oxydes LixCuy-xCo3-yO4. Ces oxydes, prepares sous forme de poudres par decomposition thermique des nitrates precurseurs entre 300 et 500°C, ont montre (DRX et FTIR) une structure spinelle inverse non-stcechiometrique avec une diminution du volume de la maille cristalline. La surface specifique par BET est d'environ 6 m2 g-1. Le pcn, obtenu par titrage acido-basique, a indique une diminution de la force du lien M-OH avec le taux du Li dans l'oxyde. Les analyses par XPS, realisees sur des films d'oxyde prepares par nebulisation reactive sur un substrat lisse de nickel, revelent un enrichissement de la surface en Cu a partir de 30% Li, et la presence des cations de surface Co2+, Co3+, Cu +, Cu2+ et Cu3+. La concentration de ce dernier montre un maximum a 10 et 20% Li. Suite a la substitution du Cu par du Li, la compensation de la charge serait assuree principalement par la formation d'especes Cu3+ pour les oxydes contenant jusqu'a 20% Li, et par la formation d'especes Co3+ aux taux de substitution superieurs. Les micrographies MEB montrent une morphologie hemispherique des particules d'oxyde reparties uniformement sur le substrat

  1. Use of LANDSAT images to study cerrado vegetation. [Mato Grosso Sul, Brazil

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Filho, P. H.

    1982-01-01

    Channel 5 and 7 LANDSAT imagery at the scale of 1:250,000 made during passes in the dry and rainy seasons were used to select the optimal season for cerrado characterization in Mato Grosso do Sul State. The study area is located around the cities of Campo Grande and Tres Lagoas, a region being used for reforestation and rangeland activities. Imagery acquired during the dry season permitted a good discrimination between "cerrado" (woodsy pasture) vegetation and reforestation. In relation to the altered areas, only the recently modified area presented good discrimination of cerrado vegetation. Imagery of the rainy season did not provide a reasonable separation between cerrado and reforestation areas but the altered area could be easily discriminated.

  2. Evaluation of aminohydantoins as a novel class of antimalarial agents.

    PubMed

    Meyers, Marvin J; Tortorella, Micky D; Xu, Jing; Qin, Limei; He, Zhengxiang; Lang, Xingfen; Zeng, Wentian; Xu, Wanwan; Qin, Li; Prinsen, Michael J; Sverdrup, Francis M; Eickhoff, Christopher S; Griggs, David W; Oliva, Jonathan; Ruminski, Peter G; Jacobsen, E Jon; Campbell, Mary A; Wood, David C; Goldberg, Daniel E; Liu, Xiaorong; Lu, Yongzhi; Lu, Xin; Tu, Zhengchao; Lu, Xiaoyun; Ding, Ke; Chen, Xiaoping

    2014-01-01

    Given the threat of drug resistance, there is an acute need for new classes of antimalarial agents that act via a unique mechanism of action relative to currently used drugs. We have identified a set of druglike compounds within the Tres Cantos Anti-Malarial Set (TCAMS) which likely act via inhibition of a Plasmodium aspartic protease. Structure-activity relationship analysis and optimization of these aminohydantoins demonstrate that these compounds are potent nanomolar inhibitors of the Plasmodium aspartic proteases PM-II and PM-IV and likely one or more other Plasmodium aspartic proteases. Incorporation of a bulky group, such as a cyclohexyl group, on the aminohydantion N-3 position gives enhanced antimalarial potency while reducing inhibition of human aspartic proteases such as BACE. We have identified compound 8p (CWHM-117) as a promising lead for optimization as an antimalarial drug with a low molecular weight, modest lipophilicity, oral bioavailability, and in vivo antimalarial activity in mice. PMID:24900778

  3. Sistema Planeta-Satélite. Simulación orbital y potenciales gravitatorios

    NASA Astrophysics Data System (ADS)

    Medina, C.; Carrillo, M.

    Se presenta un programa (desarrollado en Quick Basic 4.5) que simula, en tres dimensiones, el movimiento orbital de un satélite (o luna) alrededor de un planeta, al tiempo que calcula y grafica, en un plano, el potencial gravitatorio del sistema en función de la distancia al planeta. Para la simulación orbital, se emplea la matriz de transformación entre el sistema del planeta y el plano orbital. Para el cálculo y graficación del potencial se aplica un desarrollo en serie hasta el segundo orden, que da cuenta del efecto de achatamiento de los polos, en caso de que éste exista. Las longitudes de los ejes del planeta, la masa de éste y del satélite, sus tamaños aparentes, y los parámetros orbitales son introducidos por el usuario.

  4. Tiempo para un cambio

    NASA Astrophysics Data System (ADS)

    Woltjer, L.

    1987-06-01

    En la reunion celebrada en diciembre dei ano pasado informe al Consejo de mi deseo de terminar mi contrato como Director General de la ESO una vez que fuera aprobado el proyecto dei VLT, que se espera sucedera hacia fines de este aAo. Cuando fue renovada mi designacion hace tres aAos, el Consejo conocia mi intencion de no completar los cinco aAos dei contrato debido a mi deseo de disponer de mas tiempo para otras actividades. Ahora, una vez terminada la fase preparatoria para el VLT, Y habiendose presentado el proyecto formalmente al Consejo el dia 31 de marzo, y esperando su muy probable aprobacion antes dei termino de este ano, me parece que el 10 de enero de 1988 presenta una excelente fecha para que se produzca un cambio en la administracion de la ESO.

  5. INFLATING HOT JUPITERS WITH OHMIC DISSIPATION

    SciTech Connect

    Batygin, Konstantin; Stevenson, David J.

    2010-05-10

    We present a new, magnetohydrodynamic mechanism for inflation of close-in giant extrasolar planets. The idea behind the mechanism is that current, which is induced through interaction of atmospheric winds and the planetary magnetic field, results in significant Ohmic dissipation of energy in the interior. We develop an analytical model for computation of interior Ohmic dissipation, with a simplified treatment of the atmosphere. We apply our model to HD209458b, Tres-4b, and HD189733b. With conservative assumptions for wind speed and field strength, our model predicts a generated power that appears to be large enough to maintain the transit radii, opening an unexplored avenue toward solving a decade-old puzzle of extrasolar gas giant radius anomalies.

  6. Nuevos fenómenos en erupciones cometarias

    NASA Astrophysics Data System (ADS)

    Silva, A.

    Se discuten aquí tres procesos físicos novedosos encontrados en la actividad de cometas: 1) El rol de una distribución de granos de hielo como fuente extendida de H2O en la coma, 2) El efecto de una discontinuidad en el plasma cometario, llamada Cometopausa, sobre la excitación del radical OH , y 3) La actividad por erupciones a grandes distancias heliocéntricas (r > 5 AU). Con respecto a 1) y 2), se presentan modelos que ajustan bien con las observaciones. En cuanto a 3), se presentan explicaciones posibles al fenómeno, y se trata el interesante caso de Chirón 2060, basándose en observaciones propias tomadas desde el CASLEO y datos anteriores.

  7. Initial Results from the 2002 Gulf of California Conjugate Margin Seismic Experiment

    NASA Astrophysics Data System (ADS)

    Holbrook, S.; Lizarralde, D.; Kent, G.; Harding, A.; Fletcher, J.; Gonzalez-Fernandez, A.; Umhoefer, P.; Axen, G.

    2003-04-01

    The Gulf of California, which marks the ongoing separation of Baja California from mainland Mexico, is one of the few locales where active continental breakup can be studied along unambiguous flow lines that join clear conjugate margin pairs. In Fall 2002, we conducted an onshore-offshore seismic experiment across the conjugate rifted margins of the Gulf of California in several rift segments. The joint U.S.-Mexico project, sponsored principally by the MARGINS program of the U.S. National Science Foundation, aimed to image crustal structure across conjugate margins of four major basins to determine the modes of extension and the influence of sedimentation and magmatism on breakup. Here we present an overview of the experiment, which was substantially altered at sea due to concerns for marine-mammal safety, and present some preliminary findings. Three flow-line transects were acquired, in the Alarcon Basin, the Guaymas Basin, and between Cabo and Tres Marias Islands. In addition, a fourth transect across the Baja Peninsula was acquired. Data acquired included (1) multichannel seismic reflection data using the R/V Ewing’s 20-gun array and 480-channel, 6-km-long streamer, (2) wide-angle reflection/refraction data recorded on ocean-bottom seismometers, from 206 deployments conducted by the R/V New Horizon, and (3) onshore-offshore data recorded on portable seismometers deployed up to 100 km inland on all transects. Initial results from the experiment include (1) clear evidence for asymmetric basement structure on the conjugate rifted margins and across the active mid-ocean spreading center, of the Guaymas Basin, (2) the suggestion of substantial magmatism in an early failed rift of the Alarcon Basin, and (3) active subduction beneath the margin at the Tres Marias islands. In addition, we will discuss new procedures for mitigating effects on marine mammals that may have a significant impact on future U.S.-sponsored seismic reflection activities.

  8. Improved Glycemic Control and Vascular Function in Overweight and Obese Subjects by Glyoxalase 1 Inducer Formulation.

    PubMed

    Xue, Mingzhan; Weickert, Martin O; Qureshi, Sheharyar; Kandala, Ngianga-Bakwin; Anwar, Attia; Waldron, Molly; Shafie, Alaa; Messenger, David; Fowler, Mark; Jenkins, Gail; Rabbani, Naila; Thornalley, Paul J

    2016-08-01

    Risk of insulin resistance, impaired glycemic control, and cardiovascular disease is excessive in overweight and obese populations. We hypothesized that increasing expression of glyoxalase 1 (Glo1)-an enzyme that catalyzes the metabolism of reactive metabolite and glycating agent methylglyoxal-may improve metabolic and vascular health. Dietary bioactive compounds were screened for Glo1 inducer activity in a functional reporter assay, hits were confirmed in cell culture, and an optimized Glo1 inducer formulation was evaluated in a randomized, placebo-controlled crossover clinical trial in 29 overweight and obese subjects. We found trans-resveratrol (tRES) and hesperetin (HESP), at concentrations achieved clinically, synergized to increase Glo1 expression. In highly overweight subjects (BMI >27.5 kg/m(2)), tRES-HESP coformulation increased expression and activity of Glo1 (27%, P < 0.05) and decreased plasma methylglyoxal (-37%, P < 0.05) and total body methylglyoxal-protein glycation (-14%, P < 0.01). It decreased fasting and postprandial plasma glucose (-5%, P < 0.01, and -8%, P < 0.03, respectively), increased oral glucose insulin sensitivity index (42 mL ⋅ min(-1) ⋅ m(-2), P < 0.02), and improved arterial dilatation Δbrachial artery flow-mediated dilatation/Δdilation response to glyceryl nitrate (95% CI 0.13-2.11). In all subjects, it decreased vascular inflammation marker soluble intercellular adhesion molecule-1 (-10%, P < 0.01). In previous clinical evaluations, tRES and HESP individually were ineffective. tRES-HESP coformulation could be a suitable treatment for improved metabolic and vascular health in overweight and obese populations. PMID:27207552

  9. Thyroid Hormone Response Element Half-Site Organization and Its Effect on Thyroid Hormone Mediated Transcription

    PubMed Central

    Paquette, Martin A.; Atlas, Ella; Wade, Mike G.; Yauk, Carole L.

    2014-01-01

    Thyroid hormone (TH) exerts its effects by binding to the thyroid hormone receptor (TR), which binds to TH response elements (TREs) to regulate target gene expression. We investigated the relative ability of liganded homodimers TR and retinoid X receptor (RXR), and the heterodimer TR/RXR, to regulate gene expression for the TRE half-site organizations: direct repeat 4 (DR4), inverted repeat 0 (IR0) and everted repeat 6 (ER6). Luciferase reporter assays using a DR4 TRE suggest that both the TR homodimer and TR/RXR heterodimer regulate luciferase expression in the presence of their respective ligands. However, in the presence of the IR0 TRE, transfection with TR/RXR and RXR alone increased luciferase activity and there was no effect of TR alone. The presence of 9-cis-retinoic acid was necessary for luciferase expression, whereas TH treatment alone was insufficient. For the ER6 TRE, transfection with TR/RXR, TR alone and RXR alone (in the presence of their respective ligands) all caused a significant increase in luciferase activity. When both ligands were present, transfection with both TR/RXR caused more activation. Finally, we investigated the efficacy of the TR-antagonist 1–850 in inhibiting transcription by TR or TR/RXR at DR4 and ER6 TREs. We found that 1–850 did not suppress luciferase activation in the presence of TR/RXR for the ER6 TRE, suggesting conformational changes of the ligand binding domain of the TR when bound to different TRE half-site organizations. Collectively, the findings indicate that there are fundamental differences between TRE configurations that affect nuclear receptor interactions with the response element and ability to bind ligands and antagonists. PMID:24971931

  10. Young Nearby Suns and Stellar Jitter Dependence on Age

    NASA Astrophysics Data System (ADS)

    Cabrera, Nicole; White, Russel; Delfosse, Xavier; Noah Quinn, Samuel; Latham, David W.

    2015-01-01

    Finding the nearest young planets offers the most direct way to improve our understanding of how planets form, how they migrate, and how they evolve. However, most radial velocity (RV) surveys have avoided young stars because of their problematic characteristics, including high levels of stellar activity. Recent advancements in infrared (IR) detectors as well as wavelength calibration methods have provided new ways of pursuing high-precision RV measurements of young stars. While this work has been successfully applied to many young late-K and M dwarfs, much less RV work has been done on young Sun-like stars, with the very recent exception of adolescent stars (~600 Myr) in open clusters. In order to better understand the dynamical and structural forces that shaped our own Solar system, we must begin to explore the more massive realm of Sun-like stars.We present precision optical radial velocity data of 5 young, nearby, Sun-like stars in AB Dor and assess our ability to detect young planets with current spectroscopic methods. The data were obtained with the TRES spectrograph on the 1.5-m Tillinghast Reflector at the Fred L. Whipple Observatory and with SOPHIE on the 1.95 m Telescope at the Observatoire de Haute Provence. We obtained a RV precision of ~8 m/s with TRES and ~7 m/s precision with SOPHIE; average observed dispersions are 38 m/s and 33 m/s, respectively. We combine our results with spectroscopic data of Sun-like stars spanning a broad range of youthful ages (< 1 Gyr) from the literature to investigate the relationship between stellar jitter and stellar age. The results suggest that the jitter of Sun-like stars decreases below 100 m/s for stars older than ~30 Myr, which would enable the discovery of hot Jupiters orbiting these adolescent age stars.

  11. Molecular detection of Rangelia vitalii in domestic dogs from Uruguay.

    PubMed

    Soares, João Fabio; Carvalho, Luis; Maya, Leticia; Dutra, Fernando; Venzal, José Manuel; Labruna, Marcelo B

    2015-05-30

    The piroplasm Rangelia vitalii is the etiological agent of canine rangeliosis, a severe disease affecting domestic dogs in South America. Two domestic dogs from two different Departments (Salto and Treinta y Tres) of Uruguay presented with clinical signs such as apathy, anorexia, pale mucous membranes, jaundice, and hemorrhagic manifestations, suggestive of a canine vector-borne disease. Molecular analysis, based on PCR and DNA sequencing of portions of the 18S rRNA gene, revealed that both dogs were infected by R. vitalii. Two consensus sequences, one from Salto and one from Treinta y Tres, differed from each other by only 1 nucleotide (99.8% similarity) and were 99.8-100% identical to corresponding sequences of R. vitalii from Brazil and Argentina available in GenBank. Through phylogenetic analysis inferred by the 18S rRNA gene, the two Uruguayan sequences of R. vitalii were aligned with the corresponding sequences from 7 other R. vitalii sequences available in GenBank (5 from Brazil and, 2 from Argentina) under high bootstrap support. The two dogs of the present study were negative for Ehrlichia canis according to the E. canis-specific real-time PCR assay. Our findings not only confirm the occurrence of R. vitalii in Uruguay but also provide the southernmost record of this re-emerging agent. The only previous report of R. vitalii in Uruguay dated from 1976, a period when molecular analyses were not available. We provide the first molecular detection of R. vitalii in Uruguay. Currently, canine rangeliosis is confirmed to occur in Brazil, Argentina, and Uruguay. PMID:25843009

  12. BEER Analysis of Kepler and CoRoT Light Curves. II. Evidence for Superrotation in the Phase Curves of Three Kepler Hot Jupiters

    NASA Astrophysics Data System (ADS)

    Faigler, S.; Mazeh, T.

    2015-02-01

    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  13. Differential Roles of C-terminal Eps15 Homology Domain Proteins as Vesiculators and Tubulators of Recycling Endosomes*

    PubMed Central

    Cai, Bishuang; Giridharan, Sai Srinivas Panapakkam; Zhang, Jing; Saxena, Sugandha; Bahl, Kriti; Schmidt, John A.; Sorgen, Paul L.; Guo, Wei; Naslavsky, Naava; Caplan, Steve

    2013-01-01

    Endocytic recycling involves the return of membranes and receptors to the plasma membrane following their internalization into the cell. Recycling generally occurs from a series of vesicular and tubular membranes localized to the perinuclear region, collectively known as the endocytic recycling compartment. Within this compartment, receptors are sorted into tubular extensions that later undergo vesiculation, allowing transport vesicles to move along microtubules and return to the cell surface where they ultimately undergo fusion with the plasma membrane. Recent studies have led to the hypothesis that the C-terminal Eps15 homology domain (EHD) ATPase proteins are involved in the vesiculation process. Here, we address the functional roles of the four EHD proteins. We developed a novel semipermeabilized cell system in which addition of purified EHD proteins to reconstitute vesiculation allows us to assess the ability of each protein to vesiculate MICAL-L1-decorated tubular recycling endosomes (TREs). Using this assay, we show that EHD1 vesiculates membranes, consistent with enhanced TRE generation observed upon EHD1 depletion. EHD4 serves a role similar to that of EHD1 in TRE vesiculation, whereas EHD2, despite being capable of vesiculating TREs in the semipermeabilized cells, fails to do so in vivo. Surprisingly, the addition of EHD3 causes tubulation of endocytic membranes in our semipermeabilized cell system, consistent with the lack of tubulation observed upon EHD3 depletion. Our novel vesiculation assay and in vitro electron microscopy analysis, combined with in vivo data, provide evidence that the functions of both EHD1 and EHD4 are primarily in TRE membrane vesiculation, whereas EHD3 is a membrane-tubulating protein. PMID:24019528

  14. OPTICAL PHASE CURVES OF KEPLER EXOPLANETS

    SciTech Connect

    Esteves, Lisa J.; De Mooij, Ernst J. W.; Jayawardhana, Ray E-mail: demooij@astro.utoronto.ca

    2013-07-20

    We conducted a comprehensive search for optical phase variations of all close-in (a/R{sub *} < 10) planet candidates in 15 quarters of Kepler space telescope data. After correcting for systematics, we found eight systems that show secondary eclipses as well as phase variations. Of these, five (Kepler-5, Kepler-6, Kepler-8, KOI-64, and KOI-2133) are new and three (TrES-2, HAT-P-7, and KOI-13) have published phase curves, albeit with many fewer observations. We model the full phase curve of each planet candidate, including the primary and secondary transits, and derive their albedos, dayside and nightside temperatures, ellipsoidal variations, and Doppler beaming. We find that KOI-64 and KOI-2133 have nightside temperatures well above their equilibrium values (while KOI-2133 also has an albedo, >1), so we conclude that they are likely to be self-luminous objects rather than planets. The other six candidates have characteristics consistent with their being planets with low geometric albedos (<0.3). For TrES-2 and KOI-13, the Kepler bandpass appears to probe atmospheric layers hotter than the planet's equilibrium temperature. For KOI-13, we detect a never-before-seen third cosine harmonic with an amplitude of 6.7 {+-} 0.3 ppm and a phase shift of -1.1 {+-} 0.1 rad in the phase curve residual, possibly due to its spin-orbit misalignment. We report derived planetary parameters for all six planets, including masses from ellipsoidal variations and Doppler beaming, and compare our results to published values when available. Our results nearly double the number of Kepler exoplanets with measured phase curve variations, thus providing valuable constraints on the properties of hot Jupiters.

  15. Inferring heat recirculation and albedo for exoplanetary atmospheres: Comparing optical phase curves and secondary eclipse data

    NASA Astrophysics Data System (ADS)

    von Paris, P.; Gratier, P.; Bordé, P.; Selsis, F.

    2016-03-01

    Context. Basic atmospheric properties, such as albedo and heat redistribution between day- and nightsides, have been inferred for a number of planets using observations of secondary eclipses and thermal phase curves. Optical phase curves have not yet been used to constrain these atmospheric properties consistently. Aims: We model previously published phase curves of CoRoT-1b, TrES-2b, and HAT-P-7b, and infer albedos and recirculation efficiencies. These are then compared to previous estimates based on secondary eclipse data. Methods: We use a physically consistent model to construct optical phase curves. This model takes Lambertian reflection, thermal emission, ellipsoidal variations, and Doppler boosting, into account. Results: CoRoT-1b shows a non-negligible scattering albedo (0.11 < AS < 0.3 at 95% confidence) as well as small day-night temperature contrasts, which are indicative of moderate to high re-distribution of energy between dayside and nightside. These values are contrary to previous secondary eclipse and phase curve analyses. In the case of HAT-P-7b, model results suggest a relatively high scattering albedo (AS ≈ 0.3). This confirms previous phase curve analysis; however, it is in slight contradiction to values inferred from secondary eclipse data. For TrES-2b, both approaches yield very similar estimates of albedo and heat recirculation. Discrepancies between recirculation and albedo values as inferred from secondary eclipse and optical phase curve analyses might be interpreted as a hint that optical and IR observations probe different atmospheric layers, hence temperatures.

  16. Optimized time-resolved imaging of contrast kinetics (TRICKS) in dynamic contrast-enhanced MRI after peptide receptor radionuclide therapy in small animal tumor models.

    PubMed

    Haeck, Joost; Bol, Karin; Bison, Sander; van Tiel, Sandra; Koelewijn, Stuart; de Jong, Marion; Veenland, Jifke; Bernsen, Monique

    2015-01-01

    Anti-tumor efficacy of targeted peptide-receptor radionuclide therapy (PRRT) relies on several factors, including functional tumor vasculature. Little is known about the effect of PRRT on tumor vasculature. With dynamic contrast-enhanced (DCE-) MRI, functional vasculature is imaged and quantified using contrast agents. In small animals DCE-MRI is a challenging application. We optimized a clinical sequence for fast hemodynamic acquisitions, time-resolved imaging of contrast kinetics (TRICKS), to obtain DCE-MRI images at both high spatial and high temporal resolution in mice and rats. Using TRICKS, functional vasculature was measured prior to PRRT and longitudinally to investigate the effect of treatment on tumor vascular characteristics. Nude mice bearing H69 tumor xenografts and rats bearing syngeneic CA20948 tumors were used to study perfusion following PRRT administration with (177) lutetium octreotate. Both semi-quantitative and quantitative parameters were calculated. Treatment efficacy was measured by tumor-size reduction. Optimized TRICKS enabled MRI at 0.032 mm(3) voxel size with a temporal resolution of less than 5 s and large volume coverage, a substantial improvement over routine pre-clinical DCE-MRI studies. Tumor response to therapy was reflected in changes in tumor perfusion/permeability parameters. The H69 tumor model showed pronounced changes in DCE-derived parameters following PRRT. The rat CA20948 tumor model showed more heterogeneity in both treatment outcome and perfusion parameters. TRICKS enabled the acquisition of DCE-MRI at both high temporal resolution (Tres ) and spatial resolutions relevant for small animal tumor models. With the high Tres enabled by TRICKS, accurate pharmacokinetic data modeling was feasible. DCE-MRI parameters revealed changes over time and showed a clear relationship between tumor size and Ktrans . PMID:25995102

  17. A Systematic Retrieval Analysis of Secondary Eclipse Spectra. II. A Uniform Analysis of Nine Planets and their C to O Ratios

    NASA Astrophysics Data System (ADS)

    Line, Michael R.; Knutson, Heather; Wolf, Aaron S.; Yung, Yuk L.

    2014-03-01

    Secondary eclipse spectroscopy provides invaluable insights into the temperatures and compositions of exoplanetary atmospheres. We carry out a systematic temperature and abundance retrieval analysis of nine exoplanets (HD 189733b, HD 209458b, HD 149026b, GJ436b, WASP-12b, WASP-19b, WASP-43b, TrES-2b, and TrES-3b) observed in secondary eclipse using a combination of space- and ground-based facilities. Our goal with this analysis is to provide a consistent set of temperatures and compositions from which self-consistent models can be compared and to probe the underlying processes that shape these atmospheres. This paper is the second in a three part series of papers exploring the retrievability of temperatures and abundances from secondary eclipse spectra and the implications of these results for the chemistry of exoplanet atmospheres. In this investigation we present a catalogue of temperatures and abundances for H2O, CH4, CO, and CO2. We find that our temperatures and abundances are generally consistent with those of previous studies, although we do not find any statistically convincing evidence for super-solar C to O ratios (e.g., solar C/O falls in the 1σ confidence intervals in eight of the nine planets in our sample). Furthermore, within our sample we find little evidence for thermal inversions over a wide range of effective temperatures (with the exception of HD 209458b), consistent with previous investigations. The lack of evidence for inversions for most planets in our sample over such a wide range of effective temperatures provides additional support for the hypothesis that TiO is unlikely to be the absorber responsible for the formation of these inversions.

  18. A systematic retrieval analysis of secondary eclipse spectra. II. A uniform analysis of nine planets and their C to O ratios

    SciTech Connect

    Line, Michael R.; Knutson, Heather; Wolf, Aaron S.; Yung, Yuk L.

    2014-03-10

    Secondary eclipse spectroscopy provides invaluable insights into the temperatures and compositions of exoplanetary atmospheres. We carry out a systematic temperature and abundance retrieval analysis of nine exoplanets (HD 189733b, HD 209458b, HD 149026b, GJ436b, WASP-12b, WASP-19b, WASP-43b, TrES-2b, and TrES-3b) observed in secondary eclipse using a combination of space- and ground-based facilities. Our goal with this analysis is to provide a consistent set of temperatures and compositions from which self-consistent models can be compared and to probe the underlying processes that shape these atmospheres. This paper is the second in a three part series of papers exploring the retrievability of temperatures and abundances from secondary eclipse spectra and the implications of these results for the chemistry of exoplanet atmospheres. In this investigation we present a catalogue of temperatures and abundances for H{sub 2}O, CH{sub 4}, CO, and CO{sub 2}. We find that our temperatures and abundances are generally consistent with those of previous studies, although we do not find any statistically convincing evidence for super-solar C to O ratios (e.g., solar C/O falls in the 1σ confidence intervals in eight of the nine planets in our sample). Furthermore, within our sample we find little evidence for thermal inversions over a wide range of effective temperatures (with the exception of HD 209458b), consistent with previous investigations. The lack of evidence for inversions for most planets in our sample over such a wide range of effective temperatures provides additional support for the hypothesis that TiO is unlikely to be the absorber responsible for the formation of these inversions.

  19. DISYUNTIVAS EN LAS CONCEPCIONES SOBRE AUTONOMÍA Y BENEFICENCIA QUE AFECTAN LA TERAPÉUTICA DEL INTENTO SUICIDA1

    PubMed Central

    Mondragón, Liliana; Monroy, Zuraya; Ito, Ma. Emily; Medina-Mora, Dra. Ma. Elena

    2010-01-01

    El objetivo del trabajo es conocer las disyuntivas entre los principios de beneficencia y autonomía, que se presentan en la relación médico-paciente, durante la terapéutica del intento de suicidio. La investigación se realizó en dos hospitales psiquiátricos de la Ciudad de México. La muestra incluyó a tres sujetos con intento de suicidio, mayores de 18 años, que eran atendidos en consulta externa a causa de una lesión autoinfligida en el último año, y a tres psiquiatras que trataban a estos pacientes. La información se obtuvo previo consentimiento informado en entrevistas individuales. Se llevó a cabo un análisis de discurso argumentado para encontrar los significados que los participantes otorgaron a los principios bioéticos y las posibles disyuntivas entre éstos. Las discordancias entre la beneficencia y la autonomía estuvieron relacionadas con el beneficio del tratamiento, el respeto por los valores y las creencias de los pacientes, entre otros. Este trabajo presenta consideraciones éticas relevantes en el escenario clínico, al ofrecer al psiquiatra un análisis bioético que le permita actuar de acuerdo con la beneficencia y respetando la autonomía del paciente frente a casos de intento de suicidio y, de esta forma procurar una mejor atención para ellos. PMID:20830214

  20. BEER ANALYSIS OF KEPLER AND CoRoT LIGHT CURVES. II. EVIDENCE FOR SUPERROTATION IN THE PHASE CURVES OF THREE KEPLER HOT JUPITERS

    SciTech Connect

    Faigler, S.; Mazeh, T.

    2015-02-10

    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  1. The Language of Planetary Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    This graph of data from NASA's Spitzer Space telescope shows changes in the infrared light output of two star-planet systems (one above, one below) located hundreds of light-years away. The data were taken while the planets, called HD 209458b and TrES-1, disappeared behind their stars in what is called a 'secondary eclipse.' The dip seen in the center of each graph represents the time when the planets were eclipsed, and tells astronomers exactly how much light they emit.

    Why a secondary eclipse? When a planet transits, or passes in front of, its star, it partially blocks the light of the star. When the planet swings around behind the star, the star completely blocks its light. This drop in total light can be measured to determine the amount of light coming from just the planet.

    Why infrared? In visible light, the glare of a star overwhelms its planetary companion and the little light the planet reflects. In infrared, a star shines less brightly, and its planet gives off its own internal light, or heat radiation, making the planet easier to detect.

    By observing these secondary eclipses at different infrared wavelengths, astronomers can obtain the planet's temperature, and, in the future, they may be able to pick out chemicals sprinkled throughout a planet's atmosphere. The technique also reveals whether a planet's orbit is elongated or circular.

    This strategy will not work for all known extrasolar planets. It is ideally suited to study those Jupiter-sized planets previously discovered to cross, or transit, between us and the Sun-like stars they orbit, out to distances of 500 light-years. NASA's Spitzer Space Telescope was the first to successfully employ this technique.

    The data of HD 209458b were taken by Spitzer's multiband imaging photometer using the 24-micron array. The data of TrES-1 were taken by Spitzer's infrared array camera using the 8-micron array.

  2. Comparative age and growth of common snook Centropomus undecimalis (Pisces: Centropomidae) from coastal and riverine areas in Southern Mexico.

    PubMed

    Perera-Garcia, Martha A; Mendoza-Carranza, Manuel; Contreras-Sánchez, Wilfrido; Ferrara, Allyse; Huerta-Ortiz, Maricela; Hernández-Gómez, Raúl E

    2013-06-01

    Common snook Centropomus unidecimalis is an important commercial and fishery species in Southern Mexico, however the high exploitation rates have resulted in a strong reduction of its abundances. Since, the information about its population structure is scarce, the objective of the present research was to determine and compare the age structure in four important fishery sites. For this, age and growth of common snook were determined from specimens collected monthly, from July 2006 to March 2008, from two coastal (Barra Bosque and Barra San Pedro) and two riverine (San Pedro and Tres Brazos) commercial fishery sites in Tabasco, Mexico. Age was determined using sectioned saggitae otoliths and data analyzed by von Bertalanffy and Levenberg-Marquardt among others. Estimated ages ranged from 2 to 17 years. Monthly patterns of marginal increment formation and the percentage of otoliths with opaque rings on the outer edge demonstrated that a single annulus was formed each year. The von Bertalanffy parameters were calculated for males and females using linear adjustment and the non-linear method of Levenberg-Marquardt. The von Bertalanffy growth equations were FLt = 109.21(1-e-0.2(t+0.57)) for Barra Bosque, FLt = 94.56(1-e-027(t+0.485)) for Barra San Pedro, FLt = 97.15(1-e 0.17(t + 1.32)) for San Pedro and FLt = 83.77(1-e-026(t + 0.49)) for Tres Brazos. According to (Hotelling's T2, p < 0.05) test growth was significantly greater for females than for males. Based on the Chen test, von Bertalanffy growth curves were different among the study sites (RSS, p < 0.05). Based on the observed differences in growth parameters among sampling sites (coastal and riverine environments) future research need to be conducted on migration and population genetics, in order to delineate the stock structure of this population and support management programs. PMID:23885591

  3. Search of Exoplanets - Phase I

    NASA Astrophysics Data System (ADS)

    Vodniza, Alberto Q.; Pereira, M. R.; Lopez, J. P.; Reyes, K.; Chaves, L.

    2008-09-01

    From the Astronomical Observatory at the University of Nariño-COLOMBIA, we have begun a systematic search for exoplanets. Initially we made differential photometry on variable stars weaker than the tenth magnitude to get enough experience on the establishment of stellar transits, so then we could undertake the work with exoplanets. We have already confirmed the transits of two exoplanets with good photometry data: At the exoplanet HAT-P-5b, discovered by Bakos and other investigators and which turns around the GSC 02634-01087, with an orbital period of 2.788491 days according to measurements of the discoverers, and also at the exoplanet TrES-3, discovered by O'Donovan and other investigators and which turns around the GSC 03089-00929, with an orbital period of 1.30619 days, established by its discoverers. Both exoplanets are quite interesting because they have one of the smallest periods found on exoplanets. The TrES-3 also provides a big opportunity for studying the orbital decay and mass loss due to evaporation, caused by the great closeness to its star. We have captured a lot of data to elaborate the lightcurves so we can estimate physical parameters of the bodies. We are getting data on various dates. Actually we are preparing the equipment to develop observations of radial velocities through spectrometry. In a later phase, we expect to verify the presence of other exoplanets which cause less deep transits, and then we can investigate stars with possible exoplanets around them. Besides we hope to design a mathematical model of the studied systems. The equipment we employed is: 14"LX200 GPS MEADE telescope, ST-7XME SBIG camera, STL-1001 SBIG camera, LHIRES III Spectrograph, and SGS-SBIG Spectrograph. On the poster it is explained at length the methodology followed over the search, the data we obtained and the physical- mathematical analysis that was carried out.

  4. The GAPS programme with HARPS-N at TNG. IX. The multi-planet system KELT-6: Detection of the planet KELT-6 c and measurement of the Rossiter-McLaughlin effect for KELT-6 b

    NASA Astrophysics Data System (ADS)

    Damasso, M.; Esposito, M.; Nascimbeni, V.; Desidera, S.; Bonomo, A. S.; Bieryla, A.; Malavolta, L.; Biazzo, K.; Sozzetti, A.; Covino, E.; Latham, D. W.; Gandolfi, D.; Rainer, M.; Petrovich, C.; Collins, K. A.; Boccato, C.; Claudi, R. U.; Cosentino, R.; Gratton, R.; Lanza, A. F.; Maggio, A.; Micela, G.; Molinari, E.; Pagano, I.; Piotto, G.; Poretti, E.; Smareglia, R.; Di Fabrizio, L.; Giacobbe, P.; Gomez-Jimenez, M.; Murabito, S.; Molinaro, M.; Affer, L.; Barbieri, M.; Bedin, L. R.; Benatti, S.; Borsa, F.; Maldonado, J.; Mancini, L.; Scandariato, G.; Southworth, J.; Zanmar Sanchez, R.

    2015-09-01

    Aims: For more than 1.5 years we spectroscopically monitored the star KELT-6 (BD+31 2447), which is known to host the transiting hot-Saturn KELT-6 b, because a previously observed long-term trend in radial velocity time series suggested that there is an outer companion. Methods: We collected a total of 93 new spectra with the HARPS-N and TRES spectrographs. A spectroscopic transit of KELT-6 b was observed with HARPS-N, and simultaneous photometry was obtained with the IAC-80 telescope. Results: We proved the existence of an outer planet with a mininum mass Mpsin i = 3.71 ± 0.21 MJup and a moderately eccentric orbit (e = 0.21-0.036+0.039) of period P ~ 3.5 years. We improved the orbital solution of KELT-6 b and obtained the first measurement of the Rossiter-McLaughlin effect, showing that the planet has a likely circular, prograde, and slightly misaligned orbit with a projected spin-orbit angle of λ = -36 ± 11 degrees. We improved the KELT-6 b transit ephemeris from photometry and provide new measurements of the stellar parameters. KELT-6 appears as an interesting case for studying the formation and evolution of multi-planet systems. Based on observations made with (i) the HARPS-N spectrograph on the Italian Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the INAF - Fundacion Galileo Galilei (Spanish Observatory of Roque de los Muchachos of the IAC); (ii) the Tillinghast Reflector Echelle Spectrograph (TRES) on the 1.5-m Tillinghast telescope, located at the Smithsonian Astrophysical Observatory's Fred L. Whipple Observatory on Mt. Hopkins in Arizona; (iii) the IAC-80 telescope at the Teide Observatory (Instituto de Astrofísica de Canarias, IAC).Figure 4 and Tables 2 and 3 are available in electronic form at http://www.aanda.org

  5. Are MWC349 A and B a Physical Binary?

    NASA Astrophysics Data System (ADS)

    Drew, Patrick; Strelnitski, Vladimir; Smith, Howard Alan; Dave Latham Jessica Mink and the TRES instrument Team, Maria Mitchell Association

    2016-01-01

    The age and evolutionary status of the only known hydrogen recombination line maser and laser star MWC349A, "A", is unknown because its spectrum has no absorption features for classification. Star A has an optical B0III companion 2.4 arcsec away, MWC349B. Previous studies suggest A & B are either gravitationally bound, and therefore both a few Myr old, or not bound and A is possibly an observable 30 Msolar star in its pre-main sequence stage. We attempt to solve the controversy by measuring the difference of radial velocities between A and B using observations from the 1.5m Tillinghast telescope and the TRES spectrometer at the Whipple Observatory. With an assumed distance of 1.2 kpc and masses of ~30 Msolar, the radial velocities cannot differ by >3 km/s for the stars to be gravitationally bound. We find a radial velocity with respect to the local standard of rest of 42 ± 18 km/s for B, and compare it with the known radial velocity of 8 ± 2 km/s for A giving a difference of 34 ± 20 km/s - much greater than 3 km/s. We conclude that A and B are not gravitationally bound, although light contamination from star A in B's spectrum makes this result somewhat inconclusive. If confirmed, however, the known spectral type of B will not determine the age of star A and star A may be an observable 30 Msolar star in its pre-main sequence stage. We gratefully acknowledge support from Dave Latham, Jessica Mink and the TRES instrument team. This project was supported in part by the NSF REU grant AST-1358980 and by the Maria Mitchell Association.

  6. Nouvelles approches en theorie du champ moyen dynamique: le cas du pouvoir thermoelectrique et celui de l'effet orbital d'un champ magnetique

    NASA Astrophysics Data System (ADS)

    Arsenault, Louis-Francois

    Les applications reliees a la generation d'energie motivent la recherche de materiaux ayant un fort pouvoir thermoelectrique (S). De plus, S nous renseigne sur certaines proprietes fondamentales des materiaux, comme, par exemple, la transition entre l'etat coherent et incoherent des quasi-particules lorsque la temperature augmente. Empiriquement, la presence de fortes interactions electron-electron peut mener a un pouvoir thermoelectrique geant. Nous avons donc etudie le modele le plus simple qui tient compte de ces fortes interactions, le modele de Hubbard. La theorie du champ moyen dynamique (DMFT) est tout indiquee dans ce cas. Nous nous sommes concentres sur un systeme tridimensionnel (3d) cubique a face centree (fcc), et ce, pour plusieurs raisons. A) Ce type de cristal est tres commun dans la nature. B) La DMFT donne de tres bons resultats en 3d et donc ce choix sert aussi de preuve de principe de la methode. C) Finalement, a cause de la frustration electronique intrinseque au fcc, celui-ci ne presente pas de symetrie particule-trou, ce qui est tres favorable a l'apparition d'une grande valeur de S. Ce travail demontre que lorsque le materiau est un isolant a demi-remplissage a cause des fortes interactions (isolant de Mott), il est possible d'obtenir de grands pouvoirs thermoelectriques en le dopant legerement. C'est un resultat pratique important. Du point de vue methodologique, nous avons montre comment la limite de frequence infinie de S et l'approche dite de Kelvin, qui considere la limite de frequence nulle avant la limite thermodynamique pour S, donnent des estimations fiables de la vraie limite continue (DC) dans les domaines de temperature appropriee. Ces deux approches facilitent grandement les calculs en court-circuit ant la necessite de recourir a de problematiques prolongements analytiques. Nous avons trouve que la methode de calcul a frequence infinie fonctionne bien lorsque les echelles d'energie sont relativement faibles. En d'autres termes

  7. Scheme for development of monitoring networks for springs in Bavaria, Germany

    NASA Astrophysics Data System (ADS)

    Bender, Steffen; Einsiedl, Florian; Wohnlich, Stefan

    2001-03-01

    The present groundwater monitoring network in Bavaria consists mostly of wells and only a small number of natural groundwater springs, all of which are analyzed for mainly the common physical and chemical constituents in groundwater. In order to develop a long-term groundwater management plan for all the groundwater resources of Bavaria, the Bavarian State Office for Water Management intends to establish a separate spring-monitoring network throughout the 11 groundwater provinces of the state. As a first step, significant physicochemical parameters that show considerable annual fluctuation (after monitoring 1-3 years) were determined at 21 springs or spring systems to create a basic data set to guide future monitoring. A selection procedure was developed around four parameters: (1) geological units, which includes the principal aquifers; (2) rate of spring discharge; (3) land utilization within a catchment; and (4) approximate size of the subterranean catchment. However, in the initial phase of the study, only the first three parameters were investigated. These parameters established a matrix for evaluating each groundwater region of Bavaria to aid in the selection of additional springs for the proposed monitoring network. Résumé. Le réseau actuel de surveillance des eaux souterraines en Bavière consiste surtout en des puits avec seulement un petit nombre de sources, tous analysés pour l'essentiel pour les composants courants physiques et chimiques des eaux souterraines. Afin de développer un plan de gestion à long terme des eaux souterraines de la Bavière, l'Office bavarois pour la gestion de l'eau cherche à mettre en place un réseau séparé de surveillance des sources dans les onze provinces hydrogéologiques du lander. Dans un premier temps, les paramètres physico-chimiques significatifs qui présentent des variations annuelles considérables, après 1 à 3 ans de surveillance, ont été déterminés à 21 sources ou groupes de sources pour

  8. Abundance and Morphological Effects of Large Woody Debris in Forested Basins of Southern Andes

    NASA Astrophysics Data System (ADS)

    Andreoli, A.; Comiti, F.; Lenzi, M. A.

    2006-12-01

    The Southern Andes mountain range represents an ideal location for studying large woody debris (LWD) in streams draining forested basins thanks to the presence of both pristine and managed woodland, and to the general low level of human alteration of stream corridors. However, no published investigations have been performed so far in such a large region. The investigated sites of this research are three basins (9-13 km2 drainage area, third-order channels) covered by Nothofagus forests: two of them are located in the Southern Chilean Andes (the Tres Arroyos in the Malalcahuello National Reserve and the Rio Toro within the Malleco Natural Reserve) and one basin lies in the Argentinean Tierra del Fuego (the Buena Esperanza basin, near the city of Ushuaia). Measured LWD were all wood pieces larger than 10 cm in diameter and 1 m in length, both in the active channel and in the adjacent active floodplain. Pieces forming log jams were all measured and the geometrical dimensions of jams were taken. Jam type was defined based on Abbe and Montgomery (2003) classification. Sediment stored behind log-steps and valley jams was evaluated approximating the sediment accumulated to a solid wedge whose geometrical dimensions were measured. Additional information relative to each LWD piece were recorded during the field survey: type (log, rootwad, log with rootwads attached), orientation to flow, origin (floated, bank erosion, landslide, natural mortality, harvest residuals) and position (log-step, in-channel, channel-bridging, channel margins, bankfull edge). In the Tres Arroyos, the average LWD volume stored within the bankfull channel is 710 m3 ha-1. The average number of pieces is 1,004 per hectare of bankfull channel area. Log-steps represent about 22% of all steps, whereas the elevation loss due to LWD (log-steps and valley jams) results in 27% loss of the total stream potential energy. About 1,600 m3 of sediment (assuming a porosity of 20%) is stored in the main channel

  9. [In Process Citation].

    PubMed

    Santos, E; Rodríguez, A; Prieto de Frías, C; Gil, M J; Fruhbeck, G; Quiroga, J; Herrero, J I; Salvador, J

    2016-01-01

    RESUMEN            Fundamento. Las alteraciones del estado nutricional son frecuentes en la cirrosis hepática. El presente estudio se ha llevado a cabo para establecer las relaciones existentes entre la función hepática, los niveles de IGF I/IGFBP-3, el estado nutricional y las concentraciones de leptina, ghrelina y glucagón en 21 pacientes en lista de espera de trasplante hepático (TH).            Material y métodos. Se han estudiado 21 varones de 56+2,1 años de edad en lista de TH clasificados por estadio Child-Pugh (CP)  de menor a mayor disfunción hepática en CPA (n=4), CPB (n=11) y CPC (n=6). Se determinó  el índice de masa corporal (IMC),  porcentaje de grasa corporal (%) mediante pletismografía de desplazamiento de aire, gasto energético mediante calorimetría indirecta, calculando su desviación respecto al valor calculado por Harris-Benedict (GER%), y determinaciones analíticas en ayunas de albúmina, glucosa, insulina, HbA1c, leptina, ghrelina total, glucagón, IGF-I e IGFBP3.            Resultados. No hubo diferencias significativas entre % grasa corporal y leptinemia en los tres grupos clasificados por CP. El grupo CPC mostró valores de ghrelina superiores a los CPA y CPB (p<0,05). Los tres grupos mostraron un valor de GER% superior al 100%  e hiperglucagonemia, sin mostrar diferencias entre ellos. La concentración  de glucagón se correlacionó positivamente con el valor de GER%  (r=0,56; p<0,01), y con la concentración de ghrelina (r=0,66; p<0,01). El valor de albúmina se correlacionó positivamente con IGF-I (r=0,52; p<0,05) e IGFBP3 (r=0,45;  p<0,05), encontrándose ambos disminuidos por igual en los tres grupos.            Conclusiones. Estos resultados muestran un aumento de ghrelina en pacientes con mayor afectación funcional hepática, así como un patrón hipermetabólico asociado a hiperglucagonemia, lo que sugiere a este factor como desequilibrador del balance energético y

  10. [In Process Citation].

    PubMed

    González-Montesinos, José Luis; Ponce-González, Jesús Gustavo; Vicente-Campos, Davinia; López-Chicharro, José; Fernández-Santos, Jorge Del Rosario; Vaz-Pardal, Carmen; Costa-Sepúlveda, José Luis; Conde-Caveda, Julio; Castro-Piñero, José

    2016-01-01

    Introducción y objetivos: un dispositivo llamado FeelBreathe ® (FB) se ha diseñado, desarrollado y patentado para el entrenamiento de la musculatura inspiratoria (IMT). Para examinar los efectos de FB en la ventilación pulmonar y el intercambio gaseoso durante el ejercicio, se tomaron medidas de 27 voluntarios varones sanos entrenados (edad: 32,5 ± 7,2 años). Métodos: al inicio del estudio se midieron tanto la presión inspiratoria máxima estática (PIM) y la capacidad pulmonar mediante espirometría. Seguidamente, se realizó un test incremental en cicloergómetro para determinar el VO 2 pico. Cada sujeto, tres días más tarde, realizó aleatoriamente tres pruebas idénticas submáximas en cicloergómetro a una intensidad comprendida al 50% entre los umbrales ventilatorios bajo tres condiciones de respiración diferentes: a) respiración oronasal (ONB), b) respiración nasal (NB) y c) la respiración nasal a través del FB. Resultados: la prueba con FB mostró una ventilación minuto (VE) y una frecuencia respiratoria (BF) inferior que en las pruebas de NB, la cual a su vez tenía menor BF, pero similar VE que ONB (p < 0,001). A pesar de esto, FB obtuvo valores similares de VO 2 , cociente respiratorio (RER), frecuencia cardiaca (HR) y saturación de oxígeno capilar periférica (SpO2) en comparación con NB y ONB. Esto último puede ocurrir debido en parte al aumento del volumen tidal (VT) y el tiempo de expiración (Tex) en FB hasta el mismo nivel que en la prueba de NB, los cuales fueron un 15% y 14% en ambas pruebas, respectivamente, superiores a ONB (p < 0,001). El porcentaje de tiempo de inspiración (Ti/Tot) fue 7% mayor en la prueba de FB en comparación con NB y ONB (p < 0,001). Solamente en la prueba de FB se encontró un aumento de la presión final de la espiración de CO 2 (P ET CO 2 ) y la reducción de la presión final de la espiración de O 2 (P ET O 2 ) y la fracción de expiración de O 2 (FEO 2 ). Conclusiones: FeelBreathe es un

  11. A Comparison of Observationally Determined Radii with Theoretical Radius Predictions for Short-Period Transiting Extrasolar Planets

    NASA Astrophysics Data System (ADS)

    Laughlin, Gregory; Wolf, Aaron; Vanmunster, Tonny; Bodenheimer, Peter; Fischer, Debra; Marcy, Geoff; Butler, Paul; Vogt, Steve

    2005-03-01

    Two extrasolar planets, HD 209458b and TrES-1, are currently known to transit bright parent stars for which physical properties can be accurately determined. The two transiting planets have very similar masses and periods and hence invite detailed comparisons between their observed and theoretically predicted properties. In this paper, we carry out these comparisons. We first report photometric and spectroscopic follow-up observations of TrES-1, and we use these observations to obtain improved estimates for the planetary radius, Rpl=(1.08+/-0.05)RJ, and the planetary mass, Mpl=(0.729+/-0.036)MJ. We also confirm that the inclination estimate of the planetary orbit as i=88.2d. These values agree with those obtained by Alonso et al. in their discovery paper, but the uncertainty in the planet radius has been improved as a result of both high-cadence photometry of two full transits and from independent radius determinations for the V=11.8 K0 V parent star. We derive estimates for the TrES-1 stellar parameters of R*/Rsolar=0.83+/-0.03 (by combining independent estimates from stellar models, high-resolution spectra, and transit light curve fitting) M*/Msolar=0.87+/-0.05 (via fitting to evolutionary tracks), Teff=5214+/-23K, [Me/H]=0.001+/-0.04, rotational velocity Vsin(i)=1.08+/-0.3kms-1, logg=4.52+/-0.05dex, logL*/Lsolar=-0.32, d=157+/-6pc, and an age of τ=4+/-2Gyr. These estimates of the physical properties of the system allow us to compute evolutionary models for the planet that result in a predicted radius of Rpl=1.05RJ for a model that contains an incompressible 20 M⊕ core and a radius Rpl=1.09RJ for a model without a core. We use our grids of planetary evolution models to show that, with standard assumptions, our code also obtains good agreement with the observed radii of the other recently discovered transiting planets, including OGLE-TR-56b, OGLE-TR-111b, OGLE-TR-113b, and OGLE-TR-132b. We report an updated radius for HD 209458b of Rpl=(1.32+/-0.05)RJ, based on

  12. Large wood storage, longitudinal distribution and mobility in channel segments of four mountain rivers, Chile

    NASA Astrophysics Data System (ADS)

    Iroume, A.; Mao, L.; Andreoli, A.; Ulloa, H.

    2013-12-01

    In Chile, besides an anecdotal reference to in-stream wood by Vidal Gormaz (1875), the first report on LW is the one by Andreoli et al. (2007). Since then, more abundant research has developed, focusing mainly on morphologic and hydraulic functions (Comiti et al., 2008; Mao et al., 2008, 2010; Iroumé at al., 2010, 2011; Ulloa et al., 2011), and also on the ecology of low order channels (Vera et al., 2012). Large wood storage, longitudinal distribution and mobility have been studied for several periods in channel segments of four mountain catchments (Pichún, El Toro, Tres Arroyos and Vuelta de Zorra) in southern Chile. The surveyed segments were divided into individual reaches, and the length of each reach was calculated using a laser distance meter and mean individual reach bankfull width and depth were obtained by averaging measurements in cross-sections. All wood pieces found within the bankfull channel more than 10 cm in diameter and 1 m in length were measured and their position was referenced to natural elements and to numbered wooden stakes indicating every reach limit. Several of these wood elements were tagged to study LW mobilization. A 1.54 km-long segment divided into 17 individual reaches was first surveyed in the Tres Arroyos during March-April 2005, and then re-surveyed in November 2008 when the study segment was extended to a total length of 2.07 km with the addition of 5 new individual reaches. Pichún, El Toro and Vuelta de Zorra were first surveyed from November 2008 to February 2009. The length of the channel segments is 1.0 (12 reaches), 2.2 (17 reaches) and 1.56 km (16 reaches) for Pichún, El Toro and Vuelta de Zorra, respectively. These segments have been re-surveyed after every winter rainy season to study LW recruitment and mobility. Using the area of the bankfull channel as reference, total LW volume was 54 m3/ha in Pichún, 202 m3/ha in El Toro, 1449 m3/ha for Tres Arroyos and 109 m3/ha for Vuelta de Zorra. The LW travel distance and

  13. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R

    2007-01-01

    Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2

  14. QIN. A Feasible High Spatiotemporal Resolution Breast DCE-MRI Protocol for Clinical Settings

    PubMed Central

    Tudorica, Luminita A.; Oh, Karen Y.; Roy, Nicole; Kettler, Mark D.; Chen, Yiyi; Hemmingson, Stephanie L.; Afzal, Aneela; Grinstead, John W.; Laub, Gerhard; Li, Xin; Huang, Wei

    2012-01-01

    Three dimensional bilateral imaging is the standard for most clinical breast dynamic contrast-enhanced (DCE) MRI protocols. Because of high spatial resolution (sRes) requirement, the typical 1–2 min temporal resolution (tRes) afforded by a conventional full-k-space-sampling gradient echo (GRE) sequence precludes meaningful and accurate pharmacokinetic analysis of DCE time-course data. The commercially available, GRE-based, k-space undersampling and data sharing TWIST (time-resolved angiography with stochastic trajectories) sequence was used in this study to perform DCE-MRI exams on thirty one patients (with 36 suspicious breast lesions) before their biopsies. The TWIST DCE-MRI was immediately followed by a single-frame conventional GRE acquisition. Blinded from each other, three radiologist readers assessed agreements in multiple lesion morphology categories between the last set of TWIST DCE images and the conventional GRE images. Fleiss’ κ test was used to evaluate inter-reader agreement. The TWIST DCE time-course data were subjected to quantitative pharmacokinetic analyses. With a four-channel phased-array breast coil, the TWIST sequence produced DCE images with 20 s or less tRes and ~ 1.0×1.0×1.4 mm3 sRes. There were no significant differences in signal-to-noise (P = 0.45) and contrast-to-noise (P = 0.51) ratios between the TWIST and conventional GRE images. The agreements in morphology evaluations between the two image sets were excellent with the intra-reader agreement ranging from 79% for mass margin to 100% for mammographic density and the inter-reader κ value ranging from 0.54 (P < 0.0001) for lesion size to 1.00 (P < 0.0001) for background parenchymal enhancement. Quantitative analyses of the DCE time-course data provided higher breast cancer diagnostic accuracy (91% specificity at 100% sensitivity) than the current clinical practice of morphology and qualitative kinetics assessments. The TWIST sequence may be used in clinical settings to acquire

  15. Homogeneous studies of transiting extrasolar planets - IV. Thirty systems with space-based light curves

    NASA Astrophysics Data System (ADS)

    Southworth, John

    2011-11-01

    I calculate the physical properties of 32 transiting extrasolar planet and brown-dwarf systems from existing photometric observations and measured spectroscopic parameters. The systems studied include 15 observed by the CoRoT satellite, 10 by Kepler and five by the Deep Impact spacecraft. Inclusion of the objects studied in previous papers leads to a sample of 58 transiting systems with homogeneously measured properties. The Kepler data include observations from Quarter 2, and my analyses of several of the systems are the first to be based on short-cadence data from this satellite. The light curves are modelled using the JKTEBOP code, with attention paid to the treatment of limb darkening, contaminating light, orbital eccentricity, correlated noise and numerical integration over long exposure times. The physical properties are derived from the light-curve parameters, spectroscopic characteristics of the host star and constraints from five sets of theoretical stellar model predictions. An alternative approach using a calibration from eclipsing binary star systems is explored and found to give comparable results whilst imposing a much smaller computational burden. My results are in good agreement with published properties for most of the transiting systems, but discrepancies are identified for CoRoT-5, CoRoT-8, CoRoT-13, Kepler-5 and Kepler-7. Many of the error bars quoted in the literature are underestimated. Refined orbital ephemerides are given for CoRoT-8 and for the Kepler planets. Asteroseismic constraints on the density of the host stars are in good agreement with the photometric equivalents for HD 17156 and TrES-2, but not for HAT-P-7 and HAT-P-11. Complete error budgets are generated for each transiting system, allowing identification of the observations best-suited to improve measurements of their physical properties. Whilst most systems would benefit from further photometry and spectroscopy, HD 17156, HD 80606, HAT-P-7 and TrES-2 are now extremely well

  16. Devenir néonatal immédiat de la grande et l'extrême prématurité: données rétrospectives d'une unité de néonatalogie à Yaoundé, Cameroun de 2009 à 2013

    PubMed Central

    Nlend, Anne Esther Njom; Zeudja, Cécile; Motaze, Annie Nga; Suzie, Moyo; Lydie, Nsoa

    2015-01-01

    L'objectif est de notre étude de décrire la typologie de la prématurité et mesurer la survie hospitalière à court terme des grands et extrêmes prématurés dans un pays à ressources limitées (PRL). C'est une étude descriptive rétrospective. Données extraites du registre des admissions du service. Inclusions de tous les nouveau-nés admis dans le service durant la période, ayant un âge gestationnel annoncé ≤ 36 semaines et 6 jours et plus de 26SA, avec au moins deux paramètres présents: âge gestationnel et poids de naissance. Principaux paramètres mesurés: pourcentage de nouveau-nés sortants vivants selon le type de prématurité: tardive, grande ou extrême. Nous avons recensé 1015 prématurés dont 314 grands prématurés (GP) et 61 extrêmes prématurés (EP). Le taux de nouveau-nés sortant vivants était de 95% chez les prématurés tardifs, de 71% chez les grands prématurés et de moins de 23% chez les extrêmes prématurés. Avant 28 semaines, le taux de mortalité était de prés de 100% chez les grands ou extrêmes prématurés de moins de 1000g contre 64% chez les plus de 1000g. Chez les GP le taux de décès était de 13% chez les nés par césarienne vs 21% chez ceux nés par voie basse (p ≤ 0,01). Le taux de prématurité médicalement induite était faible dans l'ensemble et de 3% chez les prématurés extrêmes. En conclusion le taux de mortalité hospitalière des EP est préoccupant, le faible taux de prématurité médicalement induite urge au renforcement de la prévention et à la mise en place de collaboration obstétrico-pédiatrique. PMID:26175812

  17. [In Process Citation].

    PubMed

    Zourdos, Michael C; Dolan, Chad; Quiles, Justin M; Klemp, Alex; Jo, Edward; Loenneke, Jeremy P; Blanco, Rocky; Whitehurst, Michael

    2016-01-01

    Introducción: el propósito de este estudio fue investigar la eficacia del entrenamiento diario de una repetición máxima (1RM) de la sentadilla en fuerza máxima. Material y método: tres levantadores de peso de competición realizaron la sentadilla durante 37 días consecutivos y se reportan como casos individuales. Participante 1 (P1) (masa corporal = 80,5 kg; edad = 28 años) y participante 3 (P3) (masa corporal = 108,8 kg; edad = 34 años) eran levantadores de fuerza; participante 2 (P2) (masa corporal = 64,1 kg; edad = 19 años) fue un levantador de pesas. Cada participante tenía por lo menos 5 años de experiencia con la posición en sentadilla de formación. Durante los días 1-35, los participantes realizaron una sentadilla de 1RM seguida por 5 conjuntos de volumen de 3 repeticiones al 85% o 2 repeticiones al 90% de la 1RM diario. En el día 36, los participantes realizan solo una serie de 1 repetición al 85% de 1RM del día 1; y el día 37 realizaron un 1RM. Resultados: cambios absolutos y porcentaje para P1 del 1 día al 37: + 5 kg/2,3% y desde el primer día al máximo (1RM era el mayor) + 12,5 kg/5,8%. P2 experimentó un aumento de 13,5 kg/10,8% en 1RM del día 1 al 37 y del día 1 al máximo. P3 demostró un aumento de 21 kg/9,5% del día 1 al 37 y del día 1 al máximo. Los tres participantes exhibieron significativa (p < 0,05) las correlaciones entre el tiempo (días) y 1RM (P1: r = 0,65, P2: r = 0,78, P3: r = 0,48). Conclusión: nuestros resultados sugieren que el entrenamiento diario de 1RM había producido efectivamente cambios significativos en la máxima fuerza en los atletas de fuerza competitiva en un periodo relativamente corto de entrenamiento. PMID:27238810

  18. Profil de l'hémogramme chez les enfants paludéens de 0 à 5 ans sous quinine, cas de la République Démocratique du Congo

    PubMed Central

    Kabamba, Arsène Tshikongo; Lukumwena, Zet Kalala; Longanga, Albert Otshudi

    2014-01-01

    Le paludisme constitue un des problèmes de santé publique majeur en République Démocratique du Congo (RDC) à cause d'une part des risques d’épidémies dans certaines zones du pays et d'autre part à cause du nombre des malades et des décès qu'il provoque. Cette étude expose les aspects hématologiques liés à la prise de la quinine au cours du paludisme grave chez l'enfant. Pour ce faire, les prises de sang ont été effectuées à deux groupes d'enfants, dans différents centres hospitaliers de Lubumbashi: le premier groupe est constitué d'enfants gravement impaludés et sous traitement à la quinine; tandis que le second groupe, composé d'enfants impaludés aussi mais sans traitement à la quinine et sert de groupe témoin. Ces prélèvements ont été analysés pour une exploration de l'hémogramme par un dosage sérique des paramètres hématologiques ci-après: les globules rouges, l'hémoglobine, l'hématocrite et le volume globulaire moyen. Les résultats obtenus montrent une différence statistiquement significative entre les deux groupes d'enfants examinés. En effet, dans la majorité des cas, une augmentation des taux plasmatiques des paramètres hématologiques analysés a été observée dans le groupe d'enfants impaludés sous traitement à la quinine, traduisant ainsi l'apport de la quinine sur la stabilisation de l'hémogramme au cours d'un paludisme grave chez l'enfant de moins de cinq ans. PMID:25722768

  19. Propriétés électroniques et schémas de bandes dans les semi-conducteurs amorphes. II. Etude des phénomènes de transport

    NASA Astrophysics Data System (ADS)

    Moliton, André; Ratier, Bernard

    We present the particular study of three important electric parameters which characterize an amorphous semiconductor. The band scheme is the Mott - Davis model and the three parameters : dark conductivity, thermoelectric power and alternative conductivity are determined versus temperature : calculations are presented on the more general manner for the successive energy levels (extended states, localized states in band tails, localized states near Fermi level). The schematic representations are finally proposed : at the classical curves obtained for the conductivities, we add a peculiar scheme for the thermoelectric power : its study is of importance for determining (with its sign) the type of amorphous semiconductor. Nous présentons de façon détaillée l'étude théorique de trois importants paramètres électriques susceptibles de caractériser un semi-conducteur amorphe. Le schéma de bande retenu est celui de Mott - Davis et les trois paramètres : conductivité continue, pouvoir thermoélectrique et conductivité alternative sont déterminés en particulier en fonction de la température : nous nous sommes attachés à présenter les calculs sous leur forme la plus générale possible en faisant intervenir successivement les différents mécanismes relatifs aux différents niveaux d'énergie (énergie relative aux états délocalisés, localisés dans les queues de bande, localisés au voisinage du niveau de Fermi). Les représentations schématiques, classiques pour la conductivité continue et à un degré moindre pour la conductivité alternative, sont proposées : nous détaillons en particulier celle du pouvoir thermoélectrique S dont l'étude est en fait essentielle car le signe de S (cf. Mott) est une des seules caractérisations fiables du type de semi-conducteur amorphe étudié.

  20. Formation et Evolution des Structures dans le Milieu interstellaire. Une Approche théorique, numérique et observationnelle

    NASA Astrophysics Data System (ADS)

    Hennebelle, Patrick

    2000-11-01

    Le milieu interstellaire, au sein duquel se forme les étoiles,présente d'importants contrastes de densités. Ces structures se forment sous l'action couplée de processus magnétohydrodynamiques, thermiques et chimiques. La première partie de cette thèse est un travail théorique et numérique sur la condensation induite dynamiquement de gaz chaud et diffus en une phase froide et condensée. Nous montrons, tout d'aborddans le cas hydrodynamique, puis MHD, comment, dans un milieu thermiquement bistable, une fluctuation de vitesse typiquement transonique conduit, si elle est d'amplitude suffisante et dure un temps assez long, à la formationd'une structure stable. L'influence de divers paramètres -amplitude et échelle spatiale caractéristique de la perturbation, pression initiale, configuration du champ magnétique- sur la condensationest étudiée numériquement et analytiquement. Des spectres synthétiques sont calculés et qualitativement comparés aux spectres observationnels. La seconde partie de la thèse porte sur l'étudeobservationnelle des phases les plus condensées du milieu interstellaire détectées en absorption sur le fond infrarouge galactique par le satellite ISO. Nous effectuons tout d'abordune extraction systématique de ces objets à partir d'une analyse multi-échelle des données ISOGAL.L'étude du rapport des contrastes à 7 et 15 um permet de mesurer le rapport de l'extinction interstellaire, peu connue dans cette région du spectre, à ces deux longueurs d'onde. Des estimations d'opacité de quelques objets sont égalementdéduites des données en infrarouge. Des observations complémentaires spectroscopiques et bolométriques dans le domaineradio ont été effectuées et permettent une analyse plus détaillée des paramètres physico-chimiques de ces nuages.

  1. Simulation du comportement thermique en régime permanent d'un moteur asynchrone à refroidissement extérieur. Etude par éléments finis

    NASA Astrophysics Data System (ADS)

    Glises, R.; Hostache, G.; Kauffmann, J. M.

    1994-09-01

    The steady state thermal modelling of an 4kW asynchronous motor is realized. A design has been made thanks to the Flux2D finite element magnetic calculus software converted into a resolution tool of the heat equation. This last is used to simulate the heat flux in fluid and solid areas. A 3D study is effected thanks to two 2D studies. The first concerns a radial view (perpendicular to the mechanical axis) whereas the second is effected for an axial view (parallel to the mechanical axis). Thermal conductivities of the materials and thermal contact resistances of the motor are determined through two different tests creating different overheatings. The first is made with a sinewave supply and pre-determine the thermophysical parameters. The second effected with direct current supplies at the rotor and the stator is used to validate these last parameters. On réalise l'étude du comportement thermique en régime permanent d'un moteur asynchrone de 4kW. Le logiciel de calculs magnétiques par éléments finis flux2D est converti en un outil de résolution de l'équation de la chaleur. Cette dernière équation sert à simuler les transferts thermiques tant dans les domaines fluides que solides. Une pseudo-étude tridimensionnelle est réalisée par le biais de deux études bidimensionnelles : la première effectuée suivant un plan radial (plan perpendiculaire à l'axe du moteur) et la seconde suivant un plan axial (plan parallèle à l'axe). Les conductivités des matériaux et des résistances thermiques de contact composant le moteur sont déterminées à l'aide de deux types d'essais qui induisent des échauffements différents. Le premier est réalisé avec une alimentation sinusoïdale et sert à prédéterminer les paramètres thermophysiques. Le second est effectué avec des alimentations à courant continu tant au stator qu'au rotor et a pour rôle la validation de ces paramètres.

  2. Interactive initialization of 2D/3D rigid registration

    SciTech Connect

    Gong, Ren Hui; Güler, Özgür; Kürklüoglu, Mustafa; Lovejoy, John; Yaniv, Ziv

    2013-12-15

    Purpose: Registration is one of the key technical components in an image-guided navigation system. A large number of 2D/3D registration algorithms have been previously proposed, but have not been able to transition into clinical practice. The authors identify the primary reason for the lack of adoption with the prerequisite for a sufficiently accurate initial transformation, mean target registration error of about 10 mm or less. In this paper, the authors present two interactive initialization approaches that provide the desired accuracy for x-ray/MR and x-ray/CT registration in the operating room setting. Methods: The authors have developed two interactive registration methods based on visual alignment of a preoperative image, MR, or CT to intraoperative x-rays. In the first approach, the operator uses a gesture based interface to align a volume rendering of the preoperative image to multiple x-rays. The second approach uses a tracked tool available as part of a navigation system. Preoperatively, a virtual replica of the tool is positioned next to the anatomical structures visible in the volumetric data. Intraoperatively, the physical tool is positioned in a similar manner and subsequently used to align a volume rendering to the x-ray images using an augmented reality (AR) approach. Both methods were assessed using three publicly available reference data sets for 2D/3D registration evaluation. Results: In the authors' experiments, the authors show that for x-ray/MR registration, the gesture based method resulted in a mean target registration error (mTRE) of 9.3 ± 5.0 mm with an average interaction time of 146.3 ± 73.0 s, and the AR-based method had mTREs of 7.2 ± 3.2 mm with interaction times of 44 ± 32 s. For x-ray/CT registration, the gesture based method resulted in a mTRE of 7.4 ± 5.0 mm with an average interaction time of 132.1 ± 66.4 s, and the AR-based method had mTREs of 8.3 ± 5.0 mm with interaction times of 58 ± 52 s. Conclusions: Based on the

  3. Preliminary results from comparisons of redundant tiltmeters at three sites in central california

    USGS Publications Warehouse

    Mortensen, C.E.; Johnston, M.J.S.

    1979-01-01

    The U.S. Geological Survey has been operating a network of shallow-borehole tiltmeters in central California since June 1973. At six sites redundant instruments have been installed as a check on data coherency. These include the Sage Ranch, Tres Pinos, New Idria, Aromas, Bear Valley and San Juan Bautista tiltmeter sites. Preliminary results from the comparison of redundant data from the Aromas, Bear Valley and San Juan Bautista sites for periods of eight, three and seven months respectively, suggest that short period tilt signals in the range 5 min < T < 3-5 h and ranging in amplitude from 5 ?? 10-8 to 10-6 rad, but not including step offsets, show excellent agreement on closely spaced instruments. Agreement is not as good in this period range for instruments at San Juan Bautista with a separation of 200 m. Signals of interest observed in this period range include coseismic tilts, teleseisms and tilts associated with creep events. Tilt signals in the period range 3-5 h < T < 2- 5 weeks are not always coherent at all three of the redundant tilt sites studied. Tilt signals in this period range have amplitudes up to 5 ?? 10-6 rad and wavelengths down to at least the instrument separation at the closely spaced sites (~several meters). Regarding longerterm coherency, the instruments at San Juan Bautista with 200-m spacing, agree within 0.5 ??rad for the N-S component and 0.7 jurad for the E-W component for a period of two months. The closely spaced redundant instruments at Aromas agree within 2 ??rad for the N-S component and 1 ??rad for the E-W component for the eight-month period of operation. Data from the three sites have been checked for effects of temperature, atmospheric pressure and rainfall. The latter appears to be critically site dependent. The worst case tilts for 1 inch of rainfall can be more than 1 jurad with a duration of a few days to a week. Typical rain-induced tilts are less than 0.3 ??rad for 1 inch of rain. The two instruments at the Sage Ranch

  4. Parameters controlling the milling process applied to the production of AI-Cu-Mg-Si alloys (2214) by mechanical alloying

    NASA Astrophysics Data System (ADS)

    Yan, X. X.; Bois, N.; Cizeron, G.

    1994-10-01

    In this study are analysed the respective influence of various parameters (processing time t_p, speed of rotation ω of the attritor axis and ratio R : the ball to powder masses) on the mechanical alloying process applied to mixed powders in order to obtain Al-Cu-Mg-Si alloys (2214 type). It was deduced that the most effective parameter is ω. Furthermore the optimum processing conditions were determined as well as the main characteristics of the powder resulting from the milling process using microscopy and X-ray diffraction. The sintering ability of samples pressed from " MA " powders was also studied thanks to dilatometric tests and compared with that of initial powder mixtures. A relationship between the size reduction of Al particles and the milling parameters is established. Dans cette étude ont été analysées les influences respectives de divers paramètres (temps de broyage t_p vitesse de rotation de l'axe de l'attriteur ω et rapport R : masse des billes/masse des poudres) sur le processus de mécanosynthèse appliqué à des poudres mélangées en vue d'obtenir des alliages Al-Cu-Mg-Si (type 2214). Il en a été déduit que le paramètre essentiel était ω. En outre, par microscopie et par diffraction X, les conditions optimales de broyage ont été déterminées, ainsi que les caractéristiques essentielles de la poudre résultant du processus d'attrition. L'aptitude au frittage des comprimés réalisés à partir de poudres traitées par voie mécanique a également été étudiée par dilatométrie et comparée à celle de la poudre initiale. Une relation permettant de relier la diminution de la taille des particules d'aluminium aux paramètres d'attrition a été établie.

  5. La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

    NASA Astrophysics Data System (ADS)

    Arroyo Betancourt, Luz I.

    Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las

  6. Migration and spawning of radio-tagged zulega Prochilodus argenteus in a dammed Brazilian river

    USGS Publications Warehouse

    Godinho, Alexandre L.; Kynard, B.

    2006-01-01

    It is difficult for agencies to evaluate the impacts of the many planned dams on Sa??o Francisco River, Brazil, migratory fishes because fish migrations are poorly known. We conducted a study on zulega Prochilodus argenteus, an important commercial and recreational fish in the Sa??o Francisco River, to identify migrations and spawning areas and to determine linear home range. During two spawning seasons (2001-2003), we radio-tagged fish in three main-stem reaches downstream of Tre??s Marias Dam (TMD), located at river kilometer (rkm) 2,109. We tagged 10 fish at Tre??s Marias (TM), which is 5 km downstream of TMD; 12 fish at Pontal, which is 28 km downstream of TMD and which includes the mouth of the Abaete?? River, and 10 fish at Cilga, which is 45 km downstream of TMD. Late-stage (ripe) adults tagged in each area during the spawning season remained at or near the tagging site, except for four Cilga fish that went to Pontal and probably spawned. The Pontal area at the Abaete?? River mouth was the most important spawning site we found. Prespawning fish moved back and forth between main-stem staging areas upstream of the Abaete?? River mouth and Pontal for short visits. These multiple visits were probably needed as ripe fish waited for spawning cues from a flooding Abaete?? River. Some fish homed to prespaw ning staging areas, spawning areas, and nonspawning areas. The migratory style of zulega was dualistic, with resident and migratory fish. Total linear home range was also dualistic, with small (<26-km) and large (53-127-km) ranges. The locations of spawning areas and home ranges suggest that the Pontal group (which includes Cilga fish) is one population that occupies about 110 km. The Pontal population overlaps a short distance with a population located downstream of Cilga. Movements of late-stage TM adults suggest that the TM group is a separate population, possibly with connections to populations upstream of TMD. ?? Copyright by the American Fisheries Society

  7. VizieR Online Data Catalog: Photometry and spectroscopy of V501 Mon (Torres+, 2015)

    NASA Astrophysics Data System (ADS)

    Torres, G.; Lacy, C. H. S.; Pavlovski, K.; Fekel, F. C.; Muterspaugh, M. W.

    2016-06-01

    Spectroscopic observations of V501 Mon were carried out with three different instruments. They began at the Harvard-Smithsonian Center for Astrophysics (CfA) in 2005 November, using the now decommissioned Digital Speedometer (DS) mounted on the 1.5m Tillinghast reflector at the Fred L. Whipple Observatory on Mount Hopkins (AZ). Seven spectra were recorded through 2009 March with an intensified photon-counting Reticon detector, and cover a narrow span of 45Å centered at 5190Å (MgIb triplet). The resolving power of this instrument was R~35000, and the signal-to-noise ratios of the spectra range from 13 to 22 per resolution element of 8.5km/s. Thirty seven additional spectra were gathered from 2009 November to 2015 February with the Tillinghast Reflector Echelle Spectrograph (TRES) on the same telescope. This bench-mounted, fiber-fed instrument provides a resolving power of R~44000 in 51 orders over the wavelength span 3900-9100Å. The signal-to-noise ratios of the 37 spectra range from 8 to 56 per resolution element of 6.8km/s. The heliocentric velocities we obtained from the DS and TRES spectra are listed in Table2. Between 2011 October and 2015 February we also obtained 57 usable spectra of V501 Mon with the Tennessee State University 2m Automatic Spectroscopic Telescope (AST) and a fiber-fed echelle spectrograph at Fairborn Observatory in southeast Arizona. The detector for these observations was a Fairchild 486 CCD, with 15μm pixels in a 4096*4096 format. The spectrograms have 48 orders ranging from 3800 to 8260Å. Because of the faintness of V501 Mon (V=12.32), we used a fiber that produced a spectral resolution of 0.4Å, corresponding to a resolving power of 15000 at 6000Å. Our spectra have typical signal-to-noise ratios per resolution element of 40 at 6000Å. We list the final values in Table3. An extensive program of CCD photometry was carried out using the NFO WebScope ear Silver City, New Mexico, for the purpose of gathering an accurate V-band light

  8. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  9. Diapycnal diffusivity in the core and oxycline of the tropical North Atlantic oxygen minimum zone

    NASA Astrophysics Data System (ADS)

    Köllner, Manuela; Visbeck, Martin; Tanhua, Toste; Fischer, Tim

    2016-08-01

    Diapycnal diffusivity estimates from two Tracer Release Experiments (TREs) and microstructure measurements in the oxycline and core of the oxygen minimum zone (OMZ) in the Eastern Tropical North Atlantic (ETNA) are compared. For the first time, two TREs within the same area at different depths were realized: the Guinea Upwelling Tracer Release Experiment (GUTRE) initiated in 2008 in the oxycline at approximately 320 m depth, and the Oxygen Supply Tracer Release Experiment (OSTRE) initiated in 2012 in the core of the OMZ at approximately 410 m depth. The mean diapycnal diffusivity Dz was found to be insignificantly smaller in the OMZ core with (1.06 ± 0.24) × 10- 5 m2 s- 1 compared to (1.11 ± 0.22) × 10- 5 m2 s- 1 90 m shallower in the oxycline. Unexpectedly, GUTRE tracer was detected during two of the OSTRE surveys which showed that the estimated diapycnal diffusivity from GUTRE over a time period of seven years was within the uncertainty of the previous estimates over a time period of three years. The results are consistent with the Dz estimates from microstructure measurements and demonstrate that Dz does not vary significantly vertically in the OMZ within the depth range of 200-600 m and does not change with time. The presence of a seamount chain in the vicinity of the GUTRE injection region did not cause enhanced Dz compared to the smoother bottom topography of the OSTRE injection region, although the analysis of vertical shear spectra from ship ADCP data showed elevated internal wave energy level in the seamount vicinity. However, the two tracer patches covered increasingly overlapping areas with time and thus spatially integrated increasingly similar fields of local diffusivity, as well as the difference in local stratification counteracted the influence of roughness on Dz. For both experiments no significant vertical displacements of the tracer were observed, thus diapycnal upwelling within the ETNA OMZ is below the uncertainty level of 5 m yr- 1.

  10. Utilisation de traceurs radioactifs pour l'évaluation du recrutement des leucocytes et des échanges vasculaires au niveau d'organes in~vivo. Description d'une méthode et discussion des problèmes d'interprétation sur quelques exemples

    NASA Astrophysics Data System (ADS)

    Bureau, M. F.

    1997-03-01

    An experimental method using simultaneously different γ emiter tracers was developed to evaluate inflammation in vivo. Experiments were performed on the anaesthetized guinea-pig to test pulmonary effects of inflammatory agents. Red blood cells, albumin and inflammatory cells (platelets or leucocytes) radiolabelled with 99m technetium, 131 iodine and 111 indium respectively were injected i.v. Their radioactivities were measured on a pulmonary region by external detection and on blood samples in a well type counter. From these measurements variations of the lung contents in red blood cells, extravascular albumin and non circulating leucocytes during inflammatory stimulation were evaluated. These parameters axe indexes of blood perfusion, vascular exchanges and leucocyte sequestration respectively. Fiability of the method and meaning of the parameters evaluated are discussed. Une méthode expérimentale utilisant simultanément différents traceurs γ a été développée pour évaluer l'inflammation in vivo. Des expériences ont été réalisées chez le cobaye anesthésié pour tester l'effet pulmonaire d'agents inflammatoires. Des globules rouges, de l'albumine et des cellules inflammatoires (plaquettes ou leucocytes) radiomarqués respectivement au technetium 99m, à l'iode 131 et à l'indium 111 sont injectés i.v. Leurs radioactivités sont mesurées sur une région pulmonaire par détection externe et sur des échantillons sanguins au compteur puit. À partir de ces mesures sont évaluées les variations des contenus pulmonaires en globules rouges, en albumine extravasculaire et en leucocytes non circulants lors d'une stimulation inflammatoire. Ces paramètres sont corrélés aux modifications de la perfusion, des échanges vasculaires et de la séquestration leucocytaire. La fiabilité de la méthode et la signification des paramètres évalués sont discutées.

  11. Exposure to 3,3',5-triiodothyronine affects histone and RNA polymerase II modifications, but not DNA methylation status, in the regulatory region of the Xenopus laevis thyroid hormone receptor βΑ gene.

    PubMed

    Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi

    2015-11-01

    Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene. PMID:26417689

  12. Live 107Pd in Some Group II and III Irons and the Time-Scales of Fe-Ni Segregations in the Early Solar System

    NASA Astrophysics Data System (ADS)

    Chen, J. H.; Wasserburg, G. J.

    1996-03-01

    In a recent report, we presented evidence for excesses (*) of ^107Ag* due to ^107Pd decay (tau bar = 6.5 Ma) in a wide variety of iron meteorites, some pallasites and mesosiderites. They provide unambiguous evidence of the in situ decay of ^107Pd in planetary differentiates. A key problem of early solar system chronologies has been the ability to interrelate different short-lived and long-lived chronometers. Evidence for the presence of both live ^107Pd and ^53Mn (tau bar = 5.3 Ma) in the early solar system has been found in several meteorites. However, there appear to be major discrepancies between the ^107Pd and ^53Mn chronometers. New Re-Os data on iron meteorites seem to support the small time differences for formation of iron meteorites as inferred by the Pd-Ag system. In this study, we selected samples on which Re-Os data were available. These include Coahuila (IIA) metal and Tres Castillos (IIIA) metal and sulfide.

  13. Le carcinome neuro-endocrine cutané primitif: à propos d'un nouveau cas et revue de la littérature

    PubMed Central

    Boukind, Samira; Elatiqi, Oumkeltoum; Dlimi, Meriem; Elamrani, Driss; Benchamkha, Yassine; Ettalbi, Saloua

    2015-01-01

    Le carcinome neuro- endocrine cutané primitif (CNEC) est une tumeur cutanée rare et agressive du sujet âgé, favorisée par le soleil et l'immunodépression. Elle est caractérisée par une évolution agressive avec un fort taux de récidive, une évolution ganglionnaire régionale et un risque de métastases à distance. Nous rapportons un cas de cette tumeur chez un patient âgé de 67 ans sous forme d'un placard nodulaire hémorragique mesurant 16 /14 cm. Le patient a bénéficié d'une exérèse chirurgicale large avec couverture de la perte de substance par un lambeau musculo-cutané du muscle grand dorsal, un curage ganglionnaire axillaire et une radiothérapie adjuvante. Après un recul de 2 ans et 2 mois, le patient est toujours vivant sans métastase ni récidive. La littérature étant pauvre, la prise en charge diagnostique et thérapeutique est controversée et donc hétérogène. Globalement le pronostic est mauvais, et certains paramètres corrélés au pronostic sont précisés. PMID:26185585

  14. New avenues for regulation of lipid metabolism by thyroid hormones and analogs.

    PubMed

    Senese, Rosalba; Lasala, Pasquale; Leanza, Cristina; de Lange, Pieter

    2014-01-01

    Weight loss due to negative energy balance is a goal in counteracting obesity and type 2 diabetes mellitus. The thyroid is known to be an important regulator of energy metabolism through the action of thyroid hormones (THs). The classic, active TH, 3,5,3'-triiodo-L-thyronine (T3) acts predominantly by binding to nuclear receptors termed TH receptors (TRs), that recognize TH response elements (TREs) on the DNA, and so regulate transcription. T3 also acts through "non-genomic" pathways that do not necessarily involve TRs. Lipid-lowering therapies have been suggested to have potential benefits, however, the establishment of comprehensive therapeutic strategies is still awaited. One drawback of using T3 in counteracting obesity has been the occurrence of heart rhythm disturbances. These are mediated through one TR, termed TRα. The end of the previous century saw the exploration of TH mimetics that specifically bind to TR beta in order to prevent cardiac disturbances, and TH derivatives such as 3,5-diiodo-L-thyronine (T2), that possess interesting biological activities. Several TH derivatives and functional analogs have low affinity for the TRs, and are suggested to act predominantly through non-genomic pathways. All this has opened new perspectives in thyroid physiology and TH derivative usage as anti-obesity therapies. This review addresses the pros and cons of these compounds, in light of their effects on energy balance regulation and on lipid/cholesterol metabolism. PMID:25538628

  15. Des proprietes de l'etat normal du modele de Hubbard bidimensionnel

    NASA Astrophysics Data System (ADS)

    Lemay, Francois

    Depuis leur decouverte, les etudes experimentales ont demontre que les supra-conducteurs a haute temperature ont une phase normale tres etrange. Les proprietes de ces materiaux ne sont pas bien decrites par la theorie du liquide de Fermi. Le modele de Hubbard bidimensionnel, bien qu'il ne soit pas encore resolu, est toujours considere comme un candidat pour expliquer la physique de ces composes. Dans cet ouvrage, nous mettons en evidence plusieurs proprietes electroniques du modele qui sont incompatibles avec l'existence de quasi-particules. Nous montrons notamment que la susceptibilite des electrons libres sur reseau contient des singularites logarithmiques qui influencent de facon determinante les proprietes de la self-energie a basse frequence. Ces singularites sont responsables de la destruction des quasi-particules. En l'absence de fluctuations antiferromagnetiques, elles sont aussi responsables de l'existence d'un petit pseudogap dans le poids spectral au niveau de Fermi. Les proprietes du modele sont egalement etudiees pour une surface de Fermi similaire a celle des supraconducteurs a haute temperature. Un parallele est etabli entre certaines caracteristiques du modele et celles de ces materiaux.

  16. En la búsqueda de características en eyecciones coronales de masa que discriminen entre dos paradigmas físicos en modelos de ECMs

    NASA Astrophysics Data System (ADS)

    Paissan, G.; Stenborg, G.; Rovira, M.

    Se conocen tres diferentes fenómenos de gran escala que ocurren en la atmósfera solar, denominados eyecciones coronales de masa (ECMs), protuberancias eruptivas y grandes fulguraciones de dos bandas. Estos fenómenos están estrechamente relacionados y podrían ser distintas manifestaciones de un único proceso físico. Las ECMs son definidas como eyecciones de gran escala de masa y flujo magnético desde la baja corona al espacio interplanetario. Desde su descubrimiento en los '70, muchos modelos han sido propuestos para explicar su origen y evolución. La explicación física de las ECMs es un tema de debate intenso. No obstante, los modelos pueden sintetizarse en dos grandes grupos: 1) los modelos de inyección de flujo y 2) los modelos de almacenamiento y liberación. En este trabajo, se presentan los estudios realizados con una serie de eventos observados con el coronógrafo MICA (Mirror Coronograph for Argentina), el telescopio en H-alfa HASTA (H-alpha Solar Telescope for Argentina) y los coronógrafos C2 y C3 de la sonda SOHO (Solar and Heliospheric Observatory). Los eventos que pudieron ser identificados como ECMs son contrastados dentro del esquema de los dos paradigmas teóricos propuestos.

  17. Biocatalytic Production of Trehalose from Maltose by Using Whole Cells of Permeabilized Recombinant Escherichia coli.

    PubMed

    Zheng, Zhaojuan; Xu, Ying; Sun, Ye; Mei, Wending; Ouyang, Jia

    2015-01-01

    Trehalose is a non-reducing disaccharide, which can protect proteins, lipid membranes, and cells from desiccation, refrigeration, dehydration, and other harsh environments. Trehalose can be produced by different pathways and trehalose synthase pathway is a convenient, practical, and low-cost pathway for the industrial production of trehalose. In this study, 3 candidate treS genes were screened from genomic databases of Pseudomonas and expressed in Escherichia coli. One of them from P. stutzeri A1501 exhibited the best transformation ability from maltose into trehalose and the least byproduct. Thus, whole cells of this recombinant E. coli were used as biocatalyst for trehalose production. In order to improve the conversion rate of maltose to trehalose, optimization of the permeabilization and biotransformation were carried out. Under optimal conditions, 92.2 g/l trehalose was produced with a high productivity of 23.1 g/(l h). No increase of glucose was detected during the whole course. The biocatalytic process developed in this study might serve as a candidate for the large scale production of trehalose. PMID:26462117

  18. Digitalización de diapositivas del Sol en H α

    NASA Astrophysics Data System (ADS)

    Missio, H.; Montenegro, C.; Montenegro, R.

    El objetivo de este trabajo ha sido el de obtener imágenes digitalizadas de las diapositivas tomadas del Sol en luz de hidrógeno de la línea correspondiente a Hα, y de esta manera llegar a convertir las mismas a un archivo digital para poder ser tratadas luego por computadora y poder contabilizar con exactitud, mediante un programa adecuado para tal fin, las zonas activas del Sol en la imagen digitalizada. En principio, para llegar a esto se pensó en la utilización de medios accesibles, y como detector se utilizó un fototransistor ubicado dentro de un soporte rectangular sobre dos ejes de desplazamiento X e Y. Se han obtenido con este procedimiento imágenes de buena calidad, construídas a partir de tres datos digitalizados en cada barrido que aportan la posición X e Y y la intensidad del pixel en ese punto indicada en 255 tonos de grises.

  19. Natural Enemies of the Frankliniella Complex Species (Thysanoptera: Thripidae) in Ataulfo Mango Agroecosystems.

    PubMed

    Rocha, Franklin H; Infante, Francisco; Castillo, Alfredo; Ibarra-Nuñez, Guillermo; Goldarazena, Arturo; Funderburk, Joe E

    2015-01-01

    A field survey was conducted in Ataulfo mango (Mangifera indica L.) orchards in Chiapas, Mexico, with the objective of determining the natural enemies of the Frankliniella complex species (Thysanoptera: Thripidae). Seven species of this genus feed and reproduce in large numbers during the mango flowering. Two representative orchards were selected: the orchard "Tres A" characterized by an intensive use of agrochemicals directed against thrips, and the orchard "La Escondida" that did not spray insecticides. During mango flowering, five inflorescences were randomly collected every 5 d in both orchards, for a total of 18 sampling dates. Results revealed the presence of 18 species of arthropods that were found predating on Frankliniella. There were 11 species in the families Aeolothripidae, Phlaeothripidae, Formicidae, Anthocoridae and Chrysopidae; and seven species of spiders in the families Araneidae, Tetragnathidae, and Uloboridae. Over 88% of predators were anthocorids, including, Paratriphleps sp. (Champion), Orius insidiosus (Say), Orius tristicolor (White), and O. perpunctatus (Reuter). The orchard that did not spray insecticides had a significantly higher number of predators suggesting a negative effect of the insecticides on the abundance of these organisms. PMID:26246440

  20. Profil anthropometrique des enfants scolarises tananariviens

    PubMed Central

    Razafimanantsoa, Fetralinjiva; Razafindramaro, Notahiana; Raherimandimby, Hasina; Robinson, Annick; RakotoAlson, Olivat; Rasamindrakotroka, Andry

    2013-01-01

    Les enfants tananariviens sont en état de malnutrition chronique. Notre objectif est d’évaluer l'indice de masse corporelle (IMC) pour estimer les enfants apparemment "sains". Une enquête et une mesure de la taille et du poids des enfants scolarisés tananariviens de 6 à 11 ans ont été réalisées. Après leur accord, la taille et l'indice de masse corporelle des 442 enfants tirés au hasard ont été ainsi obtenus. L'analyse de la moyenne de la taille a révélé une différence significative à 8 ans, une différence non évidente sur l'indice de masse corporelle. La comparaison avec les valeurs de référence (OMS 2006) a montré un retard statural de 34% avec une tendance globale à la hausse et un déficit pondéral égal à 5,5% selon le z score. Ainsi, au sein d'une population malnutrie, l'indice de masse corporelle pourrait être utilisé comme un des paramètres à considérer dans l’évaluation de l’état de santé pour classer ces enfants en bonne santé apparente. PMID:24711862

  1. Benchmarking the power of amateur observatories for TTV exoplanets detection

    NASA Astrophysics Data System (ADS)

    Baluev, Roman V.; Sokov, Evgenii N.; Shaidulin, Vakhit Sh.; Sokova, Iraida A.; Jones, Hugh R. A.; Tuomi, Mikko; Anglada-Escudé, Guillem; Benni, Paul; Colazo, Carlos A.; Schneiter, Matias E.; D'Angelo, Carolina S. Villarreal; Burdanov, Artem Yu.; Fernández-Lajús, Eduardo; Baştürk, Özgür; Hentunen, Veli-Pekka; Shadick, Stan

    2015-07-01

    We perform an analysis of ˜80 000 photometric measurements for the following 10 stars hosting transiting planets: WASP-2, -4, -5, -52, Kelt-1, CoRoT-2, XO-2, TrES-1, HD 189733, GJ 436. Our analysis includes mainly transit light curves from the Exoplanet Transit Database, public photometry from the literature, and some proprietary photometry privately supplied by other authors. Half of these light curves were obtained by amateurs. From this photometry we derive 306 transit timing measurements, as well as improved planetary transit parameters. Additionally, for 6 of these 10 stars we present a set of radial velocity measurements obtained from the spectra stored in the HARPS, HARPS-N and SOPHIE archives using the HARPS-TERRA pipeline. Our analysis of these transit timing and radial velocity data did not reveal significant hints of additional orbiting bodies in almost all of the cases. In the WASP-4 case, we found hints of marginally significant TTV signals having amplitude 10-20 s, although their parameters are model dependent and uncertain, while radial velocities did not reveal statistically significant Doppler signals.

  2. Mapping of sites in forest stands.

    PubMed

    Netto, Sylvio Péllico; Stefanello, Flavio R; Pelissari, Allan L; David, Hassan C

    2014-12-01

    Generally, the forest companies use the total one year planting area as a minimum stratum of the total population and, consequently, the forest inventory processing has been conducted by applying the stratified random sampling to it. This study was carried out in the National Forest of Tres Barras, Brazil, and it aimed to classify and map the sites of Pinus elliottii stands. A systematic sampling was structured into clusters and applied independently by compartments. The clusters, in maltese cross, were composed of four sampling subunits, using Prodan sampling method with a fixed number of six trees. By analysis of the methodology it was possible to confirm the hypothesis: a) the selective thinning cause expressive increase of volumetric variability within compartments; b) the variation of sites within the compartments causes volumetric expansion of variance and this grows proportionally to the quality of the sites; c) the stratification in sites results in minimum variance within them; d) the stratification in sites resulted in until to 91% reduction of variances within them. PMID:25590737

  3. Comparaison de lois de commande. Régulation numérique de courant dans l'association convertisseur-machine

    NASA Astrophysics Data System (ADS)

    Kalinowski, D.; Bergmann, C.

    1991-05-01

    This article deals with a comparison of different numerical command laws, as regards dynamical characteristics and robustness, for direct current motor control. The power converter, which uses bi-directional switches, connect directly the three-phase source to the servo-motor. Simulations, compared with experimental results, show the variations of the dynamical characteristics regarding perturbations, that is to say: model parameters are not constant, the converter is not linear, and there are numerical saturations. Cet article présente différentes stratégies de commande, sur un critère de rapidité/robustesse, pour une régulation numérique du courant dans un servo-moteur à courant continu. Le convertisseur de puissance, à la base de la structure, est constitué d'interrupteurs bidirectionnels et réalise l'alimentation directe de la charge à travers un réseau triphasé. Les simulations, confrontées aux résultats expérimentaux, montrent la très nette dépendance des caractéristiques dynamiques finales vis-à-vis des éléments perturbateurs à savoir : la variation des paramètres constituants le modèle, les non-linéarités des convertisseurs et les saturations numériques.

  4. Biomechanically Constrained Surface Registration: Application to MR-TRUS Fusion for Prostate Interventions.

    PubMed

    Khallaghi, Siavash; Sánchez, C Antonio; Rasoulian, Abtin; Sun, Yue; Imani, Farhad; Khojaste, Amir; Goksel, Orcun; Romagnoli, Cesare; Abdi, Hamidreza; Chang, Silvia; Mousavi, Parvin; Fenster, Aaron; Ward, Aaron; Fels, Sidney; Abolmaesumi, Purang

    2015-11-01

    In surface-based registration for image-guided interventions, the presence of missing data can be a significant issue. This often arises with real-time imaging modalities such as ultrasound, where poor contrast can make tissue boundaries difficult to distinguish from surrounding tissue. Missing data poses two challenges: ambiguity in establishing correspondences; and extrapolation of the deformation field to those missing regions. To address these, we present a novel non-rigid registration method. For establishing correspondences, we use a probabilistic framework based on a Gaussian mixture model (GMM) that treats one surface as a potentially partial observation. To extrapolate and constrain the deformation field, we incorporate biomechanical prior knowledge in the form of a finite element model (FEM). We validate the algorithm, referred to as GMM-FEM, in the context of prostate interventions. Our method leads to a significant reduction in target registration error (TRE) compared to similar state-of-the-art registration algorithms in the case of missing data up to 30%, with a mean TRE of 2.6 mm. The method also performs well when full segmentations are available, leading to TREs that are comparable to or better than other surface-based techniques. We also analyze robustness of our approach, showing that GMM-FEM is a practical and reliable solution for surface-based registration. PMID:26054062

  5. [In Process Citation].

    PubMed

    Reyna, Nadia; Moreno-Rojas, Rafael; Mendoza, Laura; Parra, Karla; Linares, Sergia; Reyna, Eduardo; Cámara-Martos, Fernando

    2016-01-01

    Se estudió el consumo de tres tipos de suplementos, proteínas del lactosuero, caseínas y maltodextrinas (control) en la disminución de la ingesta energética y prolongación del efecto de saciedad de 60 mujeres obesas. Después de 10 semanas, la reducción del peso corporal, IMC, % de grasa corporal y circunferencia de la cintura fue significativamente mayor (p < 0,001) en el grupo que consumió las proteínas lactoséricas frente a los otros dos grupos (control y caseínas). También se observa un descenso en la ingesta energética de -383 kcal/día en las mujeres que consumieron las proteínas de lactosuero frente a un descenso de -144 kcal/día en el grupo de caseínas y de tan solo -70 kcal/día en el grupo control. Finalmente la regulación del efecto de saciedad mediante escala visual analógica fue también más efectiva en el caso de las proteínasséricas, que en el caso de las caseínas y maltodextrinas. PMID:27019242

  6. VizieR Online Data Catalog: Planetary candidates from 1st yr K2 mission (Vanderburg+, 2016)

    NASA Astrophysics Data System (ADS)

    Vanderburg, A.; Latham, D. W.; Buchhave, L. A.; Bieryla, A.; Berlind, P.; Calkins, M. L.; Esquerdo, G. A.; Welsh, S.; Johnson, J. A.

    2016-02-01

    During Campaign 0, K2 observed a field centered at RAJ2000=06:33:11.14,DEJ2000=+21:35:16.40, for a period of 80 days between March and May of 2014. During Campaign 1, K2 observed a field centered at RAJ2000=11:35:45.51,DEJ2000=+01:25:02.28 for 83 days between June and August of 2014. Field 2 of the K2 mission is centered at RAJ2000=16:24:30.34,DEJ2000=-22:26:50.28, and was observed for 79 days between 2014 August and November. Field 3 of the K2 mission is centered at RAJ2000=22:26:39.68,DEJ2000=-11:05:47.99, and was observed for 69 days between 2014 November and 2015 February. We observed 68 stars with the high-resolution Tillinghast Reflector Echelle Spectrograph (TRES; on the 1.5m telescope at Fred L. Whipple Observatory (FLWO) on Mt. Hopkins, Arizona; R=44000) at least once, collecting a total of 101 spectra, and extracted the spectra using the procedure described in Buchhave et al. (2010, J/ApJ/720/1118). See tables 3 and 4. (4 data files).

  7. INITIAL CHARACTERISTICS OF KEPLER SHORT CADENCE DATA

    SciTech Connect

    Gilliland, Ronald L.; Jenkins, Jon M.; Caldwell, Douglas A.; Clarke, Bruce D.; Quintana, Elisa V.; Twicken, Joseph D.; Van Cleve, Jeffrey E.; Hall, Jennifer; Klaus, Todd; McCauliff, Sean

    2010-04-20

    The Kepler Mission offers two options for observations-either long cadence (LC) used for the bulk of core mission science, or short cadence (SC) which is used for applications such as asteroseismology of solar-like stars and transit timing measurements of exoplanets where the 1 minute sampling is critical. We discuss the characteristics of SC data obtained in the 33.5 day long Quarter 1 observations with Kepler which completed on 2009 June 15. The truly excellent time series precisions are nearly Poisson limited at 11th magnitude providing per-point measurement errors of 200 parts-per-million per minute. For extremely saturated stars near seventh magnitude precisions of 40 ppm are reached, while for background limited measurements at 17th magnitude precisions of 7 mmag are maintained. We note the presence of two additive artifacts, one that generates regularly spaced peaks in frequency, and one that involves additive offsets in the time domain inversely proportional to stellar brightness. The difference between LC and SC sampling is illustrated for transit observations of TrES-2.

  8. La opacidad atmosférica del CASLEO a ondas milimétricas

    NASA Astrophysics Data System (ADS)

    Bareilles, F.; Olalde, J.; Picardo, C.; Guarrera, L.; Arnal, E. M.; Morras, R.; Perilli, D.; Salazar, P.

    Mediante el uso de un radiómetro que trabaja en la frecuencia de 210 GHz, se han realizado mediciones de la transparencia de la atmósfera a esa frecuencia. Los sitios en los que se han realizado las medidas, corresponden al Cerro Negro de la Tina (Cerro Burek), ubicado a unos 2650 m de altura, y a un sitio ubicado a unos 3400 m de altura, localizado en la Pampa del Jarillal. Las mediciones forman parte de una campaña que cubrirá un lapso de tres años, durante la cual se caracterizan distintas zonas ubicadas en la cordillera. Los resultados que se comunican fueron obtenidos durante el período diciembre de 2002 a septiembre de 2003. Se realiza una comparación preliminar entre la opacidad atmosférica de los lugares mencionados y aquélla de otros sitios en los que se encuentran instaladas facilidades observacionales que operan en la banda milimétrica y submilimétrica del espectro.

  9. Production de faisceaux EPR à l'aide d'un oscillateur paramétrique optique à auto-verrouillage de phase

    NASA Astrophysics Data System (ADS)

    Longchambon, L.; Laurat, J.; Treps, N.; Ducci, S.; Maître, A.; Coudreau, T.; Fabre, C.

    2002-06-01

    Nous étudions théoriquement les propriétés quantiques des faisceaux lumineux continus orthogonalement polarisés émis par un Oscillateur Paramétrique Optique (OPO) de type II contenant une lame biréfringente. Quand les axes optiques de la lame sont tournés par rapport à ceux du cristal paramétrique, un couplage apparaît entre les faisceaux signal et complémentaire qui entraîne un verrouillage de phase entre les deux modes et un fonctionnement à dégénérescence de fréquence à l'intérieur d'une zone d'accrochage. Les corrélations quantiques entre les deux faisceaux permettent de définir les zones dans l'espace des paramètres expérimentaux où les différents critères associés à l'intrication EPR utilisés en information quantique sont vérifiés.

  10. Algorithmes et architectures pour ordinateurs quantiques supraconducteurs

    NASA Astrophysics Data System (ADS)

    Blais, Alexandre

    Depuis sa formulation, la theorie de l'information a ete basee, implicitement, sur les lois de la physique classique. Une telle formulation est toutefois incomplete puisqu'elle ne tient pas compte de la realite quantique. Au cours des vingt dernieres annees, l'expansion de la theorie de l'information englobant les effets purement quantiques a connu un interet grandissant. La realisation d'un systeme de traitement de l'information quantique, un ordinateur quantique, presente toutefois de nombreux defis. Dans ce document, on s'interesse a differents aspects concernant ces defis. On commence par presenter des concepts algorithmiques comme l'optimisation de calculs quantiques et le calcul quantique geometrique. Par la suite, on s'interesse au design et a differents aspects de l'utilisation de qubits bases sur les jonctions Josephson. En particulier, un nouveau design de qubit supraconducteur est suggere. On presente aussi une approche originale pour l'interaction entre qubits. Cette approche est tres generale puisqu'elle peut etre appliquee a differents designs de qubits. Finalement, on s'interesse a la lecture des qubits supraconducteurs de flux. Le detecteur suggere ici a l'avantage de pouvoir etre decouple du qubit lorsqu'il n'y a pas de mesure en cours.