Science.gov

Sample records for defective ribosome biogenesis

  1. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  2. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  3. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  4. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  5. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  6. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  7. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  8. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  9. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  10. Activation of the tumor suppressor p53 upon impairment of ribosome biogenesis.

    PubMed

    Bursac, Sladana; Brdovcak, Maja Cokaric; Donati, Giulio; Volarevic, Sinisa

    2014-06-01

    Errors in ribosome biogenesis can result in quantitative or qualitative defects in protein synthesis and consequently lead to improper execution of the genetic program and the development of specific diseases. Evidence has accumulated over the last decade suggesting that perturbation of ribosome biogenesis triggers a p53-activating checkpoint signaling pathway, often referred to as the ribosome biogenesis stress checkpoint pathway. Although it was originally suggested that p53 has a prominent role in preventing diseases by monitoring the fidelity of ribosome biogenesis, recent work has demonstrated that p53 activation upon impairment of ribosome biogenesis also mediates pathological manifestations in humans. Perturbations of ribosome biogenesis can trigger a p53-dependent checkpoint signaling pathway independent of DNA damage and the tumor suppressor ARF through inhibitory interactions of specific ribosomal components with the p53 negative regulator, Mdm2. Here we review the recent advances made toward understanding of this newly-recognized checkpoint signaling pathway, its role in health and disease, and discuss possible future directions in this exciting research field. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. PMID:24514102

  11. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  12. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  13. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  14. The emerging roles of ribosome biogenesis in craniofacial development.

    PubMed

    Ross, Adam P; Zarbalis, Konstantinos S

    2014-01-01

    Neural crest cells (NCCs) are a transient, migratory cell population, which originates during neurulation at the neural folds and contributes to the majority of tissues, including the mesenchymal structures of the craniofacial skeleton. The deregulation of the complex developmental processes that guide migration, proliferation, and differentiation of NCCs may result in a wide range of pathological conditions grouped together as neurocristopathies. Recently, due to their multipotent properties neural crest stem cells have received considerable attention as a possible source for stem cell based regenerative therapies. This exciting prospect underlines the need to further explore the developmental programs that guide NCC differentiation. This review explores the particular importance of ribosome biogenesis defects in this context since a specific interface between ribosomopathies and neurocristopathies exists as evidenced by disorders such as Treacher-Collins-Franceschetti syndrome (TCS) and Diamond-Blackfan anemia (DBA). PMID:24550838

  15. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  16. Functional characterization of the ribosome biogenesis factors PES, BOP1, and WDR12 (PeBoW), and mechanisms of defective cell growth and proliferation caused by PeBoW deficiency in Arabidopsis

    PubMed Central

    Ahn, Chang Sook; Cho, Hui Kyung; Lee, Du-Hwa; Sim, Hee-Jung; Kim, Sang-Gyu; Pai, Hyun-Sook

    2016-01-01

    The nucleolar protein pescadillo (PES) controls biogenesis of the 60S ribosomal subunit through functional interactions with Block of Proliferation 1 (BOP1) and WD Repeat Domain 12 (WDR12) in plants. In this study, we determined protein characteristics and in planta functions of BOP1 and WDR12, and characterized defects in plant cell growth and proliferation caused by a deficiency of PeBoW (PES-BOP1-WDR12) proteins. Dexamethasone-inducible RNAi of BOP1 and WDR12 caused developmental arrest and premature senescence in Arabidopsis, similar to the phenotype of PES RNAi. Both the N-terminal domain and WD40 repeats of BOP1 and WDR12 were critical for specific associations with 60S/80S ribosomes. In response to nucleolar stress or DNA damage, PeBoW proteins moved from the nucleolus to the nucleoplasm. Kinematic analyses of leaf growth revealed that depletion of PeBoW proteins led to dramatically suppressed cell proliferation, cell expansion, and epidermal pavement cell differentiation. A deficiency in PeBoW proteins resulted in reduced cyclin-dependent kinase Type A activity, causing reduced phosphorylation of histone H1 and retinoblastoma-related (RBR) protein. PeBoW silencing caused rapid transcriptional modulation of cell-cycle genes, including reduction of E2Fa and Cyclin D family genes, and induction of several KRP genes, accompanied by down-regulation of auxin-related genes and up-regulation of jasmonic acid-related genes. Taken together, these results suggest that the PeBoW proteins involved in ribosome biogenesis play a critical role in plant cell growth and survival, and their depletion leads to inhibition of cell-cycle progression, possibly modulated by phytohormone signaling. PMID:27440937

  17. Functional characterization of the ribosome biogenesis factors PES, BOP1, and WDR12 (PeBoW), and mechanisms of defective cell growth and proliferation caused by PeBoW deficiency in Arabidopsis.

    PubMed

    Ahn, Chang Sook; Cho, Hui Kyung; Lee, Du-Hwa; Sim, Hee-Jung; Kim, Sang-Gyu; Pai, Hyun-Sook

    2016-09-01

    The nucleolar protein pescadillo (PES) controls biogenesis of the 60S ribosomal subunit through functional interactions with Block of Proliferation 1 (BOP1) and WD Repeat Domain 12 (WDR12) in plants. In this study, we determined protein characteristics and in planta functions of BOP1 and WDR12, and characterized defects in plant cell growth and proliferation caused by a deficiency of PeBoW (PES-BOP1-WDR12) proteins. Dexamethasone-inducible RNAi of BOP1 and WDR12 caused developmental arrest and premature senescence in Arabidopsis, similar to the phenotype of PES RNAi. Both the N-terminal domain and WD40 repeats of BOP1 and WDR12 were critical for specific associations with 60S/80S ribosomes. In response to nucleolar stress or DNA damage, PeBoW proteins moved from the nucleolus to the nucleoplasm. Kinematic analyses of leaf growth revealed that depletion of PeBoW proteins led to dramatically suppressed cell proliferation, cell expansion, and epidermal pavement cell differentiation. A deficiency in PeBoW proteins resulted in reduced cyclin-dependent kinase Type A activity, causing reduced phosphorylation of histone H1 and retinoblastoma-related (RBR) protein. PeBoW silencing caused rapid transcriptional modulation of cell-cycle genes, including reduction of E2Fa and Cyclin D family genes, and induction of several KRP genes, accompanied by down-regulation of auxin-related genes and up-regulation of jasmonic acid-related genes. Taken together, these results suggest that the PeBoW proteins involved in ribosome biogenesis play a critical role in plant cell growth and survival, and their depletion leads to inhibition of cell-cycle progression, possibly modulated by phytohormone signaling. PMID:27440937

  18. Glycogen synthase kinase-3 is involved in regulation of ribosome biogenesis in yeast.

    PubMed

    Yabuki, Yukari; Kodama, Yushi; Katayama, Masako; Sakamoto, Akiko; Kanemaru, Hirofumi; Wan, Kun; Mizuta, Keiko

    2014-01-01

    Secretory defects cause transcriptional repression of both ribosomal proteins and ribosomal RNA genes in Saccharomyces cerevisiae. Rrs1, a trans-acting factor that participates in ribosome biogenesis, is involved in the signaling pathway induced by secretory defects. Here, we found that Rrs1 interacts with two homologs of the glycogen synthase kinase-3 (GSK-3), Rim11, and Mrk1. Rrs1 possesses a repetitive consensus amino acid sequence for phosphorylation by GSK-3, and mutation of this sequence abolished the interaction of Rrs1 with Rim11 and Mrk1. Although this mutation did not affect vegetative cell growth or secretory response, disruption of all four genes encoding GSK-3 homologs, especially Mck1, diminished the transcriptional repression of ribosomal protein genes in response to secretory defects. Among the four GSK-3 kinases, Mck1 appears to be the primary mediator of this response, while the other GSK-3 kinases contribute redundantly. PMID:25035982

  19. Nom1 Mediates Pancreas Development by Regulating Ribosome Biogenesis in Zebrafish

    PubMed Central

    Qin, Wei; Chen, Zelin; Zhang, Yihan; Yan, Ruibin; Yan, Guanrong; Li, Song; Zhong, Hanbing; Lin, Shuo

    2014-01-01

    Ribosome biogenesis is an important biological process for proper cellular function and development. Defects leading to improper ribosome biogenesis can cause diseases such as Diamond-Blackfan anemia and Shwachman-Bodian-Diamond syndrome. Nucleolar proteins are a large family of proteins and are involved in many cellular processes, including the regulation of ribosome biogenesis. Through a forward genetic screen and positional cloning, we identified and characterized a zebrafish line carrying mutation in nucleolar protein with MIF4G domain 1 (nom1), which encodes a conserved nulceolar protein with a role in pre-rRNA processing. Zebrafish nom1 mutants exhibit major defects in endoderm development, especially in exocrine pancreas. Further studies revealed that impaired proliferation of ptf1a-expressing pancreatic progenitor cells mainly contributed to the phenotype. RNA-seq and molecular analysis showed that ribosome biogenesis and pre-mRNA splicing were both affected in the mutant embryos. Several defects of ribosome assembly have been shown to have a p53-dependent mechanism. In the nom1 mutant, loss of p53 did not rescue the pancreatic defect, suggesting a p53-independent role. Further studies indicate that protein phosphatase 1 alpha, an interacting protein to Nom1, could partially rescue the pancreatic defect in nom1 morphants if a human nucleolar localization signal sequence was artificially added. This suggests that targeting Pp1α into the nucleolus by Nom1 is important for pancreatic proliferation. Altogether, our studies revealed a new mechanism involving Nom1 in controlling vertebrate exocrine pancreas formation. PMID:24967912

  20. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  1. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  2. The Ribosome Biogenesis Factor Nol11 Is Required for Optimal rDNA Transcription and Craniofacial Development in Xenopus

    PubMed Central

    Griffin, John N.; Sondalle, Samuel B.; del Viso, Florencia; Baserga, Susan J.; Khokha, Mustafa K.

    2015-01-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  3. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    PubMed

    Griffin, John N; Sondalle, Samuel B; Del Viso, Florencia; Baserga, Susan J; Khokha, Mustafa K

    2015-03-01

    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  4. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish.

    PubMed

    Bielczyk-Maczyńska, Ewa; Lam Hung, Laure; Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A; Wali, Neha; Warren, Alan J; Barroso, Inês; Stemple, Derek L; Cvejic, Ana

    2015-12-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  5. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish

    PubMed Central

    Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A.; Wali, Neha; Warren, Alan J.; Barroso, Inês; Stemple, Derek L.; Cvejic, Ana

    2015-01-01

    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9 sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9 sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9 sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9 sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9 sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  6. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    PubMed

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  7. The methyltransferase adaptor protein Trm112 is involved in biogenesis of both ribosomal subunits

    PubMed Central

    Sardana, Richa; Johnson, Arlen W.

    2012-01-01

    We previously identified Bud23 as the methyltransferase that methylates G1575 of rRNA in the P-site of the small (40S) ribosomal subunit. In this paper, we show that Bud23 requires the methyltransferase adaptor protein Trm112 for stability in vivo. Deletion of Trm112 results in a bud23Δ-like mutant phenotype. Thus Trm112 is required for efficient small-subunit biogenesis. Genetic analysis suggests the slow growth of a trm112Δ mutant is due primarily to the loss of Bud23. Surprisingly, suppression of the bud23Δ-dependent 40S defect revealed a large (60S) biogenesis defect in a trm112Δ mutant. Using sucrose gradient sedimentation analysis and coimmunoprecipitation, we show that Trm112 is also involved in 60S subunit biogenesis. The 60S defect may be dependent on Nop2 and Rcm1, two additional Trm112 interactors that we identify. Our work extends the known range of Trm112 function from modification of tRNAs and translation factors to both ribosomal subunits, showing that its effects span all aspects of the translation machinery. Although Trm112 is required for Bud23 stability, our results suggest that Trm112 is not maintained in a stable complex with Bud23. We suggest that Trm112 stabilizes its free methyltransferase partners not engaged with substrate and/or helps to deliver its methyltransferase partners to their substrates. PMID:22956767

  8. Two orthogonal cleavages separate subunit RNAs in mouse ribosome biogenesis

    PubMed Central

    Wang, Minshi; Anikin, Leonid; Pestov, Dimitri G.

    2014-01-01

    Ribosome biogenesis is a dynamic multistep process, many features of which are still incompletely documented. Here, we show that changes in this pathway can be captured and annotated by means of a graphic set of pre-rRNA ratios, a technique we call Ratio Analysis of Multiple Precursors (RAMP). We find that knocking down a ribosome synthesis factor produces a characteristic RAMP profile that exhibits consistency across a range of depletion levels. This facilitates the inference of affected steps and simplifies comparative analysis. We applied RAMP to examine how endonucleolytic cleavages of the mouse pre-rRNA transcript in the internal transcribed spacer 1 (ITS1) are affected by depletion of factors required for maturation of the small ribosomal subunit (Rcl1, Fcf1/Utp24, Utp23) and the large subunit (Pes1, Nog1). The data suggest that completion of early maturation in a subunit triggers its release from the common pre-rRNA transcript by stimulating cleavage at the proximal site in ITS1. We also find that splitting of pre-rRNA in the 3′ region of ITS1 is prevalent in adult mouse tissues and quiescent cells, as it is in human cells. We propose a model for subunit separation during mammalian ribosome synthesis and discuss its implications for understanding pre-rRNA processing pathways. PMID:25190460

  9. Ribosome biogenesis: emerging evidence for a central role in the regulation of skeletal muscle mass†

    PubMed Central

    Chaillou, Thomas; Kirby, Tyler J.; McCarthy, John J.

    2016-01-01

    The ribosome is a supramolecular ribonucleoprotein complex that functions at the heart of the translation machinery to convert mRNA into protein. Ribosome biogenesis is the primary determinant of translational capacity of the cell and accordingly has an essential role in the control of cell growth in eukaryotes. Cumulative evidence supports the hypothesis that ribosome biogenesis has an important role in the regulation of skeletal muscle mass. The purpose of this review is to, first, summarize the main mechanisms known to regulate ribosome biogenesis and, second, put forth the hypothesis that ribosome biogenesis is a central mechanism used by skeletal muscle to regulate protein synthesis and control skeletal muscle mass in response to anabolic and catabolic stimuli. The mTORC1 and Wnt/β-catenin/c-myc signaling pathways are discussed as the major pathways that work in concert with each of the three RNA polymerases (RNA Pol I, II and III) in regulating ribosome biogenesis. Consistent with our hypothesis, activation of these two pathways has been shown to be associated with ribosome biogenesis during skeletal muscle hypertrophy. Although further study is required, the finding that ribosome biogenesis is altered under catabolic states, in particular during disuse atrophy, suggests that its activation represents a novel therapeutic target to reduce or prevent muscle atrophy. Lastly, the emerging field of ribosome specialization is discussed and its potential role in the regulation of gene expression during periods of skeletal muscle plasticity. PMID:24604615

  10. BUD22 Affects Ty1 Retrotransposition and Ribosome Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Dakshinamurthy, Arun; Nyswaner, Katherine M.; Farabaugh, Philip J.; Garfinkel, David J.

    2010-01-01

    A variety of cellular factors affect the movement of the retrovirus-like transposon Ty1. To identify genes involved in Ty1 virus-like particle (VLP) function, the level of the major capsid protein (Gag-p45) and its proteolytic precursor (Gag-p49p) was monitored in a subset of Ty1 cofactor mutants. Twenty-nine of 87 mutants contained alterations in the level of Gag; however, only bud22Δ showed a striking defect in Gag processing. BUD22 affected the +1 translational frameshifting event required to express the Pol proteins protease, integrase, and reverse transcriptase. Therefore, it is possible that the bud22Δ mutant may not produce enough functional Ty1 protease to completely process Gag-p49 to p45. Furthermore, BUD22 is required for 18S rRNA processing and 40S subunit biogenesis and influences polysome density. Together our results suggest that BUD22 is involved in a step in ribosome biogenesis that not only affects general translation, but also may alter the frameshifting efficiency of ribosomes, an event central to Ty1 retrotransposition. PMID:20498295

  11. A liaison between mTOR signaling, ribosome biogenesis and cancer☆

    PubMed Central

    Gentilella, Antonio; Kozma, Sara C.; Thomas, George

    2016-01-01

    The ability to translate genetic information into functional proteins is considered a landmark in evolution. Ribosomes have evolved to take on this responsibility and, although there are some differences in their molecular make-up, both prokaryotes and eukaryotes share a common structural architecture and similar underlying mechanisms of protein synthesis. Understanding ribosome function and biogenesis has been the focus of extensive research since the early days of their discovery. In the last decade however, new and unexpected roles have emerged that place deregulated ribosome biogenesis and protein synthesis at the crossroads of pathological settings, particularly cancer, revealing a set of novel cellular checkpoints. Moreover, it is also becoming evident that mTOR signaling, which regulates an array of anabolic processes, including ribosome biogenesis, is often exploited by cancer cells to sustain proliferation through the upregulation of global protein synthesis. The use of pharmacological agents that interfere with ribosome biogenesis and mTOR signaling has proven to be an effective strategy to control cancer development clinically. Here we discuss the most recent findings concerning the underlying mechanisms by which mTOR signaling controls ribosome production and the potential impact of ribosome bio-genesis in tumor development. This article is part of a Special Issue entitled: Translation and Cancer. PMID:25735853

  12. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  13. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    PubMed

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300

  14. Rational Extension of the Ribosome Biogenesis Pathway Using Network-Guided Genetics

    PubMed Central

    Li, Zhihua; Lee, Insuk; Moradi, Emily; Hung, Nai-Jung; Johnson, Arlen W.; Marcotte, Edward M.

    2009-01-01

    Biogenesis of ribosomes is an essential cellular process conserved across all eukaryotes and is known to require >170 genes for the assembly, modification, and trafficking of ribosome components through multiple cellular compartments. Despite intensive study, this pathway likely involves many additional genes. Here, we employ network-guided genetics—an approach for associating candidate genes with biological processes that capitalizes on recent advances in functional genomic and proteomic studies—to computationally identify additional ribosomal biogenesis genes. We experimentally evaluated >100 candidate yeast genes in a battery of assays, confirming involvement of at least 15 new genes, including previously uncharacterized genes (YDL063C, YIL091C, YOR287C, YOR006C/TSR3, YOL022C/TSR4). We associate the new genes with specific aspects of ribosomal subunit maturation, ribosomal particle association, and ribosomal subunit nuclear export, and we identify genes specifically required for the processing of 5S, 7S, 20S, 27S, and 35S rRNAs. These results reveal new connections between ribosome biogenesis and mRNA splicing and add >10% new genes—most with human orthologs—to the biogenesis pathway, significantly extending our understanding of a universally conserved eukaryotic process. PMID:19806183

  15. Ribosome biogenesis in skeletal development and the pathogenesis of skeletal disorders.

    PubMed

    Trainor, Paul A; Merrill, Amy E

    2014-06-01

    The skeleton affords a framework and structural support for vertebrates, while also facilitating movement, protecting vital organs, and providing a reservoir of minerals and cells for immune system and vascular homeostasis. The mechanical and biological functions of the skeleton are inextricably linked to the size and shape of individual bones, the diversity of which is dependent in part upon differential growth and proliferation. Perturbation of bone development, growth and proliferation, can result in congenital skeletal anomalies, which affect approximately 1 in 3000 live births [1]. Ribosome biogenesis is integral to all cell growth and proliferation through its roles in translating mRNAs and building proteins. Disruption of any steps in the process of ribosome biogenesis can lead to congenital disorders termed ribosomopathies. In this review, we discuss the role of ribosome biogenesis in skeletal development and in the pathogenesis of congenital skeletal anomalies. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. PMID:24252615

  16. The NF45/NF90 Heterodimer Contributes to the Biogenesis of 60S Ribosomal Subunits and Influences Nucleolar Morphology

    PubMed Central

    Wandrey, Franziska; Montellese, Christian; Koos, Krisztian; Badertscher, Lukas; Bammert, Lukas; Cook, Atlanta G.; Zemp, Ivo; Horvath, Peter

    2015-01-01

    The interleukin enhancer binding factors ILF2 (NF45) and ILF3 (NF90/NF110) have been implicated in various cellular pathways, such as transcription, microRNA (miRNA) processing, DNA repair, and translation, in mammalian cells. Using tandem affinity purification, we identified human NF45 and NF90 as components of precursors to 60S (pre-60S) ribosomal subunits. NF45 and NF90 are enriched in nucleoli and cosediment with pre-60S ribosomal particles in density gradient analysis. We show that association of the NF45/NF90 heterodimer with pre-60S ribosomal particles requires the double-stranded RNA binding domains of NF90, while depletion of NF45 and NF90 by RNA interference leads to a defect in 60S biogenesis. Nucleoli of cells depleted of NF45 and NF90 have altered morphology and display a characteristic spherical shape. These effects are not due to impaired rRNA transcription or processing of the precursors to 28S rRNA. Consistent with a role of the NF45/NF90 heterodimer in nucleolar steps of 60S subunit biogenesis, downregulation of NF45 and NF90 leads to a p53 response, accompanied by induction of the cyclin-dependent kinase inhibitor p21/CIP1, which can be counteracted by depletion of RPL11. Together, these data indicate that NF45 and NF90 are novel higher-eukaryote-specific factors required for the maturation of 60S ribosomal subunits. PMID:26240280

  17. Interplay between trigger factor and other protein biogenesis factors on the ribosome

    NASA Astrophysics Data System (ADS)

    Bornemann, Thomas; Holtkamp, Wolf; Wintermeyer, Wolfgang

    2014-06-01

    Nascent proteins emerging from translating ribosomes in bacteria are screened by a number of ribosome-associated protein biogenesis factors, among them the chaperone trigger factor (TF), the signal recognition particle (SRP) that targets ribosomes synthesizing membrane proteins to the membrane and the modifying enzymes, peptide deformylase (PDF) and methionine aminopeptidase (MAP). Here, we examine the interplay between these factors both kinetically and at equilibrium. TF rapidly scans the ribosomes until it is stabilized on ribosomes presenting TF-specific nascent chains. SRP binding to those complexes is strongly impaired. Thus, TF in effect prevents SRP binding to the majority of ribosomes, except those presenting SRP-specific signal sequences, explaining how the small amount of SRP in the cell can be effective in membrane targeting. PDF and MAP do not interfere with TF or SRP binding to translating ribosomes, indicating that nascent-chain processing can take place before or in parallel with TF or SRP binding.

  18. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    PubMed

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. PMID:26709046

  19. MRM2 and MRM3 are involved in biogenesis of the large subunit of the mitochondrial ribosome

    PubMed Central

    Rorbach, Joanna; Boesch, Pierre; Gammage, Payam A.; Nicholls, Thomas J. J.; Pearce, Sarah F.; Patel, Dipali; Hauser, Andreas; Perocchi, Fabiana; Minczuk, Michal

    2014-01-01

    Defects of the translation apparatus in human mitochondria are known to cause disease, yet details of how protein synthesis is regulated in this organelle remain to be unveiled. Ribosome production in all organisms studied thus far entails a complex, multistep pathway involving a number of auxiliary factors. This includes several RNA processing and modification steps required for correct rRNA maturation. Little is known about the maturation of human mitochondrial 16S rRNA and its role in biogenesis of the mitoribosome. Here we investigate two methyltransferases, MRM2 (also known as RRMJ2, encoded by FTSJ2) and MRM3 (also known as RMTL1, encoded by RNMTL1), that are responsible for modification of nucleotides of the 16S rRNA A-loop, an essential component of the peptidyl transferase center. Our studies show that inactivation of MRM2 or MRM3 in human cells by RNA interference results in respiratory incompetence as a consequence of diminished mitochondrial translation. Ineffective translation in MRM2- and MRM3-depleted cells results from aberrant assembly of the large subunit of the mitochondrial ribosome (mt-LSU). Our findings show that MRM2 and MRM3 are human mitochondrial methyltransferases involved in the modification of 16S rRNA and are important factors for the biogenesis and function of the large subunit of the mitochondrial ribosome. PMID:25009282

  20. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway.

    PubMed

    Thomas, Franziska; Kutay, Ulrike

    2003-06-15

    The production of ribosomes constitutes a major biosynthetic task for cells. Eukaryotic small and large ribosomal subunits are assembled in the nucleolus and independently exported to the cytoplasm. Most nuclear export pathways require RanGTP-binding export receptors. We analyzed the role of CRM1, the export receptor for leucine-rich nuclear export signals (NES), in the biogenesis of ribosomal subunits in vertebrate cells. Inhibition of the CRM1 export pathway led to a defect in nuclear export of both 40S and 60S subunits in HeLa cells. Moreover, the export of newly made ribosomal subunits in Xenopus oocytes was efficiently and specifically competed by BSA-NES conjugates. The CRM1 dependence of 60S subunit export suggested a conserved function for NMD3, a factor proposed to be a 60S subunit export adaptor in yeast. Indeed, we observed that nuclear export of human NMD3 (hNMD3) is sensitive to leptomycin B (LMB), which inactivates CRM1. It had, however, not yet been demonstrated that Nmd3 can interact with CRM1. Using purified recombinant proteins we have shown here that hNMD3 binds to CRM1 directly, in a RanGTP-dependent manner, by way of a C-terminal NES sequence. Our results suggest that the functions of CRM1 and NMD3 in ribosomal subunit export are conserved from yeast to higher eukaryotes. PMID:12724356

  1. Concerted removal of the Erb1-Ytm1 complex in ribosome biogenesis relies on an elaborate interface.

    PubMed

    Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard

    2016-01-29

    The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7-Erb1-Ytm1 complex (or human Pes1-Bop1-Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1-Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1-Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1-Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628

  2. Visualizing ribosome biogenesis: parallel assembly pathways for the 30S subunit.

    PubMed

    Mulder, Anke M; Yoshioka, Craig; Beck, Andrea H; Bunner, Anne E; Milligan, Ronald A; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2010-10-29

    Ribosomes are self-assembling macromolecular machines that translate DNA into proteins, and an understanding of ribosome biogenesis is central to cellular physiology. Previous studies on the Escherichia coli 30S subunit suggest that ribosome assembly occurs via multiple parallel pathways rather than through a single rate-limiting step, but little mechanistic information is known about this process. Discovery single-particle profiling (DSP), an application of time-resolved electron microscopy, was used to obtain more than 1 million snapshots of assembling 30S subunits, identify and visualize the structures of 14 assembly intermediates, and monitor the population flux of these intermediates over time. DSP results were integrated with mass spectrometry data to construct the first ribosome-assembly mechanism that incorporates binding dependencies, rate constants, and structural characterization of populated intermediates. PMID:21030658

  3. The nucleolar GTPase nucleostemin-like 1 plays a role in plant growth and senescence by modulating ribosome biogenesis

    PubMed Central

    Jeon, Young; Park, Yong-Joon; Cho, Hui Kyung; Jung, Hyun Ju; Ahn, Tae-Kyu; Kang, Hunseung; Pai, Hyun-Sook

    2015-01-01

    Nucleostemin is a nucleolar GTP-binding protein that is involved in stem cell proliferation, embryonic development, and ribosome biogenesis in mammals. Plant nucleostemin-like 1 (NSN1) plays a role in embryogenesis, and apical and floral meristem development. In this study, a nucleolar function of NSN1 in the regulation of ribosome biogenesis was identified. Green fluorescent protein (GFP)-fused NSN1 localized to the nucleolus, which was primarily determined by its N-terminal domain. Recombinant NSN1 and its N-terminal domain (NSN1-N) bound to RNA in vitro. Recombinant NSN1 expressed GTPase activity in vitro. NSN1 silencing in Arabidopsis thaliana and Nicotiana benthamiana led to growth retardation and premature senescence. NSN1 interacted with Pescadillo and EBNA1 binding protein 2 (EBP2), which are nucleolar proteins involved in ribosome biogenesis, and with several ribosomal proteins. NSN1, NSN1-N, and EBP2 co-fractionated primarily with the 60S ribosomal large subunit in vivo. Depletion of NSN1 delayed 25S rRNA maturation and biogenesis of the 60S ribosome subunit, and repressed global translation. NSN1-deficient plants exhibited premature leaf senescence, excessive accumulation of reactive oxygen species, and senescence-related gene expression. Taken together, these results suggest that NSN1 plays a crucial role in plant growth and senescence by modulating ribosome biogenesis. PMID:26163696

  4. The structure of Rpf2-Rrs1 explains its role in ribosome biogenesis.

    PubMed

    Kharde, Satyavati; Calviño, Fabiola R; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-08-18

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2-Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2-Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2-Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  5. Direct relationship between the level of p53 stabilization induced by rRNA synthesis-inhibiting drugs and the cell ribosome biogenesis rate.

    PubMed

    Scala, F; Brighenti, E; Govoni, M; Imbrogno, E; Fornari, F; Treré, D; Montanaro, L; Derenzini, M

    2016-02-25

    Many drugs currently used in chemotherapy work by hindering the process of ribosome biogenesis. In tumors with functional p53, the inhibition of ribosome biogenesis may contribute to the efficacy of this treatment by inducing p53 stabilization. As the level of stabilized p53 is critical for the induction of cytotoxic effects, it seems useful to highlight those cancer cell characteristics that can predict the degree of p53 stabilization following the treatment with inhibitors of ribosome biogenesis. In the present study we exposed a series of p53 wild-type human cancer cell lines to drugs such as actinomycin D (ActD), doxorubicin, 5-fluorouracil and CX-5461, which hinder ribosomal RNA (rRNA) synthesis. We found that the amount of stabilized p53 was directly related to the level of ribosome biogenesis in cells before the drug treatment. This was due to different levels of inactivation of the ribosomal proteins-MDM2 pathway of p53 digestion. Inhibition of rRNA synthesis always caused cell cycle arrest, independent of the ribosome biogenesis rate of the cells, whereas apoptosis occurred only in cells with a high rDNA transcription rate. The level of p53 stabilization induced by drugs acting in different ways from the inhibition of ribosome biogenesis, such as hydroxyurea (HU) and nutlin-3, was independent of the level of ribosome biogenesis in cells and always lower than that occurring after the inhibition of rRNA synthesis. Interestingly, in cells with a low ribosome biogenesis rate, the combined treatment with ActD and HU exerted an additive effect on p53 stabilization. These results indicated that (i) drugs inhibiting ribosome biogenesis may be highly effective in p53 wild-type cancers with a high ribosome biogenesis rate, as they induce apoptotic cell death, and (ii) the combination of drugs capable of stabilizing p53 through different mechanisms may be useful for treating cancers with a low ribosome biogenesis rate. PMID:25961931

  6. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay

    2011-01-01

    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  7. Identification and Expression Analysis of Ribosome Biogenesis Factor Co-orthologs in Solanum lycopersicum

    PubMed Central

    Simm, Stefan; Fragkostefanakis, Sotirios; Paul, Puneet; Keller, Mario; Einloft, Jens; Scharf, Klaus-Dieter; Schleiff, Enrico

    2015-01-01

    Ribosome biogenesis involves a large inventory of proteinaceous and RNA cofactors. More than 250 ribosome biogenesis factors (RBFs) have been described in yeast. These factors are involved in multiple aspects like rRNA processing, folding, and modification as well as in ribosomal protein (RP) assembly. Considering the importance of RBFs for particular developmental processes, we examined the complexity of RBF and RP (co-)orthologs by bioinformatic assignment in 14 different plant species and expression profiling in the model crop Solanum lycopersicum. Assigning (co-)orthologs to each RBF revealed that at least 25% of all predicted RBFs are encoded by more than one gene. At first we realized that the occurrence of multiple RBF co-orthologs is not globally correlated to the existence of multiple RP co-orthologs. The transcript abundance of genes coding for predicted RBFs and RPs in leaves and anthers of S. lycopersicum was determined by next generation sequencing (NGS). In combination with existing expression profiles, we can conclude that co-orthologs of RBFs by large account for a preferential function in different tissue or at distinct developmental stages. This notion is supported by the differential expression of selected RBFs during male gametophyte development. In addition, co-regulated clusters of RBF and RP coding genes have been observed. The relevance of these results is discussed. PMID:25698879

  8. Saccharomyces cerevisiae nucleolar protein Nop7p is necessary for biogenesis of 60S ribosomal subunits.

    PubMed Central

    Adams, Cynthia C; Jakovljevic, Jelena; Roman, Judibelle; Harnpicharnchai, Piyanun; Woolford, John L

    2002-01-01

    To identify new gene products that participate in ribosome biogenesis, we carried out a screen for mutations that result in lethality in combination with mutations in DRS1, a Saccharomyces cerevisiae nucleolar DEAD-box protein required for synthesis of 60S ribosomal subunits. We identified the gene NOP7that encodes an essential protein. The temperature-sensitive nop7-1 mutation or metabolic depletion of Nop7p results in a deficiency of 60S ribosomal subunits and accumulation of halfmer polyribosomes. Analysis of pre-rRNA processing indicates that nop7 mutants exhibit a delay in processing of 27S pre-rRNA to mature 25S rRNA and decreased accumulation of 25S rRNA. Thus Nop7p, like Drs1p, is required for essential steps leading to synthesis of 60S ribosomal subunits. In addition, inactivation or depletion of Nop7p also affects processing at the A0, A1, and A2 sites, which may result from the association of Nop7p with 35S pre-rRNA in 90S pre-rRNPs. Nop7p is localized primarily in the nucleolus, where most steps in ribosome assembly occur. Nop7p is homologous to the zebrafish pescadillo protein necessary for embryonic development. The Nop7 protein contains the BRCT motif, a protein-protein interaction domain through which, for example, the human BRCA1 protein interacts with RNA helicase A. PMID:11911362

  9. Concerted removal of the Erb1–Ytm1 complex in ribosome biogenesis relies on an elaborate interface

    PubMed Central

    Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard

    2016-01-01

    The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7–Erb1–Ytm1 complex (or human Pes1–Bop1–Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1–Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1–Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1–Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628

  10. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  11. Runx1 deficiency decreases ribosome biogenesis and confers stress resistance to hematopoietic stem and progenitor cells

    PubMed Central

    Cai, Xiongwei; Gao, Long; Teng, Li; Ge, Jingping; Oo, Zaw Min; Kumar, Ashish R.; Gilliland, D. Gary; Mason, Philip J.; Tan, Kai; Speck, Nancy A.

    2015-01-01

    Summary The transcription factor RUNX1 is frequently mutated in myelodysplastic syndrome and leukemia. RUNX1 mutations can be early events, creating pre-leukemic stem cells that expand in the bone marrow. Here we show, counter-intuitively, that Runx1 deficient hematopoietic stem and progenitor cells (HSPCs) have a slow growth, low biosynthetic, small cell phenotype and markedly reduced ribosome biogenesis (Ribi). The reduced Ribi involved decreased levels of rRNA and many mRNAs encoding ribosome proteins. Runx1 appears to directly regulate Ribi; Runx1 is enriched on the promoters of genes encoding ribosome proteins, and binds the ribosomal DNA repeats. Runx1 deficient HSPCs have lower p53 levels, reduced apoptosis, an attenuated unfolded protein response, and accordingly are resistant to genotoxic and endoplasmic reticulum stress. The low biosynthetic activity and corresponding stress resistance provides a selective advantage to Runx1 deficient HSPCs, allowing them to expand in the bone marrow and outcompete normal HSPCs. PMID:26165925

  12. NPM1/B23: A Multifunctional Chaperone in Ribosome Biogenesis and Chromatin Remodeling

    PubMed Central

    Lindström, Mikael S.

    2011-01-01

    At a first glance, ribosome biogenesis and chromatin remodeling are quite different processes, but they share a common problem involving interactions between charged nucleic acids and small basic proteins that may result in unwanted intracellular aggregations. The multifunctional nuclear acidic chaperone NPM1 (B23/nucleophosmin) is active in several stages of ribosome biogenesis, chromatin remodeling, and mitosis as well as in DNA repair, replication and transcription. In addition, NPM1 plays an important role in the Myc-ARF-p53 pathway as well as in SUMO regulation. However, the relative importance of NPM1 in these processes remains unclear. Provided herein is an update on the expanding list of the diverse activities and interacting partners of NPM1. Mechanisms of NPM1 nuclear export functions of NPM1 in the nucleolus and at the mitotic spindle are discussed in relation to tumor development. It is argued that the suggested function of NPM1 as a histone chaperone could explain several, but not all, of the effects observed in cells following changes in NPM1 expression. A future challenge is to understand how NPM1 is activated, recruited, and controlled to carry out its functions. PMID:21152184

  13. Yeast Rrp14p is a nucleolar protein involved in both ribosome biogenesis and cell polarity

    PubMed Central

    Yamada, Hiroko; Horigome, Chihiro; Okada, Takafumi; Shirai, Chiharu; Mizuta, Keiko

    2007-01-01

    We previously cloned RRP14/YKL082c, whose product exhibits two-hybrid interaction with Ebp2p, a regulatory factor of assembly of 60S ribosomal subunits. Depletion of Rrp14p results in shortage of 60S ribosomal subunits and retardation of processing from 27S pre-rRNA to 25S rRNA. Furthermore, 35S pre-rRNA synthesis appears to decline in Rrp14p-depleted cells. Rrp14p interacts with regulatory factors of 60S subunit assembly and also with Utp11p and Faf1p, which are regulatory factors required for assembly of 40S ribosomal subunits. We propose that Rrp14p is involved in ribosome synthesis from the beginning of 35S pre-rRNA synthesis to assembly of the 60S ribosomal subunit. Disruption of RRP14 causes an extremely slow growth rate of the cell, a severe defect in ribosome synthesis, and a depolarized localization of cortical actin patches throughout the cell cycle. These results suggest that Rrp14p has dual functions in ribosome synthesis and polarized cell growth. PMID:17804645

  14. The conserved interaction of C7orf30 with MRPL14 promotes biogenesis of the mitochondrial large ribosomal subunit and mitochondrial translation

    PubMed Central

    Fung, Stephen; Nishimura, Tamiko; Sasarman, Florin; Shoubridge, Eric A.

    2013-01-01

    Mammalian mitochondria harbor a dedicated translation apparatus that is required for the synthesis of 13 mitochondrial DNA (mtDNA)-encoded polypeptides, all of which are essential components of the oxidative phosphorylation (OXPHOS) complexes. Little is known about the mechanism of assembly of the mitoribosomes that catalyze this process. Here we show that C7orf30, a member of the large family of DUF143 proteins, associates with the mitochondrial large ribosomal subunit (mt-LSU). Knockdown of C7orf30 by short hairpin RNA (shRNA) does not alter the sedimentation profile of the mt-LSU, but results in the depletion of several mt-LSU proteins and decreased monosome formation. This leads to a mitochondrial translation defect, involving the majority of mitochondrial polypeptides, and a severe OXPHOS assembly defect. Immunoprecipitation and mass spectrometry analyses identified mitochondrial ribosomal protein (MRP)L14 as the specific interacting protein partner of C7orf30 in the mt-LSU. Reciprocal experiments in which MRPL14 was depleted by small interfering RNA (siRNA) phenocopied the C7orf30 knockdown. Members of the DUF143 family have been suggested to be universally conserved ribosomal silencing factors, acting by sterically inhibiting the association of the small and large ribosomal subunits. Our results demonstrate that, although the interaction between C7orf30 and MRPL14 has been evolutionarily conserved, human C7orf30 is, on the contrary, essential for mitochondrial ribosome biogenesis and mitochondrial translation. PMID:23171548

  15. The structure of Rpf2–Rrs1 explains its role in ribosome biogenesis

    PubMed Central

    Kharde, Satyavati; Calviño, Fabiola R.; Gumiero, Andrea; Wild, Klemens; Sinning, Irmgard

    2015-01-01

    The assembly of eukaryotic ribosomes is a hierarchical process involving about 200 biogenesis factors and a series of remodeling steps. The 5S RNP consisting of the 5S rRNA, RpL5 and RpL11 is recruited at an early stage, but has to rearrange during maturation of the pre-60S ribosomal subunit. Rpf2 and Rrs1 have been implicated in 5S RNP biogenesis, but their precise role was unclear. Here, we present the crystal structure of the Rpf2–Rrs1 complex from Aspergillus nidulans at 1.5 Å resolution and describe it as Brix domain of Rpf2 completed by Rrs1 to form two anticodon-binding domains with functionally important tails. Fitting the X-ray structure into the cryo-EM density of a previously described pre-60S particle correlates with biochemical data. The heterodimer forms specific contacts with the 5S rRNA, RpL5 and the biogenesis factor Rsa4. The flexible protein tails of Rpf2–Rrs1 localize to the central protuberance. Two helices in the Rrs1 C-terminal tail occupy a strategic position to block the rotation of 25S rRNA and the 5S RNP. Our data provide a structural model for 5S RNP recruitment to the pre-60S particle and explain why removal of Rpf2–Rrs1 is necessary for rearrangements to drive 60S maturation. PMID:26117542

  16. Autophagy induction is a Tor- and Tp53-independent cell survival response in a zebrafish model of disrupted ribosome biogenesis.

    PubMed

    Boglev, Yeliz; Badrock, Andrew P; Trotter, Andrew J; Du, Qian; Richardson, Elsbeth J; Parslow, Adam C; Markmiller, Sebastian J; Hall, Nathan E; de Jong-Curtain, Tanya A; Ng, Annie Y; Verkade, Heather; Ober, Elke A; Field, Holly A; Shin, Donghun; Shin, Chong H; Hannan, Katherine M; Hannan, Ross D; Pearson, Richard B; Kim, Seok-Hyung; Ess, Kevin C; Lieschke, Graham J; Stainier, Didier Y R; Heath, Joan K

    2013-01-01

    Ribosome biogenesis underpins cell growth and division. Disruptions in ribosome biogenesis and translation initiation are deleterious to development and underlie a spectrum of diseases known collectively as ribosomopathies. Here, we describe a novel zebrafish mutant, titania (tti(s450)), which harbours a recessive lethal mutation in pwp2h, a gene encoding a protein component of the small subunit processome. The biochemical impacts of this lesion are decreased production of mature 18S rRNA molecules, activation of Tp53, and impaired ribosome biogenesis. In tti(s450), the growth of the endodermal organs, eyes, brain, and craniofacial structures is severely arrested and autophagy is up-regulated, allowing intestinal epithelial cells to evade cell death. Inhibiting autophagy in tti(s450) larvae markedly reduces their lifespan. Somewhat surprisingly, autophagy induction in tti(s450) larvae is independent of the state of the Tor pathway and proceeds unabated in Tp53-mutant larvae. These data demonstrate that autophagy is a survival mechanism invoked in response to ribosomal stress. This response may be of relevance to therapeutic strategies aimed at killing cancer cells by targeting ribosome biogenesis. In certain contexts, these treatments may promote autophagy and contribute to cancer cells evading cell death. PMID:23408911

  17. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients

    PubMed Central

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A.; French, Deborah; Podsakoff, Gregory M.; Bessler, Monica; Mason, Philip J.

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed “corrected” lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

  18. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    PubMed

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

  19. Perinatal Exogenous Nitric Oxide in Fawn-Hooded Hypertensive Rats Reduces Renal Ribosomal Biogenesis in Early Life

    PubMed Central

    Wesseling, Sebastiaan; Essers, Paul B.; Koeners, Maarten P.; Pereboom, Tamara C.; Braam, Branko; van Faassen, Ernst E.; MacInnes, Alyson W.; Joles, Jaap A.

    2011-01-01

    Nitric oxide (NO) is known to depress ribosome biogenesis in vitro. In this study we analyzed the influence of exogenous NO on ribosome biogenesis in vivo using a proven antihypertensive model of perinatal NO administration in genetically hypertensive rats. Fawn-hooded hypertensive rat (FHH) dams were supplied with the NO-donor molsidomine in drinking water from 2 weeks before to 4 weeks after birth, and the kidneys were subsequently collected from 2 day, 2 week, and 9 to 10-month-old adult offspring. Although the NO-donor increased maternal NO metabolite excretion, the NO status of juvenile renal (and liver) tissue was unchanged as assayed by EPR spectroscopy of NO trapped with iron-dithiocarbamate complexes. Nevertheless, microarray analysis revealed marked differential up-regulation of renal ribosomal protein genes at 2 days and down-regulation at 2 weeks and in adult males. Such differential regulation of renal ribosomal protein genes was not observed in females. These changes were confirmed in males at 2 weeks by expression analysis of renal ribosomal protein L36a and by polysome profiling, which also revealed a down-regulation of ribosomes in females at that age. However, renal polysome profiles returned to normal in adults after early exposure to molsidomine. No direct effects of molsidomine were observed on cellular proliferation in kidneys at any age, and the changes induced by molsidomine in renal polysome profiles at 2 weeks were absent in the livers of the same rats. Our results suggest that the previously found prolonged antihypertensive effects of perinatal NO administration may be due to epigenetically programmed alterations in renal ribosome biogenesis during a critical fetal period of renal development, and provide a salient example of a drug-induced reduction of ribosome biogenesis that is accompanied by a beneficial long-term health effect in both males and females. PMID:22303348

  20. Free energy rhythms in S. cerevisiae A dynamic perspective with implications for ribosomal biogenesis

    PubMed Central

    Gross, A.; Li, Caroline M.; Remacle, F.; Levine, R.D.

    2013-01-01

    To describe the time course of cellular systems we integrate ideas from thermodynamics and information theory to discuss the work needed to change the state of the cell. The biological example analyzed is experimental microarray transcription level oscillations of yeast at the different phases as characterized by oxygen consumption. Surprisal analysis was applied to identify groups of transcripts that oscillate in concert and thereby to compute changes in the free energy with time. Three dominant transcript groups were identified by surprisal analysis. The groups correspond to the respiratory, early and late reductive phases. Genes involved in ribosome biogenesis, peaked at the respiratory phase. The work to prepare the state is shown to be the sum of the contributions of these groups. We paid particular attention to work requirements during ribosomal building, and the correlation with ATP levels and dissolved oxygen. The suggestion that cells in the respiratory phase likely build ribosomes, an energy intensive process, in preparation for protein production during S-phase of the cell cycle is validated by an experiment. Surprisal analysis thereby provided a useful tool to determine the synchronization of transcription events and energetics in a cell in real time. PMID:23379300

  1. Mutations in the leader region of ribosomal RNA operons cause structurally defective 30 S ribosomes as revealed by in vivo structural probing.

    PubMed

    Balzer, M; Wagner, R

    1998-02-27

    The biogenesis of functional ribosomes is regulated in a very complex manner, involving different proteins and RNA molecules. RNAs are not only essential components of both ribosomal subunits but also transiently interacting factors during particle formation. In eukaryotes snoRNAs act as molecular chaperones to assist maturation, modification and assembly. In a very similar way highly conserved leader sequences of bacterial rRNA operons are involved in the correct formation of 30 S ribosomal subunits. Certain mutations in the rRNA leader region cause severe growth defects due to malfunction of ribosomes which are assembled from such transcription units. To understand how the leader sequences act to facilitate the formation of the correct 30 S subunits we performed in vivo chemical probing to assess structural differences between ribosomes assembled either from rRNA transcribed from wild-type operons or from operons which contain mutations in the rRNA leader region. Cells transformed with plasmids containing the respective rRNA operons were reacted with dimethylsulphate (DMS). Ribosomes were isolated by sucrose gradient centrifugation and modified nucleotides within the 16 S rRNA were identified by primer extension reaction. Structural differences between ribosomes from wild-type and mutant rRNA operons occur in several clusters within the 16 S rRNA secondary structure. The most prominent differences are located in the central domain including the universally conserved pseudoknot structure which connects the 5', the central and the 3' domain of 16 S rRNA. Two other clusters with structural differences fall in the 5' domain where the leader had been shown to interact with mature 16 S rRNA and within the ribosomal protein S4 binding site. The other differences in structure are located in sites which are also known as sites for the action of several antibiotics. The data explain the functional defects of ribosomes from rRNA operons with leader mutations and help to

  2. Deficiency of the ribosome biogenesis gene Sbds in hematopoietic stem and progenitor cells causes neutropenia in mice by attenuating lineage progression in myelocytes.

    PubMed

    Zambetti, Noemi A; Bindels, Eric M J; Van Strien, Paulina M H; Valkhof, Marijke G; Adisty, Maria N; Hoogenboezem, Remco M; Sanders, Mathijs A; Rommens, Johanna M; Touw, Ivo P; Raaijmakers, Marc H G P

    2015-10-01

    Shwachman-Diamond syndrome is a congenital bone marrow failure disorder characterized by debilitating neutropenia. The disease is associated with loss-of-function mutations in the SBDS gene, implicated in ribosome biogenesis, but the cellular and molecular events driving cell specific phenotypes in ribosomopathies remain poorly defined. Here, we established what is to our knowledge the first mammalian model of neutropenia in Shwachman-Diamond syndrome through targeted downregulation of Sbds in hematopoietic stem and progenitor cells expressing the myeloid transcription factor CCAAT/enhancer binding protein α (Cebpa). Sbds deficiency in the myeloid lineage specifically affected myelocytes and their downstream progeny while, unexpectedly, it was well tolerated by rapidly cycling hematopoietic progenitor cells. Molecular insights provided by massive parallel sequencing supported cellular observations of impaired cell cycle exit and formation of secondary granules associated with the defect of myeloid lineage progression in myelocytes. Mechanistically, Sbds deficiency activated the p53 tumor suppressor pathway and induced apoptosis in these cells. Collectively, the data reveal a previously unanticipated, selective dependency of myelocytes and downstream progeny, but not rapidly cycling progenitors, on this ubiquitous ribosome biogenesis protein, thus providing a cellular basis for the understanding of myeloid lineage biased defects in Shwachman-Diamond syndrome. PMID:26185170

  3. Deficiency of the ribosome biogenesis gene Sbds in hematopoietic stem and progenitor cells causes neutropenia in mice by attenuating lineage progression in myelocytes

    PubMed Central

    Zambetti, Noemi A.; Bindels, Eric M. J.; Van Strien, Paulina M. H.; Valkhof, Marijke G.; Adisty, Maria N.; Hoogenboezem, Remco M.; Sanders, Mathijs A.; Rommens, Johanna M.; Touw, Ivo P.; Raaijmakers, Marc H. G. P.

    2015-01-01

    Shwachman-Diamond syndrome is a congenital bone marrow failure disorder characterized by debilitating neutropenia. The disease is associated with loss-of-function mutations in the SBDS gene, implicated in ribosome biogenesis, but the cellular and molecular events driving cell specific phenotypes in ribosomopathies remain poorly defined. Here, we established what is to our knowledge the first mammalian model of neutropenia in Shwachman-Diamond syndrome through targeted downregulation of Sbds in hematopoietic stem and progenitor cells expressing the myeloid transcription factor CCAAT/enhancer binding protein α (Cebpa). Sbds deficiency in the myeloid lineage specifically affected myelocytes and their downstream progeny while, unexpectedly, it was well tolerated by rapidly cycling hematopoietic progenitor cells. Molecular insights provided by massive parallel sequencing supported cellular observations of impaired cell cycle exit and formation of secondary granules associated with the defect of myeloid lineage progression in myelocytes. Mechanistically, Sbds deficiency activated the p53 tumor suppressor pathway and induced apoptosis in these cells. Collectively, the data reveal a previously unanticipated, selective dependency of myelocytes and downstream progeny, but not rapidly cycling progenitors, on this ubiquitous ribosome biogenesis protein, thus providing a cellular basis for the understanding of myeloid lineage biased defects in Shwachman-Diamond syndrome. PMID:26185170

  4. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases

    PubMed Central

    McCaughan, Urszula M.; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G.

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  5. RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis

    PubMed Central

    Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas

    2014-01-01

    During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650

  6. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases.

    PubMed

    McCaughan, Urszula M; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  7. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  8. RNA helicase DDX5 is a p53-independent target of ARF that participates in ribosome biogenesis

    PubMed Central

    Saporita, Anthony J.; Chang, Hsiang-Chun; Winkeler, Crystal L.; Apicelli, Anthony J.; Kladney, Raleigh D.; Wang, Jianbo; Townsend, R. Reid; Michel, Loren S.; Weber, Jason D.

    2011-01-01

    The p19ARF tumor suppressor limits ribosome biogenesis and responds to hyperproliferative signals to activate the p53 checkpoint response. While its activation of p53 has been well characterized, ARF’s role in restraining nucleolar ribosome production is poorly understood. Here we report the use of a mass spectroscopic analysis to identify protein changes within the nucleoli of Arf-deficient mouse cells. Through this approach, we discovered that ARF limited the nucleolar localization of the RNA helicase DDX5 which promotes the synthesis and maturation of rRNA, ultimately increasing ribosome output and proliferation. ARF inhibited the interaction between DDX5 and nucleophosmin (NPM), preventing association of DDX5 with the rDNA promoter and nuclear pre-ribosomes. In addition, Arf-deficient cells transformed by oncogenic RasV12 were addicted to DDX5, since reduction of DDX5 was sufficient to impair RasV12-driven colony formation in soft agar and tumor growth in mice. Taken together, our findings indicate that DDX5 is a key p53-independent target of the ARF tumor suppressor and is a novel non-oncogene participant in ribosome biogenesis. PMID:21937682

  9. WHITE PANICLE1, a Val-tRNA Synthetase Regulating Chloroplast Ribosome Biogenesis in Rice, Is Essential for Early Chloroplast Development1[OPEN

    PubMed Central

    Wang, Chunming; Zheng, Ming; Lyu, Jia; Xu, Yang; Li, Xiaohui; Niu, Mei; Long, Wuhua; Wang, Di; Wang, Yihua; Wan, Jianmin

    2016-01-01

    Chloroplasts and mitochondria contain their own genomes and transcriptional and translational systems. Establishing these genetic systems is essential for plant growth and development. Here we characterized a mutant form of a Val-tRNA synthetase (OsValRS2) from Oryza sativa that is targeted to both chloroplasts and mitochondria. A single base change in OsValRS2 caused virescent to albino phenotypes in seedlings and white panicles at heading. We therefore named this mutant white panicle 1 (wp1). Chlorophyll autofluorescence observations and transmission electron microscopy analyses indicated that wp1 mutants are defective in early chloroplast development. RNA-seq analysis revealed that expression of nuclear-encoded photosynthetic genes is significantly repressed, while expression of many chloroplast-encoded genes also changed significantly in wp1 mutants. Western-blot analyses of chloroplast-encoded proteins showed that chloroplast protein levels were reduced in wp1 mutants, although mRNA levels of some genes were higher in wp1 than in wild type. We found that wp1 was impaired in chloroplast ribosome biogenesis. Taken together, our results show that OsValRS2 plays an essential role in chloroplast development and regulating chloroplast ribosome biogenesis. PMID:26839129

  10. Peter Pan functions independently of its role in ribosome biogenesis during early eye and craniofacial cartilage development in Xenopus laevis.

    PubMed

    Bugner, Verena; Tecza, Aleksandra; Gessert, Susanne; Kühl, Michael

    2011-06-01

    The Xenopus oocyte possesses a large maternal store of ribosomes, thereby uncoupling early development from the de novo ribosome biosynthesis required for cell growth. Brix domain-containing proteins, such as Peter Pan (PPan), are essential for eukaryotic ribosome biogenesis. In this study, we demonstrate that PPan is expressed maternally as well as in the eye and cranial neural crest cells (NCCs) during early Xenopus laevis development. Depletion of PPan and interference with rRNA processing using antisense morpholino oligonucleotides resulted in eye and cranial cartilage malformations. Loss of PPan, but not interference with rRNA processing, led to an early downregulation of specific marker genes of the eye, including Rx1 and Pax6, and of NCCs, such as Twist, Slug and FoxD3. We found that PPan protein is localized in the nucleoli and mitochondria and that loss of PPan results in increased apoptosis. These findings indicate a novel function of PPan that is independent of its role in ribosome biogenesis. PMID:21558383

  11. Meristematic cell proliferation and ribosome biogenesis are decoupled in diamagnetically levitated Arabidopsis seedlings

    PubMed Central

    2013-01-01

    Background Cell growth and cell proliferation are intimately linked in the presence of Earth’s gravity, but are decoupled under the microgravity conditions present in orbiting spacecraft. New technologies to simulate microgravity conditions for long-duration experiments, with stable environmental conditions, in Earth-based laboratories are required to further our understanding of the effect of extraterrestrial conditions on the growth, development and health of living matter. Results We studied the response of transgenic seedlings of Arabidopsis thaliana, containing either the CycB1-GUS proliferation marker or the DR5-GUS auxin-mediated growth marker, to diamagnetic levitation in the bore of a superconducting solenoid magnet. As a control, a second set of seedlings were exposed to a strong magnetic field, but not to levitation forces. A third set was exposed to a strong field and simulated hypergravity (2 g). Cell proliferation and cell growth cytological parameters were measured for each set of seedlings. Nucleolin immunodetection was used as a marker of cell growth. Collectively, the data indicate that these two fundamental cellular processes are decoupled in root meristems, as in microgravity: cell proliferation was enhanced whereas cell growth markers were depleted. These results also demonstrated delocalisation of auxin signalling in the root tip despite the fact that levitation of the seedling as a whole does not prevent the sedimentation of statoliths in the root cells. Conclusions In our model system, we found that diamagnetic levitation led to changes that are very similar to those caused by real- [e.g. on board the International Space Station (ISS)] or mechanically-simulated microgravity [e.g. using a Random Positioning Machine (RPM)]. These changes decoupled meristematic cell proliferation from ribosome biogenesis, and altered auxin polar transport. PMID:24006876

  12. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    PubMed

    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Lin, Sheng-Ting; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J; Hartman Iv, John L; Lukacs, Gergely L

    2016-05-01

    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  13. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect

    PubMed Central

    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M.; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J.; Hartman IV, John L.; Lukacs, Gergely L.

    2016-01-01

    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  14. Ribosomal Biogenesis and Translational Flux Inhibition by the Selective Inhibitor of Nuclear Export (SINE) XPO1 Antagonist KPT-185.

    PubMed

    Tabe, Yoko; Kojima, Kensuke; Yamamoto, Shinichi; Sekihara, Kazumasa; Matsushita, Hiromichi; Davis, Richard Eric; Wang, Zhiqiang; Ma, Wencai; Ishizawa, Jo; Kazuno, Saiko; Kauffman, Michael; Shacham, Sharon; Fujimura, Tsutomu; Ueno, Takashi; Miida, Takashi; Andreeff, Michael

    2015-01-01

    Mantle cell lymphoma (MCL) is an aggressive B-cell lymphoma characterized by the aberrant expression of several growth-regulating, oncogenic effectors. Exportin 1 (XPO1) mediates the nucleocytoplasmic transport of numerous molecules including oncogenic growth-regulating factors, RNAs, and ribosomal subunits. In MCL cells, the small molecule KPT-185 blocks XPO1 function and exerts anti-proliferative effects. In this study, we investigated the molecular mechanisms of this putative anti-tumor effect on MCL cells using cell growth/viability assays, immunoblotting, gene expression analysis, and absolute quantification proteomics. KPT-185 exhibited a p53-independent anti-lymphoma effect on MCL cells, by suppression of oncogenic mediators (e.g., XPO1, cyclin D1, c-Myc, PIM1, and Bcl-2 family members), repression of ribosomal biogenesis, and downregulation of translation/chaperone proteins (e.g., PIM2, EEF1A1, EEF2, and HSP70) that are part of the translational/transcriptional network regulated by heat shock factor 1. These results elucidate a novel mechanism in which ribosomal biogenesis appears to be a key component through which XPO1 contributes to tumor cell survival. Thus, we propose that the blockade of XPO1 could be a promising, novel strategy for the treatment of MCL and other malignancies overexpressing XPO1. PMID:26340096

  15. Ribosomal Biogenesis and Translational Flux Inhibition by the Selective Inhibitor of Nuclear Export (SINE) XPO1 Antagonist KPT-185

    PubMed Central

    Yamamoto, Shinichi; Sekihara, Kazumasa; Matsushita, Hiromichi; Davis, Richard Eric; Wang, Zhiqiang; Ma, Wencai; Ishizawa, Jo; Kazuno, Saiko; Kauffman, Michael; Shacham, Sharon; Fujimura, Tsutomu; Ueno, Takashi; Miida, Takashi; Andreeff, Michael

    2015-01-01

    Mantle cell lymphoma (MCL) is an aggressive B-cell lymphoma characterized by the aberrant expression of several growth-regulating, oncogenic effectors. Exportin 1 (XPO1) mediates the nucleocytoplasmic transport of numerous molecules including oncogenic growth-regulating factors, RNAs, and ribosomal subunits. In MCL cells, the small molecule KPT-185 blocks XPO1 function and exerts anti-proliferative effects. In this study, we investigated the molecular mechanisms of this putative anti-tumor effect on MCL cells using cell growth/viability assays, immunoblotting, gene expression analysis, and absolute quantification proteomics. KPT-185 exhibited a p53-independent anti-lymphoma effect on MCL cells, by suppression of oncogenic mediators (e.g., XPO1, cyclin D1, c-Myc, PIM1, and Bcl-2 family members), repression of ribosomal biogenesis, and downregulation of translation/chaperone proteins (e.g., PIM2, EEF1A1, EEF2, and HSP70) that are part of the translational/transcriptional network regulated by heat shock factor 1. These results elucidate a novel mechanism in which ribosomal biogenesis appears to be a key component through which XPO1 contributes to tumor cell survival. Thus, we propose that the blockade of XPO1 could be a promising, novel strategy for the treatment of MCL and other malignancies overexpressing XPO1. PMID:26340096

  16. Analysis of two domains with novel RNA-processing activities throws light on the complex evolution of ribosomal RNA biogenesis

    PubMed Central

    Burroughs, A. Maxwell; Aravind, L.

    2014-01-01

    Ribosomal biogenesis has been extensively investigated, especially to identify the elusive nucleases and cofactors involved in the complex rRNA processing events in eukaryotes. Large-scale screens in yeast identified two biochemically uncharacterized proteins, TSR3 and TSR4, as being key players required for rRNA maturation. Using multiple computational approaches we identify the conserved domains comprising these proteins and establish sequence and structural features providing novel insights regarding their roles. TSR3 is unified with the DTW domain into a novel superfamily of predicted enzymatic domains, with the balance of the available evidence pointing toward an RNase role with the archaeo-eukaryotic TSR3 proteins processing rRNA and the bacterial versions potentially processing tRNA. TSR4, its other eukaryotic homologs PDCD2/rp-8, PDCD2L, Zfrp8, and trus, the predominantly bacterial DUF1963 proteins, and other uncharacterized proteins are unified into a new domain superfamily, which arose from an ancient duplication event of a strand-swapped, dimer-forming all-beta unit. We identify conserved features mediating protein-protein interactions (PPIs) and propose a potential chaperone-like function. While contextual evidence supports a conserved role in ribosome biogenesis for the eukaryotic TSR4-related proteins, there is no evidence for such a role for the bacterial versions. Whereas TSR3-related proteins can be traced to the last universal common ancestor (LUCA) with a well-supported archaeo-eukaryotic branch, TSR4-related proteins of eukaryotes are derived from within the bacterial radiation of this superfamily, with archaea entirely lacking them. This provides evidence for “systems admixture,” which followed the early endosymbiotic event, playing a key role in the emergence of the uniquely eukaryotic ribosome biogenesis process. PMID:25566315

  17. Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis.

    PubMed

    Knight, John R P; Bastide, Amandine; Peretti, Diego; Roobol, Anne; Roobol, Jo; Mallucci, Giovanna R; Smales, C Mark; Willis, Anne E

    2016-04-01

    The RNA exosome is essential for 3' processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3' preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo. PMID:26857222

  18. Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis

    PubMed Central

    Bastide, Amandine; Peretti, Diego; Roobol, Anne; Roobol, Jo; Mallucci, Giovanna R.; Smales, C. Mark; Willis, Anne E.

    2016-01-01

    The RNA exosome is essential for 3′ processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3′ preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo. PMID:26857222

  19. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  20. Structure of ERA in Complex with the 3 End of 16s rRNBA Implications for Ribosome Biogenesis

    SciTech Connect

    Tu, C.; Zhou, X; Tropea, J; Austin, B; Waugh, D; Court, D; Ji, X

    2009-01-01

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the 1531AUCACCUCCUUA1542 sequence at the 3? end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  1. Comparative proteomic analysis of the silkworm middle silk gland reveals the importance of ribosome biogenesis in silk protein production.

    PubMed

    Li, Jian-ying; Ye, Lu-peng; Che, Jia-qian; Song, Jia; You, Zheng-ying; Yun, Ki-chan; Wang, Shao-hua; Zhong, Bo-xiong

    2015-08-01

    The silkworm middle silk gland (MSG) is the sericin synthesis and secretion unique sub-organ. The molecular mechanisms of regulating MSG protein synthesis are largely unknown. Here, we performed shotgun proteomic analysis on the three MSG subsections: the anterior (MSG-A), middle (MSG-M), and posterior (MSG-P) regions. The results showed that more strongly expressed proteins in the MSG-A were involved in multiple processes, such as silk gland development and silk protein protection. The proteins that were highly expressed in the MSG-M were enriched in the ribosome pathway. MSG-P proteins with stronger expression were mainly involved in the oxidative phosphorylation and citrate cycle pathways. These results suggest that the MSG-M is the most active region in the sericin synthesis. Furthermore, comparing the proteome of the MSG with the posterior silk gland (PSG) revealed that the specific and highly expressed proteins in the MSG were primarily involved in the ribosome and aminoacyl-tRNA biosynthesis pathways. These results indicate that silk protein synthesis is much more active as a result of the enhancement of translation-related pathways in the MSG. These results also suggest that enhancing ribosome biogenesis is important to the efficient synthesis of silk proteins. PMID:26051239

  2. Cockayne syndrome protein A is a transcription factor of RNA polymerase I and stimulates ribosomal biogenesis and growth

    PubMed Central

    Koch, Sylvia; Garcia Gonzalez, Omar; Assfalg, Robin; Schelling, Adrian; Schäfer, Patrick; Scharffetter-Kochanek, Karin; Iben, Sebastian

    2014-01-01

    Mutations in the Cockayne syndrome A (CSA) protein account for 20% of Cockayne syndrome (CS) cases, a childhood disorder of premature aging and early death. Hitherto, CSA has exclusively been described as DNA repair factor of the transcription-coupled branch of nucleotide excision repair. Here we show a novel function of CSA as transcription factor of RNA polymerase I in the nucleolus. Knockdown of CSA reduces pre-rRNA synthesis by RNA polymerase I. CSA associates with RNA polymerase I and the active fraction of the rDNA and stimulates re-initiation of rDNA transcription by recruiting the Cockayne syndrome proteins TFIIH and CSB. Moreover, compared with CSA deficient parental CS cells, CSA transfected CS cells reveal significantly more rRNA with induced growth and enhanced global translation. A previously unknown global dysregulation of ribosomal biogenesis most likely contributes to the reduced growth and premature aging of CS patients. PMID:24781187

  3. The Stability of Ribosome Biogenesis Factor WBSCR22 Is Regulated by Interaction with TRMT112 via Ubiquitin-Proteasome Pathway

    PubMed Central

    Õunap, Kadri; Leetsi, Lilian; Matsoo, Maarja; Kurg, Reet

    2015-01-01

    The human WBSCR22 protein is a 18S rRNA methyltransferase involved in pre-rRNA processing and ribosome 40S subunit biogenesis. Recent studies have shown that the protein function in ribosome synthesis is independent of its enzymatic activity. In this work, we have studied the WBSCR22 protein interaction partners by SILAC-coupled co-immunoprecipitation assay and identified TRMT112 as the interaction partner of WBSCR22. Knock-down of TRMT112 expression decreased the WBSCR22 protein level in mammalian cells, suggesting that the stability of WBSCR22 is regulated through the interaction with TRMT112. The localization of the TRMT112 protein is determined by WBSCR22, and the WBSCR22-TRMT112 complex is localized in the cell nucleus. We provide evidence that the interaction between WBSCR22/Bud23 and TRMT112/Trm112 is conserved between mammals and yeast, suggesting that the function of TRMT112 as a co-activator of methyltransferases is evolutionarily conserved. Finally, we show that the transiently expressed WBSCR22 protein is ubiquitinated and degraded through the proteasome pathway, revealing the tight control of the WBSCR22 protein level in the cells. PMID:26214185

  4. Novel structural co-expression analysis linking the NPM1-associated ribosomal biogenesis network to chronic myelogenous leukemia

    PubMed Central

    Chan, Lawrence WC; Lin, Xihong; Yung, Godwin; Lui, Thomas; Chiu, Ya Ming; Wang, Fengfeng; Tsui, Nancy BY; Cho, William CS; Yip, SP; Siu, Parco M.; Wong, SC Cesar; Yung, Benjamin YM

    2015-01-01

    Co-expression analysis reveals useful dysregulation patterns of gene cooperativeness for understanding cancer biology and identifying new targets for treatment. We developed a structural strategy to identify co-expressed gene networks that are important for chronic myelogenous leukemia (CML). This strategy compared the distributions of expressional correlations between CML and normal states, and it identified a data-driven threshold to classify strongly co-expressed networks that had the best coherence with CML. Using this strategy, we found a transcriptome-wide reduction of co-expression connectivity in CML, reflecting potentially loosened molecular regulation. Conversely, when we focused on nucleophosmin 1 (NPM1) associated networks, NPM1 established more co-expression linkages with BCR-ABL pathways and ribosomal protein networks in CML than normal. This finding implicates a new role of NPM1 in conveying tumorigenic signals from the BCR-ABL oncoprotein to ribosome biogenesis, affecting cellular growth. Transcription factors may be regulators of the differential co-expression patterns between CML and normal. PMID:26205693

  5. The ribosome biogenesis pathway as an early target of benzyl butyl phthalate (BBP) toxicity in Chironomus riparius larvae.

    PubMed

    Herrero, Óscar; Planelló, Rosario; Morcillo, Gloria

    2016-02-01

    Butyl benzyl phthalate (BBP) is a ubiquitous contaminant whose presence in the environment is expected for decades, since it has been extensively used worldwide as a plasticizer in the polyvinyl chloride (PVC) industry and the manufacturing of many other products. In the present study, the interaction of BBP with the ribosome biogenesis pathway and the general transcriptional profile of Chironomus riparius aquatic larvae were investigated by means of changes in the rDNA activity (through the study of the internal transcribed spacer 2, ITS2) and variations in the expression profile of ribosomal protein genes (rpL4, rpL11, and rpL13) after acute 24-h and 48-h exposures to a wide range of BBP doses. Furthermore, cytogenetic assays were conducted to evaluate the transcriptional activity of polytene chromosomes from salivary gland cells, with special attention to the nucleolus and the Balbiani rings (BRs) of chromosome IV. BBP caused a dose and time-dependent toxicity in most of the selected biomarkers, with a general depletion in the gene expression levels and the activity of BR2 after 48-h treatments. At the same time, decondensation and activation of some centromeres took place, while the activity of nucleolus remained unaltered. Withdrawal of the xenobiotic allowed the larvae to reach control levels in the case of rpL4 and rpL13 genes, which were previously slightly downregulated in 24-h tests. These data provide the first evidence on the interaction of BBP with the ribosome synthesis pathways, which results in a significant impairment of the functional activity of ribosomal protein genes. Thus, the depletion of ribosomes would be a long-term effect of BBP-induced cellular damage. These findings may have important implications for understanding the adverse biological effects of BBP in C. riparius, since they provide new sensitive biomarkers of BBP exposure and highlight the suitability of this organism for ecotoxicological risk assessment, especially in aquatic

  6. 20-Hydroxyecdysone stimulates nuclear accumulation of BmNep1, a nuclear ribosome biogenesis-related protein in the silkworm, Bombyx mori.

    PubMed

    Ji, M-M; Liu, A-Q; Sima, Y-H; Xu, S-Q

    2016-10-01

    The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx. PMID:27329527

  7. Comparative effects of whey protein versus L-leucine on skeletal muscle protein synthesis and markers of ribosome biogenesis following resistance exercise.

    PubMed

    Mobley, C Brooks; Fox, Carlton D; Thompson, Richard M; Healy, James C; Santucci, Vincent; Kephart, Wesley C; McCloskey, Anna E; Kim, Mike; Pascoe, David D; Martin, Jeffrey S; Moon, Jordan R; Young, Kaelin C; Roberts, Michael D

    2016-03-01

    We compared immediate post-exercise whey protein (WP, 500 mg) versus L-leucine (LEU, 54 mg) feedings on skeletal muscle protein synthesis (MPS) mechanisms and ribosome biogenesis markers 3 h following unilateral plantarflexor resistance exercise in male, Wistar rats (~250 g). Additionally, in vitro experiments were performed on differentiated C2C12 myotubes to compare nutrient (i.e., WP, LEU) and 'exercise-like' treatments (i.e., caffeine, hydrogen peroxide, and AICAR) on ribosome biogenesis markers. LEU and WP significantly increased phosphorylated-rpS6 (Ser235/236) in the exercised (EX) leg 2.4-fold (P < 0.01) and 2.7-fold (P < 0.001) compared to the non-EX leg, respectively, whereas vehicle-fed control (CTL) did not (+65 %, P > 0.05). Compared to the non-EX leg, MPS levels increased 32 % and 52 % in the EX leg of CTL (P < 0.01) and WP rats (P < 0.001), respectively, but not in LEU rats (+15 %, P > 0.05). Several genes associated with ribosome biogenesis robustly increased in the EX versus non-EX legs of all treatments; specifically, c-Myc mRNA, Nop56 mRNA, Bop1 mRNA, Ncl mRNA, Npm1 mRNA, Fb1 mRNA, and Xpo-5 mRNA. However, only LEU significantly increased 45S pre-rRNA levels in the EX leg (63 %, P < 0.001). In vitro findings confirmed that 'exercise-like' treatments similarly altered markers of ribosome biogenesis, but only LEU increased 47S pre-rRNA levels (P < 0.01). Collectively, our data suggests that resistance exercise, as well as 'exercise-like' signals in vitro, acutely increase the expression of genes associated with ribosome biogenesis independent of nutrient provision. Moreover, while EX with or without WP appears superior for enhancing translational efficiency (i.e., increasing MPS per unit of RNA), LEU administration (or co-administration) may further enhance ribosome biogenesis over prolonged periods with resistance exercise. PMID:26507545

  8. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  9. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  10. Drosophila Mbm Is a Nucleolar Myc and Casein Kinase 2 Target Required for Ribosome Biogenesis and Cell Growth of Central Brain Neuroblasts

    PubMed Central

    Hovhanyan, Anna; Herter, Eva K.; Pfannstiel, Jens; Gallant, Peter

    2014-01-01

    Proper cell growth is a prerequisite for maintaining repeated cell divisions. Cells need to translate information about intracellular nutrient availability and growth cues from energy-sensing organs into growth-promoting processes, such as sufficient supply with ribosomes for protein synthesis. Mutations in the mushroom body miniature (mbm) gene impair proliferation of neural progenitor cells (neuroblasts) in the central brain of Drosophila melanogaster. Yet the molecular function of Mbm has so far been unknown. Here we show that mbm does not affect the molecular machinery controlling asymmetric cell division of neuroblasts but instead decreases their cell size. Mbm is a nucleolar protein required for small ribosomal subunit biogenesis in neuroblasts. Accordingly, levels of protein synthesis are reduced in mbm neuroblasts. Mbm expression is transcriptionally regulated by Myc, which, among other functions, relays information from nutrient-dependent signaling pathways to ribosomal gene expression. At the posttranslational level, Mbm becomes phosphorylated by casein kinase 2 (CK2), which has an impact on localization of the protein. We conclude that Mbm is a new part of the Myc target network involved in ribosome biogenesis, which, together with CK2-mediated signals, enables neuroblasts to synthesize sufficient amounts of proteins required for proper cell growth. PMID:24615015

  11. The human 18S rRNA base methyltransferases DIMT1L and WBSCR22-TRMT112 but not rRNA modification are required for ribosome biogenesis

    PubMed Central

    Zorbas, Christiane; Nicolas, Emilien; Wacheul, Ludivine; Huvelle, Emmeline; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2015-01-01

    At the heart of the ribosome lie rRNAs, whose catalytic function in translation is subtly modulated by posttranscriptional modifications. In the small ribosomal subunit of budding yeast, on the 18S rRNA, two adjacent adenosines (A1781/A1782) are N6-dimethylated by Dim1 near the decoding site, and one guanosine (G1575) is N7-methylated by Bud23-Trm112 at a ridge between the P- and E-site tRNAs. Here we establish human DIMT1L and WBSCR22-TRMT112 as the functional homologues of yeast Dim1 and Bud23-Trm112. We report that these enzymes are required for distinct pre-rRNA processing reactions leading to synthesis of 18S rRNA, and we demonstrate that in human cells, as in budding yeast, ribosome biogenesis requires the presence of the modification enzyme rather than its RNA-modifying catalytic activity. We conclude that a quality control mechanism has been conserved from yeast to human by which binding of a methyltransferase to nascent pre-rRNAs is a prerequisite to processing, so that all cleaved RNAs are committed to faithful modification. We further report that 18S rRNA dimethylation is nuclear in human cells, in contrast to yeast, where it is cytoplasmic. Yeast and human ribosome biogenesis thus have both conserved and distinctive features. PMID:25851604

  12. Rrp12 and the Exportin Crm1 Participate in Late Assembly Events in the Nucleolus during 40S Ribosomal Subunit Biogenesis

    PubMed Central

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-01-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes. PMID:25474739

  13. A Single Acetylation of 18 S rRNA Is Essential for Biogenesis of the Small Ribosomal Subunit in Saccharomyces cerevisiae*

    PubMed Central

    Ito, Satoshi; Akamatsu, Yu; Noma, Akiko; Kimura, Satoshi; Miyauchi, Kenjyo; Ikeuchi, Yoshiho; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Biogenesis of eukaryotic ribosome is a complex event involving a number of non-ribosomal factors. During assembly of the ribosome, rRNAs are post-transcriptionally modified by 2′-O-methylation, pseudouridylation, and several base-specific modifications, which are collectively involved in fine-tuning translational fidelity and/or modulating ribosome assembly. By mass-spectrometric analysis, we demonstrated that N4-acetylcytidine (ac4C) is present at position 1773 in the 18 S rRNA of Saccharomyces cerevisiae. In addition, we found an essential gene, KRE33 (human homolog, NAT10), that we renamed RRA1 (ribosomal RNA cytidine acetyltransferase 1) encoding an RNA acetyltransferase responsible for ac4C1773 formation. Using recombinant Rra1p, we could successfully reconstitute ac4C1773 in a model rRNA fragment in the presence of both acetyl-CoA and ATP as substrates. Upon depletion of Rra1p, the 23 S precursor of 18 S rRNA was accumulated significantly, which resulted in complete loss of 18 S rRNA and small ribosomal subunit (40 S), suggesting that ac4C1773 formation catalyzed by Rra1p plays a critical role in processing of the 23 S precursor to yield 18 S rRNA. When nuclear acetyl-CoA was depleted by inactivation of acetyl-CoA synthetase 2 (ACS2), we observed temporal accumulation of the 23 S precursor, indicating that Rra1p modulates biogenesis of 40 S subunit by sensing nuclear acetyl-CoA concentration. PMID:25086048

  14. Ccr4-Not Regulates RNA Polymerase I Transcription and Couples Nutrient Signaling to the Control of Ribosomal RNA Biogenesis

    PubMed Central

    Laribee, R. Nicholas; Hosni-Ahmed, Amira; Workman, Jason J.; Chen, Hongfeng

    2015-01-01

    Ribosomal RNA synthesis is controlled by nutrient signaling through the mechanistic target of rapamycin complex 1 (mTORC1) pathway. mTORC1 regulates ribosomal RNA expression by affecting RNA Polymerase I (Pol I)-dependent transcription of the ribosomal DNA (rDNA) but the mechanisms involved remain obscure. This study provides evidence that the Ccr4-Not complex, which regulates RNA Polymerase II (Pol II) transcription, also functions downstream of mTORC1 to control Pol I activity. Ccr4-Not localizes to the rDNA and physically associates with the Pol I holoenzyme while Ccr4-Not disruption perturbs rDNA binding of multiple Pol I transcriptional regulators including core factor, the high mobility group protein Hmo1, and the SSU processome. Under nutrient rich conditions, Ccr4-Not suppresses Pol I initiation by regulating interactions with the essential transcription factor Rrn3. Additionally, Ccr4-Not disruption prevents reduced Pol I transcription when mTORC1 is inhibited suggesting Ccr4-Not bridges mTORC1 signaling with Pol I regulation. Analysis of the non-essential Pol I subunits demonstrated that the A34.5 subunit promotes, while the A12.2 and A14 subunits repress, Ccr4-Not interactions with Pol I. Furthermore, ccr4Δ is synthetically sick when paired with rpa12Δ and the double mutant has enhanced sensitivity to transcription elongation inhibition suggesting that Ccr4-Not functions to promote Pol I elongation. Intriguingly, while low concentrations of mTORC1 inhibitors completely inhibit growth of ccr4Δ, a ccr4Δ rpa12Δ rescues this growth defect suggesting that the sensitivity of Ccr4-Not mutants to mTORC1 inhibition is at least partially due to Pol I deregulation. Collectively, these data demonstrate a novel role for Ccr4-Not in Pol I transcriptional regulation that is required for bridging mTORC1 signaling to ribosomal RNA synthesis. PMID:25815716

  15. The complexity of human ribosome biogenesis revealed by systematic nucleolar screening of Pre-rRNA processing factors.

    PubMed

    Tafforeau, Lionel; Zorbas, Christiane; Langhendries, Jean-Louis; Mullineux, Sahra-Taylor; Stamatopoulou, Vassiliki; Mullier, Romain; Wacheul, Ludivine; Lafontaine, Denis L J

    2013-08-22

    Mature ribosomal RNAs (rRNAs) are produced from polycistronic precursors following complex processing. Precursor (pre)-rRNA processing has been extensively characterized in yeast and was assumed to be conserved in humans. We functionally characterized 625 nucleolar proteins in HeLa cells and identified 286 required for processing, including 74 without a yeast homolog. For selected candidates, we demonstrated that pre-rRNA processing defects are conserved in different cell types (including primary cells), defects are not due to activation of a p53-dependent nucleolar tumor surveillance pathway, and they precede cell-cycle arrest and apoptosis. We also investigated the exosome's role in processing internal transcribed spacers (ITSs) and report that 3' end maturation of 18S rRNA involves EXOSC10/Rrp6, a yeast ITS2 processing factor. We conclude that human cells adopt unique strategies and recruit distinct trans-acting factors to carry out essential processing steps, posing fundamental implications for understanding ribosomopathies at the molecular level and developing effective therapeutic agents. PMID:23973377

  16. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  17. Genetic analysis and characterization of a Caulobacter crescentus mutant defective in membrane biogenesis.

    PubMed Central

    Hodgson, D; Shaw, P; Letts, V; Henry, S; Shapiro, L

    1984-01-01

    A mutant of Caulobacter crescentus has been isolated which has an auxotrophic requirement for unsaturated fatty acids or biotin for growth on medium containing glucose as the carbon source. This mutant exhibits a pleiotropic phenotype which includes (i) the auxotrophic requirement, (ii) cell death in cultures attempting to grow on glucose in the absence of fatty acids or biotin, and (iii) a major change in the outer membrane protein composition before cell death. This genetic lesion did not appear to affect directly a fatty acid biosynthetic reaction because fatty acid and phospholipid syntheses were found to continue in the absence of supplement. Oleic acid repressed fatty acid biosynthesis and induced fatty acid degradation in the wild-type parent, AE5000 . The mutant strain, AE6000 , was altered in both of these regulatory functions. The AE6000 mutant also showed specific inhibition of the synthesis of outer membrane and flagellar proteins. Total phospholipid, DNA, RNA, and protein syntheses were unaffected. The multiple phenotypes of the AE6000 mutant were found to cosegregate and to map between hclA and lacA on the C. crescentus chromosome. The defect in this mutant appears to be associated with a regulatory function in membrane biogenesis and provides evidence for a direct coordination of membrane protein synthesis and lipid metabolism in C. crescentus. Images PMID:6202671

  18. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  19. A residue substitution in the plastid ribosomal protein L12/AL1 produces defective plastid ribosome and causes early seedling lethality in rice.

    PubMed

    Zhao, Dong-Sheng; Zhang, Chang-Quan; Li, Qian-Feng; Yang, Qing-Qing; Gu, Ming-Hong; Liu, Qiao-Quan

    2016-05-01

    The plastid ribosome is essential for chloroplast biogenesis as well as seedling formation. As the plastid ribosome closely resembles the prokaryotic 70S ribosome, many plastid ribosomal proteins (PRPs) have been identified in higher plants. However, their assembly in the chloroplast ribosome in rice remains unclear. In the present study, we identified a novel rice mutant, albino lethal 1 (al1), from a chromosome segment substitution line population. The al1 mutant displayed an albino phenotype at the seedling stage and did not survive past the three-leaf stage. No other apparent differences in plant morphology were observed in the al1 mutant. The albino phenotype of the al1 mutant was associated with decreased chlorophyll content and abnormal chloroplast morphology. Using fine mapping, AL1 was shown to encode the PRPL12, a protein localized in the chloroplasts of rice, and a spontaneous single-nucleotide mutation (C/T), resulting in a residue substitution from leucine in AL1 to phenylalanine in al1, was found to be responsible for the early seedling lethality. This point mutation is located at the L10 interface feature of the L12/AL1 protein. Yeast two-hybrid analysis showed that there was no physical interaction between al1 and PRPL10. In addition, the mutation had little effect on the transcript abundance of al1, but had a remarkable effect on the protein abundance of al1 and transcript abundance of chloroplast biogenesis-related and photosynthesis-related genes. These results provide a first glimpse into the molecular details of L12's function in rice. PMID:26873698

  20. Origin of the nucleus and Ran-dependent transport to safeguard ribosome biogenesis in a chimeric cell

    PubMed Central

    Jékely, Gáspár

    2008-01-01

    Background The origin of the nucleus is a central problem about the origin of eukaryotes. The common ancestry of nuclear pore complexes (NPC) and vesicle coating complexes indicates that the nucleus evolved via the modification of a pre-existing endomembrane system. Such an autogenous scenario is cell biologically feasible, but it is not clear what were the selective or neutral mechanisms that had led to the origin of the nuclear compartment. Results A key selective force during the autogenous origin of the nucleus could have been the need to segregate ribosome factories from the cytoplasm where ribosomal proteins (RPs) of the protomitochondrium were synthesized. After its uptake by an anuclear cell the protomitochondrium transferred several of its RP genes to the host genome. Alphaproteobacterial RPs and archaebacterial-type host ribosomes were consequently synthesized in the same cytoplasm. This could have led to the formation of chimeric ribosomes. I propose that the nucleus evolved when the host cell compartmentalised its ribosome factories and the tightly linked genome to reduce ribosome chimerism. This was achieved in successive stages by first evolving karyopherin and RanGTP dependent chaperoning of RPs, followed by the evolution of a membrane network to serve as a diffusion barrier, and finally a hydrogel sieve to ensure selective permeability at nuclear pores. Computer simulations show that a gradual segregation of cytoplasm and nucleoplasm via these steps can progressively reduce ribosome chimerism. Conclusion Ribosome chimerism can provide a direct link between the selective forces for and the mechanisms of evolving nuclear transport and compartmentalisation. The detailed molecular scenario presented here provides a solution to the gradual evolution of nuclear compartmentalization from an anuclear stage. Reviewers This article was reviewed by Eugene V Koonin, Martijn Huynen, Anthony M. Poole and Patrick Forterre. PMID:18652645

  1. Nuclear Matrix Protein 4 Is a Novel Regulator of Ribosome Biogenesis and Controls the Unfolded Protein Response via Repression of Gadd34 Expression.

    PubMed

    Young, Sara K; Shao, Yu; Bidwell, Joseph P; Wek, Ronald C

    2016-06-24

    The unfolded protein response (UPR) maintains protein homeostasis by governing the processing capacity of the endoplasmic reticulum (ER) to manage ER client loads; however, key regulators within the UPR remain to be identified. Activation of the UPR sensor PERK (EIFAK3/PEK) results in the phosphorylation of the α subunit of eIF2 (eIF2α-P), which represses translation initiation and reduces influx of newly synthesized proteins into the overloaded ER. As part of this adaptive response, eIF2α-P also induces a feedback mechanism through enhanced transcriptional and translational expression of Gadd34 (Ppp1r15A),which targets type 1 protein phosphatase for dephosphorylation of eIF2α-P to restore protein synthesis. Here we describe a novel mechanism by which Gadd34 expression is regulated through the activity of the zinc finger transcription factor NMP4 (ZNF384, CIZ). NMP4 functions to suppress bone anabolism, and we suggest that this occurs due to decreased protein synthesis of factors involved in bone formation through NMP4-mediated dampening of Gadd34 and c-Myc expression. Loss of Nmp4 resulted in an increase in c-Myc and Gadd34 expression that facilitated enhanced ribosome biogenesis and global protein synthesis. Importantly, protein synthesis was sustained during pharmacological induction of the UPR through a mechanism suggested to involve GADD34-mediated dephosphorylation of eIF2α-P. Sustained protein synthesis sensitized cells to pharmacological induction of the UPR, and the observed decrease in cell viability was restored upon inhibition of GADD34 activity. We conclude that NMP4 is a key regulator of ribosome biogenesis and the UPR, which together play a central role in determining cell viability during endoplasmic reticulum stress. PMID:27129771

  2. Adjacent Gene Pairing Plays a Role in the Coordinated Expression of Ribosome Biogenesis Genes MPP10 and YJR003C in Saccharomyces cerevisiae ▿

    PubMed Central

    Arnone, James T.; McAlear, Michael A.

    2011-01-01

    The rRNA and ribosome biogenesis (RRB) regulon from Saccharomyces cerevisiae contains some 200 genes, the expression of which is tightly regulated under changing cellular conditions. RRB gene promoters are enriched for the RRPE and PAC consensus motifs, and a significant fraction of RRB genes are found as adjacent gene pairs. A genetic analysis of the MPP10 promoter revealed that both the RRPE and PAC motifs are important for coordinated expression of MPP10 following heat shock, osmotic stress, and glucose replenishment. The association of the RRPE binding factor Stb3 with the MPP10 promoter was found to increase after glucose replenishment and to decrease following heat shock. Similarly, bulk histone H3 clearing and histone H4K12 acetylation levels at the MPP10 promoter were found to increase or decrease following glucose replenishment or heat shock, respectively. Interestingly, substitutions in the PAC and RRPE sequences at the MPP10 promoter were also found to impact the regulated expression of the adjacent RRB gene YJR003, whose promoter lies in the opposite orientation and some 3.8 kb away. Furthermore, the regulated expression of YJR003C could be disrupted by inserting a reporter cassette that increased its distance from MPP10. Given that a high incidence of gene pairing was also found within the ribosomal protein (RP) and RRB regulons across different yeast species, our results indicate that immediately adjacent positioning of genes can be functionally significant for their coregulated expression. PMID:21115740

  3. A high-throughput screen of the GTPase activity of Escherichia coli EngA to find an inhibitor of bacterial ribosome biogenesis

    PubMed Central

    Bharat, Amrita; Blanchard, Jan E.; Brown, Eric D.

    2014-01-01

    The synthesis of ribosomes is an essential process, which is aided by a variety of transacting factors in bacteria. Among these is a group of GTPases essential for bacterial viability and emerging as promising targets for new antibacterial agents. Herein, we describe a robust high-throughput screening process for inhibitors of one such GTPase, the Escherichia coli EngA protein. The primary screen employed an assay of phosphate production in 384-well density. Reaction conditions were chosen to maximize sensitivity for the discovery of competitive inhibitors while maintaining a strong signal amplitude and low noise. In a pilot screen of 31,800 chemical compounds, 44 active compounds were identified. Further, we describe the elimination of non-specific inhibitors that were detergent-sensitive or reactive as well as those that interfered with the high-throughput phosphate assay. Four inhibitors survived these common counter-screens for non-specificity but these chemicals were also inhibitors of the unrelated enzyme dihydrofolate reductase, suggesting that they too were promiscuously active. The high-throughput screen of the EngA protein described here provides a meticulous pilot study in the search for specific inhibitors of GTPases involved in ribosome biogenesis. PMID:23606650

  4. RNA chaperones stimulate formation and yield of the U3 snoRNA-pre-rRNA duplexes needed for eukaryotic ribosome biogenesis

    PubMed Central

    Gérczei, Tímea; Shah, Binal N.; Manzo, Anthony J.; Walter, Nils G.; Correll, Carl C.

    2010-01-01

    To satisfy the high demand for ribosome synthesis in rapidly growing eukaryotic cells, short duplexes between the U3 small nucleolar RNA (snoRNA) and the precursor ribosomal RNA (pre-rRNA) must form quickly and with high yield. These interactions, designated the U3-ETS and U3-18S duplexes, are essential to initiate the processing of small subunit rRNA. Previously, we showed in vitro that duplexes corresponding to those in Saccharomyces cerevisiae are only observed after addition of one of two proteins: Imp3p or Imp4p. Here, we used fluorescence-based and other in vitro assays to determine whether these proteins possess RNA chaperone activities and to assess whether these activities are sufficient to satisfy the duplex yield and rate requirements expected in vivo. Assembly of both proteins with the U3 snoRNA into a chaperone complex destabilizes a U3-stem structure, apparently to expose its 18S base-pairing site. As a result, the chaperone complex accelerates formation of the U3-18S duplex from an undetectable rate to one comparable to the intrinsic rate observed for hybridizing short duplexes. The chaperone complex also stabilizes the U3-ETS duplex by 2.7 kcal/mol. These chaperone activities provide high U3-ETS duplex yield and rapid U3-18S duplex formation over a broad concentration range to help ensure that the U3-pre-rRNA interactions limit neither ribosome biogenesis nor rapid cell growth. The thermodynamic and kinetic framework used is general and thus suitable to investigate the mechanism of action of other RNA chaperones. PMID:19482034

  5. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  6. The Zinc Finger Protein ZNF658 Regulates the Transcription of Genes Involved in Zinc Homeostasis and Affects Ribosome Biogenesis through the Zinc Transcriptional Regulatory Element

    PubMed Central

    Ogo, Ogo A.; Tyson, John; Cockell, Simon J.; Howard, Alison; Valentine, Ruth A.

    2015-01-01

    We previously identified the ZTRE (zinc transcriptional regulatory element) in genes involved in zinc homeostasis and showed that it mediates transcriptional repression in response to zinc. We now report that ZNF658 acts at the ZTRE. ZNF658 was identified by matrix-assisted laser desorption ionization–time of flight mass spectrometry of a band excised after electrophoretic mobility shift assay using a ZTRE probe. The protein contains a KRAB domain and 21 zinc fingers. It has similarity with ZAP1 from Saccharomyces cerevisiae, which regulates the response to zinc restriction, including a conserved DNA binding region we show to be functional also in ZNF658. Small interfering RNA (siRNA) targeted to ZNF658 abrogated the zinc-induced, ZTRE-dependent reduction in SLC30A5 (ZnT5 gene), SLC30A10 (ZnT10 gene), and CBWD transcripts in human Caco-2 cells and the ability of zinc to repress reporter gene expression from corresponding promoter-reporter constructs. Microarray analysis of the effect of reducing ZNF658 expression by siRNA uncovered a large decrease in rRNA. We find that ZTREs are clustered within the 45S rRNA precursor. We also saw effects on expression of multiple ribosomal proteins. ZNF658 thus links zinc homeostasis with ribosome biogenesis, the most active transcriptional, and hence zinc-demanding, process in the cell. ZNF658 is thus a novel transcriptional regulator that plays a fundamental role in the orchestrated cellular response to zinc availability. PMID:25582195

  7. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans

    PubMed Central

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L. J.; Wöhnert, Jens; Entian, Karl-Dieter

    2016-01-01

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m1acp3Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  8. Ribosome biogenesis factor Tsr3 is the aminocarboxypropyl transferase responsible for 18S rRNA hypermodification in yeast and humans.

    PubMed

    Meyer, Britta; Wurm, Jan Philip; Sharma, Sunny; Immer, Carina; Pogoryelov, Denys; Kötter, Peter; Lafontaine, Denis L J; Wöhnert, Jens; Entian, Karl-Dieter

    2016-05-19

    The chemically most complex modification in eukaryotic rRNA is the conserved hypermodified nucleotide N1-methyl-N3-aminocarboxypropyl-pseudouridine (m(1)acp(3)Ψ) located next to the P-site tRNA on the small subunit 18S rRNA. While S-adenosylmethionine was identified as the source of the aminocarboxypropyl (acp) group more than 40 years ago the enzyme catalyzing the acp transfer remained elusive. Here we identify the cytoplasmic ribosome biogenesis protein Tsr3 as the responsible enzyme in yeast and human cells. In functionally impaired Tsr3-mutants, a reduced level of acp modification directly correlates with increased 20S pre-rRNA accumulation. The crystal structure of archaeal Tsr3 homologs revealed the same fold as in SPOUT-class RNA-methyltransferases but a distinct SAM binding mode. This unique SAM binding mode explains why Tsr3 transfers the acp and not the methyl group of SAM to its substrate. Structurally, Tsr3 therefore represents a novel class of acp transferase enzymes. PMID:27084949

  9. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  10. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  11. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  12. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis

    PubMed Central

    Kamio, Takuya; Gu, Bai-wei; Olson, Timothy S.; Zhang, Yanping; Mason, Philip J.; Bessler, Monica

    2016-01-01

    MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA) and in 5q- myelodysplastic syndrome (MDS). DBA and 5q- MDS are associated with inherited (DBA) or acquired (5q- MDS) haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F), retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM), these mice showed a significant decrease in Ter119hi cells compared to wild type (WT) littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low) was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01). This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko). Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK) cells, accompanied by significant decreases in multipotent progenitor (MPP) cells (p < 0.01). Competitive BM repopulation experiments showed

  13. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    PubMed

    Kamio, Takuya; Gu, Bai-Wei; Olson, Timothy S; Zhang, Yanping; Mason, Philip J; Bessler, Monica

    2016-01-01

    MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA) and in 5q- myelodysplastic syndrome (MDS). DBA and 5q- MDS are associated with inherited (DBA) or acquired (5q- MDS) haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F), retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM), these mice showed a significant decrease in Ter119hi cells compared to wild type (WT) littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low) was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01). This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko). Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK) cells, accompanied by significant decreases in multipotent progenitor (MPP) cells (p < 0.01). Competitive BM repopulation experiments showed

  14. Defect in the Formation of 70S Ribosomes Caused by Lack of Ribosomal Protein L34 Can Be Suppressed by Magnesium

    PubMed Central

    Kobayashi, Ako; Suzuki, Shota; Kawamura, Fujio; Shiwa, Yuh; Watanabe, Satoru; Yoshikawa, Hirofumi; Hanai, Ryo; Ishizuka, Morio

    2014-01-01

    To elucidate the biological functions of the ribosomal protein L34, which is encoded by the rpmH gene, the rpmH deletion mutant of Bacillus subtilis and two suppressor mutants were characterized. Although the ΔrpmH mutant exhibited a severe slow-growth phenotype, additional mutations in the yhdP or mgtE gene restored the growth rate of the ΔrpmH strain. Either the disruption of yhdP, which is thought to be involved in the efflux of Mg2+, or overexpression of mgtE, which plays a major role in the import of Mg2+, could suppress defects in both the formation of the 70S ribosome and growth caused by the absence of L34. Interestingly, the Mg2+ content was lower in the ΔrpmH cells than in the wild type, and the Mg2+ content in the ΔrpmH cells was restored by either the disruption of yhdP or overexpression of mgtE. In vitro experiments on subunit association demonstrated that 50S subunits that lacked L34 could form 70S ribosomes only at a high concentration of Mg2+. These results showed that L34 is required for efficient 70S ribosome formation and that L34 function can be restored partially by Mg2+. In addition, the Mg2+ content was consistently lower in mutants that contained significantly reduced amounts of the 70S ribosome, such as the ΔrplA (L1) and ΔrplW (L23) strains and mutant strains with a reduced number of copies of the rrn operon. Thus, the results indicated that the cellular Mg2+ content is influenced by the amount of 70S ribosomes. PMID:25182490

  15. Human nucleolar protein Nop52 (RRP1/NNP-1) is involved in site 2 cleavage in internal transcribed spacer 1 of pre-rRNAs at early stages of ribosome biogenesis

    PubMed Central

    Yoshikawa, Harunori; Ishikawa, Hideaki; Izumikawa, Keiichi; Miura, Yutaka; Hayano, Toshiya; Isobe, Toshiaki; Simpson, Richard J.; Takahashi, Nobuhiro

    2015-01-01

    During the early steps of ribosome biogenesis in mammals, the two ribosomal subunits 40S and 60S are produced via splitting of the large 90S pre-ribosomal particle (90S) into pre-40S and pre-60S pre-ribosomal particles (pre-40S and pre-60S). We previously proposed that replacement of fibrillarin by Nop52 (RRP1/NNP-1) for the binding to p32 (C1QBP) is a key event that drives this splitting process. However, how the replacement by RRP1 is coupled with the endo- and/or exo-ribonucleolytic cleavage of pre-rRNA remains unknown. In this study, we demonstrate that RRP1 deficiency suppressed site 2 cleavage on ITS1 of 47S/45S, 41S and 36S pre-rRNAs in human cells. RRP1 was also present in 90S and was localized in the dense fibrillar component of the nucleolus dependently on active RNA polymerase I transcription. In addition, double knockdown of XRN2 and RRP1 revealed that RRP1 accelerated the site 2 cleavage of 47S, 45S and 41S pre-rRNAs. These data suggest that RRP1 is involved not only in competitive binding with fibrillarin to C1QBP on 90S but also in site 2 cleavage in ITS1 of pre-rRNAs at early stages of human ribosome biogenesis; thus, it is likely that RRP1 integrates the cleavage of site 2 with the physical split of 90S into pre-40S and pre-60S. PMID:25969445

  16. Human nucleolar protein Nop52 (RRP1/NNP-1) is involved in site 2 cleavage in internal transcribed spacer 1 of pre-rRNAs at early stages of ribosome biogenesis.

    PubMed

    Yoshikawa, Harunori; Ishikawa, Hideaki; Izumikawa, Keiichi; Miura, Yutaka; Hayano, Toshiya; Isobe, Toshiaki; Simpson, Richard J; Takahashi, Nobuhiro

    2015-06-23

    During the early steps of ribosome biogenesis in mammals, the two ribosomal subunits 40S and 60S are produced via splitting of the large 90S pre-ribosomal particle (90S) into pre-40S and pre-60S pre-ribosomal particles (pre-40S and pre-60S). We previously proposed that replacement of fibrillarin by Nop52 (RRP1/NNP-1) for the binding to p32 (C1QBP) is a key event that drives this splitting process. However, how the replacement by RRP1 is coupled with the endo- and/or exo-ribonucleolytic cleavage of pre-rRNA remains unknown. In this study, we demonstrate that RRP1 deficiency suppressed site 2 cleavage on ITS1 of 47S/45S, 41S and 36S pre-rRNAs in human cells. RRP1 was also present in 90S and was localized in the dense fibrillar component of the nucleolus dependently on active RNA polymerase I transcription. In addition, double knockdown of XRN2 and RRP1 revealed that RRP1 accelerated the site 2 cleavage of 47S, 45S and 41S pre-rRNAs. These data suggest that RRP1 is involved not only in competitive binding with fibrillarin to C1QBP on 90S but also in site 2 cleavage in ITS1 of pre-rRNAs at early stages of human ribosome biogenesis; thus, it is likely that RRP1 integrates the cleavage of site 2 with the physical split of 90S into pre-40S and pre-60S. PMID:25969445

  17. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  18. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  19. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  20. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  1. Identification of six loci in which mutations partially restore peroxisome biogenesis and/or alleviate the metabolic defect of pex2 mutants in podospora.

    PubMed Central

    Ruprich-Robert, Gwenaël; Berteaux-Lecellier, Véronique; Zickler, Denise; Panvier-Adoutte, Arlette; Picard, Marguerite

    2002-01-01

    Peroxins (PEX) are proteins required for peroxisome biogenesis. Mutations in PEX genes cause lethal diseases in humans, metabolic defects in yeasts, and developmental disfunctions in plants and filamentous fungi. Here we describe the first large-scale screening for suppressors of a pex mutation. In Podospora anserina, pex2 mutants exhibit a metabolic defect [inability to grow on medium containing oleic acid (OA medium) as sole carbon source] and a developmental defect (inability to differentiate asci in homozygous crosses). Sixty-three mutations able to restore growth of pex2 mutants on OA medium have been analyzed. They fall in six loci (suo1 to suo6) and act as dominant, allele-nonspecific suppressors. Most suo mutations have pleiotropic effects in a pex2(+) background: formation of unripe ascospores (all loci except suo5 and suo6), impaired growth on OA medium (all loci except suo4 and suo6), or sexual defects (suo4). Using immunofluorescence and GFP staining, we show that peroxisome biogenesis is partially restored along with a low level of ascus differentiation in pex2 mutant strains carrying either the suo5 or the suo6 mutations. The data are discussed with respect to beta-oxidation of fatty acids, peroxisome biogenesis, and cell differentiation. PMID:12136013

  2. Maize mutants lacking chloroplast FtsY exhibit pleiotropic defects in the biogenesis of thylakoid membranes.

    PubMed

    Asakura, Yukari; Hirohashi, Toshiya; Kikuchi, Shingo; Belcher, Susan; Osborne, Erin; Yano, Satoshi; Terashima, Ichiro; Barkan, Alice; Nakai, Masato

    2004-01-01

    A chloroplast signal recognition particle (SRP) that is related to the SRP involved in secretion in bacteria and eukaryotic cells is used for the insertion of light-harvesting chlorophyll proteins (LHCPs) into the thylakoid membranes. A conserved component of the SRP mechanism is a membrane-bound SRP receptor, denoted FtsY in bacteria. Plant genomes encode FtsY homologs that are targeted to the chloroplast (cpFtsY). To investigate the in vivo roles of cpFtsY, we characterized maize cpFtsY and maize mutants having a Mu transposon insertion in the corresponding gene (chloroplast SRP receptor1, or csr1). Maize cpFtsY accumulates to much higher levels in leaf tissue than in roots and stems. Interestingly, it is present at similar levels in etiolated and green leaf tissue and was found to bind the prolamellar bodies of etioplasts. A null cpFtsY mutant, csr1-1, showed a substantial loss of leaf chlorophyll, whereas a "leaky" allele, csr1-3, conditioned a more moderate chlorophyll deficiency. Both alleles caused the loss of various LHCPs and the thylakoid-bound photosynthetic enzyme complexes and were seedling lethal. By contrast, levels of the membrane-bound components of the thylakoid protein transport machineries were not altered. The thylakoid membranes in csr1-1 chloroplasts were unstacked and reduced in abundance, but the prolamellar bodies in mutant etioplasts appeared normal. These results demonstrate the essentiality of cpFtsY for the biogenesis not only of the LHCPs but also for the assembly of the other membrane-bound components of the photosynthetic apparatus. PMID:14688289

  3. GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily, controls seed germination, growth and biomass accumulation through ribosome-biogenesis protein interactions in Arabidopsis thaliana

    PubMed Central

    2014-01-01

    Background WD40 domains have been found in a plethora of eukaryotic proteins, acting as scaffolding molecules assisting proper activity of other proteins, and are involved in multi-cellular processes. They comprise several stretches of 44-60 amino acid residues often terminating with a WD di-peptide. They act as a site of protein-protein interactions or multi-interacting platforms, driving the assembly of protein complexes or as mediators of transient interplay among other proteins. In Arabidopsis, members of WD40 protein superfamily are known as key regulators of plant-specific events, biologically playing important roles in development and also during stress signaling. Results Using reverse genetic and protein modeling approaches, we characterize GIGANTUS1 (GTS1), a new member of WD40 repeat protein in Arabidopsis thaliana and provide evidence of its role in controlling plant growth development. GTS1 is highly expressed during embryo development and negatively regulates seed germination, biomass yield and growth improvement in plants. Structural modeling analysis suggests that GTS1 folds into a β-propeller with seven pseudo symmetrically arranged blades around a central axis. Molecular docking analysis shows that GTS1 physically interacts with two ribosomal protein partners, a component of ribosome Nop16, and a ribosome-biogenesis factor L19e through β-propeller blade 4 to regulate cell growth development. Conclusions Our results indicate that GTS1 might function in plant developmental processes by regulating ribosomal structural features, activities and biogenesis in plant cells. Our results suggest that GIGANTUS1 might be a promising target to engineer transgenic plants with higher biomass and improved growth development for plant-based bioenergy production. PMID:24467952

  4. Ubiquitous Autofragmentation of Fluorescent Proteins Creates Abundant Defective Ribosomal Products (DRiPs) for Immunosurveillance.

    PubMed

    Wei, Jiajie; Gibbs, James S; Hickman, Heather D; Cush, Stephanie S; Bennink, Jack R; Yewdell, Jonathan W

    2015-06-26

    Green fluorescent protein (GFP) and other fluorescent proteins are essential tools for biological research. When fused to peptides or proteins as a reporter, GFP enables localization and quantitation of gene products in otherwise unmanipulated live cells or organisms. We previously reported that a sizable fraction of nascent GFP is post-translationally converted into a 20-kDa Triton X-100-insoluble proteasome substrate (Qian, S. B., Princiotta, M. F., Bennink, J. R., and Yewdell, J. W. (2006) J. Biol. Chem. 281, 392-400; Dolan, B. P., Li, L., Veltri, C. A., Ireland, C. M., Bennink, J. R., and Yewdell, J. W. (2011) J. Immunol. 186, 2065-2072). Here, we show that a similarly sized fragment is generated by all GFP and red fluorescent protein family members we examined. We demonstrate that fragmentation is a by-product of GFP chromophore rearrangement. A non-rearranging GFP mutant fails to fragment and generates diminished levels of K(b)-SIINFEKL complexes when SIINFEKL is genetically fused to either the C- or N-terminal domains of GFP fusion proteins. Instructively, another fragmenting GFP mutant that cannot create the functional chromophore but still generates fragments also demonstrates diminished K(b)-SIINFEKL generation. However, the mutant and wild-type fragments differ fundamentally in that wild-type fragments are rapidly liberated from the intact molecule and degraded quickly, accounting for increased K(b)-SIINFEKL generation. In the fragmenting mutant, the fragments are generated slowly and remain associated, likely in a native conformation based on their original structural description (Barondeau, D. P., Kassmann, C. J., Tainer, J. A., and Getzoff, E. D. (2006) J. Am. Chem. Soc. 128, 4685-4693). The wild-type GFP fragments represent the first biochemically defined natural defective ribosomal products to contribute peptides for immunosurveillance, enabling quantitation of peptide generation efficiency from this source of defective ribosomal products. More

  5. Ubiquitous Autofragmentation of Fluorescent Proteins Creates Abundant Defective Ribosomal Products (DRiPs) for Immunosurveillance*

    PubMed Central

    Wei, Jiajie; Gibbs, James S.; Hickman, Heather D.; Cush, Stephanie S.; Bennink, Jack R.; Yewdell, Jonathan W.

    2015-01-01

    Green fluorescent protein (GFP) and other fluorescent proteins are essential tools for biological research. When fused to peptides or proteins as a reporter, GFP enables localization and quantitation of gene products in otherwise unmanipulated live cells or organisms. We previously reported that a sizable fraction of nascent GFP is post-translationally converted into a 20-kDa Triton X-100-insoluble proteasome substrate (Qian, S. B., Princiotta, M. F., Bennink, J. R., and Yewdell, J. W. (2006) J. Biol. Chem. 281, 392–400; Dolan, B. P., Li, L., Veltri, C. A., Ireland, C. M., Bennink, J. R., and Yewdell, J. W. (2011) J. Immunol. 186, 2065–2072). Here, we show that a similarly sized fragment is generated by all GFP and red fluorescent protein family members we examined. We demonstrate that fragmentation is a by-product of GFP chromophore rearrangement. A non-rearranging GFP mutant fails to fragment and generates diminished levels of Kb-SIINFEKL complexes when SIINFEKL is genetically fused to either the C- or N-terminal domains of GFP fusion proteins. Instructively, another fragmenting GFP mutant that cannot create the functional chromophore but still generates fragments also demonstrates diminished Kb-SIINFEKL generation. However, the mutant and wild-type fragments differ fundamentally in that wild-type fragments are rapidly liberated from the intact molecule and degraded quickly, accounting for increased Kb-SIINFEKL generation. In the fragmenting mutant, the fragments are generated slowly and remain associated, likely in a native conformation based on their original structural description (Barondeau, D. P., Kassmann, C. J., Tainer, J. A., and Getzoff, E. D. (2006) J. Am. Chem. Soc. 128, 4685–4693). The wild-type GFP fragments represent the first biochemically defined natural defective ribosomal products to contribute peptides for immunosurveillance, enabling quantitation of peptide generation efficiency from this source of defective ribosomal products. More

  6. Metallothionein Abrogates GTP Cyclohydrolase I inhibition-Induced Cardiac Contractile and Morphological Defect: Role of Mitochondrial Biogenesis

    PubMed Central

    Ceylan-Isik, Asli F.; Guo, Kelly K.; Carlson, Edward C.; Privratsky, Jamie R.; Liao, Song-Jie; Cai, Lu; Chen, Alex F.; Ren, Jun

    2009-01-01

    One key mechanism for endothelial dysfunction is eNOS uncoupling, whereby eNOS generates O2•− rather than NO, due to deficient eNOS cofactor tetrahydrobiopterin (BH4). This study was designed to examine the effect of BH4 deficiency on cardiac morphology and function as well as the impact of metallothionein (MT) on BH4 deficiency-induced abnormalities, if any. FVB and cardiac-specific MT transgenic mice were exposed to 2,4-diamino-6-hydroxy-pyrimidine (DAHP, 10 mmol/l, 3 wks), an inhibitor of the BH4 synthetic enzyme GTP cyclohydrolase I. DAHP reduced plasma BH4 levels by 85% and elevated blood pressure in both FVB and MT mice. Echocardiography found decreased fractional shortening and increased end systolic diameter in DAHP-treated FVB mice. Cardiomyocytes from DAHP-treated FVB mice displayed enhanced O2•− production, contractile and intracellular Ca2+ defects including depressed peak shortening and maximal velocity of shortening/relengthening, prolonged duration of relengthening, reduced intracellular Ca2+ rise and clearance. DAHP triggered mitochondrial swelling/myocardial filament aberrations and mitochondrial O2•− accumulation, assessed by TEM and MitoSOX Red fluorescence, respectively. DAHP also promoted the L-NAME inhibitable O2•− production and eNOS phosphorylation at Thr497. Although MT had little effect on cardiac mechanics and ultrastructure, it attenuated DAHP-induced defects in cardiac function, morphology, O2•− production and eNOS phosphorylation (Thr497). The DAHP-induced cardiomyocyte mechanical responses were alleviated by in vitro BH4 treatment. DAHP inhibited mitochondrial biogenesis, mitochondrial uncoupling protein 2 (UCP2) and chaperone HSP90, all but UCP2 was rescued by MT. Our data suggest a role of BH4 deficiency in cardiac dysfunction and therapeutic potential of antioxidants against eNOS uncoupling in the hearts. PMID:19398661

  7. Squalene is lipotoxic to yeast cells defective in lipid droplet biogenesis.

    PubMed

    Valachovic, Martin; Garaiova, Martina; Holic, Roman; Hapala, Ivan

    2016-01-22

    The toxic effect of overloaded lipids on cell physiology and viability was described in various organisms. In this study we focused on the potential lipotoxicity of squalene, a linear triterpene synthesized in eukaryotic cells as an intermediate in sterol biosynthesis. Squalene toxicity was studied in the yeast Saccharomyces cerevisiae, a model unicellular eukaryote established in lipotoxicity studies. Squalene levels in yeast are typically low but its accumulation can be induced under specific conditions, e.g. by inhibition of squalene monooxygenase with the antimycotic terbinafine. At higher levels squalene is stored in lipid droplets. We demonstrated that low doses of terbinafine caused severe impairment of growth and loss of viability of the yeast mutant dga1Δ lro1Δ are1Δ are2Δ unable to form lipid droplets and that these defects were linked to squalene accumulation. The hypersensitivity of the lipid droplet-less mutant to terbinafine was alleviated by decreasing squalene accumulation with low doses of squalene synthase inhibitor zaragozic acid. Our results proved that accumulated squalene is lipotoxic to yeast cells if it cannot be efficiently sequestered in lipid droplets. This supports the hypothesis about the role of squalene in the fungicidal activity of terbinafine. Squalene toxicity may represent also a limiting factor for production of this high-value lipid in yeast. PMID:26703208

  8. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  9. Mutation of the rice ASL2 gene encoding plastid ribosomal protein L21 causes chloroplast developmental defects and seedling death.

    PubMed

    Lin, D; Jiang, Q; Zheng, K; Chen, S; Zhou, H; Gong, X; Xu, J; Teng, S; Dong, Y

    2015-05-01

    The plastid ribosome proteins (PRPs) play important roles in plastid protein biosynthesis, chloroplast differentiation and early chloroplast development. However, the specialised functions of individual protein components of the chloroplast ribosome in rice (Oryza sativa) remain unresolved. In this paper, we identified a novel rice PRP mutant named asl2 (Albino seedling lethality 2) exhibiting an albino, seedling death phenotype. In asl2 mutants, the alteration of leaf colour was associated with chlorophyll (Chl) content and abnormal chloroplast development. Through map-based cloning and complementation, the mutated ASL2 gene was isolated and found to encode the chloroplast 50S ribosome protein L21 (RPL21c), a component of the chloroplast ribosome large subunit, which was localised in chloroplasts. ASL2 was expressed at a higher level in the plumule and leaves, implying its tissue-specific expression. Additionally, the expression of ASL2 was regulated by light. The transcript levels of the majority of genes for Chl biosynthesis, photosynthesis and chloroplast development were strongly affected in asl2 mutants. Collectively, the absence of functional ASL2 caused chloroplast developmental defects and seedling death. This report establishes the important role of RPL21c in chloroplast development in rice. PMID:25280352

  10. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  11. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  12. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  13. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  14. Bypass of the pre-60S ribosomal quality control as a pathway to oncogenesis.

    PubMed

    Sulima, Sergey O; Patchett, Stephanie; Advani, Vivek M; De Keersmaecker, Kim; Johnson, Arlen W; Dinman, Jonathan D

    2014-04-15

    Ribosomopathies are a class of diseases caused by mutations that affect the biosynthesis and/or functionality of the ribosome. Although they initially present as hypoproliferative disorders, such as anemia, patients have elevated risk of hyperproliferative disease (cancer) by midlife. Here, this paradox is explored using the rpL10-R98S (uL16-R98S) mutant yeast model of the most commonly identified ribosomal mutation in acute lymphoblastic T-cell leukemia. This mutation causes a late-stage 60S subunit maturation failure that targets mutant ribosomes for degradation. The resulting deficit in ribosomes causes the hypoproliferative phenotype. This 60S subunit shortage, in turn, exerts pressure on cells to select for suppressors of the ribosome biogenesis defect, allowing them to reestablish normal levels of ribosome production and cell proliferation. However, suppression at this step releases structurally and functionally defective ribosomes into the translationally active pool, and the translational fidelity defects of these mutants culminate in destabilization of selected mRNAs and shortened telomeres. We suggest that in exchange for resolving their short-term ribosome deficits through compensatory trans-acting suppressors, cells are penalized in the long term by changes in gene expression that ultimately undermine cellular homeostasis. PMID:24706786

  15. PIM1 destabilization activates a p53-dependent response to ribosomal stress in cancer cells.

    PubMed

    Sagar, Vinay; Caldarola, Sara; Aria, Valentina; Monteleone, Valentina; Fuoco, Claudia; Gargioli, Cesare; Cannata, Stefano; Loreni, Fabrizio

    2016-04-26

    Defects in ribosome biogenesis triggers a stress response (ribosomal stress) that can lead to growth arrest and apoptosis. Signaling pathways activated by ribosomal stress are specifically involved in the pathological mechanism of a group of disorders defined as ribosomopathies. However, more generally, the quality control of ribosome synthesis is part of the regulatory circuits that control cell metabolism. A number of studies identified tumor suppressor p53 as a central player in ribosomal stress. We have previously reported that the kinase PIM1 plays a role as a sensor for ribosome deficiency. In this report we address the relationship between PIM1 and p53 in cancer cell lines after depletion of a ribosomal protein. We identified a novel signaling pathway that includes the kinase AKT and the ubiquitin ligase MDM2. In fact, our results indicate that the lower level of PIM1, induced by ribosomal stress, causes inactivation of AKT, inhibition of MDM2 and a consequent p53 stabilization. Therefore, we propose that activation of p53 in response to ribosomal stress, is dependent on the pathway PIM1-AKT-MDM2. In addition, we report evidence that PIM1 level may be relevant to assess the sensitivity of cancer cells to chemotherapeutic drugs that induce ribosomal stress. PMID:26993775

  16. The C-terminal silencing domain of Rap1p is essential for the repression of ribosomal protein genes in response to a defect in the secretory pathway.

    PubMed Central

    Mizuta, K; Tsujii, R; Warner, J R; Nishiyama, M

    1998-01-01

    We have previously shown that a functional secretory pathway is essential for continued ribosome synthesis in Saccharomyces cerevisiae. When a temperature-sensitive mutant defective in the secretory pathway is transferred to the non-permissive temperature, transcription of both rRNA genes and ribosomal protein genes is nearly abolished. In order to define the cis -acting element(s) of ribosomal protein genes sensitive to a defect in the secretory pathway, we have constructed a series of fusion genes containing the CYH2 promoter region, with various deletions, fused to lacZ. Each fusion gene for which transcription is detected is subject to the repression. Rap1p is the transcriptional activator for most ribosomal protein genes, as well as having an important role in silencing in the vicinity of telomeres and at the silent mating-type loci. To assess its role in the repression of transcription by the defect in the secretory pathway, we have introduced rap1 mutations. The replacement of wild-type Rap1p by Rap1p truncated at the C-terminal region caused substantial attenuation of the repression. Furthermore, we have demonstrated that the Rap1p-truncation affects the repression of TCM1 , encoding ribosomal protein L3, which has no Rap1p-binding site in its upstream regulatory region. These results suggest that the repression of transcription of ribosomal protein genes by a secretory defect is mediated through Rap1p, but does not require a Rap1p-binding site within the UAS. PMID:9461469

  17. Las1 interacts with Grc3 polynucleotide kinase and is required for ribosome synthesis in Saccharomyces cerevisiae

    PubMed Central

    Castle, Christopher D.; Sardana, Richa; Dandekar, Varada; Borgianini, Victoria; Johnson, Arlen W.; Denicourt, Catherine

    2013-01-01

    Ribosome biogenesis is a multi-step process that couples cell growth with cell proliferation. Although several large-scale analysis of pre-ribosomal particles have identified numerous trans-acting factors involved in this process, many proteins involved in pre-rRNA processing and ribosomal subunit maturation have yet to be identified. Las1 was originally identified in Saccharomyces cerevisiae as a protein involved in cell morphogenesis. We previously demonstrated that the human homolog, Las1L, is required for efficient ITS2 rRNA processing and synthesis of the 60S ribosomal subunit. Here, we report that the functions of Las1 in ribosome biogenesis are also conserved in S. cerevisiae. Depletion of Las1 led to the accumulation of both the 27S and 7S rRNA intermediates and impaired the synthesis of the 60S subunit. We show that Las1 co-precipitates mainly with the 27S rRNA and associates with an Nsa1 and Rix1-containing pre-60S particle. We further identify Grc3 as a major Las1-interacting protein. We demonstrate that the kinase activity of Grc3 is required for efficient pre-rRNA processing and that depletion of Grc3 leads to rRNA processing defects similar to the ones observed in Las1-depleted cells. We propose that Las1 and Grc3 function together in a conserved mechanism to modulate rRNA processing and eukaryotic ribosome biogenesis. PMID:23175604

  18. Ribosomopathies: Global process, tissue specific defects.

    PubMed

    Yelick, Pamela C; Trainor, Paul A

    2015-01-01

    Disruptions in ribosomal biogenesis would be expected to have global and in fact lethal effects on a developing organism. However, mutations in ribosomal protein genes have been shown in to exhibit tissue specific defects. This seemingly contradictory finding - that globally expressed genes thought to play fundamental housekeeping functions can in fact exhibit tissue and cell type specific functions - provides new insight into roles for ribosomes, the protein translational machinery of the cell, in regulating normal development and disease. Furthermore it illustrates the surprisingly dynamic nature of processes regulating cell type specific protein translation. In this review, we discuss our current knowledge of a variety of ribosomal protein mutations associated with human disease, and models to better understand the molecular mechanisms associated with each. We use specific examples to emphasize both the similarities and differences between the effects of various human ribosomal protein mutations. Finally, we discuss areas of future study that are needed to further our understanding of the role of ribosome biogenesis in normal development, and possible approaches that can be used to treat debilitating ribosomopathy diseases. PMID:26442198

  19. Ribosomopathies: Global process, tissue specific defects

    PubMed Central

    Yelick, Pamela C; Trainor, Paul A

    2015-01-01

    Disruptions in ribosomal biogenesis would be expected to have global and in fact lethal effects on a developing organism. However, mutations in ribosomal protein genes have been shown in to exhibit tissue specific defects. This seemingly contradictory finding - that globally expressed genes thought to play fundamental housekeeping functions can in fact exhibit tissue and cell type specific functions ‐ provides new insight into roles for ribosomes, the protein translational machinery of the cell, in regulating normal development and disease. Furthermore it illustrates the surprisingly dynamic nature of processes regulating cell type specific protein translation. In this review, we discuss our current knowledge of a variety of ribosomal protein mutations associated with human disease, and models to better understand the molecular mechanisms associated with each. We use specific examples to emphasize both the similarities and differences between the effects of various human ribosomal protein mutations. Finally, we discuss areas of future study that are needed to further our understanding of the role of ribosome biogenesis in normal development, and possible approaches that can be used to treat debilitating ribosomopathy diseases. PMID:26442198

  20. The emerging importance of ribosomal dysfunction in the pathogenesis of hematologic disorders.

    PubMed

    Raiser, David M; Narla, Anupama; Ebert, Benjamin L

    2014-03-01

    More than a decade has passed since the initial identification of ribosomal protein gene mutations in patients with Diamond-Blackfan anemia (DBA), a hematologic disorder that became the founding member of a class of diseases known as ribosomopathies. In these diseases, genetic abnormalities that result in defective ribosome biogenesis cause strikingly tissue-specific phenotypes in patients, specifically bone marrow failure, craniofacial abnormalities and skeletal defects. Several animal models and numerous in vitro studies have demonstrated that the p53 pathway is central to the ribosomopathy phenotype. Additionally, there is mounting evidence of a link between the dysregulation of components of the translational machinery and the pathology of various malignancies. The importance of the role of ribosomal dysfunction in the pathogenesis of hematologic disorders is becoming clearer, and elucidation of the underlying mechanisms could have broad implications for both basic cellular biology and clinical intervention strategies. PMID:23863123

  1. The RICE MINUTE-LIKE1 (RML1) gene, encoding a ribosomal large subunit protein L3B, regulates leaf morphology and plant architecture in rice

    PubMed Central

    Zheng, Ming; Wang, Yihua; Liu, Xi; Sun, Juan; Wang, Yunlong; Xu, Yang; Lv, Jia; Long, Wuhua; Zhu, Xiaopin; Guo, Xiuping; Jiang, Ling; Wang, Chunming; Wan, Jianmin

    2016-01-01

    Mutations of ribosomal proteins (RPs) are known to cause developmental abnormalities in yeast, mammals, and dicotyledonous plants; however, their effects have not been studied in rice. Here, we identifiy a ribosomal biogenesis mutant, rice minute-like1 (rml1) that displays a minute phenotype as evidenced by retarded growth and defects in the vascular system. We determine that RML1 encodes a ribosome large subunit protein 3B (RPL3B) in rice by means of map-based cloning and genetic complementation. RPL3B is abundantly expressed in all the tissues, whereas RPL3A, another RPL3 gene family member, is expressed at low levels. Notably, the expression level of RPL3A in the rml1 mutant is similar to that in the wild-type, suggesting that RPL3A provides no functional compensation for RPL3B in rml1 plants. Ribosomal profiles show that mutation of RPL3B leads to a significant reduction in free 60S ribosomal subunits and polysomes, indicating a ribosomal insufficiency in the rml1 mutant. Our results demonstrate that the ribosomal protein gene RPL3B is required for maintaining normal leaf morphology and plant architecture in rice through its regulation of ribosome biogenesis. PMID:27241493

  2. The RICE MINUTE-LIKE1 (RML1) gene, encoding a ribosomal large subunit protein L3B, regulates leaf morphology and plant architecture in rice.

    PubMed

    Zheng, Ming; Wang, Yihua; Liu, Xi; Sun, Juan; Wang, Yunlong; Xu, Yang; Lv, Jia; Long, Wuhua; Zhu, Xiaopin; Guo, Xiuping; Jiang, Ling; Wang, Chunming; Wan, Jianmin

    2016-05-01

    Mutations of ribosomal proteins (RPs) are known to cause developmental abnormalities in yeast, mammals, and dicotyledonous plants; however, their effects have not been studied in rice. Here, we identifiy a ribosomal biogenesis mutant, rice minute-like1 (rml1) that displays a minute phenotype as evidenced by retarded growth and defects in the vascular system. We determine that RML1 encodes a ribosome large subunit protein 3B (RPL3B) in rice by means of map-based cloning and genetic complementation. RPL3B is abundantly expressed in all the tissues, whereas RPL3A, another RPL3 gene family member, is expressed at low levels. Notably, the expression level of RPL3A in the rml1 mutant is similar to that in the wild-type, suggesting that RPL3A provides no functional compensation for RPL3B in rml1 plants. Ribosomal profiles show that mutation of RPL3B leads to a significant reduction in free 60S ribosomal subunits and polysomes, indicating a ribosomal insufficiency in the rml1 mutant. Our results demonstrate that the ribosomal protein gene RPL3B is required for maintaining normal leaf morphology and plant architecture in rice through its regulation of ribosome biogenesis. PMID:27241493

  3. rRNA Pseudouridylation Defects Affect Ribosomal Ligand Binding and Translational Fidelity from Yeast to Human Cells

    PubMed Central

    Jack, Karen; Bellodi, Cristian; Landry, Dori M.; Niederer, Rachel; Meskauskas, Arturas; Musalgaonkar, Sharmishtha; Kopmar, Noam; Krasnykh, Olya; Dean, Alison M.; Thompson, Sunnie R.; Ruggero, Davide; Dinman, Jonathan D.

    2011-01-01

    Summary How pseudouridylation (Ψ), the most common and evolutionarily conserved modification of rRNA, regulates ribosome activity is poorly understood. Medically, Ψ is important because the rRNA Ψ synthase, DKC1, is mutated in X-linked Dyskeratosis Congenita (X-DC) and Hoyeraal-Hreidarsson syndrome (HH). Here we characterize ribosomes isolated from a yeast strain where Cbf5p, the yeast homologue of DKC1, is catalytically impaired through a D95A mutation (cbf5-D95A). Ribosomes from cbf5-D95A cells display decreased affinities for tRNA binding to the A- and P-sites as well as the cricket paralysis virus IRES (Internal Ribosome Entry Site), which interacts with both the P- and E-sites of the ribosome. This biochemical impairment in ribosome activity manifests as decreased translational fidelity and IRES-dependent translational initiation, which are also evident in mouse and human cells deficient for DKC1 activity. These findings uncover specific roles for Ψ modification in ribosome-ligand interactions that are conserved in yeast, mouse, and humans. PMID:22099312

  4. Mitochondrial biogenesis: pharmacological approaches.

    PubMed

    Valero, Teresa

    2014-01-01

    ), myoclonic epilepsy with ragged-red fibers (MERRF), mitochondrial encephalomyopathy, lactic acidosis and strokelike episodes (MELAS), Leber's hereditary optic neuropathy (LHON), the syndrome of neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP), and Leigh's syndrome. Likewise, other diseases in which mitochondrial dysfunction plays a very important role include neurodegenerative diseases, diabetes or cancer. Generally, in mitochondrial diseases a mutation in the mitochondrial DNA leads to a loss of functionality of the OXPHOS system and thus to a depletion of ATP and overproduction of ROS, which can, in turn, induce further mtDNA mutations. The work by Yu-Ting Wu, Shi-Bei Wu, and Yau-Huei Wei (Department of Biochemistry and Molecular Biology, National Yang-Ming University, Taiwan) [4] focuses on the aforementioned mitochondrial diseases with special attention to the compensatory mechanisms that prompt mitochondria to produce more energy even under mitochondrial defect-conditions. These compensatory mechanisms include the overexpression of antioxidant enzymes, mitochondrial biogenesis and overexpression of respiratory complex subunits, as well as metabolic shift to glycolysis. The pathways observed to be related to mitochondrial biogenesis as a compensatory adaptation to the energetic deficits in mitochondrial diseases are described (PGC- 1, Sirtuins, AMPK). Several pharmacological strategies to trigger these signaling cascades, according to these authors, are the use of bezafibrate to activate the PPAR-PGC-1α axis, the activation of AMPK by resveratrol and the use of Sirt1 agonists such as quercetin or resveratrol. Other strategies currently used include the addition of antioxidant supplements to the diet (dietary supplementation with antioxidants) such as L-carnitine, coenzyme Q10,MitoQ10 and other mitochondria-targeted antioxidants,N-acetylcysteine (NAC), vitamin C, vitamin E vitamin K1, vitamin B, sodium pyruvate or -lipoic acid. As aforementioned, other

  5. Both endonucleolytic and exonucleolytic cleavage mediate ITS1 removal during human ribosomal RNA processing.

    PubMed

    Sloan, Katherine E; Mattijssen, Sandy; Lebaron, Simon; Tollervey, David; Pruijn, Ger J M; Watkins, Nicholas J

    2013-03-01

    Human ribosome production is up-regulated during tumorogenesis and is defective in many genetic diseases (ribosomopathies). We have undertaken a detailed analysis of human precursor ribosomal RNA (pre-rRNA) processing because surprisingly little is known about this important pathway. Processing in internal transcribed spacer 1 (ITS1) is a key step that separates the rRNA components of the large and small ribosomal subunits. We report that this was initiated by endonuclease cleavage, which required large subunit biogenesis factors. This was followed by 3' to 5' exonucleolytic processing by RRP6 and the exosome, an enzyme complex not previously linked to ITS1 removal. In contrast, RNA interference-mediated knockdown of the endoribonuclease MRP did not result in a clear defect in ITS1 processing. Despite the apparently high evolutionary conservation of the pre-rRNA processing pathway and ribosome synthesis factors, each of these features of human ITS1 processing is distinct from those in budding yeast. These results also provide significant insight into the links between ribosomopathies and ribosome production in human cells. PMID:23439679

  6. DEMONSTRATION BULLETIN: BIOGENESIS SOIL WASHING TECHNOLOGY - BIOGENESIS

    EPA Science Inventory

    The BioGenesisSM soil washing technology was developed by BioGenesis Enterprises, Inc. to remove organic compounds from soil. The technology uses a proprietary solution (BioGenesisSM cleaner) to transfer organic compounds from the soil matrix to a liquid phase. BioGenesis claims...

  7. Ribosomal stress activates eEF2K–eEF2 pathway causing translation elongation inhibition and recruitment of Terminal Oligopyrimidine (TOP) mRNAs on polysomes

    PubMed Central

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G.; Loreni, Fabrizio

    2014-01-01

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  8. Ribosomal stress activates eEF2K-eEF2 pathway causing translation elongation inhibition and recruitment of terminal oligopyrimidine (TOP) mRNAs on polysomes.

    PubMed

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G; Loreni, Fabrizio

    2014-11-10

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  9. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  10. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  11. Deregulation of Internal Ribosome Entry Site-Mediated p53 Translation in Cancer Cells with Defective p53 Response to DNA Damage

    PubMed Central

    Halaby, Marie-Jo; Harris, Benjamin R. E.; Miskimins, W. Keith; Cleary, Margot P.

    2015-01-01

    Synthesis of the p53 tumor suppressor and its subsequent activation following DNA damage are critical for its protection against tumorigenesis. We previously discovered an internal ribosome entry site (IRES) at the 5′ untranslated region of the p53 mRNA. However, the connection between IRES-mediated p53 translation and p53's tumor suppressive function is unknown. In this study, we identified two p53 IRES trans-acting factors, translational control protein 80 (TCP80), and RNA helicase A (RHA), which positively regulate p53 IRES activity. Overexpression of TCP80 and RHA also leads to increased expression and synthesis of p53. Furthermore, we discovered two breast cancer cell lines that retain wild-type p53 but exhibit defective p53 induction and synthesis following DNA damage. The levels of TCP80 and RHA are extremely low in both cell lines, and expression of both proteins is required to significantly increase the p53 IRES activity in these cells. Moreover, we found cancer cells transfected with a shRNA against TCP80 not only exhibit decreased expression of TCP80 and RHA but also display defective p53 induction and diminished ability to induce senescence following DNA damage. Therefore, our findings reveal a novel mechanism of p53 inactivation that links deregulation of IRES-mediated p53 translation with tumorigenesis. PMID:26391949

  12. Overproduction of CcmG and CcmFHRc Fully Suppresses the c-Type Cytochrome Biogenesis Defect of Rhodobacter capsulatus CcmI-Null Mutants

    PubMed Central

    Sanders, Carsten; Deshmukh, Meenal; Astor, Doniel; Kranz, Robert G.; Daldal, Fevzi

    2005-01-01

    Gram-negative bacteria like Rhodobacter capsulatus use intertwined pathways to carry out the posttranslational maturation of c-type cytochromes (Cyts). This periplasmic process requires at least 10 essential components for apo-Cyt c chaperoning, thio-oxidoreduction, and the delivery of heme and its covalent ligation. One of these components, CcmI (also called CycH), is thought to act as an apo-Cyt c chaperone. In R. capsulatus, CcmI-null mutants are unable to produce c-type Cyts and thus sustain photosynthetic (Ps) growth. Previously, we have shown that overproduction of the putative heme ligation components CcmF and CcmHRc (also called Ccl1 and Ccl2) can partially bypass the function of CcmI on minimal, but not on enriched, media. Here, we demonstrate that either additional overproduction of CcmG (also called HelX) or hyperproduction of CcmF-CcmHRc is needed to completely overcome the role of CcmI during the biogenesis of c-type Cyts on both minimal and enriched media. These findings indicate that, in the absence of CcmI, interactions between the heme ligation and thioreduction pathways become restricted for sufficient Cyt c production. We therefore suggest that CcmI, along with its apo-Cyt chaperoning function, is also critical for the efficacy of holo-Cyt c formation, possibly via its close interactions with other components performing the final heme ligation steps during Cyt c biogenesis. PMID:15937187

  13. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  14. The Chaperone Network Connected to Human Ribosome-Associated Complex ▿ ‡ †

    PubMed Central

    Jaiswal, Himjyot; Conz, Charlotte; Otto, Hendrik; Wölfle, Tina; Fitzke, Edith; Mayer, Matthias P.; Rospert, Sabine

    2011-01-01

    Mammalian ribosome-associated complex (mRAC), consisting of the J-domain protein MPP11 and the atypical Hsp70 homolog (70-homolog) Hsp70L1, can partly complement the function of RAC, which is the homologous complex from Saccharomyces cerevisiae. RAC is the J-domain partner exclusively of the 70-homolog Ssb, which directly and independently of RAC binds to the ribosome. We here show that growth defects due to mRAC depletion in HeLa cells resemble those of yeast strains lacking RAC. Functional conservation, however, did not extend to the 70-homolog partner of mRAC. None of the major human 70-homologs was able to complement the growth defects of yeast strains lacking Ssb or was bound to ribosomes in an Ssb-like manner. Instead, our data suggest that mRAC was a specific partner of human Hsp70 but not of its close homolog Hsc70. On a mechanistic level, ATP binding, but not ATP hydrolysis, by Hsp70L1 affected mRAC's function as a J-domain partner of Hsp70. The combined data indicate that, while functionally conserved, yeast and mammalian cells have evolved distinct solutions to ensure that Hsp70-type chaperones can efficiently assist the biogenesis of newly synthesized polypeptide chains. PMID:21245388

  15. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  16. Human disorders of peroxisome metabolism and biogenesis.

    PubMed

    Waterham, Hans R; Ferdinandusse, Sacha; Wanders, Ronald J A

    2016-05-01

    Peroxisomes are dynamic organelles that play an essential role in a variety of cellular catabolic and anabolic metabolic pathways, including fatty acid alpha- and beta-oxidation, and plasmalogen and bile acid synthesis. Defects in genes encoding peroxisomal proteins can result in a large variety of peroxisomal disorders either affecting specific metabolic pathways, i.e., the single peroxisomal enzyme deficiencies, or causing a generalized defect in function and assembly of peroxisomes, i.e., peroxisome biogenesis disorders. In this review, we discuss the clinical, biochemical, and genetic aspects of all human peroxisomal disorders currently known. PMID:26611709

  17. Non-Diamond Blackfan anemia disorders of ribosome function: Shwachman Diamond syndrome and 5q- syndrome.

    PubMed

    Burwick, Nicholas; Shimamura, Akiko; Liu, Johnson M

    2011-04-01

    A number of human disorders, dubbed ribosomopathies, are linked to impaired ribosome biogenesis or function. These include but are not limited to Diamond Blackfan anemia (DBA), Shwachman Diamond syndrome (SDS), and the 5q- myelodysplastic syndrome (MDS). This review focuses on the latter two non-DBA disorders of ribosome function. Both SDS and 5q- syndrome lead to impaired hematopoiesis and a predisposition to leukemia. SDS, due to bi-allelic mutations of the SBDS gene, is a multi-system disorder that also includes bony abnormalities, and pancreatic and neurocognitive dysfunction. SBDS associates with the 60S subunit in human cells and has a role in subunit joining and translational activation in yeast models. In contrast, 5q- syndrome is associated with acquired haplo-insufficiency of RPS14, a component of the small 40S subunit. RPS14 is critical for 40S assembly in yeast models, and depletion of RPS14 in human CD34(+) cells is sufficient to recapitulate the 5q- erythroid defect. Both SDS and the 5q- syndrome represent important models of ribosome function and may inform future treatment strategies for the ribosomopathies. PMID:21435510

  18. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    PubMed

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  19. MTR4, a putative RNA helicase and exosome co-factor, is required for proper rRNA biogenesis and development in Arabidopsis thaliana.

    PubMed

    Lange, Heike; Sement, François M; Gagliardi, Dominique

    2011-10-01

    The exosome is a conserved protein complex that is responsible for essential 3'→5' RNA degradation in both the nucleus and the cytosol. It is composed of a nine-subunit core complex to which co-factors confer both RNA substrate recognition and ribonucleolytic activities. Very few exosome co-factors have been identified in plants. Here, we have characterized a putative RNA helicase, AtMTR4, that is involved in the degradation of several nucleolar exosome substrates in Arabidopsis thaliana. We show that AtMTR4, rather than its closely related protein HEN2, is required for proper rRNA biogenesis in Arabidopsis. AtMTR4 is mostly localized in the nucleolus, a subcellular compartmentalization that is shared with another exosome co-factor, RRP6L2. AtMTR4 and RRP6L2 cooperate in several steps of rRNA maturation and surveillance, such as processing the 5.8S rRNA and removal of rRNA maturation by-products. Interestingly, degradation of the Arabidopsis 5' external transcribed spacer (5' ETS) requires cooperation of both the 5'→3' and 3'→5' exoribonucleolytic pathways. Accumulating AtMTR4 targets give rise to illegitimate small RNAs; however, these do not affect rRNA metabolism or contribute to the phenotype of mtr4 mutants. Plants lacking AtMTR4 are viable but show several developmental defects, including aberrant vein patterning and pointed first leaves. The mtr4 phenotype resembles that of several ribosomal protein and nucleolin mutants, and may be explained by delayed ribosome biogenesis, as we observed a reduced rate of rRNA accumulation in mtr4 mutants. Taken together, these data link AtMTR4 with rRNA biogenesis and development in Arabidopsis. PMID:21682783

  20. MYC and Mitochondrial Biogenesis

    PubMed Central

    Morrish, Fionnuala; Hockenbery, David

    2014-01-01

    Mitochondria, the powerhouses of the cell, face two imperatives concerning biogenesis. The first is the requirement for dividing cells to replicate their mitochondrial content by growth of existing mitochondria. The second is the dynamic regulation of mitochondrial content in response to organismal and cellular cues (e.g., exercise, caloric restriction, energy status, temperature). MYC provides the clearest example of a programmed expansion of mitochondrial content linked to the cell cycle. As an oncogene, MYC also presents intriguing questions about the role of its mitochondrial targets in cancer-related phenotypes, such as the Warburg effect and MYC-dependent apoptosis. PMID:24789872

  1. Peroxisome Biogenesis and Function

    PubMed Central

    Kaur, Navneet; Reumann, Sigrun; Hu, Jianping

    2009-01-01

    Peroxisomes are small and single membrane-delimited organelles that execute numerous metabolic reactions and have pivotal roles in plant growth and development. In recent years, forward and reverse genetic studies along with biochemical and cell biological analyses in Arabidopsis have enabled researchers to identify many peroxisome proteins and elucidate their functions. This review focuses on the advances in our understanding of peroxisome biogenesis and metabolism, and further explores the contribution of large-scale analysis, such as in sillco predictions and proteomics, in augmenting our knowledge of peroxisome function In Arabidopsis. PMID:22303249

  2. Curli Biogenesis and Function

    PubMed Central

    Barnhart, Michelle M.; Chapman, Matthew R.

    2010-01-01

    Curli are the major proteinaceous component of a complex extra-cellular matrix produced by many Enterobacteriaceae. Curli were first discovered in the late 1980s on Escherichia coli strains that caused bovine mastitis, and have since been implicated in many physiological and pathogenic processes of E. coli and Salmonella spp. Curli fibers are involved in adhesion to surfaces, cell aggregation, and biofilm formation. Curli also mediate host cell adhesion and invasion, and they are potent inducers of the host inflammatory response. The structure and biogenesis of curli are unique among bacterial fibers that have been described to date. Structurally and biochemically, curli belong to a growing class of fibers known as amyloids. Amyloid fiber formation is responsible for several human diseases including Alzheimer's, Huntington's, and prion diseases, although the process of in vivo amyloid formation is not well understood. Curli provide a unique system to study macromolecular assembly in bacteria and in vivo amyloid fiber formation. Here, we review curli biogenesis, regulation, role in biofilm formation, and role in pathogenesis. PMID:16704339

  3. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress.

    PubMed

    Yoshikawa, Masaru; Fujii, Yoichi Robertus

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  4. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress

    PubMed Central

    2016-01-01

    Dysfunction of ribosome biogenesis induces divergent ribosome-related diseases including ribosomopathy and occasionally results in carcinogenesis. Although many defects in ribosome-related genes have been investigated, little is known about contribution of ribosomal RNA (rRNA) in ribosome-related disorders. Meanwhile, microRNA (miRNA), an important regulator of gene expression, is derived from both coding and noncoding region of the genome and is implicated in various diseases. Therefore, we performed in silico analyses using M-fold, TargetScan, GeneCoDia3, and so forth to investigate RNA relationships between rRNA and miRNA against cellular stresses. We have previously shown that miRNA synergism is significantly correlated with disease and the miRNA package is implicated in memory for diseases; therefore, quantum Dynamic Nexus Score (DNS) was also calculated using MESer program. As a result, seventeen RNA sequences identical with known miRNAs were detected in the human rRNA and termed as rRNA-hosted miRNA analogs (rmiRNAs). Eleven of them were predicted to form stem-loop structures as pre-miRNAs, and especially one stem-loop was completely identical with hsa-pre-miR-3678 located in the non-rDNA region. Thus, these rmiRNAs showed significantly high DNS values, participation in regulation of cancer-related pathways, and interaction with nucleolar RNAs, suggesting that rmiRNAs may be stress-responsible resident miRNAs which transmit stress-tuning information in multiple levels. PMID:27517048

  5. Poxvirus Membrane Biogenesis

    PubMed Central

    2015-01-01

    Poxviruses differ from most DNA viruses by replicating entirely within the cytoplasm. The first discernible viral structures are crescents and spherical immature virions containing a single lipoprotein membrane bilayer with an external honeycomb lattice. Because this viral membrane displays no obvious continuity with a cellular organelle, a de novo origin was suggested. Nevertheless, transient connections between viral and cellular membranes could be difficult to resolve. Despite the absence of direct evidence, the intermediate compartment (ERGIC) between the endoplasmic reticulum (ER) and Golgi apparatus and the ER itself were considered possible sources of crescent membranes. A break-through in understanding poxvirus membrane biogenesis has come from recent studies of the abortive replication of several vaccinia virus null mutants. Novel images showing continuity between viral crescents and the ER and the accumulation of immature virions in the expanded ER lumen provide the first direct evidence for a cellular origin of this poxvirus membrane. PMID:25728299

  6. Poxvirus membrane biogenesis.

    PubMed

    Moss, Bernard

    2015-05-01

    Poxviruses differ from most DNA viruses by replicating entirely within the cytoplasm. The first discernible viral structures are crescents and spherical immature virions containing a single lipoprotein membrane bilayer with an external honeycomb lattice. Because this viral membrane displays no obvious continuity with a cellular organelle, a de novo origin was suggested. Nevertheless, transient connections between viral and cellular membranes could be difficult to resolve. Despite the absence of direct evidence, the intermediate compartment (ERGIC) between the endoplasmic reticulum (ER) and Golgi apparatus and the ER itself were considered possible sources of crescent membranes. A break-through in understanding poxvirus membrane biogenesis has come from recent studies of the abortive replication of several vaccinia virus null mutants. Novel images showing continuity between viral crescents and the ER and the accumulation of immature virions in the expanded ER lumen provide the first direct evidence for a cellular origin of this poxvirus membrane. PMID:25728299

  7. Ribosome recycling defects modify the balance between the synthesis and assembly of specific subunits of the oxidative phosphorylation complexes in yeast mitochondria

    PubMed Central

    Ostojić, Jelena; Panozzo, Cristina; Bourand-Plantefol, Alexa; Herbert, Christopher J.; Dujardin, Geneviève; Bonnefoy, Nathalie

    2016-01-01

    Mitochondria have their own translation machinery that produces key subunits of the OXPHOS complexes. This machinery relies on the coordinated action of nuclear-encoded factors of bacterial origin that are well conserved between humans and yeast. In humans, mutations in these factors can cause diseases; in yeast, mutations abolishing mitochondrial translation destabilize the mitochondrial DNA. We show that when the mitochondrial genome contains no introns, the loss of the yeast factors Mif3 and Rrf1 involved in ribosome recycling neither blocks translation nor destabilizes mitochondrial DNA. Rather, the absence of these factors increases the synthesis of the mitochondrially-encoded subunits Cox1, Cytb and Atp9, while strongly impairing the assembly of OXPHOS complexes IV and V. We further show that in the absence of Rrf1, the COX1 specific translation activator Mss51 accumulates in low molecular weight forms, thought to be the source of the translationally-active form, explaining the increased synthesis of Cox1. We propose that Rrf1 takes part in the coordination between translation and OXPHOS assembly in yeast mitochondria. These interactions between general and specific translation factors might reveal an evolutionary adaptation of the bacterial translation machinery to the set of integral membrane proteins that are translated within mitochondria. PMID:27257059

  8. Ribosome recycling defects modify the balance between the synthesis and assembly of specific subunits of the oxidative phosphorylation complexes in yeast mitochondria.

    PubMed

    Ostojić, Jelena; Panozzo, Cristina; Bourand-Plantefol, Alexa; Herbert, Christopher J; Dujardin, Geneviève; Bonnefoy, Nathalie

    2016-07-01

    Mitochondria have their own translation machinery that produces key subunits of the OXPHOS complexes. This machinery relies on the coordinated action of nuclear-encoded factors of bacterial origin that are well conserved between humans and yeast. In humans, mutations in these factors can cause diseases; in yeast, mutations abolishing mitochondrial translation destabilize the mitochondrial DNA. We show that when the mitochondrial genome contains no introns, the loss of the yeast factors Mif3 and Rrf1 involved in ribosome recycling neither blocks translation nor destabilizes mitochondrial DNA. Rather, the absence of these factors increases the synthesis of the mitochondrially-encoded subunits Cox1, Cytb and Atp9, while strongly impairing the assembly of OXPHOS complexes IV and V. We further show that in the absence of Rrf1, the COX1 specific translation activator Mss51 accumulates in low molecular weight forms, thought to be the source of the translationally-active form, explaining the increased synthesis of Cox1. We propose that Rrf1 takes part in the coordination between translation and OXPHOS assembly in yeast mitochondria. These interactions between general and specific translation factors might reveal an evolutionary adaptation of the bacterial translation machinery to the set of integral membrane proteins that are translated within mitochondria. PMID:27257059

  9. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  10. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  11. Peroxisomal Biogenesis in Ischemic Brain

    PubMed Central

    Young, Jennifer M.; Nelson, Jonathan W.; Cheng, Jian; Zhang, Wenri; Mader, Sarah; Davis, Catherine M.; Morrison, Richard S.

    2015-01-01

    Abstract Aims: Peroxisomes are highly adaptable and dynamic organelles, adjusting their size, number, and enzyme composition to changing environmental and metabolic demands. We determined whether peroxisomes respond to ischemia, and whether peroxisomal biogenesis is an adaptive response to cerebral ischemia. Results: Focal cerebral ischemia induced peroxisomal biogenesis in peri-infarct neurons, which was associated with a corresponding increase in peroxisomal antioxidant enzyme catalase. Peroxisomal biogenesis was also observed in primary cultured cortical neurons subjected to ischemic insult induced by oxygen-glucose deprivation (OGD). A catalase inhibitor increased OGD-induced neuronal death. Moreover, preventing peroxisomal proliferation by knocking down dynamin-related protein 1 (Drp1) exacerbated neuronal death induced by OGD, whereas enhancing peroxisomal biogenesis pharmacologically using a peroxisome proliferator-activated receptor-alpha agonist protected against neuronal death induced by OGD. Innovation: This is the first documentation of ischemia-induced peroxisomal biogenesis in mammalian brain using a combined in vivo and in vitro approach, electron microscopy, high-resolution laser-scanning confocal microscopy, and super-resolution structured illumination microscopy. Conclusion: Our findings suggest that neurons respond to ischemic injury by increasing peroxisome biogenesis, which serves a protective function, likely mediated by enhanced antioxidant capacity of neurons. Antioxid. Redox Signal. 22, 109–120. PMID:25226217

  12. SIGNALING PATHWAYS IN MELANOSOME BIOGENESIS AND PATHOLOGY

    PubMed Central

    Schiaffino, Maria Vittoria

    2010-01-01

    Melanosomes are the specialized intracellular organelles of pigment cells devoted to the synthesis, storage and transport of melanin pigments, which are responsible for most visible pigmentation in mammals and other vertebrates. As a direct consequence, any genetic mutation resulting in alteration of melanosomal function, either because affecting pigment cell survival, migration and differentiation, or because interfering with melanosome biogenesis, transport and transfer to keratinocytes, is immediately translated into color variations of skin, fur, hair or eyes. Thus, over one hundred genes and proteins have been identified as pigmentary determinants in mammals, providing us with a deep understanding of this biological system, which functions by using mechanisms and processes that have parallels in other tissues and organs. In particular, many genes implicated in melanosome biogenesis have been characterized, so that melanosomes represent an incredible source of information and a model for organelles belonging to the secretory pathway. Furthermore, the function of melanosomes can be associated with common physiological phenotypes, such as variation of pigmentation among individuals, and with rare pathological conditions, such as albinism, characterized by severe visual defects. Among the most relevant mechanisms operating in melanosome biogenesis are the signal transduction pathways mediated by two peculiar G protein-coupled receptors: the melanocortin-1 receptor (MC1R), involved in the fair skin/red hair phenotype and skin cancer; and OA1 (GPR143), whose loss-of-function results in X-linked ocular albinism. This review will focus on the most recent novelties regarding the functioning of these two receptors, by highlighting emerging signaling mechanisms and general implications for cell biology and pathology. PMID:20381640

  13. p53- and ERK7-Dependent Ribosome Surveillance Response Regulates Drosophila Insulin-Like Peptide Secretion

    PubMed Central

    Hasygar, Kiran; Hietakangas, Ville

    2014-01-01

    Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs) regulate larval growth by secreting insulin-like peptides (dILPs) in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15), which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions. PMID:25393288

  14. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  15. Keeping FIT, storing fat: Lipid droplet biogenesis.

    PubMed

    Choudhary, Vineet; Golden, Andy; Prinz, William A

    2016-01-01

    All eukaryotes store excess lipids in organelles known as lipid droplets (LDs), which play central roles in lipid metabolism. Understanding LD biogenesis and metabolism is critical for understanding the pathophysiology of lipid metabolic disorders like obesity and atherosclerosis. LDs are composed of a core of neutral lipids surrounded by a monolayer of phospholipids that often contains coat proteins. Nascent LDs bud from the endoplasmic reticulum (ER) but the mechanism is not known. In this commentary we discuss our recent finding that a conserved family of proteins called fat storage-inducing transmembrane (FIT) proteins is necessary for LDs budding from the ER. In cells lacking FIT proteins, LDs remain in the ER membrane. C. elegans has a single FIT protein (FITM-2), which we found is essential; almost all homozygous fitm-2 animals die as larvae and those that survive to adulthood give rise to embryos that die as L1 and L2 larvae. Homozygous fitm-2 animals have a number of abnormalities including a significant decrease in intestinal LDs and dramatic defects in muscle development. Understanding how FIT proteins mediate LD biogenesis and what roles they play in lipid metabolism and development are fascinating challenges for the future. PMID:27383728

  16. Stimulation of mTORC1 with L-leucine rescues defects associated with Roberts syndrome.

    PubMed

    Xu, Baoshan; Lee, Kenneth K; Zhang, Lily; Gerton, Jennifer L

    2013-01-01

    Roberts syndrome (RBS) is a human disease characterized by defects in limb and craniofacial development and growth and mental retardation. RBS is caused by mutations in ESCO2, a gene which encodes an acetyltransferase for the cohesin complex. While the essential role of the cohesin complex in chromosome segregation has been well characterized, it plays additional roles in DNA damage repair, chromosome condensation, and gene expression. The developmental phenotypes of Roberts syndrome and other cohesinopathies suggest that gene expression is impaired during embryogenesis. It was previously reported that ribosomal RNA production and protein translation were impaired in immortalized RBS cells. It was speculated that cohesin binding at the rDNA was important for nucleolar form and function. We have explored the hypothesis that reduced ribosome function contributes to RBS in zebrafish models and human cells. Two key pathways that sense cellular stress are the p53 and mTOR pathways. We report that mTOR signaling is inhibited in human RBS cells based on the reduced phosphorylation of the downstream effectors S6K1, S6 and 4EBP1, and this correlates with p53 activation. Nucleoli, the sites of ribosome production, are highly fragmented in RBS cells. We tested the effect of inhibiting p53 or stimulating mTOR in RBS cells. The rescue provided by mTOR activation was more significant, with activation rescuing both cell division and cell death. To study this cohesinopathy in a whole animal model we used ESCO2-mutant and morphant zebrafish embryos, which have developmental defects mimicking RBS. Consistent with RBS patient cells, the ESCO2 mutant embryos show p53 activation and inhibition of the TOR pathway. Stimulation of the TOR pathway with L-leucine rescued many developmental defects of ESCO2-mutant embryos. Our data support the idea that RBS can be attributed in part to defects in ribosome biogenesis, and stimulation of the TOR pathway has therapeutic potential. PMID:24098154

  17. Stimulation of mTORC1 with L-leucine Rescues Defects Associated with Roberts Syndrome

    PubMed Central

    Xu, Baoshan; Lee, Kenneth K.; Zhang, Lily; Gerton, Jennifer L.

    2013-01-01

    Roberts syndrome (RBS) is a human disease characterized by defects in limb and craniofacial development and growth and mental retardation. RBS is caused by mutations in ESCO2, a gene which encodes an acetyltransferase for the cohesin complex. While the essential role of the cohesin complex in chromosome segregation has been well characterized, it plays additional roles in DNA damage repair, chromosome condensation, and gene expression. The developmental phenotypes of Roberts syndrome and other cohesinopathies suggest that gene expression is impaired during embryogenesis. It was previously reported that ribosomal RNA production and protein translation were impaired in immortalized RBS cells. It was speculated that cohesin binding at the rDNA was important for nucleolar form and function. We have explored the hypothesis that reduced ribosome function contributes to RBS in zebrafish models and human cells. Two key pathways that sense cellular stress are the p53 and mTOR pathways. We report that mTOR signaling is inhibited in human RBS cells based on the reduced phosphorylation of the downstream effectors S6K1, S6 and 4EBP1, and this correlates with p53 activation. Nucleoli, the sites of ribosome production, are highly fragmented in RBS cells. We tested the effect of inhibiting p53 or stimulating mTOR in RBS cells. The rescue provided by mTOR activation was more significant, with activation rescuing both cell division and cell death. To study this cohesinopathy in a whole animal model we used ESCO2-mutant and morphant zebrafish embryos, which have developmental defects mimicking RBS. Consistent with RBS patient cells, the ESCO2 mutant embryos show p53 activation and inhibition of the TOR pathway. Stimulation of the TOR pathway with L-leucine rescued many developmental defects of ESCO2-mutant embryos. Our data support the idea that RBS can be attributed in part to defects in ribosome biogenesis, and stimulation of the TOR pathway has therapeutic potential. PMID:24098154

  18. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  19. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  20. Magnetosome biogenesis in magnetotactic bacteria.

    PubMed

    Uebe, René; Schüler, Dirk

    2016-09-13

    Magnetotactic bacteria derive their magnetic orientation from magnetosomes, which are unique organelles that contain nanometre-sized crystals of magnetic iron minerals. Although these organelles have evident potential for exciting biotechnological applications, a lack of genetically tractable magnetotactic bacteria had hampered the development of such tools; however, in the past decade, genetic studies using two model Magnetospirillum species have revealed much about the mechanisms of magnetosome biogenesis. In this Review, we highlight these new insights and place the molecular mechanisms of magnetosome biogenesis in the context of the complex cell biology of Magnetospirillum spp. Furthermore, we discuss the diverse properties of magnetosome biogenesis in other species of magnetotactic bacteria and consider the value of genetically 'magnetizing' non-magnetotactic bacteria. Finally, we discuss future prospects for this highly interdisciplinary and rapidly advancing field. PMID:27620945

  1. Minotaur is critical for primary piRNA biogenesis

    PubMed Central

    Vagin, Vasily V.; Yu, Yang; Jankowska, Anna; Luo, Yicheng; Wasik, Kaja A.; Malone, Colin D.; Harrison, Emily; Rosebrock, Adam; Wakimoto, Barbara T.; Fagegaltier, Delphine; Muerdter, Felix; Hannon, Gregory J.

    2013-01-01

    Piwi proteins and their associated small RNAs are essential for fertility in animals. In part, this is due to their roles in guarding germ cell genomes against the activity of mobile genetic elements. piRNA populations direct Piwi proteins to silence transposon targets and, as such, form a molecular code that discriminates transposons from endogenous genes. Information ultimately carried by piRNAs is encoded within genomic loci, termed piRNA clusters. These give rise to long, single-stranded, primary transcripts that are processed into piRNAs. Despite the biological importance of this pathway, neither the characteristics that define a locus as a source of piRNAs nor the mechanisms that catalyze primary piRNA biogenesis are well understood. We searched an EMS-mutant collection annotated for fertility phenotypes for genes involved in the piRNA pathway. Twenty-seven homozygous sterile strains showed transposon-silencing defects. One of these, which strongly impacted primary piRNA biogenesis, harbored a causal mutation in CG5508, a member of the Drosophila glycerol-3-phosphate O-acetyltransferase (GPAT) family. These enzymes catalyze the first acylation step on the path to the production of phosphatidic acid (PA). Though this pointed strongly to a function for phospholipid signaling in the piRNA pathway, a mutant form of CG5508, which lacks the GPAT active site, still functions in piRNA biogenesis. We have named this new biogenesis factor Minotaur. PMID:23788724

  2. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  3. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  4. The Conserved Endoribonuclease YbeY Is Required for Chloroplast Ribosomal RNA Processing in Arabidopsis1

    PubMed Central

    Liu, Jinwen; Zhou, Wenbin; Liu, Guifeng; Yang, Chuanping; Sun, Yi; Wu, Wenjuan; Cao, Shenquan; Wang, Chong; Hai, Guanghui; Wang, Zhifeng; Bock, Ralph; Huang, Jirong

    2015-01-01

    Maturation of chloroplast ribosomal RNAs (rRNAs) comprises several endoribonucleolytic and exoribonucleolytic processing steps. However, little is known about the specific enzymes involved and the cleavage steps they catalyze. Here, we report the functional characterization of the single Arabidopsis (Arabidopsis thaliana) gene encoding a putative YbeY endoribonuclease. AtYbeY null mutants are seedling lethal, indicating that AtYbeY function is essential for plant growth. Knockdown plants display slow growth and show pale-green leaves. Physiological and ultrastructural analyses of atybeY mutants revealed impaired photosynthesis and defective chloroplast development. Fluorescent microcopy analysis showed that, when fused with the green fluorescence protein, AtYbeY is localized in chloroplasts. Immunoblot and RNA gel-blot assays revealed that the levels of chloroplast-encoded subunits of photosynthetic complexes are reduced in atybeY mutants, but the corresponding transcripts accumulate normally. In addition, atybeY mutants display defective maturation of both the 5′ and 3′ ends of 16S, 23S, and 4.5S rRNAs as well as decreased accumulation of mature transcripts from the transfer RNA genes contained in the chloroplast rRNA operon. Consequently, mutant plants show a severe deficiency in ribosome biogenesis, which, in turn, results in impaired plastid translational activity. Furthermore, biochemical assays show that recombinant AtYbeY is able to cleave chloroplast rRNAs as well as messenger RNAs and transfer RNAs in vitro. Taken together, our findings indicate that AtYbeY is a chloroplast-localized endoribonuclease that is required for chloroplast rRNA processing and thus for normal growth and development. PMID:25810095

  5. Resistance in the Ribosome: RUNX1, pre-LSCs, and HSPCs

    PubMed Central

    Ito, Kyoko; Ito, Keisuke

    2015-01-01

    Therapeutic targeting of pre-leukemic stem cells (pre-LSCs) may be a viable strategy to eradicate residual disease and prevent leukemia relapse. Now in Cell Stem Cell, Cai et al. (2015) show that loss-of-function mutations in RUNX1 reduce ribosome biogenesis and provide pre-LSCs a selective advantage over normal hematopoietic cells through increased stress resistance. PMID:26253196

  6. Cellulose biogenesis in Dictyostelium discoideum

    SciTech Connect

    Blanton, R.L.

    1993-12-31

    Organisms that synthesize cellulose can be found amongst the bacteria, protistans, fungi, and animals, but it is in plants that the importance of cellulose in function (as the major structural constituent of plant cell walls) and economic use (as wood and fiber) can be best appreciated. The structure of cellulose and its biosynthesis have been the subjects of intense investigation. One of the most important insights gained from these studies is that the synthesis of cellulose by living organisms involves much more than simply the polymerization of glucose into a (1{r_arrow}4)-{beta}-linked polymer. The number of glucoses in a polymer (the degree of polymerization), the crystalline form assumed by the glucan chains when they crystallize to form a microfibril, and the dimensions and orientation of the microfibrils are all subject to cellular control. Instead of cellulose biosynthesis, a more appropriate term might be cellulose biogenesis, to emphasize the involvement of cellular structures and mechanisms in controlling polymerization and directing crystallization and deposition. Dictyostelium discoideum is uniquely suitable for the study of cellulose biogenesis because of its amenability to experimental study and manipulation and the extent of our knowledge of its basic cellular mechanisms (as will be evident from the rest of this volume). In this chapter, I will summarize what is known about cellulose biogenesis in D. discoideum, emphasizing its potential to illuminate our understanding both of D. discoideum development and plant cellulose biogenesis.

  7. Differential expression of ribosomal proteins in myelodysplastic syndromes.

    PubMed

    Rinker, Elizabeth B; Dueber, Julie C; Qualtieri, Julianne; Tedesco, Jason; Erdogan, Begum; Bosompem, Amma; Kim, Annette S

    2016-02-01

    Aberrations of ribosomal biogenesis have been implicated in several congenital bone marrow failure syndromes, such as Diamond-Blackfan anaemia, Shwachman-Diamond syndrome and Dyskeratosis Congenita. Recent studies have identified haploinsufficiency of RPS14 in the acquired bone marrow disease isolated 5q minus syndrome, a subtype of myelodysplastic syndromes (MDS). However, the expression of various proteins comprising the ribosomal subunits and other proteins enzymatically involved in the synthesis of the ribosome has not been explored in non-5q minus MDS. Furthermore, differences in the effects of these expression alterations among myeloid, erythroid and megakaryocyte lineages have not been well elucidated. We examined the expression of several proteins related to ribosomal biogenesis in bone marrow biopsy specimens from patients with MDS (5q minus patients excluded) and controls with no known myeloid disease. Specifically, we found that there is overexpression of RPS24, DKC1 and SBDS in MDS. This overexpression is in contrast to the haploinsufficiency identified in the congenital bone marrow failure syndromes and in acquired 5q minus MDS. Potential mechanisms for these differences and aetiology for these findings in MDS are discussed. PMID:26408650

  8. TORC1 and TORC2 work together to regulate ribosomal protein S6 phosphorylation in Saccharomyces cerevisiae.

    PubMed

    Yerlikaya, Seda; Meusburger, Madeleine; Kumari, Romika; Huber, Alexandre; Anrather, Dorothea; Costanzo, Michael; Boone, Charles; Ammerer, Gustav; Baranov, Pavel V; Loewith, Robbie

    2016-01-15

    Nutrient-sensitive phosphorylation of the S6 protein of the 40S subunit of the eukaryote ribosome is highly conserved. However, despite four decades of research, the functional consequences of this modification remain unknown. Revisiting this enigma in Saccharomyces cerevisiae, we found that the regulation of Rps6 phosphorylation on Ser-232 and Ser-233 is mediated by both TOR complex 1 (TORC1) and TORC2. TORC1 regulates phosphorylation of both sites via the poorly characterized AGC-family kinase Ypk3 and the PP1 phosphatase Glc7, whereas TORC2 regulates phosphorylation of only the N-terminal phosphosite via Ypk1. Cells expressing a nonphosphorylatable variant of Rps6 display a reduced growth rate and a 40S biogenesis defect, but these phenotypes are not observed in cells in which Rps6 kinase activity is compromised. Furthermore, using polysome profiling and ribosome profiling, we failed to uncover a role of Rps6 phosphorylation in either global translation or translation of individual mRNAs. Taking the results together, this work depicts the signaling cascades orchestrating Rps6 phosphorylation in budding yeast, challenges the notion that Rps6 phosphorylation plays a role in translation, and demonstrates that observations made with Rps6 knock-ins must be interpreted cautiously. PMID:26582391

  9. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  10. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  11. Divergent Mitochondrial Biogenesis Responses in Human Cardiomyopathy

    PubMed Central

    Ahuja, Preeti; Wanagat, Jonathan; Wang, Zhihua; Wang, Yibin; Liem, David A.; Ping, Peipei; Antoshechkin, Igor A.; Margulies, Kenneth B.; MacLellan, W. Robb

    2014-01-01

    Background Mitochondria are key players in the development and progression of heart failure (HF). Mitochondrial (mt) dysfunction leads to diminished energy production and increased cell death contributing to the progression of left ventricular (LV) failure. The fundamental mechanisms that underlie mt dysfunction in HF have not been fully elucidated. Methods and Results To characterize mt morphology, biogenesis and genomic integrity in human HF, we investigated LV tissue from non-failing (NF) hearts and end-stage ischemic (ICM) or dilated (DCM) cardiomyopathic hearts. Although mt dysfunction was present in both types of cardiomyopathy, mt were smaller and increased in number in DCM compared to ICM or NF hearts. Mt volume density and mtDNA copy number was increased by ~2-fold (P<0.001) in DCM hearts in comparison to ICM hearts. These changes were accompanied by an increase in the expression of mtDNA-encoded genes in DCM versus no change in ICM. mtDNA repair and antioxidant genes were reduced in failing hearts suggestive of a defective repair and protection system, which may account for the 4.1-fold increase in mtDNA deletion mutations in DCM (P<0.05 vs NF hearts, P<0.05 vs ICM). Conclusions In DCM, mt dysfunction is associated with mtDNA damage and deletions, which could be a consequence of mutating stress coupled with a PGC-1α-dependent stimulus for mt biogenesis. However, this maladaptive compensatory response contributes to additional oxidative damage. Thus, our findings support further investigations into novel mechanisms and therapeutic strategies for mt dysfunction in DCM. PMID:23589024

  12. Regulation of chloroplast biogenesis: the immutans mutant of Arabidopsis

    SciTech Connect

    Rodermel, Steven

    2015-11-16

    The immutans (im) variegation mutant of Arabidopsis is an ideal model to gain insight into factors that control chloroplast biogenesis. im defines the gene for PTOX, a plastoquinol terminal oxidase that participates in control of thylakoid redox. Here, we report that the im defect can be suppressed during the late stages of plant development by gigantea (gi2), which defines the gene for GIGANTEA (GI), a central component of the circadian clock that plays a poorly-understood role in diverse plant developmental processes. imgi2 mutants are late-flowering and display other well-known phenotypes associated with gi2, such as starch accumulation and resistance to oxidative stress. We show that the restoration of chloroplast biogenesis in imgi2 is caused by a developmental-specific de-repression of cytokinin signaling that involves crosstalk with signaling pathways mediated by gibberellin (GA) and SPINDLY (SPY), a GA response inhibitor. Suppression of the plastid defect in imgi2 is likely caused by a relaxation of excitation pressures in developing plastids by factors contributed by gi2, including enhanced rates of photosynthesis and increased resistance to oxidative stress. Interestingly, the suppression phenotype of imgi can be mimicked by crossing im with the starch accumulation mutant, sex1, perhaps because sex1 utilizes pathways similar to gi. We conclude that our studies provide a direct genetic linkage between GIGANTEA and chloroplast biogenesis, and we construct a model of interactions between signaling pathways mediated by gi, GA, SPY, cytokinins, and sex1 that are required for chloroplast biogenesis.

  13. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges.

    PubMed

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae-independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. PMID:27528195

  14. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  15. A Nonradioactive Assay to Measure Production and Processing of Ribosomal RNA by 4sU-Tagging.

    PubMed

    Burger, Kaspar; Eick, Dirk

    2016-01-01

    In vivo metabolic pulse labeling is a classical approach to assess production and processing of ribosomal RNA (rRNA). However, conventional labeling techniques can be indirect and require work with radioactivity. Here, we describe in detail a protocol for in vivo metabolic labeling, purification, and readout of nascent rRNA by 4-thiouridine (4sU). We propose 4sU labeling as standard nonradioactive technique for the analysis of rRNA metabolism during ribosome biogenesis. PMID:27576715

  16. The intriguing realm of protein biogenesis: Facing the green co-translational protein maturation networks.

    PubMed

    Breiman, Adina; Fieulaine, Sonia; Meinnel, Thierry; Giglione, Carmela

    2016-05-01

    The ribosome is the cell's protein-making factory, a huge protein-RNA complex, that is essential to life. Determining the high-resolution structures of the stable "core" of this factory was among the major breakthroughs of the past decades, and was awarded the Nobel Prize in 2009. Now that the mysteries of the ribosome appear to be more traceable, detailed understanding of the mechanisms that regulate protein synthesis includes not only the well-known steps of initiation, elongation, and termination but also the less comprehended features of the co-translational events associated with the maturation of the nascent chains. The ribosome is a platform for co-translational events affecting the nascent polypeptide, including protein modifications, folding, targeting to various cellular compartments for integration into membrane or translocation, and proteolysis. These events are orchestrated by ribosome-associated protein biogenesis factors (RPBs), a group of a dozen or more factors that act as the "welcoming committee" for the nascent chain as it emerges from the ribosome. In plants these factors have evolved to fit the specificity of different cellular compartments: cytoplasm, mitochondria and chloroplast. This review focuses on the current state of knowledge of these factors and their interaction around the exit tunnel of dedicated ribosomes. Particular attention has been accorded to the plant system, highlighting the similarities and differences with other organisms. PMID:26555180

  17. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  18. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  19. Inactivation of nucleolin leads to nucleolar disruption, cell cycle arrest and defects in centrosome duplication

    PubMed Central

    Ugrinova, Iva; Monier, Karine; Ivaldi, Corinne; Thiry, Marc; Storck, Sébastien; Mongelard, Fabien; Bouvet, Philippe

    2007-01-01

    Background Nucleolin is a major component of the nucleolus, but is also found in other cell compartments. This protein is involved in various aspects of ribosome biogenesis from transcription regulation to the assembly of pre-ribosomal particles; however, many reports suggest that it could also play an important role in non nucleolar functions. To explore nucleolin function in cell proliferation and cell cycle regulation we used siRNA to down regulate the expression of nucleolin. Results We found that, in addition to the expected effects on pre-ribosomal RNA accumulation and nucleolar structure, the absence of nucleolin results in a cell growth arrest, accumulation in G2, and an increase of apoptosis. Numerous nuclear alterations, including the presence of micronuclei, multiple nuclei or large nuclei are also observed. In addition, a large number of mitotic cells showed a defect in the control of centrosome duplication, as indicated by the presence of more than 2 centrosomes per cell associated with a multipolar spindle structure in the absence of nucleolin. This phenotype is very similar to that obtained with the inactivation of another nucleolar protein, B23. Conclusion Our findings uncovered a new role for nucleolin in cell division, and highlight the importance of nucleolar proteins for centrosome duplication. PMID:17692122

  20. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  1. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  2. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  3. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    PubMed Central

    2012-01-01

    Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a) as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters. PMID:22686419

  4. Abnormal Synaptic Vesicle Biogenesis in Drosophila Synaptogyrin Mutants

    PubMed Central

    Stevens, Robin J.; Akbergenova, Yulia; Jorquera, Ramon A.; Littleton, J. Troy

    2012-01-01

    Sustained neuronal communication relies on the coordinated activity of multiple proteins that regulate synaptic vesicle biogenesis and cycling within the presynaptic terminal. Synaptogyrin and synaptophysin are conserved MARVEL domain-containing transmembrane proteins that are among the most abundant synaptic vesicle constituents, although their role in the synaptic vesicle cycle has remained elusive. To further investigate the function of these proteins, we generated and characterized a synaptogyrin (gyr) null mutant in Drosophila, whose genome encodes a single synaptogyrin isoform and lacks a synaptophysin homolog. We demonstrate that Drosophila synaptogyrin plays a modulatory role in synaptic vesicle biogenesis at larval neuromuscular junctions. Drosophila lacking synaptogyrin are viable and fertile and have no overt deficits in motor function. However, ultrastructural analysis of gyr larvae revealed increased synaptic vesicle diameter and enhanced variability in the size of synaptic vesicles. In addition, the resolution of endocytic cisternae into synaptic vesicles in response to strong stimulation is defective in gyr mutants. Electrophysiological analysis demonstrated an increase in quantal size and a concomitant decrease in quantal content, suggesting functional consequences for transmission caused by the loss of synaptogyrin. Furthermore, high-frequency stimulation resulted in increased facilitation and a delay in recovery from synaptic depression, indicating that synaptic vesicle exo-endocytosis is abnormally regulated during intense stimulation conditions. These results suggest that synaptogyrin modulates the synaptic vesicle exo-endocytic cycle and is required for the proper biogenesis of synaptic vesicles at nerve terminals. PMID:23238721

  5. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  6. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  7. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  8. EVALUATION OF THE BIOGENESIS SOIL WASHING TECHNOLOGY

    EPA Science Inventory

    The BioGenesis Enterprises, Inc. (BioGenesis) soil washing technology was demonstrated as part of the US Environmental Protection Agency's (EPA) Superfund Innovative Technology Evaluation (SITE) program in November 1992. The demonstration was conducted over three days at a petrol...

  9. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time. PMID:25987256

  10. p53-Mediated Biliary Defects Caused by Knockdown of cirh1a, the Zebrafish Homolog of the Gene Responsible for North American Indian Childhood Cirrhosis

    PubMed Central

    Wilkins, Benjamin J.; Lorent, Kristin; Matthews, Randolph P.; Pack, Michael

    2013-01-01

    North American Indian Childhood Cirrhosis (NAIC) is a rare, autosomal recessive, progressive cholestatic disease of infancy affecting the Cree-Ojibway first Nations of Quebec. All NAIC patients are homozygous for a missense mutation (R565W) in CIRH1A, the human homolog of the yeast nucleolar protein Utp4. Utp4 is part of the t-Utp subcomplex of the small subunit (SSU) processome, a ribonucleoprotein complex required for ribosomal RNA processing and small subunit assembly. NAIC has thus been proposed to be a primary ribosomal disorder (ribosomopathy); however, investigation of the pathophysiologic mechanism of this disease has been hindered by lack of an animal model. Here, using a morpholino oligonucleotide (MO)-based loss-of-function strategy, we have generated a model of NAIC in the zebrafish, Danio rerio. Zebrafish Cirhin shows substantial homology to the human homolog, and cirh1a mRNA is expressed in developing hepatocytes and biliary epithelial cells. Injection of two independent MOs directed against cirh1a at the one-cell stage causes defects in canalicular and biliary morphology in 5 dpf larvae. In addition, 5 dpf Cirhin-deficient larvae have dose-dependent defects in hepatobiliary function, as assayed by the metabolism of an ingested fluorescent lipid reporter. Previous yeast and in vitro studies have shown that defects in ribosome biogenesis cause stabilization and nuclear accumulation of p53, which in turn causes p53-mediated cell cycle arrest and/or apoptosis. Thus, the nucleolus appears to function as a cellular stress sensor in some cell types. In accordance with this hypothesis, transcriptional targets of p53 are upregulated in Cirhin-deficient zebrafish embryos, and defects in biliary function seen in Cirhin-deficient larvae are completely abrogated by mutation of tp53. Our data provide the first in vivo evidence of a role for Cirhin in biliary development, and support the hypothesis that congenital defects affecting ribosome biogenesis can activate

  11. Disorders of Lysosome-related Organelle Biogenesis: Clinical and Molecular Genetics

    PubMed Central

    Huizing, Marjan; Helip-Wooley, Amanda; Westbroek, Wendy; Gunay-Aygun, Meral; Gahl, William A.

    2009-01-01

    Lysosome-related organelles (LROs) are a heterogeneous group of vesicles that share various features with lysosomes, but are distinct in function, morphology, and composition. The biogenesis of LROs employs a common machinery, and genetic defects in this machinery can affect all LROs or only an individual LRO, resulting in a variety of clinical features. In this review, we discuss the main components in LRO biogenesis. We also address the function, composition and resident cell type of the major LROs. Finally, we describe the clinical characteristics of the major human LRO disorders. PMID:18544035

  12. The yeast NOP4 gene product is an essential nucleolar protein required for pre-rRNA processing and accumulation of 60S ribosomal subunits.

    PubMed Central

    Sun, C; Woolford, J L

    1994-01-01

    The Saccharomyces cerevisiae NOP4 gene was isolated by screening a lambda gt11 yeast genomic DNA library with a monoclonal antibody against a yeast nucleolar protein. NOP4 encodes a 78 kDa protein that contains two prototypical RNA recognition motifs (RRMs) flanking an imperfect RRM lacking characteristic RNP1 and RNP2 motifs. In addition, there is a fourth incomplete RRM. NOP4 is a single copy essential gene present on chromosome XVI, between RAD1 and PEP4. To examine the function of Nop4p, we constructed a conditional null allele of NOP4 by placing this gene under the control of the glucose-repressible GAL1 promoter. When cells are shifted from galactose-containing medium to glucose-containing medium, NOP4 transcription is terminated, Nop4 protein is depleted and cell growth is impaired. Nop4 protein depletion results in diminished accumulation of 60S ribosomal subunits, assignable to a defect in ribosome biogenesis arising from a lack of production of mature 25S rRNA from 27S precursor rRNA. Images PMID:8039505

  13. The K+-dependent GTPase Nug1 is implicated in the association of the helicase Dbp10 to the immature peptidyl transferase centre during ribosome maturation

    PubMed Central

    Manikas, Rizos-Georgios; Thomson, Emma; Thoms, Matthias; Hurt, Ed

    2016-01-01

    Ribosome synthesis employs a number of energy-consuming enzymes in both eukaryotes and prokaryotes. One such enzyme is the conserved circularly permuted GTPase Nug1 (nucleostemin in human). Nug1 is essential for 60S subunit assembly and nuclear export, but its role and time of action during maturation remained unclear. Based on in vitro enzymatic assays using the Chaetomium thermophilum (Ct) orthologue, we show that Nug1 exhibits a low intrinsic GTPase activity that is stimulated by potassium ions, rendering Nug1 a cation-dependent GTPase. In vivo we observe 60S biogenesis defects upon depletion of yeast Nug1 or expression of a Nug1 nucleotide-binding mutant. Most prominently, the RNA helicase Dbp10 was lost from early pre-60S particles, which suggested a physical interaction that could be reconstituted in vitro using CtNug1 and CtDbp10. In vivo rRNA–protein crosslinking revealed that Nug1 and Dbp10 bind at proximal and partially overlapping sites on the 60S pre-ribosome, most prominently to H89 that will constitute part of the peptidyl transferase center (PTC). The binding sites of Dbp10 are the same as those identified for the prokaryotic helicase DbpA bound to the 50S subunit. We suggest that Dbp10 and DbpA are performing a conserved role during PTC formation in all organisms. PMID:26823502

  14. The K⁺-dependent GTPase Nug1 is implicated in the association of the helicase Dbp10 to the immature peptidyl transferase centre during ribosome maturation.

    PubMed

    Manikas, Rizos-Georgios; Thomson, Emma; Thoms, Matthias; Hurt, Ed

    2016-02-29

    Ribosome synthesis employs a number of energy-consuming enzymes in both eukaryotes and prokaryotes. One such enzyme is the conserved circularly permuted GTPase Nug1 (nucleostemin in human). Nug1 is essential for 60S subunit assembly and nuclear export, but its role and time of action during maturation remained unclear. Based on in vitro enzymatic assays using the Chaetomium thermophilum (Ct) orthologue, we show that Nug1 exhibits a low intrinsic GTPase activity that is stimulated by potassium ions, rendering Nug1 a cation-dependent GTPase. In vivo we observe 60S biogenesis defects upon depletion of yeast Nug1 or expression of a Nug1 nucleotide-binding mutant. Most prominently, the RNA helicase Dbp10 was lost from early pre-60S particles, which suggested a physical interaction that could be reconstituted in vitro using CtNug1 and CtDbp10. In vivo rRNA-protein crosslinking revealed that Nug1 and Dbp10 bind at proximal and partially overlapping sites on the 60S pre-ribosome, most prominently to H89 that will constitute part of the peptidyl transferase center (PTC). The binding sites of Dbp10 are the same as those identified for the prokaryotic helicase DbpA bound to the 50S subunit. We suggest that Dbp10 and DbpA are performing a conserved role during PTC formation in all organisms. PMID:26823502

  15. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    PubMed

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. PMID:27016143

  16. Plant Peroxisomes: Biogenesis and Function

    PubMed Central

    Hu, Jianping; Baker, Alison; Bartel, Bonnie; Linka, Nicole; Mullen, Robert T.; Reumann, Sigrun; Zolman, Bethany K.

    2012-01-01

    Peroxisomes are eukaryotic organelles that are highly dynamic both in morphology and metabolism. Plant peroxisomes are involved in numerous processes, including primary and secondary metabolism, development, and responses to abiotic and biotic stresses. Considerable progress has been made in the identification of factors involved in peroxisomal biogenesis, revealing mechanisms that are both shared with and diverged from non-plant systems. Furthermore, recent advances have begun to reveal an unexpectedly large plant peroxisomal proteome and have increased our understanding of metabolic pathways in peroxisomes. Coordination of the biosynthesis, import, biochemical activity, and degradation of peroxisomal proteins allows for highly dynamic responses of peroxisomal metabolism to meet the needs of a plant. Knowledge gained from plant peroxisomal research will be instrumental to fully understanding the organelle’s dynamic behavior and defining peroxisomal metabolic networks, thus allowing the development of molecular strategies for rational engineering of plant metabolism, biomass production, stress tolerance, and pathogen defense. PMID:22669882

  17. Biogenesis of light harvesting proteins.

    PubMed

    Dall'Osto, Luca; Bressan, Mauro; Bassi, Roberto

    2015-09-01

    The LHC family includes nuclear-encoded, integral thylakoid membrane proteins, most of which coordinate chlorophyll and xanthophyll chromophores. By assembling with the core complexes of both photosystems, LHCs form a flexible peripheral moiety for enhancing light-harvesting cross-section, regulating its efficiency and providing protection against photo-oxidative stress. Upon its first appearance, LHC proteins underwent evolutionary diversification into a large protein family with a complex genetic redundancy. Such differentiation appears as a crucial event in the adaptation of photosynthetic organisms to changing environmental conditions and land colonization. The structure of photosystems, including nuclear- and chloroplast-encoded subunits, presented the cell with a number of challenges for the control of the light harvesting function. Indeed, LHC-encoding messages are translated in the cytosol, and pre-proteins imported into the chloroplast, processed to their mature size and targeted to the thylakoids where are assembled with chromophores. Thus, a tight coordination between nuclear and plastid gene expression, in response to environmental stimuli, is required to adjust LHC composition during photoacclimation. In recent years, remarkable progress has been achieved in elucidating structure, function and regulatory pathways involving LHCs; however, a number of molecular details still await elucidation. In this review, we will provide an overview on the current knowledge on LHC biogenesis, ranging from organization of pigment-protein complexes to the modulation of gene expression, import and targeting to the photosynthetic membranes, and regulation of LHC assembly and turnover. Genes controlling these events are potential candidate for biotechnological applications aimed at optimizing light use efficiency of photosynthetic organisms. This article is part of a Special Issue entitled: Chloroplast biogenesis. PMID:25687893

  18. Pharmacological induction of mitochondrial biogenesis as a therapeutic strategy for the treatment of type 2 diabetes.

    PubMed

    Zamora, Mònica; Pardo, Rosario; Villena, Josep A

    2015-11-01

    Defects in mitochondrial oxidative function have been associated with the onset of type 2 diabetes. Although the causal relationship between mitochondrial dysfunction and diabetes has not been fully established, numerous studies indicate that improved glucose homeostasis achieved via lifestyle interventions, such as exercise or calorie restriction, is tightly associated with increased mitochondrial biogenesis and oxidative function. Therefore, it is conceivable that potentiating mitochondrial biogenesis by pharmacological means could constitute an efficacious therapeutic strategy that would particularly benefit those diabetic patients who cannot adhere to comprehensive programs based on changes in lifestyle or that require a relatively rapid improvement in their diabetic status. In this review, we discuss several pharmacological targets and drugs that modulate mitochondrial biogenesis as well as their potential use as treatments for insulin resistance and diabetes. PMID:26212547

  19. Ribosomal Proteins and Human Diseases: Pathogenesis, Molecular Mechanisms, and Therapeutic Implications

    PubMed Central

    Wang, Wei; Nag, Subhasree; Zhang, Xu; Wang, Ming-Hai; Wang, Hui; Zhou, Jianwei; Zhang, Ruiwen

    2014-01-01

    Ribosomes are essential components of the protein synthesis machinery. The process of ribosome biogenesis is well organized and tightly regulated. Recent studies have shown that ribosomal proteins (RPs) have extraribosomal functions that are involved in cell proliferation, differentiation, apoptosis, DNA repair, and other cellular processes. The dysfunction of RPs has been linked to the development and progression of hematological, metabolic, and cardiovascular diseases and cancer. Perturbation of ribosome biogenesis results in ribosomal stress, which triggers activation of the p53 signaling pathway through RPs-MDM2 interactions, resulting in p53-dependent cell cycle arrest and apoptosis. RPs also regulate cellular functions through p53-independent mechanisms. We herein review the recent advances in several forefronts of RP research, including the understanding of their biological features and roles in regulating cellular functions, maintaining cell homeostasis, and their involvement in the pathogenesis of human diseases. We also highlight the translational potential of this research for the identification of molecular biomarkers, and in the discovery and development of novel treatments for human diseases. PMID:25164622

  20. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  1. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  2. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  3. Nucleolin protein interacts with microprocessor complex to affect biogenesis of microRNAs 15a and 16.

    PubMed

    Pickering, Brian F; Yu, Dihua; Van Dyke, Michael W

    2011-12-23

    MicroRNAs (miRNA) are endogenous, short, non-coding RNA that undergo a multistep biogenesis before generating the functional, mature sequence. The core components of the microprocessor complex, consisting of Drosha and DGCR8, are both necessary and sufficient for this process, although accessory proteins have been found that modulate the biogenesis of a subset of miRNA. Curiously, many of the proteins involved in miRNA biogenesis are also needed for ribosomal RNA processing. Here we show that nucleolin, another protein critical for rRNA processing, is involved in the biogenesis of microRNA 15a/16 (miR-15a/16), specifically at the primary to precursor stage of processing. Through overexpression and knockdown studies, we show that miR-15a/16 levels are directly correlated to nucleolin expression. Furthermore, we found that cellular localization is critical for the proper functioning of nucleolin in this pathway and that nucleolin directly interacts with DGCR8 and Drosha in the nucleus. Nucleolin can bind to the primary miRNA both directly and specifically. Finally, we show that in the absence of nucleolin, cell extracts are unable to process miR-15a/16 in vitro and that this can be rescued by the addition of nucleolin. Our findings offer a new protein component in the microRNA biogenesis pathway and lend insight into miRNA dysregulation in certain cancers. PMID:22049078

  4. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  5. Atg7 is required for acrosome biogenesis during spermatogenesis in mice

    PubMed Central

    Wang, Hongna; Wan, Haifeng; Li, Xixia; Liu, Weixiao; Chen, Qi; Wang, Yaqing; Yang, Lin; Tang, Hongmei; Zhang, Xiujun; Duan, Enkui; Zhao, Xiaoyang; Gao, Fei; Li, Wei

    2014-01-01

    The acrosome is a specialized organelle that covers the anterior part of the sperm nucleus and plays an essential role in the process of fertilization. The molecular mechanism underlying the biogenesis of this lysosome-related organelle (LRO) is still largely unknown. Here, we show that germ cell-specific Atg7-knockout mice were infertile due to a defect in acrosome biogenesis and displayed a phenotype similar to human globozoospermia; this reproductive defect was successfully rescued by intracytoplasmic sperm injections. Furthermore, the depletion of Atg7 in germ cells did not affect the early stages of development of germ cells, but at later stages of spermatogenesis, the proacrosomal vesicles failed to fuse into a single acrosomal vesicle during the Golgi phase, which finally resulted in irregular or nearly round-headed spermatozoa. Autophagic flux was disrupted in Atg7-depleted germ cells, finally leading to the failure of LC3 conjugation to Golgi apparatus-derived vesicles. In addition, Atg7 partially regulated another globozoospermia-related protein, Golgi-associated PDZ- and coiled-coil motif-containing protein (GOPC), during acrosome biogenesis. Finally, the injection of either autophagy or lysosome inhibitors into testis resulted in a similar phenotype to that of germ cell-specific Atg7-knockout mice. Altogether, our results uncover a new role for Atg7 in the biogenesis of the acrosome, and we provide evidence to support the autolysosome origination hypothesis for the acrosome. PMID:24853953

  6. Nuclear/nucleolar GTPase 2 proteins as a subfamily of YlqF/YawG GTPases function in pre-60S ribosomal subunit maturation of mono- and dicotyledonous plants.

    PubMed

    Im, Chak Han; Hwang, Sung Min; Son, Young Sim; Heo, Jae Bok; Bang, Woo Young; Suwastika, I Nengah; Shiina, Takashi; Bahk, Jeong Dong

    2011-03-11

    The YlqF/YawG families are important GTPases involved in ribosome biogenesis, cell proliferation, or cell growth, however, no plant homologs have yet to be characterized. Here we isolated rice (Oryza sativa) and Arabidopsis nuclear/nucleolar GTPase 2 (OsNug2 and AtNug2, respectively) that belong to the YawG subfamily and characterized them for pre-60S ribosomal subunit maturation. They showed typical intrinsic YlqF/YawG family GTPase activities in bacteria and yeasts with k(cat) values 0.12 ± 0.007 min(-1) (n = 6) and 0.087 ± 0.002 min(-1) (n = 4), respectively, and addition of 60S ribosomal subunits stimulated their activities in vitro. In addition, OsNug2 rescued the lethality of the yeast nug2 null mutant through recovery of 25S pre-rRNA processing. By yeast two-hybrid screening five clones, including a putative one of 60S ribosomal proteins, OsL10a, were isolated. Subcellular localization and pulldown assays resulted in that the N-terminal region of OsNug2 is sufficient for nucleolar/nuclear targeting and association with OsL10a. OsNug2 is physically associated with pre-60S ribosomal complexes highly enriched in the 25S, 5.8S, and 5S rRNA, and its interaction was stimulated by exogenous GTP. Furthermore, the AtNug2 knockdown mutant constructed by the RNAi method showed defective growth on the medium containing cycloheximide. Expression pattern analysis revealed that the distribution of AtNug2 mainly in the meristematic region underlies its potential role in active plant growth. Finally, it is concluded that Nug2/Nog2p GTPase from mono- and didicotyledonous plants is linked to the pre-60S ribosome complex and actively processed 27S into 25S during the ribosomal large subunit maturation process, i.e. prior to export to the cytoplasm. PMID:21205822

  7. Nuclear/Nucleolar GTPase 2 Proteins as a Subfamily of YlqF/YawG GTPases Function in Pre-60S Ribosomal Subunit Maturation of Mono- and Dicotyledonous Plants*

    PubMed Central

    Im, Chak Han; Hwang, Sung Min; Son, Young Sim; Heo, Jae Bok; Bang, Woo Young; Suwastika, I. Nengah; Shiina, Takashi; Bahk, Jeong Dong

    2011-01-01

    The YlqF/YawG families are important GTPases involved in ribosome biogenesis, cell proliferation, or cell growth, however, no plant homologs have yet to be characterized. Here we isolated rice (Oryza sativa) and Arabidopsis nuclear/nucleolar GTPase 2 (OsNug2 and AtNug2, respectively) that belong to the YawG subfamily and characterized them for pre-60S ribosomal subunit maturation. They showed typical intrinsic YlqF/YawG family GTPase activities in bacteria and yeasts with kcat values 0.12 ± 0.007 min−1 (n = 6) and 0.087 ± 0.002 min−1 (n = 4), respectively, and addition of 60S ribosomal subunits stimulated their activities in vitro. In addition, OsNug2 rescued the lethality of the yeast nug2 null mutant through recovery of 25S pre-rRNA processing. By yeast two-hybrid screening five clones, including a putative one of 60S ribosomal proteins, OsL10a, were isolated. Subcellular localization and pulldown assays resulted in that the N-terminal region of OsNug2 is sufficient for nucleolar/nuclear targeting and association with OsL10a. OsNug2 is physically associated with pre-60S ribosomal complexes highly enriched in the 25S, 5.8S, and 5S rRNA, and its interaction was stimulated by exogenous GTP. Furthermore, the AtNug2 knockdown mutant constructed by the RNAi method showed defective growth on the medium containing cycloheximide. Expression pattern analysis revealed that the distribution of AtNug2 mainly in the meristematic region underlies its potential role in active plant growth. Finally, it is concluded that Nug2/Nog2p GTPase from mono- and didicotyledonous plants is linked to the pre-60S ribosome complex and actively processed 27S into 25S during the ribosomal large subunit maturation process, i.e. prior to export to the cytoplasm. PMID:21205822

  8. HDL biogenesis, remodeling, and catabolism.

    PubMed

    Zannis, Vassilis I; Fotakis, Panagiotis; Koukos, Georgios; Kardassis, Dimitris; Ehnholm, Christian; Jauhiainen, Matti; Chroni, Angeliki

    2015-01-01

    In this chapter, we review how HDL is generated, remodeled, and catabolized in plasma. We describe key features of the proteins that participate in these processes, emphasizing how mutations in apolipoprotein A-I (apoA-I) and the other proteins affect HDL metabolism. The biogenesis of HDL initially requires functional interaction of apoA-I with the ATP-binding cassette transporter A1 (ABCA1) and subsequently interactions of the lipidated apoA-I forms with lecithin/cholesterol acyltransferase (LCAT). Mutations in these proteins either prevent or impair the formation and possibly the functionality of HDL. Remodeling and catabolism of HDL is the result of interactions of HDL with cell receptors and other membrane and plasma proteins including hepatic lipase (HL), endothelial lipase (EL), phospholipid transfer protein (PLTP), cholesteryl ester transfer protein (CETP), apolipoprotein M (apoM), scavenger receptor class B type I (SR-BI), ATP-binding cassette transporter G1 (ABCG1), the F1 subunit of ATPase (Ecto F1-ATPase), and the cubulin/megalin receptor. Similarly to apoA-I, apolipoprotein E and apolipoprotein A-IV were shown to form discrete HDL particles containing these apolipoproteins which may have important but still unexplored functions. Furthermore, several plasma proteins were found associated with HDL and may modulate its biological functions. The effect of these proteins on the functionality of HDL is the topic of ongoing research. PMID:25522986

  9. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  10. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  11. Dissecting the transcriptional phenotype of ribosomal protein deficiency: implications for Diamond-Blackfan Anemia.

    PubMed

    Aspesi, Anna; Pavesi, Elisa; Robotti, Elisa; Crescitelli, Rossella; Boria, Ilenia; Avondo, Federica; Moniz, Hélène; Da Costa, Lydie; Mohandas, Narla; Roncaglia, Paola; Ramenghi, Ugo; Ronchi, Antonella; Gustincich, Stefano; Merlin, Simone; Marengo, Emilio; Ellis, Steven R; Follenzi, Antonia; Santoro, Claudio; Dianzani, Irma

    2014-07-25

    Defects in genes encoding ribosomal proteins cause Diamond Blackfan Anemia (DBA), a red cell aplasia often associated with physical abnormalities. Other bone marrow failure syndromes have been attributed to defects in ribosomal components but the link between erythropoiesis and the ribosome remains to be fully defined. Several lines of evidence suggest that defects in ribosome synthesis lead to "ribosomal stress" with p53 activation and either cell cycle arrest or induction of apoptosis. Pathways independent of p53 have also been proposed to play a role in DBA pathogenesis. We took an unbiased approach to identify p53-independent pathways activated by defects in ribosome synthesis by analyzing global gene expression in various cellular models of DBA. Ranking-Principal Component Analysis (Ranking-PCA) was applied to the identified datasets to determine whether there are common sets of genes whose expression is altered in these different cellular models. We observed consistent changes in the expression of genes involved in cellular amino acid metabolic process, negative regulation of cell proliferation and cell redox homeostasis. These data indicate that cells respond to defects in ribosome synthesis by changing the level of expression of a limited subset of genes involved in critical cellular processes. Moreover, our data support a role for p53-independent pathways in the pathophysiology of DBA. PMID:24835311

  12. Dissecting the transcriptional phenotype of ribosomal protein deficiency: implications for Diamond-Blackfan Anemia

    PubMed Central

    Aspesi, Anna; Pavesi, Elisa; Robotti, Elisa; Crescitelli, Rossella; Boria, Ilenia; Avondo, Federica; Moniz, Hélène; Da Costa, Lydie; Mohandas, Narla; Roncaglia, Paola; Ramenghi, Ugo; Ronchi, Antonella; Gustincich, Stefano; Merlin, Simone; Marengo, Emilio; Ellis, Steven R.; Follenzi, Antonia; Santoro, Claudio; Dianzani, Irma

    2014-01-01

    Defects in genes encoding ribosomal proteins cause Diamond Blackfan Anemia (DBA), a red cell aplasia often associated with physical abnormalities. Other bone marrow failure syndromes have been attributed to defects in ribosomal components but the link between erythropoiesis and the ribosome remains to be fully defined. Several lines of evidence suggest that defects in ribosome synthesis lead to “ribosomal stress” with p53 activation and either cell cycle arrest or induction of apoptosis. Pathways independent of p53 have also been proposed to play a role in DBA pathogenesis. We took an unbiased approach to identify p53-independent pathways activated by defects in ribosome synthesis by analyzing global gene expression in various cellular models of DBA. Ranking-Principal Component Analysis (Ranking-PCA) was applied to the identified datasets to determine whether there are common sets of genes whose expression is altered in these different cellular models. We observed consistent changes in the expression of genes involved in cellular amino acid metabolic process, negative regulation of cell proliferation and cell redox homeostasis. These data indicate that cells respond to defects in ribosome synthesis by changing the level of expression of a limited subset of genes involved in critical cellular processes. Moreover, our data support a role for p53-independent pathways in the pathophysiology of DBA. PMID:24835311

  13. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  14. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  15. Rhabdomere biogenesis in Drosophila photoreceptors is acutely sensitive to phosphatidic acid levels

    PubMed Central

    Coessens, Elise; Manifava, Maria; Georgiev, Plamen; Pettitt, Trevor; Wood, Eleanor; Garcia-Murillas, Isaac; Okkenhaug, Hanneke; Trivedi, Deepti; Zhang, Qifeng; Razzaq, Azam; Zaid, Ola; Wakelam, Michael; O'Kane, Cahir J; Ktistakis, Nicholas

    2009-01-01

    Phosphatidic acid (PA) is postulated to have both structural and signaling functions during membrane dynamics in animal cells. In this study, we show that before a critical time period during rhabdomere biogenesis in Drosophila melanogaster photoreceptors, elevated levels of PA disrupt membrane transport to the apical domain. Lipidomic analysis shows that this effect is associated with an increase in the abundance of a single, relatively minor molecular species of PA. These transport defects are dependent on the activation state of Arf1. Transport defects via PA generated by phospholipase D require the activity of type I phosphatidylinositol (PI) 4 phosphate 5 kinase, are phenocopied by knockdown of PI 4 kinase, and are associated with normal endoplasmic reticulum to Golgi transport. We propose that PA levels are critical for apical membrane transport events required for rhabdomere biogenesis. PMID:19349583

  16. PBR1 selectively controls biogenesis of photosynthetic complexes by modulating translation of the large chloroplast gene Ycf1 in Arabidopsis

    PubMed Central

    Yang, Xiao-Fei; Wang, Yu-Ting; Chen, Si-Ting; Li, Ji-Kai; Shen, Hong-Tao; Guo, Fang-Qing

    2016-01-01

    The biogenesis of photosystem I (PSI), cytochrome b6f (Cytb6f) and NADH dehydrogenase (NDH) complexes relies on the spatially and temporally coordinated expression and translation of both nuclear and chloroplast genes. Here we report the identification of photosystem biogenesis regulator 1 (PBR1), a nuclear-encoded chloroplast RNA-binding protein that regulates the concerted biogenesis of NDH, PSI and Cytb6f complexes. We identified Ycf1, one of the two largest chloroplast genome-encoded open reading frames as the direct downstream target protein of PBR1. Biochemical and molecular analyses reveal that PBR1 regulates Ycf1 translation by directly binding to its mRNA. Surprisingly, we further demonstrate that relocation of the chloroplast gene Ycf1 fused with a plastid-transit sequence to the nucleus bypasses the requirement of PBR1 for Ycf1 translation, which sufficiently complements the defects in biogenesis of NDH, PSI and Cytb6f complexes in PBR1-deficient plants. Remarkably, the nuclear-encoded PBR1 tightly controls the expression of the chloroplast gene Ycf1 at the translational level, which is sufficient to sustain the coordinated biogenesis of NDH, PSI and Cytb6f complexes as a whole. Our findings provide deep insights into better understanding of how a predominant nuclear-encoded factor can act as a migratory mediator and undergoes selective translational regulation of the target plastid gene in controlling biogenesis of photosynthetic complexes. PMID:27462450

  17. PBR1 selectively controls biogenesis of photosynthetic complexes by modulating translation of the large chloroplast gene Ycf1 in Arabidopsis.

    PubMed

    Yang, Xiao-Fei; Wang, Yu-Ting; Chen, Si-Ting; Li, Ji-Kai; Shen, Hong-Tao; Guo, Fang-Qing

    2016-01-01

    The biogenesis of photosystem I (PSI), cytochrome b 6 f (Cytb 6 f) and NADH dehydrogenase (NDH) complexes relies on the spatially and temporally coordinated expression and translation of both nuclear and chloroplast genes. Here we report the identification of photosystem biogenesis regulator 1 (PBR1), a nuclear-encoded chloroplast RNA-binding protein that regulates the concerted biogenesis of NDH, PSI and Cytb 6 f complexes. We identified Ycf1, one of the two largest chloroplast genome-encoded open reading frames as the direct downstream target protein of PBR1. Biochemical and molecular analyses reveal that PBR1 regulates Ycf1 translation by directly binding to its mRNA. Surprisingly, we further demonstrate that relocation of the chloroplast gene Ycf1 fused with a plastid-transit sequence to the nucleus bypasses the requirement of PBR1 for Ycf1 translation, which sufficiently complements the defects in biogenesis of NDH, PSI and Cytb 6 f complexes in PBR1-deficient plants. Remarkably, the nuclear-encoded PBR1 tightly controls the expression of the chloroplast gene Ycf1 at the translational level, which is sufficient to sustain the coordinated biogenesis of NDH, PSI and Cytb 6 f complexes as a whole. Our findings provide deep insights into better understanding of how a predominant nuclear-encoded factor can act as a migratory mediator and undergoes selective translational regulation of the target plastid gene in controlling biogenesis of photosynthetic complexes. PMID:27462450

  18. Ribosomal protein S6 is highly expressed in non-Hodgkin lymphoma and associates with mRNA containing a 5' terminal oligopyrimidine tract.

    PubMed

    Hagner, P R; Mazan-Mamczarz, K; Dai, B; Balzer, E M; Corl, S; Martin, S S; Zhao, X F; Gartenhaus, R B

    2011-03-31

    The molecular mechanism(s) linking tumorigenesis and morphological alterations in the nucleolus are presently coming into focus. The nucleolus is the cellular organelle in which the formation of ribosomal subunits occurs. Ribosomal biogenesis occurs through the transcription of ribosomal RNA (rRNA), rRNA processing and production of ribosomal proteins. An error in any of these processes may lead to deregulated cellular translation, evident in multiple cancers and 'ribosomopathies'. Deregulated protein synthesis may be achieved through the overexpression of ribosomal proteins as seen in primary leukemic blasts with elevated levels of ribosomal proteins S11 and S14. In this study, we demonstrate that ribosomal protein S6 (RPS6) is highly expressed in primary diffuse large B-cell lymphoma (DLBCL) samples. Genetic modulation of RPS6 protein levels with specifically targeted short hairpin RNA (shRNA) lentiviruses led to a decrease in the actively proliferating population of cells compared with control shRNA. Low-dose rapamycin treatments have been shown to affect the translation of 5' terminal oligopyrimidine (5' TOP) tract mRNA, which encodes the translational machinery, implicating RPS6 in 5' TOP translation. Recently, it was shown that disruption of 40S ribosomal biogenesis through specific small inhibitory RNA knockdown of RPS6 defined RPS6 as a critical regulator of 5' TOP translation. For the first time, we show that RPS6 associates with multiple mRNAs containing a 5' TOP tract. These findings expand our understanding of the mechanism(s) involved in ribosomal biogenesis and deregulated protein synthesis in DLBCL. PMID:21102526

  19. cAMP-induced Mitochondrial Compartment Biogenesis

    PubMed Central

    Yoboue, Edgar D.; Augier, Eric; Galinier, Anne; Blancard, Corinne; Pinson, Benoît; Casteilla, Louis; Rigoulet, Michel; Devin, Anne

    2012-01-01

    Cell fate and proliferation are tightly linked to the regulation of the mitochondrial energy metabolism. Hence, mitochondrial biogenesis regulation, a complex process that requires a tight coordination in the expression of the nuclear and mitochondrial genomes, has a major impact on cell fate and is of high importance. Here, we studied the molecular mechanisms involved in the regulation of mitochondrial biogenesis through a nutrient-sensing pathway, the Ras-cAMP pathway. Activation of this pathway induces a decrease in the cellular phosphate potential that alleviates the redox pressure on the mitochondrial respiratory chain. One of the cellular consequences of this modulation of cellular phosphate potential is an increase in the cellular glutathione redox state. The redox state of the glutathione disulfide-glutathione couple is a well known important indicator of the cellular redox environment, which is itself tightly linked to mitochondrial activity, mitochondria being the main cellular producer of reactive oxygen species. The master regulator of mitochondrial biogenesis in yeast (i.e. the transcriptional co-activator Hap4p) is positively regulated by the cellular glutathione redox state. Using a strain that is unable to modulate its glutathione redox state (Δglr1), we pinpoint a positive feedback loop between this redox state and the control of mitochondrial biogenesis. This is the first time that control of mitochondrial biogenesis through glutathione redox state has been shown. PMID:22396541

  20. Insights into chloroplast biogenesis and development.

    PubMed

    Pogson, Barry J; Ganguly, Diep; Albrecht-Borth, Verónica

    2015-09-01

    In recent years many advances have been made to obtain insight into chloroplast biogenesis and development. In plants several plastids types exist such as the proplastid (which is the progenitor of all plastids), leucoplasts (group of colourless plastids important for storage including elaioplasts (lipids), amyloplasts (starch) or proteinoplasts (proteins)), chromoplasts (yellow to orange-coloured due to carotenoids, in flowers or in old leaves as gerontoplasts), and the green chloroplasts. Chloroplasts are indispensable for plant development; not only by performing photosynthesis and thus rendering the plant photoautotrophic, but also for biochemical processes (which in some instances can also take place in other plastids types), such as the synthesis of pigments, lipids, and plant hormones and sensing environmental stimuli. Although we understand many aspects of these processes there are gaps in our understanding of the establishment of functional chloroplasts and their regulation. Why is that so? Even though chloroplast function is comparable in all plants and most of the algae, ferns and moss, detailed analyses have revealed many differences, specifically with respect to its biogenesis. As an update to our prior review on the genetic analysis of chloroplast biogenesis and development [1] herein we will focus on recent advances in Angiosperms (monocotyledonous and dicotyledonous plants) that provide novel insights and highlight the challenges and prospects for unravelling the regulation of chloroplast biogenesis specifically during the establishment of the young plants. This article is part of a Special Issue entitled: Chloroplast Biogenesis. PMID:25667967

  1. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  2. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  3. Heat shock proteins: molecular chaperones of protein biogenesis.

    PubMed Central

    Craig, E A; Gambill, B D; Nelson, R J

    1993-01-01

    Heat shock proteins (Hsps) were first identified as proteins whose synthesis was enhanced by stresses such as an increase in temperature. Recently, several of the major Hsps have been shown to be intimately involved in protein biogenesis through a direct interaction with a wide variety of proteins. As a reflection of this role, these Hsps have been referred to as molecular chaperones. Hsp70s interact with incompletely folded proteins, such as nascent chains on ribosomes and proteins in the process of translocation from the cytosol into mitochondria and the endoplasmic reticulum. Hsp60 also binds to unfolded proteins, preventing aggregation and facilitating protein folding. Although less well defined, other Hsps such as Hsp90 also play important roles in modulating the activity of a number of proteins. The function of the proteolytic system is intertwined with that of molecular chaperones. Several components of this system, encoded by heat-inducible genes, are responsible for the degradation of abnormal or misfolded proteins. The budding yeast Saccharomyces cerevisiae has proven very useful in the analysis of the role of molecular chaperones in protein maturation, translocation, and degradation. In this review, results of experiments are discussed within the context of experiments with other organisms in an attempt to describe the current state of understanding of these ubiquitous and important proteins. PMID:8336673

  4. Myristoylated CIL-7 regulates ciliary extracellular vesicle biogenesis.

    PubMed

    Maguire, Julie E; Silva, Malan; Nguyen, Ken C Q; Hellen, Elizabeth; Kern, Andrew D; Hall, David H; Barr, Maureen M

    2015-08-01

    The cilium both releases and binds to extracellular vesicles (EVs). EVs may be used by cells as a form of intercellular communication and mediate a broad range of physiological and pathological processes. The mammalian polycystins (PCs) localize to cilia, as well as to urinary EVs released from renal epithelial cells. PC ciliary trafficking defects may be an underlying cause of autosomal dominant polycystic kidney disease (PKD), and ciliary-EV interactions have been proposed to play a central role in the biology of PKD. In Caenorhabditis elegans and mammals, PC1 and PC2 act in the same genetic pathway, act in a sensory capacity, localize to cilia, and are contained in secreted EVs, suggesting ancient conservation. However, the relationship between cilia and EVs and the mechanisms generating PC-containing EVs remain an enigma. In a forward genetic screen for regulators of C. elegans PKD-2 ciliary localization, we identified CIL-7, a myristoylated protein that regulates EV biogenesis. Loss of CIL-7 results in male mating behavioral defects, excessive accumulation of EVs in the lumen of the cephalic sensory organ, and failure to release PKD-2::GFP-containing EVs to the environment. Fatty acylation, such as myristoylation and palmitoylation, targets proteins to cilia and flagella. The CIL-7 myristoylation motif is essential for CIL-7 function and for targeting CIL-7 to EVs. C. elegans is a powerful model with which to study ciliary EV biogenesis in vivo and identify cis-targeting motifs such as myristoylation that are necessary for EV-cargo association and function. PMID:26041936

  5. The SMC Loader Scc2 Promotes ncRNA Biogenesis and Translational Fidelity

    PubMed Central

    Zakari, Musinu; Trimble Ross, Rhonda; Peak, Allison; Blanchette, Marco; Seidel, Chris; Gerton, Jennifer L.

    2015-01-01

    The Scc2-Scc4 complex is essential for loading the cohesin complex onto DNA. Cohesin has important roles in chromosome segregation, DSB repair, and chromosome condensation. Here we report that Scc2 is important for gene expression in budding yeast. Scc2 and the transcriptional regulator Paf1 collaborate to promote the production of Box H/ACA snoRNAs which guide pseudouridylation of RNAs including ribosomal RNA. Mutation of SCC2 was associated with defects in the production of ribosomal RNA, ribosome assembly, and splicing. While the scc2 mutant does not have a general defect in protein synthesis, it shows increased frameshifting and reduced cap-independent translation. These findings suggest Scc2 normally promotes a gene expression program that supports translational fidelity. We hypothesize that translational dysfunction may contribute to the human disorder Cornelia de Lange syndrome, which is caused by mutations in NIPBL, the human ortholog of SCC2. PMID:26176819

  6. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone

    2009-02-06

    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  7. The Ribosome-Sec61 Translocon Complex Forms a Cytosolically Restricted Environment for Early Polytopic Membrane Protein Folding.

    PubMed

    Patterson, Melissa A; Bandyopadhyay, Anannya; Devaraneni, Prasanna K; Woodward, Josha; Rooney, LeeAnn; Yang, Zhongying; Skach, William R

    2015-11-27

    Transmembrane topology of polytopic membrane proteins (PMPs) is established in the endoplasmic reticulum (ER) by the ribosome Sec61-translocon complex (RTC) through iterative cycles of translocation initiation and termination. It remains unknown, however, whether tertiary folding of transmembrane domains begins after the nascent polypeptide integrates into the lipid bilayer or within a proteinaceous environment proximal to translocon components. To address this question, we used cysteine scanning mutagenesis to monitor aqueous accessibility of stalled translation intermediates to determine when, during biogenesis, hydrophilic peptide loops of the aquaporin-4 (AQP4) water channel are delivered to cytosolic and lumenal compartments. Results showed that following ribosome docking on the ER membrane, the nascent polypeptide was shielded from the cytosol as it emerged from the ribosome exit tunnel. Extracellular loops followed a well defined path through the ribosome, the ribosome translocon junction, the Sec61-translocon pore, and into the ER lumen coincident with chain elongation. In contrast, intracellular loops (ICLs) and C-terminalresidues exited the ribosome into a cytosolically shielded environment and remained inaccessible to both cytosolic and lumenal compartments until translation was terminated. Shielding of ICL1 and ICL2, but not the C terminus, became resistant to maneuvers that disrupt electrostatic ribosome interactions. Thus, the early folding landscape of polytopic proteins is shaped by a spatially restricted environment localized within the assembled ribosome translocon complex. PMID:26254469

  8. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  9. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  10. Zinc Regulates a Switch between Primary and Alternative S18 Ribosomal Proteins in Mycobacterium tuberculosis

    PubMed Central

    Prisic, Sladjana; Hwang, Hyonson; Dow, Allexa; Barnaby, Omar; Pan, Tenny S.; Lonzanida, Jaymes A.; Chazin, Walter J.; Steen, Hanno; Husson, Robert N.

    2015-01-01

    SUMMARY The Mycobacterium tuberculosis genome encodes five putative “alternative” ribosomal proteins whose expression is repressed at high Zn2+ concentration. Each alternative protein has a primary homolog that is predicted to bind Zn2+. We hypothesized that zinc triggers a switch between these paired homologous proteins and therefore chose one of these pairs, S18-1/S18-2, to study mechanisms of the predicted competition for their incorporation into ribosomes. As predicted, our data show that Zn2+-depletion causes accumulation of both S18-2 mRNA and protein. In contrast, S18-1 mRNA levels are unchanged to slightly elevated under Zn2+-limited conditions. However the amount of S18-1 protein is markedly decreased. We further demonstrate that both S18 proteins interact with ribosomal protein S6, a committed step in ribosome biogenesis. Zn2+ is absolutely required for the S18-1/S6 interaction, while it is dispensable for S18-2/S6 dimer formation. These data suggest a model in which the S18-1 is the dominant ribosome constituent in high zinc conditions, e.g. inside of phagosomes, but that it can be replaced by S18-2 when zinc is deficient, e.g. in the extracellular milieu. Consequently, Zn2+-depletion may serve as a signal for building alternative ribosomes when M. tuberculosis is released from macrophages, to allow survival in the extracellular environment. PMID:25858183

  11. MPV17L2 is required for ribosome assembly in mitochondria

    PubMed Central

    Dalla Rosa, Ilaria; Durigon, Romina; Pearce, Sarah F.; Rorbach, Joanna; Hirst, Elizabeth M.A.; Vidoni, Sara; Reyes, Aurelio; Brea-Calvo, Gloria; Minczuk, Michal; Woellhaf, Michael W.; Herrmann, Johannes M.; Huynen, Martijn A.; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    MPV17 is a mitochondrial protein of unknown function, and mutations in MPV17 are associated with mitochondrial deoxyribonucleic acid (DNA) maintenance disorders. Here we investigated its most similar relative, MPV17L2, which is also annotated as a mitochondrial protein. Mitochondrial fractionation analyses demonstrate MPV17L2 is an integral inner membrane protein, like MPV17. However, unlike MPV17, MPV17L2 is dependent on mitochondrial DNA, as it is absent from ρ0 cells, and co-sediments on sucrose gradients with the large subunit of the mitochondrial ribosome and the monosome. Gene silencing of MPV17L2 results in marked decreases in the monosome and both subunits of the mitochondrial ribosome, leading to impaired protein synthesis in the mitochondria. Depletion of MPV17L2 also induces mitochondrial DNA aggregation. The DNA and ribosome phenotypes are linked, as in the absence of MPV17L2 proteins of the small subunit of the mitochondrial ribosome are trapped in the enlarged nucleoids, in contrast to a component of the large subunit. These findings suggest MPV17L2 contributes to the biogenesis of the mitochondrial ribosome, uniting the two subunits to create the translationally competent monosome, and provide evidence that assembly of the small subunit of the mitochondrial ribosome occurs at the nucleoid. PMID:24948607

  12. Structure of the Bacillus subtilis 70S ribosome reveals the basis for species-specific stalling

    NASA Astrophysics Data System (ADS)

    Sohmen, Daniel; Chiba, Shinobu; Shimokawa-Chiba, Naomi; Innis, C. Axel; Berninghausen, Otto; Beckmann, Roland; Ito, Koreaki; Wilson, Daniel N.

    2015-04-01

    Ribosomal stalling is used to regulate gene expression and can occur in a species-specific manner. Stalling during translation of the MifM leader peptide regulates expression of the downstream membrane protein biogenesis factor YidC2 (YqjG) in Bacillus subtilis, but not in Escherichia coli. In the absence of structures of Gram-positive bacterial ribosomes, a molecular basis for species-specific stalling has remained unclear. Here we present the structure of a Gram-positive B. subtilis MifM-stalled 70S ribosome at 3.5-3.9 Å, revealing a network of interactions between MifM and the ribosomal tunnel, which stabilize a non-productive conformation of the PTC that prevents aminoacyl-tRNA accommodation and thereby induces translational arrest. Complementary genetic analyses identify a single amino acid within ribosomal protein L22 that dictates the species specificity of the stalling event. Such insights expand our understanding of how the synergism between the ribosome and the nascent chain is utilized to modulate the translatome in a species-specific manner.

  13. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-06-01

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly. PMID:27251291

  14. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  15. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  16. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.

    PubMed

    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L

    2016-09-01

    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling. PMID:27390266

  17. Ribosomal RNAs in translation termination: facts and hypotheses.

    PubMed

    Arkov, A L; Murgola, E J

    1999-12-01

    It is now well established that ribosomal RNAs (rRNAs) play an active role in every aspect of translation. This review focuses on recent evidence for the involvement of rRNAs from both subunits of the ribosome in translation termination. This evidence comprises data obtained with rRNA mutants both in vivo and in vitro. In particular, mutations in specific regions of rRNAs caused readthrough of nonsense codons in vivo. Consistent with their in vivo characteristics, the mutations decreased the productive association of the ribosome with release factor 2 (RF2) and the efficiency of catalysis of peptidyl-tRNA hydrolysis in the presence of RF2 in realistic in vitro termination systems. It is now evident that genetic selections for termination-defective mutants in vivo and their characterization in realistic in vitro termination assays will rapidly advance our understanding of the mechanism of termination. PMID:10648958

  18. Ribosomal protein deficiency causes Tp53-independent erythropoiesis failure in zebrafish.

    PubMed

    Yadav, Gnaneshwar V; Chakraborty, Anirban; Uechi, Tamayo; Kenmochi, Naoya

    2014-04-01

    Diamond-Blackfan anemia is an inherited genetic disease caused by mutations in ribosomal protein genes. The disease is characterized by bone marrow failure, congenital anomalies, and a severe erythroid defect. The activation of the TP53 pathway has been suggested to be critical for the pathophysiology of Diamond-Blackfan anemia. While this pathway plays a role in the morphological defects that associate with ribosomal protein loss-of-function in animal models, its role in the erythroid defects has not been clearly established. To understand the specificity of erythroid defects in Diamond-Blackfan anemia, we knocked down five RP genes (two Diamond-Blackfan anemia-associated and three non-Diamond-Blackfan anemia-associated) in zebrafish and analyzed the effects on the developmental and erythroid phenotypes in the presence and absence of Tp53. The co-inhibition of Tp53 activity rescued the morphological deformities but did not alleviate the erythroid aplasia indicating that ribosomal protein deficiency causes erythroid failure in a Tp53-independent manner. Interestingly, treatment with L-Leucine or L-Arginine, amino acids that augment mRNA translation via mTOR pathway, rescued the morphological defects and resulted in a substantial recovery of erythroid cells. Our results suggest that altered translation because of impaired ribosome function could be responsible for the morphological and erythroid defects in ribosomal protein-deficient zebrafish. PMID:24417973

  19. Stimulatory Effects of Balanced Deep Sea Water on Mitochondrial Biogenesis and Function.

    PubMed

    Ha, Byung Geun; Park, Jung-Eun; Cho, Hyun-Jung; Shon, Yun Hee

    2015-01-01

    The worldwide prevalence of metabolic diseases, including obesity and diabetes, is increasing. Mitochondrial dysfunction is recognized as a core feature of these diseases. Emerging evidence also suggests that defects in mitochondrial biogenesis, number, morphology, fusion, and fission, contribute to the development and progression of metabolic diseases. Our previous studies revealed that balanced deep-sea water (BDSW) has potential as a treatment for diabetes and obesity. In this study, we aimed to investigate the mechanism by which BDSW regulates diabetes and obesity by studying its effects on mitochondrial metabolism. To determine whether BDSW regulates mitochondrial biogenesis and function, we investigated its effects on mitochondrial DNA (mtDNA) content, mitochondrial enzyme activity, and the expression of transcription factors and mitochondria specific genes, as well as on the phosphorylation of signaling molecules associated with mitochondria biogenesis and its function in C2C12 myotubes. BDSW increased mitochondrial biogenesis in a time and dose-dependent manner. Quantitative real-time PCR revealed that BDSW enhances gene expression of PGC-1α, NRF1, and TFAM for mitochondrial transcription; MFN1/2 and DRP1 for mitochondrial fusion; OPA1 for mitochondrial fission; TOMM40 and TIMM44 for mitochondrial protein import; CPT-1α and MCAD for fatty acid oxidation; CYTC for oxidative phosphorylation. Upregulation of these genes was validated by increased mitochondria staining, CS activity, CytC oxidase activity, NAD+ to NADH ratio, and the phosphorylation of signaling molecules such as AMPK and SIRT1. Moreover, drinking BDSW remarkably improved mtDNA content in the muscles of HFD-induced obese mice. Taken together, these results suggest that the stimulatory effect of BDSW on mitochondrial biogenesis and function may provide further insights into the regulatory mechanism of BDSW-induced anti-diabetic and anti-obesity action. PMID:26068191

  20. Molecular Complexity Orchestrates Modulation of Phagosome Biogenesis and Escape to the Cytosol of macrophages by Francisella tularensis

    PubMed Central

    Asare, Rexford; Kwaik, Yousef Abu

    2010-01-01

    Upon entry of Francisella tularensis to macrophages, the Francisella-containing phagosome (FCP) is trafficked into an acidified late endosome-like phagosome with limited fusion to the lysosomes followed by rapid escape into the cytosol where the organism replicates. Although the Francisella Pathogenicity Island (FPI), which encodes a type VI-like secretion apparatus, is required for modulation of phagosome biogenesis and escape into the cytosol, the mechanisms involved are not known. To decipher the molecular bases of modulation of biogenesis of the FCP and bacterial escape into the macrophage cytosol, we have screened a comprehensive mutant library of F. tularensis subsp novicida for their defect in proliferation within human macrophages, followed by characterization of modulation of phagosome biogenesis and bacterial escape into the cytosol. Our data show that at least 202 genes are required for intracellular proliferation within macrophages. Among the 125 most defective mutants in intracellular proliferation, we show that the FCP of at least 91 mutants co-localize persistently with the late endosomal/lysosomal marker LAMP-1 and fail to escape into the cytosol, as determined by fluorescence-based phagosome integrity assays and transmission electron microscopy. At least 34 genes are required for proliferation within the cytosol but do not play a detectable role in modulation of phagosome biogenesis and bacterial escape into the cytosol. Our data indicate a tremendous adaptation and metabolic reprogramming by F. tularensis to adjust to the micro-environmental and nutritional cues within the FCP, and these adjustments play essential roles in modulation of phagosome biogenesis and escape into the cytosol of macrophages as well as proliferation in the cytosol. The plethora of the networks of genes that orchestrate F. tularensis-mediated modulation of phagosome biogenesis, phagosomal escape, and bacterial proliferation within the cytosol is novel, complex, and involves

  1. eIF1A augments Ago2-mediated Dicer-independent miRNA biogenesis and RNA interference

    NASA Astrophysics Data System (ADS)

    Yi, Tingfang; Arthanari, Haribabu; Akabayov, Barak; Song, Huaidong; Papadopoulos, Evangelos; Qi, Hank H.; Jedrychowski, Mark; Güttler, Thomas; Guo, Cuicui; Luna, Rafael E.; Gygi, Steven P.; Huang, Stephen A.; Wagner, Gerhard

    2015-05-01

    MicroRNA (miRNA) biogenesis and miRNA-guided RNA interference (RNAi) are essential for gene expression in eukaryotes. Here we report that translation initiation factor eIF1A directly interacts with Ago2 and promotes Ago2 activities in RNAi and miR-451 biogenesis. Biochemical and NMR analyses demonstrate that eIF1A binds to the MID domain of Ago2 and this interaction does not impair translation initiation. Alanine mutation of the Ago2-facing Lys56 in eIF1A impairs RNAi activities in human cells and zebrafish. The eIF1A-Ago2 assembly facilitates Dicer-independent biogenesis of miR-451, which mediates erythrocyte maturation. Human eIF1A (heIF1A), but not heIF1A(K56A), rescues the erythrocyte maturation delay in eif1axb knockdown zebrafish. Consistently, miR-451 partly compensates erythrocyte maturation defects in zebrafish with eif1axb knockdown and eIF1A(K56A) expression, supporting a role of eIF1A in miRNA-451 biogenesis in this model. Our results suggest that eIF1A is a novel component of the Ago2-centred RNA-induced silencing complexes (RISCs) and augments Ago2-dependent RNAi and miRNA biogenesis.

  2. eIF1A augments Ago2-mediated Dicer-independent miRNA biogenesis and RNA interference

    PubMed Central

    Yi, Tingfang; Arthanari, Haribabu; Akabayov, Barak; Song, Huaidong; Papadopoulos, Evangelos; Qi, Hank H.; Jedrychowski, Mark; Güttler, Thomas; Guo, Cuicui; Luna, Rafael E.; Gygi, Steven P.; Huang, Stephen A.; Wagner, Gerhard

    2015-01-01

    MicroRNA (miRNA) biogenesis and miRNA-guided RNA interference (RNAi) are essential for gene expression in eukaryotes. Here we report that translation initiation factor eIF1A directly interacts with Ago2 and promotes Ago2 activities in RNAi and miR-451 biogenesis. Biochemical and NMR analyses demonstrate that eIF1A binds to the MID-domain of Ago2 and this interaction does not impair translation initiation. Alanine mutation of the Ago2-facing Lys56 in eIF1A impairs RNAi activities in human cells and zebrafish. The eIF1A-Ago2 assembly facilitates Dicer-independent biogenesis of miR-451, which mediates erythrocyte maturation. Human eIF1A (heIF1A), but not heIF1A(K56A), rescues the erythrocyte maturation delay in eif1axb knockdown zebrafish. Consistently, miR-451 partly compensates erythrocyte maturation defects in zebrafish with eif1axb knockdown and eIF1A(K56A) expression, supporting a role of eIF1A in miRNA-451 biogenesis in this model. Our results suggest that eIF1A is a novel component of the Ago2-centered RNA induced silencing complexes (RISCs) and augments Ago2-dependent RNAi and miRNA biogenesis. PMID:26018492

  3. SuhB Associates with Nus Factors To Facilitate 30S Ribosome Biogenesis in Escherichia coli

    PubMed Central

    Singh, Navjot; Bubunenko, Mikhail; Smith, Carol; Abbott, David M.; Stringer, Anne M.; Shi, Ronald; Court, Donald L.

    2016-01-01

    ABSTRACT A complex of highly conserved proteins consisting of NusB, NusE, NusA, and NusG is required for robust expression of rRNA in Escherichia coli. This complex is proposed to prevent Rho-dependent transcription termination by a process known as “antitermination.” The mechanism of this antitermination in rRNA is poorly understood but requires association of NusB and NusE with a specific RNA sequence in rRNA known as BoxA. Here, we identify a novel member of the rRNA antitermination machinery: the inositol monophosphatase SuhB. We show that SuhB associates with elongating RNA polymerase (RNAP) at rRNA in a NusB-dependent manner. Although we show that SuhB is required for BoxA-mediated antitermination in a reporter system, our data indicate that the major function of the NusB/E/A/G/SuhB complex is not to prevent Rho-dependent termination of rRNA but rather to promote correct rRNA maturation. This occurs through formation of a SuhB-mediated loop between NusB/E/BoxA and RNAP/NusA/G. Thus, we have reassigned the function of these proteins at rRNA and identified another key player in this complex. PMID:26980831

  4. The prolyl isomerase, FKBP25, interacts with RNA-engaged nucleolin and the pre-60S ribosomal subunit.

    PubMed

    Gudavicius, Geoff; Dilworth, David; Serpa, Jason J; Sessler, Nicole; Petrotchenko, Evgeniy V; Borchers, Christoph H; Nelson, Christopher J

    2014-07-01

    Peptidyl-proline isomerases of the FK506-binding protein (FKBP) family belong to a class of enzymes that catalyze the cis-trans isomerization of prolyl-peptide bonds in proteins. A handful of FKBPs are found in the nucleus, implying that the isomerization of proline in nuclear proteins is enzymatically controlled. FKBP25 is a nuclear protein that has been shown to associate with chromatin modifiers and transcription factors. In this study, we performed the first proteomic characterization of FKBP25 and found that it interacts with numerous ribosomal proteins, ribosomal processing factors, and a small selection of chromatin modifiers. In agreement with previous reports, we found that nucleolin is a major FKBP25-interacting protein and demonstrated that this interaction is dependent on rRNA. FKBP25 interacts with the immature large ribosomal subunit in nuclear extract but does not associate with mature ribosomes, implicating this FKBP's action in ribosome biogenesis. Despite engaging nascent 60S ribosomes, FKBP25 does not affect steady-state levels of rRNAs or its pre-rRNA intermediates. We conclude that FKBP25 is likely recruited to preribosomes to chaperone one of the protein components of the ribosome large subunit. PMID:24840943

  5. Explosive cell lysis as a mechanism for the biogenesis of bacterial membrane vesicles and biofilms.

    PubMed

    Turnbull, Lynne; Toyofuku, Masanori; Hynen, Amelia L; Kurosawa, Masaharu; Pessi, Gabriella; Petty, Nicola K; Osvath, Sarah R; Cárcamo-Oyarce, Gerardo; Gloag, Erin S; Shimoni, Raz; Omasits, Ulrich; Ito, Satoshi; Yap, Xinhui; Monahan, Leigh G; Cavaliere, Rosalia; Ahrens, Christian H; Charles, Ian G; Nomura, Nobuhiko; Eberl, Leo; Whitchurch, Cynthia B

    2016-01-01

    Many bacteria produce extracellular and surface-associated components such as membrane vesicles (MVs), extracellular DNA and moonlighting cytosolic proteins for which the biogenesis and export pathways are not fully understood. Here we show that the explosive cell lysis of a sub-population of cells accounts for the liberation of cytosolic content in Pseudomonas aeruginosa biofilms. Super-resolution microscopy reveals that explosive cell lysis also produces shattered membrane fragments that rapidly form MVs. A prophage endolysin encoded within the R- and F-pyocin gene cluster is essential for explosive cell lysis. Endolysin-deficient mutants are defective in MV production and biofilm development, consistent with a crucial role in the biogenesis of MVs and liberation of extracellular DNA and other biofilm matrix components. Our findings reveal that explosive cell lysis, mediated through the activity of a cryptic prophage endolysin, acts as a mechanism for the production of bacterial MVs. PMID:27075392

  6. Explosive cell lysis as a mechanism for the biogenesis of bacterial membrane vesicles and biofilms

    PubMed Central

    Turnbull, Lynne; Toyofuku, Masanori; Hynen, Amelia L.; Kurosawa, Masaharu; Pessi, Gabriella; Petty, Nicola K.; Osvath, Sarah R.; Cárcamo-Oyarce, Gerardo; Gloag, Erin S.; Shimoni, Raz; Omasits, Ulrich; Ito, Satoshi; Yap, Xinhui; Monahan, Leigh G.; Cavaliere, Rosalia; Ahrens, Christian H.; Charles, Ian G.; Nomura, Nobuhiko; Eberl, Leo; Whitchurch, Cynthia B.

    2016-01-01

    Many bacteria produce extracellular and surface-associated components such as membrane vesicles (MVs), extracellular DNA and moonlighting cytosolic proteins for which the biogenesis and export pathways are not fully understood. Here we show that the explosive cell lysis of a sub-population of cells accounts for the liberation of cytosolic content in Pseudomonas aeruginosa biofilms. Super-resolution microscopy reveals that explosive cell lysis also produces shattered membrane fragments that rapidly form MVs. A prophage endolysin encoded within the R- and F-pyocin gene cluster is essential for explosive cell lysis. Endolysin-deficient mutants are defective in MV production and biofilm development, consistent with a crucial role in the biogenesis of MVs and liberation of extracellular DNA and other biofilm matrix components. Our findings reveal that explosive cell lysis, mediated through the activity of a cryptic prophage endolysin, acts as a mechanism for the production of bacterial MVs. PMID:27075392

  7. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans.

    PubMed

    Holdt, Lesca M; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  8. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

    PubMed Central

    Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  9. Bag6/Bat3/Scythe: a novel chaperone activity with diverse regulatory functions in protein biogenesis and degradation.

    PubMed

    Lee, Jin-Gu; Ye, Yihong

    2013-04-01

    Upon emerging from the ribosome exiting tunnel, polypeptide folding occurs immediately with the assistance of both ribosome-associated and free chaperones. While many chaperones known to date are dedicated folding catalysts, recent studies have revealed a novel chaperoning system that functions at the interface of protein biogenesis and quality control by using a special "holdase" activity in order to sort and channel client proteins to distinct destinations. The key component, Bag6/Bat3/Scythe, can effectively shield long hydrophobic segments exposed on the surface of a polypeptide, preventing aggregation or inappropriate interactions before a triaging decision is made. The biological consequences of Bag6-mediated chaperoning are divergent for different substrates, ranging from membrane integration to proteasome targeting and destruction. Accordingly, Bag6 can act in various cellular contexts in order to execute many essential cellular functions, while dysfunctions in the Bag6 system can cause severe cellular abnormalities that may be associated with some pathological conditions. PMID:23417671

  10. Structures of the scanning and engaged states of the mammalian SRP-ribosome complex

    PubMed Central

    Voorhees, Rebecca M; Hegde, Ramanujan S

    2015-01-01

    The universally conserved signal recognition particle (SRP) is essential for the biogenesis of most integral membrane proteins. SRP scans the nascent chains of translating ribosomes, preferentially engaging those with hydrophobic targeting signals, and delivers these ribosome-nascent chain complexes to the membrane. Here, we present structures of native mammalian SRP-ribosome complexes in the scanning and engaged states. These structures reveal the near-identical SRP architecture of these two states, show many of the SRP-ribosome interactions at atomic resolution, and suggest how the polypeptide-binding M domain selectively engages hydrophobic signals. The scanning M domain, pre-positioned at the ribosomal exit tunnel, is auto-inhibited by a C-terminal amphipathic helix occluding its hydrophobic binding groove. Upon engagement, the hydrophobic targeting signal displaces this amphipathic helix, which then acts as a protective lid over the signal. Biochemical experiments suggest how scanning and engagement are coordinated with translation elongation to minimize exposure of hydrophobic signals during membrane targeting. DOI: http://dx.doi.org/10.7554/eLife.07975.001 PMID:26158507

  11. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges

    PubMed Central

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae–independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. DOI: http://dx.doi.org/10.7554/eLife.17508.001 PMID:27528195

  12. Centriole biogenesis and function in multiciliated cells

    PubMed Central

    Zhang, Siwei; Mitchell, Brian J.

    2016-01-01

    The use of Xenopus embryonic skin as a model system for the development of ciliated epithelia is well established. This tissue is comprised of numerous cell types, most notably the multiciliated cells (MCCs) that each contain approximately 150 motile cilia. At the base of each cilium lies the centriole-based structure called the basal body. Centriole biogenesis is typically restricted to two new centrioles per cell cycle, each templating from an existing “mother” centriole. In contrast, MCCs are post-mitotic cells in which the majority of centrioles arise “de novo” without templating from a mother centriole, instead, these centrioles nucleate from an electron-dense structure termed the deuterostome. How centriole number is regulated in these cells and the mechanism by which the deuterosome templates nascent centrioles is still poorly understood. Here, we describe methods for regulating MCC cell fate as well as for visualizing and manipulating centriole biogenesis. PMID:26175436

  13. Oil body biogenesis during Brassica napus embryogenesis.

    PubMed

    He, Yu-Qing; Wu, Yan

    2009-08-01

    Although the oil body is known to be an important membrane enclosed compartment for oil storage in seeds, we have little understanding about its biogenesis during embryogenesis. In the present study we investigated the oil body emergence and variations in Brassica napus cv. Topas. The results demonstrate that the oil bodies could be detected already at the heart stage, at the same time as the embryos began to turn green, and the starch grains accumulated in the chloroplast stroma. In comparison, we have studied the development of oil bodies between Arabidopsis thaliana wild type (Col) and the low-seed-oil mutant wrinkled1-3. We observed that the oil body development in the embryos of Col is similar to that of B. napus cv. Topas, and that the size of the oil bodies was obviously smaller in the embryos of wrinkled1-3. Our results suggest that the oil body biogenesis might be coupled with the embryo chloroplast. PMID:19686376

  14. Analysis of photosystem II biogenesis in cyanobacteria.

    PubMed

    Heinz, Steffen; Liauw, Pasqual; Nickelsen, Jörg; Nowaczyk, Marc

    2016-03-01

    Photosystem II (PSII), a large multisubunit membrane protein complex found in the thylakoid membranes of cyanobacteria, algae and plants, catalyzes light-driven oxygen evolution from water and reduction of plastoquinone. Biogenesis of PSII requires coordinated assembly of at least 20 protein subunits, as well as incorporation of various organic and inorganic cofactors. The stepwise assembly process is facilitated by numerous protein factors that have been identified in recent years. Further analysis of this process requires the development or refinement of specific methods for the identification of novel assembly factors and, in particular, elucidation of the unique role of each. Here we summarize current knowledge of PSII biogenesis in cyanobacteria, focusing primarily on the impact of methodological advances and innovations. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Conrad Mullineaux. PMID:26592144

  15. PPARα in lysosomal biogenesis: A perspective

    PubMed Central

    Ghosh, Arunava; Pahan, Kalipada

    2016-01-01

    Lysosomes are membrane-bound vesicles containing hydrolytic enzymes, ubiquitously present in all eukaryotic cells. Classically considered to be central to the cellular waste management machinery, recent studies revealed the role of lysosomes in a wide array of cellular processes like, degradation, cellular development, programmed cell death, secretion, plasma membrane repair, nutritional responses, and lipid metabolism. We recently studied the regulation of TFEB, considered to be the master regulator of lysosomal biogenesis, by activation of peroxisomal proliferator activated receptor α (PPARα), one of the key regulators of lipid metabolism. In this article, we discuss how the recent finding could be put in to perspective with the previous findings that relate lysosomal biogenesis to lipid metabolism, and comment on the possibility of a bi-directional interplay between these two distinct cellular processes upon activation of PPARα. PMID:26621249

  16. Enantiomeric Natural Products: Occurrence and Biogenesis**

    PubMed Central

    Finefield, Jennifer M.; Sherman, David H.; Kreitman, Martin; Williams, Robert M.

    2012-01-01

    In Nature, chiral natural products are usually produced in optically pure form; however, on occasion Nature is known to produce enantiomerically opposite metabolites. These enantiomeric natural products can arise in Nature from a single species, or from different genera and/or species. Extensive research has been carried out over the years in an attempt to understand the biogenesis of naturally occurring enantiomers, however, many fascinating puzzles and stereochemical anomalies still remain. PMID:22555867

  17. Structural Basis for the Rescue of Stalled Ribosomes: Structure of YaeJ Bound to the Ribosome

    SciTech Connect

    Gagnon, Matthieu G.; Seetharaman, Sai V.; Bulkley, David; Steitz, Thomas A.

    2012-06-19

    In bacteria, the hybrid transfer-messenger RNA (tmRNA) rescues ribosomes stalled on defective messenger RNAs (mRNAs). However, certain gram-negative bacteria have evolved proteins that are capable of rescuing stalled ribosomes in a tmRNA-independent manner. Here, we report a 3.2 angstrom-resolution crystal structure of the rescue factor YaeJ bound to the Thermus thermophilus 70S ribosome in complex with the initiator tRNA{sub i}{sup fMet} and a short mRNA. The structure reveals that the C-terminal tail of YaeJ functions as a sensor to discriminate between stalled and actively translating ribosomes by binding in the mRNA entry channel downstream of the A site between the head and shoulder of the 30S subunit. This allows the N-terminal globular domain to sample different conformations, so that its conserved GGQ motif is optimally positioned to catalyze the hydrolysis of peptidyl-tRNA. This structure gives insights into the mechanism of YaeJ function and provides a basis for understanding how it rescues stalled ribosomes.

  18. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  19. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  20. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  1. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  2. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  3. Ribosomal small subunit domains radiate from a central core.

    PubMed

    Gulen, Burak; Petrov, Anton S; Okafor, C Denise; Vander Wood, Drew; O'Neill, Eric B; Hud, Nicholas V; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2'OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  4. Ribosomal small subunit domains radiate from a central core

    NASA Astrophysics Data System (ADS)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  5. Ribosomal small subunit domains radiate from a central core

    PubMed Central

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  6. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  7. GABP Transcription Factor (Nuclear Respiratory Factor 2) Is Required for Mitochondrial Biogenesis

    PubMed Central

    Yang, Zhong-Fa; Drumea, Karen; Mott, Stephanie; Wang, Junling

    2014-01-01

    Mitochondria are membrane-bound cytoplasmic organelles that serve as the major source of ATP production in eukaryotic cells. GABP (also known as nuclear respiratory factor 2) is a nuclear E26 transformation-specific transcription factor (ETS) that binds and activates mitochondrial genes that are required for electron transport and oxidative phosphorylation. We conditionally deleted Gabpa, the DNA-binding component of this transcription factor complex, from mouse embryonic fibroblasts (MEFs) to examine the role of Gabp in mitochondrial biogenesis, function, and gene expression. Gabpα loss modestly reduced mitochondrial mass, ATP production, oxygen consumption, and mitochondrial protein synthesis but did not alter mitochondrial morphology, membrane potential, apoptosis, or the expression of several genes that were previously reported to be GABP targets. However, the expression of Tfb1m, a methyltransferase that modifies ribosomal rRNA and is required for mitochondrial protein translation, was markedly reduced in Gabpα-null MEFs. We conclude that Gabp regulates Tfb1m expression and plays an essential, nonredundant role in mitochondrial biogenesis. PMID:24958105

  8. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  9. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  11. Ribosomes in the balance: structural equilibrium ensures translational fidelity and proper gene expression

    PubMed Central

    Musalgaonkar, Sharmishtha; Moomau, Christine A.; Dinman, Jonathan D.

    2014-01-01

    At equilibrium, empty ribosomes freely transit between the rotated and un-rotated states. In the cell, the binding of two translation elongation factors to the same general region of the ribosome stabilizes one state over the other. These stabilized states are resolved by expenditure of energy in the form of GTP hydrolysis. A prior study employing mutants of a late assembling peripheral ribosomal protein suggested that ribosome rotational status determines its affinity for elongation factors, and hence translational fidelity and gene expression. Here, mutants of the early assembling integral ribosomal protein uL2 are used to test the generality of this hypothesis. rRNA structure probing analyses reveal that mutations in the uL2 B7b bridge region shift the equilibrium toward the rotated state, propagating rRNA structural changes to all of the functional centers of ribosome. Structural disequilibrium unbalances ribosome biochemically: rotated ribosomes favor binding of the eEF2 translocase and disfavor that of the elongation ternary complex. This manifests as specific translational fidelity defects, impacting the expression of genes involved in telomere maintenance. A model is presented describing how cyclic intersubunit rotation ensures the unidirectionality of translational elongation, and how perturbation of rotational equilibrium affects specific aspects of translational fidelity and cellular gene expression. PMID:25389262

  12. Genome-Wide Screens in Saccharomyces cerevisiae Highlight a Role for Cardiolipin in Biogenesis of Mitochondrial Outer Membrane Multispan Proteins

    PubMed Central

    Sauerwald, Julia; Jores, Tobias; Eisenberg-Bord, Michal; Chuartzman, Silvia Gabriela

    2015-01-01

    A special group of mitochondrial outer membrane (MOM) proteins spans the membrane several times via multiple helical segments. Such multispan proteins are synthesized on cytosolic ribosomes before their targeting to mitochondria and insertion into the MOM. Previous work recognized the import receptor Tom70 and the mitochondrial import (MIM) complex, both residents of the MOM, as required for optimal biogenesis of these proteins. However, their involvement is not sufficient to explain either the entire import pathway or its regulation. To identify additional factors that are involved in the biogenesis of MOM multispan proteins, we performed complementary high-throughput visual and growth screens in Saccharomyces cerevisiae. Cardiolipin (CL) synthase (Crd1) appeared as a candidate in both screens. Our results indeed demonstrate lower steady-state levels of the multispan proteins Ugo1, Scm4, and Om14 in mitochondria from crd1Δ cells. Importantly, MOM single-span proteins were not affected by this mutation. Furthermore, organelles lacking Crd1 had a lower in vitro capacity to import newly synthesized Ugo1 and Scm4 molecules. Crd1, which is located in the mitochondrial inner membrane, condenses phosphatidylglycerol together with CDP-diacylglycerol to obtain de novo synthesized CL molecules. Hence, our findings suggest that CL is an important component in the biogenesis of MOM multispan proteins. PMID:26149385

  13. Peroxisome biogenesis in mammalian cells: The impact of genes and environment.

    PubMed

    Farr, Rebecca L; Lismont, Celien; Terlecky, Stanley R; Fransen, Marc

    2016-05-01

    The initiation and progression of many human diseases are mediated by a complex interplay of genetic, epigenetic, and environmental factors. As all diseases begin with an imbalance at the cellular level, it is essential to understand how various types of molecular aberrations, metabolic changes, and environmental stressors function as switching points in essential communication networks. In recent years, peroxisomes have emerged as important intracellular hubs for redox-, lipid-, inflammatory-, and nucleic acid-mediated signaling pathways. In this review, we focus on how nature and nurture modulate peroxisome biogenesis and function in mammalian cells. First, we review emerging evidence that changes in peroxisome activity can be linked to the epigenetic regulation of cell function. Next, we outline how defects in peroxisome biogenesis may directly impact cellular pathways involved in the development of disease. In addition, we discuss how changes in the cellular microenvironment can modulate peroxisome biogenesis and function. Finally, given the importance of peroxisome function in multiple aspects of health, disease, and aging, we highlight the need for more research in this still understudied field. PMID:26305119

  14. Human PEX1 is mutated in complementation group 1 of the peroxisome biogenesis disorders.

    PubMed

    Portsteffen, H; Beyer, A; Becker, E; Epplen, C; Pawlak, A; Kunau, W H; Dodt, G

    1997-12-01

    Human peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal-recessive disease caused by mutations in PEX genes that encode peroxins, proteins required for peroxisome biogenesis. These lethal diseases include Zellweger syndrome (ZS), neonatal adrenoleukodystrophy (NALD) and infantile Refsum's disease (IRD), three phenotypes now thought to represent a continuum of clinical features that are most severe in ZS, milder in NALD and least severe in IRD2. At least eleven PBD complementation groups have been identified by somatic-cell hybridization analysis compared to the eighteen PEX complementation groups that have been found in yeast. We have cloned the human PEX1 gene encoding a 147-kD member of the AAA protein family (ATPases associated with diverse cellular activities), which is the putative orthologue of Saccharomyces cerevisiae Pex1p (ScPex1p). Human PEX1 has been identified by computer-based 'homology probing' using the ScPex1p sequence to screen databases of expressed sequence tags (dbEST) for human cDNA clones. Expression of PEX1 rescued the cells from the biogenesis defect in human fibroblasts of complementation group 1 (CG1), the largest PBD complementation group. We show that PEX1 is mutated in CG1 patients. PMID:9398848

  15. Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili

    PubMed Central

    Wolfgang, Matthew; van Putten, Jos P.M.; Hayes, Stanley F.; Dorward, David; Koomey, Michael

    2000-01-01

    Type IV pili (Tfp) are a unique class of multifunctional surface organelles in Gram-negative bacteria, which play important roles in prokaryotic cell biology. Although components of the Tfp biogenesis machinery have been characterized, it is not clear how they function or interact. Using Neisseria gonorrhoeae as a model system, we report here that organelle biogenesis can be resolved into two discrete steps: fiber formation and translocation of the fiber to the cell surface. This conclusion is based on the capturing of an intermediate state in which the organelle is retained within the cell owing to the simultaneous absence of the secretin family member and biogenesis component PilQ and the twitching motility/pilus retraction protein PilT. This finding is the first demonstration of a specific translocation defect associated with loss of secretin function, and additionally confirms the role of PilT as a conditional antagonist of stable pilus fiber formation. These findings have important implications for Tfp structure and function and are pertinent to other membrane translocation systems that utilize a highly related set of components. PMID:11101514

  16. Acid sphingomyelinase modulates the autophagic process by controlling lysosomal biogenesis in Alzheimer’s disease

    PubMed Central

    Lee, Jong Kil; Jin, Hee Kyung; Park, Min Hee; Kim, Bo-ra; Lee, Phil Hyu; Nakauchi, Hiromitsu; Carter, Janet E.; He, Xingxuan; Schuchman, Edward H.

    2014-01-01

    In Alzheimer’s disease (AD), abnormal sphingolipid metabolism has been reported, although the pathogenic consequences of these changes have not been fully characterized. We show that acid sphingomyelinase (ASM) is increased in fibroblasts, brain, and/or plasma from patients with AD and in AD mice, leading to defective autophagic degradation due to lysosomal depletion. Partial genetic inhibition of ASM (ASM+/−) in a mouse model of familial AD (FAD; amyloid precursor protein [APP]/presenilin 1 [PS1]) ameliorated the autophagocytic defect by restoring lysosomal biogenesis, resulting in improved AD clinical and pathological findings, including reduction of amyloid-β (Aβ) deposition and improvement of memory impairment. Similar effects were noted after pharmacologic restoration of ASM to the normal range in APP/PS1 mice. Autophagic dysfunction in neurons derived from FAD patient induced pluripotent stem cells (iPSCs) was restored by partial ASM inhibition. Overall, these results reveal a novel mechanism of ASM pathogenesis in AD that leads to defective autophagy due to impaired lysosomal biogenesis and suggests that partial ASM inhibition is a potential new therapeutic intervention for the disease. PMID:25049335

  17. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    PubMed Central

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

    2016-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

  18. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq

    PubMed Central

    Smagin, Dmitry A.; Kovalenko, Irina L.; Galyamina, Anna G.; Bragin, Anatoly O.; Orlov, Yuriy L.; Kudryavtseva, Natalia N.

    2016-01-01

    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. There were no differentially expressed ribosomal genes in the ventral tegmental area, midbrain raphe nuclei, or striatum. This approach may be used to identify a pharmacological treatment of ribosome biogenesis abnormalities in the brain of patients with “ribosomopathies.” PMID:26839715

  19. Dysfunction in Ribosomal Gene Expression in the Hypothalamus and Hippocampus following Chronic Social Defeat Stress in Male Mice as Revealed by RNA-Seq.

    PubMed

    Smagin, Dmitry A; Kovalenko, Irina L; Galyamina, Anna G; Bragin, Anatoly O; Orlov, Yuriy L; Kudryavtseva, Natalia N

    2016-01-01

    Chronic social defeat stress leads to the development of anxiety- and depression-like states in male mice and is accompanied by numerous molecular changes in brain. The influence of 21-day period of social stress on ribosomal gene expression in five brain regions was studied using the RNA-Seq database. Most Rps, Rpl, Mprs, and Mprl genes were upregulated in the hypothalamus and downregulated in the hippocampus, which may indicate ribosomal dysfunction following chronic social defeat stress. There were no differentially expressed ribosomal genes in the ventral tegmental area, midbrain raphe nuclei, or striatum. This approach may be used to identify a pharmacological treatment of ribosome biogenesis abnormalities in the brain of patients with "ribosomopathies." PMID:26839715

  20. Target of Rapamycin Regulates Development and Ribosomal RNA Expression through Kinase Domain in Arabidopsis1[W][OA

    PubMed Central

    Ren, Maozhi; Qiu, Shuqing; Venglat, Prakash; Xiang, Daoquan; Feng, Li; Selvaraj, Gopalan; Datla, Raju

    2011-01-01

    Target of rapamycin (TOR) is a central regulator of cell growth, cell death, nutrition, starvation, hormone, and stress responses in diverse eukaryotes. However, very little is known about TOR signaling and the associated functional domains in plants. We have taken a genetic approach to dissect TOR functions in Arabidopsis (Arabidopsis thaliana) and report here that the kinase domain is essential for the role of TOR in embryogenesis and 45S rRNA expression. Twelve new T-DNA insertion mutants, spanning 14.2 kb of TOR-encoding genomic region, have been characterized. Nine of these share expression of defective kinase domain and embryo arrest at 16 to 32 cell stage. However, three T-DNA insertion lines affecting FATC domain displayed normal embryo development, indicating that FATC domain was dispensable in Arabidopsis. Genetic complementation showed that the TOR kinase domain alone in tor-10/tor-10 mutant background can rescue early embryo lethality and restore normal development. Overexpression of full-length TOR or kinase domain in Arabidopsis displayed developmental abnormalities in meristem, leaf, root, stem, flowering time, and senescence. We further show that TOR, especially the kinase domain, plays a role in ribosome biogenesis by activating 45S rRNA production. Of the six putative nuclear localization sequences in the kinase domain, nuclear localization sequence 6 was identified to confer TOR nuclear targeting in transient expression assays. Chromatin immunoprecipitation studies revealed that the HEAT repeat domain binds to 45S rRNA promoter and the 5′ external transcribed spacer elements motif. Together, these results show that TOR controls the embryogenesis, postembryonic development, and 45S rRNA production through its kinase domain in Arabidopsis. PMID:21266656

  1. Biogenesis, delivery, and function of extracellular RNA.

    PubMed

    Patton, James G; Franklin, Jeffrey L; Weaver, Alissa M; Vickers, Kasey; Zhang, Bing; Coffey, Robert J; Ansel, K Mark; Blelloch, Robert; Goga, Andrei; Huang, Bo; L'Etoille, Noelle; Raffai, Robert L; Lai, Charles P; Krichevsky, Anna M; Mateescu, Bogdan; Greiner, Vanille J; Hunter, Craig; Voinnet, Olivier; McManus, Michael T

    2015-01-01

    The Extracellular RNA (exRNA) Communication Consortium was launched by the National Institutes of Health to focus on the extent to which RNA might function in a non-cell-autonomous manner. With the availability of increasingly sensitive tools, small amounts of RNA can be detected in serum, plasma, and other bodily fluids. The exact mechanism(s) by which RNA can be secreted from cells and the mechanisms for the delivery and uptake by recipient cells remain to be determined. This review will summarize current knowledge about the biogenesis and delivery of exRNA and outline projects seeking to understand the functional impact of exRNA. PMID:26320939

  2. MicroRNA biogenesis pathways in cancer

    PubMed Central

    Lin, Shuibin; Gregory, Richard I.

    2016-01-01

    MicroRNAs (miRNAs) are critical regulators of gene expression. Amplification and overexpression of individual ‘oncomiRs’ or genetic loss of tumour suppressor miRNAs are associated with human cancer and are sufficient to drive tumorigenesis in mouse models. Furthermore, global miRNA depletion caused by genetic and epigenetic alterations in components of the miRNA biogenesis machinery is oncogenic. This, together with the recent identification of novel miRNA regulatory factors and pathways, highlights the importance of miRNA dysregulation in cancer. PMID:25998712

  3. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  4. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  5. Oligodendroglial membrane dynamics in relation to myelin biogenesis.

    PubMed

    Ozgen, Hande; Baron, Wia; Hoekstra, Dick; Kahya, Nicoletta

    2016-09-01

    In the central nervous system, oligodendrocytes synthesize a specialized membrane, the myelin membrane, which enwraps the axons in a multilamellar fashion to provide fast action potential conduction and to ensure axonal integrity. When compared to other membranes, the composition of myelin membranes is unique with its relatively high lipid to protein ratio. Their biogenesis is quite complex and requires a tight regulation of sequential events, which are deregulated in demyelinating diseases such as multiple sclerosis. To devise strategies for remedying such defects, it is crucial to understand molecular mechanisms that underlie myelin assembly and dynamics, including the ability of specific lipids to organize proteins and/or mediate protein-protein interactions in healthy versus diseased myelin membranes. The tight regulation of myelin membrane formation has been widely investigated with classical biochemical and cell biological techniques, both in vitro and in vivo. However, our knowledge about myelin membrane dynamics, such as membrane fluidity in conjunction with the movement/diffusion of proteins and lipids in the membrane and the specificity and role of distinct lipid-protein and protein-protein interactions, is limited. Here, we provide an overview of recent findings about the myelin structure in terms of myelin lipids, proteins and membrane microdomains. To give insight into myelin membrane dynamics, we will particularly highlight the application of model membranes and advanced biophysical techniques, i.e., approaches which clearly provide an added value to insight obtained by classical biochemical techniques. PMID:27141942

  6. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  7. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  8. Ribosomal protein L3: Gatekeeper to the A-site

    PubMed Central

    2007-01-01

    Summary Ribosomal protein L3 (L3) is an essential and indispensable component for formation of the peptidyltransferase center. Atomic resolution ribosome structures reveal two extensions of L3 protruding deep into the core of the large subunit. The central extension of L3 in Saccharomyces cerevisiae was investigated using a combination of molecular genetic, biochemical, chemical probing and molecular modeling methods. A reciprocal relationship between ribosomal affinity for eEF-1A stimulated binding of aa-tRNA and for eEF2 suggests that the central extension of L3 may function as an allosteric switch in coordinating binding of the elongation factors. Opening of the aa-tRNA accommodation corridor promoted resistance to the A-site specific translational inhibitor anisomycin, suggesting a competitive model for anisomycin resistance. These changes were also found to inhibit peptidyltransferase activity, stimulating programmed -1 ribosomal frameshifting, and promoting virus propagation defects. These studies provide a basis for deeper insight for rational design of small molecule antiviral therapeutics. PMID:17386264

  9. Maintaining Ancient Organelles: Mitochondrial Biogenesis and Maturation

    PubMed Central

    Vega, Rick B.; Horton, Julie L.; Kelly, Daniel P.

    2015-01-01

    The ultrastructure of the cardiac myocyte is remarkable for the high density of mitochondria tightly packed between sarcomeres. This structural organization is designed to provide energy in the form of ATP to fuel normal pump function of the heart. A complex system comprised of regulatory factors and energy metabolic machinery, encoded by both mitochondrial and nuclear genomes, is required for the coordinate control of cardiac mitochondrial biogenesis, maturation, and high-capacity function. This process involves the action of a transcriptional regulatory network that builds and maintains the mitochondrial genome, and to drive the expression of the energy transduction machinery. This finely tuned system is responsive to developmental and physiological cues as well as changes in fuel substrate availability. Deficiency of components critical for mitochondrial energy production frequently manifests as a cardiomyopathic phenotype, underscoring the requirement to maintain high respiration rates in the heart. Although a precise causative role is not clear, there is increasing evidence that perturbations in this regulatory system occur in the hypertrophied and failing heart. This review summarizes current knowledge and highlights recent advances in our understanding of the transcriptional regulatory factors and signaling networks that serve to regulate mitochondrial biogenesis and function in the mammalian heart. PMID:25999422

  10. Mitochondrial biogenesis is required for axonal growth.

    PubMed

    Vaarmann, Annika; Mandel, Merle; Zeb, Akbar; Wareski, Przemyslaw; Liiv, Joanna; Kuum, Malle; Antsov, Eva; Liiv, Mailis; Cagalinec, Michal; Choubey, Vinay; Kaasik, Allen

    2016-06-01

    During early development, neurons undergo complex morphological rearrangements to assemble into neuronal circuits and propagate signals. Rapid growth requires a large quantity of building materials, efficient intracellular transport and also a considerable amount of energy. To produce this energy, the neuron should first generate new mitochondria because the pre-existing mitochondria are unlikely to provide a sufficient acceleration in ATP production. Here, we demonstrate that mitochondrial biogenesis and ATP production are required for axonal growth and neuronal development in cultured rat cortical neurons. We also demonstrate that growth signals activating the CaMKKβ, LKB1-STRAD or TAK1 pathways also co-activate the AMPK-PGC-1α-NRF1 axis leading to the generation of new mitochondria to ensure energy for upcoming growth. In conclusion, our results suggest that neurons are capable of signalling for upcoming energy requirements. Earlier activation of mitochondrial biogenesis through these pathways will accelerate the generation of new mitochondria, thereby ensuring energy-producing capability for when other factors for axonal growth are synthesized. PMID:27122166

  11. Integrator mediates the biogenesis of enhancer RNAs

    PubMed Central

    Lai, Fan; Gardini, Alessandro; Zhang, Anda; Shiekhattar, Ramin

    2015-01-01

    Integrator is a multi-subunit complex stably associated with the C-terminal domain (CTD) of RNA polymerase II (RNAPII) 1. Integrator is endowed with a core catalytic RNA endonuclease activity, which is required for the 3′-end processing of non-polyadenylated RNAPII-dependent uridylate-rich small nuclear RNA genes (UsnRNAs) 1. Here, we examined the requirement of Integrator in the biogenesis of transcripts derived from distal regulatory elements (enhancers) involved in tissue- and temporal-specific regulation of gene expression 2–5. Integrator is recruited to enhancers and super-enhancers in a stimulus-dependent manner. Functional depletion of Integrator subunits diminishes the signal-dependent induction of eRNAs and abrogates the stimulus-induced enhancer-promoter chromatin looping. Global nuclear run-on and RNAPII profiling reveals a role for Integrator in 3′-end cleavage of eRNAs primary transcripts leading to transcriptional termination. In the absence of Integrator, eRNAs remain bound to RNAPII and their primary transcripts accumulates. Importantly, the induction of eRNAs and gene expression responsiveness requires the catalytic activity of Integrator complex. We propose a role for Integrator in biogenesis of eRNAs and enhancer function in metazoans. PMID:26308897

  12. Unravelling the mechanisms regulating muscle mitochondrial biogenesis.

    PubMed

    Hood, David A; Tryon, Liam D; Carter, Heather N; Kim, Yuho; Chen, Chris C W

    2016-08-01

    Skeletal muscle is a tissue with a low mitochondrial content under basal conditions, but it is responsive to acute increases in contractile activity patterns (i.e. exercise) which initiate the signalling of a compensatory response, leading to the biogenesis of mitochondria and improved organelle function. Exercise also promotes the degradation of poorly functioning mitochondria (i.e. mitophagy), thereby accelerating mitochondrial turnover, and preserving a pool of healthy organelles. In contrast, muscle disuse, as well as the aging process, are associated with reduced mitochondrial quality and quantity in muscle. This has strong negative implications for whole-body metabolic health and the preservation of muscle mass. A number of traditional, as well as novel regulatory pathways exist in muscle that control both biogenesis and mitophagy. Interestingly, although the ablation of single regulatory transcription factors within these pathways often leads to a reduction in the basal mitochondrial content of muscle, this can invariably be overcome with exercise, signifying that exercise activates a multitude of pathways which can respond to restore mitochondrial health. This knowledge, along with growing realization that pharmacological agents can also promote mitochondrial health independently of exercise, leads to an optimistic outlook in which the maintenance of mitochondrial and whole-body metabolic health can be achieved by taking advantage of the broad benefits of exercise, along with the potential specificity of drug action. PMID:27470593

  13. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  14. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  15. The ribosome quality control pathway can access nascent polypeptides stalled at the Sec61 translocon.

    PubMed

    von der Malsburg, Karina; Shao, Sichen; Hegde, Ramanujan S

    2015-06-15

    Cytosolic ribosomes that stall during translation are split into subunits, and nascent polypeptides trapped in the 60S subunit are ubiquitinated by the ribosome quality control (RQC) pathway. Whether the RQC pathway can also target stalls during cotranslational translocation into the ER is not known. Here we report that listerin and NEMF, core RQC components, are bound to translocon-engaged 60S subunits on native ER membranes. RQC recruitment to the ER in cultured cells is stimulated by translation stalling. Biochemical analyses demonstrated that translocon-targeted nascent polypeptides that subsequently stall are polyubiquitinated in 60S complexes. Ubiquitination at the translocon requires cytosolic exposure of the polypeptide at the ribosome-Sec61 junction. This exposure can result from either failed insertion into the Sec61 channel or partial backsliding of translocating nascent chains. Only Sec61-engaged nascent chains early in their biogenesis were relatively refractory to ubiquitination. Modeling based on recent 60S-RQC and 80S-Sec61 structures suggests that the E3 ligase listerin accesses nascent polypeptides via a gap in the ribosome-translocon junction near the Sec61 lateral gate. Thus the RQC pathway can target stalled translocation intermediates for degradation from the Sec61 channel. PMID:25877867

  16. Ribosomal protein L4 is a novel regulator of the MDM2-p53 loop

    PubMed Central

    He, Xia; Li, Yuhuang; Dai, Mu-Shui; Sun, Xiao-Xin

    2016-01-01

    A number of ribosomal proteins (RPs) have been shown to play a critical role in coordinating ribosome biogenesis with cell growth and proliferation by suppressing MDM2 to induce p53 activation. While how the MDM2-p53 pathway is regulated by multiple RPs is unclear, it remains to be interesting to identify additional RPs that can regulate this pathway. Here we report that ribosomal protein L4 (RPL4) directly interacts with MDM2 at the central acidic domain and suppresses MDM2-mediated p53 ubiquitination and degradation, leading to p53 stabilization and activation. Interestingly, overexpression of RPL4 promotes the binding of MDM2 to RPL5 and RPL11 and forms a complex with RPL5, RPL11 and MDM2 in cells. Conversely, knockdown of RPL4 also induces p53 levels and p53-dependent cell cycle arrest. This p53-dependent effect requires both RPL5 and RPL11, suggesting that depletion of RPL4 triggers ribosomal stress. Together, our results reveal that balanced levels of RPL4 are critical for normal cell growth and proliferation via regulating the MDM2-p53 loop. PMID:26908445

  17. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  18. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies.

    PubMed

    Amanatiadou, Elsa P; Papadopoulos, Giorgio L; Strouboulis, John; Vizirianakis, Ioannis S

    2015-01-01

    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  19. The role of ribosomal proteins in the regulation of cell proliferation, tumorigenesis, and genomic integrity.

    PubMed

    Xu, Xilong; Xiong, Xiufang; Sun, Yi

    2016-07-01

    Ribosomal proteins (RPs), the essential components of the ribosome, are a family of RNA-binding proteins, which play prime roles in ribosome biogenesis and protein translation. Recent studies revealed that RPs have additional extra-ribosomal functions, independent of protein biosynthesis, in regulation of diverse cellular processes. Here, we review recent advances in our understanding of how RPs regulate apoptosis, cell cycle arrest, cell proliferation, neoplastic transformation, cell migration and invasion, and tumorigenesis through both MDM2/p53-dependent and p53-independent mechanisms. We also discuss the roles of RPs in the maintenance of genome integrity via modulating DNA damage response and repair. We further discuss mutations or deletions at the somatic or germline levels of some RPs in human cancers as well as in patients of Diamond-Blackfan anemia and 5q- syndrome with high susceptibility to cancer development. Moreover, we discuss the potential clinical application, based upon abnormal levels of RPs, in biomarker development for early diagnosis and/or prognosis of certain human cancers. Finally, we discuss the pressing issues in the field as future perspectives for better understanding the roles of RPs in human cancers to eventually benefit human health. PMID:27294833

  20. Computational and Experimental Characterization of Ribosomal DNA and RNA G-Quadruplexes

    NASA Astrophysics Data System (ADS)

    Cho, Samuel

    DNA G-quadruplexes in human telomeres and gene promoters are being extensively studied for their role in controlling the growth of cancer cells. Recent studies strongly suggest that guanine (G)-rich genes encoding pre-ribosomal RNA (pre-rRNA) are a potential anticancer target through the inhibition of RNA polymerase I (Pol I) in ribosome biogenesis. However, the structures of ribosomal G-quadruplexes at atomic resolution are unknown, and very little biophysical characterization has been performed on them to date. Here, we have modeled two putative rDNA G-quadruplex structures, NUC 19P and NUC 23P, which we observe via circular dichroism (CD) spectroscopy to adopt a predominantly parallel topology, and their counterpart rRNA. To validate and refine the putative ribosomal G-quadruplex structures, we performed all-atom molecular dynamics (MD) simulations using the CHARMM36 force field in the presence and absence of stabilizing K + or Na + ions. We optimized the CHARMM36 force field K + parameters to be more consistent with quantum mechanical calculations (and the polarizable Drude model force field) so that the K + ion is predominantly in the G-quadruplex channel. Our MD simulations show that the rDNA G-quadruplex have more well-defined, predominantly parallel-topology structures than rRNA and NUC 19P is more structured than NUC 23P, which features extended loops. Our study demonstrates that they are both potential targets for the design of novel chemotherapeutics.

  1. Biogenesis of the preprotein translocase of the outer mitochondrial membrane: protein kinase A phosphorylates the precursor of Tom40 and impairs its import.

    PubMed

    Rao, Sanjana; Schmidt, Oliver; Harbauer, Angelika B; Schönfisch, Birgit; Guiard, Bernard; Pfanner, Nikolaus; Meisinger, Chris

    2012-05-01

    The preprotein translocase of the outer mitochondrial membrane (TOM) functions as the main entry gate for the import of nuclear-encoded proteins into mitochondria. The major subunits of the TOM complex are the three receptors Tom20, Tom22, and Tom70 and the central channel-forming protein Tom40. Cytosolic kinases have been shown to regulate the biogenesis and activity of the Tom receptors. Casein kinase 2 stimulates the biogenesis of Tom22 and Tom20, whereas protein kinase A (PKA) impairs the receptor function of Tom70. Here we report that PKA exerts an inhibitory effect on the biogenesis of the β-barrel protein Tom40. Tom40 is synthesized as precursor on cytosolic ribosomes and subsequently imported into mitochondria. We show that PKA phosphorylates the precursor of Tom40. The phosphorylated Tom40 precursor is impaired in import into mitochondria, whereas the nonphosphorylated precursor is efficiently imported. We conclude that PKA plays a dual role in the regulation of the TOM complex. Phosphorylation by PKA not only impairs the receptor activity of Tom70, but it also inhibits the biogenesis of the channel protein Tom40. PMID:22419819

  2. Neural stem cell transplantation enhances mitochondrial biogenesis in a transgenic mouse model of Alzheimer's disease-like pathology.

    PubMed

    Zhang, Wei; Gu, Guo-Jun; Shen, Xing; Zhang, Qi; Wang, Gang-Min; Wang, Pei-Jun

    2015-03-01

    Mitochondrial dysfunction, especially a defect in mitochondrial biogenesis, is an early and prominent feature of Alzheimer's disease (AD). Previous studies demonstrated that the number of mitochondria is significantly reduced in susceptible hippocampal neurons from AD patients. Neural stem cell (NSC) transplantation in AD-like mice can compensate for the neuronal loss resulting from amyloid-beta protein deposition. The effects of NSC transplantation on mitochondrial biogenesis and cognitive function in AD-like mice, however, are poorly understood. In this study, we injected NSCs or vehicle into 12-month-old amyloid precursor protein (APP)/PS1 transgenic mice, a mouse model of AD-like pathology. The effects of NSC transplantation on cognitive function, the amount of mitochondrial DNA, the expression of mitochondrial biogenesis factors and mitochondria-related proteins, and mitochondrial morphology were investigated. Our results show that in NSC-injected APP/PS1 (Tg-NSC) mice, the cognitive function, number of mitochondria, and expression of mitochondria-related proteins, specifically the mitochondrial fission factors (dynamin-related protein 1 [Drp1] and fission 1 [Fis1]) and the mitochondrial fusion factor optic atrophy 1 (OPA1), were significantly increased compared with those in age-matched vehicle-injected APP/PS1 (Tg-Veh) mice, whereas the expression of mitochondrial fusion factors mitofusion 1 (Mfn1) and Mfn2 was significantly decreased. These data indicate that NSC transplantation may enhance mitochondria biogenesis and further rescue cognitive deficits in AD-like mice. PMID:25582749

  3. Iron-sulfur cluster biogenesis in mammalian cells: new insights into the molecular mechanisms of cluster delivery

    PubMed Central

    Maio, Nunziata; Rouault, Tracey. A.

    2014-01-01

    Iron-sulfur (Fe-S) clusters are ancient, ubiquitous cofactors composed of iron and inorganic sulfur. The combination of the chemical reactivity of iron and sulfur, together with many variations of cluster composition, oxidation states and protein environments, enables Fe-S clusters to participate in numerous biological processes. Fe-S clusters are essential to redox catalysis in nitrogen fixation, mitochondrial respiration and photosynthesis, to regulatory sensing in key metabolic pathways (i. e. cellular iron homeostasis and oxidative stress response), and to the replication and maintenance of the nuclear genome. Fe-S cluster biogenesis is a multistep process that involves a complex sequence of catalyzed protein- protein interactions and coupled conformational changes between the components of several dedicated multimeric complexes. Intensive studies of the assembly process have clarified key points in the biogenesis of Fe-S proteins. However several critical questions still remain, such as: what is the role of frataxin? Why do some defects of Fe-S cluster biogenesis cause mitochondrial iron overload? How are specific Fe-S recipient proteins recognized in the process of Fe-S transfer? This review focuses on the basic steps of Fe-S cluster biogenesis, drawing attention to recent advances achieved on the identification of molecular features that guide selection of specific subsets of nascent Fe-S recipients by the cochaperone HSC20. Additionally, it outlines the distinctive phenotypes of human diseases due to mutations in the components of the basic pathway. PMID:25245479

  4. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  5. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  6. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  7. Insulin Granule Biogenesis, Trafficking and Exocytosis

    PubMed Central

    Hou, June Chunqiu; Min, Le; Pessin, Jeffrey E.

    2015-01-01

    It is becoming increasingly apparent that beta cell dysfunction resulting in abnormal insulin secretion is the essential element in the progression of patients from a state of impaired glucose tolerance to frank type 2 diabetes (Del Prato, 2003; Del Prato and Tiengo, 2001). Although extensive studies have examined the molecular, cellular and physiologic mechanisms of insulin granule biogenesis, sorting, and exocytosis the precise mechanisms controlling these processes and their dysregulation in the developed of diabetes remains an area of important investigation. We now know that insulin biogenesis initiates with the synthesis of preproinsulin in rough endoplastic reticulum and conversion of preproinsulin to proinsulin. Proinsulin begins to be packaged in the Trans-Golgi Network and is sorting into immature secretory granules. These immature granules become acidic via ATP-dependent proton pump and proinsulin undergoes proteolytic cleavage resulting the formation of insulin and C-peptide. During the granule maturation process, insulin is crystallized with zinc and calcium in the form of dense-core granules and unwanted cargo and membrane proteins undergo selective retrograde trafficking to either the constitutive trafficking pathway for secretion or to degradative pathways. The newly formed mature dense-core insulin granules populate two different intracellular pools, the readily releasable pools (RRP) and the reserved pool. These two distinct populations are thought to be responsible for the biphasic nature of insulin release in which the RRP granules are associated with the plasma membrane and undergo an acute calcium-dependent release accounting for first phase insulin secretion. In contrast, second phase insulin secretion requires the trafficking of the reserved granule pool to the plasma membrane. The initial trigger for insulin granule fusion with the plasma membrane is a rise in intracellular calcium and in the case of glucose stimulation results from

  8. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

    2014-01-01

    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  9. Galactolipid synthesis in chloroplast inner envelope is essential for proper thylakoid biogenesis, photosynthesis, and embryogenesis.

    PubMed

    Kobayashi, Koichi; Kondo, Maki; Fukuda, Hiroaki; Nishimura, Mikio; Ohta, Hiroyuki

    2007-10-23

    The biogenesis of thylakoid membranes, an indispensable event for the photoautotrophic growth of plants, requires a significant increase in the level of the unique thylakoid membrane lipid monogalactosyldiacylglycerol (MGDG), which constitutes the bulk of membrane lipids in chloroplasts. The final step in MGDG biosynthesis occurs in the plastid envelope and is catalyzed by MGDG synthase. Here we report the identification and characterization of an Arabidopsis mutant showing a complete defect in MGDG synthase 1. The mutant seeds germinated as small albinos only in the presence of sucrose. The seedlings lacked galactolipids and had disrupted photosynthetic membranes, leading to the complete impairment of photosynthetic ability and photoautotrophic growth. Moreover, invagination of the inner envelope, which is not seen in mature WT chloroplasts, was observed in the mutant, supporting an old hypothesis that envelope invagination is a major event in early chloroplast biogenesis. In addition to the defective seedling phenotype, embryo development was arrested in the mutant, although seeds with impaired embryos could germinate heterotrophically. These results demonstrate the importance of galactolipids not only in photosynthetic growth but also in embryogenesis. PMID:17940034

  10. Biogenesis of an Antitumor Antibiotic Protein, Neocarzonostatin

    PubMed Central

    Kudo, Kozo; Kikuchi, Mikio; Ishida, Nakao

    1972-01-01

    A study of the biogenesis of the antitumor protein antibiotic neocarzinostatin (NCS) was undertaken. The production of NCS, as well as the growth of Streptomyces carzinostaticus in a production medium, was sensitive to puromycin, chloramphenicol, and actinomycin D. However, when a 12-hr culture in production medium was transferred to a nongrowth medium consisting of a phosphate buffer with Mg2+ and Ca2+, rapid NCS synthesis and liberation occurred. NCS production in this medium was no longer sensitive to actinomycin D, but was sensitive to puromycin and chloramphenicol. The conversion of a precursor NCS to an active form was shown to occur in this medium. Subcellular analysis suggested that NCS synthesis occurred by a mechanism similar to that of protein synthesis by membrane polysomes. PMID:4670693

  11. ABCA1 and nascent HDL biogenesis.

    PubMed

    Wang, Shuhui; Smith, Jonathan D

    2014-01-01

    ABCA1 mediates the secretion of cellular free cholesterol and phospholipids to an extracellular acceptor, apolipoprotein AI, to form nascent high-density lipoprotein (HDL). Thus, ABCA1 is a key molecule in cholesterol homeostasis. Functional studies of certain Tangier disease mutations demonstrate that ABCA1 has multiple activities, including plasma membrane remodeling and apoAI binding to cell surface, which participate in nascent HDL biogenesis. Recent advances in our understanding of ABCA1 have demonstrated that ABCA1also mediates unfolding the N terminus of apoAI on the cell surface, followed by lipidation of apoAI and release of nascent HDL. Although ABCA1-mediated cholesterol efflux to apoAI can occur on the plasma membrane, the role of apoAI retroendocytosis during cholesterol efflux may play a role in macrophage foam cells that store cholesterol esters in cytoplasmic lipid droplets. PMID:25359426

  12. Cytochrome c biogenesis: the Ccm system.

    PubMed

    Sanders, Carsten; Turkarslan, Serdar; Lee, Dong-Woo; Daldal, Fevzi

    2010-06-01

    Cytochromes of c-type contain covalently attached hemes that are formed via thioether bonds between the vinyls of heme b and cysteines within C(1)XXC(2)H motifs of apocytochromes. In diverse organisms this post-translational modification relies on membrane-associated specific biogenesis proteins, referred to as cytochrome c maturation (Ccm) systems. A highly complex version of these systems, Ccm or System I, is found in Gram-negative bacteria, archaea and plant mitochondria. We describe emerging functional interactions between the Ccm components categorized into three conserved modules, and present a mechanistic view of the molecular basis of ubiquitous vinyl-2 approximately Cys(1) and vinyl-4 approximately Cys(2) heme b-apocytochrome thioether bonds in c-type cytochromes. PMID:20382024

  13. Biogenesis of Plant Prevacuolar Multivesicular Bodies.

    PubMed

    Cui, Yong; Shen, Jinbo; Gao, Caiji; Zhuang, Xiaohong; Wang, Junqi; Jiang, Liwen

    2016-06-01

    Plant prevacuolar compartments (PVCs), or multivesicular bodies (MVBs), are single membrane-bound organelles that play important roles in mediating protein trafficking to vacuoles in the secretory pathway. PVC/MVB also serves as a late endosome in the endocytic pathway in plants. Since the plant PVC was identified as an MVB more than 10 years ago, great progress has been made toward the understanding of PVC/MVB function and biogenesis in plants. In this review, we first summarize previous research into the identification and characterization of plant PVCs/MVBs, and then highlight recent advances on the mechanisms underlying intraluminal vesicle formation and maturation of plant PVCs/MVBs. In addition, we discuss the possible crosstalk that appears to occur between PVCs/MVBs and autophagosomes during autophagy in plants. Finally, we list some open questions and present future perspectives in this field. PMID:26836198

  14. Biogenesis of respiratory cytochromes in bacteria.

    PubMed Central

    Thöny-Meyer, L

    1997-01-01

    Biogenesis of respiratory cytochromes is defined as consisting of the posttranslational processes that are necessary to assemble apoprotein, heme, and sometimes additional cofactors into mature enzyme complexes with electron transfer functions. Different biochemical reactions take place during maturation: (i) targeting of the apoprotein to or through the cytoplasmic membrane to its subcellular destination; (ii) proteolytic processing of precursor forms; (iii) assembly of subunits in the membrane and oligomerization; (iv) translocation and/or modification of heme and covalent or noncovalent binding to the protein moiety; (v) transport, processing, and incorporation of other cofactors; and (vi) folding and stabilization of the protein. These steps are discussed for the maturation of different oxidoreductase complexes, and they are arranged in a linear pathway to best account for experimental findings from studies concerning cytochrome biogenesis. The example of the best-studied case, i.e., maturation of cytochrome c, appears to consist of a pathway that requires at least nine specific genes and more general cellular functions such as protein secretion or the control of the redox state in the periplasm. Covalent attachment of heme appears to be enzyme catalyzed and takes place in the periplasm after translocation of the precursor through the membrane. The genetic characterization and the putative biochemical functions of cytochrome c-specific maturation proteins suggest that they may be organized in a membrane-bound maturase complex. Formation of the multisubunit cytochrome bc, complex and several terminal oxidases of the bo3, bd, aa3, and cbb3 types is discussed in detail, and models for linear maturation pathways are proposed wherever possible. PMID:9293186

  15. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  16. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  17. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  18. Biogenesis of RNA Polymerases II and III Requires the Conserved GPN Small GTPases in Saccharomyces cerevisiae

    PubMed Central

    Minaker, Sean W.; Filiatrault, Megan C.; Ben-Aroya, Shay; Hieter, Philip; Stirling, Peter C.

    2013-01-01

    The GPN proteins are a poorly characterized and deeply evolutionarily conserved family of three paralogous small GTPases, Gpn1, 2, and 3. The founding member, GPN1/NPA3/XAB1, is proposed to function in nuclear import of RNA polymerase II along with a recently described protein called Iwr1. Here we show that the previously uncharacterized protein Gpn2 binds both Gpn3 and Npa3/Gpn1 and that temperature-sensitive alleles of Saccharomyces cerevisiae GPN2 and GPN3 exhibit genetic interactions with RNA polymerase II mutants, hypersensitivity to transcription inhibition, and defects in RNA polymerase II nuclear localization. Importantly, we identify previously unrecognized RNA polymerase III localization defects in GPN2, GPN3, and IWR1 mutant backgrounds but find no localization defects of unrelated nuclear proteins or of RNA polymerase I. Previously, it was unclear whether the GPN proteins and Iwr1 had overlapping function in RNA polymerase II assembly or import. In this study, we show that the nuclear import defect of iwr1Δ, but not the GPN2 or GPN3 mutant defects, is partially suppressed by fusion of a nuclear localization signal to the RNA polymerase II subunit Rpb3. These data, combined with strong genetic interactions between GPN2 and IWR1, suggest that the GPN proteins function upstream of Iwr1 in RNA polymerase II and III biogenesis. We propose that the three GPN proteins execute a common, and likely essential, function in RNA polymerase assembly and transport. PMID:23267056

  19. Impaired mitochondrial biogenesis is a common feature to myocardial hypertrophy and end-stage ischemic heart failure

    PubMed Central

    Pisano, Annalinda; Cerbelli, Bruna; Perli, Elena; Pelullo, Maria; Bargelli, Valentina; Preziuso, Carmela; Mancini, Massimiliano; He, Langping; Bates, Matthew GD; Lucena, Joaquin R; Della Monica, Paola Lilla; Familiari, Giuseppe; Petrozza, Vincenzo; Nediani, Chiara; Taylor, Robert W; d’Amati, Giulia; Giordano, Carla

    2016-01-01

    Mitochondrial (mt) DNA depletion and oxidative mtDNA damage have been implicated in the process of pathological cardiac remodeling. Whether these features are present in the early phase of maladaptive cardiac remodeling, that is, during compensated cardiac hypertrophy, is still unknown. We compared the morphologic and molecular features of mt biogenesis and markers of oxidative stress in human heart from adult subjects with compensated hypertrophic cardiomyopathy and heart failure. We have shown that mtDNA depletion is a constant feature of both conditions. A quantitative loss of mtDNA content was associated with significant down-regulation of selected modulators of mt biogenesis and decreased expression of proteins involved in mtDNA maintenance. Interestingly, mtDNA depletion characterized also the end-stage phase of cardiomyopathies due to a primary mtDNA defect. Oxidative stress damage was detected only in failing myocardium. PMID:26764143

  20. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

    PubMed

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

    2016-09-16

    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. PMID:27530925

  1. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  2. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  3. Dynamic periplasmic chaperone reservoir facilitates biogenesis of outer membrane proteins.

    PubMed

    Costello, Shawn M; Plummer, Ashlee M; Fleming, Patrick J; Fleming, Karen G

    2016-08-16

    Outer membrane protein (OMP) biogenesis is critical to bacterial physiology because the cellular envelope is vital to bacterial pathogenesis and antibiotic resistance. The process of OMP biogenesis has been studied in vivo, and each of its components has been studied in isolation in vitro. This work integrates parameters and observations from both in vivo and in vitro experiments into a holistic computational model termed "Outer Membrane Protein Biogenesis Model" (OMPBioM). We use OMPBioM to assess OMP biogenesis mathematically in a global manner. Using deterministic and stochastic methods, we are able to simulate OMP biogenesis under varying genetic conditions, each of which successfully replicates experimental observations. We observe that OMPs have a prolonged lifetime in the periplasm where an unfolded OMP makes, on average, hundreds of short-lived interactions with chaperones before folding into its native state. We find that some periplasmic chaperones function primarily as quality-control factors; this function complements the folding catalysis function of other chaperones. Additionally, the effective rate for the β-barrel assembly machinery complex necessary for physiological folding was found to be higher than has currently been observed in vitro. Overall, we find a finely tuned balance between thermodynamic and kinetic parameters maximizes OMP folding flux and minimizes aggregation and unnecessary degradation. In sum, OMPBioM provides a global view of OMP biogenesis that yields unique insights into this essential pathway. PMID:27482090

  4. Diabetes regulates mitochondrial biogenesis and fission in neurons

    PubMed Central

    Edwards, J.L.; Quattrini, A.; Lentz, S.I.; Figueroa-Romero, C.; Cerri, F.; Backus, C.; Hong, Y.; Feldman, E.L.

    2014-01-01

    Aims Normal mitochondrial (Mt) activity is a critical component of neuronal metabolism and function. Disruption of Mt activity by altered Mt fission and fusion is the root cause of both neurodegenerative disorders and Charcot-Marie-Tooth Type 2A inherited neuropathy. The current study addressed the role of Mt fission in the pathogenesis of diabetic neuropathy (DN). Methods Mt biogenesis and fission were assayed in both in vivo and in vitro models of DN. Gene, protein, mitochondrial DNA and ultrastructural analyses were used to assess Mt biogenesis and fission. Results Our data reveal increased Mt biogenesis in dorsal root ganglion (DRG) neurons from diabetic compared to non-diabetic mice. An essential step in Mt biogenesis is Mt fission, regulated by the Mt fission protein Drp1. Evaluation of in vivo diabetic neurons indicated small, fragmented Mt, suggesting increased fission. In vitro studies reveal short-term hyperglycemic exposure increased expression of Drp1. The influence of hyperglycemia-mediated Mt fission on cellular viability was evaluated by knockdown of Drp1. Knockdown of Drp1 resulted in decreased susceptibility to hyperglycemic damage. Conclusions We propose that: 1) Mt undergo biogenesis in response to hyperglycemia, but the increased biogenesis is insufficient to accommodate the metabolic load; 2) hyperglycemia causes an excess of Mt fission, creating small, damaged mitochondria; and 3) reduction of aberrant Mt fission increases neuronal survival and indicates an important role for the fission-fusion equilibrium in the pathogenesis of DN. PMID:19847394

  5. STA1, an Arabidopsis pre-mRNA processing factor 6 homolog, is a new player involved in miRNA biogenesis

    PubMed Central

    Ben Chaabane, Samir; Liu, Renyi; Chinnusamy, Viswanathan; Kwon, Yerim; Park, Joo-hyuk; Kim, Seo Yeon; Zhu, Jian-Kang; Yang, Seong Wook; Lee, Byeong-ha

    2013-01-01

    MicroRNAs (miRNAs) are small regulatory RNAs that have important regulatory roles in numerous developmental and metabolic processes in most eukaryotes. In Arabidopsis, DICER-LIKE1 (DCL1), HYPONASTIC LEAVES 1, SERRATE, HUA ENHANCER1 and HASTY are involved in processing of primary miRNAs (pri-miRNAs) to yield precursor miRNAs (pre-miRNAs) and eventually miRNAs. In addition to these components, mRNA cap-binding proteins, CBP80/ABA HYPERSENSITIVE1 and CBP20, also participate in miRNA biogenesis. Here, we show that STABILIZED1 (STA1), an Arabidopsis pre-mRNA processing factor 6 homolog, is also involved in the biogenesis of miRNAs. Similar to other miRNA biogenesis-defective mutants, sta1-1 accumulated significantly lower levels of mature miRNAs and concurrently higher levels of pri-miRNAs than wild type. The dramatic reductions of mature miRNAs were associated with the accumulation of their target gene transcripts and developmental defects. Furthermore, sta1-1 impaired splicing of intron containing pri-miRNAs and decreased transcript levels of DCL1. These results suggest that STA1 is involved in miRNA biogenesis directly by functioning in pri-miRNA splicing and indirectly by modulating the DCL1 transcript level. PMID:23268445

  6. Birth Defects

    MedlinePlus

    ... NICHD Research Information Clinical Trials Resources and Publications Birth Defects: Condition Information Skip sharing on social media links Share this: Page Content What are birth defects? Birth defects are structural or functional abnormalities present ...

  7. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  8. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  9. Analysis of the interactome of ribosomal protein S19 mutants.

    PubMed

    Caterino, Marianna; Aspesi, Anna; Pavesi, Elisa; Imperlini, Esther; Pagnozzi, Daniela; Ingenito, Laura; Santoro, Claudio; Dianzani, Irma; Ruoppolo, Margherita

    2014-10-01

    Diamond-Blackfan anemia, characterized by defective erythroid progenitor maturation, is caused in one-fourth of cases by mutations of ribosomal protein S19 (RPS19), which is a component of the ribosomal 40S subunit. Our previous work described proteins interacting with RPS19 with the aim to determine its functions. Here, two RPS19 mutants, R62W and R101H, have been selected to compare their interactomes versus the wild-type protein one, using the same functional proteomic approach that we employed to characterize RPS19 interactome. Mutations R62W and R101H impair RPS19 ability to associate with the ribosome. Results presented in this paper highlight the striking differences between the interactomes of wild-type and mutant RPS19 proteins. In particular, mutations abolish interactions with proteins having splicing, translational and helicase activity, thus confirming the role of RPS19 in RNA processing/metabolism and translational control. The data have been deposited to the ProteomeXchange with identifier PXD000640 (http://proteomecentral.proteomexchange.org/dataset/PXD000640). PMID:25069755

  10. Eukaryotic rpL10 drives ribosomal rotation

    PubMed Central

    Sulima, Sergey O.; Gülay, Suna P.; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W.; Dinman, Jonathan D.

    2014-01-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a ‘test drive’ before final maturation. PMID:24214990

  11. Eukaryotic rpL10 drives ribosomal rotation.

    PubMed

    Sulima, Sergey O; Gülay, Suna P; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W; Dinman, Jonathan D

    2014-02-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a 'test drive' before final maturation. PMID:24214990

  12. Repetitive elements regulate circular RNA biogenesis

    PubMed Central

    Wilusz, Jeremy E

    2015-01-01

    It was long assumed that eukaryotic precursor mRNAs (pre-mRNAs) are almost always spliced to generate a linear mRNA that is subsequently translated to produce a protein. However, it is now clear that thousands of protein-coding genes can be non-canonically spliced to produce circular noncoding RNAs, some of which are expressed at much higher levels than their associated linear mRNAs. How then does the splicing machinery decide whether to generate a linear mRNA or a circular RNA? Recent work has revealed that intronic repetitive elements, including sequences derived from transposons, are critical regulators of this decision. In most cases, circular RNA biogenesis appears to be initiated when complementary sequences from 2 different introns base pair to one another. This brings the splice sites from the intervening exon(s) into close proximity and facilitates the backsplicing event that generates the circular RNA. As many pre-mRNAs contain multiple intronic repeats, distinct circular transcripts can be produced depending on which repeats base pair to one another. Intronic repeats are thus critical regulatory sequences that control the functional output of their host genes, and potentially cause the functions of protein-coding genes to be highly divergent across species. PMID:26442181

  13. Biogenesis of pipecolic acid in Rhizoctonia leguminicola

    SciTech Connect

    Wickwire, B.M.

    1989-01-01

    This laboratory has long been interested in the biogenesis and biological properties of two indolizidine alkaloids, slaframine and swainsonine that are produced by the fungal parasite Rhizoctonia Leguminicola. Slaframine, (1S,6S,8aS-1 acetoxy-6-aminooctahydroindolizine) is a parasympathetic secretagogue, and swainsonine (1S,2R,8R,8aR-1,2,8-trihydroxyoctahydroindolizine) is a potent {alpha}-mannosidase inhibitor. This thesis concerns the initial steps of the biosynthesis of these alkaloids from lysine, via the common intermediate pipecolic acid, in whole cells and cell free enzyme systems of R. leguminicola. In confirmation of earlier work performed in this laboratory, L-lysine was used preferentially for pipecolate biosynthesis in R. Leguminicola. This pathway was supported by the finding that cell free extracts of R. leguminicola consistently converted L-(U-{sup 14}C)-lysine to three labelled metabolites: saccharopine, peak II, and pipecolic acid. Peak II was subsequently identified by appropriate proton NMR studies to be {delta}{sup 1}-piperideine-6-carboxylate, and the following pathway of pipecolic acid formation was postulated: L-lysine {yields} saccharopine {yields} {delta}{sup 1}-piperideine-6-carboxylate {yields} pipecolate. This pathway was confirmed by demonstration of each enzymatic step in vitro from purified radiolabeled substrates.

  14. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  15. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  16. Mitochondrial Ribosomal Protein L12 Is Required for POLRMT Stability and Exists as Two Forms Generated by Alternative Proteolysis during Import.

    PubMed

    Nouws, Jessica; Goswami, Arvind V; Bestwick, Megan; McCann, Beverly Jo; Surovtseva, Yulia V; Shadel, Gerald S

    2016-01-01

    To translate the 13 mtDNA-encoded mRNAs involved in oxidative phosphorylation (OXPHOS), mammalian mitochondria contain a dedicated set of ribosomes comprising rRNAs encoded by the mitochondrial genome and mitochondrial ribosomal proteins (MRPs) that are encoded by nuclear genes and imported into the matrix. In addition to their role in the ribosome, several MRPs have auxiliary functions or have been implicated in other cellular processes like cell cycle regulation and apoptosis. For example, we have shown that human MRPL12 binds and activates mitochondrial RNA polymerase (POLRMT), and hence has distinct functions in the ribosome and mtDNA transcription. Here we provide concrete evidence that there are two mature forms of mammalian MRPL12 that are generated by a two-step cleavage during import, involving efficient cleavage by mitochondrial processing protease and a second inefficient or regulated cleavage by mitochondrial intermediate protease. We also show that knock-down of MRPL12 by RNAi results in instability of POLRMT, but not other primary mitochondrial transcription components, and a corresponding decrease in mitochondrial transcription rates. Knock-down of MRPL10, the binding partner of MRPL12 in the ribosome, results in selective degradation of the mature long form of MRPL12, but has no effect on POLRMT. We propose that the two forms of MRPL12 are involved in homeostatic regulation of mitochondrial transcription and ribosome biogenesis that likely contribute to cell cycle, growth regulation, and longevity pathways to which MRPL12 has been linked. PMID:26586915

  17. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  18. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  19. Resistance exercise enhances the molecular signaling of mitochondrial biogenesis induced by endurance exercise in human skeletal muscle.

    PubMed

    Wang, Li; Mascher, Henrik; Psilander, Niklas; Blomstrand, Eva; Sahlin, Kent

    2011-11-01

    Combining endurance and strength training (concurrent training) may change the adaptation compared with single mode training. However, the site of interaction and the mechanisms are unclear. We have investigated the hypothesis that molecular signaling of mitochondrial biogenesis after endurance exercise is impaired by resistance exercise. Ten healthy subjects performed either only endurance exercise (E; 1-h cycling at ∼65% of maximal oxygen uptake), or endurance exercise followed by resistance exercise (ER; 1-h cycling + 6 sets of leg press at 70-80% of 1 repetition maximum) in a randomized cross-over design. Muscle biopsies were obtained before and after exercise (1 and 3 h postcycling). The mRNA of genes related to mitochondrial biogenesis [(peroxisome proliferator-activated receptor-γ coactivator-1 (PGC-1)α, PGC-1-related coactivator (PRC)] related coactivator) and substrate regulation (pyruvate dehydrogenase kinase-4) increased after both E and ER, but the mRNA levels were about twofold higher after ER (P < 0.01). Phosphorylation of proteins involved in the signaling cascade of protein synthesis [mammalian target of rapamycin (mTOR), ribosomal S6 kinase 1, and eukaryotic elongation factor 2] was altered after ER but not after E. Moreover, ER induced a larger increase in mRNA of genes associated with positive mTOR signaling (cMyc and Rheb). Phosphorylation of AMP-activated protein kinase, acetyl-CoA carboxylase, and Akt increased similarly at 1 h postcycling (P < 0.01) after both types of exercise. Contrary to our hypothesis, the results demonstrate that ER, performed after E, amplifies the adaptive signaling response of mitochondrial biogenesis compared with single-mode endurance exercise. The mechanism may relate to a cross talk between signaling pathways mediated by mTOR. The results suggest that concurrent training may be beneficial for the adaptation of muscle oxidative capacity. PMID:21836044

  20. l-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome

    PubMed Central

    Xu, Baoshan; Sowa, Nenja; Cardenas, Maria E.; Gerton, Jennifer L.

    2015-01-01

    Cohesinopathies are human genetic disorders that include Cornelia de Lange syndrome (CdLS) and Roberts syndrome (RBS) and are characterized by defects in limb and craniofacial development as well as mental retardation. The developmental phenotypes of CdLS and other cohesinopathies suggest that mutations in the structure and regulation of the cohesin complex during embryogenesis interfere with gene regulation. In a previous project, we showed that RBS was associated with highly fragmented nucleoli and defects in both ribosome biogenesis and protein translation. l-leucine stimulation of the mTOR pathway partially rescued translation in human RBS cells and development in zebrafish models of RBS. In this study, we investigate protein translation in zebrafish models of CdLS. Our results show that phosphorylation of RPS6 as well as 4E-binding protein 1 (4EBP1) was reduced in nipbla/b, rad21 and smc3-morphant embryos, a pattern indicating reduced translation. Moreover, protein biosynthesis and rRNA production were decreased in the cohesin morphant embryo cells. l-leucine partly rescued protein synthesis and rRNA production in the cohesin morphants and partially restored phosphorylation of RPS6 and 4EBP1. Concomitantly, l-leucine treatment partially improved cohesinopathy embryo development including the formation of craniofacial cartilage. Interestingly, we observed that alpha-ketoisocaproate (α-KIC), which is a keto derivative of leucine, also partially rescued the development of rad21 and nipbla/b morphants by boosting mTOR-dependent translation. In summary, our results suggest that cohesinopathies are caused in part by defective protein synthesis, and stimulation of the mTOR pathway through l-leucine or its metabolite α-KIC can partially rescue development in zebrafish models for CdLS. PMID:25378554

  1. L-leucine partially rescues translational and developmental defects associated with zebrafish models of Cornelia de Lange syndrome.

    PubMed

    Xu, Baoshan; Sowa, Nenja; Cardenas, Maria E; Gerton, Jennifer L

    2015-03-15

    Cohesinopathies are human genetic disorders that include Cornelia de Lange syndrome (CdLS) and Roberts syndrome (RBS) and are characterized by defects in limb and craniofacial development as well as mental retardation. The developmental phenotypes of CdLS and other cohesinopathies suggest that mutations in the structure and regulation of the cohesin complex during embryogenesis interfere with gene regulation. In a previous project, we showed that RBS was associated with highly fragmented nucleoli and defects in both ribosome biogenesis and protein translation. l-leucine stimulation of the mTOR pathway partially rescued translation in human RBS cells and development in zebrafish models of RBS. In this study, we investigate protein translation in zebrafish models of CdLS. Our results show that phosphorylation of RPS6 as well as 4E-binding protein 1 (4EBP1) was reduced in nipbla/b, rad21 and smc3-morphant embryos, a pattern indicating reduced translation. Moreover, protein biosynthesis and rRNA production were decreased in the cohesin morphant embryo cells. l-leucine partly rescued protein synthesis and rRNA production in the cohesin morphants and partially restored phosphorylation of RPS6 and 4EBP1. Concomitantly, l-leucine treatment partially improved cohesinopathy embryo development including the formation of craniofacial cartilage. Interestingly, we observed that alpha-ketoisocaproate (α-KIC), which is a keto derivative of leucine, also partially rescued the development of rad21 and nipbla/b morphants by boosting mTOR-dependent translation. In summary, our results suggest that cohesinopathies are caused in part by defective protein synthesis, and stimulation of the mTOR pathway through l-leucine or its metabolite α-KIC can partially rescue development in zebrafish models for CdLS. PMID:25378554

  2. Rab11a Is Essential for Lamellar Body Biogenesis in the Human Epidermis.

    PubMed

    Reynier, Marie; Allart, Sophie; Gaspard, Elise; Moga, Alain; Goudounèche, Dominique; Serre, Guy; Simon, Michel; Leprince, Corinne

    2016-06-01

    Most of the skin barrier function is attributable to the outermost layer of the epidermis, the stratum corneum, which is composed of flattened, anucleated cells called corneocytes surrounded by a lipid-enriched lamellar matrix. The composition of the stratum corneum is directly dependent on the underlying granular keratinocytes, which are the last living cells in the stratified epidermis. Many components present in the intercorneocyte matrix are delivered by the underlying granular keratinocytes through a secretion process dependent on lysosome-related organelles called lamellar bodies. Because of the importance of lamellar bodies in the maintenance of the epidermal barrier, the mechanisms regulating their biogenesis must be better understood. In this study, we show that the Rab11a GTPase is highly expressed in terminally differentiated keratinocytes, where it is partly associated with lamellar bodies. Rab11a silencing in three-dimensional in vitro reconstructed human epidermis induces a barrier defect, a decrease in the amount of lipid found in the stratum corneum, a reduction in lamellar body density and secretion areas in granular keratinocytes, and the mis-sorting of lamellar body cargoes being driven to the lysosomal degradation pathway. Our results highlight the importance of Rab11a-dependent regulation of lamellar body biogenesis in keratinocytes and consequently on epidermal barrier homeostasis. PMID:26872604

  3. ADAR1 Activation Drives Leukemia Stem Cell Self-Renewal by Impairing Let-7 Biogenesis.

    PubMed

    Zipeto, Maria Anna; Court, Angela C; Sadarangani, Anil; Delos Santos, Nathaniel P; Balaian, Larisa; Chun, Hye-Jung; Pineda, Gabriel; Morris, Sheldon R; Mason, Cayla N; Geron, Ifat; Barrett, Christian; Goff, Daniel J; Wall, Russell; Pellecchia, Maurizio; Minden, Mark; Frazer, Kelly A; Marra, Marco A; Crews, Leslie A; Jiang, Qingfei; Jamieson, Catriona H M

    2016-08-01

    Post-transcriptional adenosine-to-inosine RNA editing mediated by adenosine deaminase acting on RNA1 (ADAR1) promotes cancer progression and therapeutic resistance. However, ADAR1 editase-dependent mechanisms governing leukemia stem cell (LSC) generation have not been elucidated. In blast crisis chronic myeloid leukemia (BC CML), we show that increased JAK2 signaling and BCR-ABL1 amplification activate ADAR1. In a humanized BC CML mouse model, combined JAK2 and BCR-ABL1 inhibition prevents LSC self-renewal commensurate with ADAR1 downregulation. Lentiviral ADAR1 wild-type, but not an editing-defective ADAR1(E912A) mutant, induces self-renewal gene expression and impairs biogenesis of stem cell regulatory let-7 microRNAs. Combined RNA sequencing, qRT-PCR, CLIP-ADAR1, and pri-let-7 mutagenesis data suggest that ADAR1 promotes LSC generation via let-7 pri-microRNA editing and LIN28B upregulation. A small-molecule tool compound antagonizes ADAR1's effect on LSC self-renewal in stromal co-cultures and restores let-7 biogenesis. Thus, ADAR1 activation represents a unique therapeutic vulnerability in LSCs with active JAK2 signaling. PMID:27292188

  4. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  5. Birth Defects

    MedlinePlus

    A birth defect is a problem that happens while a baby is developing in the mother's body. Most birth defects happen during the first 3 months of ... in the United States is born with a birth defect. A birth defect may affect how the ...

  6. Biogenesis and architecture of arterivirus replication organelles.

    PubMed

    van der Hoeven, Barbara; Oudshoorn, Diede; Koster, Abraham J; Snijder, Eric J; Kikkert, Marjolein; Bárcena, Montserrat

    2016-07-15

    All eukaryotic positive-stranded RNA (+RNA) viruses appropriate host cell membranes and transform them into replication organelles, specialized micro-environments that are thought to support viral RNA synthesis. Arteriviruses (order Nidovirales) belong to the subset of +RNA viruses that induce double-membrane vesicles (DMVs), similar to the structures induced by e.g. coronaviruses, picornaviruses and hepatitis C virus. In the last years, electron tomography has revealed substantial differences between the structures induced by these different virus groups. Arterivirus-induced DMVs appear to be closed compartments that are continuous with endoplasmic reticulum membranes, thus forming an extensive reticulovesicular network (RVN) of intriguing complexity. This RVN is remarkably similar to that described for the distantly related coronaviruses (also order Nidovirales) and sets them apart from other DMV-inducing viruses analysed to date. We review here the current knowledge and open questions on arterivirus replication organelles and discuss them in the light of the latest studies on other DMV-inducing viruses, particularly coronaviruses. Using the equine arteritis virus (EAV) model system and electron tomography, we present new data regarding the biogenesis of arterivirus-induced DMVs and uncover numerous putative intermediates in DMV formation. We generated cell lines that can be induced to express specific EAV replicase proteins and showed that DMVs induced by the transmembrane proteins nsp2 and nsp3 form an RVN and are comparable in topology and architecture to those formed during viral infection. Co-expression of the third EAV transmembrane protein (nsp5), expressed as part of a self-cleaving polypeptide that mimics viral polyprotein processing in infected cells, led to the formation of DMVs whose size was more homogenous and closer to what is observed upon EAV infection, suggesting a regulatory role for nsp5 in modulating membrane curvature and DMV formation. PMID

  7. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes

    PubMed Central

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-01-01

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  8. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes.

    PubMed

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-12-15

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  9. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  10. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  11. The VPS33B-binding protein VPS16B is required in megakaryocyte and platelet α-granule biogenesis

    PubMed Central

    Urban, Denisa; Li, Ling; Christensen, Hilary; Pluthero, Fred G.; Chen, Shao Zun; Puhacz, Michael; Garg, Parvesh M.; Lanka, Kiran K.; Cummings, James J.; Kramer, Helmut; Wasmuth, James D.; Parkinson, John

    2012-01-01

    Patients with platelet α or dense δ-granule defects have bleeding problems. Although several proteins are known to be required for δ-granule development, less is known about α-granule biogenesis. Our previous work showed that the BEACH protein NBEAL2 and the Sec1/Munc18 protein VPS33B are required for α-granule biogenesis. Using a yeast two-hybrid screen, mass spectrometry, coimmunoprecipitation, and bioinformatics studies, we identified VPS16B as a VPS33B-binding protein. Immunoblotting confirmed VPS16B expression in various human tissues and cells including megakaryocytes and platelets, and also in megakaryocytic Dami cells. Characterization of platelets from a patient with arthrogryposis, renal dysfunction, and cholestasis (ARC) syndrome containing mutations in C14orf133 encoding VPS16B revealed pale-appearing platelets in blood films and electron microscopy revealed a complete absence of α-granules, whereas δ-granules were observed. Soluble and membrane-bound α-granule proteins were reduced or undetectable, suggesting that both releasable and membrane-bound α-granule constituents were absent. Immunofluorescence microscopy of Dami cells stably expressing GFP-VPS16B revealed that similar to VPS33B, GFP-VPS16B colocalized with markers of the trans-Golgi network, late endosomes and α-granules. We conclude that VPS16B, similar to its binding partner VPS33B, is essential for megakaryocyte and platelet α-granule biogenesis. PMID:23002115

  12. The VPS33B-binding protein VPS16B is required in megakaryocyte and platelet α-granule biogenesis.

    PubMed

    Urban, Denisa; Li, Ling; Christensen, Hilary; Pluthero, Fred G; Chen, Shao Zun; Puhacz, Michael; Garg, Parvesh M; Lanka, Kiran K; Cummings, James J; Kramer, Helmut; Wasmuth, James D; Parkinson, John; Kahr, Walter H A

    2012-12-13

    Patients with platelet α or dense δ-granule defects have bleeding problems. Although several proteins are known to be required for δ-granule development, less is known about α-granule biogenesis. Our previous work showed that the BEACH protein NBEAL2 and the Sec1/Munc18 protein VPS33B are required for α-granule biogenesis. Using a yeast two-hybrid screen, mass spectrometry, coimmunoprecipitation, and bioinformatics studies, we identified VPS16B as a VPS33B-binding protein. Immunoblotting confirmed VPS16B expression in various human tissues and cells including megakaryocytes and platelets, and also in megakaryocytic Dami cells. Characterization of platelets from a patient with arthrogryposis, renal dysfunction, and cholestasis (ARC) syndrome containing mutations in C14orf133 encoding VPS16B revealed pale-appearing platelets in blood films and electron microscopy revealed a complete absence of α-granules, whereas δ-granules were observed. Soluble and membrane-bound α-granule proteins were reduced or undetectable, suggesting that both releasable and membrane-bound α-granule constituents were absent. Immunofluorescence microscopy of Dami cells stably expressing GFP-VPS16B revealed that similar to VPS33B, GFP-VPS16B colocalized with markers of the trans-Golgi network, late endosomes and α-granules. We conclude that VPS16B, similar to its binding partner VPS33B, is essential for megakaryocyte and platelet α-granule biogenesis. PMID:23002115

  13. Structural insights into the function of a unique tandem GTPase EngA in bacterial ribosome assembly

    PubMed Central

    Zhang, Xiaoxiao; Yan, Kaige; Zhang, Yixiao; Li, Ningning; Ma, Chengying; Li, Zhifei; Zhang, Yanqing; Feng, Boya; Liu, Jing; Sun, Yadong; Xu, Yanji; Lei, Jianlin; Gao, Ning

    2014-01-01

    Many ribosome-interacting GTPases, with proposed functions in ribosome biogenesis, are also implicated in the cellular regulatory coupling between ribosome assembly process and various growth control pathways. EngA is an essential GTPase in bacteria, and intriguingly, it contains two consecutive GTPase domains (GD), being one-of-a-kind among all known GTPases. EngA is required for the 50S subunit maturation. However, its molecular role remains elusive. Here, we present the structure of EngA bound to the 50S subunit. Our data show that EngA binds to the peptidyl transferase center (PTC) and induces dramatic conformational changes on the 50S subunit, which virtually returns the 50S subunit to a state similar to that of the late-stage 50S assembly intermediates. Very interestingly, our data show that the two GDs exhibit a pseudo-two-fold symmetry in the 50S-bound conformation. Our results indicate that EngA recognizes certain forms of the 50S assembly intermediates, and likely facilitates the conformational maturation of the PTC of the 23S rRNA in a direct manner. Furthermore, in a broad context, our data also suggest that EngA might be a sensor of the cellular GTP/GDP ratio, endowed with multiple conformational states, in response to fluctuations in cellular nucleotide pool, to facilitate and regulate ribosome assembly. PMID:25389271

  14. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  15. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  16. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  17. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  18. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  19. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  20. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  1. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  2. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  3. Role of AAA(+)-proteins in peroxisome biogenesis and function.

    PubMed

    Grimm, Immanuel; Erdmann, Ralf; Girzalsky, Wolfgang

    2016-05-01

    Mutations in the PEX1 gene, which encodes a protein required for peroxisome biogenesis, are the most common cause of the Zellweger spectrum diseases. The recognition that Pex1p shares a conserved ATP-binding domain with p97 and NSF led to the discovery of the extended family of AAA+-type ATPases. So far, four AAA+-type ATPases are related to peroxisome function. Pex6p functions together with Pex1p in peroxisome biogenesis, ATAD1/Msp1p plays a role in membrane protein targeting and a member of the Lon-family of proteases is associated with peroxisomal quality control. This review summarizes the current knowledge on the AAA+-proteins involved in peroxisome biogenesis and function. PMID:26453804

  4. Rice RNA-dependent RNA polymerase 6 acts in small RNA biogenesis and spikelet development.

    PubMed

    Song, Xianwei; Wang, Dekai; Ma, Lijia; Chen, Zhiyu; Li, Pingchuan; Cui, Xia; Liu, Chunyan; Cao, Shouyun; Chu, Chengcai; Tao, Yuezhi; Cao, Xiaofeng

    2012-08-01

    Higher plants have evolved multiple RNA-dependent RNA polymerases (RDRs), which work with Dicer-like (DCL) proteins to produce different classes of small RNAs with specialized molecular functions. Here we report that OsRDR6, the rice (Oryza sativa L.) homolog of Arabidopsis RDR6, acts in the biogenesis of various types and sizes of small RNAs. We isolated a rice osrdr6-1 mutant, which was temperature sensitive and showed spikelet defects. This mutant displays reduced accumulation of tasiR-ARFs, the conserved trans-acting siRNAs (tasiRNAs) derived from the TAS3 locus, and ectopic expression of tasiR-ARF target genes, the Auxin Response Factors (including ARF2 and ARF3/ETTIN). The loss of tasiR-mediated repression of ARFs in osrdr6-1 can explain its morphological defects, as expression of two non-targeted ARF3 gene constructs (ARF3muts) in a wild-type background mimics the osrdr6 and osdcl4-1 mutant phenotypes. Small RNA high-throughput sequencing also reveals that besides tasiRNAs, 21-nucleotide (nt) phased small RNAs are also largely dependent on OsRDR6. Unexpectedly, we found that osrdr6-1 has a strong impact on the accumulation of 24-nt phased small RNAs, but not on unphased ones. Our work uncovers the key roles of OsRDR6 in small RNA biogenesis and directly illustrates the crucial functions of tasiR-ARFs in rice development. PMID:22443269

  5. Histidine Methylation of Yeast Ribosomal Protein Rpl3p Is Required for Proper 60S Subunit Assembly

    PubMed Central

    Al-Hadid, Qais; Roy, Kevin; Munroe, William; Dzialo, Maria C.; Chanfreau, Guillaume F.

    2014-01-01

    Histidine protein methylation is an unusual posttranslational modification. In the yeast Saccharomyces cerevisiae, the large ribosomal subunit protein Rpl3p is methylated at histidine 243, a residue that contacts the 25S rRNA near the P site. Rpl3p methylation is dependent upon the presence of Hpm1p, a candidate seven-beta-strand methyltransferase. In this study, we elucidated the biological activities of Hpm1p in vitro and in vivo. Amino acid analyses reveal that Hpm1p is responsible for all of the detectable protein histidine methylation in yeast. The modification is found on a polypeptide corresponding to the size of Rpl3p in ribosomes and in a nucleus-containing organelle fraction but was not detected in proteins of the ribosome-free cytosol fraction. In vitro assays demonstrate that Hpm1p has methyltransferase activity on ribosome-associated but not free Rpl3p, suggesting that its activity depends on interactions with ribosomal components. hpm1 null cells are defective in early rRNA processing, resulting in a deficiency of 60S subunits and translation initiation defects that are exacerbated in minimal medium. Cells lacking Hpm1p are resistant to cycloheximide and verrucarin A and have decreased translational fidelity. We propose that Hpm1p plays a role in the orchestration of the early assembly of the large ribosomal subunit and in faithful protein production. PMID:24865971

  6. Exercise induces mitochondrial biogenesis after brain ischemia in rats.

    PubMed

    Zhang, Q; Wu, Y; Zhang, P; Sha, H; Jia, J; Hu, Y; Zhu, J

    2012-03-15

    Stroke is a major cause of death worldwide. Previous studies have suggested both exercise and mitochondrial biogenesis contribute to improved post-ischemic recovery of brain function. However, the exact mechanism underlying this effect is unclear. On the other hand, the benefit of exercise-induced mitochondrial biogenesis in brain has been confirmed. In this study, we attempted to determine whether treadmill exercise induces functional improvement through regulation of mitochondrial biogenesis after brain ischemia. We subjected adult male rats to ischemia, followed by either treadmill exercise or non-exercise and analyzed the effect of exercise on the amount of mitochondrial DNA (mtDNA), expression of mitochondrial biogenesis factors, and mitochondrial protein. In the ischemia-exercise group, only peroxisome proliferator activated receptor coactivator-1 (PGC-1) expression was increased significantly after 3 days of treadmill training. However, after 7 days of training, the levels of mtDNA, nuclear respiratory factor 1, NRF-1, mitochondrial transcription factor A, TFAM, and the mitochondrial protein cytochrome C oxidase subunit IV (COXIV) and heat shock protein-60 (HSP60) also increased above levels observed in non-exercised ischemic animals. These changes followed with significant changes in behavioral scores and cerebral infarct volume. The results indicate that exercise can promote mitochondrial biogenesis after ischemic injury, which may serve as a novel component of exercise-induced repair mechanisms of the brain. Understanding the molecular basis for exercise-induced neuroprotection may be beneficial in the development of therapeutic approaches for brain recovery from the ischemic injury. Based upon our findings, stimulation or enhancement of mitochondrial biogenesis may prove a novel neuroprotective strategy in the future. PMID:22266265

  7. TIF-IA-Dependent Regulation of Ribosome Synthesis in Drosophila Muscle Is Required to Maintain Systemic Insulin Signaling and Larval Growth

    PubMed Central

    Ghosh, Abhishek; Rideout, Elizabeth J.; Grewal, Savraj S.

    2014-01-01

    The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis—a limiting step in ribosome biogenesis—via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs) from the brain and increased expression of Imp-L2—a secreted factor that binds and inhibits dILP activity—from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis. PMID:25356674

  8. Mitochondrial biogenesis and dynamics in the developing and diseased heart

    PubMed Central

    Dorn, Gerald W.; Vega, Rick B.; Kelly, Daniel P.

    2015-01-01

    The mitochondrion is a complex organelle that serves essential roles in energy transduction, ATP production, and a myriad of cellular signaling events. A finely tuned regulatory network orchestrates the biogenesis, maintenance, and turnover of mitochondria. The high-capacity mitochondrial system in the heart is regulated in a dynamic way to generate and consume enormous amounts of ATP in order to support the constant pumping function in the context of changing energy demands. This review describes the regulatory circuitry and downstream events involved in mitochondrial biogenesis and its coordination with mitochondrial dynamics in developing and diseased hearts. PMID:26443844

  9. Transmembrane segments form tertiary hairpins in the folding vestibule of the ribosome.

    PubMed

    Tu, Liwei; Khanna, Pooja; Deutsch, Carol

    2014-01-01

    Folding of membrane proteins begins in the ribosome as the peptide is elongated. During this process, the nascent peptide navigates along 100Å of tunnel from the peptidyltransferase center to the exit port. Proximal to the exit port is a "folding vestibule" that permits the nascent peptide to compact and explore conformational space for potential tertiary folding partners. The latter occurs for cytosolic subdomains but has not yet been shown for transmembrane segments. We now demonstrate, using an accessibility assay and an improved intramolecular crosslinking assay, that the helical transmembrane S3b-S4 hairpin ("paddle") of a voltage-gated potassium (Kv) channel, a critical region of the Kv voltage sensor, forms in the vestibule. S3-S4 hairpin interactions are detected at an early stage of Kv biogenesis. Moreover, this vestibule hairpin is consistent with a closed-state conformation of the Kv channel in the plasma membrane. PMID:24055377

  10. Transmembrane Segments Form Tertiary Hairpins in the Folding Vestibule of the Ribosome.

    PubMed Central

    Tu, LiWei; Khanna, Pooja; Deutsch, Carol

    2013-01-01

    Folding of membrane proteins begins in the ribosome as the peptide is elongated. During this process, the nascent peptide navigates along 100 Å of tunnel from the peptidyltransferase center to the exit port. Proximal to the exit port is a ‘folding vestibule’ that permits the nascent peptide to compact and explore conformational space for potential tertiary folding partners. The latter occurs for cytosolic subdomains, but has not yet been shown for transmembrane segments. We now demonstrate, using an accessibility assay and an improved, intramolecular crosslinking assay, that the helical transmembrane S3b-S4 hairpin (‘paddle’) of a voltage-gated potassium (Kv) channel, a critical region of the Kv voltage sensor, forms in the vestibule. S3-S4 hairpin interactions are detected at an early stage of Kv biogenesis. Moreover, this vestibule hairpin is consistent with a closed-state conformation of the Kv channel in the plasma membrane. PMID:24055377

  11. The global translation profile in a ribosomal protein mutant resembles that of an eIF3 mutant

    PubMed Central

    2013-01-01

    Background Genome-wide assays performed in Arabidopsis and other organisms have revealed that the translation status of mRNAs responds dramatically to different environmental stresses and genetic lesions in the translation apparatus. To identify additional features of the global landscape of translational control, we used microarray analysis of polysomal as well as non-polysomal mRNAs to examine the defects in translation in a poly(A) binding protein mutant, pab2 pab8, as well as in a mutant of a large ribosomal subunit protein, rpl24b/shortvalve1. Results The mutation of RPL24B stimulated the ribosome occupancy of mRNAs for nuclear encoded ribosomal proteins. Detailed analysis yielded new insights into the translational regulon containing the ribosomal protein mRNAs. First, the ribosome occupancy defects in the rpl24b mutant partially overlapped with those in a previously analyzed initiation factor mutant, eif3h. Second, a group of mRNAs with incomplete coding sequences appeared to be uncoupled from the regulon, since their dependence on RPL24B differed from regular mRNAs. Third, different sister paralogs of the ribosomal proteins differed in their translation state in the wild-type. Some sister paralogs also differed in their response to the rpl24b mutation. In contrast to rpl24b, the pab2 pab8 mutant revealed few gene specific translational defects, but a group of seed storage protein mRNAs were stimulated in their ribosome occupancy. In the course of this work, while optimizing the statistical analysis of ribosome occupancy data, we collected 12 biological replicates of translation states from wild-type seedlings. We defined 20% of mRNAs as having a high variance in their translation state. Many of these mRNAs were functionally associated with responses to the environment, suggesting that subtle variation in the environmental conditions is sensed by plants and transduced to affect the translational efficiency of hundreds of mRNAs. Conclusions These data

  12. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  13. Protein L5 is crucial for in vivo assembly of the bacterial 50S ribosomal subunit central protuberance

    PubMed Central

    Korepanov, Alexey P.; Korobeinikova, Anna V.; Shestakov, Sergey A.; Garber, Maria B.; Gongadze, George M.

    2012-01-01

    In the present work, ribosomes assembled in bacterial cells in the absence of essential ribosomal protein L5 were obtained. After arresting L5 synthesis, Escherichia coli cells divide a limited number of times. During this time, accumulation of defective large ribosomal subunits occurs. These 45S particles lack most of the central protuberance (CP) components (5S rRNA and proteins L5, L16, L18, L25, L27, L31, L33 and L35) and are not able to associate with the small ribosomal subunit. At the same time, 5S rRNA is found in the cytoplasm in complex with ribosomal proteins L18 and L25 at quantities equal to the amount of ribosomes. Thus, it is the first demonstration that protein L5 plays a key role in formation of the CP during assembly of the large ribosomal subunit in the bacterial cell. A possible model for the CP assembly in vivo is discussed in view of the data obtained. PMID:22821559

  14. Alterations in skeletal muscle indicators of mitochondrial structure and biogenesis in patients with type 2 diabetes and heart failure: effects of epicatechin rich cocoa.

    PubMed

    Taub, Pam R; Ramirez-Sanchez, Israel; Ciaraldi, Theodore P; Perkins, Guy; Murphy, Anne N; Naviaux, Robert; Hogan, Michael; Maisel, Alan S; Henry, Robert R; Ceballos, Guillermo; Villarreal, Francisco

    2012-02-01

    (-)-Epicatechin (Epi), a flavanol in cacao stimulates mitochondrial volume and cristae density and protein markers of skeletal muscle (SkM) mitochondrial biogenesis in mice. Type 2 diabetes mellitus (DM2) and heart failure (HF) are diseases associated with defects in SkM mitochondrial structure/function. A study was implemented to assess perturbations and to determine the effects of Epi-rich cocoa in SkM mitochondrial structure and mediators of biogenesis. Five patients with DM2 and stage II/III HF consumed dark chocolate and a beverage containing approximately 100 mg of Epi per day for 3 months. We assessed changes in protein and/or activity levels of oxidative phosphorylation proteins, porin, mitofilin, nNOS, nitric oxide, cGMP, SIRT1, PGC1α, Tfam, and mitochondria volume and cristae abundance by electron microscopy from SkM. Apparent major losses in normal mitochondria structure were observed before treatment. Epi-rich cocoa increased protein and/or activity of mediators of biogenesis and cristae abundance while not changing mitochondrial volume density. Epi-rich cocoa treatment improves SkM mitochondrial structure and in an orchestrated manner, increases molecular markers of mitochondrial biogenesis resulting in enhanced cristae density. Future controlled studies are warranted using Epi-rich cocoa (or pure Epi) to translate improved mitochondrial structure into enhanced cardiac and/or SkM muscle function. PMID:22376256

  15. Effects of base change mutations within an Escherichia coli ribosomal RNA leader region on rRNA maturation and ribosome formation

    PubMed Central

    Schäferkordt, Jan; Wagner, Rolf

    2001-01-01

    The effects of base change mutations in a highly conserved sequence (boxC) within the leader of bacterial ribosomal RNAs (rRNAs) was studied. The boxC sequence preceding the 16S rRNA structural gene constitutes part of the RNase III processing site, one of the first cleavage sites on the pathway to mature 16S rRNA. Moreover, rRNA leader sequences facilitate correct 16S rRNA folding, thereby assisting ribosomal subunit formation. Mutations in boxC cause cold sensitivity and result in 16S rRNA and 30S subunit deficiency. Strains in which all rRNA operons are replaced by mutant transcription units are viable. Thermodynamic studies by temperature gradient gel electrophoresis reveal that mutant transcripts have a different, less ordered structure. In addition, RNA secondary structure differences between mutant and wild-type transcripts were determined by chemical and enzymatic probing. Differences are found in the leader RNA sequence itself but also in structurally important regions of the mature 16S rRNA. A minor fraction of the rRNA transcripts from mutant operons is not processed by RNase III, resulting in a significantly extended precursor half-life compared to the wild-type. The boxC mutations also give rise to a new aberrant degradation product of 16S rRNA. This intermediate cannot be detected in strains lacking RNase III. Together the results indicate that the boxC sequence, although important for RNase III processing, is likely to serve additional functions by facilitating correct formation of the mature 16S rRNA structure. They also suggest that quality control steps are acting during ribosome biogenesis. PMID:11504877

  16. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  17. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  18. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  19. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  20. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  1. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  2. Fe/S protein biogenesis in trypanosomes - A review.

    PubMed

    Lukeš, Julius; Basu, Somsuvro

    2015-06-01

    Trypanosoma brucei, the causative agent of the African sleeping sickness of humans, and other kinetoplastid flagellates belong to the eukarytotic supergroup Excavata. This early-branching model protist is known for a broad range of unique features. As it is amenable to most techniques of forward and reverse genetics, T. brucei was subject to several studies of its iron-sulfur (Fe/S) protein biogenesis and thus represents the best studied excavate eukaryote. Here we review what is known about the Fe/S protein biogenesis of T. brucei, and focus especially on the comparative and evolutionary interesting aspects. We also explore the connections between the well-known and quite conserved ISC and CIA machineries and the tRNA thiolation pathway. Moreover, the Fe/S cluster protein biogenesis is dissected in the procyclic stage of T. brucei which has an active mitochondrion, as well as in its pathogenic bloodstream stage with a metabolically repressed organelle. This article is part of a Special Issue entitled: Fe/S proteins: Analysis, structure, function, biogenesis and diseases. PMID:25196712

  3. Germ plasm biogenesis –an Oskar-centric perspective

    PubMed Central

    Lehmann, Ruth

    2016-01-01

    Germ granules are the hallmark of all germ cells. These membrane-less, electron-dense structures were first observed over 100 years ago. Today, their role in regulating and processing transcripts critical for the establishment, maintenance and protection of germ cells is well-established and pathways outlining the biochemical mechanisms and physical properties associated with their biogenesis are emerging. PMID:26970648

  4. Targeting mitochondrial biogenesis to overcome drug resistance to MAPK inhibitors

    PubMed Central

    Zhang, Gao; Frederick, Dennie T.; Wu, Lawrence; Wei, Zhi; Krepler, Clemens; Srinivasan, Satish; Chae, Young Chan; Xu, Xiaowei; Choi, Harry; Dimwamwa, Elaida; Shannan, Batool; Basu, Devraj; Zhang, Dongmei; Guha, Manti; Xiao, Min; Randell, Sergio; Sproesser, Katrin; Xu, Wei; Liu, Jephrey; Karakousis, Giorgos C.; Schuchter, Lynn M.; Gangadhar, Tara C.; Amaravadi, Ravi K.; Gu, Mengnan; Xu, Caiyue; Ghosh, Abheek; Xu, Weiting; Tian, Tian; Zhang, Jie; Zha, Shijie; Brafford, Patricia; Weeraratna, Ashani; Davies, Michael A.; Wargo, Jennifer A.; Avadhani, Narayan G.; Lu, Yiling; Mills, Gordon B.; Altieri, Dario C.; Flaherty, Keith T.

    2016-01-01

    Targeting multiple components of the MAPK pathway can prolong the survival of patients with BRAFV600E melanoma. This approach is not curative, as some BRAF-mutated melanoma cells are intrinsically resistant to MAPK inhibitors (MAPKi). At the systemic level, our knowledge of how signaling pathways underlie drug resistance needs to be further expanded. Here, we have shown that intrinsically resistant BRAF-mutated melanoma cells with a low basal level of mitochondrial biogenesis depend on this process to survive MAPKi. Intrinsically resistant cells exploited an integrated stress response, exhibited an increase in mitochondrial DNA content, and required oxidative phosphorylation to meet their bioenergetic needs. We determined that intrinsically resistant cells rely on the genes encoding TFAM, which controls mitochondrial genome replication and transcription, and TRAP1, which regulates mitochondrial protein folding. Therefore, we targeted mitochondrial biogenesis with a mitochondrium-targeted, small-molecule HSP90 inhibitor (Gamitrinib), which eradicated intrinsically resistant cells and augmented the efficacy of MAPKi by inducing mitochondrial dysfunction and inhibiting tumor bioenergetics. A subset of tumor biopsies from patients with disease progression despite MAPKi treatment showed increased mitochondrial biogenesis and tumor bioenergetics. A subset of acquired drug-resistant melanoma cell lines was sensitive to Gamitrinib. Our study establishes mitochondrial biogenesis, coupled with aberrant tumor bioenergetics, as a potential therapy escape mechanism and paves the way for a rationale-based combinatorial strategy to improve the efficacy of MAPKi. PMID:27043285

  5. Folding and Biogenesis of Mitochondrial Small Tim Proteins

    PubMed Central

    Ceh-Pavia, Efrain; Spiller, Michael P.; Lu, Hui

    2013-01-01

    Correct and timely folding is critical to the function of all proteins. The importance of this is illustrated in the biogenesis of the mitochondrial intermembrane space (IMS) “small Tim” proteins. Biogenesis of the small Tim proteins is regulated by dedicated systems or pathways, beginning with synthesis in the cytosol and ending with assembly of individually folded proteins into functional complexes in the mitochondrial IMS. The process is mostly centered on regulating the redox states of the conserved cysteine residues: oxidative folding is crucial for protein function in the IMS, but oxidized (disulfide bonded) proteins cannot be imported into mitochondria. How the redox-sensitive small Tim precursor proteins are maintained in a reduced, import-competent form in the cytosol is not well understood. Recent studies suggest that zinc and the cytosolic thioredoxin system play a role in the biogenesis of these proteins. In the IMS, the mitochondrial import and assembly (MIA) pathway catalyzes both import into the IMS and oxidative folding of the small Tim proteins. Finally, assembly of the small Tim complexes is a multistep process driven by electrostatic and hydrophobic interactions; however, the chaperone function of the complex might require destabilization of these interactions to accommodate the substrate. Here, we review how folding of the small Tim proteins is regulated during their biogenesis, from maintenance of the unfolded precursors in the cytosol, to their import, oxidative folding, complex assembly and function in the IMS. PMID:23945562

  6. Targeting mitochondrial biogenesis to overcome drug resistance to MAPK inhibitors.

    PubMed

    Zhang, Gao; Frederick, Dennie T; Wu, Lawrence; Wei, Zhi; Krepler, Clemens; Srinivasan, Satish; Chae, Young Chan; Xu, Xiaowei; Choi, Harry; Dimwamwa, Elaida; Ope, Omotayo; Shannan, Batool; Basu, Devraj; Zhang, Dongmei; Guha, Manti; Xiao, Min; Randell, Sergio; Sproesser, Katrin; Xu, Wei; Liu, Jephrey; Karakousis, Giorgos C; Schuchter, Lynn M; Gangadhar, Tara C; Amaravadi, Ravi K; Gu, Mengnan; Xu, Caiyue; Ghosh, Abheek; Xu, Weiting; Tian, Tian; Zhang, Jie; Zha, Shijie; Liu, Qin; Brafford, Patricia; Weeraratna, Ashani; Davies, Michael A; Wargo, Jennifer A; Avadhani, Narayan G; Lu, Yiling; Mills, Gordon B; Altieri, Dario C; Flaherty, Keith T; Herlyn, Meenhard

    2016-05-01

    Targeting multiple components of the MAPK pathway can prolong the survival of patients with BRAFV600E melanoma. This approach is not curative, as some BRAF-mutated melanoma cells are intrinsically resistant to MAPK inhibitors (MAPKi). At the systemic level, our knowledge of how signaling pathways underlie drug resistance needs to be further expanded. Here, we have shown that intrinsically resistant BRAF-mutated melanoma cells with a low basal level of mitochondrial biogenesis depend on this process to survive MAPKi. Intrinsically resistant cells exploited an integrated stress response, exhibited an increase in mitochondrial DNA content, and required oxidative phosphorylation to meet their bioenergetic needs. We determined that intrinsically resistant cells rely on the genes encoding TFAM, which controls mitochondrial genome replication and transcription, and TRAP1, which regulates mitochondrial protein folding. Therefore, we targeted mitochondrial biogenesis with a mitochondrium-targeted, small-molecule HSP90 inhibitor (Gamitrinib), which eradicated intrinsically resistant cells and augmented the efficacy of MAPKi by inducing mitochondrial dysfunction and inhibiting tumor bioenergetics. A subset of tumor biopsies from patients with disease progression despite MAPKi treatment showed increased mitochondrial biogenesis and tumor bioenergetics. A subset of acquired drug-resistant melanoma cell lines was sensitive to Gamitrinib. Our study establishes mitochondrial biogenesis, coupled with aberrant tumor bioenergetics, as a potential therapy escape mechanism and paves the way for a rationale-based combinatorial strategy to improve the efficacy of MAPKi. PMID:27043285

  7. Peroxisome Biogenesis Disorders: Biological, Clinical and Pathophysiological Perspectives

    ERIC Educational Resources Information Center

    Braverman, Nancy E.; D'Agostino, Maria Daniela; MacLean, Gillian E.

    2013-01-01

    The peroxisome biogenesis disorders (PBD) are a heterogeneous group of autosomal recessive disorders in which peroxisome assembly is impaired, leading to multiple peroxisome enzyme deficiencies, complex developmental sequelae and progressive disabilities. Mammalian peroxisome assembly involves the protein products of 16 "PEX" genes;…

  8. Ear defects.

    PubMed

    Shonka, David C; Park, Stephen S

    2009-08-01

    The projection and exposure of the auricle make it particularly susceptible to actinic injury and thus to cutaneous malignancies. Auricular reconstruction is challenging because of its unique surface anatomy and undulating topography. This article organizes auricular defects into different categories based on anatomic location and extent of tissue loss, including skin-only defects, small composite defects, full-thickness defects involving or sparing the upper third of the ear, and total auricular loss. The authors share an algorithm for repair of the array of auricular defects. PMID:19698921

  9. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  10. Auxin Transport and Ribosome Biogenesis Mutant/Reporter Lines to Study Plant Cell Growth and Proliferation under Altered Gravity

    NASA Astrophysics Data System (ADS)

    Valbuena, Miguel A.; Manzano, Ana I.; van Loon, Jack JWA.; Saez-Vasquez, Julio; Carnero-Diaz, Eugenie; Herranz, Raul; Medina, F. J.

    2013-02-01

    We tested different Arabidopsis thaliana strains to check their availability for space use in the International Space Station (ISS). We used mutants and reporter gene strains affecting factors of cell proliferation and cell growth, to check variations induced by an altered gravity vector. Seedlings were grown either in a Random Positioning Machine (RPM), under simulated microgravity (μg), or in a Large Diameter Centrifuge (LDC), under hypergravity (2g). A combination of the two devices (μgRPM+LDC) was also used. Under all gravity alterations, seedling roots were longer than in control 1g conditions, while the levels of the nucleolar protein nucleolin were depleted. Alterations in the pattern of expression of PIN2, an auxin transporter, and of cyclin B1, a cell cycle regulator, were shown. All these alterations are compatible with previous space data, so the use of these strains will be useful in the next experiments in ISS, under real microgravity.

  11. Insights into the biogenesis of lysosome-related organelles from the study of the Hermansky-Pudlak syndrome.

    PubMed

    Bonifacino, Juan S

    2004-12-01

    Lysosome-related organelles (LROs) are a family of cell-type-specific organelles that include melanosomes, platelet dense bodies, and cytotoxic T cell granules. The name, LRO, recognizes the fact that all of these organelles contain subsets of lysosomal proteins in addition to cell-type-specific proteins. The recent identification of genetic disorders that cause combined defects in several of these organelles indicates that they share common biogenetic pathways. Studies of one of these disorders, the Hermansky-Pudlak syndrome (HPS), have provided helpful insights into the molecular machinery involved in LRO biogenesis. HPS is a genetically heterogeneous disorder caused by mutations in any of 7 genes in humans and 15 genes in mice. These genes encode subunits of 4 multi-protein complexes named AP-3, BLOC-1, BLOC-2 and BLOC-3, in addition to miscellaneous components of the general protein trafficking machinery. The AP-3 complex is a coat protein involved in vesicle formation and cargo selection in the endosomal-lysosomal system. One of these cargo molecules is the melanosomal enzyme, tyrosinase, the missorting of which may explain the defective melanosomes in AP-3-deficient humans and mice. The function of the BLOC complexes is unknown, although they are thought to mediate either vesicle tethering/fusion or cytoplasmic dispersal of LROs. Further studies of these complexes should contribute to the elucidation of the mechanisms of LRO biogenesis and the pathogenesis of HPS. PMID:15838104

  12. DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana.

    PubMed

    Xie, Zhixin; Allen, Edwards; Wilken, April; Carrington, James C

    2005-09-01

    Arabidopsis thaliana contains four DICER-LIKE (DCL) genes with specialized functions in small RNA biogenesis for RNA interference-related processes. A mutant with defects in DCL4 was identified and analyzed for microRNA- and endogenous, small interfering RNA (siRNA)-related functions. The dcl4-2 mutant contained normal or near-normal levels of microRNAs (21 nt) and heterochromatin-associated siRNAs (24 nt). In contrast, this mutant lacked each of three families of 21-nt trans-acting siRNAs (ta-siRNAs) and possessed elevated levels of ta-siRNA target transcripts. The dcl4-2 mutant resembled an rna-dependent RNA polymerase 6 mutant in that both mutants lacked ta-siRNAs and displayed heterochronic defects in which vegetative phase change was accelerated. Double mutant analyses with dcl2-1, dcl3-1, and dcl4-2 alleles revealed hierarchical redundancy among DCL activities, leading to alternative processing of ta-siRNA precursors in the absence of DCL4. These data support the concept that plants have specialized and compartmentalized DCL functions for biogenesis of distinct small RNA classes. PMID:16129836

  13. Stress triggers mitochondrial biogenesis to preserve steroidogenesis in Leydig cells.

    PubMed

    Gak, Igor A; Radovic, Sava M; Dukic, Aleksandra R; Janjic, Marija M; Stojkov-Mimic, Natasa J; Kostic, Tatjana S; Andric, Silvana A

    2015-10-01

    Adaptability to stress is a fundamental prerequisite for survival. Mitochondria are a key component of the stress response in all cells. For steroid-hormones-producing cells, including also Leydig cells of testes, the mitochondria are a key control point for the steroid biosynthesis and regulation. However, the mitochondrial biogenesis in steroidogenic cells has never been explored. Here we show that increased mitochondrial biogenesis is the adaptive response of testosterone-producing Leydig cells from stressed rats. All markers of mitochondrial biogenesis together with transcription factors and related kinases are up-regulated in Leydig cells from rats exposed to repeated psychophysical stress. This is followed with increased mitochondrial mass. The expression of PGC1, master regulator of mitochondrial biogenesis and integrator of environmental signals, is stimulated by cAMP-PRKA, cGMP, and β-adrenergic receptors. Accordingly, stress-triggered mitochondrial biogenesis represents an adaptive mechanism and does not only correlate with but also is an essential for testosterone production, being both events depend on the same regulators. Here we propose that all events induced by acute stress, the most common stress in human society, provoke adaptive response of testosterone-producing Leydig cells and activate PGC1, a protein required to make new mitochondria but also protector against the oxidative damage. Given the importance of mitochondria for steroid hormones production and stress response, as well as the role of steroid hormones in stress response and metabolic syndrome, we anticipate our result to be a starting point for more investigations since stress is a constant factor in life and has become one of the most significant health problems in modern societies. PMID:26036344

  14. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  15. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  16. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  17. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  18. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress.

    PubMed

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L J

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  19. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    PubMed Central

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.

    2016-01-01

    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  20. Stepwise and dynamic assembly of the earliest precursors of small ribosomal subunits in yeast.

    PubMed

    Zhang, Liman; Wu, Chen; Cai, Gaihong; Chen, She; Ye, Keqiong

    2016-03-15

    The eukaryotic ribosomal RNA (rRNA) is associated cotranscriptionally with numerous factors into an enormous 90S preribosomal particle that conducts early processing of small ribosomal subunits. The assembly pathway and structure of the 90S particle is poorly understood. Here, we affinity-purified and analyzed the constituents of yeast 90S particles that were assembled on a series of plasmid-encoded 3'-truncated pre-18S RNAs. We determined the assembly point of 65 proteins and the U3, U14, and snR30 small nucleolar RNAs (snoRNAs), revealing a stepwise and dynamic assembly map. The 5' external transcribed spacer (ETS) alone can nucleate a large complex. When the 18S rRNA is nearly complete, the 90S structure undergoes a dramatic reorganization, releasing U14, snR30, and 14 protein factors that bind earlier. We also identified a reference state of 90S that is fully assembled yet has not undergone 5'ETS processing. The assembly map present here provides a new framework to understand small subunit biogenesis. PMID:26980190

  1. Transport on a lattice with dynamical defects

    NASA Astrophysics Data System (ADS)

    Turci, Francesco; Parmeggiani, Andrea; Pitard, Estelle; Romano, M. Carmen; Ciandrini, Luca

    2013-01-01

    Many transport processes in nature take place on substrates, often considered as unidimensional lanes. These unidimensional substrates are typically nonstatic: Affected by a fluctuating environment, they can undergo conformational changes. This is particularly true in biological cells, where the state of the substrate is often coupled to the active motion of macromolecular complexes, such as motor proteins on microtubules or ribosomes on mRNAs, causing new interesting phenomena. Inspired by biological processes such as protein synthesis by ribosomes and motor protein transport, we introduce the concept of localized dynamical sites coupled to a driven lattice gas dynamics. We investigate the phenomenology of transport in the presence of dynamical defects and find a regime characterized by an intermittent current and subject to severe finite-size effects. Our results demonstrate the impact of the regulatory role of the dynamical defects in transport not only in biology but also in more general contexts.

  2. The Effect of Natural LCAT Mutations on the Biogenesis of HDL.

    PubMed

    Fotakis, Panagiotis; Kuivenhoven, Jan Albert; Dafnis, Eugene; Kardassis, Dimitris; Zannis, Vassilis I

    2015-06-01

    We have investigated how the natural LCAT[T147I] and LCAT[P274S] mutations affect the pathway of biogenesis of HDL. Gene transfer of WT LCAT in LCAT(-/-) mice increased 11.8-fold the plasma cholesterol, whereas the LCAT[T147I] and LCAT[P274S] mutants caused a 5.2- and 2.9-fold increase, respectively. The LCAT[P274S] and the WT LCAT caused a monophasic distribution of cholesterol in the HDL region, whereas the LCAT[T147I] caused a biphasic distribution of cholesterol in the LDL and HDL region. Fractionation of plasma showed that the expression of WT LCAT increased plasma apoE and apoA-IV levels and shifted the distribution of apoA-I to lower densities. The LCAT[T147I] and LCAT[P274S] mutants restored partially apoA-I in the HDL3 fraction and LCAT[T147I] increased apoE in the VLD/IDL/LDL fractions. The in vivo functionality of LCAT was further assessed based on is its ability to correct the aberrant HDL phenotype that was caused by the apoA-I[L159R]FIN mutation. Co-infection of apoA-I(-/-) mice with this apoA-I mutant and either of the two mutant LCAT forms restored only partially the HDL biogenesis defect that was caused by the apoA-I[L159R]FIN and generated a distinct aberrant HDL phenotype. PMID:25948084

  3. SORCS1 is necessary for normal insulin secretory granule biogenesis in metabolically stressed β cells

    PubMed Central

    Kebede, Melkam A.; Oler, Angie T.; Gregg, Trillian; Balloon, Allison J.; Johnson, Adam; Mitok, Kelly; Rabaglia, Mary; Schueler, Kathryn; Stapleton, Donald; Thorstenson, Candice; Wrighton, Lindsay; Floyd, Brendan J.; Richards, Oliver; Raines, Summer; Eliceiri, Kevin; Seidah, Nabil G.; Rhodes, Christopher; Keller, Mark P.; Coon, Joshua L.; Audhya, Anjon; Attie, Alan D.

    2014-01-01

    We previously positionally cloned Sorcs1 as a diabetes quantitative trait locus. Sorcs1 belongs to the Vacuolar protein sorting-10 (Vps10) gene family. In yeast, Vps10 transports enzymes from the trans-Golgi network (TGN) to the vacuole. Whole-body Sorcs1 KO mice, when made obese with the leptinob mutation (ob/ob), developed diabetes. β Cells from these mice had a severe deficiency of secretory granules (SGs) and insulin. Interestingly, a single secretagogue challenge failed to consistently elicit an insulin secretory dysfunction. However, multiple challenges of the Sorcs1 KO ob/ob islets consistently revealed an insulin secretion defect. The luminal domain of SORCS1 (Lum-Sorcs1), when expressed in a β cell line, acted as a dominant-negative, leading to SG and insulin deficiency. Using syncollin-dsRed5TIMER adenovirus, we found that the loss of Sorcs1 function greatly impairs the rapid replenishment of SGs following secretagogue challenge. Chronic exposure of islets from lean Sorcs1 KO mice to high glucose and palmitate depleted insulin content and evoked an insulin secretion defect. Thus, in metabolically stressed mice, Sorcs1 is important for SG replenishment, and under chronic challenge by insulin secretagogues, loss of Sorcs1 leads to diabetes. Overexpression of full-length SORCS1 led to a 2-fold increase in SG content, suggesting that SORCS1 is sufficient to promote SG biogenesis. PMID:25157818

  4. Centrosomal protein CP110 controls maturation of the mother centriole during cilia biogenesis

    PubMed Central

    Yadav, Sharda Prasad; Sharma, Neel Kamal; Liu, Chunqiao; Dong, Lijin; Li, Tiansen; Swaroop, Anand

    2016-01-01

    ABSTRACT Defects in cilia centrosomal genes cause pleiotropic clinical phenotypes, collectively called ciliopathies. Cilia biogenesis is initiated by the interaction of positive and negative regulators. Centriolar coiled coil protein 110 (CP110) caps the distal end of the mother centriole and is known to act as a suppressor to control the timing of ciliogenesis. Here, we demonstrate that CP110 promotes cilia formation in vivo, in contrast to findings in cultured cells. Cp110−/− mice die shortly after birth owing to organogenesis defects as in ciliopathies. Shh signaling is impaired in null embryos and primary cilia are reduced in multiple tissues. We show that CP110 is required for anchoring of basal bodies to the membrane during cilia formation. CP110 loss resulted in an abnormal distribution of core components of subdistal appendages (SDAs) and of recycling endosomes, which may be associated with premature extension of axonemal microtubules. Our data implicate CP110 in SDA assembly and ciliary vesicle docking, two requisite early steps in cilia formation. We suggest that CP110 has unique context-dependent functions, acting as both a suppressor and a promoter of ciliogenesis. PMID:26965371

  5. Small G proteins in peroxisome biogenesis: the potential involvement of ADP-ribosylation factor 6

    PubMed Central

    2009-01-01

    Background Peroxisomes execute diverse and vital functions in virtually every eukaryote. New peroxisomes form by budding from pre-existing organelles or de novo by vesiculation of the ER. It has been suggested that ADP-ribosylation factors and COPI coatomer complexes are involved in these processes. Results Here we show that all viable Saccharomyces cerevisiae strains deficient in one of the small GTPases which have an important role in the regulation of vesicular transport contain functional peroxisomes, and that the number of these organelles in oleate-grown cells is significantly upregulated in the arf1 and arf3 null strains compared to the wild-type strain. In addition, we provide evidence that a portion of endogenous Arf6, the mammalian orthologue of yeast Arf3, is associated with the cytoplasmic face of rat liver peroxisomes. Despite this, ablation of Arf6 did neither influence the regulation of peroxisome abundance nor affect the localization of peroxisomal proteins in cultured fetal hepatocytes. However, co-overexpression of wild-type, GTP hydrolysis-defective or (dominant-negative) GTP binding-defective forms of Arf1 and Arf6 caused mislocalization of newly-synthesized peroxisomal proteins and resulted in an alteration of peroxisome morphology. Conclusion These observations suggest that Arf6 is a key player in mammalian peroxisome biogenesis. In addition, they also lend strong support to and extend the concept that specific Arf isoform pairs may act in tandem to regulate exclusive trafficking pathways. PMID:19686593

  6. Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export

    PubMed Central

    Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

    2016-01-01

    The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms. PMID:26872259

  7. Three-Dimensional Distribution of UBF and Nopp140 in Relationship to Ribosomal DNA Transcription During Mouse Preimplantation Development.

    PubMed

    Koné, Maïmouna Coura; Fleurot, Renaud; Chebrout, Martine; Debey, Pascale; Beaujean, Nathalie; Bonnet-Garnier, Amélie

    2016-04-01

    The nucleolus is a dynamic nuclear compartment that is mostly involved in ribosome subunit biogenesis; however, it may also play a role in many other biological processes, such as stress response and the cell cycle. Mainly using electron microscopy, several studies have tried to decipher how active nucleoli are set up during early development in mice. In this study, we analyzed nucleologenesis during mouse early embryonic development using 3D-immunofluorescent detection of UBF and Nopp140, two proteins associated with different nucleolar compartments. UBF is a transcription factor that helps maintain the euchromatic state of ribosomal genes; Nopp140 is a phosphoprotein that has been implicated in pre-rRNA processing. First, using detailed image analyses and the in situ proximity ligation assay technique, we demonstrate that UBF and Nopp140 dynamic redistribution between the two-cell and blastocyst stages (time of implantation) is correlated with morphological and structural modifications that occur in embryonic nucleolar compartments. Our results also support the hypothesis that nucleoli develop at the periphery of nucleolar precursor bodies. Finally, we show that the RNA polymerase I inhibitor CX-5461: 1) disrupts transcriptional activity, 2) alters preimplantation development, and 3) leads to a complete reorganization of UBF and Nopp140 distribution. Altogether, our results underscore that highly dynamic changes are occurring in the nucleoli of embryos and confirm a close link between ribosomal gene transcription and nucleologenesis during the early stages of development. PMID:26984997

  8. Comparisons of Ribosomal Protein Gene Promoters Indicate Superiority of Heterologous Regulatory Sequences for Expressing Transgenes in Phytophthora infestans

    PubMed Central

    Khachatoorian, Careen; Judelson, Howard S.

    2015-01-01

    Molecular genetics approaches in Phytophthora research can be hampered by the limited number of known constitutive promoters for expressing transgenes and the instability of transgene activity. We have therefore characterized genes encoding the cytoplasmic ribosomal proteins of Phytophthora and studied their suitability for expressing transgenes in P. infestans. Phytophthora spp. encode a standard complement of 79 cytoplasmic ribosomal proteins. Several genes are duplicated, and two appear to be pseudogenes. Half of the genes are expressed at similar levels during all stages of asexual development, and we discovered that the majority share a novel promoter motif named the PhRiboBox. This sequence is enriched in genes associated with transcription, translation, and DNA replication, including tRNA and rRNA biogenesis. Promoters from the three P. infestans genes encoding ribosomal proteins S9, L10, and L23 and their orthologs from P. capsici were tested for their ability to drive transgenes in stable transformants of P. infestans. Five of the six promoters yielded strong expression of a GUS reporter, but the stability of expression was higher using the P. capsici promoters. With the RPS9 and RPL10 promoters of P. infestans, about half of transformants stopped making GUS over two years of culture, while their P. capsici orthologs conferred stable expression. Since cross-talk between native and transgene loci may trigger gene silencing, we encourage the use of heterologous promoters in transformation studies. PMID:26716454

  9. The activated glucocorticoid receptor modulates presumptive autoregulation of ribosomal protein S6 protein kinase, p70 S6K.

    PubMed

    Shah, O Jameel; Iniguez-Lluhi, Jorge A; Romanelli, Angela; Kimball, Scot R; Jefferson, Leonard S

    2002-01-25

    Protein metabolism in eukaryotic organisms is defined by a synthesis-degradation equilibrium that is subject to regulation by hormonal and nutritional signals. In mammalian tissues such as skeletal muscle, glucocorticoid hormones specify a catabolic response that influences both protein synthetic and protein degradative pathways. With regard to the former, glucocorticoids attenuate mRNA translation at two levels: translational efficiency, i.e. translation initiation, and translational capacity, i.e. ribosome biogenesis. Glucocorticoids may impair translational capacity through the ribosomal S6 protein kinase (p70 S6K), a recognized glucocorticoid target and an effector of ribosomal protein synthesis. We demonstrate here that the reduction in growth factor-activated p70 S6K activity by glucocorticoids depends upon a functional glucocorticoid receptor (GR) and that the GR is both necessary and sufficient to render p70 S6K subject to glucocorticoid regulation. Furthermore, the DNA binding and transcriptional activation but not repression properties of the GR are indispensable for p70 S6K regulation. Finally, a mutational analysis of the p70 S6K carboxyl terminus indicates that this region confers glucocorticoid sensitivity, and thus glucocorticoids may facilitate autoinhibition of the enzyme ultimately reducing the efficiency with which T389 is phosphorylated. PMID:11705993

  10. Distinct tmRNA sequence elements facilitate RNase R engagement on rescued ribosomes for selective nonstop mRNA decay

    PubMed Central

    Venkataraman, Krithika; Zafar, Hina; Karzai, A. Wali

    2014-01-01

    trans-Translation, orchestrated by SmpB and tmRNA, is the principal eubacterial pathway for resolving stalled translation complexes. RNase R, the leading nonstop mRNA surveillance factor, is recruited to stalled ribosomes in a trans-translation dependent process. To elucidate the contributions of SmpB and tmRNA to RNase R recruitment, we evaluated Escherichia coli–Francisella tularensis chimeric variants of tmRNA and SmpB. This evaluation showed that while the hybrid tmRNA supported nascent polypeptide tagging and ribosome rescue, it suffered defects in facilitating RNase R recruitment to stalled ribosomes. To gain further insights, we used established tmRNA and SmpB variants that impact distinct stages of the trans-translation process. Analysis of select tmRNA variants revealed that the sequence composition and positioning of the ultimate and penultimate codons of the tmRNA ORF play a crucial role in recruiting RNase R to rescued ribosomes. Evaluation of defined SmpB C-terminal tail variants highlighted the importance of establishing the tmRNA reading frame, and provided valuable clues into the timing of RNase R recruitment to rescued ribosomes. Taken together, these studies demonstrate that productive RNase R-ribosomes engagement requires active trans-translation, and suggest that RNase R captures the emerging nonstop mRNA at an early stage after establishment of the tmRNA ORF as the surrogate mRNA template. PMID:25200086

  11. Arabidopsis NMD3 Is Required for Nuclear Export of 60S Ribosomal Subunits and Affects Secondary Cell Wall Thickening

    PubMed Central

    Chen, Mei-Qin; Zhang, Ai-Hong; Zhang, Quan; Zhang, Bao-Cai; Nan, Jie; Li, Xia; Liu, Na; Qu, Hong; Lu, Cong-Ming; Sudmorgen; Zhou, Yi-Hua; Xu, Zhi-Hong; Bai, Shu-Nong

    2012-01-01

    NMD3 is required for nuclear export of the 60S ribosomal subunit in yeast and vertebrate cells, but no corresponding function of NMD3 has been reported in plants. Here we report that Arabidopsis thaliana NMD3 (AtNMD3) showed a similar function in the nuclear export of the 60S ribosomal subunit. Interference with AtNMD3 function by overexpressing a truncated dominant negative form of the protein lacking the nuclear export signal sequence caused retainment of the 60S ribosomal subunits in the nuclei. More interestingly, the transgenic Arabidopsis with dominant negative interference of AtNMD3 function showed a striking failure of secondary cell wall thickening, consistent with the altered expression of related genes and composition of cell wall components. Observation of a significant decrease of rough endoplasmic reticulum (RER) in the differentiating interfascicular fiber cells of the transgenic plant stems suggested a link between the defective nuclear export of 60S ribosomal subunits and the abnormal formation of the secondary cell wall. These findings not only clarified the evolutionary conservation of NMD3 functions in the nuclear export of 60S ribosomal subunits in yeast, animals and plants, but also revealed a new facet of the regulatory mechanism underlying secondary cell wall thickening in Arabidopsis. This new facet is that the nuclear export of 60S ribosomal subunits and the formation of RER may play regulatory roles in coordinating protein synthesis in cytoplasm and transcription in nuclei. PMID:22558264

  12. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    SciTech Connect

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  13. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  14. Mitochondrial cytochrome c biogenesis: no longer an enigma

    PubMed Central

    Babbitt, Shalon E.; Sutherland, Molly C.; Francisco, Brian San; Mendez, Deanna L.; Kranz, Robert G.

    2015-01-01

    Cytochromes c and c1are heme proteins that are essential for aerobic respiration. Release of cytochrome c from mitochondria is an important signal in apoptosis initiation. Biogenesis of c-type cytochromes involves covalent attachment of heme to two cysteines (at a conserved CXXCH sequence) in the apocytochrome. Heme attachment is catalyzed in most mitochondria by holocytochrome c synthase (HCCS), which is also necessary for import of apocytochrome c. Thus, HCCS affects cellular levels of cytochrome c, impacting mitochondrial physiology and cell death. Here, we review the mechanisms of HCCS function and the roles played by heme and residues in the CXXCH motif. Additionally, we consider concepts emerging within the two prokaryotic cytochrome c biogenesis pathways. PMID:26073510

  15. Biogenesis and Assembly of Eukaryotic Cytochrome c Oxidase Catalytic Core

    PubMed Central

    Soto, Ileana C.; Fontanesi, Flavia; Liu, Jingjing; Barrientos, Antoni

    2011-01-01

    Eukaryotic cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. COX is a multimeric enzyme formed by subunits of dual genetic origin which assembly is intricate and highly regulated. The COX catalytic core is formed by three mitochondrial DNA encoded subunits, Cox1, Cox2 and Cox3, conserved in the bacterial enzyme. Their biogenesis requires the action of messenger-specific and subunit-specific factors which facilitate the synthesis, membrane insertion, maturation or assembly of the core subunits. The study of yeast strains and human cell lines from patients carrying mutations in structural subunits and COX assembly factors has been invaluable to identify these ancillary factors. Here we review the current state of knowledge of the biogenesis and assembly of the eukaryotic COX catalytic core and discuss the degree of conservation of the players and mechanisms operating from yeast to human. PMID:21958598

  16. Pex19p, a Farnesylated Protein Essential for Peroxisome Biogenesis

    PubMed Central

    Götte, Klaudia; Girzalsky, Wolfgang; Linkert, Michael; Baumgart, Evelyn; Kammerer, Stefan; Kunau, Wolf-Hubert; Erdmann, Ralf

    1998-01-01

    We report the identification and molecular characterization of Pex19p, an oleic acid-inducible, farnesylated protein of 39.7 kDa that is essential for peroxisome biogenesis in Saccharomyces cerevisiae. Cells lacking Pex19p are characterized by the absence of morphologically detectable peroxisomes and mislocalization of peroxisomal matrix proteins to the cytosol. The human HK33 gene product was identified as the putative human ortholog of Pex19p. Evidence is provided that farnesylation of Pex19p takes place at the cysteine of the C-terminal CKQQ amino acid sequence. Farnesylation of Pex19p was shown to be essential for the proper function of the protein in peroxisome biogenesis. Pex19p was shown to interact with Pex3p in vivo, and this interaction required farnesylation of Pex19p. PMID:9418908

  17. Birth Defects

    MedlinePlus

    ... with birth defects may need surgery or other medical treatments. Today, doctors can diagnose many birth defects in the womb. This enables them to treat or even correct some problems before the baby is born. Centers for Disease Control and Prevention

  18. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  19. The miRNA biogenesis in marine bivalves.

    PubMed

    Rosani, Umberto; Pallavicini, Alberto; Venier, Paola

    2016-01-01

    Small non-coding RNAs include powerful regulators of gene expression, transposon mobility and virus activity. Among the various categories, mature microRNAs (miRNAs) guide the translational repression and decay of several targeted mRNAs. The biogenesis of miRNAs depends on few gene products, essentially conserved from basal to higher metazoans, whose protein domains allow specific interactions with dsRNA. Here, we report the identification of key genes responsible of the miRNA biogenesis in 32 bivalves, with particular attention to the aquaculture species Mytilus galloprovincialis and Crassostrea gigas. In detail, we have identified and phylogenetically compared eight evolutionary conserved proteins: DROSHA, DGCR8, EXP5, RAN, DICER TARBP2, AGO and PIWI. In mussels, we recognized several other proteins participating in the miRNA biogenesis or in the subsequent RNA silencing. According to digital expression analysis, these genes display low and not inducible expression levels in adult mussels and oysters whereas they are considerably expressed during development. As miRNAs play an important role also in the antiviral responses, knowledge on their production and regulative effects can shed light on essential molecular processes and provide new hints for disease prevention in bivalves. PMID:26989613

  20. The miRNA biogenesis in marine bivalves

    PubMed Central

    Rosani, Umberto; Pallavicini, Alberto

    2016-01-01

    Small non-coding RNAs include powerful regulators of gene expression, transposon mobility and virus activity. Among the various categories, mature microRNAs (miRNAs) guide the translational repression and decay of several targeted mRNAs. The biogenesis of miRNAs depends on few gene products, essentially conserved from basal to higher metazoans, whose protein domains allow specific interactions with dsRNA. Here, we report the identification of key genes responsible of the miRNA biogenesis in 32 bivalves, with particular attention to the aquaculture species Mytilus galloprovincialis and Crassostrea gigas. In detail, we have identified and phylogenetically compared eight evolutionary conserved proteins: DROSHA, DGCR8, EXP5, RAN, DICER TARBP2, AGO and PIWI. In mussels, we recognized several other proteins participating in the miRNA biogenesis or in the subsequent RNA silencing. According to digital expression analysis, these genes display low and not inducible expression levels in adult mussels and oysters whereas they are considerably expressed during development. As miRNAs play an important role also in the antiviral responses, knowledge on their production and regulative effects can shed light on essential molecular processes and provide new hints for disease prevention in bivalves. PMID:26989613

  1. MicroRNA-27b Regulates Mitochondria Biogenesis in Myocytes

    PubMed Central

    Zhang, Shunhua; Du, Jingjing; Bai, Lin; Zhang, Yi; Jiang, Yanzhi; Li, Xuewei; Wang, Jinyong; Zhu, Li

    2016-01-01

    MicroRNAs (miRNAs) are small, non-coding RNAs that affect the post-transcriptional regulation of various biological pathways. To date, it is not fully understood how miRNAs regulate mitochondrial biogenesis. This study aimed at the identification of the role of miRNA-27b in mitochondria biogenesis. The mitochondria content in C2C12 cells was significantly increased during myogenic differentiation and accompanied by a marked decrease of miRNA-27b expression. Furthermore, the expression of the predicted target gene of miRNA-27b, forkhead box j3 (Foxj3), was also increased during myogenic differentiation. Luciferase activity assays confirmed that miRNA-27b directly targets the 3’-untranslated region (3’-UTR) of Foxj3. Overexpression of miRNA-27b provoked a decrease of mitochondria content and diminished expression of related mitochondrial genes and Foxj3 both at mRNA and protein levels. The expression levels of downstream genes of Foxj3, such as Mef2c, PGC1α, NRF1 and mtTFA, were also decreased in C2C12 cells upon overexpression of miRNA-27b. These results suggested that miRNA-27b may affect mitochondria biogenesis by down-regulation of Foxj3 during myocyte differentiation. PMID:26849429

  2. Altered Endosome Biogenesis in Prostate Cancer has Biomarker Potential

    PubMed Central

    Johnson, Ian R D; Parkinson-Lawrence, Emma J; Shandala, Tetyana; Weigert, Roberto; Butler, Lisa M; Brooks, Doug A

    2016-01-01

    Prostate cancer is the second most common form of cancer in males, affecting one in eight men by the time they reach the age of 70. Current diagnostic tests for prostate cancer have significant problems with both false negatives and false positives, necessitating the search for new molecular markers. A recent investigation of endosomal and lysosomal proteins revealed that the critical process of endosomal biogenesis might be altered in prostate cancer. Here, a panel of endosomal markers was evaluated in prostate cancer and non-malignant cells and a significant increase in gene and protein expression was found for early, but not late endosomal proteins. There was also a differential distribution of early endosomes, and altered endosomal traffic and signalling of the transferrin receptors (TFRC and TFR2) in prostate cancer cells. These findings support the concept that endosome biogenesis and function is altered in prostate cancer. Microarray analysis of a clinical cohort confirmed the altered endosomal gene expression observed in cultured prostate cancer cells. Furthermore, in prostate cancer patient tissue specimens, the early endosomal marker and adaptor protein APPL1 showed consistently altered basement membrane histology in the vicinity of tumours and concentrated staining within tumour masses. These novel observations on altered early endosome biogenesis provide a new avenue for prostate cancer biomarker investigation and suggest new methods for the early diagnosis and accurate prognosis of prostate cancer. PMID:25080433

  3. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  4. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  5. Impaired Nrf2 regulation of mitochondrial biogenesis in rostral ventrolateral medulla on hypertension induced by systemic inflammation.

    PubMed

    Wu, Kay L H; Wu, Chih-Wei; Chao, Yung-Mei; Hung, Chun-Ying; Chan, Julie Y H

    2016-08-01

    Oxidative stress in rostral ventrolateral medulla (RVLM), where sympathetic premotor neurons reside, is involved in the development of hypertension under systemic inflammation. Mitochondrial dysfunction contributes to tissue oxidative stress. In this study, we sought to investigate whether hypertension developed under systemic inflammation is attributable to impaired mitochondrial biogenesis in RVLM. In normotensive Sprague-Dawley rats, intraperitoneal infusion of a low dose Escherichia coli lipopolysaccharide (LPS) for 7 days promoted a pressor response, alongside a decrease in mitochondrial DNA (mtDNA) copy number, reductions in protein expression of nuclear DNA-encoded transcription factors for mitochondrial biogenesis, including mitochondrial transcription factor A (TFAM) and nuclear factor erythroid-derived 2-like 2 (Nrf2), and suppression of nuclear translocation of the phosphorylated Nrf2 (p-Nrf2) in RVLM neurons; all of which were abrogated by treatment with intracisternal infusion of an interleukin-1β (IL-1β) blocker, IL-1Ra, or a mobile mitochondrial electron carrier, coenzyme Q10 (CoQ10). Microinjection into RVLM of IL-1β suppressed the expressions of p-Nrf2 and TFAM, and evoked a pressor response; conversely, the Nrf2 inducer, tert-butylhydroquinone, lessened the LPS-induced suppression of TFAM expression and pressor response. At cellular level, exposure of neuronal N2a cells to IL-1β decreased mtDNA copy number, increased protein interaction of Nrf2 to its negative regulator, kelch-like ECH-associated protein 1 (Keap1), and reduced DNA binding activity of p-Nrf2 to Tfam gene. Together these results indicate that defect mitochondrial biogenesis in RVLM neurons entailing redox-sensitive and IL-1β-dependent suppression of TFAM because of the increase in the formation of Keap1/Nrf2 complex, reductions in nuclear translocation of the activated Nrf2 and its binding to the Tfam gene promoter may underlie hypertension developed under the LPS

  6. Characterization of Yeast Extracellular Vesicles: Evidence for the Participation of Different Pathways of Cellular Traffic in Vesicle Biogenesis

    PubMed Central

    Joffe, Luna S.; Guimarães, Allan J.; Sobreira, Tiago J. P.; Nosanchuk, Joshua D.; Cordero, Radames J. B.; Frases, Susana; Casadevall, Arturo; Almeida, Igor C.; Nimrichter, Leonardo; Rodrigues, Marcio L.

    2010-01-01

    Background Extracellular vesicles in yeast cells are involved in the molecular traffic across the cell wall. In yeast pathogens, these vesicles have been implicated in the transport of proteins, lipids, polysaccharide and pigments to the extracellular space. Cellular pathways required for the biogenesis of yeast extracellular vesicles are largely unknown. Methodology/Principal Findings We characterized extracellular vesicle production in wild type (WT) and mutant strains of the model yeast Saccharomyces cerevisiae using transmission electron microscopy in combination with light scattering analysis, lipid extraction and proteomics. WT cells and mutants with defective expression of Sec4p, a secretory vesicle-associated Rab GTPase essential for Golgi-derived exocytosis, or Snf7p, which is involved in multivesicular body (MVB) formation, were analyzed in parallel. Bilayered vesicles with diameters at the 100–300 nm range were found in extracellular fractions from yeast cultures. Proteomic analysis of vesicular fractions from the cells aforementioned and additional mutants with defects in conventional secretion pathways (sec1-1, fusion of Golgi-derived exocytic vesicles with the plasma membrane; bos1-1, vesicle targeting to the Golgi complex) or MVB functionality (vps23, late endosomal trafficking) revealed a complex and interrelated protein collection. Semi-quantitative analysis of protein abundance revealed that mutations in both MVB- and Golgi-derived pathways affected the composition of yeast extracellular vesicles, but none abrogated vesicle production. Lipid analysis revealed that mutants with defects in Golgi-related components of the secretory pathway had slower vesicle release kinetics, as inferred from intracellular accumulation of sterols and reduced detection of these lipids in vesicle fractions in comparison with WT cells. Conclusions/Significance Our results suggest that both conventional and unconventional pathways of secretion are required for

  7. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  8. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  9. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome

    PubMed Central

    Sharma, Divya; Cukras, Anthony R.; Rogers, Elizabeth J.; Southworth, Daniel R.; Green, Rachel

    2007-01-01

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S rRNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit referred to as “closure”. Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a “restrictive” phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity modulating binding site for paromomycin in the 16S rRNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations. PMID:17967466

  10. Ribosome hijacking: a role for small protein B during trans-translation

    PubMed Central

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-01-01

    Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006

  11. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  12. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  13. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  14. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  15. Biogenesis of antibiotics-viewing its history and glimpses of the future.

    PubMed

    Spížek, J; Sigler, K; Řezanka, T; Demain, A

    2016-07-01

    This review aims at comparing some historical data with the current situation in the study of biogenesis of natural compounds, antibiotics in the first place. Biogenesis of tetracyclines and cycloheximide and related compounds serves as example. Examples of molecular biological and bioinformatics methods used in the study of antibiotic biogenesis are described both in terms of its historical aspects and the current knowledge. PMID:27188629

  16. A Comprehensive Analysis of Chromoplast Differentiation Reveals Complex Protein Changes Associated with Plastoglobule Biogenesis and Remodeling of Protein Systems in Sweet Orange Flesh1[OPEN

    PubMed Central

    Zeng, Yunliu; Du, Jiabin; Wang, Lun; Pan, Zhiyong; Xu, Qiang; Xiao, Shunyuan; Deng, Xiuxin

    2015-01-01

    Globular and crystalloid chromoplasts were observed to be region specifically formed in sweet orange (Citrus sinensis) flesh and converted from amyloplasts during fruit maturation, which was associated with the composition of specific carotenoids and the expression of carotenogenic genes. Subsequent isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomic analyses of purified plastids from the flesh during chromoplast differentiation and senescence identified 1,386 putative plastid-localized proteins, 1,016 of which were quantified by spectral counting. The iTRAQ values reflecting the expression abundance of three identified proteins were validated by immunoblotting. Based on iTRAQ data, chromoplastogenesis appeared to be associated with three major protein expression patterns: (1) marked decrease in abundance of the proteins participating in the translation machinery through ribosome assembly; (2) increase in abundance of the proteins involved in terpenoid biosynthesis (including carotenoids), stress responses (redox, ascorbate, and glutathione), and development; and (3) maintenance of the proteins for signaling and DNA and RNA. Interestingly, a strong increase in abundance of several plastoglobule-localized proteins coincided with the formation of plastoglobules in the chromoplast. The proteomic data also showed that stable functioning of protein import, suppression of ribosome assembly, and accumulation of chromoplast proteases are correlated with the amyloplast-to-chromoplast transition; thus, these processes may play a collective role in chromoplast biogenesis and differentiation. By contrast, the chromoplast senescence process was inferred to be associated with significant increases in stress response and energy supply. In conclusion, this comprehensive proteomic study identified many potentially new plastid-localized proteins and provides insights into the potential developmental and molecular mechanisms underlying chromoplast

  17. A Comprehensive Analysis of Chromoplast Differentiation Reveals Complex Protein Changes Associated with Plastoglobule Biogenesis and Remodeling of Protein Systems in Sweet Orange Flesh.

    PubMed

    Zeng, Yunliu; Du, Jiabin; Wang, Lun; Pan, Zhiyong; Xu, Qiang; Xiao, Shunyuan; Deng, Xiuxin

    2015-08-01

    Globular and crystalloid chromoplasts were observed to be region specifically formed in sweet orange (Citrus sinensis) flesh and converted from amyloplasts during fruit maturation, which was associated with the composition of specific carotenoids and the expression of carotenogenic genes. Subsequent isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomic analyses of purified plastids from the flesh during chromoplast differentiation and senescence identified 1,386 putative plastid-localized proteins, 1,016 of which were quantified by spectral counting. The iTRAQ values reflecting the expression abundance of three identified proteins were validated by immunoblotting. Based on iTRAQ data, chromoplastogenesis appeared to be associated with three major protein expression patterns: (1) marked decrease in abundance of the proteins participating in the translation machinery through ribosome assembly; (2) increase in abundance of the proteins involved in terpenoid biosynthesis (including carotenoids), stress responses (redox, ascorbate, and glutathione), and development; and (3) maintenance of the proteins for signaling and DNA and RNA. Interestingly, a strong increase in abundance of several plastoglobule-localized proteins coincided with the formation of plastoglobules in the chromoplast. The proteomic data also showed that stable functioning of protein import, suppression of ribosome assembly, and accumulation of chromoplast proteases are correlated with the amyloplast-to-chromoplast transition; thus, these processes may play a collective role in chromoplast biogenesis and differentiation. By contrast, the chromoplast senescence process was inferred to be associated with significant increases in stress response and energy supply. In conclusion, this comprehensive proteomic study identified many potentially new plastid-localized proteins and provides insights into the potential developmental and molecular mechanisms underlying chromoplast

  18. Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

    PubMed Central

    Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.; Raikhel, Natasha V.

    2015-01-01

    The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function. PMID:25535344

  19. Aβ25-35 Suppresses Mitochondrial Biogenesis in Primary Hippocampal Neurons.

    PubMed

    Dong, Weiguo; Wang, Feng; Guo, Wanqing; Zheng, Xuehua; Chen, Yue; Zhang, Wenguang; Shi, Hong

    2016-01-01

    Mitochondrial biogenesis is involved in the regulation of mitochondrial content, morphology, and function. Impaired mitochondrial biogenesis has been observed in Alzheimer's disease. Amyloid-β (Aβ) has been shown to cause mitochondrial dysfunction in cultured neurons, but its role in mitochondrial biogenesis in neurons remains poorly defined. AMP-activated protein kinase (AMPK) and sirtuin 1 (SIRT1) are key energy-sensing molecules regulating mitochondrial biogenesis. In addition, peroxisome proliferator-activated receptor-γ coactivator 1-alpha (PGC-1α), the master regulator of mitochondrial biogenesis, is a target for SIRT1 deacetylase activity. In this study, we investigated the effects of Aβ25-35 on mitochondrial biogenesis in cultured hippocampal neurons and the underlying mechanisms. In primary hippocampal neurons, we found that 24-h incubation with Aβ25-35 suppressed both phosphorylations of AMPK and SIRT1 expression and increased PGC-1α acetylation expression. In addition, Aβ25-35 also resulted in a decrease in mitochondrial DNA copy number, as well as decreases in the expression of mitochondrial biogenesis factors (PGC-1α, NRF 1, NRF 2, and Tfam). Taken together, these data show that Aβ25-35 suppresses mitochondrial biogenesis in hippocampal neurons. Aβ25-35-induced impairment of mitochondrial biogenesis may be associated with the inhibition of the AMPK-SIRT1-PGC-1α pathway. PMID:26055049

  20. OCRL1 engages with the F-BAR protein pacsin 2 to promote biogenesis of membrane-trafficking intermediates

    PubMed Central

    Billcliff, Peter G.; Noakes, Christopher J.; Mehta, Zenobia B.; Yan, Guanhua; Mak, LokHang; Woscholski, Rudiger; Lowe, Martin

    2016-01-01

    Mutation of the inositol 5-phosphatase OCRL1 causes Lowe syndrome and Dent-2 disease. Loss of OCRL1 function perturbs several cellular processes, including membrane traffic, but the underlying mechanisms remain poorly defined. Here we show that OCRL1 is part of the membrane-trafficking machinery operating at the trans-Golgi network (TGN)/endosome interface. OCRL1 interacts via IPIP27A with the F-BAR protein pacsin 2. OCRL1 and IPIP27A localize to mannose 6-phosphate receptor (MPR)–containing trafficking intermediates, and loss of either protein leads to defective MPR carrier biogenesis at the TGN and endosomes. OCRL1 5-phosphatase activity, which is membrane curvature sensitive, is stimulated by IPIP27A-mediated engagement of OCRL1 with pacsin 2 and promotes scission of MPR-containing carriers. Our data indicate a role for OCRL1, via IPIP27A, in regulating the formation of pacsin 2–dependent trafficking intermediates and reveal a mechanism for coupling PtdIns(4,5)P2 hydrolysis with carrier biogenesis on endomembranes. PMID:26510499

  1. Chloroplast Biogenesis-Associated Nuclear Genes: Control by Plastid Signals Evolved Prior to Their Regulation as Part of Photomorphogenesis

    PubMed Central

    Hills, Alison C.; Khan, Safina; López-Juez, Enrique

    2015-01-01

    The assembly of photosynthetically competent chloroplasts occurs in angiosperm seedlings when first exposed to light, and is due to the control by light of photosynthesis-associated nuclear genes (PhANGs), also dependent upon plastid-to-nucleus “biogenic” communication signals. The relationship between light- and plastid signal-regulation of PhANGs is close but poorly understood. In contrast, many conifers green in the dark and the promoter of a pine PhANG, Lhcb, is active in the dark in tobacco. Here, we show that the activity of this promoter in tobacco is sensitive to plastid photobleaching, or to the inhibition of plastid translation in the light or the dark, and the same interventions reduce expression of the native gene in pine seedlings, demonstrating classic plastid biogenic signaling in gymnosperms. Furthermore, Arabidopsis mutations causing defective plastid biogenesis suppress the effect in darkness of mutations in COP1 and DET1, repressors of photomorphogenesis, for the expression of several PhANGs but not a photosynthesis-unrelated, light-regulated gene. GLK transcriptional regulators mediate the response of LHCB but not of other tested PhANGs. We propose the ability to suppress PhANG response to positive plastid biogenic signals in the dark may have contributed to the evolution of light-controlled chloroplast biogenesis. PMID:26697036

  2. Cell-Specific Transcriptional Profiling of Ciliated Sensory Neurons Reveals Regulators of Behavior and Extracellular Vesicle Biogenesis.

    PubMed

    Wang, Juan; Kaletsky, Rachel; Silva, Malan; Williams, April; Haas, Leonard A; Androwski, Rebecca J; Landis, Jessica N; Patrick, Cory; Rashid, Alina; Santiago-Martinez, Dianaliz; Gravato-Nobre, Maria; Hodgkin, Jonathan; Hall, David H; Murphy, Coleen T; Barr, Maureen M

    2015-12-21

    Cilia and extracellular vesicles (EVs) are signaling organelles [1]. Cilia act as cellular sensory antennae, with defects resulting in human ciliopathies. Cilia both release and bind to EVs [1]. EVs are sub-micron-sized particles released by cells and function in both short- and long-range intercellular communication. In C. elegans and mammals, the autosomal dominant polycystic kidney disease (ADPKD) gene products polycystin-1 and polycystin-2 localize to both cilia and EVs, act in the same genetic pathway, and function in a sensory capacity, suggesting ancient conservation [2]. A fundamental understanding of EV biology and the relationship between the polycystins, cilia, and EVs is lacking. To define properties of a ciliated EV-releasing cell, we performed RNA-seq on 27 GFP-labeled EV-releasing neurons (EVNs) isolated from adult C. elegans. We identified 335 significantly overrepresented genes, of which 61 were validated by GFP reporters. The EVN transcriptional profile uncovered new pathways controlling EV biogenesis and polycystin signaling and also identified EV cargo, which included an antimicrobial peptide and ASIC channel. Tumor-necrosis-associated factor (TRAF) homologs trf-1 and trf-2 and the p38 mitogen-activated protein kinase (MAPK) pmk-1 acted in polycystin-signaling pathways controlling male mating behaviors. pmk-1 was also required for EV biogenesis, independent of the innate immunity MAPK signaling cascade. This first high-resolution transcriptome profile of a subtype of ciliated sensory neurons isolated from adult animals reveals the functional components of an EVN. PMID:26687621

  3. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  4. Identification of Methylated Proteins in the Yeast Small Ribosomal Subunit: A Role for SPOUT Methyltransferases in Protein Arginine Methylation†

    PubMed Central

    Young, Brian D.; Weiss, David I.; Zurita-Lopez, Cecilia I.; Webb, Kristofor J.; Clarke, Steven G.; McBride, Anne E.

    2012-01-01

    We have characterized the posttranslational methylation of Rps2, Rps3, and Rps27a, three small ribosomal subunit proteins in the yeast Saccharomyces cerevisiae, using mass spectrometry and amino acid analysis. We found that Rps2 is substoichiometrically modified at arginine-10 by the Rmt1 methyltransferase. We demonstrated that Rps3 is stoichiometrically modified by ω-monomethylation at arginine-146 by mass spectrometric and site-directed mutagenic analyses. Substitution of alanine for arginine at position 146 is associated with slow cell growth, suggesting that the amino acid identity at this site may influence ribosomal function and/or biogenesis. Analysis of the three-dimensional structure of Rps3 in S. cerevisiae shows that arginine-146 makes contacts with the small subunit rRNA. Screening of deletion mutants encoding potential yeast methyltransferases revealed that the loss of the YOR021C gene results in the absence of methylation on Rps3. We demonstrated that recombinant Yor021c catalyzes ω-monomethylarginine formation when incubated with S-adenosylmethionine and hypomethylated ribosomes prepared from a YOR021C deletion strain. Interestingly, Yor021c belongs to the family of SPOUT methyltransferases that, to date, have only been shown to modify RNA substrates. Our findings suggest a wider role for SPOUT methyltransferases in nature. Finally, we have demonstrated the presence of a stoichiometrically methylated cysteine residue at position 39 of Rps27a in a zinc-cysteine cluster. The discovery of these three novel sites of protein modification within the small ribosomal subunit will now allow for an analysis of their functional roles in translation and possibly other cellular processes. PMID:22650761

  5. Structure and function of the yeast listerin (Ltn1) conserved N-terminal domain in binding to stalled 60S ribosomal subunits.

    PubMed

    Doamekpor, Selom K; Lee, Joong-Won; Hepowit, Nathaniel L; Wu, Cheng; Charenton, Clement; Leonard, Marilyn; Bengtson, Mario H; Rajashankar, Kanagalaghatta R; Sachs, Matthew S; Lima, Christopher D; Joazeiro, Claudio A P

    2016-07-19

    The Ltn1 E3 ligase (listerin in mammals) has emerged as a paradigm for understanding ribosome-associated ubiquitylation. Ltn1 binds to 60S ribosomal subunits to ubiquitylate nascent polypeptides that become stalled during synthesis; among Ltn1's substrates are aberrant products of mRNA lacking stop codons [nonstop translation products (NSPs)]. Here, we report the reconstitution of NSP ubiquitylation in Neurospora crassa cell extracts. Upon translation in vitro, ribosome-stalled NSPs were ubiquitylated in an Ltn1-dependent manner, while still ribosome-associated. Furthermore, we provide biochemical evidence that the conserved N-terminal domain (NTD) plays a significant role in the binding of Ltn1 to 60S ribosomal subunits and that NTD mutations causing defective 60S binding also lead to defective NSP ubiquitylation, without affecting Ltn1's intrinsic E3 ligase activity. Finally, we report the crystal structure of the Ltn1 NTD at 2.4-Å resolution. The structure, combined with additional mutational studies, provides insight to NTD's role in binding stalled 60S subunits. Our findings show that Neurospora extracts can be used as a tool to dissect mechanisms underlying ribosome-associated protein quality control and are consistent with a model in which Ltn1 uses 60S subunits as adapters, at least in part via its NTD, to target stalled NSPs for ubiquitylation. PMID:27385828

  6. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  7. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  8. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  9. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  10. Collaborator of alternative reading frame protein (CARF) regulates early processing of pre-ribosomal RNA by retaining XRN2 (5′-3′ exoribonuclease) in the nucleoplasm

    PubMed Central

    Sato, Shigeko; Ishikawa, Hideaki; Yoshikawa, Harunori; Izumikawa, Keiichi; Simpson, Richard J.; Takahashi, Nobuhiro

    2015-01-01

    Collaborator of alternative reading frame protein (CARF) associates directly with ARF, p53, and/or human double minute 2 protein (HDM2), a ubiquitin-protein ligase, without cofactors and regulates cell proliferation by forming a negative feedback loop. Although ARF, p53, and HDM2 also participate in the regulation of ribosome biogenesis, the involvement of CARF in this process remains unexplored. In this study, we demonstrate that CARF associates with 5′-3′ exoribonuclease 2 (XRN2), which plays a major role in both the maturation of rRNA and the degradation of a variety of discarded pre-rRNA species. We show that overexpression of CARF increases the localization of XRN2 in the nucleoplasm and a concomitant suppression of pre-rRNA processing that leads to accumulation of the 5′ extended from of 45S/47S pre-rRNA and 5′-01, A0-1 and E-2 fragments of pre-rRNA transcript in the nucleolus. This was also observed upon XRN2 knockdown. Knockdown of CARF increased the amount of XRN2 in the nucleolar fraction as determined by cell fractionation and by immnocytochemical analysis. These observations suggest that CARF regulates early steps of pre-rRNA processing during ribosome biogenesis by controlling spatial distribution of XRN2 between the nucleoplasm and nucleolus. PMID:26531822

  11. Collaborator of alternative reading frame protein (CARF) regulates early processing of pre-ribosomal RNA by retaining XRN2 (5'-3' exoribonuclease) in the nucleoplasm.

    PubMed

    Sato, Shigeko; Ishikawa, Hideaki; Yoshikawa, Harunori; Izumikawa, Keiichi; Simpson, Richard J; Takahashi, Nobuhiro

    2015-12-01

    Collaborator of alternative reading frame protein (CARF) associates directly with ARF, p53, and/or human double minute 2 protein (HDM2), a ubiquitin-protein ligase, without cofactors and regulates cell proliferation by forming a negative feedback loop. Although ARF, p53, and HDM2 also participate in the regulation of ribosome biogenesis, the involvement of CARF in this process remains unexplored. In this study, we demonstrate that CARF associates with 5'-3' exoribonuclease 2 (XRN2), which plays a major role in both the maturation of rRNA and the degradation of a variety of discarded pre-rRNA species. We show that overexpression of CARF increases the localization of XRN2 in the nucleoplasm and a concomitant suppression of pre-rRNA processing that leads to accumulation of the 5' extended from of 45S/47S pre-rRNA and 5'-01, A0-1 and E-2 fragments of pre-rRNA transcript in the nucleolus. This was also observed upon XRN2 knockdown. Knockdown of CARF increased the amount of XRN2 in the nucleolar fraction as determined by cell fractionation and by immnocytochemical analysis. These observations suggest that CARF regulates early steps of pre-rRNA processing during ribosome biogenesis by controlling spatial distribution of XRN2 between the nucleoplasm and nucleolus. PMID:26531822

  12. A secondary structural common core in the ribosomal ITS2 (internal transcribed spacer) of Culexspecies from diverse geographical locations

    PubMed Central

    Bhargavi, Ryavarapu; Vishwakarma, Siddharth; Murty, Upadhyayula Suryanarayana

    2005-01-01

    In the present study, sequence and structural analysis of ITS2 region (the spacer segment between 5.8S and 28S rRNA of mature rRNA sequences) of 7 Culex species belonging to 5 different geographical locations was carried out. Alignment of the ITS2 sequence from the 7 species revealed 8 homologous domains. Four species namely C. vishnui, C. annulus, C. pipiens, C. quiquefasciatusshowed high sequence (98­100%) and RNA secondary structure similarity. The ITS2 similarity among different species is high despite their varying geographical locations. Several common features of secondary structure are shared among these species, with some of them supported by compensatory changes, suggesting the significant role by ITS2 as an RNA domain during ribosome biogenesis. PMID:17597853

  13. Elucidation of pathways of ribosomal RNA degradation: an essential role for RNase E.

    PubMed

    Sulthana, Shaheen; Basturea, Georgeta N; Deutscher, Murray P

    2016-08-01

    Although normally stable in growing cells, ribosomal RNAs are degraded under conditions of stress, such as starvation, and in response to misassembled or otherwise defective ribosomes in a process termed RNA quality control. Previously, our laboratory found that large fragments of 16S and 23S rRNA accumulate in strains lacking the processive exoribonucleases RNase II, RNase R, and PNPase, implicating these enzymes in the later steps of rRNA breakdown. Here, we define the pathways of rRNA degradation in the quality control process and during starvation, and show that the essential endoribonuclease, RNase E, is required to make the initial cleavages in both degradative processes. We also present evidence that explains why the exoribonuclease, RNase PH, is required to initiate the degradation of rRNA during starvation. The data presented here provide the first detailed description of rRNA degradation in bacterial cells. PMID:27298395

  14. Biogenesis and Functions of Exosomes and Extracellular Vesicles.

    PubMed

    Dreyer, Florian; Baur, Andreas

    2016-01-01

    Research on extracellular vesicles (EVs) is a new and emerging field that is rapidly growing. Many features of these structures still need to be described and discovered. This concerns their biogenesis, their release and cellular entrance mechanisms, as well as their functions, particularly in vivo. Hence our knowledge on EV is constantly evolving and sometimes changing. In our review we summarize the most important facts of our current knowledge about extracellular vesicles and described some of the assumed functions in the context of cancer and HIV infection. PMID:27317183

  15. Biogenesis of the multifunctional lipid droplet: Lipids, proteins, and sites

    PubMed Central

    Gross, Steven P.

    2014-01-01

    Lipid droplets (LDs) are ubiquitous dynamic organelles that store and supply lipids in all eukaryotic and some prokaryotic cells for energy metabolism, membrane synthesis, and production of essential lipid-derived molecules. Interest in the organelle’s cell biology has exponentially increased over the last decade due to the link between LDs and prevalent human diseases and the discovery of new and unexpected functions of LDs. As a result, there has been significant recent progress toward understanding where and how LDs are formed, and the specific lipid pathways that coordinate LD biogenesis. PMID:24590170

  16. Mitochondrial biogenesis during differentiation of Artemia salina cysts.

    PubMed

    Schmitt, H; Grossfeld, H; Littauer, U Z

    1973-09-01

    Mitochondria isolated from cysts of Artemia salina (brine shrimp) were found to be devoid of cristae and to possess a low respiratory capability. Hydration of the cysts induces marked biochemical and morphological changes in the mitochondria. Their biogenesis proceeds in two stages. The first stage is completed within 1 h and is characterized by a rapid increase in the respiratory capability of the mitochondria, their cytochrome oxidase, cytochrome b, cytochrome c and perhaps some morphological changes. In the second stage there is an increase in the protein-synthesizing capacity of the mitochondria as well as striking changes in mitochondrial morphology leading to the formation of cristae. PMID:4355924

  17. Serine protease autotransporters of enterobacteriaceae (SPATEs): biogenesis and function.

    PubMed

    Dautin, Nathalie

    2010-06-01

    Serine Protease Autotransporters of Enterobacteriaceae (SPATEs) constitute a large family of proteases secreted by Escherichia coli and Shigella. SPATEs exhibit two distinct proteolytic activities. First, a C-terminal catalytic site triggers an intra-molecular cleavage that releases the N-terminal portion of these proteins in the extracellular medium. Second, the secreted N-terminal domains of SPATEs are themselves proteases; each contains a canonical serine-protease catalytic site. Some of these secreted proteases are toxins, eliciting various effects on mammalian cells. Here, we discuss the biogenesis of SPATEs and their function as toxins. PMID:22069633

  18. The Biogenesis of Lysosomes and Lysosome-Related Organelles

    PubMed Central

    Luzio, J. Paul; Hackmann, Yvonne; Dieckmann, Nele M.G.; Griffiths, Gillian M.

    2014-01-01

    Lysosomes were once considered the end point of endocytosis, simply used for macromolecule degradation. They are now recognized to be dynamic organelles, able to fuse with a variety of targets and to be re-formed after fusion events. They are also now known to be the site of nutrient sensing and signaling to the cell nucleus. In addition, lysosomes are secretory organelles, with specialized machinery for regulated secretion of proteins in some cell types. The biogenesis of lysosomes and lysosome-related organelles is discussed, taking into account their dynamic nature and multiple roles. PMID:25183830

  19. The biogenesis and emerging roles of circular RNAs.

    PubMed

    Chen, Ling-Ling

    2016-04-01

    Circular RNAs (circRNAs) are produced from precursor mRNA (pre-mRNA) back-splicing of thousands of genes in eukaryotes. Although circRNAs are generally expressed at low levels, recent findings have shed new light on their cell type-specific and tissue-specific expression and on the regulation of their biogenesis. Furthermore, the data indicate that circRNAs shape gene expression by titrating microRNAs, regulating transcription and interfering with splicing, thus effectively expanding the diversity and complexity of eukaryotic transcriptomes. PMID:26908011

  20. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  1. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  2. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  3. Loss-of-function mutations in the RNA biogenesis factor NAF1 predispose to pulmonary fibrosis-emphysema.

    PubMed

    Stanley, Susan E; Gable, Dustin L; Wagner, Christa L; Carlile, Thomas M; Hanumanthu, Vidya Sagar; Podlevsky, Joshua D; Khalil, Sara E; DeZern, Amy E; Rojas-Duran, Maria F; Applegate, Carolyn D; Alder, Jonathan K; Parry, Erin M; Gilbert, Wendy V; Armanios, Mary

    2016-08-10

    Chronic obstructive pulmonary disease and pulmonary fibrosis have been hypothesized to represent premature aging phenotypes. At times, they cluster in families, but the genetic basis is not understood. We identified rare, frameshift mutations in the gene for nuclear assembly factor 1, NAF1, a box H/ACA RNA biogenesis factor, in pulmonary fibrosis-emphysema patients. The mutations segregated with short telomere length, low telomerase RNA levels, and extrapulmonary manifestations including myelodysplastic syndrome and liver disease. A truncated NAF1 was detected in cells derived from patients, and, in cells in which the frameshift mutation was introduced by genome editing, telomerase RNA levels were reduced. The mutant NAF1 lacked a conserved carboxyl-terminal motif, which we show is required for nuclear localization. To understand the disease mechanism, we used CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 (CRISPR-associated protein-9 nuclease) to generate Naf1(+/-) mice and found that they had half the levels of telomerase RNA. Other box H/ACA RNA levels were also decreased, but rRNA pseudouridylation, which is guided by snoRNAs, was intact. Moreover, first-generation Naf1(+/-) mice showed no evidence of ribosomal pathology. Our data indicate that disease in NAF1 mutation carriers is telomere-mediated; they show that NAF1 haploinsufficiency selectively disturbs telomere length homeostasis by decreasing the levels of telomerase RNA while sparing rRNA pseudouridylation. PMID:27510903

  4. Expanding the spectrum of PEX10-related peroxisomal biogenesis disorders: slowly progressive recessive ataxia.

    PubMed

    Renaud, Mathilde; Guissart, Claire; Mallaret, Martial; Ferdinandusse, Sacha; Cheillan, David; Drouot, Nathalie; Muller, Jean; Claustres, Mireille; Tranchant, Christine; Anheim, Mathieu; Koenig, Michel

    2016-08-01

    Peroxisomal biogenesis disorders (PBDs) consist of a heterogeneous group of autosomal recessive diseases, in which peroxisome assembly and proliferation are impaired leading to severe multisystem disease and early death. PBDs include Zellweger spectrum disorders (ZSDs) with a relatively mild clinical phenotype caused by PEX1, (MIM# 602136), PEX2 (MIM# 170993), PEX6 (MIM# 601498), PEX10 (MIM# 602859), PEX12 (MIM# 601758), and PEX16 (MIM# 603360) mutations. Three adult patients are reported belonging to a non-consanguineous French family affected with slowly progressive cerebellar ataxia, axonal neuropathy, and pyramidal signs. Mental retardation and diabetes mellitus were optional. The age at onset was in childhood or in adolescence (3-15 years). Brain MRI showed marked cerebellar atrophy. Biochemical blood analyses suggested a mild peroxisomal defect. With whole exome sequencing, two mutations in PEX10 were found in the three patients: c.827G>T (novel) causing the missense change p.Cys276Phe and c.932G>A causing the missense change p.Arg311Gln. The phenotypic spectrum related to PEX10 mutations includes slowly progressive, syndromic recessive ataxia. PMID:27230853

  5. S1 domain-containing STF modulates plastid transcription and chloroplast biogenesis in Nicotiana benthamiana.

    PubMed

    Jeon, Young; Jung, Hyun Ju; Kang, Hunseung; Park, Youn-Il; Lee, Soon Hee; Pai, Hyun-Sook

    2012-01-01

    • In this study, we examined the biochemical and physiological functions of Nicotiana benthamiana S1 domain-containing Transcription-Stimulating Factor (STF) using virus-induced gene silencing (VIGS), cosuppression, and overexpression strategies. • STF : green fluorescent protein (GFP) fusion protein colocalized with sulfite reductase (SiR), a chloroplast nucleoid-associated protein also present in the stroma. Full-length STF and its S1 domain preferentially bound to RNA, probably in a sequence-nonspecific manner. • STF silencing by VIGS or cosuppression resulted in severe leaf yellowing caused by disrupted chloroplast development. STF deficiency significantly perturbed plastid-encoded multimeric RNA polymerase (PEP)-dependent transcript accumulation. Chloroplast transcription run-on assays revealed that the transcription rate of PEP-dependent plastid genes was reduced in the STF-silenced leaves. Conversely, the exogenously added recombinant STF protein increased the transcription rate, suggesting a direct role of STF in plastid transcription. Etiolated seedlings of STF cosuppression lines showed defects in the light-triggered transition from etioplasts to chloroplasts, accompanied by reduced light-induced expression of plastid-encoded genes. • These results suggest that STF plays a critical role as an auxiliary factor of the PEP transcrip